Real-time PCR Machine System Modeling and a Systematic Approach for the Robust Design of a Real-time PCR-on-a-Chip System

PubMed Central

Lee, Da-Sheng

2010-01-01

Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR) machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DNA quantification and achieve a robust design for a real-time PCR-on-a-chip system. Accelerated lift testing was adopted to evaluate the reliability of the chip prototype. According to the life test plan, this proposed real-time PCR-on-a-chip system was simulated to work continuously for over three years with similar reproducibility in DNA quantification. This not only shows the robustness of the lab-on-a-chip system, but also verifies the effectiveness of our systematic method for achieving a robust design. PMID:22315563

Simplest chronoscope. III. Further comparisons between reaction times obtained by meterstick versus machine.

PubMed

Montare, Alberto

2013-06-01

The three classical Donders' reaction time (RT) tasks (simple, choice, and discriminative RTs) were employed to compare reaction time scores from college students obtained by use of Montare's simplest chronoscope (meterstick) methodology to scores obtained by use of a digital-readout multi-choice reaction timer (machine). Five hypotheses were tested. Simple RT, choice RT, and discriminative RT were faster when obtained by meterstick than by machine. The meterstick method showed higher reliability than the machine method and was less variable. The meterstick method of the simplest chronoscope may help to alleviate the longstanding problems of low reliability and high variability of reaction time performances; while at the same time producing faster performance on Donders' simple, choice and discriminative RT tasks than the machine method.

29 CFR 1917.151 - Machine guarding.

Code of Federal Regulations, 2013 CFR

2013-07-01

... restarting upon restoration of power. (7) The power supply to machines shall be turned off, locked out, and... contact with moving parts. (2) Belt, rope and chain drives shall be guarded to prevent employees from coming into contact with moving parts. (3) Gears, sprockets and chains shall be guarded to prevent...

29 CFR 1917.151 - Machine guarding.

Code of Federal Regulations, 2012 CFR

2012-07-01

... restarting upon restoration of power. (7) The power supply to machines shall be turned off, locked out, and... contact with moving parts. (2) Belt, rope and chain drives shall be guarded to prevent employees from coming into contact with moving parts. (3) Gears, sprockets and chains shall be guarded to prevent...

29 CFR 1917.151 - Machine guarding.

Code of Federal Regulations, 2014 CFR

2014-07-01

... restarting upon restoration of power. (7) The power supply to machines shall be turned off, locked out, and... contact with moving parts. (2) Belt, rope and chain drives shall be guarded to prevent employees from coming into contact with moving parts. (3) Gears, sprockets and chains shall be guarded to prevent...

29 CFR 1917.151 - Machine guarding.

Code of Federal Regulations, 2011 CFR

2011-07-01

... restarting upon restoration of power. (7) The power supply to machines shall be turned off, locked out, and... contact with moving parts. (2) Belt, rope and chain drives shall be guarded to prevent employees from coming into contact with moving parts. (3) Gears, sprockets and chains shall be guarded to prevent...

29 CFR 1917.151 - Machine guarding.

Code of Federal Regulations, 2010 CFR

2010-07-01

... restarting upon restoration of power. (7) The power supply to machines shall be turned off, locked out, and... contact with moving parts. (2) Belt, rope and chain drives shall be guarded to prevent employees from coming into contact with moving parts. (3) Gears, sprockets and chains shall be guarded to prevent...

Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nasarabadi, Shanavaz

2011-01-11

A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

Thrown object testing of forest machine operator protective structures

Treesearch

S.E. Taylor; M.W. Veal; R.B. Rummer

2003-01-01

High-speed chains or rotating disks are commonly used to cut and process trees during forest harvesting operations. Mechanical failure or fatigue of these tools can lead to a potentially hazardous situation where fragments of chain or sawteeth are thrown through the operator enclosures on forest machines. This poster presentation discusses the development and...

Use of Artificial Intelligence and Machine Learning Algorithms with Gene Expression Profiling to Predict Recurrent Nonmuscle Invasive Urothelial Carcinoma of the Bladder.

PubMed

Bartsch, Georg; Mitra, Anirban P; Mitra, Sheetal A; Almal, Arpit A; Steven, Kenneth E; Skinner, Donald G; Fry, David W; Lenehan, Peter F; Worzel, William P; Cote, Richard J

2016-02-01

Due to the high recurrence risk of nonmuscle invasive urothelial carcinoma it is crucial to distinguish patients at high risk from those with indolent disease. In this study we used a machine learning algorithm to identify the genes in patients with nonmuscle invasive urothelial carcinoma at initial presentation that were most predictive of recurrence. We used the genes in a molecular signature to predict recurrence risk within 5 years after transurethral resection of bladder tumor. Whole genome profiling was performed on 112 frozen nonmuscle invasive urothelial carcinoma specimens obtained at first presentation on Human WG-6 BeadChips (Illumina®). A genetic programming algorithm was applied to evolve classifier mathematical models for outcome prediction. Cross-validation based resampling and gene use frequencies were used to identify the most prognostic genes, which were combined into rules used in a voting algorithm to predict the sample target class. Key genes were validated by quantitative polymerase chain reaction. The classifier set included 21 genes that predicted recurrence. Quantitative polymerase chain reaction was done for these genes in a subset of 100 patients. A 5-gene combined rule incorporating a voting algorithm yielded 77% sensitivity and 85% specificity to predict recurrence in the training set, and 69% and 62%, respectively, in the test set. A singular 3-gene rule was constructed that predicted recurrence with 80% sensitivity and 90% specificity in the training set, and 71% and 67%, respectively, in the test set. Using primary nonmuscle invasive urothelial carcinoma from initial occurrences genetic programming identified transcripts in reproducible fashion, which were predictive of recurrence. These findings could potentially impact nonmuscle invasive urothelial carcinoma management. Copyright © 2016 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

PubMed

Garg, Pankaj

2017-07-01

Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

Development and validation of a SYBR Green I-based real-time polymerase chain reaction method for detection of haptoglobin gene deletion in clinical materials.

PubMed

Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro

2010-06-01

Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).

DL-ADR: a novel deep learning model for classifying genomic variants into adverse drug reactions.

PubMed

Liang, Zhaohui; Huang, Jimmy Xiangji; Zeng, Xing; Zhang, Gang

2016-08-10

Genomic variations are associated with the metabolism and the occurrence of adverse reactions of many therapeutic agents. The polymorphisms on over 2000 locations of cytochrome P450 enzymes (CYP) due to many factors such as ethnicity, mutations, and inheritance attribute to the diversity of response and side effects of various drugs. The associations of the single nucleotide polymorphisms (SNPs), the internal pharmacokinetic patterns and the vulnerability of specific adverse reactions become one of the research interests of pharmacogenomics. The conventional genomewide association studies (GWAS) mainly focuses on the relation of single or multiple SNPs to a specific risk factors which are a one-to-many relation. However, there are no robust methods to establish a many-to-many network which can combine the direct and indirect associations between multiple SNPs and a serial of events (e.g. adverse reactions, metabolic patterns, prognostic factors etc.). In this paper, we present a novel deep learning model based on generative stochastic networks and hidden Markov chain to classify the observed samples with SNPs on five loci of two genes (CYP2D6 and CYP1A2) respectively to the vulnerable population of 14 types of adverse reactions. A supervised deep learning model is proposed in this study. The revised generative stochastic networks (GSN) model with transited by the hidden Markov chain is used. The data of the training set are collected from clinical observation. The training set is composed of 83 observations of blood samples with the genotypes respectively on CYP2D6*2, *10, *14 and CYP1A2*1C, *1 F. The samples are genotyped by the polymerase chain reaction (PCR) method. A hidden Markov chain is used as the transition operator to simulate the probabilistic distribution. The model can perform learning at lower cost compared to the conventional maximal likelihood method because the transition distribution is conditional on the previous state of the hidden Markov chain. A least square loss (LASSO) algorithm and a k-Nearest Neighbors (kNN) algorithm are used as the baselines for comparison and to evaluate the performance of our proposed deep learning model. There are 53 adverse reactions reported during the observation. They are assigned to 14 categories. In the comparison of classification accuracy, the deep learning model shows superiority over the LASSO and kNN model with a rate over 80 %. In the comparison of reliability, the deep learning model shows the best stability among the three models. Machine learning provides a new method to explore the complex associations among genomic variations and multiple events in pharmacogenomics studies. The new deep learning algorithm is capable of classifying various SNPs to the corresponding adverse reactions. We expect that as more genomic variations are added as features and more observations are made, the deep learning model can improve its performance and can act as a black-box but reliable verifier for other GWAS studies.

Full Dynamic Reactions in the Basic Shaft Bearings of Big Band Saw Machines

NASA Astrophysics Data System (ADS)

Marinov, Boycho

2013-03-01

The band saws machines are a certain class woodworking machines for longitudinal or transversal cutting as well as for curvilinear wood cutting. These machines saw the wood through a band-saw blade and two feeding wheels. These wheels usually are very large and they are produced with inaccuracies. The centre of mass of the disc is displaced from the axis of rotation of the distance e (eccentricity) and the axis of the disk makes an angle with the axis of rotation. In this paper, the dy- namic reactions in the bearings of the basic shaft, which drives the band saw machines, are analyzed. These reactions are caused by the external loading and the kinematics and the mass characteristics of the rotating disk. The expressions for the full dynamic reactions are obtained. These expressions allow the parameters of the machines to be chosen in such a way that the loading in the shaft and the bearings to be minimal.

Nuclear Fusion Within Extremely Dense Plasma Enhanced by Quantum Particle Waves

NASA Astrophysics Data System (ADS)

Miao, Feng; Zheng, Xianjun; Deng, Baiquan

2015-05-01

Quantum effects play an enhancement role in p-p chain reactions occurring within stars. Such an enhancement is quantified by a wave penetration factor that is proportional to the density of the participating fuel particles. This leads to an innovative theory for dense plasma, and its result shows good agreement with independent data derived from the solar energy output. An analysis of the first Z-pinch machine in mankind's history exhibiting neutron emission leads to a derived deuterium plasma beam density greater than that of water, with plasma velocities exceeding 10000 km/s. Fusion power could be achieved by the intersection of four such pinched plasma beams with powerful head-on collisions in their common focal region due to the beam and target enhanced reaction. supported by the Fund for the Construction of Graduate Degree of China (No. 2014XWD-S0805)

Mechanical properties experimental investigation of HTPB propellant after thermal accelerated aging

NASA Astrophysics Data System (ADS)

Yang, Xiaohong; Sun, Chaoxiang; Zhang, Junfa; Xu, Jinsheng; Tan, Bingdong

2017-04-01

To get accurate aging mechanical properties of aged HTPB propellant, the thermal accelerated aging experiment method is utilized and the uniaxial tensile experiments were conducted to obtain the mechanical data of aged HTPB propellants, and the maximum tensile strength, σm, maximum tensile strain, ɛm, and the fracture tensile strain, ɛb, of HTPB propellant with different aging time and various aging temperatures,were obtained, using universal material testing machine. The experimental results show that the σm of HTPB propellant initially increases, subsequently decreases and finally increases with aging time. The ɛm and ɛb generally decrease with increasing aging time, what's more, the decrease rate of both ɛm and ɛb reduce with the aging time. What's more, the postcure effect and oxidation reaction occurred inside HTPB matrix, including the chain degradation reaction and oxidation-induced crosslinking, were discussed to explain the mechanical aging rule of HTPB propellant.

An evolutionary sensor approach for self-organizing production chains

NASA Astrophysics Data System (ADS)

Mocan, M.; Gillich, E. V.; Mituletu, I. C.; Korka, Z. I.

2018-01-01

Industry 4.0 is the actual great step in industrial progress. Convergence of industrial equipment with the power of advanced computing and analysis, low-cost sensing, and new connecting technologies are presumed to bring unexpected advancements in automation, flexibility, and efficiency. In this context, sensors ensure information regarding three essential areas: the number of processed elements, the quality of production and the condition of tools and equipment. To obtain this valuable information, the data resulted from a sensor has to be firstly processed and afterward used by the different stakeholders. If machines are linked together, this information can be employed to organize the production chain with few or without human intervention. We describe here the implementation of a sensor in a milling machine that is part of a simple production chain, capable of providing information regarding the number of manufactured pieces. It is used by the other machines in the production chain, in order to define the type and number of pieces to be manufactured by them and/or to set optimal parameters for their working regime. Secondly, the information achieved by monitoring the machine and manufactured piece dynamic behavior is used to evaluate the product quality. This information is used to warn about the need of maintenance, being transmitted to the specialized department. It is also transmitted to the central unit, in order to reorganize the production by involving other machines or by reconsidering the manufacturing regime of the existing machines. A special attention is drawn on analyzing and classifying the signals acquired via optical sensor from simulated processes.

Simple model of inhibition of chain-branching combustion processes

NASA Astrophysics Data System (ADS)

Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.

2017-11-01

A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

Chain-reaction crash in traffic flow controlled by taillights

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-02-01

We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.

Designing a mathematical model for integrating dynamic cellular manufacturing into supply chain system

NASA Astrophysics Data System (ADS)

Aalaei, Amin; Davoudpour, Hamid

2012-11-01

This article presents designing a new mathematical model for integrating dynamic cellular manufacturing into supply chain system with an extensive coverage of important manufacturing features consideration of multiple plants location, multi-markets allocation, multi-period planning horizons with demand and part mix variation, machine capacity, and the main constraints are demand of markets satisfaction in each period, machine availability, machine time-capacity, worker assignment, available time of worker, production volume for each plant and the amounts allocated to each market. The aim of the proposed model is to minimize holding and outsourcing costs, inter-cell material handling cost, external transportation cost, procurement & maintenance and overhead cost of machines, setup cost, reconfiguration cost of machines installation and removal, hiring, firing and salary worker costs. Aimed to prove the potential benefits of such a design, presented an example is shown using a proposed model.

ONR Far East Scientific Information Bulletin

DTIC Science & Technology

1990-09-01

In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by

Effect of perception irregularity on chain-reaction crash in low visibility

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-06-01

We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.

A best on-line algorithm for single machine scheduling the equal length jobs with the special chain precedence and delivery time

NASA Astrophysics Data System (ADS)

Gu, Cunchang; Mu, Yundong

2013-03-01

In this paper, we consider a single machine on-line scheduling problem with the special chains precedence and delivery time. All jobs arrive over time. The chains chainsi arrive at time ri , it is known that the processing and delivery time of each job on the chain satisfy one special condition CD a forehand: if the job J(i)j is the predecessor of the job J(i)k on the chain chaini, then they satisfy p(i)j = p(i)k = p >= qj >= qk , i = 1,2, ---,n , where pj and qj denote the processing time and the delivery time of the job Jj respectively. Obviously, if the arrival jobs have no chains precedence, it shows that the length of the corresponding chain is 1. The objective is to minimize the time by which all jobs have been delivered. We provide an on-line algorithm with a competitive ratio of √2 , and the result is the best possible.

The simplest chronoscope II: reaction time measured by meterstick versus machine.

PubMed

Montare, Alberto

2010-12-01

Visual simple reaction time (SRT) scores measured in 31 college students of both sexes by use of the simplest chronoscope methodology (meterstick SRT) were compared to scores obtained by use of an electromechanical multi-choice reaction timer (machine SRT). Four hypotheses were tested. Results indicated that the previous mean value of meterstick SRT was replicated; meterstick SRT was significantly faster than long-standing population estimates of mean SRT; and machine SRT was significantly slower than the same long-standing mean SRT estimates for the population. Also, the mean meterstick SRT of 181 msec. was significantly faster than the mean machine SRT of 294 msec. It was theorized that differential visual information processing occurred such that the dorsal visual stream subserved meterstick SRT; whereas the ventral visual stream subserved machine SRT.

Chain-reaction crash on a highway in high visibility

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2016-05-01

We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

Effect of vehicular size on chain-reaction crash

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-11-01

We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

Kinetic aspects of chain growth in Fischer-Tropsch synthesis.

PubMed

Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M

2017-04-28

Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.

Physarum machines: encapsulating reaction-diffusion to compute spanning tree

NASA Astrophysics Data System (ADS)

Adamatzky, Andrew

2007-12-01

The Physarum machine is a biological computing device, which employs plasmodium of Physarum polycephalum as an unconventional computing substrate. A reaction-diffusion computer is a chemical computing device that computes by propagating diffusive or excitation wave fronts. Reaction-diffusion computers, despite being computationally universal machines, are unable to construct certain classes of proximity graphs without the assistance of an external computing device. I demonstrate that the problem can be solved if the reaction-diffusion system is enclosed in a membrane with few ‘growth points’, sites guiding the pattern propagation. Experimental approximation of spanning trees by P. polycephalum slime mold demonstrates the feasibility of the approach. Findings provided advance theory of reaction-diffusion computation by enriching it with ideas of slime mold computation.

Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

PubMed

Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

2015-01-01

Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

Dollar Summary of Federal Supply Classification and Service Category by Company, FY84, Part 2 (2620-4540).

DTIC Science & Technology

1984-01-01

MANUFACTURING OHIO DLA POWER AND HAND PUMPS 31 COCA - COLA COMPANY INC THE WISCONSIN NAVY POWER AND HAND PUMPS 85 COLE-PARMER INSTRUMENT CO ILLINOIS NAVY...ELECTRICAL & ULTRASONIC EROSION MACHINES 123 OL MARKETING INC OKLAHOMA USAF ELECTRICAL 8 ULTRASONIC EROSION MACHINES 120 JCK & CASTER CO MINNESOTA DLA...FITTINGS FOR ROPE CABLE AND CHAIN ’I9 EILO MANUFACTURING INC OKLAHOMA NAVY FITTINGS FOR ROPE CABLE AND CHAIN !2? GATEWAY MARKETING CORPORATION NEW

Biomechanical properties of jaw periosteum-derived mineralized culture on different titanium topography.

PubMed

Att, Wael; Kubo, Katsutoshi; Yamada, Masahiro; Maeda, Hatsuhiko; Ogawa, Takahiro

2009-01-01

This study evaluated the biomechanical properties of periosteum-derived mineralized culture on different surface topographies of titanium. Titanium surfaces modified by machining or by acid etching were analyzed using scanning electron microscopy (SEM). Rat mandibular periosteum-derived cells were cultured on either of the titanium surfaces. Cell proliferation was evaluated by cell counts, and gene expression was analyzed using a reverse-transcriptase polymerase chain reaction. Alkaline phosphatase (ALP) stain assay was employed to evaluate osteoblastic activity. Matrix mineralization was examined via von Kossa stain assay, total calcium deposition, and SEM. The hardness and elastic modulus of mineralized cultures were measured using a nano-indenter. The machined surface demonstrated a flat topographic configuration, while the acid-etched surface revealed a uniform micron-scale roughness. Both cell density and ALP activity were significantly higher on the machined surface than on the acid-etched surface. The expression of bone-related genes was up-regulated or enhanced on the acid-etched surface compared to the machined surface. Von Kossa stain showed significantly greater positive areas for the machined surface compared to the acid-etched surface, while total calcium deposition was statistically similar. Mineralized culture on the acid-etched surface was characterized by denser calcium deposition, more mature collagen deposition on the superficial layer, and larger and denser globular matrices inside the matrix than the culture on the machined surface. The mineralized matrix on the acid-etched surface was two times harder than on the machined surface, whereas the elastic modulus was comparable between the two surfaces. The design of this study can be used as a model to evaluate the effect of implant surface topography on the biomechanical properties of periosteum-derived mineralized culture. The results suggest that mandibular periosteal cells respond to different titanium surface topographies differently enough to produce mineralized matrices with different biomechanical qualities.

Structure design of lower limb exoskeletons for gait training

NASA Astrophysics Data System (ADS)

Li, Jianfeng; Zhang, Ziqiang; Tao, Chunjing; Ji, Run

2015-09-01

Due to the close physical interaction between human and machine in process of gait training, lower limb exoskeletons should be safe, comfortable and able to smoothly transfer desired driving force/moments to the patients. Correlatively, in kinematics the exoskeletons are required to be compatible with human lower limbs and thereby to avoid the uncontrollable interactional loads at the human-machine interfaces. Such requirement makes the structure design of exoskeletons very difficult because the human-machine closed chains are complicated. In addition, both the axis misalignments and the kinematic character difference between the exoskeleton and human joints should be taken into account. By analyzing the DOF(degree of freedom) of the whole human-machine closed chain, the human-machine kinematic incompatibility of lower limb exoskeletons is studied. An effective method for the structure design of lower limb exoskeletons, which are kinematically compatible with human lower limb, is proposed. Applying this method, the structure synthesis of the lower limb exoskeletons containing only one-DOF revolute and prismatic joints is investigated; the feasible basic structures of exoskeletons are developed and classified into three different categories. With the consideration of quasi-anthropopathic feature, structural simplicity and wearable comfort of lower limb exoskeletons, a joint replacement and structure comparison based approach to select the ideal structures of lower limb exoskeletons is proposed, by which three optimal exoskeleton structures are obtained. This paper indicates that the human-machine closed chain formed by the exoskeleton and human lower limb should be an even-constrained kinematic system in order to avoid the uncontrollable human-machine interactional loads. The presented method for the structure design of lower limb exoskeletons is universal and simple, and hence can be applied to other kinds of wearable exoskeletons.

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

PubMed

Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

2016-12-01

To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

30 CFR 75.1719-1 - Illumination in working places.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., hydraulic, pneumatic, or mechanical power supplied by a source located on the machine or transmitted to the machine by cables, ropes, or chains. (c) The lighting prescribed in this section shall be in addition to...

30 CFR 75.1719-1 - Illumination in working places.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., hydraulic, pneumatic, or mechanical power supplied by a source located on the machine or transmitted to the machine by cables, ropes, or chains. (c) The lighting prescribed in this section shall be in addition to...

Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

PubMed

Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

2013-09-23

Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

A Comparison of Forward and Concurrent Chaining Strategies in Teaching Laundromat Skills to Students with Severe Handicaps.

ERIC Educational Resources Information Center

McDonnell, John; McFarland, Susan

1988-01-01

In a study which taught four high school students with severe handicaps to use a commercial washing machine and laundry soap dispenser, a concurrent chaining strategy was found more efficient than forward chaining in facilitating skill acquisition. Concurrent chaining also resulted in better maintenance at four- and eight-week follow-up…

Press Releases | Argonne National Laboratory

Science.gov Websites

Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

Introduction to Polymer Chemistry.

ERIC Educational Resources Information Center

Harris, Frank W.

1981-01-01

Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

A nanojet: propulsion of a molecular machine by an asymmetric distribution of reaction--products

NASA Astrophysics Data System (ADS)

Liverpool, Tanniemola; Golestanian, Ramin; Ajdari, Armand

2006-03-01

A simple model for the reaction-driven propulsion of a small device is proposed as a model for (part of) a molecular machine in aqueous media. Motion of the device is driven by an asymmetric distribution of reaction products. We calculate the propulsive velocity of the device as well as the scale of the velocity fluctuations. We also consider the effects of hydrodynamic flow as well as a number of different scenarios for the kinetics of the reaction.

Propulsion of a Molecular Machine by Asymmetric Distribution of Reaction Products

NASA Astrophysics Data System (ADS)

Golestanian, Ramin; Liverpool, Tanniemola B.; Ajdari, Armand

2005-06-01

A simple model for the reaction-driven propulsion of a small device is proposed as a model for (part of) a molecular machine in aqueous media. The motion of the device is driven by an asymmetric distribution of reaction products. The propulsive velocity of the device is calculated as well as the scale of the velocity fluctuations. The effects of hydrodynamic flow as well as a number of different scenarios for the kinetics of the reaction are addressed.

Propulsion of a molecular machine by asymmetric distribution of reaction products.

PubMed

Golestanian, Ramin; Liverpool, Tanniemola B; Ajdari, Armand

2005-06-10

A simple model for the reaction-driven propulsion of a small device is proposed as a model for (part of) a molecular machine in aqueous media. The motion of the device is driven by an asymmetric distribution of reaction products. The propulsive velocity of the device is calculated as well as the scale of the velocity fluctuations. The effects of hydrodynamic flow as well as a number of different scenarios for the kinetics of the reaction are addressed.

Polymerization as a Model Chain Reaction

ERIC Educational Resources Information Center

Morton, Maurice

1973-01-01

Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

DOE R&D Accomplishments Database

Weinberg, Alvin M.; Noderer, L. C.

1951-05-15

The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

Reducing Coal Dust With Water Jets

NASA Technical Reports Server (NTRS)

Gangal, M. D.; Lewis, E. V.

1985-01-01

Jets also cool and clean cutting equipment. Modular pick-and-bucket miner suffers from disadvantage: Creates large quantities of potentially explosive coal dust. Dust clogs drive chain and other parts and must be removed by hand. Picks and bucket lips become overheated by friction and be resharpened or replaced frequently. Addition of oscillating and rotating water jets to pick-and-bucket machine keeps down dust, cools cutting edges, and flushes machine. Rotating jets wash dust away from drive chain. Oscillating jets cool cutting surfaces. Both types of jet wet airborne coal dust; it precipitates.

A Machine Learning Application Based in Random Forest for Integrating Mass Spectrometry-Based Metabolomic Data: A Simple Screening Method for Patients With Zika Virus

PubMed Central

Melo, Carlos Fernando Odir Rodrigues; Navarro, Luiz Claudio; de Oliveira, Diogo Noin; Guerreiro, Tatiane Melina; Lima, Estela de Oliveira; Delafiori, Jeany; Dabaja, Mohamed Ziad; Ribeiro, Marta da Silva; de Menezes, Maico; Rodrigues, Rafael Gustavo Martins; Morishita, Karen Noda; Esteves, Cibele Zanardi; de Amorim, Aline Lopes Lucas; Aoyagui, Caroline Tiemi; Parise, Pierina Lorencini; Milanez, Guilherme Paier; do Nascimento, Gabriela Mansano; Ribas Freitas, André Ricardo; Angerami, Rodrigo; Costa, Fábio Trindade Maranhão; Arns, Clarice Weis; Resende, Mariangela Ribeiro; Amaral, Eliana; Junior, Renato Passini; Ribeiro-do-Valle, Carolina C.; Milanez, Helaine; Moretti, Maria Luiza; Proenca-Modena, Jose Luiz; Avila, Sandra; Rocha, Anderson; Catharino, Rodrigo Ramos

2018-01-01

Recent Zika outbreaks in South America, accompanied by unexpectedly severe clinical complications have brought much interest in fast and reliable screening methods for ZIKV (Zika virus) identification. Reverse-transcriptase polymerase chain reaction (RT-PCR) is currently the method of choice to detect ZIKV in biological samples. This approach, nonetheless, demands a considerable amount of time and resources such as kits and reagents that, in endemic areas, may result in a substantial financial burden over affected individuals and health services veering away from RT-PCR analysis. This study presents a powerful combination of high-resolution mass spectrometry and a machine-learning prediction model for data analysis to assess the existence of ZIKV infection across a series of patients that bear similar symptomatic conditions, but not necessarily are infected with the disease. By using mass spectrometric data that are inputted with the developed decision-making algorithm, we were able to provide a set of features that work as a “fingerprint” for this specific pathophysiological condition, even after the acute phase of infection. Since both mass spectrometry and machine learning approaches are well-established and have largely utilized tools within their respective fields, this combination of methods emerges as a distinct alternative for clinical applications, providing a diagnostic screening—faster and more accurate—with improved cost-effectiveness when compared to existing technologies. PMID:29696139

A Machine Learning Application Based in Random Forest for Integrating Mass Spectrometry-Based Metabolomic Data: A Simple Screening Method for Patients With Zika Virus.

PubMed

Melo, Carlos Fernando Odir Rodrigues; Navarro, Luiz Claudio; de Oliveira, Diogo Noin; Guerreiro, Tatiane Melina; Lima, Estela de Oliveira; Delafiori, Jeany; Dabaja, Mohamed Ziad; Ribeiro, Marta da Silva; de Menezes, Maico; Rodrigues, Rafael Gustavo Martins; Morishita, Karen Noda; Esteves, Cibele Zanardi; de Amorim, Aline Lopes Lucas; Aoyagui, Caroline Tiemi; Parise, Pierina Lorencini; Milanez, Guilherme Paier; do Nascimento, Gabriela Mansano; Ribas Freitas, André Ricardo; Angerami, Rodrigo; Costa, Fábio Trindade Maranhão; Arns, Clarice Weis; Resende, Mariangela Ribeiro; Amaral, Eliana; Junior, Renato Passini; Ribeiro-do-Valle, Carolina C; Milanez, Helaine; Moretti, Maria Luiza; Proenca-Modena, Jose Luiz; Avila, Sandra; Rocha, Anderson; Catharino, Rodrigo Ramos

2018-01-01

Recent Zika outbreaks in South America, accompanied by unexpectedly severe clinical complications have brought much interest in fast and reliable screening methods for ZIKV (Zika virus) identification. Reverse-transcriptase polymerase chain reaction (RT-PCR) is currently the method of choice to detect ZIKV in biological samples. This approach, nonetheless, demands a considerable amount of time and resources such as kits and reagents that, in endemic areas, may result in a substantial financial burden over affected individuals and health services veering away from RT-PCR analysis. This study presents a powerful combination of high-resolution mass spectrometry and a machine-learning prediction model for data analysis to assess the existence of ZIKV infection across a series of patients that bear similar symptomatic conditions, but not necessarily are infected with the disease. By using mass spectrometric data that are inputted with the developed decision-making algorithm, we were able to provide a set of features that work as a "fingerprint" for this specific pathophysiological condition, even after the acute phase of infection. Since both mass spectrometry and machine learning approaches are well-established and have largely utilized tools within their respective fields, this combination of methods emerges as a distinct alternative for clinical applications, providing a diagnostic screening-faster and more accurate-with improved cost-effectiveness when compared to existing technologies.

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2014 CFR

2014-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2013 CFR

2013-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2012 CFR

2012-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

Emilio Segrè and Spontaneous Fission

Science.gov Websites

fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

27. Bollinger twinchain tandem, pigcasting machine, located at the north ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

27. Bollinger twin-chain tandem, pig-casting machine, located at the north end of the plant. Prior to closing, approximately 40 percent of the plant's: iron production was cast into pigs and sold to foundry customers. The pig-casting machine employed a controller, lime man, trough man, and crane operator. - Central Furnaces, 2650 Broadway, east bank of Cuyahoga River, Cleveland, Cuyahoga County, OH

Modeling and simulation of five-axis virtual machine based on NX

NASA Astrophysics Data System (ADS)

Li, Xiaoda; Zhan, Xianghui

2018-04-01

Virtual technology in the machinery manufacturing industry has shown the role of growing. In this paper, the Siemens NX software is used to model the virtual CNC machine tool, and the parameters of the virtual machine are defined according to the actual parameters of the machine tool so that the virtual simulation can be carried out without loss of the accuracy of the simulation. How to use the machine builder of the CAM module to define the kinematic chain and machine components of the machine is described. The simulation of virtual machine can provide alarm information of tool collision and over cutting during the process to users, and can evaluate and forecast the rationality of the technological process.

Chain Reaction Polymerization.

ERIC Educational Resources Information Center

McGrath, James E.

1981-01-01

The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

Characterizing Chain Processes in Visible Light Photoredox Catalysis

PubMed Central

Cismesia, Megan A.

2015-01-01

The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708

Predicting the outcomes of organic reactions via machine learning: are current descriptors sufficient?

PubMed

Skoraczyński, G; Dittwald, P; Miasojedow, B; Szymkuć, S; Gajewska, E P; Grzybowski, B A; Gambin, A

2017-06-15

As machine learning/artificial intelligence algorithms are defeating chess masters and, most recently, GO champions, there is interest - and hope - that they will prove equally useful in assisting chemists in predicting outcomes of organic reactions. This paper demonstrates, however, that the applicability of machine learning to the problems of chemical reactivity over diverse types of chemistries remains limited - in particular, with the currently available chemical descriptors, fundamental mathematical theorems impose upper bounds on the accuracy with which raction yields and times can be predicted. Improving the performance of machine-learning methods calls for the development of fundamentally new chemical descriptors.

Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

2016-09-15

It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

Pulse electrochemical meso/micro/nano ultraprecision machining technology.

PubMed

Lee, Jeong Min; Kim, Young Bin; Park, Jeong Woo

2013-11-01

This study demonstrated meso/micro/nano-ultraprecision machining through electrochemical reactions using intermittent DC pulses. The experiment focused on two machining methods: (1) pulse electrochemical polishing (PECP) of stainless steel, and (2) pulse electrochemical nano-patterning (PECNP) on a silicon (Si) surface, using atomic force microscopy (AFM) for fabrication. The dissolution reaction at the stainless steel surface following PECP produced a very clean, smooth workpiece. The advantages of the PECP process included improvements in corrosion resistance, deburring of the sample surface, and removal of hydrogen from the stainless steel surface as verified by time-of-flight secondary-ion mass spectrometry (TOF-SIMS). In PECNP, the electrochemical reaction generated within water molecules produced nanoscale oxide textures on a Si surface. Scanning probe microscopy (SPM) was used to evaluate nanoscale-pattern processing on a Si wafer surface produced by AFM-PECNP For both processes using pulse electrochemical reactions, three-dimensional (3-D) measurements and AFM were used to investigate the changes on the machined surfaces. Preliminary results indicated the potential for advancing surface polishing techniques and localized micro/nano-texturing technology using PECP and PECNP processes.

Machine learning of single molecule free energy surfaces and the impact of chemistry and environment upon structure and dynamics

NASA Astrophysics Data System (ADS)

Mansbach, Rachael A.; Ferguson, Andrew L.

2015-03-01

The conformational states explored by polymers and proteins can be controlled by environmental conditions (e.g., temperature, pressure, and solvent) and molecular chemistry (e.g., molecular weight and side chain identity). We introduce an approach employing the diffusion map nonlinear machine learning technique to recover single molecule free energy landscapes from molecular simulations, quantify changes to the landscape as a function of external conditions and molecular chemistry, and relate these changes to modifications of molecular structure and dynamics. In an application to an n-eicosane chain, we quantify the thermally accessible chain configurations as a function of temperature and solvent conditions. In an application to a family of polyglutamate-derivative homopeptides, we quantify helical stability as a function of side chain length, resolve the critical side chain length for the helix-coil transition, and expose the molecular mechanisms underpinning side chain-mediated helix stability. By quantifying single molecule responses through perturbations to the underlying free energy surface, our approach provides a quantitative bridge between experimentally controllable variables and microscopic molecular behavior, guiding and informing rational engineering of desirable molecular structure and function.

Machine learning of single molecule free energy surfaces and the impact of chemistry and environment upon structure and dynamics.

PubMed

Mansbach, Rachael A; Ferguson, Andrew L

2015-03-14

The conformational states explored by polymers and proteins can be controlled by environmental conditions (e.g., temperature, pressure, and solvent) and molecular chemistry (e.g., molecular weight and side chain identity). We introduce an approach employing the diffusion map nonlinear machine learning technique to recover single molecule free energy landscapes from molecular simulations, quantify changes to the landscape as a function of external conditions and molecular chemistry, and relate these changes to modifications of molecular structure and dynamics. In an application to an n-eicosane chain, we quantify the thermally accessible chain configurations as a function of temperature and solvent conditions. In an application to a family of polyglutamate-derivative homopeptides, we quantify helical stability as a function of side chain length, resolve the critical side chain length for the helix-coil transition, and expose the molecular mechanisms underpinning side chain-mediated helix stability. By quantifying single molecule responses through perturbations to the underlying free energy surface, our approach provides a quantitative bridge between experimentally controllable variables and microscopic molecular behavior, guiding and informing rational engineering of desirable molecular structure and function.

Development of a novel fingerprint for chemical reactions and its application to large-scale reaction classification and similarity.

PubMed

Schneider, Nadine; Lowe, Daniel M; Sayle, Roger A; Landrum, Gregory A

2015-01-26

Fingerprint methods applied to molecules have proven to be useful for similarity determination and as inputs to machine-learning models. Here, we present the development of a new fingerprint for chemical reactions and validate its usefulness in building machine-learning models and in similarity assessment. Our final fingerprint is constructed as the difference of the atom-pair fingerprints of products and reactants and includes agents via calculated physicochemical properties. We validated the fingerprints on a large data set of reactions text-mined from granted United States patents from the last 40 years that have been classified using a substructure-based expert system. We applied machine learning to build a 50-class predictive model for reaction-type classification that correctly predicts 97% of the reactions in an external test set. Impressive accuracies were also observed when applying the classifier to reactions from an in-house electronic laboratory notebook. The performance of the novel fingerprint for assessing reaction similarity was evaluated by a cluster analysis that recovered 48 out of 50 of the reaction classes with a median F-score of 0.63 for the clusters. The data sets used for training and primary validation as well as all python scripts required to reproduce the analysis are provided in the Supporting Information.

Biological Moleculars: Have Most of Our Problems Already Been Solved?

NASA Technical Reports Server (NTRS)

Downey, James P.; Rose, M. Franklin (Technical Monitor)

2000-01-01

Evolution has resulted in biological machinery that engineers have great reason to envy and at present can only poorly mimic. This is not just a curiosity as biological systems perform many functions that are desired industrial processes. Examples include photosynthesis, chemosynthesis, energy storage, low temperature chemical conversion, reproducible manufacture of chemical compounds, etc. The bases of biological machinery are the proteins and nucleic acids that comprise living organisms. Each molecule functions as a part of a biological machine. In many cases the molecule can be properly regarded as a stand alone machine of its own. Concepts and methods for harnessing the power of biological molecules exist but are often overlooked in the industrial world. Some are old and appear crude but are quite effective, e.g. the fermentation of grains and fruits. Currently, there is a revolution in progress regarding the harnessing biological processes. These include techniques such as genetic manipulation via polymerase chain reaction, forced evolution also known as evolution in a test tube, determination of molecular structure, and combinatorial chemistry. The following is a brief discussion on how these processes are performed and how they may relate to industrial and aerospace processes.

Atwood's Machine as a Tool to Introduce Variable Mass Systems

ERIC Educational Resources Information Center

de Sousa, Celia A.

2012-01-01

This article discusses an instructional strategy which explores eventual similarities and/or analogies between familiar problems and more sophisticated systems. In this context, the Atwood's machine problem is used to introduce students to more complex problems involving ropes and chains. The methodology proposed helps students to develop the…

Internal force corrections with machine learning for quantum mechanics/molecular mechanics simulations.

PubMed

Wu, Jingheng; Shen, Lin; Yang, Weitao

2017-10-28

Ab initio quantum mechanics/molecular mechanics (QM/MM) molecular dynamics simulation is a useful tool to calculate thermodynamic properties such as potential of mean force for chemical reactions but intensely time consuming. In this paper, we developed a new method using the internal force correction for low-level semiempirical QM/MM molecular dynamics samplings with a predefined reaction coordinate. As a correction term, the internal force was predicted with a machine learning scheme, which provides a sophisticated force field, and added to the atomic forces on the reaction coordinate related atoms at each integration step. We applied this method to two reactions in aqueous solution and reproduced potentials of mean force at the ab initio QM/MM level. The saving in computational cost is about 2 orders of magnitude. The present work reveals great potentials for machine learning in QM/MM simulations to study complex chemical processes.

Peroxy radical detection by chemical amplification (PERCA)

NASA Technical Reports Server (NTRS)

Stedman, D. H.

1986-01-01

Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.

Synergies Between Quantum Mechanics and Machine Learning in Reaction Prediction.

PubMed

Sadowski, Peter; Fooshee, David; Subrahmanya, Niranjan; Baldi, Pierre

2016-11-28

Machine learning (ML) and quantum mechanical (QM) methods can be used in two-way synergy to build chemical reaction expert systems. The proposed ML approach identifies electron sources and sinks among reactants and then ranks all source-sink pairs. This addresses a bottleneck of QM calculations by providing a prioritized list of mechanistic reaction steps. QM modeling can then be used to compute the transition states and activation energies of the top-ranked reactions, providing additional or improved examples of ranked source-sink pairs. Retraining the ML model closes the loop, producing more accurate predictions from a larger training set. The approach is demonstrated in detail using a small set of organic radical reactions.

Tangled nonlinear driven chain reactions of all optical singularities

NASA Astrophysics Data System (ADS)

Vasil'ev, V. I.; Soskin, M. S.

2012-03-01

Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

28. HOISTING CHAIN, ELECTRIC GENERATOR (FORMERLY USED TO DRIVE BELTS), ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

28. HOISTING CHAIN, ELECTRIC GENERATOR (FORMERLY USED TO DRIVE BELTS), ACETYLENE TANK, ENGINE LATHE, WELDING AREA, SCREW PRESS, AND AIR COMPRESSOR (L TO R)-LOOKING NORTHEAST. - W. A. Young & Sons Foundry & Machine Shop, On Water Street along Monongahela River, Rices Landing, Greene County, PA

Wind power machine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Denehi, D.

1992-07-28

This patent describes wind powered apparatus for producing electricity. It comprises: an endless chain trained over and movable in a continuous path about two substantially spaced-apart sprockets, a plurality of sails fixedly attached to the chain, guide means positioned adjacent the chain and operable, a rotary electrical generator; means connecting at least one of the sprockets to the generator to rotate the latter in response to movement of the chain by wind acting upon the sail flaps when in the first, open position thereof.

Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

PubMed

Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

2018-06-01

Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

Topological dynamics of optical singularities in speckle-fields induced by photorefractive scattering in a LiNbO{sub 3} : Fe crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vasil'ev, Vasilii I; Soskin, M S

2013-02-28

A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less

Product carbon footprint assessment supporting the green supply chain construction in household appliance manufacturers

NASA Astrophysics Data System (ADS)

Chen, Jianhua; Sun, Liang; Guo, Huiting

2017-11-01

Supply chain carbon emission is one of the factors considered in the green supply chain management. A method was designed to support the green supply chain measures based on the carbon footprint assessment for products. A research for 3 typical household appliances carbon footprint assessment was conducted to explore using product carbon footprint assessment method to guide the green supply chain management of the manufacturers. The result could reflect the differences directions on green supply chain management of manufacturers of washing machine, air conditioner and microwave, respectively That is, the washing machine manufacturer should pay attention to the low carbon activities in upstream suppliers in highest priority, and also the promotion of product energy efficiency. The air conditioner manufacturer should pay attention to the product energy efficiency increasing in highest priority, and the improvement of refrigerant to decrease its GWP. And the microwave manufacture could only focus on the energy efficiency increasing because it contributes most of the carbon emission to its carbon footprint. Besides, the representativeness of product and the applicability of the method were also discussed. As the manufacturer could master the technical information on raw material and components of its products to conduct the product carbon footprint assessment, this method could help the manufacturer to identify the effective green supply chain measures in the preliminary stage.

Understanding dental CAD/CAM for restorations - dental milling machines from a mechanical engineering viewpoint. Part A: chairside milling machines.

PubMed

Lebon, Nicolas; Tapie, Laurent; Duret, Francois; Attal, Jean-Pierre

2016-01-01

The dental milling machine is an important device in the dental CAD/CAM chain. Nowadays, dental numerical controlled (NC) milling machines are available for dental surgeries (chairside solution). This article provides a mechanical engineering approach to NC milling machines to help dentists understand the involvement of technology in digital dentistry practice. First, some technical concepts and definitions associated with NC milling machines are described from a mechanical engineering viewpoint. The technical and economic criteria of four chairside dental NC milling machines that are available on the market are then described. The technical criteria are focused on the capacities of the embedded technologies of these milling machines to mill both prosthetic materials and types of shape restorations. The economic criteria are focused on investment costs and interoperability with third-party software. The clinical relevance of the technology is assessed in terms of the accuracy and integrity of the restoration.

Machine Learning in Computer-Aided Synthesis Planning.

PubMed

Coley, Connor W; Green, William H; Jensen, Klavs F

2018-05-15

Computer-aided synthesis planning (CASP) is focused on the goal of accelerating the process by which chemists decide how to synthesize small molecule compounds. The ideal CASP program would take a molecular structure as input and output a sorted list of detailed reaction schemes that each connect that target to purchasable starting materials via a series of chemically feasible reaction steps. Early work in this field relied on expert-crafted reaction rules and heuristics to describe possible retrosynthetic disconnections and selectivity rules but suffered from incompleteness, infeasible suggestions, and human bias. With the relatively recent availability of large reaction corpora (such as the United States Patent and Trademark Office (USPTO), Reaxys, and SciFinder databases), consisting of millions of tabulated reaction examples, it is now possible to construct and validate purely data-driven approaches to synthesis planning. As a result, synthesis planning has been opened to machine learning techniques, and the field is advancing rapidly. In this Account, we focus on two critical aspects of CASP and recent machine learning approaches to both challenges. First, we discuss the problem of retrosynthetic planning, which requires a recommender system to propose synthetic disconnections starting from a target molecule. We describe how the search strategy, necessary to overcome the exponential growth of the search space with increasing number of reaction steps, can be assisted through a learned synthetic complexity metric. We also describe how the recursive expansion can be performed by a straightforward nearest neighbor model that makes clever use of reaction data to generate high quality retrosynthetic disconnections. Second, we discuss the problem of anticipating the products of chemical reactions, which can be used to validate proposed reactions in a computer-generated synthesis plan (i.e., reduce false positives) to increase the likelihood of experimental success. While we introduce this task in the context of reaction validation, its utility extends to the prediction of side products and impurities, among other applications. We describe neural network-based approaches that we and others have developed for this forward prediction task that can be trained on previously published experimental data. Machine learning and artificial intelligence have revolutionized a number of disciplines, not limited to image recognition, dictation, translation, content recommendation, advertising, and autonomous driving. While there is a rich history of using machine learning for structure-activity models in chemistry, it is only now that it is being successfully applied more broadly to organic synthesis and synthesis design. As reported in this Account, machine learning is rapidly transforming CASP, but there are several remaining challenges and opportunities, many pertaining to the availability and standardization of both data and evaluation metrics, which must be addressed by the community at large.

ReactionPredictor: prediction of complex chemical reactions at the mechanistic level using machine learning.

PubMed

Kayala, Matthew A; Baldi, Pierre

2012-10-22

Proposing reasonable mechanisms and predicting the course of chemical reactions is important to the practice of organic chemistry. Approaches to reaction prediction have historically used obfuscating representations and manually encoded patterns or rules. Here we present ReactionPredictor, a machine learning approach to reaction prediction that models elementary, mechanistic reactions as interactions between approximate molecular orbitals (MOs). A training data set of productive reactions known to occur at reasonable rates and yields and verified by inclusion in the literature or textbooks is derived from an existing rule-based system and expanded upon with manual curation from graduate level textbooks. Using this training data set of complex polar, hypervalent, radical, and pericyclic reactions, a two-stage machine learning prediction framework is trained and validated. In the first stage, filtering models trained at the level of individual MOs are used to reduce the space of possible reactions to consider. In the second stage, ranking models over the filtered space of possible reactions are used to order the reactions such that the productive reactions are the top ranked. The resulting model, ReactionPredictor, perfectly ranks polar reactions 78.1% of the time and recovers all productive reactions 95.7% of the time when allowing for small numbers of errors. Pericyclic and radical reactions are perfectly ranked 85.8% and 77.0% of the time, respectively, rising to >93% recovery for both reaction types with a small number of allowed errors. Decisions about which of the polar, pericyclic, or radical reaction type ranking models to use can be made with >99% accuracy. Finally, for multistep reaction pathways, we implement the first mechanistic pathway predictor using constrained tree-search to discover a set of reasonable mechanistic steps from given reactants to given products. Webserver implementations of both the single step and pathway versions of ReactionPredictor are available via the chemoinformatics portal http://cdb.ics.uci.edu/.

Acetylene chain reaction on hydrogenated boron nitride monolayers: a density functional theory study.

PubMed

Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru

2017-11-28

Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.

The Argonne Braille Project.

ERIC Educational Resources Information Center

Grunwald, Arnold

A project summary and 20 related papers are presented on the Argonne Braille Machine, a device which produces braille-equivalent information on magnetic tape rather than embossing dots on paper. The summary traces the machine's development while 10 papers cover such issues as user reactions, evaluation proposals, use and care of the machine, the…

76 FR 5384 - Agency Information Collection Activities; Submission for Office of Management and Budget Review...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-01-31

... Request; Restaurant Menu and Vending Machine Labeling: Registration for Small Chains Under Section 4205 of... following proposed collection of information to OMB for review and clearance. I. Background Restaurant Menu... chain restaurants and similar retail food establishments (SRFE) with 20 or more locations, as well as...

Atwood's Heavy Chain

ERIC Educational Resources Information Center

Beeken, Paul

2011-01-01

While perusing various websites in search of a more challenging lab for my students, I came across a number of ideas where replacing the string in an Atwood's machine with a simple ball chain like the kind found in lamp pulls created an interesting system to investigate. The replacement of the string produced a nice nonuniform acceleration, but…

Supplement to Theory of Neutron Chain Reactions

DOE R&D Accomplishments Database

Weinberg, Alvin M.; Noderer, L. C.

1952-05-26

General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

Amazing structure of respirasome: unveiling the secrets of cell respiration.

PubMed

Guo, Runyu; Gu, Jinke; Wu, Meng; Yang, Maojun

2016-12-01

Respirasome, a huge molecular machine that carries out cellular respiration, has gained growing attention since its discovery, because respiration is the most indispensable biological process in almost all living creatures. The concept of respirasome has renewed our understanding of the respiratory chain organization, and most recently, the structure of respirasome solved by Yang's group from Tsinghua University (Gu et al. Nature 237(7622):639-643, 2016) firstly presented the detailed interactions within this huge molecular machine, and provided important information for drug design and screening. However, the study of cellular respiration went through a long history. Here, we briefly showed the detoured history of respiratory chain investigation, and then described the amazing structure of respirasome.

Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

PubMed

Zhou, Yu; Pearson, John E; Auerbach, Anthony

2005-12-01

We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

PubMed

Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

2017-11-01

Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.

PubMed

Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján

2016-02-20

In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.

The Armys M-1 Abrams, M-2/M-3 Bradley, and M-1126 Stryker: Background and Issues for Congress

DTIC Science & Technology

2016-04-05

smoothbore gun 1 x coaxial mounted 7.62 mm M-240 machine gun 1 x roof mounted 12.7 mm M-2 HB machine gun 1 x roof mounted 7.62 mm M-240 machine gun 12...Bradley Fighting Vehicle Table 2. Selected Basic Characteristics— M2 /3-A2 Armament 1 x turret mounted M-242 25mm “Bushmaster” chain gun 2 x turret...mounted TOW anti-tank missiles 1 x coaxial mounted 7.62 mm M-240C machine gun 8 x turret mounted smoke grenade launchers Crew M-2: 3 crew, 6

The application of machine learning techniques in the clinical drug therapy.

PubMed

Meng, Huan-Yu; Jin, Wan-Lin; Yan, Cheng-Kai; Yang, Huan

2018-05-25

The development of a novel drug is an extremely complicated process that includes the target identification, design and manufacture, and proper therapy of the novel drug, as well as drug dose selection, drug efficacy evaluation, and adverse drug reaction control. Due to the limited resources, high costs, long duration, and low hit-to-lead ratio in the development of pharmacogenetics and computer technology, machine learning techniques have assisted novel drug development and have gradually received more attention by researchers. According to current research, machine learning techniques are widely applied in the process of the discovery of new drugs and novel drug targets, the decision surrounding proper therapy and drug dose, and the prediction of drug efficacy and adverse drug reactions. In this article, we discussed the history, workflow, and advantages and disadvantages of machine learning techniques in the processes mentioned above. Although the advantages of machine learning techniques are fairly obvious, the application of machine learning techniques is currently limited. With further research, the application of machine techniques in drug development could be much more widespread and could potentially be one of the major methods used in drug development. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

PubMed

Umamaheswari, A; Venkateswarlu, K

2004-06-01

Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

A comparison of forward and concurrent chaining strategies in teaching laundromat skills to students with severe handicaps.

PubMed

McDonnell, J; McFarland, S

1988-01-01

This study compared the relative efficiency of forward and concurrent chaining strategies in teaching the use of a commercial washing machine and laundry soap dispenser to four high school students with severe handicaps. Acquisition and maintenance of the laundromat skills were assessed through a multielement, alternating treatment within subject design. Results indicated that the concurrent chaining strategy was more efficient than forward chaining in facilitating acquisition of the activities. Four week and eight week follow-up probes indicated that concurrent chaining resulted in better maintenance of the activities. The implications of these results for teaching community activities and future research in building complex chains are discussed.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Manufacturing of embedded multimode waveguides by reactive lamination of cyclic olefin polymer and polymethylmethacrylate

NASA Astrophysics Data System (ADS)

Kelb, Christian; Rother, Raimund; Schuler, Anne-Katrin; Hinkelmann, Moritz; Rahlves, Maik; Prucker, Oswald; Müller, Claas; Rühe, Jürgen; Reithmeier, Eduard; Roth, Bernhard

2016-03-01

We demonstrate the manufacturing of embedded multimode optical waveguides through linking of polymethylmethacrylate (PMMA) foils and cyclic olefin polymer (COP) filaments based on a lamination process. Since the two polymeric materials cannot be fused together through interdiffusion of polymer chains, we utilize a reactive lamination agent based on PMMA copolymers containing photoreactive 2-acryloyloxyanthraquinone units, which allows the creation of monolithic PMMA-COP substrates through C-H insertion reactions across the interface between the two materials. We elucidate the lamination process and evaluate the chemical link between filament and foils by carrying out extraction tests with a custom-built tensile testing machine. We also show attenuation measurements of the manufactured waveguides for different manufacturing parameters. The lamination process is in particular suited for large-scale and low-cost fabrication of board-level devices with optical waveguides or other micro-optical structures, e.g., optofluidic devices.

The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

PubMed

Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

2006-07-01

We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

BCR CDR3 length distributions differ between blood and spleen and between old and young patients, and TCR distributions can be used to detect myelodysplastic syndrome

NASA Astrophysics Data System (ADS)

Pickman, Yishai; Dunn-Walters, Deborah; Mehr, Ramit

2013-10-01

Complementarity-determining region 3 (CDR3) is the most hyper-variable region in B cell receptor (BCR) and T cell receptor (TCR) genes, and the most critical structure in antigen recognition and thereby in determining the fates of developing and responding lymphocytes. There are millions of different TCR Vβ chain or BCR heavy chain CDR3 sequences in human blood. Even now, when high-throughput sequencing becomes widely used, CDR3 length distributions (also called spectratypes) are still a much quicker and cheaper method of assessing repertoire diversity. However, distribution complexity and the large amount of information per sample (e.g. 32 distributions of the TCRα chain, and 24 of TCRβ) calls for the use of machine learning tools for full exploration. We have examined the ability of supervised machine learning, which uses computational models to find hidden patterns in predefined biological groups, to analyze CDR3 length distributions from various sources, and distinguish between experimental groups. We found that (a) splenic BCR CDR3 length distributions are characterized by low standard deviations and few local maxima, compared to peripheral blood distributions; (b) healthy elderly people's BCR CDR3 length distributions can be distinguished from those of the young; and (c) a machine learning model based on TCR CDR3 distribution features can detect myelodysplastic syndrome with approximately 93% accuracy. Overall, we demonstrate that using supervised machine learning methods can contribute to our understanding of lymphocyte repertoire diversity.

Single Molecule Spectroscopy of Amino Acids and Peptides by Recognition Tunneling

PubMed Central

Zhao, Yanan; Ashcroft, Brian; Zhang, Peiming; Liu, Hao; Sen, Suman; Song, Weisi; Im, JongOne; Gyarfas, Brett; Manna, Saikat; Biswas, Sovan; Borges, Chad; Lindsay, Stuart

2014-01-01

The human proteome has millions of protein variants due to alternative RNA splicing and post-translational modifications, and variants that are related to diseases are frequently present in minute concentrations. For DNA and RNA, low concentrations can be amplified using the polymerase chain reaction, but there is no such reaction for proteins. Therefore, the development of single molecule protein sequencing is a critical step in the search for protein biomarkers. Here we show that single amino acids can be identified by trapping the molecules between two electrodes that are coated with a layer of recognition molecules and measuring the electron tunneling current across the junction. A given molecule can bind in more than one way in the junction, and we therefore use a machine-learning algorithm to distinguish between the sets of electronic ‘fingerprints’ associated with each binding motif. With this recognition tunneling technique, we are able to identify D, L enantiomers, a methylated amino acid, isobaric isomers, and short peptides. The results suggest that direct electronic sequencing of single proteins could be possible by sequentially measuring the products of processive exopeptidase digestion, or by using a molecular motor to pull proteins through a tunnel junction integrated with a nanopore. PMID:24705512

75 FR 39026 - Disclosure of Nutrient Content Information for Standard Menu Items Offered for Sale at Chain...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-07

... DEPARTMENT OF HEALTH AND HUMAN SERVICES> Food and Drug Administration [Docket No. FDA-2010-N-0298] Disclosure of Nutrient Content Information for Standard Menu Items Offered for Sale at Chain Restaurants or Similar Retail Food Establishments and for Articles of Food Sold From Vending Machines AGENCY: Food and...

Automated planning for intelligent machines in energy-related applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weisbin, C.R.; de Saussure, G.; Barhen, J.

1984-01-01

This paper discusses the current activities of the Center for Engineering Systems Advanced Research (CESAR) program related to plan generation and execution by an intelligent machine. The system architecture for the CESAR mobile robot (named HERMIES-1) is described. The minimal cut-set approach is developed to reduce the tree search time of conventional backward chaining planning techniques. Finally, a real-time concept of an Intelligent Machine Operating System is presented in which planning and reasoning is embedded in a system for resource allocation and process management.

Assessment of free fetal DNA concentration in maternal plasma during the first trimester of pregnancy: comparative study between EDTA and PPT tubes - pilot study.

PubMed

Chadud, Carolina Schneider; Araujo Júnior, Edward; Martinhago, Ciro Dresh; Andari, Viviane Cristina Mello; Tedesco, Giselle Darahem; Bussamra, Luiz Claudio Silva; Aoki, Tsutomu

2015-01-01

To compare ethylenediamine tetraacetic acid (EDTA) tubes and plasma preparation tubes (PPT) for evaluating maternal plasma during the first trimester of pregnancy. A cross-sectional study was conducted on 24 male fetuses in women between 6 and 14 weeks of pregnancy. Blood samples (10 mL) were collected and stored in EDTA and PPT tubes. Subsequently, the samples were centrifuged and sent for free fetal DNA extraction by means of the polymerase chain reaction (PCR) technique. The reactions were performed in a real time PCR machine for detecting the amplification products. The genome region chosen for performing the PCR reactions was a target specific for the Y chromosome, in which the DYS-14 marker was amplified only when the DNA was of male sex. The free fetal DNA concentration was given by the threshold cycle (TC). To compare the tubes, the paired Student t-test was used. The mean gestational age was 11.08 ± 2.30 weeks (range: 6-14). The mean TC for PPT was 30.08 ± 1.05 (range: 27.08-32.61) and for EDTA, 30.23 ± 0.96 (range: 28.01-32.09), but without statistical significance (p=0.357). We did not observe any statistically significant difference in free fetal DNA concentration between the EDTA and PPT tubes.

Atwood's Heavy Chain

NASA Astrophysics Data System (ADS)

Beeken, Paul

2011-11-01

While perusing various websites in search of a more challenging lab for my students, I came across a number of ideas where replacing the string in an Atwood's machine with a simple ball chain like the kind found in lamp pulls created an interesting system to investigate. The replacement of the string produced a nice nonuniform acceleration, but one that my AP® students found difficult to analyze given their current math background. As the year progressed, we began to explore the importance of work and its utility in making predictions on systems that did not lend themselves to easy analysis using Newtonian mechanics. The effort made it apparent that the heavy rope Atwood's machine would make a perfect system for investigation using the lessons gained from work and energy.

Polymerase chain reaction system

DOEpatents

Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

2004-03-02

A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

2013-06-28

Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

Control and reduction of peak temperature in self-curing resins.

PubMed

Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A

2009-07-01

INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.

Learning to predict chemical reactions.

PubMed

Kayala, Matthew A; Azencott, Chloé-Agathe; Chen, Jonathan H; Baldi, Pierre

2011-09-26

Being able to predict the course of arbitrary chemical reactions is essential to the theory and applications of organic chemistry. Approaches to the reaction prediction problems can be organized around three poles corresponding to: (1) physical laws; (2) rule-based expert systems; and (3) inductive machine learning. Previous approaches at these poles, respectively, are not high throughput, are not generalizable or scalable, and lack sufficient data and structure to be implemented. We propose a new approach to reaction prediction utilizing elements from each pole. Using a physically inspired conceptualization, we describe single mechanistic reactions as interactions between coarse approximations of molecular orbitals (MOs) and use topological and physicochemical attributes as descriptors. Using an existing rule-based system (Reaction Explorer), we derive a restricted chemistry data set consisting of 1630 full multistep reactions with 2358 distinct starting materials and intermediates, associated with 2989 productive mechanistic steps and 6.14 million unproductive mechanistic steps. And from machine learning, we pose identifying productive mechanistic steps as a statistical ranking, information retrieval problem: given a set of reactants and a description of conditions, learn a ranking model over potential filled-to-unfilled MO interactions such that the top-ranked mechanistic steps yield the major products. The machine learning implementation follows a two-stage approach, in which we first train atom level reactivity filters to prune 94.00% of nonproductive reactions with a 0.01% error rate. Then, we train an ensemble of ranking models on pairs of interacting MOs to learn a relative productivity function over mechanistic steps in a given system. Without the use of explicit transformation patterns, the ensemble perfectly ranks the productive mechanism at the top 89.05% of the time, rising to 99.86% of the time when the top four are considered. Furthermore, the system is generalizable, making reasonable predictions over reactants and conditions which the rule-based expert does not handle. A web interface to the machine learning based mechanistic reaction predictor is accessible through our chemoinformatics portal ( http://cdb.ics.uci.edu) under the Toolkits section.

Learning to Predict Chemical Reactions

PubMed Central

Kayala, Matthew A.; Azencott, Chloé-Agathe; Chen, Jonathan H.

2011-01-01

Being able to predict the course of arbitrary chemical reactions is essential to the theory and applications of organic chemistry. Approaches to the reaction prediction problems can be organized around three poles corresponding to: (1) physical laws; (2) rule-based expert systems; and (3) inductive machine learning. Previous approaches at these poles respectively are not high-throughput, are not generalizable or scalable, or lack sufficient data and structure to be implemented. We propose a new approach to reaction prediction utilizing elements from each pole. Using a physically inspired conceptualization, we describe single mechanistic reactions as interactions between coarse approximations of molecular orbitals (MOs) and use topological and physicochemical attributes as descriptors. Using an existing rule-based system (Reaction Explorer), we derive a restricted chemistry dataset consisting of 1630 full multi-step reactions with 2358 distinct starting materials and intermediates, associated with 2989 productive mechanistic steps and 6.14 million unproductive mechanistic steps. And from machine learning, we pose identifying productive mechanistic steps as a statistical ranking, information retrieval, problem: given a set of reactants and a description of conditions, learn a ranking model over potential filled-to-unfilled MO interactions such that the top ranked mechanistic steps yield the major products. The machine learning implementation follows a two-stage approach, in which we first train atom level reactivity filters to prune 94.00% of non-productive reactions with a 0.01% error rate. Then, we train an ensemble of ranking models on pairs of interacting MOs to learn a relative productivity function over mechanistic steps in a given system. Without the use of explicit transformation patterns, the ensemble perfectly ranks the productive mechanism at the top 89.05% of the time, rising to 99.86% of the time when the top four are considered. Furthermore, the system is generalizable, making reasonable predictions over reactants and conditions which the rule-based expert does not handle. A web interface to the machine learning based mechanistic reaction predictor is accessible through our chemoinformatics portal (http://cdb.ics.uci.edu) under the Toolkits section. PMID:21819139

Modeling competitive substitution in a polyelectrolyte complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu

2015-12-28

We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less

29 CFR 570.65 - Occupations involving the operation of circular saws, band saws, guillotine shears, chain saws...

Code of Federal Regulations, 2013 CFR

2013-07-01

... notches or teeth, running over wheels or pulleys, and used for sawing materials. Chain saw shall mean a... machine equipped with a moveable blade operated vertically and used to shear materials. The term shall not... moving blade that alternately changes direction on a linear cutting axis used for sawing materials. Wood...

29 CFR 570.65 - Occupations involving the operation of circular saws, band saws, guillotine shears, chain saws...

Code of Federal Regulations, 2012 CFR

2012-07-01

... notches or teeth, running over wheels or pulleys, and used for sawing materials. Chain saw shall mean a... machine equipped with a moveable blade operated vertically and used to shear materials. The term shall not... moving blade that alternately changes direction on a linear cutting axis used for sawing materials. Wood...

29 CFR 570.65 - Occupations involved in the operations of circular saws, band saws, guillotine shears, chain saws...

Code of Federal Regulations, 2011 CFR

2011-07-01

... notches or teeth, running over wheels or pulleys, and used for sawing materials. Chain saw shall mean a... machine equipped with a moveable blade operated vertically and used to shear materials. The term shall not... moving blade that alternately changes direction on a linear cutting axis used for sawing materials. Wood...

29 CFR 570.65 - Occupations involving the operation of circular saws, band saws, guillotine shears, chain saws...

Code of Federal Regulations, 2014 CFR

2014-07-01

... notches or teeth, running over wheels or pulleys, and used for sawing materials. Chain saw shall mean a... machine equipped with a moveable blade operated vertically and used to shear materials. The term shall not... moving blade that alternately changes direction on a linear cutting axis used for sawing materials. Wood...

The Physics and Physical Chemistry of Molecular Machines.

PubMed

Astumian, R Dean; Mukherjee, Shayantani; Warshel, Arieh

2016-06-17

The concept of a "power stroke"-a free-energy releasing conformational change-appears in almost every textbook that deals with the molecular details of muscle, the flagellar rotor, and many other biomolecular machines. Here, it is shown by using the constraints of microscopic reversibility that the power stroke model is incorrect as an explanation of how chemical energy is used by a molecular machine to do mechanical work. Instead, chemically driven molecular machines operating under thermodynamic constraints imposed by the reactant and product concentrations in the bulk function as information ratchets in which the directionality and stopping torque or stopping force are controlled entirely by the gating of the chemical reaction that provides the fuel for the machine. The gating of the chemical free energy occurs through chemical state dependent conformational changes of the molecular machine that, in turn, are capable of generating directional mechanical motions. In strong contrast to this general conclusion for molecular machines driven by catalysis of a chemical reaction, a power stroke may be (and often is) an essential component for a molecular machine driven by external modulation of pH or redox potential or by light. This difference between optical and chemical driving properties arises from the fundamental symmetry difference between the physics of optical processes, governed by the Bose-Einstein relations, and the constraints of microscopic reversibility for thermally activated processes. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Chain Experiment competition inspires learning of physics

NASA Astrophysics Data System (ADS)

Dziob, Daniel; Górska, Urszula; Kołodziej, Tomasz

2017-05-01

The Chain Experiment is an annual competition which originated in Slovenia in 2005 and later expanded to Poland in 2013. For the purpose of the event, each participating team designs and builds a contraption that transports a small steel ball from one end to the other. At the same time the constructed machine needs to use a number of interesting phenomena and physics laws. In the competition’s finale, all contraptions are connected to each other to form a long chain transporting steel balls. In brief, they are all evaluated for qualities such as: creativity and advance in theoretical background, as well as the reliability of the constructed machine to work without human help. In this article, we present the contraptions developed by students taking part in the competition in order to demonstrate the advance in theoretical basis together with creativity in design and outstanding engineering skills of its participants. Furthermore, we situate the Chain Experiment in the context of other group competitions, at the same time demonstrating that—besides activating numerous group work skills—it also improves the ability to think critically and present one’s knowledge to a broader audience. We discussed it in the context of problem based learning, gamification and collaborative testing.

Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

PubMed

Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

2011-03-14

Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

PubMed

Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

2012-12-01

Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Investigation of Dynamic Force/Vibration Transmission Characteristics of Four-Square Type Gear Durability Test Machines

NASA Technical Reports Server (NTRS)

Kahraman, Ahmet

2002-01-01

In this study, design requirements for a dynamically viable, four-square type gear test machine are investigated. Variations of four-square type gear test machines have been in use for durability and dynamics testing of both parallel- and cross-axis gear set. The basic layout of these machines is illustrated. The test rig is formed by two gear pairs, of the same reduction ratio, a test gear pair and a reaction gear pair, connected to each other through shafts of certain torsional flexibility to form an efficient, closed-loop system. A desired level of constant torque is input to the circuit through mechanical (a split coupling with a torque arm) or hydraulic (a hydraulic actuator) means. The system is then driven at any desired speed by a small DC motor. The main task in hand is the isolation of the test gear pair from the reaction gear pair under dynamic conditions. Any disturbances originated at the reaction gear mesh might potentially travel to the test gearbox, altering the dynamic loading conditions of the test gear mesh, and hence, influencing the outcome of the durability or dynamics test. Therefore, a proper design of connecting structures becomes a major priority. Also, equally important is the issue of how close the operating speed of the machine is to the resonant frequencies of the gear meshes. This study focuses on a detailed analysis of the current NASA Glenn Research Center gear pitting test machine for evaluation of its resonance and vibration isolation characteristics. A number of these machines as the one illustrated has been used over last 30 years to establish an extensive database regarding the influence of the gear materials, processes surface treatments and lubricants on gear durability. This study is intended to guide an optimum design of next generation test machines for the most desirable dynamic characteristics.

Silicon-based sleeve devices for chemical reactions

DOEpatents

Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

1996-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Silicon-based sleeve devices for chemical reactions

DOEpatents

Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

1996-12-31

A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

Architectures for reasoning in parallel

NASA Technical Reports Server (NTRS)

Hall, Lawrence O.

1989-01-01

The research conducted has dealt with rule-based expert systems. The algorithms that may lead to effective parallelization of them were investigated. Both the forward and backward chained control paradigms were investigated in the course of this work. The best computer architecture for the developed and investigated algorithms has been researched. Two experimental vehicles were developed to facilitate this research. They are Backpac, a parallel backward chained rule-based reasoning system and Datapac, a parallel forward chained rule-based reasoning system. Both systems have been written in Multilisp, a version of Lisp which contains the parallel construct, future. Applying the future function to a function causes the function to become a task parallel to the spawning task. Additionally, Backpac and Datapac have been run on several disparate parallel processors. The machines are an Encore Multimax with 10 processors, the Concert Multiprocessor with 64 processors, and a 32 processor BBN GP1000. Both the Concert and the GP1000 are switch-based machines. The Multimax has all its processors hung off a common bus. All are shared memory machines, but have different schemes for sharing the memory and different locales for the shared memory. The main results of the investigations come from experiments on the 10 processor Encore and the Concert with partitions of 32 or less processors. Additionally, experiments have been run with a stripped down version of EMYCIN.

Tools to minimize interlaboratory variability in vitellogenin gene expression monitoring programs

USGS Publications Warehouse

Jastrow, Aaron; Gordon, Denise A.; Auger, Kasie M.; Punska, Elizabeth C.; Arcaro, Kathleen F.; Keteles, Kristen; Winkelman, Dana L.; Lattier, David; Biales, Adam; Lazorchak, James M.

2017-01-01

The egg yolk precursor protein vitellogenin is widely used as a biomarker of estrogen exposure in male fish. However, standardized methodology is lacking and little is known regarding the reproducibility of results among laboratories using different equipment, reagents, protocols, and data analysis programs. To address this data gap we tested the reproducibility across laboratories to evaluate vitellogenin gene (vtg) expression and assessed the value of using a freely available software data analysis program. Samples collected from studies of male fathead minnows (Pimephales promelas) exposed to 17α-ethinylestradiol (EE2) and minnows exposed to processed wastewater effluent were evaluated for vtg expression in 4 laboratories. Our results indicate reasonable consistency among laboratories if the free software for expression analysis LinRegPCR is used, with 3 of 4 laboratories detecting vtg in fish exposed to 5 ng/L EE2 (n = 5). All 4 laboratories detected significantly increased vtg levels in 15 male fish exposed to wastewater effluent compared with 15 male fish held in a control stream. Finally, we were able to determine that the source of high interlaboratory variability from complementary deoxyribonucleic acid (cDNA) to quantitative polymerase chain reaction (qPCR) analyses was the expression analysis software unique to each real-time qPCR machine. We successfully eliminated the interlaboratory variability by reanalyzing raw fluorescence data with independent freeware, which yielded cycle thresholds and polymerase chain reaction (PCR) efficiencies that calculated results independently of proprietary software. Our results suggest that laboratories engaged in monitoring programs should validate their PCR protocols and analyze their gene expression data following the guidelines established in the present study for all gene expression biomarkers. 

Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

PubMed

Chen, Y T; Mercer, G O; Chen, Y

1993-11-01

Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

PubMed

Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

2016-10-01

The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

PubMed

Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

2002-07-01

Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

Organic reactions mediated by electrochemically generated ArS+.

PubMed

Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi

2011-04-21

Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.

Technical preventive measures in Japan.

PubMed

Yonekawa, Y

1994-05-01

Technical preventive measures against vibration syndrome in the field of industrial health are reviewed in the present paper. The first technical prevention measure is to reduce vibration transmission from the tools to the operators. This measure employs vibration isolators between the handles and vibration sources of machine tools. Handles of tools using Neidhalt dampers, shear type rubber mounts and springs have reduced frequency-weighted acceleration levels (Lh,w) from 2 dB to 10 dB (Lh,w (dB) = 20 log a/ao; a: frequency-weighted acceleration (rms), ao = 10(-5) m/s2) in Z direction, while no reduction was found in X, Y directions. The second measure is to reduce vibration at the source; New chain saws have been developed to reduce vibration with twin cylinder instead of a single cylinder engines. This cancels unbalanced movements inside the internal combustion engine. Such chain saws reduced Lh,w values more than 10 dB in both front and rear handles except in Z direction of the front handle. A new type of impact wrench has been devised with an oil pulse device to avoid direct metal contact inside the power source. This new impact wrench lowered Lh,w values more than 10 dB in three directions. The third measure is to use a remote control system or to substitute another machine generating less vibration. Vibration reduction at the handle lever of the remote control chain saw was more than 20 dB. A more effective means is to substitute other machines for conventional tools: a hydraulic wheel jumbo instead of a leg-type rock drill; a hydraulic breaker instead of a hand-held breaker. However, these heavy machines produce whole-body vibration which might give rise to other problems such as back pain.

14. View to the east up the Sugar River. The ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

14. View to the east up the Sugar River. The 1920 enclosed wooden footbridge connected the Chain Machine Building to the company's power plant, pattern shop, and foundry. The Sullivan Machinery Co. Erecting Shop and Machine Shops are in the center of the photo, and the Baltimore truss bridge is visible in the background. - Sullivan Machinery Company, Main Street between Pearl & Water Streets, Claremont, Sullivan County, NH

Automatic spin-chain learning to explore the quantum speed limit

NASA Astrophysics Data System (ADS)

Zhang, Xiao-Ming; Cui, Zi-Wei; Wang, Xin; Yung, Man-Hong

2018-05-01

One of the ambitious goals of artificial intelligence is to build a machine that outperforms human intelligence, even if limited knowledge and data are provided. Reinforcement learning (RL) provides one such possibility to reach this goal. In this work, we consider a specific task from quantum physics, i.e., quantum state transfer in a one-dimensional spin chain. The mission for the machine is to find transfer schemes with the fastest speeds while maintaining high transfer fidelities. The first scenario we consider is when the Hamiltonian is time independent. We update the coupling strength by minimizing a loss function dependent on both the fidelity and the speed. Compared with a scheme proven to be at the quantum speed limit for the perfect state transfer, the scheme provided by RL is faster while maintaining the infidelity below 5 ×10-4 . In the second scenario where a time-dependent external field is introduced, we convert the state transfer process into a Markov decision process that can be understood by the machine. We solve it with the deep Q-learning algorithm. After training, the machine successfully finds transfer schemes with high fidelities and speeds, which are faster than previously known ones. These results show that reinforcement learning can be a powerful tool for quantum control problems.

Classification of Strawberry Fruit Shape by Machine Learning

NASA Astrophysics Data System (ADS)

Ishikawa, T.; Hayashi, A.; Nagamatsu, S.; Kyutoku, Y.; Dan, I.; Wada, T.; Oku, K.; Saeki, Y.; Uto, T.; Tanabata, T.; Isobe, S.; Kochi, N.

2018-05-01

Shape is one of the most important traits of agricultural products due to its relationships with the quality, quantity, and value of the products. For strawberries, the nine types of fruit shape were defined and classified by humans based on the sampler patterns of the nine types. In this study, we tested the classification of strawberry shapes by machine learning in order to increase the accuracy of the classification, and we introduce the concept of computerization into this field. Four types of descriptors were extracted from the digital images of strawberries: (1) the Measured Values (MVs) including the length of the contour line, the area, the fruit length and width, and the fruit width/length ratio; (2) the Ellipse Similarity Index (ESI); (3) Elliptic Fourier Descriptors (EFDs), and (4) Chain Code Subtraction (CCS). We used these descriptors for the classification test along with the random forest approach, and eight of the nine shape types were classified with combinations of MVs + CCS + EFDs. CCS is a descriptor that adds human knowledge to the chain codes, and it showed higher robustness in classification than the other descriptors. Our results suggest machine learning's high ability to classify fruit shapes accurately. We will attempt to increase the classification accuracy and apply the machine learning methods to other plant species.

A method for integrating and ranking the evidence for biochemical pathways by mining reactions from text

PubMed Central

Miwa, Makoto; Ohta, Tomoko; Rak, Rafal; Rowley, Andrew; Kell, Douglas B.; Pyysalo, Sampo; Ananiadou, Sophia

2013-01-01

Motivation: To create, verify and maintain pathway models, curators must discover and assess knowledge distributed over the vast body of biological literature. Methods supporting these tasks must understand both the pathway model representations and the natural language in the literature. These methods should identify and order documents by relevance to any given pathway reaction. No existing system has addressed all aspects of this challenge. Method: We present novel methods for associating pathway model reactions with relevant publications. Our approach extracts the reactions directly from the models and then turns them into queries for three text mining-based MEDLINE literature search systems. These queries are executed, and the resulting documents are combined and ranked according to their relevance to the reactions of interest. We manually annotate document-reaction pairs with the relevance of the document to the reaction and use this annotation to study several ranking methods, using various heuristic and machine-learning approaches. Results: Our evaluation shows that the annotated document-reaction pairs can be used to create a rule-based document ranking system, and that machine learning can be used to rank documents by their relevance to pathway reactions. We find that a Support Vector Machine-based system outperforms several baselines and matches the performance of the rule-based system. The success of the query extraction and ranking methods are used to update our existing pathway search system, PathText. Availability: An online demonstration of PathText 2 and the annotated corpus are available for research purposes at http://www.nactem.ac.uk/pathtext2/. Contact: makoto.miwa@manchester.ac.uk Supplementary information: Supplementary data are available at Bioinformatics online. PMID:23813008

Surfactant-controlled polymerization of semiconductor clusters to quantum dots through competing step-growth and living chain-growth mechanisms.

PubMed

Evans, Christopher M; Love, Alyssa M; Weiss, Emily A

2012-10-17

This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.

Kinetics of Chemical Reactions in Flames

NASA Technical Reports Server (NTRS)

Zeldovich, Y.; Semenov, N.

1946-01-01

In part I of the paper the theory of flame propagation is developed along the lines followed by Frank-Kamenetsky and one of the writers. The development of chain processes in flames is considered. A basis is given for the application of the method of stationary concentrations to reactions in flames; reactions with branching chains are analyzed. The case of a diffusion coefficient different from the coefficient of temperature conductivity is considered.

Modeling Stochastic Kinetics of Molecular Machines at Multiple Levels: From Molecules to Modules

PubMed Central

Chowdhury, Debashish

2013-01-01

A molecular machine is either a single macromolecule or a macromolecular complex. In spite of the striking superficial similarities between these natural nanomachines and their man-made macroscopic counterparts, there are crucial differences. Molecular machines in a living cell operate stochastically in an isothermal environment far from thermodynamic equilibrium. In this mini-review we present a catalog of the molecular machines and an inventory of the essential toolbox for theoretically modeling these machines. The tool kits include 1), nonequilibrium statistical-physics techniques for modeling machines and machine-driven processes; and 2), statistical-inference methods for reverse engineering a functional machine from the empirical data. The cell is often likened to a microfactory in which the machineries are organized in modular fashion; each module consists of strongly coupled multiple machines, but different modules interact weakly with each other. This microfactory has its own automated supply chain and delivery system. Buoyed by the success achieved in modeling individual molecular machines, we advocate integration of these models in the near future to develop models of functional modules. A system-level description of the cell from the perspective of molecular machinery (the mechanome) is likely to emerge from further integrations that we envisage here. PMID:23746505

Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

USDA-ARS?s Scientific Manuscript database

This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

[Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

PubMed

Wang, F; Zhang, Y Q; Ding, J; Yu, L X

2017-10-18

To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

PubMed

Igarashi, T; Yamamoto, A; Goto, N

1996-10-01

Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

PubMed

Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

2017-01-01

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

Structure–Function Studies of Hydrophobic Residues That Clamp a Basic Glutamate Side Chain during Catalysis by Triosephosphate Isomerase

PubMed Central

2016-01-01

Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328

Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates.

PubMed

Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M

2013-03-28

This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

Microfabricated electrochemiluminescence cell for chemical reaction detection

DOEpatents

Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

2003-01-01

A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions

NASA Astrophysics Data System (ADS)

Zlokazov, V. B.; Utyonkov, V. K.

2017-07-01

The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.

Peppytides: Interactive Models of Polypeptide Chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zuckermann, Ron; Chakraborty, Promita; Derisi, Joe

2014-01-21

Peppytides are scaled, 3D-printed models of polypeptide chains that can be folded into accurate protein structures. Designed and created by Berkeley Lab Researcher, Promita Chakraborty, and Berkeley Lab Senior Scientist, Dr. Ron Zuckermann, Peppytides are accurate physical models of polypeptide chains that anyone can interact with and fold intro various protein structures - proving to be a great educational tool, resulting in a deeper understanding of these fascinating structures and how they function. Build your own Peppytide model and learn about how nature's machines fold into their intricate architectures!

Peppytides: Interactive Models of Polypeptide Chains

ScienceCinema

Zuckermann, Ron; Chakraborty, Promita; Derisi, Joe

2018-06-08

Peppytides are scaled, 3D-printed models of polypeptide chains that can be folded into accurate protein structures. Designed and created by Berkeley Lab Researcher, Promita Chakraborty, and Berkeley Lab Senior Scientist, Dr. Ron Zuckermann, Peppytides are accurate physical models of polypeptide chains that anyone can interact with and fold intro various protein structures - proving to be a great educational tool, resulting in a deeper understanding of these fascinating structures and how they function. Build your own Peppytide model and learn about how nature's machines fold into their intricate architectures!

A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

NASA Astrophysics Data System (ADS)

Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua

2017-08-01

Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.

Problem-Solving Test: Real-Time Polymerase Chain Reaction

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

EPA Science Inventory

Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

ERIC Educational Resources Information Center

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

EPA Science Inventory

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

USDA-ARS?s Scientific Manuscript database

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

PubMed

Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

2005-03-01

We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

EPA Science Inventory

A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

EPA Science Inventory

Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

17. Baltimore through truss steel bridge (1905), built by the ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

17. Baltimore through truss steel bridge (1905), built by the American Bridge Company. The bridge is 15 to 20 feet wide, with a wooden deck, and connects the Sullivan Machine Co. with the Foundry. The enclosed bridge in the background was constructed ca. 1920, and connects the Chain Machine Building with its power plant, foundry, and pattern shop. - Sullivan Machinery Company, Main Street between Pearl & Water Streets, Claremont, Sullivan County, NH

A novel automated device for rapid nucleic acid extraction utilizing a zigzag motion of magnetic silica beads.

PubMed

Yamaguchi, Akemi; Matsuda, Kazuyuki; Uehara, Masayuki; Honda, Takayuki; Saito, Yasunori

2016-02-04

We report a novel automated device for nucleic acid extraction, which consists of a mechanical control system and a disposable cassette. The cassette is composed of a bottle, a capillary tube, and a chamber. After sample injection in the bottle, the sample is lysed, and nucleic acids are adsorbed on the surface of magnetic silica beads. These magnetic beads are transported and are vibrated through the washing reagents in the capillary tube under the control of the mechanical control system, and thus, the nucleic acid is purified without centrifugation. The purified nucleic acid is automatically extracted in 3 min for the polymerase chain reaction (PCR). The nucleic acid extraction is dependent on the transport speed and the vibration frequency of the magnetic beads, and optimizing these two parameters provided better PCR efficiency than the conventional manual procedure. There was no difference between the detection limits of our novel device and that of the conventional manual procedure. We have already developed the droplet-PCR machine, which can amplify and detect specific nucleic acids rapidly and automatically. Connecting the droplet-PCR machine to our novel automated extraction device enables PCR analysis within 15 min, and this system can be made available as a point-of-care testing in clinics as well as general hospitals. Copyright © 2015 Elsevier B.V. All rights reserved.

THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST

PubMed Central

Keil, Harry; Wasserman, David; Dawson, Charles R.

1944-01-01

1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415

THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST.

PubMed

Keil, H; Wasserman, D; Dawson, C R

1944-10-01

1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.

Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

PubMed Central

deWit, D; Wootton, M; Allan, B; Steyn, L

1993-01-01

A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

Micro-machined calorimetric biosensors

DOEpatents

Doktycz, Mitchel J.; Britton, Jr., Charles L.; Smith, Stephen F.; Oden, Patrick I.; Bryan, William L.; Moore, James A.; Thundat, Thomas G.; Warmack, Robert J.

2002-01-01

A method and apparatus are provided for detecting and monitoring micro-volumetric enthalpic changes caused by molecular reactions. Micro-machining techniques are used to create very small thermally isolated masses incorporating temperature-sensitive circuitry. The thermally isolated masses are provided with a molecular layer or coating, and the temperature-sensitive circuitry provides an indication when the molecules of the coating are involved in an enthalpic reaction. The thermally isolated masses may be provided singly or in arrays and, in the latter case, the molecular coatings may differ to provide qualitative and/or quantitative assays of a substance.

Microfabricated sleeve devices for chemical reactions

DOEpatents

Northrup, M. Allen

2003-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Enzymatic preparation of structured oils containing short-chain fatty acids.

PubMed

Kanda, Ayato; Namiki, Fusako; Hara, Setsuko

2010-01-01

Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.

An ab initio molecular dynamics and density functional theory study of the formation of phosphate chains from metathiophosphates.

PubMed

Mosey, Nicholas J; Woo, Tom K

2006-09-04

The reactions that occur between metathiophosphate (MTP) molecules are identified and examined through ab initio molecular dynamics simulations and static quantum chemical calculations at the density functional level of theory. The simulations show that certain types of MTPs can react to yield phosphate chains, while others only dimerize. These differences are rationalized in terms of reaction energies and the electronic structures of these molecules. In the reaction leading to the formation of phosphate chains, the reactive center, a tri-coordinate phosphorus atom, is continually regenerated. A polymerization mechanism linking MTPs to phosphate chains is developed on the basis of these results. This information sheds light on the underlying processes that may be responsible for the formation of phosphates under high-temperature conditions and may prove useful in the development of protocols for the rational synthesis of complex phosphate structures.

DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

EPA Science Inventory

The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

29 CFR 1910.155 - Scope, application and definitions applicable to this subpart.

Code of Federal Regulations, 2010 CFR

2010-07-01

... by inhibiting the chemical chain reaction of fuel and oxygen. It is also known as...F3) which is a medium for extinguishing fires by inhibiting the chemical chain reaction of fuel and..., odorless, electrically nonconductive inert gas (chemical formula CO2) that is a medium for extinguishing...

Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

ERIC Educational Resources Information Center

Phelps, Tara L.; And Others

1996-01-01

Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

Determining Annealing Temperatures for Polymerase Chain Reaction

ERIC Educational Resources Information Center

Porta, Angela R.; Enners, Edward

2012-01-01

The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

USDA-ARS?s Scientific Manuscript database

A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.

PubMed

Borkar, Santosh Ramdas; Aidhen, Indrapal Singh

2017-04-18

Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.

Multi-scale modeling of diffusion-controlled reactions in polymers: renormalisation of reactivity parameters.

PubMed

Everaers, Ralf; Rosa, Angelo

2012-01-07

The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.

Temperature control apparatus

DOEpatents

Northrup, M. Allen

2003-08-05

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

PubMed

Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

2014-01-01

Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

Device and method for producing a containment barrier underneath and around in-situ buried waste

DOEpatents

Gardner, Bradley M.; Smith, Ann M.; Hanson, Richard W.; Hodges, Richard T.

1998-01-01

An apparatus for building a horizontal underground barrier by cutting through soil and depositing a slurry, preferably on which cures into a hardened material. The apparatus includes a digging means for cutting and removing soil to create a void under the surface of the ground and injection means for inserting barrier-forming material into the void. In one embodiment, the digging means is a continuous cutting chain. Mounted on the continuous cutting chain are cutter teeth for cutting through soil and discharge paddles for removing the loosened soil. This invention includes a barrier placement machine, a method for building an underground horizontal containment barrier using the barrier placement machine, and the underground containment system. Preferably the underground containment barrier goes underneath and around the site to be contained in a bathtub-type containment.

Underground barrier construction apparatus with soil-retaining shield

DOEpatents

Gardner, Bradley M.; Smith, Ann Marie; Hanson, Richard W.; Hodges, Richard T.

1998-01-01

An apparatus for building a horizontal underground barrier by cutting through soil and depositing a slurry, preferably one which cures into a hardened material. The apparatus includes a digging means for cutting and removing soil to create a void under the surface of the ground, a shield means for maintaining the void, and injection means for inserting barrier-forming material into the void. In one embodiment, the digging means is a continuous cutting chain. Mounted on the continuous cutting chain are cutter teeth for cutting through soil and discharge paddles for removing the loosened soil. This invention includes a barrier placement machine, a method for building an underground horizontal containment barrier using the barrier placement machine, and the underground containment system. Preferably the underground containment barrier goes underneath and around the site to be contained in a bathtub-type containment.

Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

PubMed

Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

2013-09-15

We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

PubMed Central

Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

2015-01-01

Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

DOE Office of Scientific and Technical Information (OSTI.GOV)

Curry, Bennett

The Arizona Commerce Authority (ACA) conducted an Innovation in Advanced Manufacturing Grant Competition to support and grow southern and central Arizona’s Aerospace and Defense (A&D) industry and its supply chain. The problem statement for this grant challenge was that many A&D machining processes utilize older generation CNC machine tool technologies that can result an inefficient use of resources – energy, time and materials – compared to the latest state-of-the-art CNC machines. Competitive awards funded projects to develop innovative new tools and technologies that reduce energy consumption for older generation machine tools and foster working relationships between industry small to medium-sizedmore » manufacturing enterprises and third-party solution providers. During the 42-month term of this grant, 12 competitive awards were made. Final reports have been included with this submission.« less

Molecules in the Spotlight

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cryan, James

2010-01-26

SLAC has just unveiled the world's first X-ray laser, the LCLS. This machine produces pulses of X-rays that are ten billion times brighter than those from conventional sources. One of the goals of this machine is to make movies of chemical reactions, including reactions necessary for life and reactions that might power new energy technologies. This public lecture will show the first results from the LCLS. As a first target, we have chosen nitrogen gas, the main component of the air we breathe. Using the unprecedented power of the LCLS X-rays as a blasting torch, we have created new formsmore » of this molecule and with unique electronic arrangements. Please share with us the first insights from this new technology.« less

Modeling stochastic kinetics of molecular machines at multiple levels: from molecules to modules.

PubMed

Chowdhury, Debashish

2013-06-04

A molecular machine is either a single macromolecule or a macromolecular complex. In spite of the striking superficial similarities between these natural nanomachines and their man-made macroscopic counterparts, there are crucial differences. Molecular machines in a living cell operate stochastically in an isothermal environment far from thermodynamic equilibrium. In this mini-review we present a catalog of the molecular machines and an inventory of the essential toolbox for theoretically modeling these machines. The tool kits include 1), nonequilibrium statistical-physics techniques for modeling machines and machine-driven processes; and 2), statistical-inference methods for reverse engineering a functional machine from the empirical data. The cell is often likened to a microfactory in which the machineries are organized in modular fashion; each module consists of strongly coupled multiple machines, but different modules interact weakly with each other. This microfactory has its own automated supply chain and delivery system. Buoyed by the success achieved in modeling individual molecular machines, we advocate integration of these models in the near future to develop models of functional modules. A system-level description of the cell from the perspective of molecular machinery (the mechanome) is likely to emerge from further integrations that we envisage here. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Dynamic high-speed acquisition system design of transmission error with USB based on LabVIEW and FPGA

NASA Astrophysics Data System (ADS)

Zheng, Yong; Chen, Yan

2013-10-01

To realize the design of dynamic acquisition system for real-time detection of transmission chain error is very important to improve the machining accuracy of machine tool. In this paper, the USB controller and FPGA is used for hardware platform design, combined with LabVIEW to design user applications, NI-VISA is taken for develop USB drivers, and ultimately achieve the dynamic acquisition system design of transmission error

An improved reaction path optimization method using a chain of conformations

NASA Astrophysics Data System (ADS)

Asada, Toshio; Sawada, Nozomi; Nishikawa, Takuya; Koseki, Shiro

2018-05-01

The efficient fast path optimization (FPO) method is proposed to optimize the reaction paths on energy surfaces by using chains of conformations. No artificial spring force is used in the FPO method to ensure the equal spacing of adjacent conformations. The FPO method is applied to optimize the reaction path on two model potential surfaces. The use of this method enabled the optimization of the reaction paths with a drastically reduced number of optimization cycles for both potentials. It was also successfully utilized to define the MEP of the isomerization of the glycine molecule in water by FPO method.

Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions

NASA Astrophysics Data System (ADS)

Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.

2018-05-01

It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

Lower extremity muscle function of front row rugby union scrummaging.

PubMed

Yaghoubi, Mostafa; Lark, Sally D; Page, Wyatt H; Fink, Philip W; Shultz, Sarah P

2018-05-16

A rugby scrum's front row must act uniformly to transfer maximal horizontal force and improve performance. This study investigated the muscle activation patterns of lower extremity muscles in front row forwards during live and machine scrums at professional and amateur levels. Electromyography was collected bilaterally on vastus lateralis, rectus femoris and gastrocnemius muscles of 75 male rugby prop players during live and machine scrums. ANOVAs compared muscle reaction time, rate of change in muscle amplitude and muscle amplitude between groups and conditions. Cross-correlation analysis explored muscle synchronicity. There were significantly greater rates of change in each muscle amplitude in professional players than amateur players. Additionally, there was significantly quicker muscle reaction time in all muscles, and greater amplitude in vastus lateralis and gastrocnemius, during the live scrum vs. machine condition. The professional props produced more synchronised muscle activation than amateur players and all players produced more synchronised muscle activation against the scrum machine vs. live scrummage. The results indicate a higher skill proficiency and muscle synchronicity in professional players. While scrum machine training is ideally suited for functional muscle strengthening during practice, to truly simulate the requirements of the scrum, training should incorporate the live situation as much as possible.

Processing of Novel Nanoparticle Dispersion Strengthened Ceramics for Improved Mechanical Performance

DTIC Science & Technology

1992-12-14

the composite . The top and bottom surfaces of each disc were removed to eliminate any reaction layer, and the discs were machined ’ to produce bars...l.It is postulated that during grinding of the composite , compressive stresses and machining flaws are introduced into the surface. The compressive...two materials considered would react differently to the annealing step. It can be expected that machining flaws will heal in the composite samples

Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

Scientific publications about DNA structure-function and PCR technique in Costa Rica: a historic view (1953-2003).

PubMed

Albertazzi, Federico J

2004-09-01

The spreading of knowledge depends on the access to the information and its immediate use. Models are useful to explain specific phenomena. The scientific community accepts some models in Biology after a period of time, once it has evidence to support it. The model of the structure and function of the DNA proposed by Watson & Crick (1953) was not the exception, since a few years later the DNA model was finally accepted. In Costa Rica, DNA function was first mentioned in 1970, in the magazine Biologia Tropical (Tropical Biology Magazine), more than 15 years after its first publication in a scientific journal. An opposite situation occurs with technical innovations. If the efficiency of a new scientific technique is proved in a compelling way, then the acceptance by the community comes swiftly. This was the case of the polymerase chain reaction, or PCR. The first PCR machine in Costa Rica arrived in 1991, only three years after its publication.

Retrosynthetic Reaction Prediction Using Neural Sequence-to-Sequence Models

PubMed Central

2017-01-01

We describe a fully data driven model that learns to perform a retrosynthetic reaction prediction task, which is treated as a sequence-to-sequence mapping problem. The end-to-end trained model has an encoder–decoder architecture that consists of two recurrent neural networks, which has previously shown great success in solving other sequence-to-sequence prediction tasks such as machine translation. The model is trained on 50,000 experimental reaction examples from the United States patent literature, which span 10 broad reaction types that are commonly used by medicinal chemists. We find that our model performs comparably with a rule-based expert system baseline model, and also overcomes certain limitations associated with rule-based expert systems and with any machine learning approach that contains a rule-based expert system component. Our model provides an important first step toward solving the challenging problem of computational retrosynthetic analysis. PMID:29104927

Ufd2p synthesizes branched ubiquitin chains to promote the degradation of substrates modified with atypical chains

PubMed Central

Liu, Chao; Liu, Weixiao; Ye, Yihong; Li, Wei

2017-01-01

Ubiquitination of a subset of proteins by ubiquitin chain elongation factors (E4), represented by Ufd2p in Saccharomyces cerevisiae, is a pivotal regulator for many biological processes. However, the mechanism of Ufd2p-mediated ubiquitination is largely unclear. Here, we show that Ufd2p catalyses K48-linked multi-monoubiquitination on K29-linked ubiquitin chains assembled by the ubiquitin ligase (Ufd4p), resulting in branched ubiquitin chains. This reaction depends on the interaction of K29-linked ubiquitin chains with two N-terminal loops of Ufd2p. Only following the addition of K48-linked ubiquitin to substrates modified with K29-linked ubiquitin chains, can the substrates be escorted to the proteasome for degradation. We demonstrate that this ubiquitin chain linkage switching reaction is essential for ERAD, oleic acid and acid pH resistance in yeast. Thus, our results suggest that Ufd2p functions by switching ubiquitin chain linkages to allow the degradation of proteins modified with a ubiquitin linkage, which is normally not targeted to the proteasome. PMID:28165462

Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

Identification of Brucella spp. by using the polymerase chain reaction.

PubMed Central

Herman, L; De Ridder, H

1992-01-01

The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

Detection of Listeria monocytogenes by using the polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bessesen, M.T.; Luo, Q.; Blaser, M.J.

1990-09-01

A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

PubMed

Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

2012-07-09

Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

9 CFR 145.33 - Terminology and classification; flocks and products.

Code of Federal Regulations, 2010 CFR

2010-01-01

.... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

Parallel and automated library synthesis of 2-long alkyl chain benzoazoles and azole[4,5-b]pyridines under microwave irradiation.

PubMed

Martínez-Palou, Rafael; Zepeda, L Gerardo; Höpfl, Herbert; Montoya, Ascensión; Guzmán-Lucero, Diego J; Guzmán, Javier

2005-01-01

A versatile route to 40-membered library of 2-long alkyl chain substituted benzoazoles (1 and 2) and azole[4,5-b]pyridines (3 and 4) via microwave-assisted combinatorial synthesis was developed. The reactions were carried out in both monomode and multimode microwave oven. With the latter, all reactions were performed in high-throughput experimental settings consisting of an 8 x 5 combinatorial library designed to synthesize 40 compounds. Each step, from the addition of reagents to the recovery of final products, was automated. The microwave-assisted N-long chain alkylation reactions of 2-alkyl-1H-benzimidazole (1) and 2-alkyl-1H-benzimidazole[4,5-b] pyridines (3) were also studied.

Drilling Precise Orifices and Slots

NASA Technical Reports Server (NTRS)

Richards, C. W.; Seidler, J. E.

1983-01-01

Reaction control thrustor injector requires precisely machined orifices and slots. Tooling setup consists of rotary table, numerical control system and torque sensitive drill press. Components used to drill oxidizer orifices. Electric discharge machine drills fuel-feed orifices. Device automates production of identical parts so several are completed in less time than previously.

Stability of vertical magnetic chains

PubMed Central

2017-01-01

A linear stability analysis is performed for a pair of coaxial vertical chains made from permanently magnetized balls under the influence of gravity. While one chain rises from the ground, the other hangs from above, with the remaining ends separated by a gap of prescribed length. Various boundary conditions are considered, as are situations in which the magnetic dipole moments in the two chains are parallel or antiparallel. The case of a single chain attached to the ground is also discussed. The stability of the system is examined with respect to three quantities: the number of balls in each chain, the length of the gap between the chains, and a single dimensionless parameter which embodies the competition between magnetic and gravitational forces. Asymptotic scaling laws involving these parameters are provided. The Hessian matrix is computed in exact form, allowing the critical parameter values at which the system loses stability and the respective eigenmodes to be determined up to machine precision. A comparison with simple experiments for a single chain attached to the ground shows good agreement. PMID:28293135

Stability of vertical magnetic chains

NASA Astrophysics Data System (ADS)

Schönke, Johannes; Fried, Eliot

2017-02-01

A linear stability analysis is performed for a pair of coaxial vertical chains made from permanently magnetized balls under the influence of gravity. While one chain rises from the ground, the other hangs from above, with the remaining ends separated by a gap of prescribed length. Various boundary conditions are considered, as are situations in which the magnetic dipole moments in the two chains are parallel or antiparallel. The case of a single chain attached to the ground is also discussed. The stability of the system is examined with respect to three quantities: the number of balls in each chain, the length of the gap between the chains, and a single dimensionless parameter which embodies the competition between magnetic and gravitational forces. Asymptotic scaling laws involving these parameters are provided. The Hessian matrix is computed in exact form, allowing the critical parameter values at which the system loses stability and the respective eigenmodes to be determined up to machine precision. A comparison with simple experiments for a single chain attached to the ground shows good agreement.

Electrochemical micro/nano-machining: principles and practices.

PubMed

Zhan, Dongping; Han, Lianhuan; Zhang, Jie; He, Quanfeng; Tian, Zhao-Wu; Tian, Zhong-Qun

2017-03-06

Micro/nano-machining (MNM) is becoming the cutting-edge of high-tech manufacturing because of the increasing industrial demand for supersmooth surfaces and functional three-dimensional micro/nano-structures (3D-MNS) in ultra-large scale integrated circuits, microelectromechanical systems, miniaturized total analysis systems, precision optics, and so on. Taking advantage of no tool wear, no surface stress, environmental friendliness, simple operation, and low cost, electrochemical micro/nano-machining (EC-MNM) has an irreplaceable role in MNM. This comprehensive review presents the state-of-art of EC-MNM techniques for direct writing, surface planarization and polishing, and 3D-MNS fabrications. The key point of EC-MNM is to confine electrochemical reactions at the micro/nano-meter scale. This review will bring together various solutions to "confined reaction" ranging from electrochemical principles through technical characteristics to relevant applications.

Immediate hypersensitivity to moxifloxacin with tolerance to ciprofloxacin: report of three cases and review of the literature.

PubMed

Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth

2010-04-01

To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.

No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

PubMed

D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

2006-10-01

Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

Man/Machine Interaction Dynamics And Performance (MMIDAP) capability

NASA Technical Reports Server (NTRS)

Frisch, Harold P.

1991-01-01

The creation of an ability to study interaction dynamics between a machine and its human operator can be approached from a myriad of directions. The Man/Machine Interaction Dynamics and Performance (MMIDAP) project seeks to create an ability to study the consequences of machine design alternatives relative to the performance of both machine and operator. The class of machines to which this study is directed includes those that require the intelligent physical exertions of a human operator. While Goddard's Flight Telerobotic's program was expected to be a major user, basic engineering design and biomedical applications reach far beyond telerobotics. Ongoing efforts are outlined of the GSFC and its University and small business collaborators to integrate both human performance and musculoskeletal data bases with analysis capabilities necessary to enable the study of dynamic actions, reactions, and performance of coupled machine/operator systems.

Identifying Innovative Interventions to Promote Healthy Eating Using Consumption-Oriented Food Supply Chain Analysis.

PubMed

Hawkes, Corinna

2009-07-01

The mapping and analysis of supply chains is a technique increasingly used to address problems in the food system. Yet such supply chain management has not yet been applied as a means of encouraging healthier diets. Moreover, most policies recommended to promote healthy eating focus on the consumer end of the chain. This article proposes a consumption-oriented food supply chain analysis to identify the changes needed in the food supply chain to create a healthier food environment, measured in terms of food availability, prices, and marketing. Along with established forms of supply chain analysis, the method is informed by a historical overview of how food supply chains have changed over time. The method posits that the actors and actions in the chain are affected by organizational, financial, technological, and policy incentives and disincentives, which can in turn be levered for change. It presents a preliminary example of the supply of Coca-Cola beverages into school vending machines and identifies further potential applications. These include fruit and vegetable supply chains, local food chains, supply chains for health-promoting versions of food products, and identifying financial incentives in supply chains for healthier eating.

Identifying Innovative Interventions to Promote Healthy Eating Using Consumption-Oriented Food Supply Chain Analysis

PubMed Central

Hawkes, Corinna

2009-01-01

The mapping and analysis of supply chains is a technique increasingly used to address problems in the food system. Yet such supply chain management has not yet been applied as a means of encouraging healthier diets. Moreover, most policies recommended to promote healthy eating focus on the consumer end of the chain. This article proposes a consumption-oriented food supply chain analysis to identify the changes needed in the food supply chain to create a healthier food environment, measured in terms of food availability, prices, and marketing. Along with established forms of supply chain analysis, the method is informed by a historical overview of how food supply chains have changed over time. The method posits that the actors and actions in the chain are affected by organizational, financial, technological, and policy incentives and disincentives, which can in turn be levered for change. It presents a preliminary example of the supply of Coca-Cola beverages into school vending machines and identifies further potential applications. These include fruit and vegetable supply chains, local food chains, supply chains for health-promoting versions of food products, and identifying financial incentives in supply chains for healthier eating. PMID:23144674

New polymer systems: Chain extension by dianhydrides

NASA Technical Reports Server (NTRS)

Rhein, R. A.; Ingham, J. D.

1972-01-01

The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.

A possible extension to the RInChI as a means of providing machine readable process data.

PubMed

Jacob, Philipp-Maximilian; Lan, Tian; Goodman, Jonathan M; Lapkin, Alexei A

2017-04-11

The algorithmic, large-scale use and analysis of reaction databases such as Reaxys is currently hindered by the absence of widely adopted standards for publishing reaction data in machine readable formats. Crucial data such as yields of all products or stoichiometry are frequently not explicitly stated in the published papers and, hence, not reported in the database entry for those reactions, limiting their usefulness for algorithmic analysis. This paper presents a possible extension to the IUPAC RInChI standard via an auxiliary layer, termed ProcAuxInfo, which is a standardised, extensible form in which to report certain key reaction parameters such as declaration of all products and reactants as well as auxiliaries known in the reaction, reaction stoichiometry, amounts of substances used, conversion, yield and operating conditions. The standard is demonstrated via creation of the RInChI including the ProcAuxInfo layer based on three published reactions and demonstrates accurate data recoverability via reverse translation of the created strings. Implementation of this or another method of reporting process data by the publishing community would ensure that databases, such as Reaxys, would be able to abstract crucial data for big data analysis of their contents.

CADB: Conformation Angles DataBase of proteins

PubMed Central

Sheik, S. S.; Ananthalakshmi, P.; Bhargavi, G. Ramya; Sekar, K.

2003-01-01

Conformation Angles DataBase (CADB) provides an online resource to access data on conformation angles (both main-chain and side-chain) of protein structures in two data sets corresponding to 25% and 90% sequence identity between any two proteins, available in the Protein Data Bank. In addition, the database contains the necessary crystallographic parameters. The package has several flexible options and display facilities to visualize the main-chain and side-chain conformation angles for a particular amino acid residue. The package can also be used to study the interrelationship between the main-chain and side-chain conformation angles. A web based JAVA graphics interface has been deployed to display the user interested information on the client machine. The database is being updated at regular intervals and can be accessed over the World Wide Web interface at the following URL: http://144.16.71.148/cadb/. PMID:12520049

The "Origin-of-Life Reactor" and Reduction of CO2 by H2 in Inorganic Precipitates.

PubMed

Jackson, J Baz

2017-08-01

It has been suggested that inorganic membranes were forerunners of organic membranes at the origin of life. Such membranes, interposed between alkaline fluid in submarine vents and the more acidic Hadean ocean, were thought to house inorganic molecular machines. H + flowed down the pH gradient (ΔpH) from ocean to vent through the molecular machines to drive metabolic reactions for early life. A set of experiments was performed by Herschy et al. (J Mol Evol 79:213-227, 2014) who followed earlier work to construct inorganic precipitate membranes which, they argued, would be transected by a ΔpH. They supposed that inorganic molecular machines might assemble by chance in the precipitate membranes, and be capable of using the ΔpH to drive unfavourable reduction of CO 2 by H 2 to formate and formaldehyde. Indeed, these workers detected both of these compounds in their origin-of-life reaction vessel and contend this was proof of principle for their hypothesis. However, it is shown here by a straightforward calculation that the formate produced was only that which reached on approach to equilibrium without any driving force from ΔpH. We conclude that the reaction was facilitated by isotropic catalysts in the precipitate membrane but not by an anisotropic ΔpH-driven molecular machine.

Comprehensive Reactive Receiver Modeling for Diffusive Molecular Communication Systems: Reversible Binding, Molecule Degradation, and Finite Number of Receptors.

PubMed

Ahmadzadeh, Arman; Arjmandi, Hamidreza; Burkovski, Andreas; Schober, Robert

2016-10-01

This paper studies the problem of receiver modeling in molecular communication systems. We consider the diffusive molecular communication channel between a transmitter nano-machine and a receiver nano-machine in a fluid environment. The information molecules released by the transmitter nano-machine into the environment can degrade in the channel via a first-order degradation reaction and those that reach the receiver nano-machine can participate in a reversible bimolecular reaction with receiver receptor proteins. Thereby, we distinguish between two scenarios. In the first scenario, we assume that the entire surface of the receiver is covered by receptor molecules. We derive a closed-form analytical expression for the expected received signal at the receiver, i.e., the expected number of activated receptors on the surface of the receiver. Then, in the second scenario, we consider the case where the number of receptor molecules is finite and the uniformly distributed receptor molecules cover the receiver surface only partially. We show that the expected received signal for this scenario can be accurately approximated by the expected received signal for the first scenario after appropriately modifying the forward reaction rate constant. The accuracy of the derived analytical results is verified by Brownian motion particle-based simulations of the considered environment, where we also show the impact of the effect of receptor occupancy on the derived analytical results.

Machine learning-based coreference resolution of concepts in clinical documents

PubMed Central

Ware, Henry; Mullett, Charles J; El-Rawas, Oussama

2012-01-01

Objective Coreference resolution of concepts, although a very active area in the natural language processing community, has not yet been widely applied to clinical documents. Accordingly, the 2011 i2b2 competition focusing on this area is a timely and useful challenge. The objective of this research was to collate coreferent chains of concepts from a corpus of clinical documents. These concepts are in the categories of person, problems, treatments, and tests. Design A machine learning approach based on graphical models was employed to cluster coreferent concepts. Features selected were divided into domain independent and domain specific sets. Training was done with the i2b2 provided training set of 489 documents with 6949 chains. Testing was done on 322 documents. Results The learning engine, using the un-weighted average of three different measurement schemes, resulted in an F measure of 0.8423 where no domain specific features were included and 0.8483 where the feature set included both domain independent and domain specific features. Conclusion Our machine learning approach is a promising solution for recognizing coreferent concepts, which in turn is useful for practical applications such as the assembly of problem and medication lists from clinical documents. PMID:22582205

Stereodivergent synthesis with a programmable molecular machine

NASA Astrophysics Data System (ADS)

Kassem, Salma; Lee, Alan T. L.; Leigh, David A.; Marcos, Vanesa; Palmer, Leoni I.; Pisano, Simone

2017-09-01

It has been convincingly argued that molecular machines that manipulate individual atoms, or highly reactive clusters of atoms, with Ångström precision are unlikely to be realized. However, biological molecular machines routinely position rather less reactive substrates in order to direct chemical reaction sequences, from sequence-specific synthesis by the ribosome to polyketide synthases, where tethered molecules are passed from active site to active site in multi-enzyme complexes. Artificial molecular machines have been developed for tasks that include sequence-specific oligomer synthesis and the switching of product chirality, a photo-responsive host molecule has been described that is able to mechanically twist a bound molecular guest, and molecular fragments have been selectively transported in either direction between sites on a molecular platform through a ratchet mechanism. Here we detail an artificial molecular machine that moves a substrate between different activating sites to achieve different product outcomes from chemical synthesis. This molecular robot can be programmed to stereoselectively produce, in a sequential one-pot operation, an excess of any one of four possible diastereoisomers from the addition of a thiol and an alkene to an α,β-unsaturated aldehyde in a tandem reaction process. The stereodivergent synthesis includes diastereoisomers that cannot be selectively synthesized through conventional iminium-enamine organocatalysis. We anticipate that future generations of programmable molecular machines may have significant roles in chemical synthesis and molecular manufacturing.

Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

PubMed

Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

2014-07-24

This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

Sleeve reaction chamber system

DOEpatents

Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

2009-08-25

A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

PubMed

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

USDA-ARS?s Scientific Manuscript database

Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

DOEpatents

Wigner, E.P.; Weinberg, A.M.

1961-01-24

A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

EPA Science Inventory

This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

ERIC Educational Resources Information Center

Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

2006-01-01

We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

PubMed

Adewale, B; Mafe, M A; Oyerinde, J P O

2005-01-01

Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

PubMed

Ragheb, Suzan Mohammed; Jimenez, Luis

Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

[The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

PubMed

Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

2014-04-01

The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

PubMed Central

Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

2014-01-01

A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

Device and method for producing a containment barrier underneath and around in-situ buried waste

DOEpatents

Gardner, B.M.; Smith, A.M.; Hanson, R.W.; Hodges, R.T.

1998-08-11

An apparatus is described for building a horizontal underground barrier by cutting through soil and depositing a slurry, preferably on which cures into a hardened material. The apparatus includes a digging means for cutting and removing soil to create a void under the surface of the ground and injection means for inserting barrier-forming material into the void. In one embodiment, the digging means is a continuous cutting chain. Mounted on the continuous cutting chain are cutter teeth for cutting through soil and discharge paddles for removing the loosened soil. This invention includes a barrier placement machine, a method for building an underground horizontal containment barrier using the barrier placement machine, and the underground containment system. Preferably the underground containment barrier goes underneath and around the site to be contained in a bathtub-type containment. 15 figs.

Underground barrier construction apparatus with soil-retaining shield

DOEpatents

Gardner, B.M.; Smith, A.M.; Hanson, R.W.; Hodges, R.T.

1998-08-04

An apparatus is described for building a horizontal underground barrier by cutting through soil and depositing a slurry, preferably one which cures into a hardened material. The apparatus includes a digging means for cutting and removing soil to create a void under the surface of the ground, a shield means for maintaining the void, and injection means for inserting barrier-forming material into the void. In one embodiment, the digging means is a continuous cutting chain. Mounted on the continuous cutting chain are cutter teeth for cutting through soil and discharge paddles for removing the loosened soil. This invention includes a barrier placement machine, a method for building an underground horizontal containment barrier using the barrier placement machine, and the underground containment system. Preferably the underground containment barrier goes underneath and around the site to be contained in a bathtub-type containment. 17 figs.

Mining machine with adjustable jib

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hart, D.

1987-05-26

A mining machine is described having a pair of crawler tracks, a means for individually driving each of the crawler tracks, a frame mounted on the crawler tracks, an elongated jib carrying a sprocket at each end, an endless cutting chain supported on the sprockets, cutters and loading flights mounted on the endless cutting chain, and means on the frame supporting the elongated jib. The means support the elongated jib consisting of a bridge on the frame, at least one scissors linkage pivotally mounted on the bridge, and arm having a first end attached to the scissors linkage, a frontmore » plate mounted on the second end of the arm and means adjustably mounting the elongated jib on the front plate. The means adjustably mount the elongated jib on the front plate including a first means for rotating the elongated jib between a vertical position and a horizontal position.« less

Safety of medium-chain triglycerides used as an intraocular tamponading agent in an experimental vitrectomy model rabbit.

PubMed

Auriol, Sylvain; Mahieu, Laurence; Brousset, Pierre; Malecaze, François; Mathis, Véronique

2013-01-01

To evaluate safety of medium-chain triglycerides used as a possible intraocular tamponading agent. A 20-gauge pars plana vitrectomy was performed in the right eye of 28 rabbits. An ophthalmologic examination was performed every week until rabbits were killed. At days 7, 30, 60, and 90, rabbits were killed and the treated eyes were examined macroscopically and prepared for histologic examination. Principal outcome was retinal toxicity evaluated by light and electron microscopy, and secondary outcomes were the presence of medium-chain triglyceride emulsification, inflammatory reactions, and the development of cataract. Histologic examination did not reveal any retinal toxicity. Two cases of moderate emulsification were observed, but in these cases, emulsification was caused by the perioperative injection of the agent and did not increase during the postoperative period. We noted 13 cases of inflammatory reaction in vitreous cavity and no case of inflammatory reaction in anterior chamber. Two eyes developed cataract as a result of perioperative trauma to the lens with the vitreous cutter and not secondary to the presence of medium-chain triglycerides in the vitreous cavity. Medium-chain triglycerides did not induce morphologic evidence of retinal toxicity. The results suggest that medium-chain triglycerides could be a promising alternative intraocular tamponading agent for the treatment of retinal detachments.

Neutron-deficient superheavy nuclei obtained in the 240Pu+48Ca reaction

NASA Astrophysics Data System (ADS)

Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu. Ts.; Rykaczewski, K. P.; Abdullin, F. Sh.; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu. S.; Voinov, A. A.; Subbotin, V. G.; Sukhov, A. M.; Karpov, A. V.; Popeko, A. G.; Sabel'nikov, A. V.; Svirikhin, A. I.; Vostokin, G. K.; Hamilton, J. H.; Kovrizhnykh, N. D.; Schlattauer, L.; Stoyer, M. A.; Gan, Z.; Huang, W. X.; Ma, L.

2018-01-01

We present new results from investigations of the 240Pu+48Ca reaction at a projectile energy of 250 MeV. Three new decay chains of 285Fl were detected with decay properties mostly consistent with those measured in earlier studies. An additional chain was observed where the nuclei may decay through energy levels different from those of the other six chains registered so far. The cross section of the 240Pu(48Ca,3 n )285Fl reaction was measured to be 0 .58-0.33+0.60pb , which is a factor of about 4-5 lower than that measured in the previous experiment at 245 MeV beam energy [V. K. Utyonkov et al., Phys. Rev. C 92, 034609 (2015)., 10.1103/PhysRevC.92.034609], consistent with expectations. The origin of an additional chain consisting of a recoil, α particle, and fission event is analyzed. The assignment of 25 short-lived SF events observed in this experiment is also discussed.

Autocatalytic formation of an iron(IV)-oxo complex via scandium ion-promoted radical chain autoxidation of an iron(II) complex with dioxygen and tetraphenylborate.

PubMed

Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi

2014-06-04

A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.

Agent Regeneration and Hazardous Waste Minimization and Teaching Note. IBM Case Study. Doc #93-1.

ERIC Educational Resources Information Center

Oliker, L. Richard; And Others

The manufacturing process used to produce printbands for International Business Machines, Inc. involves a photolithographic process in which the stainless steel panels are chemically machined using strong ferric chloride etching solution containing hydrochloric acid. The waste material that results from this chemical reaction is a solution…

Machine Translation in the German Classroom: Detection, Reaction, Prevention

ERIC Educational Resources Information Center

Steding, Soren

2009-01-01

There are many websites today that offer free machine translations and although beginning students of German are not always proficient enough to judge the quality of these translations or to fully understand certain translation results, they use these services nonetheless for their assignments. The problem for the educator is to distinguish…

Research on the Relationship between Reaction Ability and Mental State for Online Assessment of Driving Fatigue.

PubMed

Guo, Mengzhu; Li, Shiwu; Wang, Linhong; Chai, Meng; Chen, Facheng; Wei, Yunong

2016-11-24

Background: Driving fatigue affects the reaction ability of a driver. The aim of this research is to analyze the relationship between driving fatigue, physiological signals and driver's reaction time. Methods: Twenty subjects were tested during driving. Data pertaining to reaction time and physiological signals including electroencephalograph (EEG) were collected from twenty simulation experiments. Grey correlation analysis was used to select the input variable of the classification model. A support vector machine was used to divide the mental state into three levels. The penalty factor for the model was optimized using a genetic algorithm. Results: The results show that α/β has the greatest correlation to reaction time. The classification results show an accuracy of 86%, a sensitivity of 87.5% and a specificity of 85.53%. The average increase of reaction time is 16.72% from alert state to fatigued state. Females have a faster decrease in reaction ability than males as driving fatigue accumulates. Elderly drivers have longer reaction times than the young. Conclusions: A grey correlation analysis can be used to improve the classification accuracy of the support vector machine (SVM) model. This paper provides basic research that online detection of fatigue can be performed using only a simple device, which is more comfortable for users.

Research on the Relationship between Reaction Ability and Mental State for Online Assessment of Driving Fatigue

PubMed Central

Guo, Mengzhu; Li, Shiwu; Wang, Linhong; Chai, Meng; Chen, Facheng; Wei, Yunong

2016-01-01

Background: Driving fatigue affects the reaction ability of a driver. The aim of this research is to analyze the relationship between driving fatigue, physiological signals and driver’s reaction time. Methods: Twenty subjects were tested during driving. Data pertaining to reaction time and physiological signals including electroencephalograph (EEG) were collected from twenty simulation experiments. Grey correlation analysis was used to select the input variable of the classification model. A support vector machine was used to divide the mental state into three levels. The penalty factor for the model was optimized using a genetic algorithm. Results: The results show that α/β has the greatest correlation to reaction time. The classification results show an accuracy of 86%, a sensitivity of 87.5% and a specificity of 85.53%. The average increase of reaction time is 16.72% from alert state to fatigued state. Females have a faster decrease in reaction ability than males as driving fatigue accumulates. Elderly drivers have longer reaction times than the young. Conclusions: A grey correlation analysis can be used to improve the classification accuracy of the support vector machine (SVM) model. This paper provides basic research that online detection of fatigue can be performed using only a simple device, which is more comfortable for users. PMID:27886139

Terminal alkenes as versatile chemical reporter groups for metabolic oligosaccharide engineering.

PubMed

Späte, Anne-Katrin; Schart, Verena F; Schöllkopf, Sophie; Niederwieser, Andrea; Wittmann, Valentin

2014-12-08

The Diels-Alder reaction with inverse electron demand (DAinv reaction) of 1,2,4,5-tetrazines with electron rich or strained alkenes was proven to be a bioorthogonal ligation reaction that proceeds fast and with high yields. An important application of the DAinv reaction is metabolic oligosaccharide engineering (MOE) which allows the visualization of glycoconjugates in living cells. In this approach, a sugar derivative bearing a chemical reporter group is metabolically incorporated into cellular glycoconjugates and subsequently derivatized with a probe by means of a bioorthogonal ligation reaction. Here, we investigated a series of new mannosamine and glucosamine derivatives with carbamate-linked side chains of varying length terminated by alkene groups and their suitability for labeling cell-surface glycans. Kinetic investigations showed that the reactivity of the alkenes in DAinv reactions increases with growing chain length. When applied to MOE, one of the compounds, peracetylated N-butenyloxycarbonylmannosamine, was especially well suited for labeling cell-surface glycans. Obviously, the length of its side chain represents the optimal balance between incorporation efficiency and speed of the labeling reaction. Sialidase treatment of the cells before the bioorthogonal labeling reaction showed that this sugar derivative is attached to the glycans in form of the corresponding sialic acid derivative and not epimerized to another hexosamine derivative to a considerable extent. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Card-based age control mechanisms at tobacco vending machines. Effect and consequences].

PubMed

Schneider, S; Meyer, C; Löber, S; Röhrig, S; Solle, D

2010-02-01

Until recently, 700,000 tobacco vending machines provided uncontrolled access to cigarettes for children and adolescents in Germany. On January 1, 2007, a card-based electronic locking device was attached to all tobacco vending machines to prevent the purchase of cigarettes by children and adolescents under 16. Starting in 2009, only persons older than 18 are able to buy cigarettes from tobacco vending machines. The aim of the present investigation (SToP Study: "Sources of Tobacco for Pupils" Study) was to assess changes in the number of tobacco vending machines after the introduction of these new technical devices (supplier's reaction). In addition, the ways smoking adolescents make purchases were assessed (consumer's reaction). We registered and mapped the total number of tobacco points of sale (tobacco POS) before and after the introduction of the card-based electronic locking device in two selected districts of the city of Cologne. Furthermore, pupils from local schools (response rate: 83%) were asked about their tobacco consumption and ways of purchase using a questionnaire. Results indicated that in the area investigated the total number of tobacco POSs decreased from 315 in 2005 to 277 in 2007. The rates of decrease were 48% for outdoor vending machines and 8% for indoor vending machines. Adolescents reported circumventing the card-based electronic locking devices (e.g., by using cards from older friends) and using other tobacco POSs (especially newspaper kiosks) or relying on their social network (mainly friends). The decreasing number of tobacco vending machines has not had a significant impact on cigarette acquisition by adolescent smokers as they tend to circumvent the newly introduced security measures.

An experimental and modeling study of the autoignition of 3-methylheptane

DOE PAGES

Wang, Weijing; Li, Zhenhua; Oehlschlaeger, Matthew A.; ...

2013-01-01

An experimental and kinetic modeling study of the autoignition of 3-methylheptane, a compound representative of the high molecular weight lightly branched alkanes found in large quantities in conventional and synthetic aviation kerosene and diesel fuels, is reported. Shock tube and rapid compression machine ignition delay time measurements are reported over a wide range of conditions of relevance to combustion engine applications: temperatures from 678 to 1356 K; pressures of 6.5, 10, 20, and 50 atm; and equivalence ratios of 0.5, 1.0, and 2.0. The wide range of temperatures examined provides observation of autoignition in three reactivity regimes, including the negativemore » temperature coefficient (NTC) regime characteristic of paraffinic fuels. Comparisons made between the current ignition delay measurements for 3-methylheptane and previous results for n-octane and 2-methylheptane quantifies the influence of a single methyl substitution and its location on the reactivity of alkanes. It is found that the three C8 alkane isomers have indistinguishable high-temperature ignition delay but their ignition delay times deviate in the NTC and low-temperature regimes in correlation with their research octane numbers. The experimental results are compared with the predictions of a proposed kinetic model that includes both high- and low-temperature oxidation chemistry. The model mechanistically explains the differences in reactivity for n-octane, 2-methylheptane, and 3-methylheptane in the NTC through the influence of the methyl substitution on the rates of isomerization reactions in the low-temperature chain branching pathway, that ultimately leads to ketohydroperoxide species, and the competition between low-temperature chain branching and the formation of cyclic ethers, in a chain propagating pathway.« less

Optimising the laboratory supply chain: The key to effective laboratory services

PubMed Central

Williams, Jason; Smith, Peter; Kuritsky, Joel

2014-01-01

Background The Supply Chain Management System (SCMS) is a contract managed under the Partnership for Supply Chain Management (PFSCM) consortium by the United States Agency for International Development (USAID). SCMS procures commodities for programmes supported by the US President’s Emergency Plan for AIDS Relief (PEPFAR). From 2005 to mid-2012, PEPFAR, through SCMS, spent approximately $384 million on non-pharmaceutical commodities. Of this, an estimated $90m was used to purchase flow cytometry technology, largely for flow cytometry platforms and reagents. Objectives The purpose of this paper is to highlight the cost differences between low, medium and high utilisation rates of common CD4 testing instruments that have been procured though PEPFAR funding. Method A scale of costs per test as a function of test volume through the machine was calculated for the two most common CD4 testing machines used in HIV programmes: Becton Dickinson (BD) FACSCount™ and BD FACSCalibur™. Instrument utilisation data collected at the facility level in three selected countries were then used to calculate the onsite cost-per-test experienced in each country. Results Cost analyses indicated that a target of at least 40% utilisation for FACSCount™ and 15% utilisation for FACSCalibur™, respectively, closely approach maximal per-test cost efficiency. The average utilisation rate for CD4 testing instruments varies widely by country, level of laboratory and partner (0% − 68%). Conclusion Our analysis indicates that, because cost-per-test is related inversely to sample throughput, the underutilisation of flow cytometry machines is resulting in an increase in average cost-per-test for many instruments. PMID:29043175

Optimization of Gas Composition Used in Plasma Chemical Vaporization Machining for Figuring of Reaction-Sintered Silicon Carbide with Low Surface Roughness.

PubMed

Sun, Rongyan; Yang, Xu; Ohkubo, Yuji; Endo, Katsuyoshi; Yamamura, Kazuya

2018-02-05

In recent years, reaction-sintered silicon carbide (RS-SiC) has been of interest in many engineering fields because of its excellent properties, such as its light weight, high rigidity, high heat conductance and low coefficient of thermal expansion. However, RS-SiC is difficult to machine owing to its high hardness and chemical inertness and because it contains multiple components. To overcome the problem of the poor machinability of RS-SiC in conventional machining, the application of atmospheric-pressure plasma chemical vaporization machining (AP-PCVM) to RS-SiC was proposed. As a highly efficient and damage-free figuring technique, AP-PCVM has been widely applied for the figuring of single-component materials, such as Si, SiC, quartz crystal wafers, and so forth. However, it has not been applied to RS-SiC since it is composed of multiple components. In this study, we investigated the AP-PCVM etching characteristics for RS-SiC by optimizing the gas composition. It was found that the different etching rates of the different components led to a large surface roughness. A smooth surface was obtained by applying the optimum gas composition, for which the etching rate of the Si component was equal to that of the SiC component.

Method for polymer synthesis in a reaction well

DOEpatents

Brennan, Thomas M.

1998-01-01

A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

Method for polymer synthesis in a reaction well

DOEpatents

Brennan, T.M.

1998-09-29

A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

Machine-learning-assisted materials discovery using failed experiments

NASA Astrophysics Data System (ADS)

Raccuglia, Paul; Elbert, Katherine C.; Adler, Philip D. F.; Falk, Casey; Wenny, Malia B.; Mollo, Aurelio; Zeller, Matthias; Friedler, Sorelle A.; Schrier, Joshua; Norquist, Alexander J.

2016-05-01

Inorganic-organic hybrid materials such as organically templated metal oxides, metal-organic frameworks (MOFs) and organohalide perovskites have been studied for decades, and hydrothermal and (non-aqueous) solvothermal syntheses have produced thousands of new materials that collectively contain nearly all the metals in the periodic table. Nevertheless, the formation of these compounds is not fully understood, and development of new compounds relies primarily on exploratory syntheses. Simulation- and data-driven approaches (promoted by efforts such as the Materials Genome Initiative) provide an alternative to experimental trial-and-error. Three major strategies are: simulation-based predictions of physical properties (for example, charge mobility, photovoltaic properties, gas adsorption capacity or lithium-ion intercalation) to identify promising target candidates for synthetic efforts; determination of the structure-property relationship from large bodies of experimental data, enabled by integration with high-throughput synthesis and measurement tools; and clustering on the basis of similar crystallographic structure (for example, zeolite structure classification or gas adsorption properties). Here we demonstrate an alternative approach that uses machine-learning algorithms trained on reaction data to predict reaction outcomes for the crystallization of templated vanadium selenites. We used information on ‘dark’ reactions—failed or unsuccessful hydrothermal syntheses—collected from archived laboratory notebooks from our laboratory, and added physicochemical property descriptions to the raw notebook information using cheminformatics techniques. We used the resulting data to train a machine-learning model to predict reaction success. When carrying out hydrothermal synthesis experiments using previously untested, commercially available organic building blocks, our machine-learning model outperformed traditional human strategies, and successfully predicted conditions for new organically templated inorganic product formation with a success rate of 89 per cent. Inverting the machine-learning model reveals new hypotheses regarding the conditions for successful product formation.

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

PubMed Central

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

Treesearch

David E. Schreiber; Karen J. Garner; James M. Slavicek

1997-01-01

Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

Probing light chain mutation effects on thrombin via molecular dynamics simulations and machine learning.

PubMed

Xiao, Jiajie; Melvin, Ryan L; Salsbury, Freddie R

2018-03-02

Thrombin is a key component for chemotherapeutic and antithrombotic therapy development. As the physiologic and pathologic roles of the light chain still remain vague, here, we continue previous efforts to understand the impacts of the disease-associated single deletion of LYS9 in the light chain. By combining supervised and unsupervised machine learning methodologies and more traditional structural analyses on data from 10 μs molecular dynamics simulations, we show that the conformational ensemble of the ΔK9 mutant is significantly perturbed. Our analyses consistently indicate that LYS9 deletion destabilizes both the catalytic cleft and regulatory functional regions and result in some conformational changes that occur in tens to hundreds of nanosecond scaled motions. We also reveal that the two forms of thrombin each prefer a distinct binding mode of a Na + ion. We expand our understanding of previous experimental observations and shed light on the mechanisms of the LYS9 deletion associated bleeding disorder by providing consistent but more quantitative and detailed structural analyses than early studies in literature. With a novel application of supervised learning, i.e. the decision tree learning on the hydrogen bonding features in the wild-type and ΔK9 mutant forms of thrombin, we predict that seven pairs of critical hydrogen bonding interactions are significant for establishing distinct behaviors of wild-type thrombin and its ΔK9 mutant form. Our calculations indicate the LYS9 in the light chain has both localized and long-range allosteric effects on thrombin, supporting the opinion that light chain has an important role as an allosteric effector.

BEST: Improved Prediction of B-Cell Epitopes from Antigen Sequences

PubMed Central

Gao, Jianzhao; Faraggi, Eshel; Zhou, Yaoqi; Ruan, Jishou; Kurgan, Lukasz

2012-01-01

Accurate identification of immunogenic regions in a given antigen chain is a difficult and actively pursued problem. Although accurate predictors for T-cell epitopes are already in place, the prediction of the B-cell epitopes requires further research. We overview the available approaches for the prediction of B-cell epitopes and propose a novel and accurate sequence-based solution. Our BEST (B-cell Epitope prediction using Support vector machine Tool) method predicts epitopes from antigen sequences, in contrast to some method that predict only from short sequence fragments, using a new architecture based on averaging selected scores generated from sliding 20-mers by a Support Vector Machine (SVM). The SVM predictor utilizes a comprehensive and custom designed set of inputs generated by combining information derived from the chain, sequence conservation, similarity to known (training) epitopes, and predicted secondary structure and relative solvent accessibility. Empirical evaluation on benchmark datasets demonstrates that BEST outperforms several modern sequence-based B-cell epitope predictors including ABCPred, method by Chen et al. (2007), BCPred, COBEpro, BayesB, and CBTOPE, when considering the predictions from antigen chains and from the chain fragments. Our method obtains a cross-validated area under the receiver operating characteristic curve (AUC) for the fragment-based prediction at 0.81 and 0.85, depending on the dataset. The AUCs of BEST on the benchmark sets of full antigen chains equal 0.57 and 0.6, which is significantly and slightly better than the next best method we tested. We also present case studies to contrast the propensity profiles generated by BEST and several other methods. PMID:22761950

The Beta-Delayed Proton and Gamma Decay of 27P for Nuclear Astrophysics

NASA Astrophysics Data System (ADS)

McCleskey, E.; Banu, A.; McCleskey, M.; Roeder, B.; Saastamoinen, A.; Spiridon, A.; Trache, L.; Tribble, R. E.; Davinson, T.; Doherty, D.; Lotay, G. J.; Wallace, J.; Woods, P. J.

2013-10-01

The main creation site of 26Al is currently under debate. The reactions for its creation or destruction are also not completely known. When 26Al is created in novae, the reaction chain is: 24Mg(p,γ)25Al(β + v)25Mg(p,γ)26Al, but this chain can be by-passed by another chain: 25Al(p,γ)26Si(p,γ)27P and it can also be destroyed directly. Another way to by-pass it is through 26mAl(p,γ)27Si* which is dominated by resonant capture. Using the Momentum Achromat Recoil Spectrometer (MARS) at the Texas A&M Cyclotron Institute and inverse kinematics, this destruction reaction was studied by the beta-delayed proton and gamma decay of 27P. Due to selection rules, states populated above the proton threshold in the compound system (27Si*) can decay to 26mAl, which are the states of interest for the capture reaction. James Madison University, VA, USA.

Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen

NASA Astrophysics Data System (ADS)

Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.

2017-12-01

The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.

X-ray characterization of short-pulse laser illuminated hydrogen storage alloys having very high performance

NASA Astrophysics Data System (ADS)

Daido, Hiroyuki; Abe, Hiroshi; Shobu, Takahisa; Shimomura, Takuya; Tokuhira, Shinnosuke; Takenaka, Yusuke; Furuyama, Takehiro; Nishimura, Akihiko; Uchida, Hirohisa; Ohshima, Takeshi

2015-09-01

Hydrogen storage alloys become more and more important in the fields of electric energy production and stage and automobiles such as Ni-MH batteries. The vacancies introduced in hydrogen absorption alloy by charged particle beams were found to be positive effect on the increase in the initial hydrogen absorption reaction rate in the previous study. The initial reaction rates of hydrogen absorption and desorption of the alloy are one of the important performances to be improved. Here, we report on the characterization of the hydrogen absorption reaction rate directly illuminated by a femtosecond and nanosecond lasers instead of particle beam machines. A laser illuminates the whole surface sequentially on a tip of a few cm square LaNi4.6Al0.4 alloy resulting in significant improvement in the hydrogen absorption reaction rate. For characterization of the surface layer, we perform an x-ray diffraction experiment using a monochromatized intense x-ray beam from SPring-8 synchrotoron machine.

Programming and machining of complex parts based on CATIA solid modeling

NASA Astrophysics Data System (ADS)

Zhu, Xiurong

2017-09-01

The complex parts of the use of CATIA solid modeling programming and simulation processing design, elaborated in the field of CNC machining, programming and the importance of processing technology. In parts of the design process, first make a deep analysis on the principle, and then the size of the design, the size of each chain, connected to each other. After the use of backstepping and a variety of methods to calculate the final size of the parts. In the selection of parts materials, careful study, repeated testing, the final choice of 6061 aluminum alloy. According to the actual situation of the processing site, it is necessary to make a comprehensive consideration of various factors in the machining process. The simulation process should be based on the actual processing, not only pay attention to shape. It can be used as reference for machining.

Additional chain-branching pathways in the low-temperature oxidation of branched alkanes

DOE PAGES

Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; ...

2015-12-31

Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C 8H 14O 4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C 8H 16O 5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C 8H 16O 5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O 2 addition, intramolecular isomerization, and OH release; C 8H 14O 4 species are proposed to result from subsequent reactions of C 8H 16O 5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less

An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

PubMed Central

Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

2005-01-01

Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

Blood grouping based on PCR methods and agarose gel electrophoresis.

PubMed

Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

2015-01-01

The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

Excitation wavelength dependence of excited state intramolecular proton transfer reaction of 4'-N,N-diethylamino-3-hydroxyflavone in room temperature ionic liquids studied by optical Kerr gate fluorescence measurement.

PubMed

Suda, Kayo; Terazima, Masahide; Sato, Hirofumi; Kimura, Yoshifumi

2013-10-17

Excited state intramolecular proton transfer reactions (ESIPT) of 4'-N,N-diethylamino-3-hydroxyflavone (DEAHF) in ionic liquids have been studied by steady-state and time-resolved fluorescence measurements at different excitation wavelengths. Steady-state measurements show the relative yield of the tautomeric form to the normal form of DEAHF decreases as excitation wavelength is increased from 380 to 450 nm. The decrease in yield is significant in ionic liquids that have cations with long alkyl chains. The extent of the decrease is correlated with the number of carbon atoms in the alkyl chains. Time-resolved fluorescence measurements using optical Kerr gate spectroscopy show that ESIPT rate has a strong excitation wavelength dependence. There is a large difference between the spectra at a 200 ps delay from different excitation wavelengths in each ionic liquid. The difference is pronounced in ionic liquids having a long alkyl chain. The equilibrium constant in the electronic excited state obtained at a 200 ps delay and the average reaction rate are also correlated with the alkyl chain length. Considering the results of the steady-state fluorescence and time-resolved measurements, the excitation wavelength dependence of ESIPT is explained by state selective excitation due to the difference of the solvation, and the number of alkyl chain carbon atoms is found to be a good indicator of the effect of inhomogeneity for this reaction.

On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

NASA Astrophysics Data System (ADS)

Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

2015-07-01

Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

29 CFR 1910.255 - Resistance welding.

Code of Federal Regulations, 2012 CFR

2012-07-01

..., the secondary of all welding transformers used in multispot, projection and seam welding machines... counterbalancing impractical or unnecessary. (2) Safety chains. All portable welding guns, transformers and related...) Grounding. The secondary and case of all portable welding transformers shall be grounded. Secondary...

29 CFR 1910.255 - Resistance welding.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., the secondary of all welding transformers used in multispot, projection and seam welding machines... counterbalancing impractical or unnecessary. (2) Safety chains. All portable welding guns, transformers and related...) Grounding. The secondary and case of all portable welding transformers shall be grounded. Secondary...

29 CFR 1910.255 - Resistance welding.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., the secondary of all welding transformers used in multispot, projection and seam welding machines... counterbalancing impractical or unnecessary. (2) Safety chains. All portable welding guns, transformers and related...) Grounding. The secondary and case of all portable welding transformers shall be grounded. Secondary...

29 CFR 1910.255 - Resistance welding.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., the secondary of all welding transformers used in multispot, projection and seam welding machines... counterbalancing impractical or unnecessary. (2) Safety chains. All portable welding guns, transformers and related...) Grounding. The secondary and case of all portable welding transformers shall be grounded. Secondary...

29 CFR 1910.255 - Resistance welding.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., the secondary of all welding transformers used in multispot, projection and seam welding machines... counterbalancing impractical or unnecessary. (2) Safety chains. All portable welding guns, transformers and related...) Grounding. The secondary and case of all portable welding transformers shall be grounded. Secondary...

30 CFR 75.1719-1 - Illumination in working places.

Code of Federal Regulations, 2013 CFR

2013-07-01

... machine by cables, ropes, or chains. (c) The lighting prescribed in this section shall be in addition to... between the gob-side of the travelway and the side of the block of coal from which coal is being extracted...

30 CFR 75.1719-1 - Illumination in working places.

Code of Federal Regulations, 2014 CFR

2014-07-01

... machine by cables, ropes, or chains. (c) The lighting prescribed in this section shall be in addition to... between the gob-side of the travelway and the side of the block of coal from which coal is being extracted...

30 CFR 75.1719-1 - Illumination in working places.

Code of Federal Regulations, 2012 CFR

2012-07-01

... machine by cables, ropes, or chains. (c) The lighting prescribed in this section shall be in addition to... between the gob-side of the travelway and the side of the block of coal from which coal is being extracted...

A Bullet-Block Experiment that Explains the Chain Fountain

NASA Astrophysics Data System (ADS)

Pantaleone, J.; Smith, R.

2018-05-01

It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.

Current problems in the dynamics and design of mechanisms and machines

NASA Astrophysics Data System (ADS)

Kestel'Man, V. N.

The papers contained in this volume deal with possible ways of improving the dynamic and structural properties of machines and mechanisms and also with problems associated with the design of aircraft equipment. Topics discussed include estimation of the stressed state of a model of an orbital film structure, a study of the operation of an aerodynamic angle transducer in flow of a hot gas, calculation of the efficiency of aircraft gear drives, and dynamic accuracy of a controlled manipulator. Papers are also presented on optimal synthesis of mechanical systems with variable properties, synthesis of mechanisms using initial kinematic chains, and using shape memory materials in the design of machines and mechanisms. (For individual items see A93-31202 to A93-31214)

Radiolysis of N-acetyl amino acids as model compounds for radiation degradation of polypeptides

NASA Astrophysics Data System (ADS)

Wayne Garrett, R.; Hill, David J. T.; Ho, Sook-Ying; O'Donnell, James H.; O'Sullivan, Paul W.; Pomery, Peter J.

Radiation chemical yields of (i) the volatile radiolysis products and (ii) the trapped free radicals from the y-radiolysis of the N-acetyl derivatives of glycine, L-valine, L-phenylalanine and L-tyrosine in the polycrystalline state have been determined at room temperature (303 K). Carbon dioxide was found to be the major molecular product for all these compounds with G(CO 2) varying from 0.36 for N-acetyl-L-tyrosine to 8 for N-acetyl-L-valine. There was evidence for some scission of the N-C α bond, indicated by the production of acetamide and the corresponding aliphatic acid, but the determination reaction was found to be of much lesser importance than the decarboxylation reaction. A protective effect of the aromatic ring in N-acetyl-L-phenylalanine and in N-acetyl-L-tyrosine was indicated by the lower yields of volatile products for these compounds. The yields of trapped free radicals were found to vary with the nature of the amino acid side chain, increasing with chain length and chain branching. The radical yields were decreased by incorporation of an aromatic moiety in the side chain, this effect being greater for the tyrosyl side chain than for the phenyl side chain. The G(R·) values showed a good correlation with G(CO 2) indicating that a common reaction may be involved in radical production and carbon dioxide formation.

Running accuracy analysis of a 3-RRR parallel kinematic machine considering the deformations of the links

NASA Astrophysics Data System (ADS)

Wang, Liping; Jiang, Yao; Li, Tiemin

2014-09-01

Parallel kinematic machines have drawn considerable attention and have been widely used in some special fields. However, high precision is still one of the challenges when they are used for advanced machine tools. One of the main reasons is that the kinematic chains of parallel kinematic machines are composed of elongated links that can easily suffer deformations, especially at high speeds and under heavy loads. A 3-RRR parallel kinematic machine is taken as a study object for investigating its accuracy with the consideration of the deformations of its links during the motion process. Based on the dynamic model constructed by the Newton-Euler method, all the inertia loads and constraint forces of the links are computed and their deformations are derived. Then the kinematic errors of the machine are derived with the consideration of the deformations of the links. Through further derivation, the accuracy of the machine is given in a simple explicit expression, which will be helpful to increase the calculating speed. The accuracy of this machine when following a selected circle path is simulated. The influences of magnitude of the maximum acceleration and external loads on the running accuracy of the machine are investigated. The results show that the external loads will deteriorate the accuracy of the machine tremendously when their direction coincides with the direction of the worst stiffness of the machine. The proposed method provides a solution for predicting the running accuracy of the parallel kinematic machines and can also be used in their design optimization as well as selection of suitable running parameters.

Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

EPA Science Inventory

The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

Highly efficient preparation of selectively isotope cluster-labeled long chain fatty acids via two consecutive C(sp3)-C(sp3) cross-coupling reactions.

PubMed

Lethu, Sébastien; Matsuoka, Shigeru; Murata, Michio

2014-02-07

An efficient synthesis involving two copper-catalyzed alkyl-alkyl coupling reactions has been designed to easily access doubly isotope-labeled fatty acids. Such NMR- and IR-active compounds were obtained in excellent overall yields and will be further used for determining the conformation of an alkyl chain of lipidic biomolecules upon interaction with proteins.

Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

USDA-ARS?s Scientific Manuscript database

This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

Atwood's machine as a tool to introduce variable mass systems

NASA Astrophysics Data System (ADS)

de Sousa, Célia A.

2012-03-01

This article discusses an instructional strategy which explores eventual similarities and/or analogies between familiar problems and more sophisticated systems. In this context, the Atwood's machine problem is used to introduce students to more complex problems involving ropes and chains. The methodology proposed helps students to develop the ability needed to apply relevant concepts in situations not previously encountered. The pedagogical advantages are relevant for both secondary and high school students, showing that, through adequate examples, the question of the validity of Newton's second law may even be introduced to introductory level students.

Polymer-based microfluidic chips for isothermal amplification of nucleic acids

NASA Astrophysics Data System (ADS)

Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

2017-11-01

Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

Polymerase chain reaction with phase change as intrinsic thermal control

NASA Astrophysics Data System (ADS)

Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

2013-04-01

This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

Photochemical reaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen) with basic amino acids and dipeptides.

PubMed

Suzuki, Tadashi; Shinoda, Mio; Osanai, Yohei; Isozaki, Tasuku

2013-08-22

Photoreaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen, KP) with basic amino acids (histidine, lysine, and arginine) and dipeptides (carnosine and anserine) including a histidine moiety in phosphate buffer solution (pH 7.4) has been investigated with transient absorption spectroscopy. With UV irradiation KP(-) gave rise to a carbanion through a decarboxylation reaction, and the carbanion easily abstracted a proton from the surrounding molecule to yield a 3-ethylbenzophenone ketyl biradical (EBPH). The dipeptides as well as the basic amino acids were found to accelerate the proton transfer reaction whereas alanine and glycine had no effect on the reaction, revealing that these amino acids having a protonated side chain act as a proton donor. The formation quantum yield of EBPH was estimated to be fairly large by means of an actinometrical method with benzophenone, and the bimolecular reaction rate constant for the proton transfer between the carbanion and the protonated basic amino acids or the protonated dipeptides was successfully determined. It has become apparent that the bimolecular reaction rate constant for the proton transfer depended on the acid dissociation constant for the side chain of the amino acids for the first time. This reaction mechanism was interpreted by difference of the heat of reaction for each basic amino acid based on the thermodynamical consideration. These results strongly suggest that the side chain of the basic amino acid residue in protein should play an important role for photochemistry of KP in vivo.

FACTORS AFFECTING THE CHAIN LENGTH OF GROUP A STREPTOCOCCI

PubMed Central

Ekstedt, Richard D.; Stollerman, Gene H.

1960-01-01

Group A streptococci which grew in long chains in the presence of homologous anti-M antibody were split into their original length by the addition of an excess of homologous M protein to the culture. The chain-splitting reaction showed temperature and pH optima (37°C., 7.5) and was completely inhibited at 0°C. or by heat-killing the long chains at 56°C. prior to the addition of M protein. Addition of sublethal doses of HgCl2, or of penicillin, inhibited the chain-splitting reaction. Pneumococci behaved in entirely comparable fashion to streptococci in similar experiments. Virulent strains of streptococci formed the shortest chains when broth media was enriched with serum. The chain-shortening effect of serum enrichment of the media was most apparent with encapsulated strains and under cultural conditions that favored capsule formation. Loss of capsules by mutation or by unfavorable growth conditions resulted in increase in chain length. The activity of the chain-splitting mechanism seemed to be independent of M protein, however, since encapsulated M-negative variants also formed very short chain in serum-enriched media. The physical presence of the capsule was not essential for chain shortening since enzymatic removal of the capsule with hyaluronidase during growth did not affect chain length. These results strongly suggest that chain-splitting of streptococci and pneumococci occurs by an active metabolic mechanism, presumably enzymatic, which is inhibited by the union of surface antigens with specific antibody. PMID:13726267

Assessing the influence of side-chain and main-chain aromatic benzyltrimethyl ammonium on anion exchange membranes.

PubMed

Li, Xiuhua; Nie, Guanghui; Tao, Jinxiong; Wu, Wenjun; Wang, Liuchan; Liao, Shijun

2014-05-28

3,3'-Di(4″-methyl-phenyl)-4,4'-difluorodiphenyl sulfone (DMPDFPS), a new monomer with two pendent benzyl groups, was easily prepared by Suzuki coupling reaction in high yield. A series of side-chain type ionomers (PAES-Qs) containing pendant side-chain benzyltrimethylammonium groups, which linked to the backbone by alkaline resisting conjugated C-C bonds, were synthesized via polycondensation, bromination, followed by quaternization and alkalization. To assess the influence of side-chain and main-chain aromatic benzyltrimethylammonium on anion exchange membranes (AEMs), the main-chain type ionomers (MPAES-Qs) with the same backbone were synthesized following the similar procedure. GPC and (1)H NMR results indicate that the bromination shows no reaction selectivity of polymer configurations and ionizations of the side-chain type polymers display higher conversions than that of the main-chain type ones do. These two kinds of AEMs were evaluated in terms of ion exchange capacity (IEC), water uptake, swelling ratio, λ, volumetric ion exchange capacity (IECVwet), hydroxide conductivity, mechanical and thermal properties, and chemical stability, respectively. The side-chain type structure endows AEMs with lower water uptake, swelling ratio and λ, higher IECVwet, much higher hydroxide conductivity, more robust dimensional stability, mechanical and thermal properties, and higher stability in hot alkaline solution. The side-chain type cationic groups containing molecular configurations have the distinction of being practical AEMs and membrane electrode assemblies of AEMFCs.

Intact carbohydrate structures as part of the melanoidin skeleton.

PubMed

Cämmerer, Bettina; Jalyschko, Walentina; Kroh, Lothar W

2002-03-27

Model melanoidins from monomeric, oligomeric, and polymeric carbohydrates, and amino acids formed under aqueous as well as water-free reaction conditions, were submitted to acidic catalyzed hydrolysis. Their degradation products were detected qualitatively and quantitatively by HPTLC and HPLC-DAD. A considerable amount of monomer carbohydrates from hydrolysis of model melanoidins formed under water-free reaction conditions was detected. It can be seen clearly that the amount of carbohydrates released increased with increasing degree of polymerization of the carbohydrates used as starting material. In comparison, the hydrolysis of melanoidins formed in aqueous condition resulted in only a small glucose release. It seems that in the Maillard reaction under water-free conditions, a significant amount of di- and oligomer carbohydrates were incorporated into the melanoidin skeleton as complete oligomer with intact glycosidic bond, forming side chains at the melanoidin skeleton. Additional side chains could be formed by transglycosylation reactions. With increasing water content, hydrothermolytic as well as retro-aldol reactions of the starting carbonyl components became significant, and therefore the possibility of forming side chains decreased. The results are consistent with the postulated melanoidin structure being built up mainly from sugar degradation products, probably branched via amino compounds.

Biodiesel production from triolein and short chain alcohols through biocatalysis.

PubMed

Salis, Andrea; Pinna, Marcella; Monduzzi, Maura; Solinas, Vincenzo

2005-09-29

Oleic acid alkyl esters (biodiesel) were synthesised by biocatalysis in solvent-free conditions. Different commercial immobilised lipases, namely Candida antarctica B, Rizhomucor miehei, and Pseudomonas cepacia, were tested towards the reaction between triolein and butanol to produce butyl oleate. Pseudomonas cepacia lipase resulted to be the most active enzyme reaching 100% of conversion after 6h. Different operative conditions such as reaction temperature, water activity, and reagent stoichiometric ratio were investigated and optimised. These conditions were then used to investigate the effect of linear and branched short chain alcohols. Methanol and 2-butanol were the worst alcohols: the former, probably, due to its low miscibility with the oil and the latter because secondary alcohols usually are less reactive than primary alcohols. Conversely, linear and branched primary alcohols with short alkyl chains (C(2)--C(4)) showed high reaction rate and conversion. A mixture of linear and branched short chain alcohols that mimics the residual of ethanol distillation (fusel oil) was successfully used for oleic acid ester synthesis. These compounds are important in biodiesel mixtures since they improve low temperature properties.

Design and finite element analysis of micro punch CNC machine modeling for medical devices

NASA Astrophysics Data System (ADS)

Pranoto, Sigiet Haryo; Mahardika, Muslim

2018-03-01

Research on micromanufacturing has been conducted. Miniaturization and weight reduction of various industrial products continue to be developed, machines with high accuracy and good quality of machining results are needed recently. This research includes design and simulation of Micro Punch CNC Machine using Abaqus with pneumatic system. This article concern of modeling simulation of punching miniplate titanium with 0.6 MPa of pressure and 500 µm of thickness. This study explaining von misses stress, safety factor and displacement analysis while the machine had the load of punching. The result gives the reaction forced of punching is 0.5 MPa on punch tip and maximum displacement is 3.237 × 10-1 mm. The safety factor is over than 12, and considered it safe for manufacturing process.

METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM

DOEpatents

Fermi, E.; Leverett, M.C.

1957-11-12

This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.

Efficient machining of ultra precise steel moulds with freeform surfaces

NASA Astrophysics Data System (ADS)

Bulla, B.; Robertson, D. J.; Dambon, O.; Klocke, F.

2013-09-01

Ultra precision diamond turning of hardened steel to produce optical quality surfaces can be realized by applying an ultrasonic assisted process. With this technology optical moulds used typically for injection moulding can be machined directly from steel without the requirement to overcoat the mould with a diamond machinable material such as Nickel Phosphor. This has both the advantage of increasing the mould tool lifetime and also reducing manufacture costs by dispensing with the relatively expensive plating process. This publication will present results we have obtained for generating free form moulds in hardened steel by means of ultrasonic assisted diamond turning with a vibration frequency of 80 kHz. To provide a baseline with which to characterize the system performance we perform plane cutting experiments on different steel alloys with different compositions. The baseline machining results provides us information on the surface roughness and on tool wear caused during machining and we relate these to material composition. Moving on to freeform surfaces, we will present a theoretical background to define the machine program parameters for generating free forms by applying slow slide servo machining techniques. A solution for optimal part generation is introduced which forms the basis for the freeform machining experiments. The entire process chain, from the raw material through to ultra precision machining is presented, with emphasis on maintaining surface alignment when moving a component from CNC pre-machining to final machining using ultrasonic assisted diamond turning. The free form moulds are qualified on the basis of the surface roughness measurements and a form error map comparing the machined surface with the originally defined surface. These experiments demonstrate the feasibility of efficient free form machining applying ultrasonic assisted diamond turning of hardened steel.

Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

NASA Technical Reports Server (NTRS)

Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

1998-01-01

Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

Ground Reaction Force and Mechanical Differences Between the Interim Resistive Exercise Device (iRED) and Smith Machine While Performing a Squat

NASA Technical Reports Server (NTRS)

Amonette, William E.; Bentley, Jason R.; Lee, Stuart M. C.; Loehr, James A.; Schneider, Suzanne

2004-01-01

Musculoskeletal unloading in microgravity has been shown to induce losses in bone mineral density, muscle cross-sectional area, and muscle strength. Currently, an Interim Resistive Exercise Device (iRED) is being flown on board the ISS to help counteract these losses. Free weight training has shown successful positive musculoskeletal adaptations. In biomechanical research, ground reaction forces (GRF) trajectories are used to define differences between exercise devices. The purpose of this evaluation is to quantify the differences in GRF between the iRED and free weight exercise performed on a Smith machine during a squat. Due to the differences in resistance properties, inertial loading and load application to the body between the two devices, we hypothesize that subjects using iRED will produce GRF that are significantly different from the Smith machine. There will be differences in bar/harness range of motion and the time when peak GRF occurred in the ROMbar. Three male subjects performed three sets of ten squats on the iRED and on the Smith Machine on two separate days at a 2-second cadence. Statistically significant differences were found between the two devices in all measured GRF variables. Average Fz and Fx during the Smith machine squat were significantly higher than iRED. Average Fy (16.82 plus or minus.23; p less than .043) was significantly lower during the Smith machine squat. The mean descent/ascent ratio of the magnitude of the resultant force vector of all three axes for the Smith machine and iRED was 0.95 and 0.72, respectively. Also, the point at which maximum Fz occurred in the range of motion (Dzpeak) was at different locations with the two devices.

Maillard reaction versus other nonenzymatic modifications in neurodegenerative processes.

PubMed

Pamplona, Reinald; Ilieva, Ekaterina; Ayala, Victoria; Bellmunt, Maria Josep; Cacabelos, Daniel; Dalfo, Esther; Ferrer, Isidre; Portero-Otin, Manuel

2008-04-01

Nonenzymatic protein modifications are generated from direct oxidation of amino acid side chains and from reaction of the nucleophilic side chains of specific amino acids with reactive carbonyl species. These reactions give rise to specific markers that have been analyzed in different neurodegenerative diseases sharing protein aggregation, such as Alzheimer's disease, Pick's disease, Parkinson's disease, dementia with Lewy bodies, Creutzfeldt-Jakob disease, and amyotrophic lateral sclerosis. Collectively, available data demonstrate that oxidative stress homeostasis, mitochondrial function, and energy metabolism are key factors in determining the disease-specific pattern of protein molecular damage. In addition, these findings suggest the lack of a "gold marker of oxidative stress," and, consequently, they strengthen the need for a molecular dissection of the nonenzymatic reactions underlying neurodegenerative processes.

Intramolecular Benzoin Reaction Catalyzed by Benzaldehyde Lyase from Pseudomonas Fluorescens Biovar I.

PubMed

Hernández, Karel; Parella, Teodor; Petrillo, Giovanna; Usón, Isabel; Wandtke, Claudia M; Joglar, Jesús; Bujons, Jordi; Clapés, Pere

2017-05-02

Intramolecular benzoin reactions catalyzed by benzaldehyde lyase from Pseudomonas fluorescens biovar I (BAL) are reported. The structure of the substrates envisaged for this reaction consists of two benzaldehyde derivatives linked by an alkyl chain. The structural requirements needed to achieve the intramolecular carbon-carbon bond reaction catalyzed by BAL were established. Thus, a linker consisting of a linear alkyl chain of three carbon atoms connected through ether-type bonds to the 2 and 2' positions of two benzaldehyde moieties, which could be substituted with either Cl, Br, or OCH 3 at either the 3 and 3' or 5 and 5' positions, were suitable substrates for BAL. Reactions with 61-84 % yields of the intramolecular product and ee values between 64 and 98 %, were achieved. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

PubMed

Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

2013-08-01

Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

PubMed

Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

2014-03-01

The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

Preemptive Isolation Precautions of Patients at High Risk for Methicillin-Resistant Staphylococcus aureus in Combination With Ultrarapid Polymerase Chain Reaction Screening as an Effective Tool for Infection Control.

PubMed

Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael

2016-12-01

This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.

Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

PubMed Central

Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

2006-01-01

Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

PubMed

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.

Synthesis of Side-Chain Oxysterols and their Enantiomers through Cross-Metathesis Reactions of Δ22 Steroids

PubMed Central

Brownholland, David P.

2017-01-01

A synthetic route that utilizes a cross-metathesis reaction with Δ22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. PMID:28300584

Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

PubMed

Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

2018-04-25

In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

METHOD OF OPERATING NUCLEAR REACTORS

DOEpatents

Untermyer, S.

1958-10-14

A method is presented for obtaining enhanced utilization of natural uranium in heavy water moderated nuclear reactors by charging the reactor with an equal number of fuel elements formed of natural uranium and of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction. The reactor is operated until the rate of burnup of plutonium equals its rate of production, the fuel elements are processed to recover plutonium, the depleted uranium is discarded, and the remaining uranium is formed into fuel elements. These fuel elements are charged into a reactor along with an equal number of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction, and reuse of the uranium is continued as aforesaid until it wlll no longer support a chain reaction when combined with an equal quantity of natural uranium.

Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

PubMed

Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

1997-09-01

In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

Analysis of self-oscillating behaviors aimed at the development of a molecular robot with organic acids as fuel

NASA Astrophysics Data System (ADS)

Nakazumi, Tomoka; Hara, Yusuke

2017-09-01

We studied the transmittance self-oscillation of a polymer chain driven by an organic acid as the fuel. The self-oscillating polymer chain consists of 4-acryloylmorpholine (ACMO) and the Ru catalyst (Ru(bpy)3) of the Belousov-Zhabotinsky (BZ) reaction. The transmittance self-oscillating behavior was affected significantly by the temperature. As the amplitude of the transmittance self-oscillation, which is reflected by the aggregation state, decreased with time, the oscillation period also decreased. This trend indicates that the polymer aggregation affects the rate of the BZ reaction significantly. The activation energy of the self-oscillating value was almost the same in the normal BZ reaction, which does not include Ru(bpy)3 complexes in the polymer chains. In addition, we demonstrated the effect of one BZ substrate (sodium bromate or malonic acid) on the transmittance self-oscillation period.

Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

PubMed

Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

2001-03-01

A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

Initiator and Photocatalyst-Free Visible Light Induced One-Pot Reaction: Concurrent RAFT Polymerization and CuAAC Click Reaction.

PubMed

Wang, Jie; Wang, Xinbo; Xue, Wentao; Chen, Gaojian; Zhang, Weidong; Zhu, Xiulin

2016-05-01

A new, visible light-catalyzed, one-pot and one-step reaction is successfully employed to design well-controlled side-chain functionalized polymers, by the combination of ambient temperature revisible addtion-fragmentation chain transfer (RAFT) polymerization and click chemistry. Polymerizations are well controlled in a living way under the irradiation of visible light-emitting diode (LED) light without photocatalyst and initiator, using the trithiocarbonate agent as iniferter (initiator-transfer agent-terminator) agent at ambient temperature. Fourier transfer infrared spectroscopy (FT-IR), NMR, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) data confirm the successful one-pot reaction. Compared to the reported zero-valent metal-catalyzed one-pot reaction, the polymerization rate is much faster than that of the click reaction, and the visible light-catalyzed one-pot reaction can be freely and easily regulated by turning on and off the light. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Governance on the Drug Supply Chain via Gcoin Blockchain.

PubMed

Tseng, Jen-Hung; Liao, Yen-Chih; Chong, Bin; Liao, Shih-Wei

2018-05-23

As a trust machine, blockchain was recently introduced to the public to provide an immutable, consensus based and transparent system in the Fintech field. However, there are ongoing efforts to apply blockchain to other fields where trust and value are essential. In this paper, we suggest Gcoin blockchain as the base of the data flow of drugs to create transparent drug transaction data. Additionally, the regulation model of the drug supply chain could be altered from the inspection and examination only model to the surveillance net model, and every unit that is involved in the drug supply chain would be able to participate simultaneously to prevent counterfeit drugs and to protect public health, including patients.

T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

PubMed

Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

2012-01-01

Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

Chain photoreduction of CCl3F in TiO2 suspensions: enhancement induced by O2.

PubMed

Winkelmann, Kurt; Calhoun, Robert L; Mills, German

2006-12-28

Trichlorofluoromethane (CFC 11) was photoreduced in aqueous suspensions of TiO2 particles containing HCO2- ions and air. Dissolved O2 inhibited the reaction during an induction period that preceded the rapid formation of chloride ions. Reaction rates were higher in systems containing O2 as compared to analogous reactions that occurred in anaerobic suspensions. High photonic efficiencies of Cl- formation (> or =15) were achieved using suspensions with pH > or = 5. As was the case for studies with air-free suspensions, reactions are best described using a photoinitiated chain mechanism that produced CHCl2F and Cl- during the propagation steps. The enhanced yields obtained in the presence of air are attributed to the removal by O2 of electrons trapped in the oxide, which are converted first into H2O2 and then into reducing radicals that participate in the chain process. Enhanced yields of Freon photoreduction were also observed during illumination of air-free suspensions containing hydrogen peroxide, which were interpreted using a similar mechanism.

Tested Demonstrations.

ERIC Educational Resources Information Center

Gilbert, George L., Ed.

1983-01-01

Free radical chlorination of methane is used in organic chemistry to introduce free radical/chain reactions. In spite of its common occurrence, demonstrations of the reaction are uncommon. Therefore, such a demonstration is provided, including background information, preparation of reactants/reaction vessel, introduction of reactants, irradiation,…

Efficient sampling of reversible cross-linking polymers: Self-assembly of single-chain polymeric nanoparticles

NASA Astrophysics Data System (ADS)

Oyarzún, Bernardo; Mognetti, Bortolo Matteo

2018-03-01

We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.

Computing exponentially faster: implementing a non-deterministic universal Turing machine using DNA

PubMed Central

Currin, Andrew; Korovin, Konstantin; Ababi, Maria; Roper, Katherine; Kell, Douglas B.; Day, Philip J.

2017-01-01

The theory of computer science is based around universal Turing machines (UTMs): abstract machines able to execute all possible algorithms. Modern digital computers are physical embodiments of classical UTMs. For the most important class of problem in computer science, non-deterministic polynomial complete problems, non-deterministic UTMs (NUTMs) are theoretically exponentially faster than both classical UTMs and quantum mechanical UTMs (QUTMs). However, no attempt has previously been made to build an NUTM, and their construction has been regarded as impossible. Here, we demonstrate the first physical design of an NUTM. This design is based on Thue string rewriting systems, and thereby avoids the limitations of most previous DNA computing schemes: all the computation is local (simple edits to strings) so there is no need for communication, and there is no need to order operations. The design exploits DNA's ability to replicate to execute an exponential number of computational paths in P time. Each Thue rewriting step is embodied in a DNA edit implemented using a novel combination of polymerase chain reactions and site-directed mutagenesis. We demonstrate that the design works using both computational modelling and in vitro molecular biology experimentation: the design is thermodynamically favourable, microprogramming can be used to encode arbitrary Thue rules, all classes of Thue rule can be implemented, and non-deterministic rule implementation. In an NUTM, the resource limitation is space, which contrasts with classical UTMs and QUTMs where it is time. This fundamental difference enables an NUTM to trade space for time, which is significant for both theoretical computer science and physics. It is also of practical importance, for to quote Richard Feynman ‘there's plenty of room at the bottom’. This means that a desktop DNA NUTM could potentially utilize more processors than all the electronic computers in the world combined, and thereby outperform the world's current fastest supercomputer, while consuming a tiny fraction of its energy. PMID:28250099

Hierarchical Robot Control System and Method for Controlling Select Degrees of Freedom of an Object Using Multiple Manipulators

NASA Technical Reports Server (NTRS)

Platt, Robert (Inventor); Wampler, II, Charles W. (Inventor); Abdallah, Muhammad E. (Inventor)

2013-01-01

A robotic system includes a robot having manipulators for grasping an object using one of a plurality of grasp types during a primary task, and a controller. The controller controls the manipulators during the primary task using a multiple-task control hierarchy, and automatically parameterizes the internal forces of the system for each grasp type in response to an input signal. The primary task is defined at an object-level of control, e.g., using a closed-chain transformation, such that only select degrees of freedom are commanded for the object. A control system for the robotic system has a host machine and algorithm for controlling the manipulators using the above hierarchy. A method for controlling the system includes receiving and processing the input signal using the host machine, including defining the primary task at the object-level of control, e.g., using a closed-chain definition, and parameterizing the internal forces for each of grasp type.

The development of mixer machine for organic animal feed production: Proposed study

NASA Astrophysics Data System (ADS)

Leman, A. M.; Wahab, R. Abdul; Zakaria, Supaat; Feriyanto, Dafit; Nor, M. I. F. Che Mohd; Muzarpar, Syafiq

2017-09-01

Mixer machine plays a major role in producing homogenous composition of animal feed. Long time production, inhomogeneous and minor agglomeration has been observed by existing mixer. Therefore, this paper proposed continuous mixer to enhance mixing efficiency with shorter time of mixing process in order to abbreviate the whole process in animal feed production. Through calculation of torque, torsion, bending, power and energy consumption will perform in mixer machine process. Proposed mixer machine is designed by two layer buckets with purpose for continuity of mixing process. Mixing process was performed by 4 blades which consists of various arm length such as 50, 100,150 and 225 mm in 60 rpm velocity clockwise rotation. Therefore by using this machine will produce the homogenous composition of animal feed through nutrition analysis and short operation time of mixing process approximately of 5 minutes. Therefore, the production of animal feed will suitable for various animals including poultry and aquatic fish. This mixer will available for various organic material in animal feed production. Therefore, this paper will highlights some areas such as continues animal feed supply chain and bio-based animal feed.

Genome scale enzyme–metabolite and drug–target interaction predictions using the signature molecular descriptor

DOE PAGES

Faulon, Jean-Loup; Misra, Milind; Martin, Shawn; ...

2007-11-23

Motivation: Identifying protein enzymatic or pharmacological activities are important areas of research in biology and chemistry. Biological and chemical databases are increasingly being populated with linkages between protein sequences and chemical structures. Additionally, there is now sufficient information to apply machine-learning techniques to predict interactions between chemicals and proteins at a genome scale. Current machine-learning techniques use as input either protein sequences and structures or chemical information. We propose here a method to infer protein–chemical interactions using heterogeneous input consisting of both protein sequence and chemical information. Results: Our method relies on expressing proteins and chemicals with a common cheminformaticsmore » representation. We demonstrate our approach by predicting whether proteins can catalyze reactions not present in training sets. We also predict whether a given drug can bind a target, in the absence of prior binding information for that drug and target. Lastly, such predictions cannot be made with current machine-learning techniques requiring binding information for individual reactions or individual targets.« less

Optical Detection of Degraded Therapeutic Proteins.

PubMed

Herrington, William F; Singh, Gajendra P; Wu, Di; Barone, Paul W; Hancock, William; Ram, Rajeev J

2018-03-23

The quality of therapeutic proteins such as hormones, subunit and conjugate vaccines, and antibodies is critical to the safety and efficacy of modern medicine. Identifying malformed proteins at the point-of-care can prevent adverse immune reactions in patients; this is of special concern when there is an insecure supply chain resulting in the delivery of degraded, or even counterfeit, drug product. Identification of degraded protein, for example human growth hormone, is demonstrated by applying automated anomaly detection algorithms. Detection of the degraded protein differs from previous applications of machine-learning and classification to spectral analysis: only example spectra of genuine, high-quality drug products are used to construct the classifier. The algorithm is tested on Raman spectra acquired on protein dilutions typical of formulated drug product and at sample volumes of 25 µL, below the typical overfill (waste) volumes present in vials of injectable drug product. The algorithm is demonstrated to correctly classify anomalous recombinant human growth hormone (rhGH) with 92% sensitivity and 98% specificity even when the algorithm has only previously encountered high-quality drug product.

Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.

PubMed

Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C

2012-09-27

We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.

Large enhancement in the heterogeneous oxidation rate of organic aerosols by hydroxyl radicals in the presence of nitric oxide

DOE PAGES

Richards-Henderson, Nicole K.; Goldstein, Allen H.; Wilson, Kevin R.

2015-10-27

In this paper we report an unexpectedly large acceleration in the effective heterogeneous OH reaction rate in the presence of NO. This 10–50 fold acceleration originates from free radical chain reactions, propagated by alkoxy radicals that form inside the aerosol by the reaction of NO with peroxy radicals, which do not appear to produce chain terminating products (e.g., alkyl nitrates), unlike gas phase mechanisms. Lastly, a kinetic model, constrained by experiments, suggests that in polluted regions heterogeneous oxidation plays a much more prominent role in the daily chemical evolution of organic aerosol than previously believed.

On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+{sup 11}B process

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belyaev, V. S.; Krainov, V. P., E-mail: vpkrainov@mail.ru; Zagreev, B. V.

2015-07-15

Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+{sup 11}B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from {sup 11}B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+{sup 11}B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons amongmore » fusion products. Nuclear reactions that follow the p+{sup 11}B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+{sup 11}B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.« less

Synthesis of side-chain oxysterols and their enantiomers through cross-metathesis reactions of Δ22 steroids.

PubMed

Brownholland, David P; Covey, Douglas F

2017-05-01

A synthetic route that utilizes a cross-metathesis reaction with Δ 22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. Copyright © 2017 Elsevier Inc. All rights reserved.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

PubMed

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

2014-04-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

PubMed Central

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

2014-01-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

PubMed

Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

2011-11-01

The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

USDA-ARS?s Scientific Manuscript database

The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

Spark Plasma Sintering for Nanostructured Smart Materials

DTIC Science & Technology

2009-03-02

polyester) with excess isocyanate to form a prepolymer , followed by the addition of a short chain diol that acts as a chain extender to link the... prepolymers together. Due to the thermodynamic imicisibility of segments of PU, phase separation into a flexible soft segment (long chain diol) and a...other reactions of the isocyanate groups with the other functional groups in the chain. [Hepburn, 1992] However, during the initial prepolymer

417th Brookhaven Lecture

ScienceCinema

Huilin Li

2017-12-09

Proteins that cleave other proteins using a molecule of water, protease complexes are exquisite macromolecular machines involved in a multitude of physiological and cellular reactions. Our structural studies shed light into the inner workings of multi-protein assemblies, and they reveal a surprisingly common strategy for controlled proteolysis employed by the two drastically different machines. Further research will facilitate rational design of drugs for treating Tb infection and Alzheimer's disease.

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

PubMed

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Typed Linear Chain Conditional Random Fields and Their Application to Intrusion Detection

NASA Astrophysics Data System (ADS)

Elfers, Carsten; Horstmann, Mirko; Sohr, Karsten; Herzog, Otthein

Intrusion detection in computer networks faces the problem of a large number of both false alarms and unrecognized attacks. To improve the precision of detection, various machine learning techniques have been proposed. However, one critical issue is that the amount of reference data that contains serious intrusions is very sparse. In this paper we present an inference process with linear chain conditional random fields that aims to solve this problem by using domain knowledge about the alerts of different intrusion sensors represented in an ontology.

Density functional computational studies on the glucose and glycine Maillard reaction: Formation of the Amadori rearrangement products

NASA Astrophysics Data System (ADS)

Jalbout, Abraham F.; Roy, Amlan K.; Shipar, Abul Haider; Ahmed, M. Samsuddin

Theoretical energy changes of various intermediates leading to the formation of the Amadori rearrangement products (ARPs) under different mechanistic assumptions have been calculated, by using open chain glucose (O-Glu)/closed chain glucose (A-Glu and B-Glu) and glycine (Gly) as a model for the Maillard reaction. Density functional theory (DFT) computations have been applied on the proposed mechanisms under different pH conditions. Thus, the possibility of the formation of different compounds and electronic energy changes for different steps in the proposed mechanisms has been evaluated. B-Glu has been found to be more efficient than A-Glu, and A-Glu has been found more efficient than O-Glu in the reaction. The reaction under basic condition is the most favorable for the formation of ARPs. Other reaction pathways have been computed and discussed in this work.0

Operation of micro and molecular machines: a new concept with its origins in interface science.

PubMed

Ariga, Katsuhiko; Ishihara, Shinsuke; Izawa, Hironori; Xia, Hong; Hill, Jonathan P

2011-03-21

A landmark accomplishment of nanotechnology would be successful fabrication of ultrasmall machines that can work like tweezers, motors, or even computing devices. Now we must consider how operation of micro- and molecular machines might be implemented for a wide range of applications. If these machines function only under limited conditions and/or require specialized apparatus then they are useless for practical applications. Therefore, it is important to carefully consider the access of functionality of the molecular or nanoscale systems by conventional stimuli at the macroscopic level. In this perspective, we will outline the position of micro- and molecular machines in current science and technology. Most of these machines are operated by light irradiation, application of electrical or magnetic fields, chemical reactions, and thermal fluctuations, which cannot always be applied in remote machine operation. We also propose strategies for molecular machine operation using the most conventional of stimuli, that of macroscopic mechanical force, achieved through mechanical operation of molecular machines located at an air-water interface. The crucial roles of the characteristics of an interfacial environment, i.e. connection between macroscopic dimension and nanoscopic function, and contact of media with different dielectric natures, are also described.

Methanol Cannon Demonstrations Revisited.

ERIC Educational Resources Information Center

Dolson, David A.; And Others

1995-01-01

Describes two variations on the traditional methanol cannon demonstration. The first variation is a chain reaction using real metal chains. The second example involves using easily available components to produce sequential explosions that can be musical in nature. (AIM)

Quasi-free Proton Knockout Reactions on the Oxygen Isotopic Chain

NASA Astrophysics Data System (ADS)

Atar, Leyla; Aumann, Thomas; Bertulani, Carlos; Paschalis, Stefanos; R3B Collaboration

2017-09-01

It is well known from electron-induced knockout data that the single-particle (SP) strength is reduced to about 60-70% for stable nuclei in comparison to the independent particle model due to the presence of short- and long-range correlations. This finding has been confirmed by nuclear knockout reactions using stable and exotic beams, however, with a strong dependency on the proton-neutron asymmetry. The observed strong reduction of SP cross sections for the deeply bound valence nucleons in asymmetric nuclei is theoretically not understood. To understand this dependency quantitatively a complementary approach, quasi-free (QF) knockout reactions in inverse kinematics, is introduced. We have performed a systematic study of spectroscopic strength of oxygen isotopes using QF (p,2p) knockout reactions in complete kinematics at the R3B/LAND setup at GSI with secondary beams containing 13-24O. The oxygen isotopic chain covers a large variation of separ ation energies, which allow a systematic study of SF with respect to isospin asymmetry. We will present results on the (p,2p) cross sections for the entire oxygen isotopic chain obtained from a single experiment. By comparison with the Eikonal reaction theory the SF and reduction factors will be presented. The work is supported by GSI-TU Darmstadt cooperation and BMBF project 05P15RDFN1.

A Shellcode Detection Method Based on Full Native API Sequence and Support Vector Machine

NASA Astrophysics Data System (ADS)

Cheng, Yixuan; Fan, Wenqing; Huang, Wei; An, Jing

2017-09-01

Dynamic monitoring the behavior of a program is widely used to discriminate between benign program and malware. It is usually based on the dynamic characteristics of a program, such as API call sequence or API call frequency to judge. The key innovation of this paper is to consider the full Native API sequence and use the support vector machine to detect the shellcode. We also use the Markov chain to extract and digitize Native API sequence features. Our experimental results show that the method proposed in this paper has high accuracy and low detection rate.

DESY II, a new injector for the DESY storage rings PETRA and DORIS II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hemmie, G.

1983-08-01

There is a proposal to build a new 9 GeV electron synchrotron as a dedicated injector for the storage rings DORIS and PETRA. This machine will be housed in the old DESY-tunnel side-by-side with the original DESY-synchrotron. It is characterized by a separated function lattice, a 12.5 Hz repetition frequency, an all-metal vacuum chamber and a high shunt impedance rf-system. After commissioning of this new machine in 1984, the old DESY-synchrotron could be converted into a dedicated proton-accelerator as part of the injection chain for HERA.

Analysis of the Laser Drilling Process for the Combination with a Single-Lip Deep Hole Drilling Process with Small Diameters

NASA Astrophysics Data System (ADS)

Biermann, Dirk; Heilmann, Markus

Due to the tendency of downsizing of components, also the industrial relevance of bore holes with small diameters and high length-to-diameter ratios rises with the growing requirements on parts. In these applications, the combination of laser pre-drilling and single-lip deep hole drilling can shorten the process chain in machining components with non-planar surfaces, or can reduce tool wear in machining case-hardened materials. In this research, the combination of these processes was realized and investigated for the very first time.

A chain reaction approach to modelling gene pathways.

PubMed

Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

2012-08-01

BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By applying it to microarray data, the chain reaction model computed a set of reaction rates to examine the effects of three polyphenols (EGCG, genistein, and resveratrol) on gene expression in this pathway during puberty. We first performed statistical analysis to test the time factor on the estrogen synthesis pathway. Global tests were used to evaluate an overall gene expression change during puberty for each experimental group. Then, a chain reaction model was employed to simulate the estrogen synthesis pathway. Specifically, the model computed the reaction rates in a set of ordinary differential equations to describe interactions between genes in the pathway (A reaction rate K of A to B represents gene A will induce gene B per unit at a rate of K; we give details in the "method" section). Since disparate changes of gene expression may cause numerical error problems in solving these differential equations, we used an implicit scheme to address this issue. We first applied the chain reaction model to obtain the reaction rates for the control group. A sensitivity study was conducted to evaluate how well the model fits to the control group data at Day 50. Results showed a small bias and mean square error. These observations indicated the model is robust to low random noises and has a good fit for the control group. Then the chain reaction model derived from the control group data was used to predict gene expression at Day 50 for the three polyphenol groups. If these nutrients affect the estrogen synthesis pathways during puberty, we expect discrepancy between observed and expected expressions. Results indicated some genes had large differences in the EGCG (e.g., Hsd3b and Sts) and the resveratrol (e.g., Hsd3b and Hrmt12) groups. CONCLUSIONS: In the present study, we have presented (I) experimental studies of the effect of nutrient diets on the gene expression changes in a selected estrogen synthesis pathway. This experiment is valuable because it allows us to examine how the nutrient-containing diets regulate gene expression in the estrogen synthesis pathway during puberty; (II) global tests to assess an overall association of this particular pathway with time factor by utilizing generalized linear models to analyze microarray data; and (III) a chain reaction model to simulate the pathway. This is a novel application because we are able to translate the gene pathway into the chemical reactions in which each reaction channel describes gene-gene relationship in the pathway. In the chain reaction model, the implicit scheme is employed to efficiently solve the differential equations. Data analysis results show the proposed model is capable of predicting gene expression changes and demonstrating the effect of nutrient-containing diets on gene expression changes in the pathway. One of the objectives of this study is to explore and develop a numerical approach for simulating the gene expression change so that it can be applied and calibrated when the data of more time slices are available, and thus can be used to interpolate the expression change at a desired time point without conducting expensive experiments for a large amount of time points. Hence, we are not claiming this is either essential or the most efficient way for simulating this problem, rather a mathematical/numerical approach that can model the expression change of a large set of genes of a complex pathway. In addition, we understand the limitation of this experiment and realize that it is still far from being a complete model of predicting nutrient-gene interactions. The reason is that in the present model, the reaction rates were estimated based on available data at two time points; hence, the gene expression change is dependent upon the reaction rates and a linear function of the gene expressions. More data sets containing gene expression at various time slices are needed in order to improve the present model so that a non-linear variation of gene expression changes at different time can be predicted.

Unraveling reaction pathways and specifying reaction kinetics for complex systems.

PubMed

Vinu, R; Broadbelt, Linda J

2012-01-01

Many natural and industrial processes involve a complex set of competing reactions that include several different species. Detailed kinetic modeling of such systems can shed light on the important pathways involved in various transformations and therefore can be used to optimize the process conditions for the desired product composition and properties. This review focuses on elucidating the various components involved in modeling the kinetics of pyrolysis and oxidation of polymers. The elementary free radical steps that constitute the chain reaction mechanism of gas-phase/nonpolar liquid-phase processes are outlined. Specification of the rate coefficients of the various reaction families, which is central to the theme of kinetics, is described. Construction of the reaction network on the basis of the types of end groups and reactive moieties in a polymer chain is discussed. Modeling frameworks based on the method of moments and kinetic Monte Carlo are evaluated using illustrations. Finally, the prospects and challenges in modeling biomass conversion are addressed.

Proton-pumping mechanism of cytochrome c oxidase: A kinetic master-equation approach

PubMed Central

Kim, Young C.; Hummer, Gerhard

2011-01-01

Cytochrome c oxidase (CcO) is an efficient energy transducer that reduces oxygen to water and converts the released chemical energy into an electrochemical membrane potential. As a true proton pump, CcO translocates protons across the membrane against this potential. Based on a wealth of experiments and calculations, an increasingly detailed picture of the reaction intermediates in the redox cycle has emerged. However, the fundamental mechanism of proton pumping coupled to redox chemistry remains largely unresolved. Here we examine and extend a kinetic master-equation approach to gain insight into redox-coupled proton pumping in CcO. Basic principles of the CcO proton pump emerge from an analysis of the simplest kinetic models that retain essential elements of the experimentally determined structure, energetics, and kinetics, and that satisfy fundamental physical principles. The master-equation models allow us to address the question of how pumping can be achieved in a system in which all reaction steps are reversible. Whereas proton pumping does not require the direct modulation of microscopic reaction barriers, such kinetic gating greatly increases the pumping efficiency. Further efficiency gains can be achieved by partially decoupling the proton uptake pathway from the ative-site region. Such a mechanism is consistent with the proposed Glu valve, in which the side chain of a key glutamic acid shuttles between the D channel and the active-site region. We also show that the models predict only small proton leaks even in the absence of turnover. The design principles identified here for CcO provide a blueprint for novel biology-inspired fuel cells, and the master-equation formulation should prove useful also for other molecular machines. PMID:21946020

The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

PubMed

Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

2002-03-01

Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

Identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in Mexico.

PubMed

Ortega, Ariadna Flores; Martínez-Castañeda, José Simón; Bautista-Gómez, Linda G; Muñoz, Raúl Fajardo; Hernández, Israel Quijano

This is the first report on circulating canine rotavirus in Mexico. Fifty samples from dogs with gastroenteritis were analyzed used polymerase chain reaction and reverse transcription polymerase chain reaction in order to identify parvovirus and rotavirus, respectively; 7% of dogs were infected with rotavirus exclusively, while 14% were co-infected with both rotavirus and parvovirus; clinical signs in co-infected dogs were more severe. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

PubMed

Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

2016-01-01

American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

Phenylalanine 445 within oxidosqualene-lanosterol cyclase from Saccharomyces cerevisiae influences C-Ring cyclization and deprotonation reactions.

PubMed

Wu, Tung-Kung; Liu, Yuan-Ting; Chiu, Feng-Hsuan; Chang, Cheng-Hsiang

2006-10-12

[reaction: see text] We describe the Saccharomyces cerevisiae oxidosqualene-lanosterol cyclase Phe445 site-saturated mutants that generate truncated tricyclic and altered deprotonation product profiles. Among these mutants, only polar side-chain group substitutions genetically complemented yeast viability and produced spatially related product diversity, supporting the Johnson model that cation-pi interactions between a carbocationic intermediate and an enzyme can be replaced by an electrostatic or polar side chain to stabilize the cationic intermediate, but with product differentiation.

Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

PubMed

Law, Dennis K S; Tsang, Raymond S W

2013-05-01

A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

A computational study of pyrolysis reactions of lignin model compounds

Treesearch

Thomas Elder

2010-01-01

Enthalpies of reaction for the initial steps in the pyrolysis of lignin have been evaluated at the CBS-4m level of theory using fully substituted b-O-4 dilignols. Values for competing unimolecular decomposition reactions are consistent with results previously published for phenethyl phenyl ether models, but with lowered selectivity. Chain propagating reactions of free...

Mechanization for Optimal Landscape Reclamation

NASA Astrophysics Data System (ADS)

Vondráčková, Terezie; Voštová, Věra; Kraus, Michal

2017-12-01

Reclamation is a method of ultimate utilization of land adversely affected by mining or other industrial activity. The paper explains the types of reclamation and the term “optimal reclamation”. Technological options of the long-lasting process of mine dumps reclamation starting with the removal of overlying rocks, transport and backfilling up to the follow-up remodelling of the mine dumps terrain. Technological units and equipment for stripping flow division. Stripping flow solution with respect to optimal reclamation. We recommend that the application of logistic chains and mining simulation with follow-up reclamation to open-pit mines be used for the implementation of optimal reclamation. In addition to a database of local heterogeneities of the stripped soil and reclaimed land, the flow of earths should be resolved in a manner allowing the most suitable soil substrate to be created for the restoration of agricultural and forest land on mine dumps. The methodology under development for the solution of a number of problems, including the geological survey of overlying rocks, extraction of stripping, their transport and backfilling in specified locations with the follow-up deployment of goal-directed reclamation. It will make possible to reduce the financial resources needed for the complex process chain by utilizing GIS, GPS and DGPS technologies, logistic tools and synergistic effects. When selecting machines for transport, moving and spreading of earths, various points of view and aspects must be taken into account. Among such aspects are e.g. the kind of earth to be operated by the respective construction machine, the kind of work activities to be performed, the machine’s capacity, the option to control the machine’s implement and economic aspects and clients’ requirements. All these points of view must be considered in the decision-making process so that the selected machine is capable of executing the required activity and that the use of an unsuitable machine is eliminated as it would result in a delay and increase in the project costs. Therefore, reclamation always includes extensive earth-moving work activities restoring the required relief of the land being reclaimed. Using the earth-moving machine capacity, the kind of soil in mine dumps, the kind of the work activity performed and the machine design, a SW application has been developed that allows the most suitable machine for the respective work technology to be selected with a view to preparing the land intended for reclamation.

29 CFR 1910.266 - Logging operations.

Code of Federal Regulations, 2010 CFR

2010-07-01

... employee against contact with a running chain saw. Sharp, calk-soled boots or other slip-resistant type... (C) Each moving element such as, but not limited to blades, buckets, saws and shears, shall be... moving elements such as, but not limited to, blades, buckets, saws and shears, after the machine is shut...

29 CFR 1910.266 - Logging operations.

Code of Federal Regulations, 2014 CFR

2014-07-01

... employee against contact with a running chain saw. Sharp, calk-soled boots or other slip-resistant type... (C) Each moving element such as, but not limited to blades, buckets, saws and shears, shall be... moving elements such as, but not limited to, blades, buckets, saws and shears, after the machine is shut...

29 CFR 1910.266 - Logging operations.

Code of Federal Regulations, 2013 CFR

2013-07-01

... employee against contact with a running chain saw. Sharp, calk-soled boots or other slip-resistant type... (C) Each moving element such as, but not limited to blades, buckets, saws and shears, shall be... moving elements such as, but not limited to, blades, buckets, saws and shears, after the machine is shut...

29 CFR 1910.266 - Logging operations.

Code of Federal Regulations, 2012 CFR

2012-07-01

... employee against contact with a running chain saw. Sharp, calk-soled boots or other slip-resistant type... (C) Each moving element such as, but not limited to blades, buckets, saws and shears, shall be... moving elements such as, but not limited to, blades, buckets, saws and shears, after the machine is shut...

29 CFR 1910.266 - Logging operations.

Code of Federal Regulations, 2011 CFR

2011-07-01

... employee against contact with a running chain saw. Sharp, calk-soled boots or other slip-resistant type... (C) Each moving element such as, but not limited to blades, buckets, saws and shears, shall be... moving elements such as, but not limited to, blades, buckets, saws and shears, after the machine is shut...

Eating and Reading in the Library.

ERIC Educational Resources Information Center

Trelease, Jim; Krashen, Stephen

1996-01-01

This article, citing the example of large bookselling chains who offer cafes in their stores, advocates the provision of food and drink in school libraries as well. High-quality food, made available by vending machine, would increase levels of wellness, energy, and teachability. Protests involving mess, lack of money, and difficulties with parents…

76 FR 5380 - Agency Information Collection Activities; Submission for Office of Management and Budget Review...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-01-31

... Request; Restaurant Menu and Vending Machine Labeling: Recordkeeping and Mandatory Third Party Disclosure... submitted the following proposed collection of information to OMB for review and clearance. Restaurant Menu...), requires chain restaurants and similar retail food establishments (SRFE) with 20 or more locations doing...

30 CFR 56.13021 - High-pressure hose connections.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 30 Mineral Resources 1 2010-07-01 2010-07-01 false High-pressure hose connections. 56.13021... and Boilers § 56.13021 High-pressure hose connections. Except where automatic shutoff valves are used, safety chains or other suitable locking devices shall be used at connections to machines of high-pressure...

Modeling the SOA Forming Potential of Substituted Dihydrofurans from Alkane + OH Reactions in the Atmosphere

NASA Astrophysics Data System (ADS)

Jordan, C. E.; Griffin, R. J.; Lim, Y. B.; Ziemann, P. J.; Atkinson, R.; Arey, J.

2005-12-01

Recent laboratory studies show that δ-hydroxycarbonyls formed in the atmosphere via OH-initiated reactions with alkanes can cyclize then dehydrate to form substituted dihydrofurans. These dihydrofurans are highly reactive, with lifetimes in the atmosphere of 1.3 h (OH), 24 s (NO3), and 7 min (O3). The ability of the δ-hydroxycarbonyls to cyclize and dehydrate has been shown to increase with increasing carbon number. Recent laboratory results show that the secondary organic aerosol (SOA) yields from alkanes also increase with carbon number reaching ~53% for C15. The reaction mechanism proposed based on the chamber results is the basis of the modeling study presented here. We have incorporated this proposed mechanism into the Caltech Atmospheric Chemistry Mechanism (CACM). For computational reasons, similar compounds are lumped together and represented by a single suitable compound. In the present case, alkanes are lumped into 3 groups: short chains (≤C6), medium chains (C7 - C12), and long chains (≥C13). SOA yields obtained in chamber studies increase dramatically from 0.5% for C8 to 25% for C12. The most dramatic increase is observed from C11 (8%) to C13 (~50%). This is attributed to the low volatility of first generation products contributing to the SOA from longer chain alkanes. Here we have studied OH reactions with the substituted dihydrofurans for medium (represented by C10) and long (represented by C16) chain alkanes using CACM along with the aerosol partitioning module MPMPO (Model to Predict the Multi-phase Partitioning of Organics). We will present the results of this modeling study, characterizing the influence of substituted dihydrofurans on the SOA forming potential of alkanes.

Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes

NASA Astrophysics Data System (ADS)

Denisov, E. T.; Shestakov, A. F.

2018-05-01

Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

175Hp contrarotating homopolar motor design report

NASA Astrophysics Data System (ADS)

Cannell, Michael J.; Drake, John L.; McConnell, Richard A.; Martino, William R.

1994-06-01

A normally conducting contrarotating homopolar motor has been designed and constructed. The reaction torque, in the outer rotor, from the inner rotor is utilized to produce true contrarotation. The machine utilizes liquid cooled conductors, high performance liquid metal current collectors, and ferrous conductors in the active region. The basic machine output is 175 hp at + or - 1,200 rpm with an input of 4 volts and 35,000 amps.

Diamond tool machining of materials which react with diamond

DOEpatents

Lundin, Ralph L.; Stewart, Delbert D.; Evans, Christopher J.

1992-01-01

Apparatus for the diamond machining of materials which detrimentally react with diamond cutting tools in which the cutting tool and the workpiece are chilled to very low temperatures. This chilling halts or retards the chemical reaction between the workpiece and the diamond cutting tool so that wear rates of the diamond tool on previously detrimental materials are comparable with the diamond turning of materials which do not react with diamond.

Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

PubMed

Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

2009-01-01

A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

Cerebral Toxoplasmosis Diagnosed by Nested-polymerase Chain Reaction in a Patient with Rheumatoid Arthritis.

PubMed

Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki

2018-05-15

A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.

Chemical reactions directed Peptide self-assembly.

PubMed

Rasale, Dnyaneshwar B; Das, Apurba K

2015-05-13

Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.

Chemical Reactions Directed Peptide Self-Assembly

PubMed Central

Rasale, Dnyaneshwar B.; Das, Apurba K.

2015-01-01

Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly. PMID:25984603

Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

PubMed Central

Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

2004-01-01

A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

One-step production of long-chain hydrocarbons from waste-biomass-derived chemicals using bi-functional heterogeneous catalysts.

PubMed

Wen, Cun; Barrow, Elizabeth; Hattrick-Simpers, Jason; Lauterbach, Jochen

2014-02-21

In this study, we demonstrate the production of long-chain hydrocarbons (C8+) from 2-methylfuran (2MF) and butanal in a single step reactive process by utilizing a bi-functional catalyst with both acid and metallic sites. Our approach utilizes a solid acid for the hydroalkylation function and as a support as well as a transition metal as hydrodeoxygenation catalyst. A series of solid acids was screened, among which MCM-41 demonstrated the best combination of activity and stability. Platinum nanoparticles were then incorporated into the MCM-41. The Pt/MCM-41 catalyst showed 96% yield for C8+ hydrocarbons and the catalytic performance was stable over four reaction cycles of 20 hour each. The reaction pathways for the production of long-chain hydrocarbons is probed with a combination of infrared spectroscopy and steady-state reaction experiments. It is proposed that 2MF and butanal go through hydroalkylation first on the acid site followed by hydrodeoxygenation to produce the hydrocarbon fuels.

Synthesis of surface-anchored DNA-polymer bioconjugates using reversible addition-fragmentation chain transfer polymerization.

PubMed

He, Peng; He, Lin

2009-07-13

We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.

Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.

PubMed

Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W

2007-04-01

Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.

Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

PubMed

Bridge, Julia A

2017-01-01

The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

Reaction pathways of propene pyrolysis.

PubMed

Qu, Yena; Su, Kehe; Wang, Xin; Liu, Yan; Zeng, Qingfeng; Cheng, Laifei; Zhang, Litong

2010-05-01

The gas-phase reaction pathways in preparing pyrolytic carbon with propene pyrolysis have been investigated in detail with a total number of 110 transition states and 50 intermediates. The structure of the species was determined with density functional theory at B3PW91/6-311G(d,p) level. The transition states and their linked intermediates were confirmed with frequency and the intrinsic reaction coordinates analyses. The elementary reactions were explored in the pathways of both direct and the radical attacking decompositions. The energy barriers and the reaction energies were determined with accurate model chemistry method at G3(MP2) level after an examination of the nondynamic electronic correlations. The heat capacities and entropies were obtained with statistical thermodynamics. The Gibbs free energies at 298.15 K for all the reaction steps were reported. Those at any temperature can be developed with classical thermodynamics by using the fitted (as a function of temperature) heat capacities. It was found that the most favorable paths are mainly in the radical attacking chain reactions. The chain was proposed with 26 reaction steps including two steps of the initialization of the chain to produce H and CH(3) radicals. For a typical temperature (1200 K) adopted in the experiments, the highest energy barriers were found in the production of C(3) to be 203.4 and 193.7 kJ/mol. The highest energy barriers for the production of C(2) and C were found 174.1 and 181.4 kJ/mol, respectively. These results are comparable with the most recent experimental observation of the apparent activation energy 201.9 +/- 0.6 or 137 +/- 25 kJ/mol. Copyright 2010 Wiley Periodicals, Inc.

TH-B-BRC-00: How to Identify and Resolve Potential Clinical Errors Before They Impact Patients Treatment: Lessons Learned

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

2016-06-15

Radiation treatment consists of a chain of events influenced by the quality of machine operation, beam data commissioning, machine calibration, patient specific data, simulation, treatment planning, imaging and treatment delivery. There is always a chance that the clinical medical physicist may make or fail to detect an error in one of the events that may impact on the patient’s treatment. In the clinical scenario, errors may be systematic and, without peer review, may have a low detectability because they are not part of routine QA procedures. During treatment, there might be errors on machine that needs attention. External reviews ofmore » some of the treatment delivery components by independent reviewers, like IROC, can detect errors, but may not be timely. The goal of this session is to help junior clinical physicists identify potential errors as well as the approach of quality assurance to perform a root cause analysis to find and eliminate an error and to continually monitor for errors. A compilation of potential errors will be presented by examples of the thought process required to spot the error and determine the root cause. Examples may include unusual machine operation, erratic electrometer reading, consistent lower electron output, variation in photon output, body parts inadvertently left in beam, unusual treatment plan, poor normalization, hot spots etc. Awareness of the possibility and detection of error in any link of the treatment process chain will help improve the safe and accurate delivery of radiation to patients. Four experts will discuss how to identify errors in four areas of clinical treatment. D. Followill, NIH grant CA 180803.« less

TH-B-BRC-01: How to Identify and Resolve Potential Clinical Errors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Das, I.

2016-06-15

Radiation treatment consists of a chain of events influenced by the quality of machine operation, beam data commissioning, machine calibration, patient specific data, simulation, treatment planning, imaging and treatment delivery. There is always a chance that the clinical medical physicist may make or fail to detect an error in one of the events that may impact on the patient’s treatment. In the clinical scenario, errors may be systematic and, without peer review, may have a low detectability because they are not part of routine QA procedures. During treatment, there might be errors on machine that needs attention. External reviews ofmore » some of the treatment delivery components by independent reviewers, like IROC, can detect errors, but may not be timely. The goal of this session is to help junior clinical physicists identify potential errors as well as the approach of quality assurance to perform a root cause analysis to find and eliminate an error and to continually monitor for errors. A compilation of potential errors will be presented by examples of the thought process required to spot the error and determine the root cause. Examples may include unusual machine operation, erratic electrometer reading, consistent lower electron output, variation in photon output, body parts inadvertently left in beam, unusual treatment plan, poor normalization, hot spots etc. Awareness of the possibility and detection of error in any link of the treatment process chain will help improve the safe and accurate delivery of radiation to patients. Four experts will discuss how to identify errors in four areas of clinical treatment. D. Followill, NIH grant CA 180803.« less

Feature selection using a one dimensional naïve Bayes' classifier increases the accuracy of support vector machine classification of CDR3 repertoires.

PubMed

Cinelli, Mattia; Sun, Yuxin; Best, Katharine; Heather, James M; Reich-Zeliger, Shlomit; Shifrut, Eric; Friedman, Nir; Shawe-Taylor, John; Chain, Benny

2017-04-01

Somatic DNA recombination, the hallmark of vertebrate adaptive immunity, has the potential to generate a vast diversity of antigen receptor sequences. How this diversity captures antigen specificity remains incompletely understood. In this study we use high throughput sequencing to compare the global changes in T cell receptor β chain complementarity determining region 3 (CDR3β) sequences following immunization with ovalbumin administered with complete Freund's adjuvant (CFA) or CFA alone. The CDR3β sequences were deconstructed into short stretches of overlapping contiguous amino acids. The motifs were ranked according to a one-dimensional Bayesian classifier score comparing their frequency in the repertoires of the two immunization classes. The top ranking motifs were selected and used to create feature vectors which were used to train a support vector machine. The support vector machine achieved high classification scores in a leave-one-out validation test reaching >90% in some cases. The study describes a novel two-stage classification strategy combining a one-dimensional Bayesian classifier with a support vector machine. Using this approach we demonstrate that the frequency of a small number of linear motifs three amino acids in length can accurately identify a CD4 T cell response to ovalbumin against a background response to the complex mixture of antigens which characterize Complete Freund's Adjuvant. The sequence data is available at www.ncbi.nlm.nih.gov/sra/?term¼SRP075893 . The Decombinator package is available at github.com/innate2adaptive/Decombinator . The R package e1071 is available at the CRAN repository https://cran.r-project.org/web/packages/e1071/index.html . b.chain@ucl.ac.uk. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press.

Thermochemistry analyses for transformation of C6 glucose compound into C9, C12 and C15 alkanes using density functional theory

NASA Astrophysics Data System (ADS)

Verma, Anand Mohan; Kishore, Nanda

2017-02-01

The hydrolysis of cellulose fraction of biomass yields C6 glucose which further can be transformed into long-chain hydrocarbons by C-C coupling. In this study, C6 glucose is transformed into three chain alkanes, namely, C9, C12 and C15 using C-C coupling reactions under the gas and aqueous phase milieus. The geometry optimisation and vibrational frequency calculations are carried out at well-known hybrid-GGA functional, B3LYP with the basis set of 6-31+g(d,p) under the density functional theory framework. The single point energetics are calculated at M05-2X/6-311+g(3df,2p) level of theory. All thermochemical properties are calculated over a wide range of temperature between 300 and 900 K at an interval of 100 K. The thermochemistry suggested that the aqueous phase behaviour is suitable for the hydrolysis of sugar into long-chain alkanes compared to gas-phase environment. The hydrodeoxygenation reactions under each reaction pathway are found as most favourable reactions in both phases; however, aqueous phase dominates over gas phase in all discussed thermodynamic parameters.

Vanadium accelerates polymerase chain reaction and expands the applicability of forensic DNA testing.

PubMed

Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko

2013-05-01

Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Kinetics of the Br2-CH3CHO Photochemical Chain Reaction

NASA Technical Reports Server (NTRS)

Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.

1997-01-01

Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).

ε-Poly-l-Lysine Peptide Chain Length Regulated by the Linkers Connecting the Transmembrane Domains of ε-Poly-l-Lysine Synthetase

PubMed Central

Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime

2014-01-01

ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. PMID:24907331

Self-healing polymers and composites based on thermal activation

NASA Astrophysics Data System (ADS)

Wang, Ying; Bolanos, Ed; Wudl, Fred; Hahn, Thomas; Kwok, Nathan

2007-04-01

Structural polymer composites are susceptible to premature failure in the form of microcracks in the matrix. Although benign initially when they form, these matrix cracks tend to coalesce and lead in service to critical damage modes such as ply delamination. The matrix cracks are difficult to detect and almost impossible to repair because they form inside the composite laminate. Therefore, polymers with self-healing capability would provide a promising potential to minimize maintenance costs while extending the service lifetime of composite structures. In this paper we report on a group of polymers and their composites which exhibit mendable property upon heating. The failure and healing mechanisms of the polymers involve Diels-Alder (DA) and retro-Diels-Alder (RDA) reactions on the polymer back-bone chain, which are thermally reversible reactions requiring no catalyst. The polymers exhibited good healing property in bulk form. Composite panels were prepared by sandwiching the monomers between carbon fiber fabric layers and cured in autoclave. Microcracks were induced on the resin-rich surface of composite with Instron machine at room temperature by holding at 1% strain for 1 min. The healing ability of the composite was also demonstrated by the disappearance of microcracks after heating. In addition to the self-healing ability, the polymers and composites also exhibited shape memory property. These unique properties may provide the material multi-functional applications. Resistance heating of traditional composites and its applicability in self-healing composites is also studied to lay groundwork for a fully integrated self-healing composite.

A stochastic DNA walker that traverses a microparticle surface

NASA Astrophysics Data System (ADS)

Jung, C.; Allen, P. B.; Ellington, A. D.

2016-02-01

Molecular machines have previously been designed that are propelled by DNAzymes, protein enzymes and strand displacement. These engineered machines typically move along precisely defined one- and two-dimensional tracks. Here, we report a DNA walker that uses hybridization to drive walking on DNA-coated microparticle surfaces. Through purely DNA:DNA hybridization reactions, the nanoscale movements of the walker can lead to the generation of a single-stranded product and the subsequent immobilization of fluorescent labels on the microparticle surface. This suggests that the system could be of use in analytical and diagnostic applications, similar to how strand exchange reactions in solution have been used for transducing and quantifying signals from isothermal molecular amplification assays. The walking behaviour is robust and the walker can take more than 30 continuous steps. The traversal of an unprogrammed, inhomogeneous surface is also due entirely to autonomous decisions made by the walker, behaviour analogous to amorphous chemical reaction network computations, which have been shown to lead to pattern formation.

Optimization of a Multi-Product Intra-Supply Chain System with Failure in Rework.

PubMed

Chiu, Singa Wang; Chen, Shin-Wei; Chang, Chih-Kai; Chiu, Yuan-Shyi Peter

2016-01-01

Globalization has created tremendous opportunities, but also made business environment highly competitive and turbulent. To gain competitive advantage, management of present-day transnational firms always seeks options to trim down various transaction and coordination costs, especially in the area of controllable intra-supply chain system. This study investigates a multi-product intra-supply chain system with failure in rework. To achieve maximum machine utilization, multiple products are fabricated in succession on a single machine. During the process, production of some defective items is inevitable. Reworking of nonconforming items is used to reduce the quality cost in production and achieving the goal of lower overall production cost. Because reworks are sometimes unsuccessful, failures in rework are also considered in this study. Finished goods for each product are transported to the sales offices when the entire production lot is quality assured after rework. A multi-delivery policy is used, wherein fixed quantity n installments of the finished lot are transported at fixed intervals during delivery time. The objective is to jointly determine the common production cycle time and the number of deliveries needed to minimize the long-term expected production-inventory-delivery costs for the problem. With the help of a mathematical model along with optimization technique, the optimal production-shipment policy is obtained. We have used a numerical example to demonstrate applicability of the result of our research.

Optimization of a Multi–Product Intra-Supply Chain System with Failure in Rework

PubMed Central

2016-01-01

Globalization has created tremendous opportunities, but also made business environment highly competitive and turbulent. To gain competitive advantage, management of present-day transnational firms always seeks options to trim down various transaction and coordination costs, especially in the area of controllable intra-supply chain system. This study investigates a multi–product intra-supply chain system with failure in rework. To achieve maximum machine utilization, multiple products are fabricated in succession on a single machine. During the process, production of some defective items is inevitable. Reworking of nonconforming items is used to reduce the quality cost in production and achieving the goal of lower overall production cost. Because reworks are sometimes unsuccessful, failures in rework are also considered in this study. Finished goods for each product are transported to the sales offices when the entire production lot is quality assured after rework. A multi-delivery policy is used, wherein fixed quantity n installments of the finished lot are transported at fixed intervals during delivery time. The objective is to jointly determine the common production cycle time and the number of deliveries needed to minimize the long–term expected production–inventory–delivery costs for the problem. With the help of a mathematical model along with optimization technique, the optimal production–shipment policy is obtained. We have used a numerical example to demonstrate applicability of the result of our research. PMID:27918588

Recoil-α-fission and recoil-α-α-fission events observed in the reaction 48Ca + 243Am

NASA Astrophysics Data System (ADS)

Forsberg, U.; Rudolph, D.; Andersson, L.-L.; Di Nitto, A.; Düllmann, Ch. E.; Fahlander, C.; Gates, J. M.; Golubev, P.; Gregorich, K. E.; Gross, C. J.; Herzberg, R.-D.; Heßberger, F. P.; Khuyagbaatar, J.; Kratz, J. V.; Rykaczewski, K.; Sarmiento, L. G.; Schädel, M.; Yakushev, A.; Åberg, S.; Ackermann, D.; Block, M.; Brand, H.; Carlsson, B. G.; Cox, D.; Derkx, X.; Dobaczewski, J.; Eberhardt, K.; Even, J.; Gerl, J.; Jäger, E.; Kindler, B.; Krier, J.; Kojouharov, I.; Kurz, N.; Lommel, B.; Mistry, A.; Mokry, C.; Nazarewicz, W.; Nitsche, H.; Omtvedt, J. P.; Papadakis, P.; Ragnarsson, I.; Runke, J.; Schaffner, H.; Schausten, B.; Shi, Yue; Thörle-Pospiech, P.; Torres, T.; Traut, T.; Trautmann, N.; Türler, A.; Ward, A.; Ward, D. E.; Wiehl, N.

2016-09-01

Products of the fusion-evaporation reaction 48Ca + 243Am were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt, Germany. Amongst the detected thirty correlated α-decay chains associated with the production of element Z = 115, two recoil-α-fission and five recoil- α- α-fission events were observed. The latter five chains are similar to four such events reported from experiments performed at the Dubna gas-filled separator, and three such events reported from an experiment at the Berkeley gas-filled separator. The four chains observed at the Dubna gas-filled separator were assigned to start from the 2n-evaporation channel 289115 due to the fact that these recoil- α- α-fission events were observed only at low excitation energies. Contrary to this interpretation, we suggest that some of these recoil- α- α-fission decay chains, as well as some of the recoil- α- α-fission and recoil-α-fission decay chains reported from Berkeley and in this article, start from the 3n-evaporation channel 288115.

IgE reactivity to alpha1 and alpha2 chains of bovine type 1 collagen in children with bovine gelatin allergy.

PubMed

Sakaguchi, M; Hori, H; Hattori, S; Irie, S; Imai, A; Yanagida, M; Miyazawa, H; Toda, M; Inouye, S

1999-09-01

Anaphylactic reactions to measles, mumps, and rubella vaccines, including gelatin as a stabilizer, have been reported. It had been found that most of these reactions to live vaccines are caused by the bovine gelatin included in these vaccines. Gelatin mainly includes denatured type I collagen, which consists of alpha1 and alpha2 chains. The current study was designed to investigate the IgE reactivity to alpha1 and alpha2 chains of bovine type I collagen in gelatin-sensitive children. Serum samples were taken from 10 children who had anaphylaxis to the vaccines and high levels of specific IgE to bovine gelatin. Bovine type I collagen was isolated from bovine skin and then separated to alpha1 and alpha2 chains by column chromatography. IgE reactivity to denatured type I collagen and its alpha1 and alpha2 chains was analyzed by immunoblotting, ELISA, and histamine release from the mast cells passive sensitized with IgE antibodies in pooled serum of the children. All children had specific IgE to bovine type I collagen. Furthermore, IgE antibodies in their sera reacted with the alpha;2 chain but not with the alpha1 chain. Similarly, the mast cells sensitized with pooled sera in the children showed alpha2 chain-specific histamine release but not alpha1 chain-specific histamine release. In gelatin allergy denatured bovine type I collagen is a major allergen and IgE-binding sites exist in the alpha2 chain of type I collagen.

Detecting Service Chains and Feature Interactions in Sensor-Driven Home Network Services

PubMed Central

Inada, Takuya; Igaki, Hiroshi; Ikegami, Kosuke; Matsumoto, Shinsuke; Nakamura, Masahide; Kusumoto, Shinji

2012-01-01

Sensor-driven services often cause chain reactions, since one service may generate an environmental impact that automatically triggers another service. We first propose a framework that can formalize and detect such service chains based on ECA (event, condition, action) rules. Although the service chain can be a major source of feature interactions, not all service chains lead to harmful interactions. Therefore, we then propose a method that identifies feature interactions within the service chains. Specifically, we characterize the degree of deviation of every service chain by evaluating the gap between expected and actual service states. An experimental evaluation demonstrates that the proposed method successfully detects 11 service chains and 6 feature interactions within 7 practical sensor-driven services. PMID:23012499

Training and generalization of laundry skills: a multiple probe evaluation with handicapped persons.

PubMed Central

Thompson, T J; Braam, S J; Fugua, R W

1982-01-01

An instructional procedure composed of a graded sequence of prompts and token reinforcement was used to train a complex chain of behaviors which included sorting, washing, and drying clothes. A multiple probe design with sequential instruction across seven major components of the laundering routine was used to demonstrate experimental control. Students were taught to launder clothing using machines located in their school and generalization was assessed later on machines located in the public laundromat. A comparison of students' laundry skills with those of normal peers indicated similar levels of proficiency. Follow-up probes demonstrated maintenance of laundry skills over a 10-month period. PMID:7096228

Training and generalization of laundry skills: a multiple probe evaluation with handicapped persons.

PubMed

Thompson, T J; Braam, S J; Fugua, R W

1982-01-01

An instructional procedure composed of a graded sequence of prompts and token reinforcement was used to train a complex chain of behaviors which included sorting, washing, and drying clothes. A multiple probe design with sequential instruction across seven major components of the laundering routine was used to demonstrate experimental control. Students were taught to launder clothing using machines located in their school and generalization was assessed later on machines located in the public laundromat. A comparison of students' laundry skills with those of normal peers indicated similar levels of proficiency. Follow-up probes demonstrated maintenance of laundry skills over a 10-month period.

Whole Protein Native Fitness Potentials

NASA Astrophysics Data System (ADS)

Faraggi, Eshel; Kloczkowski, Andrzej

2013-03-01

Protein structure prediction can be separated into two tasks: sample the configuration space of the protein chain, and assign a fitness between these hypothetical models and the native structure of the protein. One of the more promising developments in this area is that of knowledge based energy functions. However, standard approaches using pair-wise interactions have shown shortcomings demonstrated by the superiority of multi-body-potentials. These shortcomings are due to residue pair-wise interaction being dependent on other residues along the chain. We developed a method that uses whole protein information filtered through machine learners to score protein models based on their likeness to native structures. For all models we calculated parameters associated with the distance to the solvent and with distances between residues. These parameters, in addition to energy estimates obtained by using a four-body-potential, DFIRE, and RWPlus were used as training for machine learners to predict the fitness of the models. Testing on CASP 9 targets showed that our method is superior to DFIRE, RWPlus, and the four-body potential, which are considered standards in the field.

Ergonomic Evaluation of Battery Powered Portable Cotton Picker

NASA Astrophysics Data System (ADS)

Dixit, A.; Manes, G. S.; Singh, A.; Prakash, A.; Mahal, J. S.

2012-09-01

Ergonomic evaluation of battery powered portable manual cotton picker was carried out on two subjects for three cotton varieties and was compared against manual method of picking. It is a hand operated machine and has a pair of chain with small sharp edged teeth and sprockets and is operated by a light weight 12 V battery. Cotton gets entangled with the chain and is collected and guided into the collection bag. Average heart rate, oxygen consumption, workload, energy expenditure was more in case of cotton picking by manual cotton picker as compared to manual picking for both the subjects for all three cotton variety types. Oxygen consumption varied from 0.81 to 0.97 l/min, workload varied from 36.32 to 46.16 W and energy expenditure varied from 16.83 to 20.33 kJ/min for both the subject in case of machine picking for all three cotton varieties. The maximum discomfort experienced by the subjects during picking cotton by manual cotton picker was in right wrist palm, right forearm, upper and lower back, left shoulder and in lower legs and both feet.

Ionizing radiation-induced destruction of benzene and dienes in aqueous media.

PubMed

Al-Sheikhly, Mohamad; Poster, Dianne L; An, Jung-Chul; Neta, Pedatsur; Silverman, Joseph; Huie, Robert E

2006-05-01

Pulse radiolysis with spectrophotometric and conductometric detection was utilized to study the formation and reactions of radicals from benzene and dienes in aqueous solutions. The benzene OH adduct, *C6H6OH, reacts with O2 (k = 3 x 10(8) L mol(-1) s(-1)) in a reversible reaction. The peroxyl radical, HOC6H6O2*, undergoes O2*- elimination, bimolecular decay, and reaction with benzene to initiate a chain reaction, depending on the dose rate, benzene concentration, and pH. The occurrence of the chain reaction is demonstrated in low-dose-rate gamma radiolysis experiments where the consumption of O2 was monitored. 1,4-Cyclohexadiene, 1,4-hexadiene, and 1,4-pentadiene form OH-adducts and undergo H-abstraction by O*- radicals. The OH-adducts react with O2 to form peroxyl radicals. These peroxyl radicals, however, do not undergo unimolecular O2*- elimination but rather decay by second-order processes, which lead to subsequent steps of O2*- elimination.

The possibility of a new resonance of three-body linear chain structure in the reaction 12C+16O at Ec.mapprox-33.5MeV

NASA Astrophysics Data System (ADS)

Kong, Xiangjing; P, L. Li; J, J. Kolata; A, Morsad; L, Goetting; R, A. Kryger; S, Dixit; R, Tighe; W, Chune

1990-05-01

There is a peak in the excitation function of total cross section of low energy α-particles in the reaction 12C+16O at Ec.m approx33.5MeV. The experimental distribution of α-particle emitted event has been obtained. The result of theoretical calculation roughly agrees with experimental data, gives an orientation where three-body resonances can be expected, and the information on internal structure of three-body linear chain molecule.

Gel Point Suppression in RAFT Polymerization of Pure Acrylic Cross-Linker Derived from Soybean Oil.

PubMed

Yan, Mengguo; Huang, Yuerui; Lu, Mingjia; Lin, Fang-Yi; Hernández, Nacú B; Cochran, Eric W

2016-08-08

Here we report the reversible addition-fragmentation chain transfer (RAFT) polymerization of acrylated epoxidized soybean oil (AESO), a cross-linker molecule, to high conversion (>50%) and molecular weight (>100 kDa) without macrogelation. Surprisingly, gelation is suppressed in this system far beyond the expectations predicated both on Flory-Stockmeyer theory and multiple other studies of RAFT polymerization featuring cross-linking moieties. By varying AESO and initiator concentrations, we show how intra- versus intermolecular cross-linking compete, yielding a trade-off between the degree of intramolecular linkages and conversion at gel point. We measured polymer chain characteristics, including molecular weight, chain dimensions, polydispersity, and intrinsic viscosity, using multidetector gel permeation chromatography and NMR to track polymerization kinetics. We show that not only the time and conversion at macrogelation, but also the chain architecture, is largely affected by these reaction conditions. At maximal AESO concentration, the gel point approaches that predicted by the Flory-Stockmeyer theory, and increases in an exponential fashion as the AESO concentration decreases. In the most dilute solutions, macrogelation cannot be detected throughout the entire reaction. Instead, cyclization/intramolecular cross-linking reactions dominate, leading to microgelation. This work is important, especially in that it demonstrates that thermoplastic rubbers could be produced based on multifunctional renewable feedstocks.

Bismuth(III) trifluoromethanesulfonate catalyzed ring opening reaction of mono epoxy oleochemicals to form keto and diketo derivatives

USDA-ARS?s Scientific Manuscript database

Using a catalytic system, methyl oleate is transformed into long chain keto and diketo derivatives via an epoxide route. Methyl 9(10)-oxooctadecanoate and methyl 9,10-dioxooctadecanoate were made by a ring opening reaction of epoxidized methyl oleate using bismuth triflate catalyst. Lower reaction t...

Direct RNA detection without nucleic acid purification and PCR: Combining sandwich hybridization with signal amplification based on branched hybridization chain reaction.

PubMed

Xu, Yao; Zheng, Zhi

2016-05-15

We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.

Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

PubMed

Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

2008-03-01

Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

Computational study on UV curing characteristics in nanoimprint lithography: Stochastic simulation

NASA Astrophysics Data System (ADS)

Koyama, Masanori; Shirai, Masamitsu; Kawata, Hiroaki; Hirai, Yoshihiko; Yasuda, Masaaki

2017-06-01

A computational simulation model of UV curing in nanoimprint lithography based on a simplified stochastic approach is proposed. The activated unit reacts with a randomly selected monomer within a critical reaction radius. Cluster units are chained to each other. Then, another monomer is activated and the next chain reaction occurs. This process is repeated until a virgin monomer disappears within the reaction radius or until the activated monomers react with each other. The simulation model well describes the basic UV curing characteristics, such as the molecular weight distributions of the reacted monomers and the effect of the initiator concentration on the conversion ratio. The effects of film thickness on UV curing characteristics are also studied by the simulation.

Problem-Solving Test: Pyrosequencing

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2013-01-01

Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…

Hydrolysis of the amorphous cellulose in cotton-based paper.

PubMed

Stephens, Catherine H; Whitmore, Paul M; Morris, Hannah R; Bier, Mark E

2008-04-01

Hydrolysis of cellulose in Whatman no. 42 cotton-based paper was studied using gel permeation chromatography (GPC), electrospray ionization-mass spectrometry (ESI-MS), and uniaxial tensile testing to understand the course and kinetics of the reaction. GPC results suggested that scission reactions passed through three stages. Additionally, the evolution of soluble oligomers in the ESI-MS data and the steady course of strength loss showed that the hydrolysis reaction occurred at a constant rate. These findings are explained with a more detailed description of the cellulose hydrolysis, which includes multiple chain scissions on amorphous segments. The breaks occur with increasing frequency near the ends of amorphous segments, where chains protrude from crystalline domains. Oligomers unattached to crystalline domains are eventually created. Late-stage reactions near the ends of amorphous segments produce a kinetic behavior that falsely suggests that hydrolysis had ceased. Monte Carlo simulations of cellulose degradation corroborated the experimental findings.

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

[The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

PubMed

D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

1993-01-01

The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

Esterification of fatty acids using nylon-immobilized lipase in n-hexane: kinetic parameters and chain-length effects.

PubMed

Zaidi, A; Gainer, J L; Carta, G; Mrani, A; Kadiri, T; Belarbi, Y; Mir, A

2002-02-28

The esterification of long-chain fatty acids in n-hexane catalyzed by nylon-immobilized lipase from Candida rugosa has been investigated. Butyl oleate (22 carbon atoms), oleyl butyrate (22 carbon atoms) and oleyl oleate (36 carbon atoms) were produced at maximum reaction rates of approximately equal to 60 mmol h(-1) g(-1) immobilized enzyme when the substrates were present in equimolar proportions at an initial concentration of 0.6 mol l(-1). The observed kinetic behavior of all the esterification reactions is found to follow a ping-pong bi-bi mechanism with competitive inhibition by both substrates. The effect of the chain-length of the fatty acids and the alcohols could be correlated to some mechanistic models, in accordance with the calculated kinetic parameters.

Copolymer Synthesis and Characterization by Post-Polymerization Modification

NASA Astrophysics Data System (ADS)

Galvin, Casey James

This PhD thesis examines the physical behavior of surface-grafted polymer assemblies (SGPAs) derived from post-polymerization modification (PPM) reactions in aqueous and vapor enriched environments, and offers an alternative method of creating SGPAs using a PPM approach. SGPAs comprise typically polymer chains grafted covalently to solid substrates. These assemblies show promise in a number of applications and technologies due to the stability imparted by the covalent graft and ability to modify interfacial properties and stability. SGPAs also offer a set of rich physics to explore in fundamental investigations as a result of confining macromolecules to a solid substrate. PPM reactions (also called polymer analogous reactions) apply small molecule organic chemistry reactions to the repeat units of polymer chains in order to generate new chemistries. By applying a PPM strategy to SGPAs, a wide variety of functional groups can be introduced into a small number of well-studied and well-behaved model polymer systems. This approach offers the advantage of holding constant other properties of the SGPA (e.g., molecular weight, MW, and grafting density, sigma) to isolate the effect of chemistry on physical behavior. Using a combination of PPM and fabrication methods that facilitate the formation of SPGAs with position-dependent gradual variation of sigma on flat impenetrable substrate, the influence of polymer chemistry and sigma is examined on the stability of weak polyelectrolyte brushes in aqueous environments at different pH levels. Degrafting of polymer chains in SGPAs exhibits a complex dependence on side chain chemistry, sigma, pH and the charge fraction (alpha) within the brush. Results of these experiments support a proposed mechanism of degrafting, wherein extension of the grafted chains away from the substrate generates tension along the polymer backbone, which activates the grafting chemistry for hydrolysis. The implications of these findings are important in developing technologies that use SGPAs in aqueous environments, and point to a need for potential alternative grafting chemistries. The behavior of SGPAs in vapor environments remains an underexplored phenomenon. By changing systematically the chemistry of SGPAs derived from a parent sample, the influence of side chain functional groups on the swelling of weak and strong polyelectrolyte brushes in the presence of water, methanol and ethanol vapors is explored. The extent of swelling and solvent uptake depends strongly on the chemistry in the polymer side chain and of the solvent. Despite bearing a permanent electrostatic charge in the side chain, the strong polyelectrolyte brushes exhibit no behavior typical of polyelectrolytes in water due to no dissociation of the counterion. Of particular interest is the behavior in humid environments of an SGPA bearing a zwitterionic group in its side chain, which results in exposure of electrostatic charges without counterions. Using substrates bearing the aforementioned sigma gradient of polymeric grafts, evidence of inter- and intramolecular complex formation is presented. Finally, a method of developing SGPAs by polymerizing bulk polymer chains through surface-grafted monomers (SGMs) is described. The SGMs are incorporated onto a solid substrate using the same PPM reaction employed in the degrafting and vapor swelling experiments, highlighting the versatility of PPM. The thickness of these SGPAs is correlated to the bulk polymer chains MW, suggesting this technique can be used in existing industrial bulk polymerization processes.

INFLUENCE OF THE KRAMER EFFECT ON ADSORPTION ON METALS.

DTIC Science & Technology

ADSORPTION, *ALLOYS, *FILMS, *METALS, *PROCESSING, ACIDS, ALCOHOLS , CYCLOHEXANES, EXCHANGE REACTIONS , FATTY ACIDS, HEAT TREATMENT , LEAD ALLOYS...LINOLENIC ACID, MACHINING , MEASUREMENT, MONOMOLECULAR FILMS, OLEIC ACID, SURFACES, TIN ALLOYS, WATER

Reducing the illegal sale of cigarettes to minors.

PubMed

Altman, D G; Foster, V; Rasenick-Douss, L; Tye, J B

1989-01-06

This study reports on an effort to stop the illegal sale of cigarettes to minors. In Santa Clara County, Calif, 412 stores and 30 vending machines were visited by 18 minors aged 14 through 16 years with the intent to purchase cigarettes; they were successful at 74% of the stores and 100% of the vending machines. After an aggressive six-month campaign using communitywide media, direct merchant education, contact with the chief executive officers of chain stores and franchise operations owned by major companies, and grassroots work with community organizations, the percentage of stores with illegal over-the-counter sale of cigarettes to minors was reduced to 39%. Sales from vending machines were not reduced. While much remains to be accomplished in stopping the illegal sale of tobacco to minors, data from this study illustrate that a well-designed community and merchant education campaign can significantly reduce such sales.

Experimental investigations of mechanical and reaction responses for drop-weight impacted energetic particles

NASA Astrophysics Data System (ADS)

Bao, Xiao-Wei; Wu, Yan-Qing; Wang, Ming-Yang; Huang, Feng-Lei

2017-02-01

Low-velocity drop-weight impact experiments on individual and multiple Cyclotetramethylene tetranitramine (HMX) energetic particles were performed using a modified drop-weight machine equipped with high-speed photography components. Multiple particles experienced more severe burning reactions than an individual particle. Comparisons between impacted salt and HMX particle show that jetting in HMX is mainly due to the motion of fragmented particles driven by gaseous reaction products. Velocity of jetting, flame propagation, and area expansion were measured via image processing, making it possible to quantify the chemical reaction or mechanical deformation violence at different stages.

A Framework to Guide the Assessment of Human-Machine Systems.

PubMed

Stowers, Kimberly; Oglesby, James; Sonesh, Shirley; Leyva, Kevin; Iwig, Chelsea; Salas, Eduardo

2017-03-01

We have developed a framework for guiding measurement in human-machine systems. The assessment of safety and performance in human-machine systems often relies on direct measurement, such as tracking reaction time and accidents. However, safety and performance emerge from the combination of several variables. The assessment of precursors to safety and performance are thus an important part of predicting and improving outcomes in human-machine systems. As part of an in-depth literature analysis involving peer-reviewed, empirical articles, we located and classified variables important to human-machine systems, giving a snapshot of the state of science on human-machine system safety and performance. Using this information, we created a framework of safety and performance in human-machine systems. This framework details several inputs and processes that collectively influence safety and performance. Inputs are divided according to human, machine, and environmental inputs. Processes are divided into attitudes, behaviors, and cognitive variables. Each class of inputs influences the processes and, subsequently, outcomes that emerge in human-machine systems. This framework offers a useful starting point for understanding the current state of the science and measuring many of the complex variables relating to safety and performance in human-machine systems. This framework can be applied to the design, development, and implementation of automated machines in spaceflight, military, and health care settings. We present a hypothetical example in our write-up of how it can be used to aid in project success.

Apparatus and method for polymer synthesis using arrays

DOEpatents

Brennan, Thomas M.

1995-01-01

A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24) , and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31) , downstream from the nozzles (22) , sweeps the common chamber ( 31 ) of toxic fumes emitted by the reagents. Each reaction well (26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.

Apparatus and method for polymer synthesis using arrays

DOEpatents

Brennan, Thomas M.

1996-01-01

A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24), and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31), downstream from the nozzles (22), sweeps the common chamber (31) of toxic fumes emitted by the reagents. Each reaction well ( 26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82 ) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.

Diamond tool machining of materials which react with diamond

DOEpatents

Lundin, R.L.; Stewart, D.D.; Evans, C.J.

1992-04-14

An apparatus is described for the diamond machining of materials which detrimentally react with diamond cutting tools in which the cutting tool and the workpiece are chilled to very low temperatures. This chilling halts or retards the chemical reaction between the workpiece and the diamond cutting tool so that wear rates of the diamond tool on previously detrimental materials are comparable with the diamond turning of materials which do not react with diamond. 1 figs.

New polymer systems: Chain extension by dianhydrides

NASA Technical Reports Server (NTRS)

Rhein, R. A.; Ingham, J. D.

1974-01-01

Three anhydrides provide effective chain extension of hydroxy-terminated polyalkylene oxides and polybutadienes. Novel feature of these anhydride reactants is that they are difunctional as anhydrides, but they are tetrafunctional if conditions are selected that lead to total esterification or reaction of all carboxyl groups.

Structure-property relationships in a series of diglycerol tetraether model lipids and their lyotropic assemblies: the effect of branching topology and chirality.

PubMed

Markowski, Thomas; Drescher, Simon; Meister, Annette; Blume, Alfred; Dobner, Bodo

2014-06-14

Three novel diglycerol tetraether lipids with one membrane-spanning chain have been synthesized. These lipids contain only two or four racemic methyl branches at selected positions of the hydrophobic chains in contrast to natural lipids from archaebacterial membranes with an isoprenoid substitution pattern. The insertion of the methyl moieties was realized starting from either (RS)-citronellyl bromide or the inexpensive methyl malonic acid ethyl ester. For chain elongation the Cu-catalysed Grignard coupling reaction was used. The preparation of diglycerol tetraethers was either performed by condensing suitable blocked monoglycerol diethers by Grubbs metathesis or by reaction of the transmembrane C32-chain with blocked glycerols followed by further alkylation steps. Finally, we could show that the resulting lipids can form closed lipid vesicles comparable to the optically pure counterparts. Therefore, these much simpler lipids compared to the natural lipids from archaebacterial membranes are also suitable for preparation of stable tailored liposomes.

RICIN-inhibitor design. Final report, 15 April 1993-14 April 1996

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schramm, V.L.

1996-05-01

The purpose of this proposal was to provide information which will permit the design of transition state inhibitors for ricin A-chain. The original goals were to solve the transition state structure based on kinetic isotope effects. Substrates were synthesized and the conditions for assays optimized to provide catalytic rates at least 1000 fold greater than those published prior to this work. Reliable assay methods have been established to permit routine assays for ricin A-chain. Substrate analogues for N-ribohydrolase reactions have been designed to establish whether the reaction involves leaving-group activation or oxycarbonium ion formation. Based on these results, leaving groupmore » activation is a major contributor and oxycarbonium-ion formation is a secondary contribution in the mechanism of catalysis by ricin A-chain. Using this information, the first submicromolar inhibitor of ricin A-chain has been synthesized, tested and kinetically characterized. The development of powerful inhibitors will be a direct extrapolation of these results.« less

ε-Poly-L-lysine peptide chain length regulated by the linkers connecting the transmembrane domains of ε-Poly-L-lysine synthetase.

PubMed

Hamano, Yoshimitsu; Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime

2014-08-01

ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Polyphosphate kinase: demonstration that short chain polyphosphate serves as a primer for the enzymatic synthesis of polyphosphate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robinson, N.A.; Wood, H.G.

1986-05-01

Polyphosphate (poly(P)) kinase, isolated from Propionibacterium shermanii, catalyzes the following reaction: poly(P/sub n/) + ATPin equilibriumpoly(P/sub n+1/) + ADP. The authors have purified this enzyme to 90% homogeneity and have shown it to be composed of 2-3 identical subunits of M/sub r/ 80,000. Investigation of the reaction mechanism by product analysis has revealed that the elongation phase is processive whereby successive elongation occurs without release of intermediate sizes until very long chains are formed. The initiation phase of synthesis has been investigated using (/sup 32/P) poly(P) primer of chain length 11-60. It is incorporated into long chain poly(P) and themore » /sup 32/P has been shown, by use of poly(P) glucokinase, to be localized at the end of the molecule. Calculation of average chain length based upon the incorporation of /sup 32/P, however, yields a value approx.3 fold higher than the value calculated by another method using poly(P) glucokinase. This result indicates that initiation of poly(P) synthesis occurs by at least one other route which does not involve short chain poly(P) primers. The effect of temperature and concentration of poly(P) primer upon the average chain length of poly(P) synthesized was also investigated. A general trend was observed in which the chain length of the synthesized poly(P) decreased as either temperature or concentration or primer was increased.« less

The Simplest Chronoscope V: A Theory of Dual Primary and Secondary Reaction Time Systems.

PubMed

Montare, Alberto

2016-12-01

Extending work by Montare, visual simple reaction time, choice reaction time, discriminative reaction time, and overall reaction time scores obtained from college students by the simplest chronoscope (a falling meterstick) method were significantly faster as well as significantly less variable than scores of the same individuals from electromechanical reaction timers (machine method). Results supported the existence of dual reaction time systems: an ancient primary reaction time system theoretically activating the V5 parietal area of the dorsal visual stream that evolved to process significantly faster sensory-motor reactions to sudden stimulations arising from environmental objects in motion, and a secondary reaction time system theoretically activating the V4 temporal area of the ventral visual stream that subsequently evolved to process significantly slower sensory-perceptual-motor reactions to sudden stimulations arising from motionless colored objects. © The Author(s) 2016.

[THE COMPARATIVE ANALYSIS OF EFFECTIVENESS OF QUICK TESTS IN DIAGNOSTIC OF INFLUENZA AND RESPIRATORY SYNCYTIAL VIRAL INFECTION IN CHILDREN].

PubMed

Petrova, E R; Sukhovetskaia, V P; Pisareva, M M; Maiorova, V G; Sverlova, M V; Danilenko, D M; Petrova, P A; Krivitskaia, V Z; Sominina, A A

2015-11-01

The analysis was implemented concerning diagnostic parameters of commercial quick tests (immune chromatographic tests BinaxNOW Influenza A&B and BinaxNow RSV Alere, Scarborough Inc., USA) under detection of antigens of influenza virus A and respiratory syncytial virus in clinical materials. The polymerase chain reaction in real-time and isolation ofviruses in cell cultures. The analysis of naso-pharyngeal smears from 116 children demonstrated that sensitivity and specifcity of detection of influenza virus A using device mariPOC in comparison with polymerase chain reaction made up to 93.8% and 99.0% correspondingly at total concordance of results of both techniques as 98.3%. At diagnosing of respiratory syncytial virus using device mariPOC parameters made up to 77.3%, 98.9% and 862% as compared with polymerase chain reaction. The sensitivity, specificity and total concordance of results of immune chromatographic tests BinaxNOW in comparison ofpolymerase chain reaction made up to 86.7%, 100% and 96.2% correspondingly at detection of influenza virus A and 80.9%, 97.4% and 91.6% correspondingly at detection of respiratory syncytial virus. In comparison with isolation technique in cell cultures sensitivity of system mariPOC and immune chromatographic tests proved to be in 1.3-1.4 times higher at detection of influenza virus A and in 1.7-2 times higher in case of isolation of respiratory syncytial virus. There is no statistically significant differences between diagnostic parameters received for mariPOC and immune chromatographic tests at diagnosing influenza virus A and respiratory syncytial viral infection.

Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

PubMed Central

Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

2010-01-01

Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

PubMed

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

2008-09-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

PubMed

Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

2015-07-01

Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Hot working behavior of selective laser melted and laser metal deposited Inconel 718

NASA Astrophysics Data System (ADS)

Bambach, Markus; Sizova, Irina

2018-05-01

The production of Nickel-based high-temperature components is of great importance for the transport and energy sector. Forging of high-temperature alloys often requires expensive dies, multiple forming steps and leads to forged parts with tolerances that require machining to create the final shape and a large amount of scrap. Additive manufacturing offers the possibility to print the desired shapes directly as net-shape components, requiring only little additional effort in machining. Especially for high-temperature alloys carrying a large amount of energy per unit mass, additive manufacturing could be more energy-efficient than forging if the energy contained in the machining scrap exceeds the energy needed for powder production and laser processing. However, the microstructure and performance of 3d-printed parts will not reach the level of forged material unless further expensive processes such as hot-isostatic pressing are used. Using the design freedom and possibilities to locally engineer material, additive manufacturing could be combined with forging operations to novel process chains, offering the possibility to reduce the number of forging steps and to create near-net shape forgings with desired local properties. Some innovative process chains combining additive manufacturing and forging have been patented recently, but almost no scientific knowledge on the workability of 3D printed preforms exists. The present study investigates the flow stress and microstructure evolution during hot working of pre-forms produced by laser powder deposition and selective laser melting (Figure 1) and puts forward a model for the flow stress.

Overview of Sustainability Studies of CNC Machining and LAM of Stainless Steel

NASA Astrophysics Data System (ADS)

Nyamekye, Patricia; Leino, Maija; Piili, Heidi; Salminen, Antti

Laser additive manufacturing (LAM), known also as 3D printing, is a powder bed fusion (PBF) type of additive manufacturing (AM) technology used to fabricate metal parts out of metal powder. The development of the technology from building prototype parts to functional parts has increased remarkably in 2000s. LAM of metals is promising technology that offers new opportunities to manufacturing and to resource efficiency. However, there is only few published articles about its sustainability. Aim in this study was to create supply chain model of LAM and CNC machining and create a methodology to carry out a life cycle inventory (LCI) data collection for these techniques. The methodology of the study was literature review and scenario modeling. The acquisition of raw material, production phase and transportations were used as basis of comparison. The modelled scenarios were fictitious and created for industries, like aviation and healthcare that often require swift delivery as well as customized parts. The results of this study showed that the use of LAM offers a possibility to reduce downtime in supply chains of spare parts and reduce part inventory more effectively than CNC machining. Also the gap between customers and business is possible to be shortened with LAM thus offering a possibility to reduce emissions due to less transportation. The results also indicated weight reduction possibility with LAM due to optimized part geometry which allow lesser amount of metallic powder to be used in making parts.

Dose-response relation between exposure to two types of hand-arm vibration and sensorineural perception of vibration.

PubMed

Virokannas, H

1995-05-01

31 railway workers and 32 lumberjacks were examined to compare the dose-response relation between the exposure to two types of hand-arm vibration and the sensory disturbances in peripheral nerves as evaluated by the vibration perception thresholds (VPTs). Clinical examinations were carried out that included measurements of the VPTs, and electroneuromyography (ENMG), and an inquiry to confirm the use of vibrating tools. Diseases of the central nervous system and neuropathies were checked by inquiry and a clinical examination, diabetes was excluded by a blood sample analysis, and the subjects with carpal tunnel syndrome confirmed with ENMG were excluded from the study. Lifetime use of hand held tamping machines (railway workers) and chain saws (lumberjacks) had a significant correlation with the VPTs at frequencies from 32 to 500 Hz. The increase of the VPTs (250 Hz) in relation to use of vibrating tools was 1.8-fold higher on average in the whole group and 2.3-fold higher in the young (< 45) railway workers who had used hand held tamping machines, than in the corresponding groups of lumberjacks, who had used chain saws, whereas the frequency weighted acceleration of vibration in tamping machines was fourfold. There was a significant dose-response relation between the exposure to hand-arm vibration and the VPTs. The VPTs as a function of the frequency weighted acceleration of vibration and the exposure to vibration gave promising results for assessment of the risk of damage to sensory nerves induced by vibration.

LETTER TO THE EDITOR: Single-species reactions on a random catalytic chain

NASA Astrophysics Data System (ADS)

Oshanin, G.; Burlatsky, S. F.

2002-11-01

We present an exact solution for a catalytically activated annihilation A + A → 0 reaction taking place on a one-dimensional chain in which some segments (placed at random, with mean concentration p) possess special, catalytic properties. An annihilation reaction takes place as soon as any two A particles land from the reservoir onto two vacant sites at the extremities of the catalytic segment, or when any A particle lands onto a vacant site on a catalytic segment while the site at the other extremity of this segment is already occupied by another A particle. We find that the disorder-average pressure P(quen) per site of such a chain is given by P(quen) = P(Lan) + β-1F, where P(Lan) = β-1 ln(1 + z) is the Langmuir adsorption pressure, (z being the activity and β-1 the temperature), while β-1F is the reaction-induced contribution, which can be expressed, under appropriate change of notation, as the Lyapunov exponent for the product of 2 × 2 random matrices, obtained exactly by Derrida and Hilhorst (1983 J. Phys. A: Math. Gen. 16 2641). Explicit asymptotic formulae for the particle mean density and the compressibility are also presented.

The laser micro-machining system for diamond anvil cell experiments and general precision machining applications at the High Pressure Collaborative Access Team

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hrubiak, Rostislav; Sinogeikin, Stanislav; Rod, Eric

We have designed and constructed a new system for micro-machining parts and sample assemblies used for diamond anvil cells and general user operations at the High Pressure Collaborative Access Team, sector 16 of the Advanced Photon Source. The new micro-machining system uses a pulsed laser of 400 ps pulse duration, ablating various materials without thermal melting, thus leaving a clean edge. With optics designed for a tight focus, the system can machine holes any size larger than 3 μm in diameter. Unlike a standard electrical discharge machining drill, the new laser system allows micro-machining of non-conductive materials such as: amorphousmore » boron and silicon carbide gaskets, diamond, oxides, and other materials including organic materials such as polyimide films (i.e., Kapton). An important feature of the new system is the use of gas-tight or gas-flow environmental chambers which allow the laser micro-machining to be done in a controlled (e.g., inert gas) atmosphere to prevent oxidation and other chemical reactions in air sensitive materials. The gas-tight workpiece enclosure is also useful for machining materials with known health risks (e.g., beryllium). Specialized control software with a graphical interface enables micro-machining of custom 2D and 3D shapes. The laser-machining system was designed in a Class 1 laser enclosure, i.e., it includes laser safety interlocks and computer controls and allows for routine operation. Though initially designed mainly for machining of the diamond anvil cell gaskets, the laser-machining system has since found many other micro-machining applications, several of which are presented here.« less

Thermally multiplexed polymerase chain reaction.

PubMed

Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

2015-07-01

Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

Integration of Machining and Inspection in Aerospace Manufacturing

NASA Astrophysics Data System (ADS)

Simpson, Bart; Dicken, Peter J.

2011-12-01

The main challenge for aerospace manufacturers today is to develop the ability to produce high-quality products on a consistent basis as quickly as possible and at the lowest-possible cost. At the same time, rising material prices are making the cost of scrap higher than ever so making it more important to minimise waste. Proper inspection and quality control methods are no longer a luxury; they are an essential part of every manufacturing operation that wants to grow and be successful. However, simply bolting on some quality control procedures to the existing manufacturing processes is not enough. Inspection must be fully-integrated with manufacturing for the investment to really produce significant improvements. The traditional relationship between manufacturing and inspection is that machining is completed first on the company's machine tools and the components are then transferred to dedicated inspection equipment to be approved or rejected. However, as machining techniques become more sophisticated, and as components become larger and more complex, there are a growing number of cases where closer integration is required to give the highest productivity and the biggest reductions in wastage. Instead of a simple linear progression from CAD to CAM to machining to inspection, a more complicated series of steps is needed, with extra data needed to fill any gaps in the information available at the various stages. These new processes can be grouped under the heading of "adaptive machining". The programming of most machining operations is based around knowing three things: the position of the workpiece on the machine, the starting shape of the material to be machined, and the final shape that needs to be achieved at the end of the operation. Adaptive machining techniques allow successful machining when at least one of those elements is unknown, by using in-process measurement to close the information gaps in the process chain. It also allows any errors to be spotted earlier in the manufacturing process, so helping the problems to be resolved more quickly and at lower cost.

Molecular diagnostics of periodontitis.

PubMed

Korona-Głowniak, Izabela; Siwiec, Radosław; Berger, Marcin; Malm, Anna; Szymańska, Jolanta

2017-01-28

The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host's health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization) come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR), real-time polymerase chain reaction (real-time PCR), 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), as well as terminal restriction fragment length polymorphism (TRFLP) and next generation sequencing (NGS). The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.

Expression and mutational analysis of Cip/Kip family in early glottic cancer.

PubMed

Kim, D-K; Lee, J H; Lee, O J; Park, C H

2015-02-01

Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

Direct and quantitative detection of HIV-1 RNA in human plasma with a branched DNA signal amplification assay.

PubMed

Urdea, M S; Wilber, J C; Yeghiazarian, T; Todd, J A; Kern, D G; Fong, S J; Besemer, D; Hoo, B; Sheridan, P J; Kokka, R

1993-11-01

To determine the relative effect of sample matrix on the quantitation of HIV RNA in plasma. Two HIV-positive specimens were diluted into five and 10 different HIV-negative plasma samples, respectively. Branched DNA signal amplification technology and reverse-transcriptase polymerase chain reaction were used to measure the viral load. In one sample the viral load by polymerase chain reaction ranged from undetectable to 1.9 x 10(5) copies/ml, and the branched DNA results ranged from 2.6 x 10(4) to 4.2 x 10(4) HIV RNA equivalent/ml. In the other sample the corresponding figures were 6.3 x 10(4) to 5.5 x 10(5) copies/ml and 5.7 x 10(4) to 7.5 x 10(4) HIV RNA equivalents/ml. In contrast to reverse-transcriptase polymerase chain reaction the branched DNA signal amplification assay does not require a separate extraction step or enzymatic amplification of the target. Therefore this measurement is less affected by the sample matrix and the signal generated is directly proportional to the viral load.

Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

PubMed Central

Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

2006-01-01

Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

PubMed

Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

2015-03-01

Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.

Real-time monitoring of enzyme-free strand displacement cascades by colorimetric assays

NASA Astrophysics Data System (ADS)

Duan, Ruixue; Wang, Boya; Hong, Fan; Zhang, Tianchi; Jia, Yongmei; Huang, Jiayu; Hakeem, Abdul; Liu, Nannan; Lou, Xiaoding; Xia, Fan

2015-03-01

The enzyme-free toehold-mediated strand displacement reaction has shown potential for building programmable DNA circuits, biosensors, molecular machines and chemical reaction networks. Here we report a simple colorimetric method using gold nanoparticles as signal generators for the real-time detection of the product of the strand displacement cascade. During the process the assembled gold nanoparticles can be separated, resulting in a color change of the solution. This assay can also be applied in complex mixtures, fetal bovine serum, and to detect single-base mismatches. These results suggest that this method could be of general utility to monitor more complex enzyme-free strand displacement reaction-based programmable systems or for further low-cost diagnostic applications.The enzyme-free toehold-mediated strand displacement reaction has shown potential for building programmable DNA circuits, biosensors, molecular machines and chemical reaction networks. Here we report a simple colorimetric method using gold nanoparticles as signal generators for the real-time detection of the product of the strand displacement cascade. During the process the assembled gold nanoparticles can be separated, resulting in a color change of the solution. This assay can also be applied in complex mixtures, fetal bovine serum, and to detect single-base mismatches. These results suggest that this method could be of general utility to monitor more complex enzyme-free strand displacement reaction-based programmable systems or for further low-cost diagnostic applications. Electronic supplementary information (ESI) available: Experimental procedures and analytical data are provided. See DOI: 10.1039/c5nr00697j

Catalysis of heat-to-work conversion in quantum machines

PubMed Central

Ghosh, A.; Latune, C. L.; Davidovich, L.; Kurizki, G.

2017-01-01

We propose a hitherto-unexplored concept in quantum thermodynamics: catalysis of heat-to-work conversion by quantum nonlinear pumping of the piston mode which extracts work from the machine. This concept is analogous to chemical reaction catalysis: Small energy investment by the catalyst (pump) may yield a large increase in heat-to-work conversion. Since it is powered by thermal baths, the catalyzed machine adheres to the Carnot bound, but may strongly enhance its efficiency and power compared with its noncatalyzed counterparts. This enhancement stems from the increased ability of the squeezed piston to store work. Remarkably, the fraction of piston energy that is convertible into work may then approach unity. The present machine and its counterparts powered by squeezed baths share a common feature: Neither is a genuine heat engine. However, a squeezed pump that catalyzes heat-to-work conversion by small investment of work is much more advantageous than a squeezed bath that simply transduces part of the work invested in its squeezing into work performed by the machine. PMID:29087326

Catalysis of heat-to-work conversion in quantum machines

NASA Astrophysics Data System (ADS)

Ghosh, A.; Latune, C. L.; Davidovich, L.; Kurizki, G.

2017-11-01

We propose a hitherto-unexplored concept in quantum thermodynamics: catalysis of heat-to-work conversion by quantum nonlinear pumping of the piston mode which extracts work from the machine. This concept is analogous to chemical reaction catalysis: Small energy investment by the catalyst (pump) may yield a large increase in heat-to-work conversion. Since it is powered by thermal baths, the catalyzed machine adheres to the Carnot bound, but may strongly enhance its efficiency and power compared with its noncatalyzed counterparts. This enhancement stems from the increased ability of the squeezed piston to store work. Remarkably, the fraction of piston energy that is convertible into work may then approach unity. The present machine and its counterparts powered by squeezed baths share a common feature: Neither is a genuine heat engine. However, a squeezed pump that catalyzes heat-to-work conversion by small investment of work is much more advantageous than a squeezed bath that simply transduces part of the work invested in its squeezing into work performed by the machine.

Catalysis of heat-to-work conversion in quantum machines.

PubMed

Ghosh, A; Latune, C L; Davidovich, L; Kurizki, G

2017-11-14

We propose a hitherto-unexplored concept in quantum thermodynamics: catalysis of heat-to-work conversion by quantum nonlinear pumping of the piston mode which extracts work from the machine. This concept is analogous to chemical reaction catalysis: Small energy investment by the catalyst (pump) may yield a large increase in heat-to-work conversion. Since it is powered by thermal baths, the catalyzed machine adheres to the Carnot bound, but may strongly enhance its efficiency and power compared with its noncatalyzed counterparts. This enhancement stems from the increased ability of the squeezed piston to store work. Remarkably, the fraction of piston energy that is convertible into work may then approach unity. The present machine and its counterparts powered by squeezed baths share a common feature: Neither is a genuine heat engine. However, a squeezed pump that catalyzes heat-to-work conversion by small investment of work is much more advantageous than a squeezed bath that simply transduces part of the work invested in its squeezing into work performed by the machine.

Attitude Control of a Satellite Simulator Using Reaction Wheels and a PID Controller

DTIC Science & Technology

2010-03-01

allow continuous and smooth control while inducing the smallest possible disturbance torques. The objective of this research is to design , build...making me feel welcome in their machine shop and for educating me on the difficulties of fabricating my engineering designs . On a personal note, much...3.16. SimSat II Reaction Wheel Designs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56 3.17. EPOS 70/10 Velocity Controller

Film Format Pandemonium

ERIC Educational Resources Information Center

Malczewski, Benjamin

2010-01-01

Every day, Americans borrow 2.1 million DVDs from public libraries. Barely beating libraries out for the top spot is Netflix, at 2.2 million daily rentals. This is according to the OCLC 2010 survey "How Libraries Stack Up." (Redbox vending-machine rentals lag behind at 1.1 million, while DVD rental chain Blockbuster is no longer in the running,…

Advances in PCR technology.

PubMed

Lauerman, Lloyd H

2004-12-01

Since the discovery of the polymerase chain reaction (PCR) 20 years ago, an avalanche of scientific publications have reported major developments and changes in specialized equipment, reagents, sample preparation, computer programs and techniques, generated through business, government and university research. The requirement for genetic sequences for primer selection and validation has been greatly facilitated by the development of new sequencing techniques, machines and computer programs. Genetic libraries, such as GenBank, EMBL and DDBJ continue to accumulate a wealth of genetic sequence information for the development and validation of molecular-based diagnostic procedures concerning human and veterinary disease agents. The mechanization of various aspects of the PCR assay, such as robotics, microfluidics and nanotechnology, has made it possible for the rapid advancement of new procedures. Real-time PCR, DNA microarray and DNA chips utilize these newer techniques in conjunction with computer and computer programs. Instruments for hand-held PCR assays are being developed. The PCR and reverse transcription-PCR (RT-PCR) assays have greatly accelerated the speed and accuracy of diagnoses of human and animal disease, especially of the infectious agents that are difficult to isolate or demonstrate. The PCR has made it possible to genetically characterize a microbial isolate inexpensively and rapidly for identification, typing and epidemiological comparison.

Prediction of lymph node parasite load from clinical data in dogs with leishmaniasis: An application of radial basis artificial neural networks.

PubMed

Torrecilha, Rafaela Beatriz Pintor; Utsunomiya, Yuri Tani; Batista, Luís Fábio da Silva; Bosco, Anelise Maria; Nunes, Cáris Maroni; Ciarlini, Paulo César; Laurenti, Márcia Dalastra

2017-01-30

Quantification of Leishmania infantum load via real-time quantitative polymerase chain reaction (qPCR) in lymph node aspirates is an accurate tool for diagnostics, surveillance and therapeutics follow-up in dogs with leishmaniasis. However, qPCR requires infrastructure and technical training that is not always available commercially or in public services. Here, we used a machine learning technique, namely Radial Basis Artificial Neural Network, to assess whether parasite load could be learned from clinical data (serological test, biochemical markers and physical signs). By comparing 18 different combinations of input clinical data, we found that parasite load can be accurately predicted using a relatively small reference set of 35 naturally infected dogs and 20 controls. In the best case scenario (use of all clinical data), predictions presented no bias or inflation and an accuracy (i.e., correlation between true and predicted values) of 0.869, corresponding to an average error of ±38.2 parasites per unit of volume. We conclude that reasonable estimates of L. infantum load from lymph node aspirates can be obtained from clinical records when qPCR services are not available. Copyright © 2016 Elsevier B.V. All rights reserved.

A statistical approach to detection of copy number variations in PCR-enriched targeted sequencing data.

PubMed

Demidov, German; Simakova, Tamara; Vnuchkova, Julia; Bragin, Anton

2016-10-22

Multiplex polymerase chain reaction (PCR) is a common enrichment technique for targeted massive parallel sequencing (MPS) protocols. MPS is widely used in biomedical research and clinical diagnostics as the fast and accurate tool for the detection of short genetic variations. However, identification of larger variations such as structure variants and copy number variations (CNV) is still being a challenge for targeted MPS. Some approaches and tools for structural variants detection were proposed, but they have limitations and often require datasets of certain type, size and expected number of amplicons affected by CNVs. In the paper, we describe novel algorithm for high-resolution germinal CNV detection in the PCR-enriched targeted sequencing data and present accompanying tool. We have developed a machine learning algorithm for the detection of large duplications and deletions in the targeted sequencing data generated with PCR-based enrichment step. We have performed verification studies and established the algorithm's sensitivity and specificity. We have compared developed tool with other available methods applicable for the described data and revealed its higher performance. We showed that our method has high specificity and sensitivity for high-resolution copy number detection in targeted sequencing data using large cohort of samples.

A Technical Approach to Marking Explosives, Propellants, and Precursor Chemicals

DTIC Science & Technology

1998-08-01

polymerase chain reaction (PCR) methods whereby small strands are cut and analyzed under specified temperature mediated enzymatic /molecular reactions (4...such as these are often overlooked. Several other companies have been investigating other methods including immunoassay techniques, microencapsulated

Selected spectroscopic results on element 115 decay chains

DOE PAGES

Rudolph, D.; Forsberg, U.; Golubev, P.; ...

2014-08-24

We observed thirty correlated α-decay chains in an experiment studying the fusion-evaporation reaction 48Ca + 243Am at the GSI Helmholtzzentrum fur Schwerionenforschung. The decay characteristics of the majority of these 30 chains are consistent with previous observations and interpretations of such chains to originate from isotopes of element Z = 115. High-resolution α-photon coincidence spectroscopy in conjunction with comprehensive Monte-Carlo simulations allow to propose excitation schemes of atomic nuclei of the heaviest elements, thereby probing nuclear structure models near the 'Island of Stability' with unprecedented experimental precision.

Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

PubMed

Brzezinski, Jennifer L

2006-01-01

The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

Bi-parentally inherited species-specific markers identify hybridization between rainbow trout and cutthroat trout subspecies

USGS Publications Warehouse

Ostberg, C.O.; Rodriguez, R.J.

2004-01-01

Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.

Flow-through polymerase chain reaction inside a seamless 3D helical microreactor fabricated utilizing a silicone tube and a paraffin mold.

PubMed

Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon

2015-03-07

We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).

[Identification of human pathogenic variola and monkeypox viruses by real-time polymerase chain reaction].

PubMed

Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N

2009-01-01

A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.

Molecular implementation of molecular shift register memories

NASA Technical Reports Server (NTRS)

Beratan, David N. (Inventor); Onuchic, Jose N. (Inventor)

1991-01-01

An electronic shift register memory (20) at the molecular level is described. The memory elements are based on a chain of electron transfer molecules (22) and the information is shifted by photoinduced (26) electron transfer reactions. Thus, multi-step sequences of charge transfer reactions are used to move charge with high efficiency down a molecular chain. The device integrates compositions of the invention onto a VLSI substrate (36), providing an example of a molecular electronic device which may be fabricated. Three energy level schemes, molecular implementation of these schemes, optical excitation strategies, charge amplification strategies, and error correction strategies are described.

Identification of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) by using polymerase chain reaction amplification and restriction analysis of the mitochondrial cytochrome b gene.

PubMed

Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R

1998-04-01

Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.

Peroxy radical measurements with NCAR's chemical amplifier

NASA Technical Reports Server (NTRS)

Cantrell, Christopher; Shetter, Richard; Calvert, Jack G.

1994-01-01

The present NCAR instrument for HO2/RO2 measurements has been described previously. It is based on the reactions involving HO2, RO2, and HO radicals with CO and NO. Since (HO2) + (RO2) + (HO) is much greater than (HO) for most atmospheres, it is useful as a peroxy radical detector. Operation of the instrument depends on the creation of a chemical chain reaction which is initiated as HO2 and RO2 radicals in ambient air encounter added NO gas; this forms an NO2 molecule and an HO or RO radical: HO2(RO2) + NO yields HO(RO) + NO2. RO radicals react relatively efficiently with O2 to form an HO2 radical, and subsequently an HO-radical, by reaction with NO. CO gas added to the reaction chamber during part of the operating cycle, recycles the HO to HO2; HO + CO (+O2) yields HO2 + CO2. The reaction sequence may form several hundred NO2 molecules per HO2 (RO2) originally present, before chain termination occurs. The added CO is replaced by N2 addition periodically so that the chain reaction is suppressed, and a 'blank' signal resulting from NO2, O3 and possibly other NO2-forming species (non-chain processes) in ambient air is recorded. The difference between the signal with and without CO is proportional to the peroxy radical concentration. The NO2 produced is monitored using a sensitive luminol chemiluminescence detector system. In the NCAR instrument the length of the amplification chain is determined using a stable source of HO2 radicals (H2O2 thermal decomposition); the ratio of the signal seen with CO present to that with N2 present gives the sensitivity of the instrument to HO2 (molecules of NO2 formed/peroxy radical). The instrument is automated to carry out in hourly repeated cycles: (1) chain length determination; (2) NO2 calibration; and (3) linearity check on the response of signals. One minute averages of signals are normally recorded. The sensitivity of the instrument to detect peroxy radicals is in the pptv range. The present instrument has operated continuously (24 hr/day) in the field studies which extended over a period of several weeks. The major advantages of this instrument are as follows: (1) its relative simplicity; (2) low power requirements; and (3) its rapid response to all types of peroxy radicals--HO2, CH3O2 and the higher alkyl and acyl peroxy radicals; however not all RO2 species generate HO2 radicals with perfect efficiency and hence have somewhat lower response/molecule than HO2 radicals.

Predicting Survival From Large Echocardiography and Electronic Health Record Datasets: Optimization With Machine Learning.

PubMed

Samad, Manar D; Ulloa, Alvaro; Wehner, Gregory J; Jing, Linyuan; Hartzel, Dustin; Good, Christopher W; Williams, Brent A; Haggerty, Christopher M; Fornwalt, Brandon K

2018-06-09

The goal of this study was to use machine learning to more accurately predict survival after echocardiography. Predicting patient outcomes (e.g., survival) following echocardiography is primarily based on ejection fraction (EF) and comorbidities. However, there may be significant predictive information within additional echocardiography-derived measurements combined with clinical electronic health record data. Mortality was studied in 171,510 unselected patients who underwent 331,317 echocardiograms in a large regional health system. We investigated the predictive performance of nonlinear machine learning models compared with that of linear logistic regression models using 3 different inputs: 1) clinical variables, including 90 cardiovascular-relevant International Classification of Diseases, Tenth Revision, codes, and age, sex, height, weight, heart rate, blood pressures, low-density lipoprotein, high-density lipoprotein, and smoking; 2) clinical variables plus physician-reported EF; and 3) clinical variables and EF, plus 57 additional echocardiographic measurements. Missing data were imputed with a multivariate imputation by using a chained equations algorithm (MICE). We compared models versus each other and baseline clinical scoring systems by using a mean area under the curve (AUC) over 10 cross-validation folds and across 10 survival durations (6 to 60 months). Machine learning models achieved significantly higher prediction accuracy (all AUC >0.82) over common clinical risk scores (AUC = 0.61 to 0.79), with the nonlinear random forest models outperforming logistic regression (p < 0.01). The random forest model including all echocardiographic measurements yielded the highest prediction accuracy (p < 0.01 across all models and survival durations). Only 10 variables were needed to achieve 96% of the maximum prediction accuracy, with 6 of these variables being derived from echocardiography. Tricuspid regurgitation velocity was more predictive of survival than LVEF. In a subset of studies with complete data for the top 10 variables, multivariate imputation by chained equations yielded slightly reduced predictive accuracies (difference in AUC of 0.003) compared with the original data. Machine learning can fully utilize large combinations of disparate input variables to predict survival after echocardiography with superior accuracy. Copyright © 2018 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

Silicone derivatives for contact lenses: functionalization, chemical characterization, and cell compatibility assessment.

PubMed

Migonney, V; Lacroix, M D; Ratner, B D; Jozefowicz, M

1995-01-01

Epoxy ring-opening functionalization of polymers at random sites along chains with various chemical groups has been demonstrated. The reaction is performed in an aqueous solution under mild conditions in order to minimize degradation of the macromolecular chains. Silicone lenses made of copolymers with epoxy side chains were functionalized with 4-hydroxybutyric acid, sodium salt. The carboxylated silicone derivatives were characterized by ESCA and radiotracers. A mean value of 30% reaction yield was concluded, based upon data from both methods; nevertheless, the latter can be improved up to 50% or more if the conditions of preparation of the epoxydized silicone lenses are optimized. Derivatized silicones were coated in the wells of culture plates to evaluate the cell compatibility of these new polymers with a fibroblast cell line (McCoy's). No cellular toxicity was observed.

Learning to Select Supplier Portfolios for Service Supply Chain

PubMed Central

Zhang, Rui; Li, Jingfei; Wu, Shaoyu; Meng, Dabin

2016-01-01

The research on service supply chain has attracted more and more focus from both academia and industrial community. In a service supply chain, the selection of supplier portfolio is an important and difficult problem due to the fact that a supplier portfolio may include multiple suppliers from a variety of fields. To address this problem, we propose a novel supplier portfolio selection method based on a well known machine learning approach, i.e., Ranking Neural Network (RankNet). In the proposed method, we regard the problem of supplier portfolio selection as a ranking problem, which integrates a large scale of decision making features into a ranking neural network. Extensive simulation experiments are conducted, which demonstrate the feasibility and effectiveness of the proposed method. The proposed supplier portfolio selection model can be applied in a real corporation easily in the future. PMID:27195756

Ab initio study of chain branching reactions involving second generation products in hydrocarbon combustion mechanisms.

PubMed

Davis, Alexander C; Francisco, Joseph S

2012-01-28

sec-Alkyl radicals are key reactive intermediates in the hydrocarbon combustion and atmospheric decomposition mechanisms that are formed by the abstraction of hydrogen from an alkane, or as a second generation product of n-alkyl H-migrations, C-C bond scissions in branched alkyl radicals, or the bimolecular reaction between olefins and n-alkyl radicals. Since alkanes and branched alkanes, which the sec-alkyl radicals are derived from, make up roughly 40-50% of traditional fuels an understanding of their chemistry is essential to improving combustion systems. The present work investigates all H-migration reactions initiated from an sec-alkyl radical that involve the movement of a secondary hydrogen, for the 2-butyl through 4-octyl radicals, using the CBS-Q, G2, and G4 composite methods. The resulting thermodynamic and kinetic parameters are compared to similar reactions in n-alkyl radicals in order to determine underlying trends. Particular attention is paid to the effect of cis/trans and 1,3-diaxial interactions on activation energies and rate coefficients. When combined with our previous work on n-alkyl radical H-migrations, a complete picture of H-migrations in unbranched alkyl radicals is obtained. This full data set suggests that the directionality of the remaining branched chains has a minimal effect on the rate coefficients for all but the largest viable transition states, which is in stark contrast to the differences predicted by the structurally similar dimethylcycloalkanes. In fact the initial location of the secondary radical site has a greater effect on the rate than does the directionality of the remaining alkyl chains. The activation energies for secondary to secondary reactions are much closer to those of the secondary to primary H-migrations. However, the rate coefficients are found to be closer to the corresponding primary to primary reaction values. A significant ramification of these results is that there will be multiple viable reaction pathways for these reactions instead of only one dominant pathway as previously believed.

Lipozyme RM IM-catalyzed acidolysis of Cinnamomum camphora seed oil with oleic acid to produce human milk fat substitutes enriched in medium-chain fatty acids.

PubMed

Zou, Xian-Guo; Hu, Jiang-Ning; Zhao, Man-Li; Zhu, Xue-Mei; Li, Hong-Yan; Liu, Xiao-Ru; Liu, Rong; Deng, Ze-Yuan

2014-10-29

In the present study, a human milk fat substitute (HMFS) enriched in medium-chain fatty acids (MCFAs) was synthesized through acidolysis reaction from Cinnamomum camphora seed oil (CCSO) with oleic acid in a solvent-free system. A commercial immobilized lipase, Lipozyme RM IM, from Rhizomucor miehei, was facilitated as a biocatalyst. Effects of different reaction conditions, including substrate molar ratio, enzyme concentration, reaction temperature, and reaction time were investigated using response surface methodology (RSM) to obtain the optimal oleic acid incorporation. After optimization, results showed that the maximal incorporation of oleic acid into HMFS was 59.68%. Compared with CCSO, medium-chain fatty acids at the sn-2 position of HMFS accounted for >70%, whereas oleic acid was occupied predominantly at the sn-1,3 position (78.69%). Meanwhile, triacylglycerol (TAG) components of OCO (23.93%), CCO (14.94%), LaCO (13.58%), OLaO (12.66%), and OOO (11.13%) were determined as the major TAG species in HMFS. The final optimal reaction conditions were carried out as follows: substrate molar ratio (oleic acid/CCSO), 5:1; enzyme concentration, 12.5% (w/w total reactants); reaction temperature, 60 °C; and reaction time, 28 h. The reusability of Lipozyme RM IM in the acidolysis reaction was also evaluated, and it was found that it could be reused up to 9 times without significant loss of activities. Urea inclusion method was used to separate and purify the synthetic product. As the ratio of HMFS/urea increased to 1:2, the acid value lowered to the minimum. In a scale-up experiment, the contents of TAG and total tocopherols in HMFS (modified CCSO) were 77.28% and 12.27 mg/100 g, respectively. All of the physicochemical indices of purified product were within food standards. Therefore, such a MCFA-enriched HMFS produced by using the acidolysis method might have potential application in the infant formula industry.

Synthesis of a pH-Sensitive Hetero[4]Rotaxane Molecular Machine that Combines [c2]Daisy and [2]Rotaxane Arrangements.

PubMed

Waelès, Philip; Riss-Yaw, Benjamin; Coutrot, Frédéric

2016-05-10

The synthesis of a novel pH-sensitive hetero[4]rotaxane molecular machine through a self-sorting strategy is reported. The original tetra-interlocked molecular architecture combines a [c2]daisy chain scaffold linked to two [2]rotaxane units. Actuation of the system through pH variation is possible thanks to the specific interactions of the dibenzo-24-crown-8 (DB24C8) macrocycles for ammonium, anilinium, and triazolium molecular stations. Selective deprotonation of the anilinium moieties triggers shuttling of the unsubstituted DB24C8 along the [2]rotaxane units. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Novel odd/even effect of alkylene chain length on the photopolymerizability of organogelators.

PubMed

Aoki, Ken'ichi; Kudo, Masabumi; Tamaoki, Nobuyuki

2004-10-28

[reaction: see text] Starting from diactylene diacarboxylic acids, we have synthesized a series of photopolymerizable organogelators that possess simple amide structures, different alkylene chain lengths, and either optically active or racemic 3,7-dimethyl-1-octylamine units. The alkylene chain length of these compounds exhibits a prominent odd/even effect with respect to the photopolymerization in the gel state and is accompanied by a stereostructural effect on the gelation ability.

Precision molding of advanced glass optics: innovative production technology for lens arrays and free form optics

NASA Astrophysics Data System (ADS)

Pongs, Guido; Bresseler, Bernd; Bergs, Thomas; Menke, Gert

2012-10-01

Today isothermal precision molding of imaging glass optics has become a widely applied and integrated production technology in the optical industry. Especially in consumer electronics (e.g. digital cameras, mobile phones, Blu-ray) a lot of optical systems contain rotationally symmetrical aspherical lenses produced by precision glass molding. But due to higher demands on complexity and miniaturization of optical elements the established process chain for precision glass molding is not sufficient enough. Wafer based molding processes for glass optics manufacturing become more and more interesting for mobile phone applications. Also cylindrical lens arrays can be used in high power laser systems. The usage of unsymmetrical free-form optics allows an increase of efficiency in optical laser systems. Aixtooling is working on different aspects in the fields of mold manufacturing technologies and molding processes for extremely high complex optical components. In terms of array molding technologies, Aixtooling has developed a manufacturing technology for the ultra-precision machining of carbide molds together with European partners. The development covers the machining of multi lens arrays as well as cylindrical lens arrays. The biggest challenge is the molding of complex free-form optics having no symmetrical axis. A comprehensive CAD/CAM data management along the entire process chain is essential to reach high accuracies on the molded lenses. Within a national funded project Aixtooling is working on a consistent data handling procedure in the process chain for precision molding of free-form optics.

The algorithm of numerical calculation of constraints reactions in a dynamic system of transport machine

NASA Astrophysics Data System (ADS)

Akhtulov, A. L.

2018-01-01

The questions of construction and practical application of the automation system for the design of components and aggregates for the construction of transport vehicles are considered, taking into account their dynamic characteristics. Based on the results of the studies, a unified method for determining the reactions of bonds of a complex spatial structure is proposed. The technique, based on the method of substructures, allows us to determine the values of the transfer functions taking into account the reactions of the bonds. After the carried out researches it is necessary to note, that such approach gives the most satisfactory results and can be used for calculations of complex mechanical systems of machines and units of different purposes. The directions of increasing the degree of validity of technical decisions are shown, especially in the early stages of design, when the cost of errors is high, with careful thorough working out of all the elements of the design, which is really feasible only on the basis of automation of design and technological work.

Atomistic Model for the Polyamide Formation from β-Lactam Catalyzed by Candida Antarctica Lipase B

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baum, Iris; Elsasser, Brigitta M.; Schwab, Leendert

2011-04-01

Candida antarctica lipase B (CALB) is an established biocatalyst for a variety of transesterification, amidation, and polymerization reactions. In contrast to polyesters, polyamides are not yet generally accessible via enzymatic polymerization. In this regard, an enzyme-catalyzed ring-opening polymerization of {beta}-lactam (2-azetidinone) using CALB is the first example of an enzymatic polyamide formation yielding unbranched poly({beta}-alanine), nylon 3. The performance of this polymerization, however, is poor, considering the maximum chain length of 18 monomer units with an average length of 8, and the molecular basis of the reaction so far is not understood. We have employed molecular modeling techniques using dockingmore » tools, molecular dynamics, and QM/MM procedures to gain insight into the mechanistic details of the various reaction steps involved. As a result, we propose a catalytic cycle for the oligomerization of {beta}-lactam that rationalizes the activation of the monomer, the chain elongation by additional {beta}-lactam molecules, and the termination of the polymer chain. In addition, the processes leading to a premature chain termination are studied. Particularly, the QM/MM calculation enables an atomistic description of all eight steps involved in the catalytic cycle, which features an in situ-generated {beta}-alanine as the elongating monomer and which is compatible with the experimental findings.« less

Multi angle laser light scattering evaluation of field exposed thermoplastic photovoltaic encapsulant materials

DOE PAGES

Kempe, Michael D.; Miller, David C.; Wohlgemuth, John H.; ...

2016-01-08

As creep of polymeric materials is potentially a safety concern for photovoltaic modules, the potential for module creep has become a significant topic of discussion in the development of IEC 61730 and IEC 61215. To investigate the possibility of creep, modules were constructed, using several thermoplastic encapsulant materials, into thin-film mock modules and deployed in Mesa, Arizona. The materials examined included poly(ethylene)-co-vinyl acetate (EVA, including formulations both cross-linked and with no curing agent), polyethylene/polyoctene copolymer (PO), poly(dimethylsiloxane) (PDMS), polyvinyl butyral (PVB), and thermoplastic polyurethane (TPU). The absence of creep in this experiment is attributable to several factors of which themore » most notable one was the unexpected cross-linking of an EVA formulation without a cross-linking agent. It was also found that some materials experienced both chain scission and cross-linking reactions, sometimes with a significant dependence on location within a module. The TPU and EVA samples were found to degrade with cross-linking reactions dominating over chain scission. In contrast, the PO materials degraded with chain scission dominating over cross-linking reactions. Furthermore, we found no significant indications that viscous creep is likely to occur in fielded modules capable of passing the qualification tests, we note that one should consider how a polymer degrades, chain scission or cross-linking, in assessing the suitability of a thermoplastic polymer in terrestrial photovoltaic applications.« less

Shock tube measurements of specific reaction rates in branched chain CH4-CO-O2 system

NASA Technical Reports Server (NTRS)

Brabbs, T. A.; Brokaw, R. S.

1974-01-01

Rate constants of two elementary bimolecular reactions involved in the oxidation of methane were determined by monitoring the exponential growth of CO flame band emission behind incident shocks in three suitably chosen gas mixtures.

Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

PubMed

Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

2017-02-15

Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

DFT-based prediction of reactivity of short-chain alcohol dehydrogenase

NASA Astrophysics Data System (ADS)

Stawoska, I.; Dudzik, A.; Wasylewski, M.; Jemioła-Rzemińska, M.; Skoczowski, A.; Strzałka, K.; Szaleniec, M.

2017-06-01

The reaction mechanism of ketone reduction by short chain dehydrogenase/reductase, ( S)-1-phenylethanol dehydrogenase from Aromatoleum aromaticum, was studied with DFT methods using cluster model approach. The characteristics of the hydride transfer process were investigated based on reaction of acetophenone and its eight structural analogues. The results confirmed previously suggested concomitant transfer of hydride from NADH to carbonyl C atom of the substrate with proton transfer from Tyr to carbonyl O atom. However, additional coupled motion of the next proton in the proton-relay system, between O2' ribose hydroxyl and Tyr154 was observed. The protonation of Lys158 seems not to affect the pKa of Tyr154, as the stable tyrosyl anion was observed only for a neutral Lys158 in the high pH model. The calculated reaction energies and reaction barriers were calibrated by calorimetric and kinetic methods. This allowed an excellent prediction of the reaction enthalpies (R2 = 0.93) and a good prediction of the reaction kinetics (R2 = 0.89). The observed relations were validated in prediction of log K eq obtained for real whole-cell reactor systems that modelled industrial synthesis of S-alcohols.

Structural modulation of silver complexes and their distinctive catalytic properties.

PubMed

Zhao, Yue; Chen, Kai; Fan, Jian; Okamura, Taka-aki; Lu, Yi; Luo, Li; Sun, Wei-Yin

2014-02-07

A family of silver(I) complexes, [Ag2(L)2(OOCCF3)2] (1), [Ag(L)0.5(OOCCF3)] (2), [Ag(L)2](OOCCF3)(H2O)2 (3), was obtained by reactions of 4,4'-di(2-oxazolinyl)biphenyl (L) and AgOOCCF3 in different reaction media. Compound 1 has a 1D chain structure with alternative connections between the Ag(I) and L ligand. When the crystal nucleation inductor, pyrazine, was added into the reaction system, complex 2 was isolated with no pyrazine observed in its structure. In 2, the 1D inorganic chains formed by Ag(I) cations and OOCCF3(-) anions were connected by the L ligand to produce a 2D network. When a different inductor, imidazole, was added into the reaction system, 3 with (4,4) topology was synthesized, and again no imidazole was found in 3. When 1-3 were used as catalysts for cycloaddition reactions between imino esters and methyl acrylate, 3 affords the highest yield, in which the particular size of the channels in 3 led to its selective catalytic performance.

Prospect of EUV mask repair technology using e-beam tool

NASA Astrophysics Data System (ADS)

Kanamitsu, Shingo; Hirano, Takashi; Suga, Osamu

2010-09-01

Currently, repair machines used for advanced photomasks utilize principle method like as FIB, AFM, and EB. There are specific characteristic respectively, thus they have an opportunity to be used in suitable situation. But when it comes to EUV generation, pattern size is so small highly expected as under 80nm that higher image resolution and repair accuracy is needed for its machines. Because FIB machine has intrinsic damage problem induced by Ga ion and AFM machine has critical tip size issue, those machines are basically difficult to be applied for EUV generation. Consequently, we focused on EB repair tool for research work. EB repair tool has undergone practical milestone about MoSi based masks. We have applied same process which is used for MoSi to EUV blank and confirmed its reaction. Then we found some severe problems which show uncontrollable feature due to its enormously strong reaction between etching gas and absorber material. Though we could etch opaque defect with conventional method and get the edge shaped straight by top-down SEM viewing, there were problems like as sidewall undercut or local erosion depending on defect shape. In order to cope with these problems, the tool vender has developed a new process and reported it through an international conference [1]. We have evaluated the new process mentioned above in detail. In this paper, we will bring the results of those evaluations. Several experiments for repair accuracy, process stability, and other items have been done under estimation of practical condition assuming diversified size and shape defects. A series of actual printability tests will be also included. On the basis of these experiments, we consider the possibility of EB-repair application for 20nm pattern.

Is the 'Bromine Explosion' generated from the reaction BrO HO2 alone?

NASA Astrophysics Data System (ADS)

Behnke, Wolfgang; Zetzsch, Cornelius

2010-05-01

We observed bromine explosions (a fast production of atomic Br and Cl under tropospheric conditions) in various smog chamber experiments in Teflon bags at room temperature at a relative humidity of about 80% in the presence of NaCl/NaBr-aerosol, simulated sunlight and ozone (200 - 400 ppb). Time profiles of ozone and hydrocarbons (HCs: n-butane, 2,2-dimethylbutane, tetramethylbutane and toluene, initially about 2 ppb each) were monitored to determine concentrations and source strengths of OH radicals, atomic Cl and Br and the corresponding time profiles of BrCl and Br2 as their photolytic precursors. The number and size of aerosols are measured as well as their chemical composition (Br-, Cl- and oxalic acid). Full records of raw data from the smog chamber runs are available at www.eurochamp.org for potential users. Chemical box model calculations deliver concentrations of various intermediates, such as aldehydes, HO2 and RO2 radicals and the inorganic halogen compounds ClO, BrO, HOCl and HOBr, where HOBr from O3 + Br- => BrO- + O2 in the aqueous/adsorbed phase induces the following gas-phase/ heterogeneous chain reaction Br + O3 => BrO + O2(1) BrO + HO2 => HOBr + O2(2a) HOBr + (Aerosol) => HOBrad(3) Surface-adsorbed HOBr reacts with Br- or Cl- to produce Br2 or BrCl, both of which are released and photolysed. Formation of Br2 should prevail up to Cl-/Br- -ratios of about 104 (Fickert, S., J.W. Adams, J.N. Crowley, J. Geophys. Res., D104, 23719-23727, 1999). A maximum of this ratio is reached about 30 minutes after the beginning and decreases during the next hours - probably by reaction of Br2 with oxalate and absorption of HBr, formed from the reaction of Br with aldehydes. Parallel to chain reaction (1)-(3) a chain reaction replacing Br by Cl seems possible but can not be realized, since the main sink of atomic Cl is its reaction with hydrocarbons - leading to chain termination - in contrast to atomic Br (ratio of rates: kCl[O3]/kCl[HC] ~ 0.1; kBr[O3]/kBr[toluene] ~ 100). Formation of aldehydes (R-CHO) interferes with the chain reaction (1) - (3) markedly, since kBr[O3] ≈kBr[R-CHO]. The chain reaction is limited by availability of ozone (degradation of HCs by atomic Cl stops completely with vanishing ozone), of HO2 (HCs are required to form HO2) and of aerosol. The central question is: will sufficient HO2 be formed from degradation of HCs to explain the magnitude of the formed Br2 and BrCl in our experiments? We found that the formation of HO2 should be by a factor of 2-4 larger to explain the formation of Br2 and BrCl. Which other sources for the formation of HOBr besides reaction (2a) are then available? The rate of CH3O2with BrO is 25% of that with HO2 (Enami, S.; Yamanaka, T.; Nakayama, T.; Hashimoto, S.; Kawasaki, M.; Shallcross, D.E.; Nakano, Y.; Ishiwata, T., J. Phys. Chem. A, 11, 3342 - 3348, 2007), suggesting that other RO2 radicals must contribute. In our model calculations we use this rate constant for all RO2 radicals to obtain reasonable agreement between the produced HOBr and the formed BrCl and Br2 necessary for our experimental degradation results. So reaction scheme (1) - (3) should be completed by: BrO + RO2 => HOBr + products (2b) The German Science Foundation (DFG) supported this research in unit 783 (HALOPROC).

Palladium-Catalyzed Oxidative Couplings and Applications to the Synthesis of Macrocycles and Strained Cyclic Dienes

NASA Astrophysics Data System (ADS)

Boon, Byron Adrian

The palladium(II)-catalyzed oxidative macrocyclization of bis(vinylboronate esters) is demonstrated as an efficient method for the synthesis of macrocyclic dienes. The macrocyclization reactions feature mild conditions due to a palladium(II) catalytic cycle which obviates the need for a high energy oxidative addition step of standard palladium(0) catalytic cycles. Instead, this oxidative coupling is promoted by chloroacetone as a terminal re-oxidant in the catalytic cycle. An extension of the oxidative coupling/macrocyclization strategy is highlighted where molecular oxygen may be used in place of chloroacetone as the terminal re-oxidant. Homocoupling reactions of vinylboronate esters served as a template to screen reaction conditions for this method. From these experiments, multiple reaction conditions gave the oxidative homocoupling product in high yield. These reaction conditions were successfully applied to the oxidative macrocyclization of a bis(vinylboronate ester) using molecular oxygen as a re-oxidant. Syntheses of strained cyclic dienes were accomplished via the palladium(II)-catalyzed oxidative cyclizations of terminal bis(vinylboronate esters). The reactions generated strained (E,E)-1,3-dienes that underwent spontaneous 4?-electrocyclizations to form bicyclic cyclobutenes. Formation of the cyclobutenes is driven by strain in the medium-ring (E,E)-1,3-diene intermediates. Thermal ring openings of the cyclobutenes give (Z,Z)-1,3-diene products, again for thermodynamic reasons. These results are in contrast with typical acyclic trans-3,4-dialkyl cyclobutenes, which favor outward torquoselective ring-openings to give (E,E)-1,3-dienes. DFT calculations verified the thermodynamic versus kinetic control of the reactions and kinetic studies are in excellent agreement with the calculated energy changes. Investigations on the transannular Pauson-Khand reaction are also highlighted. The Pauson-Khand reaction is a powerful tool for the synthesis of cyclopentenones through the efficient [2+2+1] cycloaddition of dicobalt alkyne complexes with alkenes. While intermolecular and intramolecular variants are widely known, transannular versions of this reaction are unknown and the basis of this study. Our successful transannular Pauson-Khand reaction required a cyclic enyne incorporating one short three-membered linker chain and a rigid aryl linker in the backbone of the long linker chain. This rigidity of the aryl linker is proposed to facilitate the transannular [2+2+1] cyclization. Computational studies revealed that transannular Pauson-Khand reactions are thermodynamically favored for cyclic enynes featuring a long linker of at least 5 carbons, but with smaller chains the reactions are thermodynamically disfavored. Experimental studies show that long linking chains with more than 5 members are required to prevent to steric interactions between the dicobalt hexacarbonyl moiety and the linking chain to allow the reaction to be kinetically favored. The final part of this work highlights progress towards the total synthesis of (+)-kingianin A. This natural product was isolated as a racemic mixture from the bark of Endiandra kingiana and is an inhibitor of antiapoptotic protein Bcl-Xl, highlighting its potential use in cancer treatments. Its structure is proposed to arise from an intermolecular Diels-Alder dimerization reaction of bicyclo[4.2.0]octadiene fragments derived from an 8pi/6pi-electrocyclization cascade. Although two total syntheses of (+/-)-kingianin A have been reported, an enantioselective synthesis has not been achieved and is the purpose of this study. This synthetic route begins from L-(+)-dimethyl tartrate, a cheap and commercially available starting material, and aims to follow a biomimetic synthetic pathway featuring a substrate controlled diastereoselective palladium(II)-catalyzed oxidative cyclization and 8pi/6pi-electrocyclization cascade. Although the feasibility of this cascade pathway has not yet been realized, key synthetic transformations to install the requisite carbocyclic framework of (+)-kingianin A have been discovered, paving the way for future investigations on the palladium(II)-catalyzed coupling/electrocyclization cascade and completion of the synthesis.

Heat Flow vs. Cash Flow: A Banking Analogy

NASA Astrophysics Data System (ADS)

Wynn, Charles M., Sr.

1997-04-01

An analogy is drawn between the withdrawal of money from an automated teller machine (ATM) and an exothermic chemical reaction. In the analogy the amount in an individual's account is regarded as the system and the money withdrawn is regarded as part of the surroundings. Diagrams are used to present the analogy. An analogy can be drawn also between a deposit into an account and an endothermic chemical reaction.

Massively parallel digital high resolution melt for rapid and absolutely quantitative sequence profiling

NASA Astrophysics Data System (ADS)

Velez, Daniel Ortiz; Mack, Hannah; Jupe, Julietta; Hawker, Sinead; Kulkarni, Ninad; Hedayatnia, Behnam; Zhang, Yang; Lawrence, Shelley; Fraley, Stephanie I.

2017-02-01

In clinical diagnostics and pathogen detection, profiling of complex samples for low-level genotypes represents a significant challenge. Advances in speed, sensitivity, and extent of multiplexing of molecular pathogen detection assays are needed to improve patient care. We report the development of an integrated platform enabling the identification of bacterial pathogen DNA sequences in complex samples in less than four hours. The system incorporates a microfluidic chip and instrumentation to accomplish universal PCR amplification, High Resolution Melting (HRM), and machine learning within 20,000 picoliter scale reactions, simultaneously. Clinically relevant concentrations of bacterial DNA molecules are separated by digitization across 20,000 reactions and amplified with universal primers targeting the bacterial 16S gene. Amplification is followed by HRM sequence fingerprinting in all reactions, simultaneously. The resulting bacteria-specific melt curves are identified by Support Vector Machine learning, and individual pathogen loads are quantified. The platform reduces reaction volumes by 99.995% and achieves a greater than 200-fold increase in dynamic range of detection compared to traditional PCR HRM approaches. Type I and II error rates are reduced by 99% and 100% respectively, compared to intercalating dye-based digital PCR (dPCR) methods. This technology could impact a number of quantitative profiling applications, especially infectious disease diagnostics.

On the complex •OH/•O--induced free radical chemistry of arylalkylamines with special emphasis on the contribution of the alkylamine side chain.

PubMed

Szabó, László; Mile, Viktória; Tóth, Tünde; Balogh, György T; Földes, Tamás; Takács, Erzsébet; Wojnárovits, László

2017-02-01

A full account of the • OH-induced free radical chemistry of an arylalkylamine is given taking all the possible reaction pathways quantitatively into consideration. Such knowledge is indispensable when the alkylamine side chain plays a crucial role in biological activity. The fundamental reactions are investigated on the model compound N-methyl-3-phenypropylamine (MPPA), and extended to its biologically active analog, to the antidepressant fluoxetine (FLX). Pulse radiolysis techniques were applied including redox titration and transient spectral analysis supplemented with DFT calculations. The contribution of the amine moiety to the free radical-induced oxidation mechanism appeared to be appreciable. • O - was used to observe hydrogen atom abstraction events at pH 14 giving rise to the strongly reducing α-aminoalkyl radicals (∼38% of the radical yield) and to benzyl (∼4%), β-aminoalkyl (∼24%), and aminyl radicals (∼31%) of MPPA. One-electron transfer was also observed yielding aminium radicals with low efficiency (∼3%). In the • OH-induced oxidation protonated α-aminoalkyl (∼49%), β-aminoalkyl (∼27%), benzyl radicals (∼4%), and aminium radicals (∼5%) are initially generated on the side chain of MPPA at pH 6, whereas hydroxycyclohexadienyl radicals (∼15%) were also produced. These initial events are followed by complex protonation-deprotonation reactions establishing acid-base equilibria; however, these processes are limited by the transient nature of the radicals and the kinetics of the ongoing reactions. The contribution of the radicals from the side chain alkylamine substituent of FLX totals up to ∼54% of the initially available oxidant yield.

Graphite grain-size spectrum and molecules from core-collapse supernovae

NASA Astrophysics Data System (ADS)

Clayton, Donald D.; Meyer, Bradley S.

2018-01-01

Our goal is to compute the abundances of carbon atomic complexes that emerge from the C + O cores of core-collapse supernovae. We utilize our chemical reaction network in which every atomic step of growth employs a quantum-mechanically guided reaction rate. This tool follows step-by-step the growth of linear carbon chain molecules from C atoms in the oxygen-rich C + O cores. We postulate that once linear chain molecules reach a sufficiently large size, they isomerize to ringed molecules, which serve as seeds for graphite grain growth. We demonstrate our technique for merging the molecular reaction network with a parallel program that can follow 1017 steps of C addition onto the rare seed species. Due to radioactivity within the C + O core, abundant ambient oxygen is unable to convert C to CO, except to a limited degree that actually facilitates carbon molecular ejecta. But oxygen severely minimizes the linear-carbon-chain abundances. Despite the tiny abundances of these linear-carbon-chain molecules, they can give rise to a small abundance of ringed-carbon molecules that serve as the nucleations on which graphite grain growth builds. We expand the C + O-core gas adiabatically from 6000 K for 109 s when reactions have essentially stopped. These adiabatic tracks emulate the actual expansions of the supernova cores. Using a standard model of 1056 atoms of C + O core ejecta having O/C = 3, we calculate standard ejection yields of graphite grains of all sizes produced, of the CO molecular abundance, of the abundances of linear-carbon molecules, and of Buckminsterfullerene. None of these except CO was expected from the C + O cores just a few years past.

Entropy driven chain effects on ligation chemistry† †Electronic supplementary information (ESI) available: Synthetic details, applied MHKS parameters, SEC chromatograms of all samples, (HT) NMR data, experimental debonding values, SANS measurements, computational data (energy contributions and geometries in the form of Gaussian archive entries). See DOI: 10.1039/c4sc02908a Click here for additional data file.

PubMed Central

Pahnke, Kai; Brandt, Josef; Gryn'ova, Ganna; Lindner, Peter; Schweins, Ralf; Schmidt, Friedrich Georg

2015-01-01

We report the investigation of fundamental entropic chain effects that enable the tuning of modular ligation chemistry – for example dynamic Diels–Alder (DA) reactions in materials applications – not only classically via the chemistry of the applied reaction sites, but also via the physical and steric properties of the molecules that are being joined. Having a substantial impact on the reaction equilibrium of the reversible ligation chemistry, these effects are important when transferring reactions from small molecule studies to larger or other entropically very dissimilar systems. The effects on the DA equilibrium and thus the temperature dependent degree of debonding (%debond) of different cyclopentadienyl (di-)functional poly(meth-)acrylate backbones (poly(methyl methacrylate), poly(iso-butyl methacrylate), poly(tert-butyl methacrylate), poly(iso-butyl acrylate), poly(n-butyl acrylate), poly(tert-butyl acrylate), poly(methyl acrylate) and poly(isobornyl acrylate)), linked via a difunctional cyanodithioester (CDTE) were examined via high temperature (HT) NMR spectroscopy as well as temperature dependent (TD) SEC measurements. A significant impact of not only chain mass and length with a difference in the degree of debonding of up to 30% for different lengths of macromonomers of the same polymer type but – remarkably – as well the chain stiffness with a difference in bonding degrees of nearly 20% for isomeric poly(butyl acrylates) is found. The results were predicted, reproduced and interpreted via quantum chemical calculations, leading to a better understanding of the underlying entropic principles. PMID:29560194

Interactions between Therapeutic Proteins and Acrylic Acid Leachable.

PubMed

Liu, Dengfeng; Nashed-Samuel, Yasser; Bondarenko, Pavel V; Brems, David N; Ren, Da

2012-01-01

Leachables are chemical compounds that migrate from manufacturing equipment, primary containers and closure systems, and packaging components into biopharmaceutical and pharmaceutical products. Acrylic acid (at concentration around 5 μg/mL) was detected as leachable in syringes from one of the potential vendors (X syringes). In order to evaluate the potential impact of acrylic acid on therapeutic proteins, an IgG 2 molecule was filled into a sterilized X syringe and then incubated at 45 °C for 45 days in a pH 5 acetate buffer. We discovered that acrylic acid can interact with proteins at three different sites: (1) the lysine side chain, (2) the N-terminus, and (3) the histidine side chain, by the Michael reaction. In this report, the direct interactions between acrylic acid leachable and a biopharmaceutical product were demonstrated and the reaction mechanism was proposed. Even thought a small amount (from 0.02% to 0.3%) of protein was found to be modified by acrylic acid, the modified protein can potentially be harmful due to the toxicity of acrylic acid. After being modified by acrylic acid, the properties of the therapeutic protein may change due to charge and hydrophobicity variations. Acrylic acid was detected to migrate from syringes (Vendor X) into a therapeutic protein solution (at a concentration around 5 μg/mL). In this study, we discovered that acrylic acid can modify proteins at three different sites: (1) the lysine side chain, 2) the N-terminus, and 3) the histidine side chain, by the Michael reaction. In this report, the direct interactions between acrylic acid leachable and a biopharmaceutical product were demonstrated and the reaction mechanism was proposed.

Identification of fragile X pre-mutation carriers in the Chinese obstetric population using a robust FMR1 polymerase chain reaction assay: implications for screening and prenatal diagnosis.

PubMed

Cheng, Y Ky; Lin, C Sw; Kwok, Y Ky; Chan, Y M; Lau, T K; Leung, T Y; Choy, K W

2017-04-01

There is significant morbidity associated with fragile X syndrome. Unfortunately, most maternal carriers are clinically silent during their reproductive years. Because of this, many experts have put forward the notion of preconception or prenatal fragile X carrier screening for females. This study aimed to determine the prevalence of fragile X syndrome pre-mutation and asymptomatic full-mutation carriers in a Chinese pregnant population, and the distribution of cytosine-guanine-guanine (CGG) repeat numbers using a robust fragile X mental retardation 1 (FMR1) polymerase chain reaction assay. This was a cross-sectional survey in prospectively recruited pregnant women from a university hospital in Hong Kong. Chinese pregnant women without a family history of fragile X syndrome were recruited between April 2013 and May 2015. A specific FMR1 polymerase chain reaction assay was performed on peripheral blood to determine the CGG repeat number of the FMR1 gene. Prenatal counselling was offered to full-mutation and pre-mutation carriers. In 2650 Chinese pregnant women, two individuals with pre-mutation alleles (0.08%, one in 1325) and one asymptomatic woman with full-mutation (0.04%, one in 2650) alleles were identified. The overall prevalence of pre-mutation and full-mutation alleles was 0.11% (1 in 883). Furthermore, 30 (1.1%) individuals with intermediate alleles were detected. In the 2617 women with normal CGG repeats, the most common CGG repeat allele was 30. The overall prevalence of pre-mutation and asymptomatic full-mutation carriers in the Chinese pregnant population was one in 883, detected by a new FMR1 polymerase chain reaction assay.

The role of acyl carrier protein isoforms from Cuphea lanceolata seeds in the de-novo biosynthesis of medium-chain fatty acids.

PubMed

Schütt, B S; Brummel, M; Schuch, R; Spener, F

1998-06-01

To investigate the role of acyl carrier protein (ACP) in determining the fate of the acyl moieties linked to it in the course of de-novo fatty acid biosynthesis in higher plants, we carried out in vitro experiments to reconstitute the fatty acid synthase (FAS) reaction in extracts of spinach (Spinacia oleracea L.) leaves, rape (Brassica napus L.) seeds and Cuphea lanceolata Ait. seeds. The action of two major C. lanceolata ACP isoforms (ACP 1 and ACP 2) compared to ACP from Escherichia coli was monitored by saponification of the corresponding FAS products with subsequent analysis of the liberated fatty acids by high-performance liquid chromatography. In a second approach the preference of the medium-chain acyl-ACP-specific thioesterase (EC 3.1.2.14) of C. lanceolata seeds for the hydrolysis of acyl-ACPs prepared from the three ACP types was investigated. Both ACP isoforms from C. lanceolata seeds supported the synthesis of medium-chain fatty acids in a reconstituted FAS reaction of spinach leaf extracts. Compared to the isoform ACP 1, ACP 2 was more effective in supporting the synthesis of such fatty acids in the FAS reaction of rape seed extracts and caused a higher accumulation of FAS products in all experiments. No preference of the medium-chain thioesterase for one specific ACP isoform was observed. The results indicate that the presence of ACP 2 is essential for the synthesis of decanoic acid in C. lanceolata seeds, and its expression in the phase of accumulation of high levels of this fatty acid provides an additional and highly efficient cofactor for stimulating the FAS reaction.

A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

PubMed Central

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

2008-01-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880

Chemical stability of insulin. 4. Mechanisms and kinetics of chemical transformations in pharmaceutical formulation.

PubMed

Brange, J

1992-01-01

Insulin decomposes by a multitude of chemical reactions [1-3]. It deamidates at two different residues by entirely different mechanisms. In acid, deamidation at AsnA21 is intramolecularly catalyzed by the protonated C-terminal, whereas above pH 6 an intermediate imide formation at residue AsnB3 leads to isoAsp and Asp derivatives. The imide formation requires a large rotation around the alpha-carbon/peptide carbonyl carbon bond at B3, corresponding to a 10 A movement of the B-chain N-terminal. The main determinant for the rate of B3 deamidation, as well as for the ratio between the two products formed, is the local conformational structure, which is highly influenced by various excipients and the physical state of the insulin. An amazing thermolysin-like, autoproteolytic cleavage of the A-chain takes place in rhombohedral insulin crystals, mediated by a concerted catalytic action by several, inter-hexameric functional groups and Zn2+. Intermolecular, covalent cross-linking of insulin molecules occurs via several mechanisms. The most prominent type of mechanism is aminolysis by the N-terminals, leading to isopeptide linkages with the A-chain side-chain amides of residues GlnA15, AsnA18 and AsnA21. The same type of reaction also leads to covalent cross-linking of the N-terminal in protamine with insulin. Disulfide exchange reactions, initiated by lysis of the A7-B7 disulfide bridge, lead mainly to formation of covalent oligo- and polymers. Activation energy (Ea) for the neutral deamidation and the aminolysis reactions was found to be 80 and 119 KJ/mol, respectively.

DNA Bipedal Motor Achieves a Large Number of Steps Due to Operation Using Microfluidics-Based Interface.

PubMed

Tomov, Toma E; Tsukanov, Roman; Glick, Yair; Berger, Yaron; Liber, Miran; Avrahami, Dorit; Gerber, Doron; Nir, Eyal

2017-04-25

Realization of bioinspired molecular machines that can perform many and diverse operations in response to external chemical commands is a major goal in nanotechnology, but current molecular machines respond to only a few sequential commands. Lack of effective methods for introduction and removal of command compounds and low efficiencies of the reactions involved are major reasons for the limited performance. We introduce here a user interface based on a microfluidics device and single-molecule fluorescence spectroscopy that allows efficient introduction and removal of chemical commands and enables detailed study of the reaction mechanisms involved in the operation of synthetic molecular machines. The microfluidics provided 64 consecutive DNA strand commands to a DNA-based motor system immobilized inside the microfluidics, driving a bipedal walker to perform 32 steps on a DNA origami track. The microfluidics enabled removal of redundant strands, resulting in a 6-fold increase in processivity relative to an identical motor operated without strand removal and significantly more operations than previously reported for user-controlled DNA nanomachines. In the motor operated without strand removal, redundant strands interfere with motor operation and reduce its performance. The microfluidics also enabled computer control of motor direction and speed. Furthermore, analysis of the reaction kinetics and motor performance in the absence of redundant strands, made possible by the microfluidics, enabled accurate modeling of the walker processivity. This enabled identification of dynamic boundaries and provided an explanation, based on the "trap state" mechanism, for why the motor did not perform an even larger number of steps. This understanding is very important for the development of future motors with significantly improved performance. Our universal interface enables two-way communication between user and molecular machine and, relying on concepts similar to that of solid-phase synthesis, removes limitations on the number of external stimuli. This interface, therefore, is an important step toward realization of reliable, processive, reproducible, and useful externally controlled DNA nanomachines.

Enhanced DNA Sensing via Catalytic Aggregation of Gold Nanoparticles

PubMed Central

Huttanus, Herbert M.; Graugnard, Elton; Yurke, Bernard; Knowlton, William B.; Kuang, Wan; Hughes, William L.; Lee, Jeunghoon

2014-01-01

A catalytic colorimetric detection scheme that incorporates a DNA-based hybridization chain reaction into gold nanoparticles was designed and tested. While direct aggregation forms an inter-particle linkage from only ones target DNA strand, the catalytic aggregation forms multiple linkages from a single target DNA strand. Gold nanoparticles were functionalized with thiol-modified DNA strands capable of undergoing hybridization chain reactions. The changes in their absorption spectra were measured at different times and target concentrations and compared against direct aggregation. Catalytic aggregation showed a multifold increase in sensitivity at low target concentrations when compared to direct aggregation. Gel electrophoresis was performed to compare DNA hybridization reactions in catalytic and direct aggregation schemes, and the product formation was confirmed in the catalytic aggregation scheme at low levels of target concentrations. The catalytic aggregation scheme also showed high target specificity. This application of a DNA reaction network to gold nanoparticle-based colorimetric detection enables highly-sensitive, field-deployable, colorimetric readout systems capable of detecting a variety of biomolecules. PMID:23891867

Regeneration of cello-oligomers via selective depolymerization of cellulose fibers derived from printed paper wastes.

PubMed

Voon, Lee Ken; Pang, Suh Cem; Chin, Suk Fun

2016-05-20

Cellulose extracted from printed paper wastes were selectively depolymerized under controlled conditions into cello-oligomers of controllable chain lengths via dissolution in an ionic liquid, 1-allyl-3-methylimidazolium chloride (AMIMCl), and in the presence of an acid catalyst, Amberlyst 15DRY. The depolymerization process was optimized against reaction temperature, concentration of acid catalyst, and reaction time. Despite rapid initial depolymerization process, the rate of cellulose depolymerization slowed down gradually upon prolonged reaction time, with 75.0 wt% yield of regenerated cello-oligomers (mean Viscosimetric Degree of Polymerization value of 81) obtained after 40 min. The depolymerization of cellulose fibers at 80 °C appeared to proceed via a second-order kinetic reaction with respect to the catalyst concentration of 0.23 mmol H3O(+). As such, the cellulose depolymerization process could afford some degree of control on the degree of polymerization or chain lengths of cello-oligomers formed. Copyright © 2016 Elsevier Ltd. All rights reserved.

Efficient Homodifunctional Bimolecular Ring-Closure Method for Cyclic Polymers by Combining RAFT and Self-Accelerating Click Reaction.

PubMed

Qu, Lin; Sun, Peng; Wu, Ying; Zhang, Ke; Liu, Zhengping

2017-08-01

An efficient metal-free homodifunctional bimolecular ring-closure method is developed for the formation of cyclic polymers by combining reversible addition-fragmentation chain transfer (RAFT) polymerization and self-accelerating click reaction. In this approach, α,ω-homodifunctional linear polymers with azide terminals are prepared by RAFT polymerization and postmodification of polymer chain end groups. By virtue of sym-dibenzo-1,5-cyclooctadiene-3,7-diyne (DBA) as small linkers, well-defined cyclic polymers are then prepared using the self-accelerating double strain-promoted azide-alkyne click (DSPAAC) reaction to ring-close the azide end-functionalized homodifunctional linear polymer precursors. Due to the self-accelerating property of DSPAAC ring-closing reaction, this novel method eliminates the requirement of equimolar amounts of telechelic polymers and small linkers in traditional bimolecular ring-closure methods. It facilitates this method to efficiently and conveniently produce varied pure cyclic polymers by employing an excess molar amount of DBA small linkers. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Toluene nitration in irradiated nitric acid and nitrite solutions

NASA Astrophysics Data System (ADS)

Elias, Gracy; Mincher, Bruce J.; Mezyk, Stephen P.; Muller, Jim; Martin, Leigh R.

2011-04-01

The kinetics, mechanisms, and stable products produced for the nitration of aryl alkyl mild ortho-para director toluene in irradiated nitric acid and neutral nitrite solutions were investigated using γ and pulse radiolysis. Electron pulse radiolysis was used to determine the bimolecular rate constants for the reaction of toluene with different transient species produced by irradiation. HPLC with UV detection, GC-MS and LC-MS, were used to assess the stable reaction products. Free-radical based nitration reaction products were found in irradiated acidic and neutral media. In 6.0 M HNO3, ring substitution, side chain substitution, and oxidation, produced different nitrated toluene products. For ring substitution, nitrogen oxide radicals were added mainly to cyclohexadienyl radicals, whereas for side chain substitution, these radicals were added to the carbon-centered benzyl radical produced by H-atom abstraction. In neutral nitrite solutions, radiolytically-induced ring nitration products approached a statistically random distribution, suggesting a direct free-radical reaction involving addition of the rad NO2 radical.

Manipulation of prenylation reactions by structure-based engineering of bacterial indolactam prenyltransferases

NASA Astrophysics Data System (ADS)

Mori, Takahiro; Zhang, Lihan; Awakawa, Takayoshi; Hoshino, Shotaro; Okada, Masahiro; Morita, Hiroyuki; Abe, Ikuro

2016-03-01

Prenylation reactions play crucial roles in controlling the activities of biomolecules. Bacterial prenyltransferases, TleC from Streptomyces blastmyceticus and MpnD from Marinactinospora thermotolerans, catalyse the `reverse' prenylation of (-)-indolactam V at the C-7 position of the indole ring with geranyl pyrophosphate or dimethylallyl pyrophosphate, to produce lyngbyatoxin or pendolmycin, respectively. Using in vitro analyses, here we show that both TleC and MpnD exhibit relaxed substrate specificities and accept various chain lengths (C5-C25) of the prenyl donors. Comparisons of the crystal structures and their ternary complexes with (-)-indolactam V and dimethylallyl S-thiophosphate revealed the intimate structural details of the enzyme-catalysed `reverse' prenylation reactions and identified the active-site residues governing the selection of the substrates. Furthermore, structure-based enzyme engineering successfully altered the preference for the prenyl chain length of the substrates, as well as the regio- and stereo-selectivities of the prenylation reactions, to produce a series of unnatural novel indolactams.

Effects of macromolecular crowding on biochemical reaction equilibria: a molecular thermodynamic perspective.

PubMed

Hu, Zhongqiao; Jiang, Jianwen; Rajagopalan, Raj

2007-09-01

A molecular thermodynamic model is developed to investigate the effects of macromolecular crowding on biochemical reactions. Three types of reactions, representing protein folding/conformational isomerization, coagulation/coalescence, and polymerization/association, are considered. The reactants, products, and crowders are modeled as coarse-grained spherical particles or as polymer chains, interacting through hard-sphere interactions with or without nonbonded square-well interactions, and the effects of crowder size and chain length as well as product size are examined. The results predicted by this model are consistent with experimentally observed crowding effects based on preferential binding or preferential exclusion of the crowders. Although simple hard-core excluded-volume arguments do in general predict the qualitative aspects of the crowding effects, the results show that other intermolecular interactions can substantially alter the extent of enhancement or reduction of the equilibrium and can even change the direction of the shift. An advantage of the approach presented here is that competing reactions can be incorporated within the model.

Development of a tandem-electrostatic-quadrupole accelerator facility for BNCT.

PubMed

Kreiner, A J; Thatar Vento, V; Levinas, P; Bergueiro, J; Di Paolo, H; Burlon, A A; Kesque, J M; Valda, A A; Debray, M E; Somacal, H R; Minsky, D M; Estrada, L; Hazarabedian, A; Johann, F; Suarez Sandin, J C; Castell, W; Davidson, J; Davidson, M; Giboudot, Y; Repetto, M; Obligado, M; Nery, J P; Huck, H; Igarzabal, M; Fernandez Salares, A

2009-07-01

In this work we describe the present status of an ongoing project to develop a tandem-electrostatic-quadrupole (TESQ) accelerator facility for accelerator-based (AB) BNCT at the Atomic Energy Commission of Argentina in Buenos Aires. The project final goal is a machine capable of delivering 30 mA of 2.4 MeV protons to be used in conjunction with a neutron production target based on the (7)Li(p,n)(7)Be reaction slightly beyond its resonance at 2.25 MeV. These are the specifications needed to produce sufficiently intense and clean epithermal neutron beams, based on the (7)Li(p,n)(7)Be reaction, to perform BNCT treatment for deep-seated tumors in less than an hour. An electrostatic machine is the technologically simplest and cheapest solution for optimized AB-BNCT. The machine being designed and constructed is a folded TESQ with a high-voltage terminal at 1.2 MV intended to work in air. Such a machine is conceptually shown to be capable of transporting and accelerating a 30 mA proton beam to 2.4 MeV. The general geometric layout, its associated electrostatic fields, and the acceleration tube are simulated using a 3D finite element procedure. The design and construction of the ESQ modules is discussed and their electrostatic fields are investigated. Beam transport calculations through the accelerator are briefly mentioned. Likewise, work related to neutron production targets, strippers, beam shaping assembly and patient treatment room is briefly described.

Microcompartments and Protein Machines in Prokaryotes

PubMed Central

Saier, Milton H.

2013-01-01

The prokaryotic cell was once thought of as a “bag of enzymes” with little or no intracellular compartmentalization. In this view, most reactions essential for life occurred as a consequence of random molecular collisions involving substrates, cofactors and cytoplasmic enzymes. Our current conception of a prokaryote is far from this view. We now consider a bacterium or an archaeon as a highly structured, non-random collection of functional membrane-embedded and proteinaceous molecular machines, each of which serves a specialized function. In this article we shall present an overview of such microcompartments including (i) the bacterial cytoskeleton and the apparati allowing DNA segregation during cells division, (ii) energy transduction apparati involving light-driven proton pumping and ion gradient-driven ATP synthesis, (iii) prokaryotic motility and taxis machines that mediate cell movements in response to gradients of chemicals and physical forces, (iv) machines of protein folding, secretion and degradation, (v) metabolasomes carrying out specific chemical reactions, (vi) 24 hour clocks allowing bacteria to coordinate their metabolic activities with the daily solar cycle and (vii) proteinaceous membrane compartmentalized structures such as sulfur granules and gas vacuoles. Membrane-bounded prokaryotic organelles were considered in a recent JMMB written symposium concerned with membraneous compartmentalization in bacteria [Saier and Bogdanov, 2013]. By contrast, in this symposium, we focus on proteinaceous microcompartments. These two symposia, taken together, provide the interested reader with an objective view of the remarkable complexity of what was once thought of as a simple non-compartmentalized cell. PMID:23920489

A Hierarchical Multivariate Bayesian Approach to Ensemble Model output Statistics in Atmospheric Prediction

DTIC Science & Technology

2017-09-01

efficacy of statistical post-processing methods downstream of these dynamical model components with a hierarchical multivariate Bayesian approach to...Bayesian hierarchical modeling, Markov chain Monte Carlo methods , Metropolis algorithm, machine learning, atmospheric prediction 15. NUMBER OF PAGES...scale processes. However, this dissertation explores the efficacy of statistical post-processing methods downstream of these dynamical model components

Production and Costs of the Chambers Delimbinator in First Thinning of Pine Plantations

Treesearch

Scott T. Mooney; Kevin D. Boston; W. Dale Greene

2000-01-01

Production and quality measures were collected and analyzed for a new chain-flail delimbing machine, Chambers Delimbinator, on two operations in central and southwestern Georgia. The first operation, Logger A, used two skidders and one loader while the second operation, Logger B, used two skidder and two loaders. Lobber B with the lower cycle time and larger piece...

29 CFR 570.65 - Occupations involved in the operations of circular saws, band saws, and guillotine shears (Order...

Code of Federal Regulations, 2010 CFR

2010-07-01

..., running over wheels or pulleys, and used for sawing materials. (6) The term guillotine shear shall mean a machine equipped with a movable blade operated vertically and used to shear materials. The term shall not... series of notches or teeth, running over wheels or pulleys, and used for sawing materials. Chain saw...

Oxidative transformation of tunichromes - Model studies with 1,2-dehydro-N-acetyldopamine and N-acetylcysteine.

PubMed

Kuang, Qun F; Abebe, Adal; Evans, Jason; Sugumaran, Manickam

2017-08-01

Tunichromes are 1,2-dehydrodopa containing bioactive peptidyl derivatives found in blood cells of several tunicates. They have been implicated in metal sequestering, tunic formation, wound healing and defense reaction. Earlier studies conducted on these compounds indicate their extreme liability, high reactivity and easy oxidative polymerization. Their reactions are also complicated by the presence of multiple dehydrodopyl units. Since they have been invoked in crosslinking and covalent binding, to understand the reactivities of these novel compounds, we have taken a simple model compound that possess the tunichrome reactive group viz., 1,2-dehydro-N-acetyldopamine (Dehydro NADA) and examined its reaction with N-acetylcysteine in presence of oxygen under both enzymatic and nonenzymatic conditions. Ultraviolet and visible spectral studies of reaction mixtures containing dehydro NADA and N-acetylcysteine in different molar ratios indicated the production of side chain and ring adducts of N-acetylcysteine to dehydro NADA. Liquid chromatography and mass spectral studies supported this contention and confirmed the production of several different products. Mass spectral analysis of these products show the potentials of dehydro NADA to form side chain adducts that can lead to polymeric products. This is the first report demonstrating the ability of dehydro dopyl units to form adducts and crosslinks with amino acid side chains. Copyright © 2017 Elsevier Inc. All rights reserved.

Mass Chain Evaluation for A=95

DOE Office of Scientific and Technical Information (OSTI.GOV)

Basu, S.K.; Sonzogni, A.; Basu, Swapan Kr.

2011-08-01

A full evaluation of the mass chain A = 95 has been done in the ENSDF format taking into account all the available data until June 2009. Excited states populated by in-beam nuclear reactions and by radioactive decay have been considered. The 'evp' editor, developed at the NNDC, has been used for the evaluation. This mass chain was last evaluated in 1993. Many new and improved data were reported since then. A total of 13 nuclei have been evaluated.

Machine Learning and Network Analysis of Molecular Dynamics Trajectories Reveal Two Chains of Red/Ox-specific Residue Interactions in Human Protein Disulfide Isomerase.

PubMed

Karamzadeh, Razieh; Karimi-Jafari, Mohammad Hossein; Sharifi-Zarchi, Ali; Chitsaz, Hamidreza; Salekdeh, Ghasem Hosseini; Moosavi-Movahedi, Ali Akbar

2017-06-16

The human protein disulfide isomerase (hPDI), is an essential four-domain multifunctional enzyme. As a result of disulfide shuffling in its terminal domains, hPDI exists in two oxidation states with different conformational preferences which are important for substrate binding and functional activities. Here, we address the redox-dependent conformational dynamics of hPDI through molecular dynamics (MD) simulations. Collective domain motions are identified by the principal component analysis of MD trajectories and redox-dependent opening-closing structure variations are highlighted on projected free energy landscapes. Then, important structural features that exhibit considerable differences in dynamics of redox states are extracted by statistical machine learning methods. Mapping the structural variations to time series of residue interaction networks also provides a holistic representation of the dynamical redox differences. With emphasizing on persistent long-lasting interactions, an approach is proposed that compiled these time series networks to a single dynamic residue interaction network (DRIN). Differential comparison of DRIN in oxidized and reduced states reveals chains of residue interactions that represent potential allosteric paths between catalytic and ligand binding sites of hPDI.

E2-EPF UCP Possesses E3 Ubiquitin Ligase Activity via Its Cysteine 118 Residue.

PubMed

Lim, Jung Hwa; Shin, Hee Won; Chung, Kyung-Sook; Kim, Nam-Soon; Kim, Ju Hee; Jung, Hong-Ryul; Im, Dong-Soo; Jung, Cho-Rok

Here, we show that E2-EPF ubiquitin carrier protein (UCP) elongated E3-independent polyubiquitin chains on the lysine residues of von Hippel-Lindau protein (pVHL) and its own lysine residues both in vitro and in vivo. The initiation of the ubiquitin reaction depended on not only Lys11 linkage but also the Lys6, Lys48 and Lys63 residues of ubiquitin, which were involved in polyubiquitin chain formation on UCP itself. UCP self-association occurred through the UBC domain, which also contributed to the interaction with pVHL. The polyubiquitin chains appeared on the N-terminus of UCP in vivo, which indicated that the N-terminus of UCP contains target lysines for polyubiquitination. The Lys76 residue of UCP was the most critical site for auto-ubiquitination, whereas the polyubiquitin chain formation on pVHL occurred on all three of its lysines (Lys159, Lys171 and Lys196). A UCP mutant in which Cys118 was changed to alanine (UCPC118A) did not form a polyubiquitin chain but did strongly accumulate mono- and di-ubiquitin via auto-ubiquitination. Polyubiquitin chain formation required the coordination of Cys95 and Cys118 between two interacting molecules. The mechanism of the polyubiquitin chain reaction of UCP may involve the transfer of ubiquitin from Cys95 to Cys118 by trans-thiolation, with polyubiquitin chains forming at Cys118 by reversible thioester bonding. The polyubiquitin chains are then moved to the lysine residues of the substrate by irreversible isopeptide bonding. During the elongation of the ubiquitin chain, an active Cys118 residue is required in both parts of UCP, namely, the catalytic enzyme and the substrate. In conclusion, UCP possesses not only E2 ubiquitin conjugating enzyme activity but also E3 ubiquitin ligase activity, and Cys118 is critical for polyubiquitin chain formation.

E2-EPF UCP Possesses E3 Ubiquitin Ligase Activity via Its Cysteine 118 Residue

PubMed Central

Lim, Jung Hwa; Shin, Hee Won; Chung, Kyung-Sook; Kim, Nam-Soon; Kim, Ju Hee; Jung, Hong-Ryul; Im, Dong-Soo; Jung, Cho-Rok

2016-01-01

Here, we show that E2-EPF ubiquitin carrier protein (UCP) elongated E3-independent polyubiquitin chains on the lysine residues of von Hippel-Lindau protein (pVHL) and its own lysine residues both in vitro and in vivo. The initiation of the ubiquitin reaction depended on not only Lys11 linkage but also the Lys6, Lys48 and Lys63 residues of ubiquitin, which were involved in polyubiquitin chain formation on UCP itself. UCP self-association occurred through the UBC domain, which also contributed to the interaction with pVHL. The polyubiquitin chains appeared on the N-terminus of UCP in vivo, which indicated that the N-terminus of UCP contains target lysines for polyubiquitination. The Lys76 residue of UCP was the most critical site for auto-ubiquitination, whereas the polyubiquitin chain formation on pVHL occurred on all three of its lysines (Lys159, Lys171 and Lys196). A UCP mutant in which Cys118 was changed to alanine (UCPC118A) did not form a polyubiquitin chain but did strongly accumulate mono- and di-ubiquitin via auto-ubiquitination. Polyubiquitin chain formation required the coordination of Cys95 and Cys118 between two interacting molecules. The mechanism of the polyubiquitin chain reaction of UCP may involve the transfer of ubiquitin from Cys95 to Cys118 by trans-thiolation, with polyubiquitin chains forming at Cys118 by reversible thioester bonding. The polyubiquitin chains are then moved to the lysine residues of the substrate by irreversible isopeptide bonding. During the elongation of the ubiquitin chain, an active Cys118 residue is required in both parts of UCP, namely, the catalytic enzyme and the substrate. In conclusion, UCP possesses not only E2 ubiquitin conjugating enzyme activity but also E3 ubiquitin ligase activity, and Cys118 is critical for polyubiquitin chain formation. PMID:27685940

Feature selection using a one dimensional naïve Bayes’ classifier increases the accuracy of support vector machine classification of CDR3 repertoires

PubMed Central

Cinelli, Mattia; Sun, , Yuxin; Best, Katharine; Heather, James M.; Reich-Zeliger, Shlomit; Shifrut, Eric; Friedman, Nir; Shawe-Taylor, John; Chain, Benny

2017-01-01

Abstract Motivation: Somatic DNA recombination, the hallmark of vertebrate adaptive immunity, has the potential to generate a vast diversity of antigen receptor sequences. How this diversity captures antigen specificity remains incompletely understood. In this study we use high throughput sequencing to compare the global changes in T cell receptor β chain complementarity determining region 3 (CDR3β) sequences following immunization with ovalbumin administered with complete Freund’s adjuvant (CFA) or CFA alone. Results: The CDR3β sequences were deconstructed into short stretches of overlapping contiguous amino acids. The motifs were ranked according to a one-dimensional Bayesian classifier score comparing their frequency in the repertoires of the two immunization classes. The top ranking motifs were selected and used to create feature vectors which were used to train a support vector machine. The support vector machine achieved high classification scores in a leave-one-out validation test reaching >90% in some cases. Summary: The study describes a novel two-stage classification strategy combining a one-dimensional Bayesian classifier with a support vector machine. Using this approach we demonstrate that the frequency of a small number of linear motifs three amino acids in length can accurately identify a CD4 T cell response to ovalbumin against a background response to the complex mixture of antigens which characterize Complete Freund’s Adjuvant. Availability and implementation: The sequence data is available at www.ncbi.nlm.nih.gov/sra/?term¼SRP075893. The Decombinator package is available at github.com/innate2adaptive/Decombinator. The R package e1071 is available at the CRAN repository https://cran.r-project.org/web/packages/e1071/index.html. Contact: b.chain@ucl.ac.uk Supplementary information: Supplementary data are available at Bioinformatics online. PMID:28073756

Improved properties of recycled polypropylene by introducing the long chain branched structure through reactive extrusion.

PubMed

Li, Yingchun; Jia, Shuai; Du, Shuanli; Wang, Yafei; Lv, Lida; Zhang, Jianbin

2018-06-01

An approach originated from preparing long chain branched polypropylene (PP) was applied to modify the properties of recycled PP that involved reactive extrusion to introduce a branched chain structure onto recycled PP under the assistance of chemical reaction between maleic anhydride (MAH) monomer and glycidyl methacrylate (GMA) grafts. The results from Fourier transformed infrared spectroscopy (FTIR) indicated the reaction took place during melt mixing, and the intensity of ester increased with increasing amount of MAH. Several rheological plots including complex viscosity, storage modulus, loss modulus, loss tangent and Cole-Cole plot were used to investigate the rheological properties of recycled PP and modified PP with MAH, which indicated an additional longer relaxation time that was not shown in recycled PP. The effects of branched structure on melting and crystallization behaviors were also investigated, demonstrating the branched chains acted as nucleating agent. Moreover, the branched structure of modified samples gave rise to enhance mechanical properties, especially, the higher impact strength compared with recycled PP. Copyright © 2018 Elsevier Ltd. All rights reserved.

Digital PCR Quantitation of Muscle Mitochondrial DNA: Age, Fiber Type, and Mutation-Induced Changes.

PubMed

Herbst, Allen; Widjaja, Kevin; Nguy, Beatrice; Lushaj, Entela B; Moore, Timothy M; Hevener, Andrea L; McKenzie, Debbie; Aiken, Judd M; Wanagat, Jonathan

2017-10-01

Definitive quantitation of mitochondrial DNA (mtDNA) and mtDNA deletion mutation abundances would help clarify the role of mtDNA instability in aging. To more accurately quantify mtDNA, we applied the emerging technique of digital polymerase chain reaction to individual muscle fibers and muscle homogenates from aged rodents. Individual fiber mtDNA content correlated with fiber type and decreased with age. We adapted a digital polymerase chain reaction deletion assay that was accurate in mixing experiments to a mutation frequency of 0.03% and quantitated an age-induced increase in deletion frequency from rat muscle homogenates. Importantly, the deletion frequency measured in muscle homogenates strongly correlated with electron transport chain-deficient fiber abundance determined by histochemical analyses. These data clarify the temporal accumulation of mtDNA deletions that lead to electron chain-deficient fibers, a process culminating in muscle fiber loss. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Development of an Electric Motor Powered Low Cost Coconut Deshelling Machine

NASA Astrophysics Data System (ADS)

Mondal, Imdadul Hoque; Prasanna Kumar, G. V.

2016-06-01

An electric motor powered coconut deshelling machine was developed in line with the commercially available unit, but with slight modifications. The machine worked on the principle that the coconut shell can be caused to fail in shear and compressive forces. It consisted of a toothed wheel, a deshelling rod, an electric motor, and a compound chain drive. A bevelled 16 teeth sprocket with 18 mm pitch was used as the toothed wheel. Mild steel round bar of 18 mm diameter was used as the deshelling rod. The sharp edge tip of the deshelling rod was inserted below the shell to apply shear force on the shell, and the fruit was tilted toward the rotary toothed wheel to apply the compressive force on the shell. The speed of rotation of the toothed wheel was set at 34 ± 2 rpm. The output capacity of the machine was found to be 24 coconuts/h with 95 % of the total time effectively used for deshelling. The labour requirement was found to be 43 man-h/1000 nuts. About 13 % of the kernels got scraped and about 7 % got sliced during the operation. The developed coconut deshelling machine was recommended for the minimum annual use of 200 h or deshelling of 4700 coconuts per year. The cost of operation for 200 h of annual use was found to be about ` 47/h. The developed machine was found to be simple, easy to operate, energy efficient, safe and reduce drudgery involved in deshelling by conventional methods.

Methodology for creating dedicated machine and algorithm on sunflower counting

NASA Astrophysics Data System (ADS)

Muracciole, Vincent; Plainchault, Patrick; Mannino, Maria-Rosaria; Bertrand, Dominique; Vigouroux, Bertrand

2007-09-01

In order to sell grain lots in European countries, seed industries need a government certification. This certification requests purity testing, seed counting in order to quantify specified seed species and other impurities in lots, and germination testing. These analyses are carried out within the framework of international trade according to the methods of the International Seed Testing Association. Presently these different analyses are still achieved manually by skilled operators. Previous works have already shown that seeds can be characterized by around 110 visual features (morphology, colour, texture), and thus have presented several identification algorithms. Until now, most of the works in this domain are computer based. The approach presented in this article is based on the design of dedicated electronic vision machine aimed to identify and sort seeds. This machine is composed of a FPGA (Field Programmable Gate Array), a DSP (Digital Signal Processor) and a PC bearing the GUI (Human Machine Interface) of the system. Its operation relies on the stroboscopic image acquisition of a seed falling in front of a camera. A first machine was designed according to this approach, in order to simulate all the vision chain (image acquisition, feature extraction, identification) under the Matlab environment. In order to perform this task into dedicated hardware, all these algorithms were developed without the use of the Matlab toolbox. The objective of this article is to present a design methodology for a special purpose identification algorithm based on distance between groups into dedicated hardware machine for seed counting.