Comparison of the diagnostic performance of microscopic examination with nested polymerase chain reaction for optimum malaria diagnosis in Upper Myanmar.

PubMed

Kang, Jung-Mi; Cho, Pyo-Yun; Moe, Mya; Lee, Jinyoung; Jun, Hojong; Lee, Hyeong-Woo; Ahn, Seong Kyu; Kim, Tae Im; Pak, Jhang Ho; Myint, Moe Kyaw; Lin, Khin; Kim, Tong-Soo; Na, Byoung-Kuk

2017-03-16

Accurate diagnosis of Plasmodium infection is crucial for prompt malaria treatment and surveillance. Microscopic examination has been widely applied as the gold standard for malaria diagnosis in most part of malaria endemic areas, but its diagnostic value has been questioned, particularly in submicroscopic malaria. In this study, the diagnostic performance of microscopic examination and nested polymerase chain reaction (PCR) was evaluated to establish optimal malaria diagnosis method in Myanmar. A total of 1125 blood samples collected from residents in the villages and towns located in Naung Cho, Pyin Oo Lwin, Tha Beik Kyin townships and Mandalay of Upper Myanmar were screened by microscopic examination and species-specific nested PCR method. Among the 1125 blood samples, 261 samples were confirmed to be infected with malaria by microscopic examination. Evaluation of the 1125 samples by species-specific nested PCR analysis revealed that the agreement between microscopic examination and nested PCR was 87.3% (261/299). Nested PCR successfully detected 38 Plasmodium falciparum or Plasmodium vivax infections, which were missed in microscopic examination. Microscopic examinations also either misdiagnosed the infected Plasmodium species, or did not detect mixed infections with different Plasmodium species in 31 cases. The nested PCR method is more reliable than conventional microscopic examination for the diagnosis of malaria infections, and this is particularly true in cases of mixed infections and submicroscopic infections. Given the observed higher sensitivity and specificity of nested PCR, the molecular method holds enormous promise in malaria diagnosis and species differentiation, and can be applied as an effective monitoring tool for malaria surveillance, control and elimination in Myanmar.

[Roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis].

PubMed

Dai, Lin; Huang, Juan; Tang, Yuan; Liao, Dian-ying; Dong, Dan-dan; Xu, Gang; Li, Gan-di

2010-06-01

To study the roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis (TL). Forty-six archival cases of histologically diagnosed TL, encountered during the period from April, 1999 to September, 2009 and with the paraffin-embedded lymph node tissue blocks available, were enrolled into the study. The presence of genome fragments of Toxoplasma gondii (T. gondii) was analyzed using semi-nested polymerase chain reaction (PCR). Thirty cases of one or two histopathologic triad of TL as the controls. The positive rate of PCR in TL group was 76.1% (35/46), as compared to 10.0% (3/30) in the control group. The difference was of statistical significance. The sensitivity and specificity of the histologic triad in diagnosing TL was 92.1% (35/38) and 71.1% (27/38), respectively. The predictive value of positive and negative PCR results was 76.1% (35/46) and 90.0% (27/30). respectively. The high specificity but low sensitivity of applying the histologic triad in diagnosing TL cases may be due to the occurrence of atypical histologic pattern. The sensitivity is improved with the use of semi-nested PCR in detecting T. gondii DNA.

Impact of human cytomegalovirus infection UL55-nested polymerase chain reaction method in hematopoietic stem cell transplant donors and recipients.

PubMed

Banan, A A; Yaghobi, R; Ramzi, M; Mehrabani, D

2009-09-01

Human cytomegalovirus (HCMV) is one of the most important and critical viral causes of graft rejection among hematopoietic stem cell transplant (HSCT) recipients. Monitoring of this viral infection has a critical role in the management of HSCT clinical complications. In this retrospective cohort, blood (plasma and buffy coat) and urine samples were collected from 110 HSCT patients and 95 donors pretransplantation and weekly for 100 days posttransplantation. An HCMV-optimized UL55-nested polymerase chain reaction (PCR) method was used to detect HCMV infection. Genotyping of the HCMV UL55 gene was performed for all UL55-nested, PCR-positive samples. HSCT donor and recipient laboratory and clinical data were statistically analyzed using SPSS version 15 software. UL55-nested, PCR-positive results were obtained in 3540/4950 (71.5%), 3634/4950 (73.4%), and 3292/4950 (66.5%) of these plasma, buffy coat, and urine samples, respectively. Twenty-five percent of transplant donors were infected with HCMV. An increase in HCMV infection was observed from pre- to post-HSCT conditions. Detection of the gB2 UL55 genotype in most transplant patient samples suggested the need to examine the possible impact of HCMV UL55 genotypes and HCMV infections among stem cell transplant recipients.

Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

PubMed

Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

2014-05-01

Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

Immunocapture reverse transcription-polymerase chain reaction combined with nested PCR greatly increases the detection of Prunus necrotic ring spot virus in the peach.

PubMed

Helguera, P R; Taborda, R; Docampo, D M; Ducasse, D A

2001-06-01

A detection system based on nested PCR after IC-RT-PCR (IC-RT-PCR-Nested PCR) was developed to improve indexing of Prunus necrotic ringspot virus in peach trees. Inhibitory effects and inconsistencies of the standard IC-RT-PCR were overcome by this approach. IC-RT-PCR-Nested PCR improved detection by three orders of magnitude compared with DAS-ELISA for the detection of PNRSV in leaves. Several different tissues were evaluated and equally consistent results were observed. The main advantages of the method are its consistency, high sensitivity and easy application in quarantine programs.

Development of a reverse transcription polymerase chain reaction method for yellow fever virus detection.

PubMed

Méndez, María C; Domingo, Cristina; Tenorio, Antonio; Pardo, Lissethe C; Rey, Gloria J; Méndez, Jairo A

2013-09-01

Yellow fever is considered a re-emerging disease and is endemic in tropical regions of Africa and South America. At present, there are no standardized or commercialized kits available for yellow fever virus detection. Therefore, diagnosis must be made by time-consuming routine techniques, and sometimes, the virus or its proteins are not detected. Furthermore, co-circulation with other flaviviruses, including dengue virus, increases the difficulty of diagnosis. To develop a specific reverse transcriptase-polymerase chain reaction (RT-PCR) and nested PCR-based assay to improve the detection and diagnosis of yellow fever virus using both serum and fresh tissue samples. RT-PCR primers were designed to amplify a short fragment of all yellow fever virus genotypes reported. A second set of primers was used in a nested PCR to increase sensitivity. Thirty-three clinical samples were tested with the standardized reaction. The expected amplicon was obtained in 25 out of 33 samples analyzed using this approach, and 2 more samples tested positive after a subsequent nested PCR approach. This improved technique not only ensures the specific detection of a wide range of yellow fever virus genotypes but also may increase the sensitivity of detection by introducing a second round of amplification, allowing a rapid differential diagnosis between dengue and yellow fever infection, which is required for effective surveillance and opportune epidemiologic measures.

Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR.

PubMed

Wills, Melanie K B; Kirby, Andrea M; Lloyd, Vett K

2018-02-04

Lyme disease is a serious vector-borne infection that is caused by the Borrelia burgdorferi sensu lato family of spirochetes, which are transmitted to humans through the bite of infected Ixodes ticks. The primary etiological agent in North America is Borrelia burgdorferi sensu stricto. As geographic risk regions expand, it is prudent to support robust surveillance programs that can measure tick infection rates, and communicate findings to clinicians, veterinarians, and the general public. The molecular technique of nested polymerase chain reaction (nPCR) has long been used for this purpose, and it remains a central, inexpensive, and robust approach in the detection of Borrelia in both ticks and wildlife. This article demonstrates the application of nPCR to tick DNA extracts to identify infected specimens. Two independent B. burgdorferi targets, genes encoding Flagellin B (FlaB) and Outer surface protein A (OspA), have been used extensively with this technique. The protocol involves tick collection, DNA extraction, and then an initial round of PCR to detect each of the two Borrelia-specific loci. Subsequent polymerase chain reaction (PCR) uses the product of the first reaction as a new template to generate smaller, internal amplification fragments. The nested approach improves upon both the specificity and sensitivity of conventional PCR. A tick is considered positive for the pathogen when inner amplicons from both Borrelia genes can be detected by agarose gel electrophoresis.

The Diagnostic Utility of Bact/ALERT and Nested PCR in the Diagnosis of Tuberculous Meningitis.

PubMed

Sastry, Apurba Sankar; Bhat K, Sandhya; Kumudavathi

2013-01-01

The early laboratory diagnosis of Tuberculous Meningitis (TBM) is crucial, to start the antitubercular chemotherapy and to prevent its complications. However, the conventional methods are either less sensitive or time consuming. Hence, the diagnostic potentials of BacT/ALERT and Polymerase Chain Reaction (PCR) was evaluated in this study. The study group comprised of 62 cases and 33 controls. The cases were divided according to Ahuja's criteria into the confirmed (two cases), highly probable (19 cases), probable (26 cases) and the possible (15 cases) subgroups. Ziehl Neelsen's (ZN) and Auramine Phenol (AP) staining, Lowenstein Jensen (LJ) medium culture, BacT/ALERT and nested Polymerase Chain Reaction (PCR) which targeted IS6110 were carried out on all the patients. The sensitivity of the LJ culture was 3.22%. BacT/ALERT showed a sensitivity and a specificity of 25.80% and 100% and those of nested PCR were found to be 40.32% and 96.97% respectively. The mean detection time of growth of the LJ culture was 31.28 days, whereas that of BacT/ALERT was 20.68 days. The contamination rate in the LJ culture and BacT/ALERT were 7.2% and 5.8% respectively. Nested PCR was found to be more sensitive, followed by BacT/ALERT as compared to the LJ culture and smear microscopy. As both false negative and false positive results have been reported for nested PCR, so it should not be used alone as a criterion for initiating or terminating the therapy, but it should be supported by clinical, radiological, cytological and other microbiological findings.

Diagnosis of Gestational, Congenital, and Placental Malaria in Colombia: Comparison of the Efficacy of Microscopy, Nested Polymerase Chain Reaction, and Histopathology

PubMed Central

Campos, Ivón M.; Uribe, Mary L.; Cuesta, Carolina; Franco-Gallego, Alexander; Carmona-Fonseca, Jaime; Maestre, Amanda

2011-01-01

The technical capability of different methods to diagnose Plasmodium in maternal peripheral blood, placenta, and umbilical cord blood has not been assessed in Colombia and seldom explored in other malaria-endemic regions. We designed a study to compare the technical and the operational-economical performances of light microscopy (LM), nested polymerase chain reaction (nPCR), and histopathology (HP). In maternal blood, LM had 41% sensitivity and 100% specificity and in placental blood, 35% and 100%, respectively, compared with nPCR. In placental tissue, LM had 33% sensitivity and 95% specificity; and nPCR 47% and 77%, respectively; compared with HP. Light microscopy had the best operational-economical qualification. We concluded that nPCR and HP performed better compared with LM, but field implementation of these two techniques remains a problem. Therefore, LM is recommended as the gold standard for diagnosis of gestational malaria and placental blood infection in the field. PMID:21633030

Clinical Usefulness of a One-Tube Nested Reverse Transcription Quantitative Polymerase Chain Reaction Assay for Evaluating Human Epidermal Growth Factor Receptor 2 mRNA Overexpression in Formalin-Fixed and Paraffin-Embedded Breast Cancer Tissue Samples.

PubMed

Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung

2017-01-01

Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.

Nested polymerase chain reaction on blood clots for gene encoding 56 kDa antigen and serology for the diagnosis of scrub typhus.

PubMed

Prakash, J A J; Kavitha, M L; Mathai, E

2011-01-01

Scrub typhus is a zoonotic illness endemic in the Asia-Pacific region. Early diagnosis and appropriate management contribute significantly to preventing adverse outcomes including mortality. Serology is widely used for diagnosing scrub typhus. Recent reports suggest that polymerase chain reaction (PCR) could be a rapid and reliable alternative. This study assessed the utility of these tests for scrub typhus diagnosis. Nested PCR to detect the 56 kDa antigen gene of O. tsutsugamushi was performed on blood clots from 87 individuals with clinically suspected scrub typhus. Weil-Felix test and scrub typhus IgM ELISA were performed on serum samples from the same patients. As a gold standard reference test was not available, latent class analysis (LCA) was used to assess the performance of the three tests. The LCA analysis showed the sensitivity of Weil-Felix test, IgM ELISA and PCR to be 59%, 100% and 58% respectively. The specificity of ELISA was only 73%, whereas those of the Weil-Felix test and PCR were 94% and 100% respectively. Nested PCR using blood clots while specific, lacked sensitivity as compared to IgM ELISA. In resource-poor settings Weil-Felix test still remains valuable despite its moderate sensitivity.

Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems.

PubMed

Ximenes, Camila; Brandão, Eduardo; Oliveira, Paula; Rocha, Abraham; Rego, Tamisa; Medeiros, Rafael; Aguiar-Santos, Ana; Ferraz, João; Reis, Christian; Araujo, Paulo; Carvalho, Luiz; Melo, Fabio L

2014-12-01

The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

Human papillomavirus detection and typing using a nested-PCR-RFLP assay.

PubMed

Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo

2011-01-01

It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.

A novel gammaherpesvirus in a large flying fox (Pteropus vampyrus) with blepharitis.

PubMed

Paige Brock, A; Cortés-Hinojosa, Galaxia; Plummer, Caryn E; Conway, Julia A; Roff, Shannon R; Childress, April L; Wellehan, James F X

2013-05-01

A novel gammaherpesvirus was identified in a large flying fox (Pteropus vampyrus) with conjunctivitis, blepharitis, and meibomianitis by nested polymerase chain reaction and sequencing. Polymerase chain reaction amplification and sequencing of 472 base pairs of the DNA-dependent DNA polymerase gene were used to identify a novel herpesvirus. Bayesian and maximum likelihood phylogenetic analyses indicated that the virus is a member of the genus Percavirus in the subfamily Gammaherpesvirinae. Additional research is needed regarding the association of this virus with conjunctivitis and other ocular pathology. This virus may be useful as a biomarker of stress and may be a useful model of virus recrudescence in Pteropus spp.

Detection of Histoplasma capsulatum in Organic Fertilizers by Hc100 Nested Polymerase Chain Reaction and Its Correlation with the Physicochemical and Microbiological Characteristics of the Samples.

PubMed

Gómez, Luisa F; Torres, Isaura P; Jiménez-A, María Del Pilar; McEwen, Juan Gmo; de Bedout, Catalina; Peláez, Carlos A; Acevedo, José M; Taylor, María L; Arango, Myrtha

2018-05-01

Histoplasma capsulatum is the causative agent of histoplasmosis and this fungus inhabits soils rich in phosphorus and nitrogen that are enriched with bird and bat manure. The replacement of organic matter in agroecosystems is necessary in the tropics, and the use of organic fertilizers has increased. Cases and outbreaks due to the presence of the fungus in these components have been reported. The Instituto Colombiano Agropecuario resolution 150 of 2003 contains the parameters set by the Colombian Technical Standard (NTC 5167) on the physicochemical and microbiological features of fertilizers, but it does not regulate the search for H. capsulatum . The aim of this study was to demonstrate H. capsulatum presence in organic fertilizers by nested polymerase chain reaction (PCR). A total of 239 samples were collected: 201 (84.1%) corresponded to organic fertilizers, 30 (12.5%) to bird excrement, and 8 (3.4%) to cave soils. The Hc100 nested PCR had a detection limit of 0.1 pg/µL and a specificity of 100%. A total of 25 (10.5%) samples were positive and validated by sequencing. Seven of the positive samples represented locations where H. capsulatum was previously detected, suggesting the persistence of the fungus. No significant correlations were detected between the physicochemical and microbiological parameters with the presence of H. capsulatum by nested PCR, indicating the fungus existence in organic fertilizers that complied with the NTC 5167. The Hc100 nested PCR targeting H. capsulatum standardized in this work will improve the evaluation of organic fertilizers and ensure the prevention of outbreaks and cases due to manufacturing, marketing, and use of fertilizers contaminated with H. capsulatum .

A simple and rapid method for detection of Trypanosoma evansi in the dromedary camel using a nested polymerase chain reaction

PubMed Central

Aradaib, Imadeldin E; Majid, Ali A

2006-01-01

A nested polymerase chain reaction (nPCR)-based assay, was developed and evaluated for rapid detection of Trypanosoma evansi in experimentally infected mice and naturally infected camels (Camelus dromedarius). Four oligonucleotide primers (TE1, TE2, TE3 and TE4), selected from nuclear repetitive gene of T. evansi, were designed and used for PCR amplifications. The first amplification, using a pair of outer primers TE1 and TE2, produced a 821-bp primary PCR product from T. evansi DNA. The second amplification, using nested (internal) pair of primers TE3 and TE4, produced a 270-bp PCR product. T. evansi DNAs extracted from blood samples of experimentally infected mice and naturally infected Sudanese breed of dromedary camels were detected by this nested PCR-based assay. The nested primers TE3 and TE4 increased the sensitivity of the PCR assay and as little as 10 fg of T. evansi DNA (equivalent to a single copy of the putative gene of the parasite) was amplified and visualized onto ethidium bromide-stained agarose gels. Amplification products were not detected when the PCR-based assay was applied to DNA from other blood parasites including Thieleria annulata, Babesia bigemina or nucleic acid free samples. Application of this nPCR-based assay to clinical samples resulted in direct detection of T. evansi from a variety of tissue samples collected from experimentally infected mice and blood from naturally infected camels. The described nPCR-based assay provides a valuable tool to study the epidemiology of T. evansi infection in camels and other susceptible animal populations. PMID:16712737

Evaluation of a nested-PCR for mycobacterium tuberculosis detection in blood and urine samples.

PubMed

da Cruz, Heidi Lacerda Alves; de Albuquerque Montenegro, Rosana; de Araújo Lima, Juliana Falcão; da Rocha Poroca, Diogo; da Costa Lima, Juliana Figueirêdo; Maria Lapa Montenegro, Lílian; Crovella, Sergio; Charifker Schindler, Haiana

2011-01-01

The polymerase chain reaction (PCR) and its variations, such as the nested-PCR, have been described as promising techniques for rapid diagnosis of tuberculosis (TB). With the aim of evaluating the usefulness of a nested-PCR method on samples of blood and urine of patients suspected of tuberculosis we analyzed 192 clinical samples, using as a molecular target the insertion element IS6110 specific of M. tuberculosis genome. Nested-PCR method showed higher sensitivity in patients with extrapulmonary tuberculosis (47.8% and 52% in blood and urine) when compared to patients with the pulmonary form of the disease (sensitivity of 29% and 26.9% in blood and urine), regardless of the type of biological sample used. The nested-PCR is a rapid technique that, even if not showing a good sensitivity, should be considered as a helpful tool especially in the extrapulmonary cases or in cases where confirmatory diagnosis is quite difficult to be achieved by routine methods. The performance of PCR-based techniques should be considered and tested in future works on other types of biological specimens besides sputum, like blood and urine, readily obtainable in most cases. The improving of M. tuberculosis nested-PCR detection in TB affected patients will give the possibility of an earlier detection of bacilli thus interrupting the transmission chain of the disease.

Differentiating Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii using nested polymerase chain reaction (PCR) in rural communities in Malaysia

PubMed Central

2012-01-01

Background In this study, a total of 426 human faecal samples were examined for the presence of Entamoeba histolytica, Entamoeba dispar, Entamoeba moshkovskii infection via a combination of microscopic examination and nested polymerase chain reaction (PCR) targeting 16S ribosomal RNA of Entamoeba species. Methods Faecal sample were collected from 426 participants in five rural villages in Peninsular Malaysia. The faecal samples were processed by direct wet smear and formalin ethyl acetate concentration technique followed by iodine staining and examined via microscopy for the presence of Entamoeba species and other intestinal parasites. Microscopically positive samples for Entamoeba species cysts were further characterized using a Nested Polymerase Chain Reaction (Nested-PCR) targeting 16S-like ribosomal RNA gene. The data entry and analysis was carried out using the SPSS software (Statistical Package for the Social Sciences) program for Windows version 17 (SPSS, Chicago, IL, USA). Results Based on single faecal examination, overall prevalence of Entamoeba infection was 17.6% (75/426). Females (19.1%) were more commonly infected compared to males (15.9%). Comparison by age groups showed that adults (23.9%) had higher infection rates than children (15.3%). The PCR results showed that 52 out of 75 microscopy positive samples successfully generated species-specific amplicons. The infection with E. histolytica (75.0%; 39/52) was the most common, followed by E. dispar (30.8%; 18/52) and E. moshkovskii (5.8%; 3/52). Of these, 33 (63.5%) were shown to contain only E. histolytica, 10 (19.2%) contained E. dispar and 3 (5.8%) contained only E. moshkovskii. Mixed infection with E. histolytica and E. dispar was found in 6 (11.5%) samples. Conclusions The present study essentially emphasized the benefit of molecular techniques in discriminating the pathogenic Entamoeba species from the non-pathogenic for accurate diagnosis and better management of amoebiasis. The presence of E. moshkovskii is of great public health concern as it was the first time it has been reported in Malaysia. PMID:22947430

Development of a highly sensitive one-tube nested real-time PCR for detecting Mycobacterium tuberculosis.

PubMed

Choi, Yeonim; Jeon, Bo-Young; Shim, Tae Sun; Jin, Hyunwoo; Cho, Sang-Nae; Lee, Hyeyoung

2014-12-01

Rapid, accurate detection of Mycobacterium tuberculosis is crucial in the diagnosis of tuberculosis (TB), but conventional diagnostic methods have limited sensitivity and specificity or are time consuming. A new highly sensitive nucleic acid amplification test, combined nested and real-time polymerase chain reaction (PCR) in a single tube (one-tube nested real-time PCR), was developed for detecting M. tuberculosis, which takes advantage of two PCR techniques, i.e., nested PCR and real-time PCR. One-tube nested real-time PCR was designed to have two sequential reactions with two sets of primers and dual probes for the insertion sequence (IS) 6110 sequence of M. tuberculosis in a single closed tube. The minimum limits of detection of IS6110 real-time PCR and IS6110 one-tube nested real-time PCR were 100 fg/μL and 1 fg/μL of M. tuberculosis DNA, respectively. AdvanSure TB/non-tuberculous mycobacteria (NTM) real-time PCR, IS6110 real-time PCR, and two-tube nested real-time PCR showed 100% sensitivity and 100% specificity for clinical M. tuberculosis isolates and NTM isolates. In comparison, the sensitivities of AdvanSure TB/NTM real-time PCR, single IS6110 real-time PCR, and one-tube nested real-time PCR were 91% (152/167), 94.6% (158/167), and 100% (167/167) for sputum specimens, respectively. In conclusion, IS6110 one-tube nested real-time PCR is useful for detecting M. tuberculosis due to its high sensitivity and simple manipulation. Copyright © 2014 Elsevier Inc. All rights reserved.

Comparison of Antigen Detection and Nested PCR in CSF Samples of HIV Positive and Negative Patients with Suspected Cryptococcal Meningitis in a Tertiary Care Hospital.

PubMed

Kumari, Sunita; Verma, Rajesh Kumar; Singh, Dharmendra Prasad; Yadav, Ramakant

2016-04-01

The cases of cryptococcal meningitis and other forms of cryptococcosis have increased in recent time and the present scenario of the condition with significant morbidity and mortality is actually posing a serious threat to the community, so an early and prompt diagnosis is necessary to prevent serious complications and thus improving the overall disease outcome. Comparison of diagnostic efficacy of nested Polymerase Chain Reaction (PCR) with Latex Agglutination Test (LAT) in the Cerebro Spinal Fluid (CSF) samples of the cases of meningitis in HIV positive and negative cases. We have compared the diagnostic efficacy of Latex Agglutination Test (LAT) with nested Polymerase Chain Reaction (PCR) in 200 Cerebrospinal Fluid (CSF) samples, including 14 HIV positive also, in the cases of suspected cryptococcal meningitis. Nested PCR was done in all cases reporting positive by LAT and results were then compared with that of India ink and culture on Sabouraud Dextrose Agar (SDA), and the isolates were further identified by urease, nitrate and sugar assimilation tests. Of the 200 cases, including 14 HIV positive, LAT was positive in 46 cases while 154 were negative. Out of these 46 LAT positive cases, nested PCR was positive in 40 cases only, while culture and India ink was positive in 38 and 33 cases respectively. Majority of the cases, 30 (65.2%) were between age group 21-50 years, while 2 (4.3%) in 0-20, and 14 (30.4%) in 51-80 years age group. Although negative staining like India ink and nigrosin are most widely used techniques, but these suffer with subjective error. Rapid method like LAT is available but it always has the scope of false positive and negative results. In such cases nested PCR can help in establishing final diagnosis.

Occurrence of Cryptosporidium andersoni in Brazilian cattle

USDA-ARS?s Scientific Manuscript database

Feces were collected from 68 cattle, 1 to 12 mo of age, on 12 farms in the municipality of Campos dos Goytacazes, Rio de Janeiro, Brazil, and examined for the presence of Cryptosporidium sp. All samples were subjected to molecular analysis by polymerase chain reaction (nested PCR) of the 18S rRNA. F...

Nested-PCR real time as alternative molecular tool for detection of Borrelia burgdorferi compared to the classical serological diagnosis of the blood.

PubMed

Sroka-Oleksiak, Agnieszka; Ufir, Krzysztof; Salamon, Dominika; Bulanda, Malgorzata; Gosiewski, Tomasz

Lyme disease, caused by Borrelia burgdorferi, is a multisystem disease that often makes difficulties to recognize caused by their genetic heterogenity. Currently, the gold standard for the detection of Lyme disease (LD) is serologic diagnostics based mainly on tests: ELISA and Western blot (WB). These methods, however, are subject to consider- able defect, especially in the initial phase of infection due to the occurrence of so-called serological window period and low specificity. For this reason, they might be replaced by molecular methods, for example polymerase chain reaction (PCR), which should be more sensitivity and specificity. In the present study we attempt to optimize the PCR reaction conditions and enhance existing test sensitivity by applying the equivalent of real time PCR - nested PCR for detection B. burgdorferi DNA in the patient's blood. The study involved 94 blood samples of patients with suspected LD. From each sample, 1.5 ml of blood was used for the isolation of bacterial DNA and PCR real time am- plification and its equivalent, in nested version. The remaining part earmarked for serologi- cal testing. Optimization of the reaction conditions made experimentally, using gradient of the temperature and gradient of the magnesium ions concentration for reaction real time in nested-PCR and PCR version. The results show that the nested-PCR real time, has a much higher sensitivity 45 (47.8%) of positive results for the detection of B. burgdorferi compared to the single- variety, without a preceding pre-amplification 2 (2.1%). Serological methods allowed the detection of infection in 41 (43.6%) samples. These results support of the nested PCR method as a better molecular tool for the detection of B. burgdorferi infection than classical PCR real time reaction. The nested-PCR real time method may be considered as a complement to ELISA and WB mainly in the early stages of infection, when in the blood circulating B. burgdorferi cells. By contrast, the results of serological and molecular tests should always be carried out tak- ing into account the patient's clinical status.

Multiple papillomas in a diamond python, Morelia spilota spilota.

PubMed

Gull, Jessica M; Lange, Christian E; Favrot, Claude; Dorrestein, Gerry M; Hatt, Jean-Michel

2012-12-01

A 4-yr-old male diamond python (Morelia spilota spilota) was evaluated for multiple black papillated exophytic skin proliferations and signs of pneumonia. The histopathologic structure of the skin biopsy specimens led to the diagnosis of a benign papilloma-like neoplasia. In this case, papillomavirus DNA could be amplified from a biopsy sample with a broad range polymerase chain reaction. Nested pan-herpes polymerase chain reaction was negative, and herpesvirus inclusion bodies were not found. Because of the histologically benign nature of the papilloma, the skin proliferations were left untreated. Ten mo after the first presentation, the skin lesions had regressed almost completely; 34 mo later, only scars from the biopsies were left.

Molecular analysis of dolphin morbillivirus: A new sensitive detection method based on nested RT-PCR.

PubMed

Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro

2016-09-01

Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.

A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

PubMed Central

2010-01-01

A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

Immunological diagnosis as an adjunctive tool for an early diagnosis of tuberculous meningitis of an immune competent child in a low tuberculosis endemic country: a case report.

PubMed

Vita, Serena; Ajassa, Camilla; Caraffa, Emanuela; Lichtner, Miriam; Mascia, Claudia; Mengoni, Fabio; Paglia, Maria Grazia; Mancarella, Cristina; Colistra, Davide; Di Biasi, Claudio; Ciardi, Rosa Maria; Mastroianni, Claudio Maria; Vullo, Vincenzo

2017-03-13

Pediatric tuberculous meningitis is a highly morbid, often fatal disease. Its prompt diagnosis and treatment saves lives, in fact delays in the initiation of therapy have been associated with high mortality rates. This is a case of an Italian child who was diagnosed with tuberculous meningitis after a history of a month of headache, fatigue and weight loss. Cerebrospinal fluid analysis revealed a lymphocytic pleocytosis with predominance and decreased glucose concentration. Microscopy and conventional diagnostic tests to identify Mycobacterium tuberculosis were negative, while a non classical method based on intracellular cytokine flow cytometry response of CD4 cells in cerebral spinal fluid helped us to address the diagnosis, that was subsequently confirmed by a nested polymerase chain reaction amplifying a 123 base pair fragment of the M. tuberculosis DNA. We diagnosed tuberculous meningitis at an early stage through an innovative immunological approach, supported by a nested polymerase chain reaction for detection of M. tuberculosis DNA. An early diagnosis is required in order to promptly initiate a therapy and to increase the patient's survival.

A nested multiplex polymerase chain reaction assay for the differential identification of three zooanthroponotic chlamydial strains in porcine swab samples.

PubMed

Li, Yingguo; Wang, Yu; Nie, Fuping; Xiao, Jinwen; Wang, Guoming; Yuan, Ling; Li, Zhengguo

2011-07-01

Porcine chlamydial infection is an enzootic infectious disease caused by multiple members of the family Chlamydiaceae (e.g. Chlamydophila abortus, Chlamydia suis, and Chlamydophila pneumoniae). Rapid and accurate differentiation of these pathogens is critical in the control and prevention of disease. The aim of the current study was to develop a nested multiplex polymerase chain reaction (nmPCR) assay to simultaneously detect the 3 chlamydial pathogens in clinical samples. In the first round of the nmPCR, 1 pair of family-specific primers were used to amplify the 1,100 base pair (bp) fragment of chlamydial ompA gene. In the second round of the nmPCR, 4 inner primers were designed for Ch. abortus, C. suis, and Ch. pneumoniae. Each pathogen produced a specific amplicon with a size of 340 bp, 526 bp, and 267 bp respectively. The assay was sensitive and specific for detecting target pathogens in both cell cultures and clinical specimens. The results, incorporated with the improved rapid DNA extraction protocol, suggest that the nmPCR could be a promising assay for differential identification of different chlamydial strains in pigs.

Detection by hemi-nested reverse transcription polymerase chain reaction and genetic characterization of wild type strains of Canine distemper virus in suspected infected dogs.

PubMed

Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio

2012-01-01

A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.

Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

PubMed Central

Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila

2015-01-01

Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940

Polymerase chain displacement reaction.

PubMed

Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

2013-02-01

Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.

Diagnostic value of nested-PCR for identification of Malassezia species in dandruff

NASA Astrophysics Data System (ADS)

Jusuf, N. K.; Nasution, T. A.; Ullyana, S.

2018-03-01

Dandruff or pityriasis simplex is a condition of abnormal occurrence of formation of yellowish white scales from the scalp. Many factors play a role in the pathogenesis of dandruff, i.e.colonization of Malassezia species. Examination of Malassezia species previously done by culture as the gold standard. However, there are various difficulties in doing the culture. Identification method with anested-polymerase chain reaction (nested-PCR) is expected to provide quickly and easily detected. This study aimedto determine the diagnostic value of nested-PCR in the identification of Malassezia species in dandruff. From 21 subjects, scales from the scalp were taken and sent to the laboratory for nested-PCR identification. Statistical analysis of diagnostic test carried out to determine sensitivity, specificity, positive predictive value, and negative predictive value. The results showed nested-PCR detected 10 sample (47.6%) positive for Malassezia species consist of M. sympodialis (23.8%); M. slooffiae (9.5%); M. furfur (4.8%); M. globosa and M. furfur (4.8%); and M. restricta and M. sympodialis (4.8%). Detection of Malassezia species by nested-PCR has 100% in sensitivity whereas the specificity was 55%. Nested-PCR test has high sensitivity. Therefore nested-PCR may be considered for a faster and simpler alternative examination in identification for Malassezia species in dandruff.

Comparison of a conventional and nested PCR for diagnostic confirmation and genotyping of Orientia tsutsugamushi.

PubMed

Janardhanan, Jeshina; Prakash, John Antony Jude; Abraham, Ooriapadickal C; Varghese, George M

2014-05-01

A nested polymerase chain reaction (PCR) targeting the 56-kDa antigen gene is currently the most commonly used molecular technique for confirmation of scrub typhus and genotyping of Orientia tsutsugamushi. In this study, we have compared the commonly used nested PCR (N-PCR) with a single-step conventional PCR (C-PCR) for amplification and genotyping. Eschar samples collected from 24 patients with scrub typhus confirmed by IgM enzyme-linked immunosorbent assay were used for DNA extraction following which amplifications were carried out using nested and C-PCR methods. The amplicons were sequenced and compared to other sequences in the database using BLAST. Conventional PCR showed a high positivity rate of 95.8% compared to the 75% observed using N-PCR. On sequence analysis, the N-PCR amplified region showed more variation among strains than the C-PCR amplified region. The C-PCR, which is more economical, provided faster and better results compared to N-PCR. Copyright © 2014 Elsevier Inc. All rights reserved.

Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections.

PubMed

Siqueira, José F; Rôças, Isabela N

2003-08-01

Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and persistent endodontic infections. This strengthens the assumption that this bacterial species is an endodontic pathogen associated with different forms of periradicular diseases. In contrast, A radicidentis was only occasionally detected in the patients examined. The role played by this species in endodontic infections remains to be clarified.

Viruses in the environment - presence and diversity of bacteriophage and enteric virus populations in the Umhlangane River, Durban, South Africa.

PubMed

Marie, Veronna; Lin, Johnson

2017-10-01

Due to the continued persistence of waterborne viral-associated infections, the presence of enteric viruses is a concern. Notwithstanding the health implications, viral diversity and abundance is an indicator of water quality declination in the environment. The aim of this study was to evaluate the presence of viruses (bacteriophage and enteric viruses) in a highly polluted, anthropogenic-influenced river system over a 6-month period at five sampling points. Cytopathic-based tissue culture assays revealed that the isolated viruses were infectious when tested on Hep-G2, HEK293 and Vero cells. While transmission electron microscopy (TEM) revealed that the majority of the viruses were bacteriophages, a number of presumptive enteric virus families were visualized, some of which include Picornaviridae, Adenoviridae, Polyomaviridae and Reoviridae. Finally, primer specific nested polymerase chain reaction (nested-PCR)/reverse transcription-polymerase chain reaction (RT-PCR) coupled with BLAST analysis identified human adenovirus, polyomavirus and hepatitis A and C virus genomes in river water samples. Taken together, the complexity of both bacteriophage and enteric virus populations in the river has potential health implications. Finally, a systematic integrated risk assessment and management plan to identify and minimize sources of faecal contamination is the most effective way of ensuring water safety and should be established in all future guidelines.

Absence of giant blood Marseille-like virus DNA detection by polymerase chain reaction in plasma from healthy US blood donors and serum from multiply transfused patients from Cameroon.

PubMed

Phan, Tung Gia; Desnues, Christelle; Switzer, William M; Djoko, Cyrille F; Schneider, Bradley S; Deng, Xutao; Delwart, Eric

2015-06-01

A new Marseilleviridae virus family member, giant blood Marseille-like (GBM) virus, was recently reported in persons from France in the serum of an infant with adenitis, in the blood of 4% of healthy blood donors, and in 9% of multiply transfused thalassemia patients. These results suggested the presence of a nucleocytoplasmic large DNA virus potentially transmissible by blood product transfusion. To investigate this possibility we tested the plasma from 113 US blood donors and 74 multiply transfused Cameroon patients for GBM viral DNA using highly sensitive polymerase chain reaction (PCR) assays. GBM DNA was not detected by nested PCR in any of these 187 human specimens. Further testing is required to confirm the occurrence of human GBM virus infections. © 2015 AABB.

Evaluation of a novel nested PCR for the routine diagnosis of feline leukemia virus (FeLV) and feline immunodeficiency virus (FIV).

PubMed

Arjona, Alvaro; Barquero, Nuria; Doménech, Ana; Tejerizo, German; Collado, Victorio M; Toural, Cristina; Martín, Daniel; Gomez-Lucia, Esperanza

2007-02-01

Laboratory diagnosis of feline leukemia virus (FeLV) and feline immunodeficiency virus (FIV) usually involves both viruses, as the clinical signs are similar and coinfection may occur. Serological methods may not represent an accurate diagnosis: maternal antibodies or cross-reactions may give false positive results to FIV, and false negative results may occur in latent FeLV status, or in certain FIV infection stages. A nested polymerase chain reaction (PCR) technique was designed to detect FeLV, FIV and feline endogenous retrovirus simultaneously. The detection of endogenous sequences was considered indicative of successful DNA extraction. The technique was used to diagnose FIV and FeLV in the blood cells of 179 cats. The kappa value with the serological data was 0.69 for FeLV and 0.87 for FIV. The joint detection of FeLV and FIV by this novel nested PCR is sensitive, specific, fast and convenient, and its applicability for clinical diagnosis is promising, as the direct evidence of the presence of the virus is more realistic than the indirect data provided by the serological detection.

Olive Ridley Sea Turtle Hatching Success as a Function of the Microbial Abundance in Nest Sand at Ostional, Costa Rica

PubMed Central

Bézy, Vanessa S.; Valverde, Roldán A.; Plante, Craig J.

2015-01-01

Several studies have suggested that significant embryo mortality is caused by microbes, while high microbial loads are generated by the decomposition of eggs broken by later nesting turtles. This occurs commonly when nesting density is high, especially during mass nesting events (arribadas). However, no previous research has directly quantified microbial abundance and the associated effects on sea turtle hatching success at a nesting beach. The aim of this study was to test the hypothesis that the microbial abundance in olive ridley sea turtle nest sand affects the hatching success at Ostional, Costa Rica. We applied experimental treatments to alter the microbial abundance within the sand into which nests were relocated. We monitored temperature, oxygen, and organic matter content throughout the incubation period and quantified the microbial abundance within the nest sand using a quantitative polymerase chain reaction (qPCR) molecular analysis. The most successful treatment in increasing hatching success was the removal and replacement of nest sand. We found a negative correlation between hatching success and fungal abundance (fungal 18S rRNA gene copies g-1 nest sand). Of secondary importance in determining hatching success was the abundance of bacteria (bacterial 16S rRNA gene copies g-1 g-1 nest sand). Our data are consistent with the hypothesis that high microbial activity is responsible for the lower hatching success observed at Ostional beach. Furthermore, the underlying mechanism appears to be the deprivation of oxygen and exposure to higher temperatures resulting from microbial decomposition in the nest. PMID:25714355

Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

NASA Astrophysics Data System (ADS)

Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

1989-04-01

The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

USGS Publications Warehouse

Chase, D.M.; Elliott, D.G.; Pascho, R.J.

2006-01-01

Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

A Newly Developed Nested PCR Assay for the Detection of Helicobacter pylori in the Oral Cavity.

PubMed

Ismail, Hawazen; Morgan, Claire; Griffiths, Paul; Williams, John; Jenkins, Gareth

2016-01-01

To develop a new nested polymerase chain reaction (PCR) assay for identifying Helicobacter pylori DNA from dental plaque. H. pylori is one of the most common chronic bacterial pathogens in humans. The accurate detection of this organism is essential for proper patient management and for the eradication of the bacteria following treatment. Forty-nine patients (24 males and 25 females; mean age: 51; range, 19 to 94 y) were investigated for the presence of H. pylori in dental plaque by single-step PCR and nested PCR and in the stomach by single-step PCR, nested PCR, and histologic examination. The newly developed nested PCR assay identified H. pylori DNA in gastric biopsies of 18 patients who were histologically classified as H. pylori-positive and 2 additional biopsies of patients who were H. pylori-negative by histologic examination (20/49; 40.8%). Dental plaque samples collected before and after endoscopy from the 49 patients revealed that single-step PCR did not detect H. pylori but nested PCR was able to detect H. pylori DNA in 40.8% (20/49) patients. Nested PCR gave a higher detection rate (40.8%, 20/49) than that of histology (36.7%, 18/49) and single-step PCR. When nested PCR results were compared with histology results there was no significant difference between the 2 methods. Our newly developed nested PCR assay is at least as sensitive as histology and may be useful for H. pylori detection in patients unfit for endoscopic examination.

Detection of pathogenic Yersinia enterocolitica in foods and water by immunomagnetic separation, nested polymerase chain reactions, and colorimetric detection of amplified DNA.

PubMed Central

Kapperud, G; Vardund, T; Skjerve, E; Hornes, E; Michaelsen, T E

1993-01-01

A two-step polymerase chain reaction (PCR) procedure with two nested pairs of primers specific for the yadA gene of Yersinia enterocolitica was developed. The PCR assay identified all common pathogenic serogroups (O:3, O:5,27, O:8, O:9, O:13, and O:21) from three continents and differentiated pathogenic Y. enterocolitica from Y. pseudotuberculosis and from a variety of nonpathogenic yersiniae representing 25 serogroups and four species. The performance of the method was evaluated with seeded food and water samples. We compared two procedures for sample preparation prior to PCR: one was based on immunomagnetic separation of the target bacteria from the sample, using magnetic particles coated with immunoglobulin antibodies to Y. enterocolitica serogroup O:3, and the other method consisted of a series of centrifugation steps combined with proteinase treatment. Regardless of the method used, the PCR assay was capable of detecting 10 to 30 CFU/g of meat in 10(6)-fold excess of indigenous bacteria. When the samples were enriched overnight in a nonselective medium, the sensitivity was increased to approximately 2 CFU/g, except for samples with an extremely high background flora (> 10(7) CFU/g). We compared gel electrophoretic detection of PCR products with a colorimetric detection method designated DIANA (detection of immobilized amplified nucleic acids), which enabled easy visualization of amplified fragments in a microtiter plate format with an optical density reader. DIANA and gel electrophoresis showed complete concordance in their discrimination between positive and negative samples. The combination of immunomagnetic separation, nested PCR, and DIANA makes possible the development of a fully automated analytic process which requires a minimum of laboratory manipulations. Images PMID:8215366

Varicella zoster virus myelitis in two elderly patients: diagnostic value of nested polymerase chain reaction assay and antibody index for cerebrospinal fluid specimens.

PubMed

Takahashi, Teruyuki; Tamura, Masato; Miki, Kenji; Yamaguchi, Mai; Kanno, Akira; Nunomura, Satoshi; Ra, Chisei; Tamiya, Takashi; Kamei, Satoshi; Takasu, Toshiaki

2013-01-01

Myelitis is one of the rarest neurological complications of the varicella zoster virus (VZV) infection. Focal muscle weakness with or without sensory disturbance occurs in approximately 5% of the cases after acute VZV infection, with complete recovery in 50-70%. This report describes two rare cases of elderly patients with VZV myelitis secondary to dermatomal zoster rash. Patient 1 was a 79-year-old woman who developed paraplegia, numbness and decreased sensation in the left arm and below thoracic (Th)-10 after sacral zoster. Spinal cord MRI showed a high-signal-intensity lesion at the cervical spinal nerve 2 on a T2-weighted image. Patient 2 was a 73-year-old man who developed right flaccid leg weakness and urinary retention after right dorsal Th 5-8 zoster. Spinal cord MRI showed a high-signal-intensity lesion at Th 3-4 on a T2-weighted image. In both cases, although the conventional single polymerase chain reaction (PCR) assays all showed negative results, the original nested PCR assay detected VZV DNA in the cerebrospinal fluid (CSF) specimen collected on admission. In addition, the anti-VZV IgG antibody by enzyme immunoassay and antibody index were elevated in the CSF specimens during the clinical courses of both patients. On the basis of these findings, both patients were diagnosed with VZV myelitis and were treated with high-dose acyclovir and corticosteroid. This combined treatment was appropriate and effective for the improvement of their functional outcomes. The detection of VZV DNA in CSF by nested PCR assay and the evaluation of the antibody index to VZV had significant diagnostic value.

Detection and typing of human papillomaviruses (HPV) in malignant, dysplastic, nondysplastic and normal oral epithelium by nested polymerase chain reaction, immunohistochemistry and transitional electron microscopy in patients of northern Greece.

PubMed

Blioumi, E; Chatzidimitriou, D; Pazartzi, Ch; Katopodi, Th; Tzimagiorgis, G; Emmanouil-Nikoloussi, E-N; Markopoulos, A; Kalekou, C; Lazaridis, N; Diza, E; Antoniades, D

2014-09-01

To evaluate the role of HPV in oral carcinogenesis, we examined the prevalence of HPV in malignant, potentially malignant and normal oral epithelium and studied the relation of HPV prevalence with other factors obtained from the patient's records. Our material consisted of 291 tissue specimens from 258 individuals. From every individual formalin fixed and paraffin embedded tissues were examined by nested Polymerase Chain Reaction (NPCR) for the detection of HPV DNA and by immunohistochemistry (IHC) for the in situ detection of HPV L1 protein. Positive PCR products were sequenced in order to type HPVs. Also 33 fresh tissues were obtained, fixed and used to detect HPV particles by transitional electron microscopy (TEM). HPV was detected in 32.9% of the tissue specimens by NPCR, in 4.7% by immunohistochemistry and in 28.1% by TEM. In detail, by nested PCR HPV L1 DNA was detected in 40% of normal tissues, 40% of fibromas, 35.8% of non-dysplastic leukoplakias, 31.6% of dysplastic leukoplakias and 22.2% of oral squamous cell carcinomas. The HPV viral load of 96.5% of the samples was very low (1 viral copy per 10(2)-10(4) cells). HPV16 prevails in all histological groups in 89-100%. We conclude that HPV does not seem, from the specific sample examined, to play a substantial role in oral carcinogenesis. However, it cannot be excluded that HPV could be involved in oral carcinogenesis only in cases with high viral load or at early stages of carcinogenesis possibly through the hit-and-run mechanism. Copyright © 2014 Elsevier Ltd. All rights reserved.

Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens* ,**

PubMed Central

Furini, Adriana Antônia da Cruz; Pedro, Heloisa da Silveira Paro; Rodrigues, Jean Francisco; Montenegro, Lilian Maria Lapa; Machado, Ricardo Luiz Dantas; Franco, Célia; Schindler, Haiana Charifker; Batista, Ida Maria Foschiani Dias; Rossit, Andrea Regina Baptista

2013-01-01

OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR) with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens. METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results. RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard), we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively). CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis. PMID:24473765

Comparison of the membrane-filtration fluorescent antibody test, the enzyme-linked immunosorbent assay, and the polymerase chain reaction to detect Renibacterium salmoninarum in salmon ovarian fluid

USGS Publications Warehouse

Pascho, Ronald J.; Chase, Dorothy M.; McKibben, Constance L.

1998-01-01

Ovarian fluid samples from naturally infected chinook salmon (Oncorhynchus tshawytscha) were examined for the presence of Renibacterium salmoninarum by the membrane-filtration fluorescent antibody test (MF-FAT), an antigen capture enzyme-linked immunosorbent assay (ELISA), and a nested polymerase chain reaction (PCR). On the basis of the MF-FAT, 64% (66/103) samples contained detectable levels of R. salmoninarum cells. Among the positive fish, the R. salmoninarum concentrations ranged from 25 cells/ml to 4.3 × 109cells/ml. A soluble antigenic fraction of R. salmoninarum was detected in 39% of the fish (40/103) by the ELISA. The ELISA is considered one of the most sensitive detection methods for bacterial kidney disease in tissues, yet it did not detect R. salmoninarum antigen consistently at bacterial cell concentrations below about 1.3 × 104cells/ml according to the MF-FAT counts. When total DNA was extracted and tested in a nested PCR designed to amplify a 320-base-pair region of the gene encoding a soluble 57-kD protein of R. salmoninarum, 100% of the 100 samples tested were positive. The results provided strong evidence that R. salmoninarum may be present in ovarian fluids thought to be free of the bacterium on the basis of standard diagnostic methods.

First microscopical and molecular-based characterization of Leishmania major within naturally infected Phlebotomus salehi (Diptera; Psychodidae) in Fars province, southern Iran

PubMed Central

DAVAMI, M H; MOTAZEDIAN, M H; KALANTARI, M; ASGARI, Q; BADZOHRE, A; MOHAMMADPOUR, I

2011-01-01

Zoonotoc cutaneous leishmaniasis is endemic in several parts of Iran. Jahrom district is one of the most important endemic foci of leishmaniasis located in Fars province, southern Iran. To identify the vectors of leishmaniasis in this area, a total of 349 sandflies were collected during May to August 2009. They were caught from outdoors in five regions of Jahrom district including villages of Mousavieh, Ghotb-Abad, Heydar-Abad, Fath-Abad and Jahrom County. Eleven species of Phlebotomine (three Phlebotomus spp. and eight Sergentomyia spp.) were detected. To determine the sandflies naturally infected by Leishmania spp., 122 female sandflies were dissected and evaluated microscopically using Giemsa-stained slides. Natural infection of 2 out of 38 (5.26%) P. papatasi and 1 out of 8 (12.5%) P. salehi to Leishmania major was confirmed in the region. Sequencing and nested polymerase chain reaction-based detection of Leishmania were carried out to confirm the microscopic findings. Five (13.16%) P. papatasi and two (25%) P. salehi were positive in nested polymerase chain reaction assay. All positive samples were shown 72–76% similarity with L. major Friedlin. On the basis of our knowledge, this is the first molecular detection of L. major within naturally infected P. salehi in this region in southern Iran. PMID:22185942

Comparison of Nested PCR and RFLP for Identification and Classification of Malassezia Yeasts from Healthy Human Skin

PubMed Central

Oh, Byung Ho; Song, Young Chan; Choe, Yong Beom; Ahn, Kyu Joong

2009-01-01

Background Malassezia yeasts are normal flora of the skin found in 75~98% of healthy subjects. The accurate identification of the Malassezia species is important for determining the pathogenesis of the Malassezia yeasts with regard to various skin diseases such as Malassezia folliculitis, seborrheic dermatitis, and atopic dermatitis. Objective This research was conducted to determine a more accurate and rapid molecular test for the identification and classification of Malassezia yeasts. Methods We compared the accuracy and efficacy of restriction fragment length polymorphism (RFLP) and the nested polymerase chain reaction (PCR) for the identification of Malassezia yeasts. Results Although both methods demonstrated rapid and reliable results with regard to identification, the nested PCR method was faster. However, 7 different Malassezia species (1.2%) were identified by the nested PCR compared to the RFLP method. Conclusion Our results show that RFLP method was relatively more accurate and reliable for the detection of various Malassezia species compared to the nested PCR. But, in the aspect of simplicity and time saving, the latter method has its own advantages. In addition, the 26S rDNA, which was targeted in this study, contains highly conserved base sequences and enough sequence variation for inter-species identification of Malassezia yeasts. PMID:20523823

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

PubMed

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

Development of a novel single tube nested PCR for enhanced detection of cytomegalovirus DNA from dried blood spots.

PubMed

Atkinson, C; Emery, V C; Griffiths, P D

2014-02-01

Newborn screening for congenital cytomegalovirus (CCMV) using dried blood spots (DBS) has been proposed because many developed countries have DBS screening programmes in place for other diseases. The aim of this study was to develop a rapid, single tube nested polymerase chain reaction (PCR) method for enhanced detection of CMV from DBS compared to existing (single target) real time PCRs. The new method was compared with existing real time PCRs for sensitivity and specificity. Overall sensitivity of the single target PCR assays in both asymptomatic and symptomatic infants with laboratory confirmed congenital CMV was 69% (CMV PCR or culture positive before day 21 of life). In contrast, the single tube nested assay had an increased sensitivity of 81% with100% specificity. Overall the assay detected CMV from a DBS equivalent to an original blood sample which contained 500IU/ml. In conclusion this single tube nested methodology allows simultaneous amplification and detection of CMV DNA in 1.5h removing the associated contamination risk of a two step nested PCR. Owing to its increased sensitivity, it has the potential to be used as a screening assay and ultimately allow early identification and intervention for children with congenital CMV. Copyright © 2013 Elsevier B.V. All rights reserved.

Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

PubMed

Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

2016-05-01

For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

The role of pleural fluid MAGE RT-nested PCR in the diagnosis of malignant pleural effusion.

PubMed

Jeon, Eun Ju; Park, Hye Kyeong; Jeon, Kyeongman; Koh, Won-Jung; Suh, Gee Young; Chung, Man Pyo; Kim, Hojoong; Kwon, O Jung; Ki, Chang-Seok; Kim, Jong-Won; Shim, Young Mog; Um, Sang-Won

2012-11-01

  Melanoma antigen (MAGE) genes are expressed in tumor cells, the testis and the placenta. The purpose of this prospective study was to investigate the sensitivity, specificity, and accuracy of the carcinoembryonic antigen (CEA), MAGE reverse transcriptase-nested polymerase chain reaction (RT-nested PCR), and cytology of pleural fluid in the diagnosis of malignant pleural effusion.   Patients in whom unilateral pleural effusion was identified on chest radiography from January to December 2009 were included in the study. MAGE genes were analyzed by RT-nested PCR using MAGE A1-6 common primers.   Of 81 enrolled patients, 46 were diagnosed as malignant pleural effusion, and 24 were diagnosed as benign pleural effusion. The diagnoses of 11 patients were not confirmed in this study. The diagnostic sensitivity, specificity, and accuracy of MAGE RT-nested PCR were 61.4%, 95.7%, and 73.1%, respectively. The diagnostic sensitivities of cytology and CEA (>5 ng/mL) were 61.4% and 75.0%, respectively. Among 17 patients with negative cytology who had malignant pleural effusion, 12 and 10 patients were positive for CEA (>5.0 ng/mL) and MAGE RT-nested PCR, respectively. However, of five patients with malignant pleural effusion that was not recognized by cytology and CEA, MAGE RT-nested PCR correctly predicted a malignant etiology in only one additional patient (20%).   MAGE RT-nested PCR seems to add little on the combination of conventional methods in the diagnosis of malignant effusion. © 2012 Tianjin Lung Cancer Institute and Wiley Publishing Asia Pty. Ltd.

[Use of nested PCR in detection of the plague pathogen].

PubMed

Glukhov, A I; Gordeev, S A; Al'tshuler, M L; Zykova, I E; Severin, S E

2003-07-01

Causative agents of plague, i.e. bacterium Yersina pestis (in the subcutaneous tissues of rodents) and their cutaneous parasites need to be isolated to enable plague prevention. A comparatively new method of polymerase chain reaction (PCR) opens up new possibilities of determining Y. pestis just within several hours and without any cultivation. The article contains a description of the PCR-method, which makes it possible to distinguish the culture of Y. pestis from cultures of other microorganism, including speci of Yersina. The method is of the cluster-type, i.e. it is made up of subsequent PC reactions with the substrate for the second reaction being the product of the first one. The cluster nature of the method preconditions a higher sensitivity and specificity versus the ordinary PCR.

Whole-Blood Nested-PCR Amplification of M. leprae-Specific DNA for Early Diagnosis of Leprosy

PubMed Central

Wen, Yan; Xing, Yan; Yuan, Lian-Chao; Liu, Jian; Zhang, Ying; Li, Huan-Ying

2013-01-01

We evaluated the sensitivity and specificity of a nested-polymerase chain reaction (PCR) method for detection of Mycobacterium leprae DNA from whole blood. Whole-blood specimens were subjected to nested-PCR amplification of M. leprae repeat DNA sequences in 49 multibacillary (MB) and 30 paucibacillary (PB) leprosy patients, 96 household contacts (HHCs), 18 tuberculosis (TB) patients, and 35 normal healthy individuals. M. leprae DNA was detected in 95.92% (47/49) of MB, 70% (21/30) of PB, and 6.25% (6/96) of HHC, but it was not detected in 18 TB or 35 normal controls. The sensitivities of the anti-bovine serum albumin (ND-O-BSA) immunoglobulin M (IgM) and antifusion protein of ML0405-ML2331 IgG for MB were 97.96% and 89.8%, and these values for PB were 70% and 53.33%. However, the ND-O-BSA enzyme-linked immunosorbent assay (ELISA) had lower specificity, with relatively high false-positive results for TB patients (16.67%) and normal healthy controls (10%). Based on these promising findings, we propose the use of nested PCR of whole-blood samples along with ELISA test for early detection of leprosy cases. PMID:23478578

Technical manual for basic version of the Markov chain nest productivity model (MCnest)

EPA Science Inventory

The Markov Chain Nest Productivity Model (or MCnest) integrates existing toxicity information from three standardized avian toxicity tests with information on species life history and the timing of pesticide applications relative to the timing of avian breeding seasons to quantit...

User’s manual for basic version of MCnest Markov chain nest productivity model

EPA Science Inventory

The Markov Chain Nest Productivity Model (or MCnest) integrates existing toxicity information from three standardized avian toxicity tests with information on species life history and the timing of pesticide applications relative to the timing of avian breeding seasons to quantit...

Sensitivity and specificity of a nested polymerase chain reaction for detection of lentivirus infection in lions (Panthera leo).

PubMed

Adams, Hayley; van Vuuren, Moritz; Kania, Stephen; Bosman, Anna-Mari; Keet, Dewald; New, John; Kennedy, Melissa

2010-12-01

Feline immunodeficiency virus (FIV) is a lentivirus in the Retroviridae family that causes lifelong infection in domestic cats. The lentivirus of African lions (Panthera leo), referred to as FIVple, is endemic in certain lion populations in eastern and southern Africa. Lentivirus infection leads to immunologic dysfunction and immunosuppressive disease in domestic cats; however, little is known about the pathogenic effects of infection in lions, nor about the epidemiologic impact on free-ranging and captive populations. Whole blood and serum samples were collected opportunistically from free-ranging lions in Kruger National Park, Republic of South Africa (RSA). Whole blood and serum samples were also collected from captive wild lions in the RSA. A nested polymerase chain reaction (PCR) assay for detection of FIV was performed on all whole blood samples. In addition, serum samples were tested for cross-reactive antibodies to domestic feline lentivirus antigens and puma lentivirus synthetic envelope peptide antigen. The PCR assay successfully amplified the lion lentivirus from African lions. The relative sensitivity and relative specificity were 79% and 100%, respectively, and the positive and negative predictive values were 100% and 67%, respectively. This research represents the first study to compare genetic material with antibody-based methods of lentivirus detection on lions in RSA. Using PCR as an additional diagnostic test for FIV in lions will increase screening sensitivity and will allow viral characterization among circulating isolates and monitoring of changes in the viral epidemiology within geographic regions and populations over time.

Actinomyces israelii in radicular cysts: a molecular study.

PubMed

Gomes, Nathália Rodrigues; Diniz, Marina Gonçalves; Pereira, Thais Dos Santos Fontes; Estrela, Carlos; de Macedo Farias, Luiz; de Andrade, Bruno Augusto Benevenuto; Gomes, Carolina Cavaliéri; Gomez, Ricardo Santiago

2017-05-01

To investigate whether the microscopic filamentous aggregates observed in radicular cysts are associated with the molecular identification of Actinomyces israelii. Moreover, to verify whether this bacterium can be detected in radicular cyst specimens not presenting aggregates. Microscopic colonies suggestive of Actinomyces were found in 8 out of 279 radicular cyst samples (case group). The case and control groups (n = 12; samples without filamentous colonies) were submitted to the semi-nested polymerase chain reaction to test the presence of A israelii. DNA sequencing was performed to validate polymerase chain reaction results. Two and 3 samples in the case and control groups, respectively, did not present a functional genomic DNA template and were excluded from the study. A israelii was identified in all samples of the case group and in 3 out of 9 samples of the control group. Although A israelii is more commonly identified in radicular cysts presenting filamentous aggregates, it also appears to be detected in radicular cysts without this microscopic finding. Copyright © 2017 Elsevier Inc. All rights reserved.

Genetic diversity of Chlamydia among captive birds from central Argentina.

PubMed

Frutos, María C; Monetti, Marina S; Vaulet, Lucia Gallo; Cadario, María E; Fermepin, Marcelo Rodríguez; Ré, Viviana E; Cuffini, Cecilia G

2015-01-01

To study the occurrence of Chlamydia spp. and their genetic diversity, we analysed 793 cloacal swabs from 12 avian orders, including 76 genera, obtained from 80 species of asymptomatic wild and captive birds that were examined with conventional nested polymerase chain reaction and quantitative polymerase chain reaction. Chlamydia spp. were not detected in wild birds; however, four species (Chlamydia psittaci, Chlamydia pecorum, Chlamydia pneumoniae and Chlamydia gallinacea) were identified among captive birds (Passeriformes, n = 20; Psittaciformes, n = 15; Rheiformes, n = 8; Falconiformes n = 2; Piciformes n = 2; Anseriformes n = 1; Galliformes n = 1; Strigiformes n = 1). Two pathogens (C. pneumoniae and C. pecorum) were identified simultaneously in samples obtained from captive birds. Based on nucleotide-sequence variations of the ompA gene, three C. psittaci-positive samples detected were grouped into a cluster with the genotype WC derived from mammalian hosts. A single positive sample was phylogenetically related to a new strain of C. gallinacea. This report contributes to our increasing understanding of the abundance of Chlamydia in the animal kingdom.

Detection of Dichelobacter nodosus in wild ungulates (Capra ibex ibex and Ovis aries musimon) and domestic sheep suffering from foot rot using a two-step polymerase chain reaction.

PubMed

Belloy, Luc; Giacometti, Marco; Boujon, Patrick; Waldvogel, Andreas

2007-01-01

Severe keratinous hoof afflictions have been recorded in ibex (Capra ibex ibex) since 1995 and more recently in mouflon (Ovis aries musimon) in Switzerland. Based on clinical observations and comparison with diseases known to affect domestic ungulates, it was hypothesized these wild ungulates were affected by foot rot associated with infection with Dichelobacter nodosus. Dichelobacter nodosus has been shown to be the essential pathogen for initiation and establishment of foot rot, a highly contagious foot disease of sheep and goats. Because these bacteria could not be cultivated from affected ibex, we developed a nested polymerase chain reaction that allowed detection of D. nodosus without culture. Using this assay, we were able to diagnose D. nodosus infections of ibex, mouflon, and domestic sheep in natural outbreaks. From these results we conclude that D. nodosus plays an etiological role in foot rot not only in domestic but also in wild Caprinae.

User's Manual MCnest - Markov Chain Nest Productivity Model Version 2.0

EPA Science Inventory

The Markov chain nest productivity model, or MCnest, is a set of algorithms for integrating the results of avian toxicity tests with reproductive life-history data to project the relative magnitude of chemical effects on avian reproduction. The mathematical foundation of MCnest i...

Avian life history profiles for use in the Markov chain nest productivity model (MCnest)

EPA Science Inventory

The Markov Chain nest productivity model, or MCnest, quantitatively estimates the effects of pesticides or other toxic chemicals on annual reproductive success of avian species (Bennett and Etterson 2013, Etterson and Bennett 2013). The Basic Version of MCnest was developed as a...

Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax

PubMed Central

Pakalapati, Deepak; Garg, Shilpi; Middha, Sheetal; Acharya, Jyoti; Subudhi, Amit K; Boopathi, Arunachalam P; Saxena, Vishal; Kochar, Sanjay K; Kochar, Dhanpat K; Das, Ashis

2013-01-01

The 28S rRNA gene was amplified and sequenced from P. falciparum and P. vivax isolates collected from northwest India. Based upon the sequence diversity of the Plasmodium 28SrRNA gene in comparison with its human counterpart, various nested polymerase chain reaction (PCR) primers were designed from the 3R region of the 28SrRNA gene and evaluated on field isolates. This is the first report demonstrating the utility of this gene for species-specific diagnosis of malaria for these two species, prevalent in India. The initial evaluation on 363 clinical isolates indicated that, in comparison with microscopy, which showed sensitivity and specificity of 85.39% and 100% respectively, the sensitivity and specificity of the nested PCR assay was found to be 99.08% and 100% respectively. This assay was also successful in detecting mixed infections that are undetected by microscopy. Our results demonstrate the utility of the 28S rRNA gene as a diagnostic target for the detection of the major plasmodial species infecting humans. PMID:23816509

Distribution of Hepatitis C virus (HCV) genotypes in seropositive patients in the state of Alagoas, Brazil

PubMed Central

Gonzaga, Rosa Maria S.; Rodart, Itatiana F.; Reis, Mitermayer Galvão; Ramalho Neto, Cícero Eduardo; Silva, Denise Wanderlei

2008-01-01

We determined the frequency of hepatitis C virus (HCV) genotypes in anti-HCV seropositive patients in the state of Alagoas, Brazil, by means of nested-reverse transcription-polymerase chain reaction (RT-nested-PCR) followed by restriction fragment length polymorphism (RFLP) of amplified fragments of the 5´NCR. The nested-PCR with genotype-specific primers from the core region was carried out when detection was not possible by the first approach. Detectable HCV-RNA was present in 115 (74.7%) of 154 serum samples. Genotype 1 was the most frequent (77.4%), against 20.9% of genotype 3 and 0.8% of genotype 2. Subtype 1b was predominant (65.2%), followed by subtypes 1a (8.7%), and 3a (6.1%). Coinfection (1a/3a) was detected in 0.8% of the samples. Indeed, there was no significant differences in the prevalence of genotype 1 compared to what has been obtained from anti-HCV seropositive patients from other locations in Brazil. Here we report for the first time the genotype 2 in the state of Alagoas. PMID:24031281

Detection of betanodaviruses in apparently healthy aquarium fishes and invertebrates.

PubMed

Gomez, Dennis Kaw; Lim, Dong Joo; Baeck, Gun Wook; Youn, Hee Jeong; Shin, Nam Shik; Youn, Hwa Young; Hwang, Cheol Yong; Park, Jun Hong; Park, Se Chang

2006-12-01

Betanodaviruses are the causative agents of viral nervous necrosis (VNN) in cultured marine fish. A total of 237 apparently healthy aquarium fish, marine (65 species) and freshwater (12 species) fishes and marine invertebrates (4 species), which were stocked in a commercial aquarium in Seoul, South Korea, were collected from November 2005 to February 2006. The brains of the fish and other tissues of the invertebrates were examined by reverse transcriptase-polymerase chain reaction (RT-PCR) and nested PCR to detect betanodavirus. Positive nested PCR results were obtained from the brains of 8 marine fish species (shrimp fish Aeoliscus strigatus, milkfish Chanos chanos, three spot damsel Dascyllus trimaculatus, Japanese anchovy Engraulis japonicus, pinecone fish Monocentris japonica, blue ribbon eel Rhinomuraena quaesita, look down fish Selene vomer, yellow tang Zebrasoma flavesenes), 1 marine invertebrate species (spiny lobster Pamulirus versicolor), and 2 freshwater fish species (South American leaf fish Monocirrhus polyacanthus and red piranha Pygocentrus nattereri). The detection rate in nested PCR was 11/237 (4.64%). These subclinically infected aquarium fish and invertebrates may constitute an inoculum source of betanodaviruses for cultured fishes in the Korean Peninsula.

Detection of betanodaviruses in apparently healthy aquarium fishes and invertebrates

PubMed Central

Gomez, Dennis Kaw; Lim, Dong Joo; Baeck, Gun Wook; Youn, Hee Jeong; Shin, Nam Shik; Youn, Hwa Young; Hwang, Cheol Yong; Park, Jun Hong

2006-01-01

Betanodaviruses are the causative agents of viral nervous necrosis (VNN) in cultured marine fish. A total of 237 apparently healthy aquarium fish, marine (65 species) and freshwater (12 species) fishes and marine invertebrates (4 species), which were stocked in a commercial aquarium in Seoul, South Korea, were collected from November 2005 to February 2006. The brains of the fish and other tissues of the invertebrates were examined by reverse transcriptase-polymerase chain reaction (RT-PCR) and nested PCR to detect betanodavirus. Positive nested PCR results were obtained from the brains of 8 marine fish species (shrimp fish Aeoliscus strigatus, milkfish Chanos chanos, three spot damsel Dascyllus trimaculatus, Japanese anchovy Engraulis japonicus, pinecone fish Monocentris japonica, blue ribbon eel Rhinomuraena quaesita, look down fish Selene vomer, yellow tang Zebrasoma flavesenes), 1 marine invertebrate species (spiny lobster Pamulirus versicolor), and 2 freshwater fish species (South American leaf fish Monocirrhus polyacanthus and red piranha Pygocentrus nattereri). The detection rate in nested PCR was 11/237 (4.64%). These subclinically infected aquarium fish and invertebrates may constitute an inoculum source of betanodaviruses for cultured fishes in the Korean Peninsula. PMID:17106229

Molecular diagnosis of Salmonella typhi and its virulence in suspected typhoid blood samples through nested multiplex PCR.

PubMed

Prabagaran, Solai Ramatchandirane; Kalaiselvi, Vellingiri; Chandramouleeswaran, Naganathan; Deepthi, Krishnan Nair Geetha; Brahmadathan, Kootallur Narayanan; Mani, Mariappa

2017-08-01

A nested multiplex polymerase chain reaction (PCR) based diagnosis was developed for the detection of virulent Salmonella typhi in the blood specimens from patients suspected for typhoid fever. After the Widal test, two pairs of primers were used for the detection of flagellin gene (fliC) of S. typhi. Among them, those positive for fliC alone were subjected to identification of genes in Via B operon of Salmonella Pathogenesity Island (SPI-7) where four primer pairs were used to detect tviA and tviB genes. Among 250 blood samples tested, 115 were positive by fliC PCR; 22 of these were negative for tviA and tviB. Hence, the method described here can be used to diagnose the incidence of Vi-negative serovar typhi especially in endemic regions where the Vi vaccine is administered. Copyright © 2017 Elsevier B.V. All rights reserved.

Nested polymerase chain reaction study of 53 cases with Turner`s syndrome: Is cytogenetically undetected Y mosaicism common?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Binder, G.; Koch, A.; Ranke, M.B.

1995-12-01

Turner`s syndrome patients with Y mosaicism face a high risk of developing gonadoblastoma. Cytogenetic analysis can fail to detect rare cells bearing a normal or structurally abnormal Y chromosome (low level Y mosaicism). We screened 53 individuals with Turner`s syndrome for presence of sex-determining region Y (SRY), the testis-specific protein, Y encoded, gene, and the Y centromeric DYZ3 repeat using nested polymerase chain reaction (PCR). Thirty girls (57%) had the 45,X karyotype, determined through standard analysis of blood lymphocytes. The remaining 23 girls (43%) were mosaics and/or had structural abnormalities in 1 X-chromosome. Genomic DNA from blood leukocytes was amplifiedmore » using 2 rounds of PCR. This method was sensitive enough to detect 0.0001% male DNA on a female background. None of 53 Turner`s syndrome cases was positive for Y-specific loci after the first round of PCR. After the second round, 2 of 53 Turner`s syndrome cases were positive for SRY mapping to the distal short arm of chromosome Y. In 1 SRY-positive subject, the karyotype was 45,X, and in the other, it was 46,Xi(Xq). None of 53 Turner`s syndrome individuals, including the 2 SRY-positive subjects, were positive for the testis-specific protein, Y encoded, gene on the proximal short arm of chromosome Y or the centromeric DYZ3 repeat. These data exclude low level Y mosaicism in almost all Turner`s syndrome cases tested. 35 refs., 3 figs., 1 tab.« less

Molecular diagnosis of lyssaviruses and sequence comparison of Australian bat lyssavirus samples.

PubMed

Foord, A J; Heine, H G; Pritchard, L I; Lunt, R A; Newberry, K M; Rootes, C L; Boyle, D B

2006-07-01

To evaluate and implement molecular diagnostic tests for the detection of lyssaviruses in Australia. A published hemi-nested reverse transcriptase polymerase chain reaction (RT-PCR) for the detection of all lyssavirus genotypes was modified to a fully nested RT-PCR format and compared with the original assay. TaqMan assays for the detection of Australian bat lyssavirus (ABLV) were compared with both the nested and hemi-nested RT-PCR assays. The sequences of RT-PCR products were determined to assess sequence variations of the target region (nucleocapsid gene) in samples of ABLV originating from different regions. The nested RT-PCR assay was highly analytically specific, and at least as analytically sensitive as the hemi-nested assay. The TaqMan assays were highly analytically specific and more analytically sensitive than either RT-PCR assay, with a detection level of approximately 10 genome equivalents per microl. Sequence of the first 544 nucleotides of the nucleocapsid protein coding sequence was obtained from all samples of ABLV received at Australian Animal Health Laboratory during the study period. The nested RT-PCR provided a means for molecular diagnosis of all tested genotypes of lyssavirus including classical rabies virus and Australian bat lyssavirus. The published TaqMan assay proved to be superior to the RT-PCR assays for the detection of ABLV in terms of analytical sensitivity. The TaqMan assay would also be faster and cross contamination is less likely. Nucleotide sequence analyses of samples of ABLV from a wide geographical range in Australia demonstrated the conserved nature of this region of the genome and therefore the suitability of this region for molecular diagnosis.

Human herpesvirus infections of the central nervous system: laboratory diagnosis based on DNA detection by nested PCR in plasma and cerebrospinal fluid samples.

PubMed

Rimério, Carla Aparecida Tavares; De Oliveira, Renato Souza; de Almeida Bonatelli, Murilo Queiroz; Nucci, Anamarli; Costa, Sandra Cecília Botelho; Bonon, Sandra Helena Alves

2015-04-01

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the "gold standard," and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture. © 2015 Wiley Periodicals, Inc.

Application of multiplex nested methylated specific PCR in early diagnosis of epithelial ovarian cancer.

PubMed

Wang, Bi; Yu, Lei; Yang, Guo-Zhen; Luo, Xin; Huang, Lin

2015-01-01

To explore the application of multiplex nested methylated specific polymerase chain reaction (PCR) in the early diagnosis of epithelial ovarian carcinoma (EOC). Serum and fresh tissue samples were collected from 114 EOC patients. RUNX3, TFPI2 and OPCML served as target genes. Methylation levels of tissues were assessed by multiplex nested methylated specific PCR, the results being compared with those for carcinoma antigen 125 (CA125). The serum free deoxyribose nucleic acid (DNA) methylation spectrum of EOC patients was completely contained in the DNA spectrum of cancer tissues, providing an accurate reflection of tumor DNA methylation conditions. Serum levels of CA125 and free DNA methylation in the EOC group were evidently higher than those in benign lesion and control groups (p<0.05). Patients with early EOC had markedly lower serum CA125 than those with advanced EOC (p<0.05), but there was no significant difference in free DNA methylation (p>0.05). The sensitivity, specificity and positive predicative value (PPV) of multiplex nested methylated specific PCR were significantly higher for detection of all patients and those with early EOC than those for CA125 (p<0.05). In the detection of patients with advanced EOC, the PPV of CA125 detection was obviously lower than that of multiplex nested methylated specific PCR (p>0.05), but there was no significant difference in sensitivity (p>0.05). Serum free DNA methylation can be used as a biological marker for EOC and multiplex nested methylated specific PCR should be considered for early diagnosis since it can accurately determine tumor methylation conditions.

Molecular surveillance of Theileria ovis, Theileria lestoquardi and Theileria annulata infection in sheep and ixodid ticks in Iran.

PubMed

Razmi, Gholamreza; Yaghfoori, Saeed

2013-01-01

A molecular study was undertaken to detect Theileria ovis, Theileria lestoquardi and Theileria annulata in sheep and tick vectors. Investigation was conducted from 2010 to 2011 in the south of Khorasan Razavi Province, Iran. A total of 150 blood samples were collected from 30 different sheep flocks. In addition, ixodid ticks were sampled from the same flocks. The stained blood smears were microscopically examined for the presence of piroplasms and a semi-nested polymerase chain reaction-restriction (PCR) was used for subsequent molecular speciation. Salivary glands were isolated from the ticks and subsequently analysed by semi-nested PCR. polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was used to differentiate between T. lestoquardi and T. annulata from PCR-positive samples. Theileria species infection was microscopically detected in 18.6% of blood smears. The presence of T. ovis and T. lestoquardi or T. annulata was detected by semi-nested PCR in 58.6% and 6.6% of blood samples respectively. In total, 169 ixodid ticks were collected from different areas of the province. The most prevalent ticks were Rhipicephalus turanicus (n = 155; 91.7% of the total), followed by Hyalomma anatolicum anatolicum (n = 8; 4.7%) and Hyalomma marginatum turanicum (n = 6; 3.5%). From an organ pooling of 33 ticks, three pools of salivary glands from R. turanicus were positive for Theileria species by semi-nested PCR. Of the three R. turanicus samples testing positive for Theileria species, two (6.1%) were positive for T. ovis and one (3.0%) for T. lestoquardi or T.annulata. Amongst the 11 PCR-positive samples for T. lestoquardi or T. annulata, 10 were positive for T. lestoquardi and one sample was positive for both T. lestoquardi and T. annulata using PCR-RFLP. The results also demonstrated that PCR-RFLP could be used for the detection of T. ovis. Based on the results, it can be concluded that T. ovis has a higher prevalence than T. lestoquardi, and that R. turanicus could be a possible vector for T. ovis and T. lestoquardi. Finally, the PCR-RFLP based on Msp1 restriction enzyme is a simple method for differentiation of Theileria species in sheep and ixodid ticks.

Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori.

PubMed

Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun

2016-07-07

To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and drug sensitivity testing, which could be performed to evaluate clarithromycin resistance of H. pylori.

Establishment of a nested-ASP-PCR method to determine the clarithromycin resistance of Helicobacter pylori

PubMed Central

Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun

2016-01-01

AIM: To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). METHODS: The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. RESULTS: The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. CONCLUSION: The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and drug sensitivity testing, which could be performed to evaluate clarithromycin resistance of H. pylori. PMID:27433095

Comparative evaluation of uniplex, nested, semi-nested, multiplex and nested multiplex PCR methods in the identification of microbial etiology of clinically suspected infectious endophthalmitis.

PubMed

Bharathi, Madasamy Jayahar; Murugan, Nandagopal; Rameshkumar, Gunasekaran; Ramakrishnan, Rengappa; Venugopal Reddy, Yerahaia Chinna; Shivkumar, Chandrasekar; Ramesh, Srinivasan

2013-05-01

This study is aimed to determine the utility of various polymerase chain reaction (PCR) methods in vitreous fluids (VFs) for detecting the infectious genomes in the diagnosis of infectious endophthalmitis in terms of sensitivity and specificity. This prospective and consecutive analysis included a total of 66 VFs that were submitted for the microbiological evaluation, which were obtained from 66 clinically diagnosed endophthalmitis patients presented between November 2010 and October 2011 at the tertiary eye care referral centre in South India. Part of the collected VFs were subjected to cultures and smears, and the remaining parts were utilized for five PCR methods: uniplex, nested, semi-nested, multiplex and nested multiplex after extracting DNA, using universal eubacterial and Propionibacterium acnes species-specific primer sets targeting 16S rRNA gene in all bacteria and P. acnes, and panfungal primers, targeting 28S rRNA gene in all fungi. Of the 66 VFs, five (7.5%) showed positive results in smears, 16 (24%) in cultures and 43 (65%) showed positive results in PCRs. Among the 43 positively amplified VFs, 10 (15%) were positive for P. acnes genome, one for panfungal genome and 42 (62%) for eubacterial genome (including 10 P. acnes positives). Among 42 eubacterial-positive VFs, 36 were positive by both uniplex (first round) and multiplex (first round) PCRs, while nested (second round) and nested multiplex (second round) PCRs produced positive results in 42 and 41 VFs, respectively. Of the 43 PCR-positive specimens, 16 (37%) had positive growth (15 bacterial and one fungal) in culture. Of 50 culture-negative specimens, 27 (54%) were showed positive amplification, of which 10 were amplified for both P. acnes and eubacterial genomes and the remaining 17 were for eubacterial genome alone. Nested PCRs are superior than uniplex and multiplex PCR. PCRs proved to be a powerful tool in the diagnosis of endophthalmitis, especially for detecting uncultured microbes.

Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

PubMed Central

Atherton, Richard; Bhavnani, Darlene; Calvopiña, Manuel; Vicuña, Yosselin; Cevallos, William; Eisenberg, Joseph

2013-01-01

The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay) were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh) gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61%) were classified as assemblage B (26 as BIII and 16 as BIV), 22 (32%) as assemblage A (3 as AI and 19 as AII) and five (7%) as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A. PMID:23827993

Loop-mediated isothermal PCR (LAMP) for the diagnosis of falciparum malaria.

PubMed

Paris, Daniel H; Imwong, Mallika; Faiz, Abul M; Hasan, Mahtabuddin; Yunus, Emran Bin; Silamut, Kamolrat; Lee, Sue J; Day, Nicholas P J; Dondorp, Arjen M

2007-11-01

A recently described loop-mediated isothermal polymerase chain reaction (LAMP) for molecular detection of Plasmodium falciparum was compared with microscopy, PfHRP2-based rapid diagnostic test (RDT), and nested polymerase chain reaction (PCR) as the "gold standard" in 115 Bangladeshi in-patients with fever. DNA extraction for LAMP was conducted by conventional methods or simple heating of the sample; test results were either assessed visually or by gel electrophoresis. Conventional DNA extraction followed by gel electrophoresis had the highest agreement with the reference method (81.7%, kappa = 0.64), with a sensitivity (95% CI) of 76.1% (68.3-83.9%), comparable to RDT and microscopy, but a specificity of 89.6% (84.0-95.2%) compared with 100% for RDT and microscopy. DNA extraction by heat treatment deteriorated specificity to unacceptable levels. LAMP enables molecular diagnosis of falciparum malaria in settings with limited technical resources but will need further optimization. The results are in contrast with a higher accuracy reported in an earlier study comparing LAMP with a non-validated PCR method.

In-house polymerase chain reaction for affordable and sustainable Chlamydia trachomatis detection in Trinidad and Tobago.

PubMed

Rampersad, Joanne; Wang, Xiaohui; Gayadeen, Helen; Ramsewak, Samuel; Ammons, David

2007-11-01

To provide a preliminary assessment of in-house polymerase chain reaction (PCR) as an alternative to the more costly commercial test for detection of asymptomatic infection by Chlamydia trachomatis and to provide much needed demographic data on infection indicators within the Trinidad and Tobago public health care system. An inexpensive in-house nested-PCR with an Internal Amplification Control was used to detect C. trachomatis and Neisseria gonorrhoeae in urine samples collected from 273 apparently healthy, pregnant women from March-September 2004 in Trinidad, West Indies. Demographic information on participants was collected and subjected to statistical analyses. C. trachomatis was detected in 57/273 (21%) samples, of which 5 (2%) were also positive for N. gonorrhoeae. Infection correlated well with certain demographic parameters, with the highest incidence of C. trachomatis infection found among pregnant women that were single or of African descent. Given the lack of commercial tests in Trinidad, in-house PCR is an inexpensive alternative that can be used to detect asymptomatic infections of C. trachomatis and to provide demographic information needed for interventions by the public health care system.

Rapid identification of HPV 16 and 18 by multiplex nested PCR-immunochromatographic test.

PubMed

Kuo, Yung-Bin; Li, Yi-Shuan; Chan, Err-Cheng

2015-02-01

Human papillomavirus (HPV) types 16 and 18 are known to be high-risk viruses that cause cervical cancer. An HPV rapid testing kit that could help physicians to make early and more informed decisions regarding patient care is needed urgently but not yet available. This study aimed to develop a multiplex nested polymerase chain reaction-immunochromatographic test (PCR-ICT) for the rapid identification of HPV 16 and 18. A multiplex nested PCR was constructed to amplify the HPV 16 and 18 genotype-specific L1 gene fragments and followed by ICT which coated with antibodies to identify rapidly the different PCR products. The type-specific gene regions of high-risk HPV 16 and 18 could be amplified successfully by multiplex nested PCR at molecular sizes of approximately 99 and 101bp, respectively. The capture antibodies raised specifically against the moleculars labeled on the PCR products could be detected simultaneously both HPV 16 and 18 in one strip. Under optimal conditions, this PCR-ICT assay had the capability to detect HPV in a sample with as low as 100 copies of HPV viral DNA. The PCR-ICT system has the advantage of direct and simultaneous detection of two high-risk HPV 16 and 18 DNA targets in one sample, which suggested a significant potential of this assay for clinical application. Copyright © 2014. Published by Elsevier B.V.

Identification of individual powdery mildew fungi infecting leaves and direct detection of gene expression by single conidium polymerase chain reaction.

PubMed

Matsuda, Yoshinori; Sameshima, Takeshi; Moriura, Nobuyuki; Inoue, Kanako; Nonomura, Teruo; Kakutani, Koji; Nishimura, Hiroaki; Kusakari, Shin-Ichi; Takamatsu, Susumu; Toyoda, Hideyoshi

2005-10-01

ABSTRACT Greenhouse-grown tomato seedlings were inoculated naturally with two genera of powdery mildew conidia forming appressorial germ tubes that could not be differentiated by length alone. For direct identification, single germinated conidia were removed from leaves by means of a glass pipette linked to the manipulator of a high-fidelity digital microscope. This microscope enabled in vivo observation of the fungi without leaf decoloration or fungal staining. The isolated conidia were subjected to PCR amplification of the 5.8S rDNA and its adjacent internal transcribed spacer sequences followed by nested PCR to attain sensitivity high enough to amplify target nucleotide sequences (PCR/nested PCR). Target sequences from the conidia were completely coincident with those of the pathogen Oidium neolycopersici or Erysiphe trifolii (syn. Microsphaera trifolii), which is nonpathogenic on tomato. Using RT-PCR/nested PCR or multiplex RT-PCR/nested PCR, it was possible to amplify transcripts expressed in single conidia. Conidia at pre- and postgermination stages were removed individually from tomato leaves, and two powdery mildew genes were monitored. The results indicated that the beta-tubulin homolog TUB2-ol was expressed at pre- and postgermination stages and the cutinase homolog CUT1-ol was only expressed postgermination. Combining digital microscopic micromanipulation and two-step PCR amplification is thus useful for investigation of individual propagules on the surface of plants.

Real-time nested multiplex PCR for the detection of herpes simplex virus types 1 and 2 and varicella zoster virus.

PubMed

O'Neill, Hugh J; Wyatt, Dorothy E; Coyle, Peter V; McCaughey, Conall; Mitchell, Frederick

2003-12-01

One hundred forty-nine specimens were tested in a LightCycler nested multiplex polymerase chain reaction (LCnmPCR) for Herpes simplex virus (HSV)1, HSV2, and VZV. Eighty-one were from genitourinary medicine (GUM) patients and the other 68 specimens were from other patients with skin lesions. The results were compared to a conventional multiplex nested PCR (nmPCR) using agarose gel electrophoresis. Twenty-five specimens were positive in both assays for HSV1 and 29 were positive for VZV. For HSV2 there were 27 positive in the LCnmPCR and 26 positive in the nmPCR assay. The melting temperatures (Tms) of each target were different with a mean of 84.75 degrees C for HSV1, 88.57 degrees C for HSV2, and 83.62 degrees C for VZV. The melting curves of positive specimens directly overlaid the melting curves of the positive controls in the assay. The LCnmPCR assay is a convenient alternative to conventional PCR using agarose gel electrophoresis. It improves specimen turnaround time by eliminating the need for gel electrophoresis, transillumination, and gel photography. It also shows increased sensitivity for HSV2 over our standard assay. This LCnmPCR reduces further the possibility of amplicon contamination with nested PCR protocols. Copyright 2003 Wiley-Liss, Inc.

Simultaneous detection of Plasmodium vivax and Plasmodium falciparum gametocytes in clinical isolates by multiplex-nested RT-PCR

PubMed Central

2012-01-01

Background Gametocyte carriage is essential for malaria transmission and endemicity of disease; thereby it is a target for malaria control strategies. Malaria-infected individuals may harbour gametocytes below the microscopic detection threshold that can be detected by reverse transcription polymerase chain reaction (RT-PCR) targeting gametocyte-specific mRNA. To date, RT-PCR has mainly been applied to the diagnosis of Plasmodium falciparum gametocytes but very limited for that of Plasmodium vivax. Methods A multiplex-nested RT-PCR targeting Pfs25 and Pvs25 mRNA specific to mature gametocytes of P. falciparum and P. vivax, respectively, was developed. The assay was evaluated using blood samples collected in rainy and dry seasons from febrile patients,in a malaria-endemic area in Thailand. Malaria diagnosis was performed by Giemsa-stained blood smears and 18S rRNA PCR. Results The multiplex-nested RT-PCR detected Pfs25 mRNA in 75 of 86 (87.2%) P. falciparum-infected individuals and Pvs25 mRNA in 82 of 90 (91.1%) P. vivax malaria patients diagnosed by 18S rRNA PCR. Gametocytes were detected in 38 (eight P. falciparum and 30 P. vivax) of 157 microscopy positive samples, implying that a large number of patients harbour sub-microscopic gametocytaemia. No seasonal differences in gametocyte carriage were observed for both malaria species diagnosed by multiplex-nested RT-PCR. With single-nested RT-PCR targeting Pfs25 or Pvs25 mRNA as standard, the multiplex-nested RT-PCR offered sensitivities of 97.4% and 98.9% and specificities of 100% and 98.8% for diagnosing mature gametocytes of P. falciparum and P. vivax, respectively. The minimum detection limit of the multiplex-nested PCR was 10 copies of templates. Conclusions The multiplex-nested RT-PCR developed herein is useful for simultaneous assessment of both P. falciparum and P. vivax gametocyte carriage that is prevalent and generally sympatric in several malaria-endemic areas outside Africa. PMID:22682065

Simultaneous detection of Plasmodium vivax and Plasmodium falciparum gametocytes in clinical isolates by multiplex-nested RT-PCR.

PubMed

Kuamsab, Napaporn; Putaporntip, Chaturong; Pattanawong, Urassaya; Jongwutiwes, Somchai

2012-06-10

Gametocyte carriage is essential for malaria transmission and endemicity of disease; thereby it is a target for malaria control strategies. Malaria-infected individuals may harbour gametocytes below the microscopic detection threshold that can be detected by reverse transcription polymerase chain reaction (RT-PCR) targeting gametocyte-specific mRNA. To date, RT-PCR has mainly been applied to the diagnosis of Plasmodium falciparum gametocytes but very limited for that of Plasmodium vivax. A multiplex-nested RT-PCR targeting Pfs25 and Pvs25 mRNA specific to mature gametocytes of P. falciparum and P. vivax, respectively, was developed. The assay was evaluated using blood samples collected in rainy and dry seasons from febrile patients,in a malaria-endemic area in Thailand. Malaria diagnosis was performed by Giemsa-stained blood smears and 18S rRNA PCR. The multiplex-nested RT-PCR detected Pfs25 mRNA in 75 of 86 (87.2%) P. falciparum-infected individuals and Pvs25 mRNA in 82 of 90 (91.1%) P. vivax malaria patients diagnosed by 18S rRNA PCR. Gametocytes were detected in 38 (eight P. falciparum and 30 P. vivax) of 157 microscopy positive samples, implying that a large number of patients harbour sub-microscopic gametocytaemia. No seasonal differences in gametocyte carriage were observed for both malaria species diagnosed by multiplex-nested RT-PCR. With single-nested RT-PCR targeting Pfs25 or Pvs25 mRNA as standard, the multiplex-nested RT-PCR offered sensitivities of 97.4% and 98.9% and specificities of 100% and 98.8% for diagnosing mature gametocytes of P. falciparum and P. vivax, respectively. The minimum detection limit of the multiplex-nested PCR was 10 copies of templates. The multiplex-nested RT-PCR developed herein is useful for simultaneous assessment of both P. falciparum and P. vivax gametocyte carriage that is prevalent and generally sympatric in several malaria-endemic areas outside Africa.

Incidence of pulmonary aspergillosis and correlation of conventional diagnostic methods with nested PCR and real-time PCR assay using BAL fluid in intensive care unit patients.

PubMed

Zarrinfar, Hossein; Makimura, Koichi; Satoh, Kazuo; Khodadadi, Hossein; Mirhendi, Hossein

2013-05-01

Although the incidence of invasive aspergillosis in the intensive care unit (ICU) is scarce, it has emerged as major problems in critically ill patients. In this study, the incidence of pulmonary aspergillosis (PA) in ICU patients has evaluated and direct microscopy and culture has compared with nested polymerase chain reaction (PCR) and real-time PCR for detection of Aspergillus fumigatus and A. flavus in bronchoalveolar lavage (BAL) samples of the patients. Thirty BAL samples obtained from ICU patients during a 16-month period were subjected to direct examinations on 20% potassium hydroxide (KOH) and culture on two culture media. Nested PCR targeting internal transcribed spacer ribosomal DNA and TaqMan real-time PCR assay targeting β-tubulin gene were used for the detection of A. fumigatus and A. flavus. Of 30 patients, 60% were men and 40% were women. The diagnosis of invasive PA was probable in 1 (3%), possible in 11 (37%), and not IPA in 18 (60%). Nine samples were positive in nested PCR including seven samples by A. flavus and two by A. fumigatus specific primers. The lowest amount of DNA that TaqMan real-time PCR could detect was ≥40 copy numbers. Only one of the samples had a positive result of A. flavus real-time PCR with Ct value of 37.5. Although a significant number of specimens were positive in nested PCR, results of this study showed that establishment of a correlation between the conventional methods with nested PCR and real-time PCR needs more data confirmed by a prospective study with a larger sample group. © 2013 Wiley Periodicals, Inc.

Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.

PubMed

Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S

2016-02-01

Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.

A nested polymerase chain reaction for the detection of genomic DNA of Myxobolus cerebralis in rainbow trout Oncorhynchus mykiss.

PubMed

Andree, K B; MacConnell, E; Hedrick, R P

1998-10-08

A nested polymerase chain reaction (PCR) test was developed to amplify a segment of the 18S rRNA gene from Myxobolus cerebralis, the agent causing whirling disease in salmonid fish. The PCR amplifies a 415 bp amplicon that was identified by dideoxynucleotide terminated sequencing to be identical to the known 18S rDNA sequence of M. cerebralis. There was no amplification of genomic DNA from 4 other myxosporean parasites of salmonid fish from the genus Myxobolus including M. arcticus, M. insidiosus, M. neurobius, and M. squamalis. The efficacy of the PCR test to detect early infections was demonstrated by amplification of the 415 bp fragment from experimentally exposed rainbow trout Oncorhynchus mykiss at 2 h and at 1, 2, and 3 wk postexposure to actinosporean stages (triactinomyxons) of M. cerebralis. In contrast, standard microscopic examinations of stained tissue sections of the same fish used for PCR were less reliable in detecting the presence of the parasite. Additional examinations of fish 5 mo postexposure, after sporogenesis had occurred, found the PCR to be a more reliable indicator of infection than pepsin-trypsin digest (PTD) method, particularly when trout were experimentally exposed to low levels of the infectious stages of the parasite. The PCR was able to amplify to detectable levels the equivalent of a single sporoplasm of M. cerebralis as found in a tissue sample. This test improves the detection of M. cerebralis because it can detect the presence of the parasite: (1) in both hosts, (2) in all known stages of its life cycle, and (3) at lower thresholds than currently used diagnostic methods. Lastly, the PCR test is less susceptible to morphological misidentifications of the spores that can occur with current microscopic procedures.

Specific detection of Echinococcus spp. from the Tibetan fox (Vulpes ferrilata) and the red fox (V. vulpes) using copro-DNA PCR analysis.

PubMed

Jiang, Weibin; Liu, Nan; Zhang, Gaotian; Renqing, Pengcuo; Xie, Fei; Li, Tiaoying; Wang, Zhenghuan; Wang, Xiaoming

2012-10-01

There are three Echinococcus species, Echinococcus granulosus, E. multilocularis, and E. shiquicus, which are distributed on the vast area of pastureland on the eastern Tibetan plateau in China. Tibetan foxes (Vulpes ferrilata) have been determined to be the main wild definitive host of E. multilocularis and E. shiquicus, but little information is available on the prevalence of these two parasites in Tibetan foxes. Consequently, the copro-prevalence of these parasites in foxes from the eastern Tibetan plateau was evaluated in this study. For each copro-DNA sample extracted from fox feces, a 133-bp segment of EgG1 Hae III was used to screen for infection with E. granulosus. Multiplex nested polymerase chain reaction (PCR) analysis was used to target an 874-bp segment of the mitochondrial COI gene to distinguish E. multilocularis and E. shiquicus. Among 184 fecal samples, 120 were from Tibetan foxes and six from red foxes (Vulpes vulpes). Of the fecal samples from Tibetan foxes, 74 (giving a copro-prevalence of 62%) showed the presence of Echinococcus spp.: 23 (19%) were found to contain E. multilocularis, 32 (27%) E. shiquicus, and 19 (16%) showed mixed infection with both E. multilocularis and E. shiquicus. Two fecal samples from red foxes were found to be infected with E. multilocularis. No fox feces were found to be infected with E. granulosus. Tests on zinc finger protein genes and a 105-bp fragment of the Sry gene found no significant difference in the prevalence of the two parasites between sexes. The efficiency of our multiplex nested PCR methods were compared with previous polymerase chain reaction-based restriction fragment length polymorphism (PCR-RFLP) methods and some problems associated with the copro-PCR were discussed.

Comparison between conventional and molecular methods for diagnosis of bovine babesiosis (Babesia bovis infection) in tick infested cattle in upper Egypt.

PubMed

Al-Hosary, Amira A T

2017-03-01

Ticks and tick-borne diseases are the main problems affecting the livestock production in Egypt. Bovine babesiosis has adverse effects on the animal health and production. A comparison of Giemsa stained blood smears, polymerase chain reaction (PCR) and nested PCR (nPCR) assays for detection of Babesia bovis infection in Egyptian Baladi cattle ( Bos taurus ) in reference to reverse line blot was carried out. The sensitivity of PCR and nested PCR (nPCR) assays were 65 and 100 % respectively. Giemsa stained blood smears showed the lowest sensitivity (30 %). According to these results using of PCR and nPCR target for B. bovis , [BBOV-IV005650 (BV5650)] gene are suitable for diagnosis of B. bovis infection. The 18Ss rRNA partial sequence confirmed that all the positive samples were Babesia bovis and all of them were deposited in the GenBank databases (Accession No: KM455548, KM455549 and KM455550).

Modified use of methylene blue in the tissue compression technique to detect sarcocysts in meat-producing animals.

PubMed

Ng, Yit Han; Subramaniam, Vellayan; Lau, Yee Ling

2015-11-30

Sarcocystosis in meat-producing animals is a major cause of reduced productivity in many countries, especially those that rely on agriculture. Although several diagnostic methods are available to detect sarcocystosis, many are too time-consuming for routine use in abattoirs and meat inspection centers, where large numbers of samples need to be tested. This study aimed to compare the sensitivity of the methylene blue tissue preparation, unstained tissue preparation and nested PCR in the detection of sarcocysts in tissue samples. Approximately three-fold more sarcocysts were detected in methylene blue-stained tissue compared to unstained controls (McNemar's test: P<0.01). Test sensitivity was comparable to that of the gold standard for sarcocyst detection, nested polymerase chain reaction. These results suggest that methylene blue can be used in tissue compression as a rapid, safe, and inexpensive technique for the detection of ruminant sarcocystosis in abattoirs. Copyright © 2015 Elsevier B.V. All rights reserved.

FilmArray, an Automated Nested Multiplex PCR System for Multi-Pathogen Detection: Development and Application to Respiratory Tract Infection

PubMed Central

Poritz, Mark A.; Blaschke, Anne J.; Byington, Carrie L.; Meyers, Lindsay; Nilsson, Kody; Jones, David E.; Thatcher, Stephanie A.; Robbins, Thomas; Lingenfelter, Beth; Amiott, Elizabeth; Herbener, Amy; Daly, Judy; Dobrowolski, Steven F.; Teng, David H. -F.; Ririe, Kirk M.

2011-01-01

The ideal clinical diagnostic system should deliver rapid, sensitive, specific and reproducible results while minimizing the requirements for specialized laboratory facilities and skilled technicians. We describe an integrated diagnostic platform, the “FilmArray”, which fully automates the detection and identification of multiple organisms from a single sample in about one hour. An unprocessed biologic/clinical sample is subjected to nucleic acid purification, reverse transcription, a high-order nested multiplex polymerase chain reaction and amplicon melt curve analysis. Biochemical reactions are enclosed in a disposable pouch, minimizing the PCR contamination risk. FilmArray has the potential to detect greater than 100 different nucleic acid targets at one time. These features make the system well-suited for molecular detection of infectious agents. Validation of the FilmArray technology was achieved through development of a panel of assays capable of identifying 21 common viral and bacterial respiratory pathogens. Initial testing of the system using both cultured organisms and clinical nasal aspirates obtained from children demonstrated an analytical and clinical sensitivity and specificity comparable to existing diagnostic platforms. We demonstrate that automated identification of pathogens from their corresponding target amplicon(s) can be accomplished by analysis of the DNA melting curve of the amplicon. PMID:22039434

A semi-nested PCR assay for molecular detection of Paracoccidioides brasiliensis in tissue samples.

PubMed

Koishi, Andrea Cristine; Vituri, Débora Fonseca; Dionízio Filho, Pedro Sebastião Raimundo; Sasaki, Alexandre Augusto; Felipe, Maria Sueli Soares; Venancio, Emerson José

2010-01-01

Paracoccidioidomycosis is a systemic infection caused by Paracoccidioides brasiliensis. In this study, a semi-nested PCR for paracoccidioidomycosis diagnosis was developed. The primers ITS1 and ITS4 were used in the first reaction, while the primers MJ03 and ITS1 primer were used in the second reaction. The semi-nested PCR was used to investigate biopsies of five patients with oral lesions that resembled paracoccidioidomycosis. The semi-nested PCR was positive for four samples and negative for a sample from a patient later diagnosed with leishmaniasis. The new semi-nested PCR describe is useful for paracoccidioidomycosis diagnosis.

Sensitivity, specificity and comparison of three commercially available immunological tests in the diagnosis of Cryptosporidium species in animals.

PubMed

Danišová, Olga; Halánová, Monika; Valenčáková, Alexandra; Luptáková, Lenka

The study was conducted to compare the specificity of immunological diagnostic methods used for the diagnosis of Cryptosporidium species capable of causing life-threatening infection in both immunosuppressed and immunocompetent patients. For the detection of Cryptosporidium species in 79 animals with diarrhoea, we used three Copro-antigen tests: RIDASCREEN ® Cryptosporidium test, Cryptosporidium 2nd Generation (ELISA) and RIDA ® QUICK Cryptosporidium. For immunoassays we used positive and negative samples detected by means of polymerase chain reaction and validated by sequencing and nested polymerase chain reaction to confirm the presence six different species of Cryptosporidium species. Prevalence of cryptosporidiosis in the entire group determined by enzyme immunoassay, enzyme linked immunosorbent assay, immuno-chromatographic test and polymerase chain reaction was 34.17%, 27.84%, 6.33% and 27.84%, respectively. Sensitivity of animal samples with enzyme immunoassay, enzyme linked immunosorbent assay, and immuno-chromatographic test was 63.6%, 40.9% and 22.7%, resp., when questionable samples were considered positive, whereas specificity of enzyme immunoassay, enzyme linked immunosorbent assay and immuno-chromatographic test was 75.9%, 78.9% and 100%, respectively. Positive predictive values and negative predictive values were different for all the tests. These differences results are controversial and therefore reliability and reproducibility of immunoassays as the only diagnostic method is questionable. The use of various Cryptosporidium species in diagnosis based on immunological testing and different results obtained by individual tests indicate potential differences in Copro-antigens produced by individual Cryptosporidium species. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Prevalence data of Rickettsia slovaca and other SFG Rickettsiae species in Dermacentor marginatus in the southeastern Iberian peninsula.

PubMed

Márquez, F J; Rojas, A; Ibarra, V; Cantero, A; Rojas, J; Oteo, J A; Muniain, M A

2006-10-01

In southern Spain, Dermacentor marginatus ticks can be infected with several genospecies of spotted fever Group (SFG) Rickettsia. We developed a nested polymerase chain reaction assay by using a species-specific probe targeting the ompA gene to detect and differentiate between the two groups of rickettsiae previously described in D. marginatus. SFG rickettsia has been detected in 85.15% of ticks studied (26.7% of positives have been to R. slovaca, the causative agent of TIBOLA-DEBONEL, and 73.3% to SFG rickettsia closely related to strains RpA4-JL-02-DnS14-DnS28).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belinsky, Steven A; Palmisano, William A

A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection ofmore » lung and other cancers.« less

Molecular detection of flaviviruses and alphaviruses in mosquitoes (Diptera: Culicidae) from coastal ecosystems in the Colombian Caribbean

PubMed Central

Hoyos-López, Richard; Suaza-Vasco, Juan; Rúa-Uribe, Guillermo; Uribe, Sandra; Gallego-Gómez, Juan Carlos

2016-01-01

Arboviruses belonging to the genera Flavivirus and Alphavirus were detected in mosquitoes in a rural area of San Bernardo del Viento (Córdoba, Colombia). A total of 22,180 mosquitoes were collected, sorted into 2,102 pools, and tested by generic/nested reverse transcription-polymerase chain reaction. Venezuelan equine encephalitis virus, dengue virus, West Nile virus, St. Louis encephalitis virus, yellow fever virus, and Culex flavivirus were detected and identified by sequencing. The detection of arboviral pathogens in this zone represents possible circulation and indicates a human health risk, demonstrating the importance of virological surveillance activities. PMID:27706377

Mefloquine improved progressive multifocal leukoencephalopathy in a patient with systemic lupus erythematosus.

PubMed

Beppu, Minako; Kawamoto, Michi; Nukuzuma, Souichi; Kohara, Nobuo

2012-01-01

We describe a case of a 67-year-old man with systemic lupus erythematosus who presented with progressive left hemiplegia. Although the cerebral spinal fluid (CSF) polymerase chain reaction (PCR) for the JC virus was negative, a brain biopsy confirmed the diagnosis of progressive multifocal leukoencephalopathy (PML). The tapering of prednisone and the use of cidofovir could not arrest the disease progression. Administration of mefloquine stopped the extension of the lesion, and resulted in obvious clinical improvement. The CSF nested PCR for the JC virus also became negative. This widely used drug should be tried for the treatment of non-HIV PML.

Encephalitozoon cuniculi in Raw Cow's Milk Remains Infectious After Pasteurization.

PubMed

Kváč, Martin; Tomanová, Vendula; Samková, Eva; Koubová, Jana; Kotková, Michaela; Hlásková, Lenka; McEvoy, John; Sak, Bohumil

2016-02-01

This study describes the prevalence of Encephalitozoon cuniculi in raw cow's milk and evaluates the effect of different milk pasteurization treatments on E. cuniculi infectivity for severe combined immunodeficient (SCID) mice. Using a nested polymerase chain reaction approach, 1 of 50 milking cows was found to repeatedly shed E. cuniculi in its feces and milk. Under experimental conditions, E. cuniculi spores in milk remained infective for SCID mice following pasteurization treatments at 72 °C for 15 s or 85 °C for 5 s. Based on these findings, pasteurized cow's milk should be considered a potential source of E. cuniculi infection in humans.

Nested high resolution models for the coastal areas of the North Indian Ocean

NASA Astrophysics Data System (ADS)

Wobus, Fred; Shapiro, Georgy

2017-04-01

Oceanographic processes at coastal scales require much higher horizontal resolution from both ocean models and observations as compared to deep water oceanography. Aside from a few exceptions such as land-locked seas, the hydrodynamics of coastal shallow waters is strongly influenced by the tides, which in turn control the mixing, formation of temperature fronts and other phenomena. The numerical modelling of the coastal domains requires good knowledge of the lateral boundary conditions. The application of lateral boundary conditions to ocean models is a notoriously tricky task, but can only be avoided with global ocean models. Smaller scale regional ocean models are typically nested within global models, and even smaller-scale coastal models may be nested within regional models, creating a nesting chain. However a direct nesting of a very high resolution coastal model into a coarse resolution global model results in degrading of the accuracy of the outputs due to the large difference between the model resolutions. This is why a nesting chain has to be applied, so that every increase in resolution is kept within a reasonable minimum (typically by a factor of 3 to 5 at each step). Global models are traditionally non-tidal, so at some stage of the nesting chain the tides need to be introduced. This is typically done by calculating the tidal constituents from a dedicated tidal model (e.g. TPXO) for all boundary points of a nested model. The tidal elevation at each boundary location can then be calculated from the harmonics at every model time step and the added to the parent model non-tidal SSH. This combination of harmonics-derived tidal SSH and non-tidal parent model SSH is typically applied to the nested domain using the Flather condition, together with the baroclinic velocities from the parent model. The harmonics-derived SSH cannot be added to an SSH signal that is already tidal, so the parent model SSH has to be either detided or taken from a non-tidal model. Due to the lack of effective detiding methods and the prevailing view that harmonics-derived SSH provide a cleaner tidal signal over the SSH taken from a tidal parent model it has traditionally only been the last model in a nesting chain that is tidal. But to our knowledge these assumptions haven't been sufficiently tested and need to be re-visited. Furthermore, the lack of tides in the larger-scale regional models limits their capability and we would like to push for a nesting chain where all regional models (including the intermediate ones) are tidal. In this study we have conducted a number of numerical experiments where we have tested whether a tidal regional model can effectively force a tidal nested model without resorting to detiding techniques and the use of a dedicated tidal model such as TPXO. We have tested whether it's possible to use a tidal parent model and use the total SSH (combined geostrophic SSH and tidal component) to force the child model at the boundary. We call this strategy "tidal nesting" as opposed to TPXO tidal forcing which is used in "traditional nesting". For our experiments we have developed 2 models based on the same NEMO 3.6 codebase. The medium resolution AS20 model covers the Arabian Sea at 1/20 ̊ with 50 layers using a hybrid s-on-top-of-z vertical discretisation scheme (Shapiro et al., 2013); and the high resolution AG60 model covers the Arabian/Persian Gulf at 1/60 ̊ with 50 layers. The AS20 model is "traditionally" nested within the UK Met Office non-tidal large-scale Indian Ocean model at 1/12 ̊ resolution and tidal constituents at the boundary are taken from the TPXO7.2 Global Tidal Solution. Our "tidal nesting" experiments use different forcing frequencies at which the tidal SSH is fed from the larger-scale AS20 into the smaller-scale AG60 model. These strategies are compared with "traditional nesting" where the inner AG60 uses boundary conditions from a non-tidal AS20 parent model and tides are computed from TPXO harmonics. The results reveal an optimal tidal nesting strategy which forces tidal SSH from the parent model at 1-hourly intervals whilst non-tidal parameters are forced at 24-hourly intervals. The analysis includes comparisons with tidal gauges in the Gulf of Oman and inside the Arabian Gulf. The accuracy of tides inside the Gulf is inhibited by the narrow Straits of Hormuz, and tidal nesting doesn't achieve the same level of agreement with observation as traditional nesting. We also found that a further increase in the SSH forcing frequency to 30 minutes does not further improve the results. The forcing at intervals of 1h/24h for tidal/non-tidal parameters shows that a 2-step tidal nesting chain is viable and thus tides can be represented in more than just the last model of a nesting chain. References: Shapiro, G., Luneva, M., Pickering, J., and Storkey, D.: The effect of various vertical discretization schemes and horizontal diffusion parameterization on the performance of a 3-D ocean model: the Black Sea case study, Ocean Sci., 9, 377-390, doi:10.5194/os-9-377-2013, 2013.

Comparison of milk culture, direct and nested polymerase chain reaction (PCR) with fecal culture based on samples from dairy herds infected with Mycobacterium avium subsp. paratuberculosis

PubMed Central

Gao, Anli; Odumeru, Joseph; Raymond, Melinda; Hendrick, Steven; Duffield, Todd; Mutharia, Lucy

2009-01-01

Mycobacterium avium subsp. paratuberculosis (MAP) is the etiologic agent of Johne’s disease in cattle and other farm ruminants, and is also a suspected pathogen of Crohn’s disease in humans. Development of diagnostic methods for MAP infection has been a challenge over the last few decades. The objective of this study was to investigate the relationship between different methods for detection of MAP in milk and fecal samples. A total of 134 milk samples and 110 feces samples were collected from 146 individual cows in 14 MAP-infected herds in southwestern Ontario. Culture, IS900 polymerase chain reaction (PCR) and nested PCR methods were used for detecting MAP in milk; results were compared with those of fecal culture. A significant relationship was found between milk culture, direct PCR, and nested PCR (P < 0.05). The fecal culture results were not related to any of the 3 assay methods used for the milk samples (P > 0.10). Although fecal culture showed a higher sensitivity than the milk culture method, the difference was not significant (P = 0.2473). The number of MAP colony-forming units (CFU) isolated by culture from fecal samples was, on average, higher than that isolated from milk samples (P = 0.0083). There was no significant correlation between the number of CFU cultured from milk and from feces (Pearson correlation coefficient = 0.1957, N = 63, P = 0.1243). The animals with high numbers of CFU in milk culture may not be detected by fecal culture at all, and vise versa. A significant proportion (29% to 41%) of the positive animals would be missed if only 1 culture method, instead of both milk and feces, were to be used for diagnosis. This suggests that the shedding of MAP in feces and milk is not synchronized. Most of the infected cows were low-level shedders. The proportion of low-level shedders may even be underestimated because MAP is killed during decontamination, thus reducing the chance of detection. Therefore, to identify suspected Johne’s-infected animals using the tests in this study, both milk and feces samples should be collected in duplicate to enhance the diagnostic rate. The high MAP kill rate identified in the culture methods during decontamination may be compensated for by using the nested PCR method, which had a higher sensitivity than the IS900 PCR method used. PMID:19337397

A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

PubMed

Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

2014-01-01

A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

A Two-Step Lyssavirus Real-Time Polymerase Chain Reaction Using Degenerate Primers with Superior Sensitivity to the Fluorescent Antigen Test

PubMed Central

Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael

2014-01-01

A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible. PMID:24822188

Genetic diversity of Plasmodium falciparum merozoite surface protein-1 block 2 in sites of contrasting altitudes and malaria endemicities in the Mount Cameroon region.

PubMed

Wanji, Samuel; Kengne-Ouafo, Arnaud J; Eyong, Ebanga E Joan; Kimbi, Helen K; Tendongfor, Nicholas; Ndamukong-Nyanga, Judith L; Nana-Djeunga, Hugues C; Bourguinat, Catherine; Sofeu-Feugaing, David D; Charvet, Claude L

2012-05-01

The present study analyzed the relationship between the genetic diversity of Plasmodium falciparum and parasitologic/entomologic indices in the Mount Cameroon region by using merozoite surface protein 1 as a genetic marker. Blood samples were collected from asymptomatic children from three altitude zones (high, intermediate, and low). Parasitologic and entomologic indices were determined by microscopy and landing catch mosquito collection/circumsporozoite protein-enzyme-linked immunosorbent assay, respectively. A total of 142 randomly selected P. falciparum-positive blood samples were genotyped by using a nested polymerase chain reaction-based technique. K-1 polymerase chain reaction products were also sequenced. As opposed to high altitude, the highest malaria prevalence (70.65%) and entomologic inoculation rate (2.43 infective/bites/night) were recorded at a low altitude site. Seven (18.91%), 22 (36.66%), and 19 (42.22%) samples from high, intermediate, and low altitudes, respectively, contained multiclonal infections. A new K-1 polymorphism was identified. This study shows a positive non-linear association between low/intermediate altitude (high malaria transmission) and an increase in P. falciparum merozoite surface protein 1 block 2 polymorphisms.

Whole blood Nested PCR and Real-time PCR amplification of Talaromyces marneffei specific DNA for diagnosis.

PubMed

Lu, Sha; Li, Xiqing; Calderone, Richard; Zhang, Jing; Ma, Jianchi; Cai, Wenying; Xi, Liyan

2016-02-01

Talaromyces marneffei is a dimorphic pathogenic fungus, which is a life-threatening invasive mycosis in the immunocompromised host. Prompt diagnosis of T. marneffei infection remains difficult although there has been progress in attempts to expedite the diagnosis of this infection. We previously demonstrated the value of nested polymerase chain reaction (PCR) to detect T. marneffei in paraffin embedded tissue samples with high sensitivity and specificity. In this study, this assay was used to detect the DNA of T. marneffei in whole blood samples. Real-time PCR assay was also evaluated to identify T. marneffei in the same samples. Twenty out of 30 whole blood samples (67%) collected from 23 patients were found positive by using the nested PCR assay, while 23/30 (77%) samples were found positive by using the real-time PCR assay. In order to express accurately the fungal loads, we used a normalized linearized plasmid as an internal control for real-time PCR. The assay results were correlated as the initial quantity (copies/μl) with fungal burden. These data indicate that combination of nested PCR and real-time PCR assay provides an attractive alternative for identification of T. marneffei DNA in whole blood samples of HIV-infected patients. © The Author 2015. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

PCR diagnostics underestimate the prevalence of avian malaria (Plasmodium relictum) in experimentally-infected passerines

USGS Publications Warehouse

Jarvi, Susan I.; Schultz, Jeffrey J.; Atkinson, Carter T.

2002-01-01

Several polymerase chain reaction (PCR)-based methods have recently been developed for diagnosing malarial infections in both birds and reptiles, but a critical evaluation of their sensitivity in experimentally-infected hosts has not been done. This study compares the sensitivity of several PCR-based methods for diagnosing avian malaria (Plasmodium relictum) in captive Hawaiian honeycreepers using microscopy and a recently developed immunoblotting technique. Sequential blood samples were collected over periods of up to 4.4 yr after experimental infection and rechallenge to determine both the duration and detectability of chronic infections. Two new nested PCR approaches for detecting circulating parasites based on P. relictum 18S rRNA genes and the thrombospondin-related anonymous protein (TRAP) gene are described. The blood smear and the PCR tests were less sensitive than serological methods for detecting chronic malarial infections. Individually, none of the diagnostic methods was 100% accurate in detecting subpatent infections, although serological methods were significantly more sensitive (97%) than either nested PCR (61–84%) or microscopy (27%). Circulating parasites in chronically infected birds either disappear completely from circulation or to drop to intensities below detectability by nested PCR. Thus, the use of PCR as a sole means of detection of circulating parasites may significantly underestimate true prevalence.

Molecular survey of Bartonella henselae and Bartonella clarridgeiae in pet cats across Japan by species-specific nested-PCR.

PubMed

Sato, S; Kabeya, H; Negishi, A; Tsujimoto, H; Nishigaki, K; Endo, Y; Maruyama, S

2017-10-01

Cats are known to be the main reservoir for Bartonella henselae and Bartonella clarridgeiae, which are the agents of 'cat-scratch disease' in humans. In the present study, we investigated the prevalence of the two Bartonella species on 1754 cat bloods collected from all prefectures in Japan during 2007-2008 by a nested-polymerase chain reaction (PCR) targeting the 16S-23S rRNA internal transcribed spacer region. Overall, Bartonella DNA was detected in 4·6% (80/1754) of the cats examined. The nested-PCR showed that 48·8% (39/80) of the positive cats were infected with B. henselae mono-infection, 33·8% (27/80) with B. clarridgeiae mono-infection and 17·5% (14/80) were infected with both species. The prevalence (5·9%; 65/1103) of Bartonella infection in the western part of Japan was significantly higher than that (2·3%; 15/651) of eastern Japan (P < 0·001). Statistical analysis of the cats examined suggested a significant association between Bartonella infection and FeLV infection (OR = 1·9; 95% CI = 1·1-3·4), but not with FIV infection (OR = 1·6; 95% CI = 1·0-2·6).

Evaluation of Different PCR-Based Assays and LAMP Method for Rapid Detection of Phytophthora infestans by Targeting the Ypt1 Gene

PubMed Central

Khan, Mehran; Li, Benjin; Jiang, Yue; Weng, Qiyong; Chen, Qinghe

2017-01-01

Late blight, caused by the oomycete Phytophthora infestans, is one of the most devastating diseases affecting potato and tomato worldwide. Early diagnosis of the P. infestans pathogen causing late blight should be the top priority for addressing disease epidemics and management. In this study, we performed a loop-mediated isothermal amplification (LAMP) assay, conventional polymerase chain reaction (PCR), nested PCR, and real-time PCR to verify and compare the sensitivity and specificity of the reaction based on the Ypt1 (Ras-related protein) gene of P. infestans. In comparison with the PCR-based assays, the LAMP technique led to higher specificity and sensitivity, using uncomplicated equipment with an equivalent time frame. All 43 P. infestans isolates, yielded positive detection results using LAMP assay showing no cross reaction with other Phytophthora spp., oomycetes or fungal pathogens. The LAMP assay yielded the lowest detectable DNA concentration (1.28 × 10-4 ng μL-1), being 10 times more sensitive than nested PCR (1.28 × 10-3 ng μL-1), 100 times more sensitive than real-time PCR (1.28 × 10-2 ng μL-1) and 103 times more sensitive than the conventional PCR assay (1.28 × 10-1 ng μL-1). In the field experiment, the LAMP assay outperformed the other tests by amplifying only diseased tissues (leaf and stem), and showing no positive reaction in healthy tissues. Overall, the LAMP assay developed in this study provides a specific, sensitive, simple, and effective visual method for detection of the P. infestans pathogen, and is therefore suitable for application in early prediction of the disease to reduce the risk of epidemics. PMID:29051751

Evaluation of Different PCR-Based Assays and LAMP Method for Rapid Detection of Phytophthora infestans by Targeting the Ypt1 Gene.

PubMed

Khan, Mehran; Li, Benjin; Jiang, Yue; Weng, Qiyong; Chen, Qinghe

2017-01-01

Late blight, caused by the oomycete Phytophthora infestans , is one of the most devastating diseases affecting potato and tomato worldwide. Early diagnosis of the P. infestans pathogen causing late blight should be the top priority for addressing disease epidemics and management. In this study, we performed a loop-mediated isothermal amplification (LAMP) assay, conventional polymerase chain reaction (PCR), nested PCR, and real-time PCR to verify and compare the sensitivity and specificity of the reaction based on the Ypt1 (Ras-related protein) gene of P. infestans. In comparison with the PCR-based assays, the LAMP technique led to higher specificity and sensitivity, using uncomplicated equipment with an equivalent time frame. All 43 P. infestans isolates, yielded positive detection results using LAMP assay showing no cross reaction with other Phytophthora spp., oomycetes or fungal pathogens. The LAMP assay yielded the lowest detectable DNA concentration (1.28 × 10 -4 ng μL -1 ), being 10 times more sensitive than nested PCR (1.28 × 10 -3 ng μL -1 ), 100 times more sensitive than real-time PCR (1.28 × 10 -2 ng μL -1 ) and 10 3 times more sensitive than the conventional PCR assay (1.28 × 10 -1 ng μL -1 ). In the field experiment, the LAMP assay outperformed the other tests by amplifying only diseased tissues (leaf and stem), and showing no positive reaction in healthy tissues. Overall, the LAMP assay developed in this study provides a specific, sensitive, simple, and effective visual method for detection of the P. infestans pathogen, and is therefore suitable for application in early prediction of the disease to reduce the risk of epidemics.

MHC Class I Chain-Related Gene A Polymorphisms and Linkage Disequilibrium with HLA-B and HLA-C Alleles in Ocular Toxoplasmosis.

PubMed

Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos

2015-01-01

This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05-4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22-0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population.

MHC Class I Chain-Related Gene A Polymorphisms and Linkage Disequilibrium with HLA-B and HLA-C Alleles in Ocular Toxoplasmosis

PubMed Central

Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos

2015-01-01

This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05–4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22–0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population. PMID:26672749

Real-time PCR assay in differentiating Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii infections in Orang Asli settlements in Malaysia.

PubMed

Lau, Yee Ling; Anthony, Claudia; Fakhrurrazi, Siti Aminah; Ibrahim, Jamaiah; Ithoi, Init; Mahmud, Rohela

2013-08-28

Amebiasis caused by Entamoeba histolytica is the third leading cause of death worldwide. This pathogenic amoeba is morphologically indistinguishable from E. dispar and E. moshkovskii, the non-pathogenic species. Polymerase chain reaction is the current method of choice approved by World Health Organization. Real-time PCR is another attractive molecular method for diagnosis of infectious diseases as post-PCR analyses are eliminated and turnaround times are shorter. The present work aimed to compare the results of Entamoeba species identification using the real-time assay against the established nested PCR method. In this study, a total of 334 human faecal samples were collected from different Orang Asli settlements. Faecal samples were processed by direct wet smear and formalin ethyl acetate concentration methods followed by iodine staining and was microscopically examined for Entamoeba species and other intestinal parasites. Microscopically positive samples were then subject to nested PCR and real-time PCR. The overall prevalence of Entamoeba infection was 19.5% (65/334). SK Posh Piah recorded highest Entamoeba prevalence (63.3%) while Kampung Kemensah had the lowest prevalence (3.7%) of Entamoeba. Microscopically positive samples were then tested by real-time PCR and nested PCR for the presence of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii infection. Real-time PCR showed higher Entamoeba detection (86.2%) compared to nested PCR (80%), although the McNemar test value showed no significant difference between the two methods (p = 0.221). This study is the first in Malaysia to report the use of real-time PCR in identifying and differentiating the three Entamoeba infections. It is also proven to be more effective compared to the conventional nested PCR molecular method.

Real-time PCR assay in differentiating Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii infections in Orang Asli settlements in Malaysia

PubMed Central

2013-01-01

Background Amebiasis caused by Entamoeba histolytica is the third leading cause of death worldwide. This pathogenic amoeba is morphologically indistinguishable from E. dispar and E. moshkovskii, the non-pathogenic species. Polymerase chain reaction is the current method of choice approved by World Health Organization. Real-time PCR is another attractive molecular method for diagnosis of infectious diseases as post-PCR analyses are eliminated and turnaround times are shorter. The present work aimed to compare the results of Entamoeba species identification using the real-time assay against the established nested PCR method. Methods In this study, a total of 334 human faecal samples were collected from different Orang Asli settlements. Faecal samples were processed by direct wet smear and formalin ethyl acetate concentration methods followed by iodine staining and was microscopically examined for Entamoeba species and other intestinal parasites. Microscopically positive samples were then subject to nested PCR and real-time PCR. Results The overall prevalence of Entamoeba infection was 19.5% (65/334). SK Posh Piah recorded highest Entamoeba prevalence (63.3%) while Kampung Kemensah had the lowest prevalence (3.7%) of Entamoeba. Microscopically positive samples were then tested by real-time PCR and nested PCR for the presence of Entamoeba histolytica, Entamoeba dispar, and Entamoeba moshkovskii infection. Real-time PCR showed higher Entamoeba detection (86.2%) compared to nested PCR (80%), although the McNemar test value showed no significant difference between the two methods (p = 0.221). Conclusions This study is the first in Malaysia to report the use of real-time PCR in identifying and differentiating the three Entamoeba infections. It is also proven to be more effective compared to the conventional nested PCR molecular method. PMID:23985047

First report of Toxoplasma gondii sporulated oocysts and Giardia duodenalis in commercial green-lipped mussels (Perna canaliculus) in New Zealand.

PubMed

Coupe, Alicia; Howe, Laryssa; Burrows, Elizabeth; Sine, Abigail; Pita, Anthony; Velathanthiri, Niluka; Vallée, Emilie; Hayman, David; Shapiro, Karen; Roe, Wendi D

2018-05-01

Pollution of marine ecosystems with the protozoan parasites Toxoplasma gondii, Cryptosporidium spp. and Giardia duodenalis can be studied using bivalve shellfish as biosentinels. Although evidence suggests that these parasites are present in New Zealand coastal waters, the extent of protozoal pollution has not been investigated. This study used optimised molecular methods to detect the presence of Cryptosporidium spp., G. duodenalis and T. gondii in commercially sourced green-lipped mussel (Perna canaliculus), an endemic species found throughout coastal New Zealand. A nested polymerase chain reaction was validated for detection of T. gondii DNA and applied to 104 commercially sourced mussels. Thirteen mussels were positive for T. gondii DNA with an estimated true prevalence of 16.4% using Bayesian statistics, and the presence of T. gondii in mussels was significantly associated with collection during the summer compared with that in the winter (P = 0.003). Consumption of contaminated shellfish may also pose a health risk for humans and marine wildlife. As only sporulated T. gondii oocysts can be infectious, a reverse transcriptase-polymerase chain reaction was used to confirm presence of a sporozoite-specific marker (SporoSAG), detected in four mussels. G. duodenalis assemblage B, known to be pathogenic in humans, was also discovered in 1% mussels, tested by polymerase chain reaction (n = 90). Cryptosporidium spp. was not detected in the sampled mussel haemolymph. Results suggest that New Zealand may have high levels of coastal contamination with T. gondii, particularly in summer months, and that naturally exposed mussels can ingest and retain sporulated oocysts, further establishing shellfish consumption as a health concern.

INCLUDING TRANSITION PROBABILITIES IN NEST SURVIVAL ESTIMATION: A MAYFIELD MARKOV CHAIN

EPA Science Inventory

This manuscript is primarily an exploration of the statistical properties of nest-survival estimates for terrestrial songbirds. The Mayfield formulation described herein should allow researchers to test for complicated effects of stressors on daily survival and overall success, i...

Classical Markov Chains: A Unifying Framework for Understanding Avian Reproductive Success

EPA Science Inventory

Traditional methods for monitoring and analysis of avian nesting success have several important shortcomings, including 1) inability to handle multiple classes of nest failure, and 2) inability to provide estimates of annual reproductive success (because birds can, and typically ...

Description of an oral Chagas disease outbreak in Venezuela, including a vertically transmitted case.

PubMed

Noya, Belkisyolé Alarcón de; Pérez-Chacón, Gladymar; Díaz-Bello, Zoraida; Dickson, Sonia; Muñoz-Calderón, Arturo; Hernández, Carlos; Pérez, Yadira; Mauriello, Luciano; Moronta, Eyleen

2017-08-01

We describe the eleventh major outbreak of foodborne Trypanosoma cruzi transmission in urban Venezuela, including evidence for vertical transmission from the index case to her fetus. After confirming fetal death at 24 weeks of gestation, pregnancy interruption was performed. On direct examination of the amniotic fluid, trypomastigotes were detected. T. cruzi specific-polymerase chain reaction (PCR) also proved positive when examining autopsied fetal organs. Finally, microscopic fetal heart examination revealed amastigote nests. Acute orally transmitted Chagas disease can be life threatening or even fatal for pregnant women and unborn fetuses owing to vertical transmission. There is therefore an urgent need to improve national epidemiologic control measures.

Herpes simplex virus type 2 recurrent meningitis (Mollaret's meningitis): a consideration for the recurrent pathogenesis.

PubMed

Sato, Rumi; Ayabe, Mitsuyoshi; Shoji, Hiroshi; Ichiyama, Takashi; Saito, Yumiko; Hondo, Ryo; Eizuru, Yoshito

2005-11-01

We report a 44-year-old Japanese woman with herpes simplex virus (HSV) type 2 recurrent meningitis (Mollaret's meningitis). The diagnosis was confirmed by nested polymerase chain reaction in her cerebrospinal fluid, but the patient's conventional HSV antibodies by complement fixation, neutralizing test or enzyme immunoassay showed low titres with low lymphoproliferative response. Several similar cases are discussed. Although the reason for the recurrent pathogenesis is uncertain, our report suggests that the low immune response including immune evasion may be involved in the pathogenesis of HSV type 2 recurrent meningitis. For this patient, long-term suppressive and patient-initiated therapies were conducted to prevent the recurrence of meningitis.

Desmoplastic small round cell tumor of the lung.

PubMed

Muramatsu, Takashi; Shimamura, Mie; Furuichi, Motohiko; Nishii, Tatsuhiko; Takeshita, Shinji; Shiono, Motomi

2010-12-01

We report a rare case of desmoplastic small round cell tumor, which arose from the left lung. A 25-year-old man was found to have an abnormal shadow during a routine physical examination and was admitted to our hospital. A thoracoscopic tumor biopsy was performed under general anesthesia. According to the histopathologic findings of permanent sections, the tumor was composed of sharply outlined nests, clusters, and trabeculae of small round to oval cells separated by a spindle-shaped desmoplastic stroma. A gene analysis revealed chimera genes of Ewing's sarcoma and Wilms' tumor by reverse transcription polymerase chain reaction. Copyright © 2010 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

Detection of Mycoplasma hyopneumoniae by polymerase chain reaction in swine presenting respiratory problems

PubMed Central

Yamaguti, M.; Muller, E.E.; Piffer, A.I.; Kich, J.D.; Klein, C.S.; Kuchiishi, S.S.

2008-01-01

Since Mycoplasma hyopneumoniae isolation in appropriate media is a difficult task and impractical for daily routine diagnostics, Nested-PCR (N-PCR) techniques are currently used to improve the direct diagnostic sensitivity of Swine Enzootic Pneumonia. In a first experiment, this paper describes a N-PCR technique optimization based on three variables: different sampling sites, sample transport media, and DNA extraction methods, using eight pigs. Based on the optimization results, a second experiment was conducted for testing validity using 40 animals. In conclusion, the obtained results of the N-PCR optimization and validation allow us to recommend this test as a routine monitoring diagnostic method for Mycoplasma hyopneumoniae infection in swine herds. PMID:24031248

A comparison between the efficiency of the Xpert MTB/RIF assay and nested PCR in identifying Mycobacterium tuberculosis during routine clinical practice.

PubMed

Kim, Cheol-Hong; Woo, Heungjeong; Hyun, In Gyu; Kim, Changhwan; Choi, Jeong-Hee; Jang, Seung-Hun; Park, Sang Myeon; Kim, Dong-Gyu; Lee, Myung Goo; Jung, Ki-Suck; Hyun, Jeongwon; Kim, Hyun Soo

2014-06-01

Polymerase chain reaction (PCR) for the detection of Mycobacterium tuberculosis (MTB) is more sensitive, specific, and rapid than the conventional methods of acid-fast bacilli (AFB) smear and culture. The aim of this study was to determine if the Xpert MTB/rifampicin (RIF) assay had additional advantages over nested PCR for the detection of MTB in a geographical area with intermediate tuberculosis (TB) incidence. Between February and December 2013, the Xpert MTB/RIF assay and MTB nested PCR, as well as AFB smear and culture, were simultaneously performed on 198 clinical samples (160 pulmonary and 38 non-pulmonary specimens) collected from 171 patients hospitalized at Hallym University Medical Center for possible TB. The accuracy of the diagnosis of MTB culture-positive TB and the turnaround time of reporting laboratory results were calculated and compared. Rifampin resistance by the Xpert MTB/RIF assay was reviewed with that of conventional drug susceptibility testing (DST). The sensitivity, specificity, and positive and negative predictive values of the Xpert MTB/RIF assay and MTB nested PCR for diagnosis of MTB culture-positive pulmonary TB were 86.1% vs. 69.4% (P=0.1563), 97.8% vs. 94.1% (P=0.2173), 91.2% vs. 75.8% (P=0.1695), and 96.4% vs. 92.0% (P=0.2032), respectively. The median turnaround times of the Xpert MTB/RIF assay and MTB nested PCR were 0 [0-4] days and 4 [1-11] days, respectively (P<0.001). Two cases of rifampin resistance, as determined by the Xpert MTB/RIF assay, were found to be multi-drug resistant (MDR) pulmonary TB by DST. The Xpert MTB/RIF assay seemed to be sensitive, specific, and comparable to nested PCR for identifying MTB among clinically suspected TB patients, and the assay can be valuable in giving a timely identification of resistance to rifampin.

A case series of possibly recrudescent Orientia tsutsugamushi infection presenting as pneumonia.

PubMed

Im, Jae-Hyoung; Baek, Ji Hyeon; Lee, Jin-Soo; Chung, Moon-Hyun; Lee, Sun Myoung; Kang, Jae-Seung

2014-01-01

Orientia tsutsugamushi remains latent in humans after scrub typhus. Pneumonia occurs as a complication of scrub typhus in the late-phase disease. However, pneumonia may also occur as a presenting manifestation of O. tsutsugamushi infection. We reviewed the cases of 3 patients with atypical pneumonia who presented at our hospital and were later confirmed to have O. tsutsugamushi infection by serology, nested polymerase chain reaction (PCR), and cell culture. All patients were young adults with no history of scrub typhus, and none claimed to have recently been exposed to areas where scrub typhus is endemic. Two cases occurred in non-outbreak seasons. Furthermore, eschar was not observed. Pneumonia was documented within 4 days after fever onset. The immunoglobulin (Ig) G antibody titers against O. tsutsugamushi were higher than the IgM titers, although the serologic test results were less helpful in the diagnosis. Nested PCR and cell culture of blood specimens confirmed the diagnosis of O. tsutsugamushi infection. These findings suggest that pneumonia can occur as a result of recrudescence of latent O. tsutsugamushi infection.

Detection of Legionella spp. by a nested-PCR assay in air samples of a wastewater treatment plant and downwind distances in Isfahan

PubMed Central

Mirzaee, Seyyed Abbas; Nikaeen, Mahnaz; Hajizadeh, Yaghob; Nabavi, BiBi Fatemeh; Hassanzadeh, Akbar

2015-01-01

Background: Wastewater contains a variety of pathogens and bio -aerosols generated during the wastewater treatment process, which could be a potential health risk for exposed individuals. This study was carried out to detect Legionella spp. in the bio -aerosols generated from different processes of a wastewater treatment plant (WWTP) in Isfahan, Iran, and the downwind distances. Materials and Methods: A total of 54 air samples were collected and analyzed for the presence of Legionella spp. by a nested- polymerase chain reaction (PCR) assay. A liquid impingement biosampler was used to capture bio -aerosols. The weather conditions were also recorded. Results: Legionella were detected in 6% of the samples, including air samples above the aeration tank (1/9), belt filter press (1/9), and 250 m downwind (1/9). Conclusion: The result of this study revealed the presence of Legionella spp. in air samples of a WWTP and downwind distance, which consequently represent a potential health risk to the exposed individuals. PMID:25802817

[Molecular cloning and expression of the severe acute respiratory syndrome-associated coronavirus nucleocapsid protein and its clinical application].

PubMed

Lu, Jian; Zhou, Bai-ping; Zhou, Yu-sen; Jiang, Xiao-ling; Wen, Li-xia; Le, Xiao-hua; Li, Bing; Xu, Liu-mei; Li, Li-xiong

2005-03-01

To clone and express nucleocapsid (N) protein of the severe acute respiratory syndrome (SARS)-associated coronavirus, and to evaluate its antigenicity and application value in the development of serological diagnostic test for SARS. SARS-associated coronavirus N protein gene was amplified from its genomic RNA by reverse transcript nested polymerase chain reaction (RT-nested-PCR) and cloned into pBAD/Thio-TOPO prokaryotic expression vector. The recombinant N fusion protein was expressed and purified, and its antigenicity and specificity was analyzed by Western Blot, to establish the recombinant N protein-based ELISA for detection of IgG antibodies to SARS-associated coronavirus, and SARS-associated coronavirus lysates-based ELISA was compared parallelly. The recombinant expression vector produced high level of the N fusion protein after induction, and that protein was purified successfully by affinity chromatography and displayed higher antigenicity and specificity as compared with whole virus lysates. The recombinant SARS-associated coronavirus N protein possessed better antigenicity and specificity and could be employed to establish a new, sensitive, and specific ELISA for SARS diagnosis.

Quantifying the effects of pesticide exposure on annual reproductive success of birds (presentation)

EPA Science Inventory

The Markov chain nest productivity model (MCnest) was developed for quantifying the effects of specific pesticide‐use scenarios on the annual reproductive success of simulated populations of birds. Each nesting attempt is divided into a series of discrete phases (e.g., egg ...

Quantifying the effects of pesticide exposure on annual reproductive success of birds

EPA Science Inventory

The Markov chain nest productivity model (MCnest) was developed for quantifying the effects of specific pesticide-use scenarios on the annual reproductive success of simulated populations of birds. Each nesting attempt is divided into a series of discrete phases (e.g., egg layin...

Detection of feline coronavirus in cheetah (Acinonyx jubatus) feces by reverse transcription-nested polymerase chain reaction in cheetahs with variable frequency of viral shedding.

PubMed

Gaffney, Patricia M; Kennedy, Melissa; Terio, Karen; Gardner, Ian; Lothamer, Chad; Coleman, Kathleen; Munson, Linda

2012-12-01

Cheetahs (Acinonyx jubatus) are a highly threatened species because of habitat loss, human conflict, and high prevalence of disease in captivity. An epidemic of feline infectious peritonitis and concern for spread of infectious disease resulted in decreased movement of cheetahs between U.S. zoological facilities for managed captive breeding. Identifying the true feline coronavirus (FCoV) infection status of cheetahs is challenging because of inconsistent correlation between seropositivity and fecal viral shedding. Because the pattern of fecal shedding of FCoV is unknown in cheetahs, this study aimed to assess the frequency of detectable fecal viral shedding in a 30-day period and to determine the most efficient fecal sampling strategy to identify cheetahs shedding FCoV. Fecal samples were collected from 16 cheetahs housed at seven zoological facilities for 30 to 46 consecutive days; the samples were evaluated for the presence of FCoV by reverse transcription-nested polymerase chain reaction (RT-nPCR). Forty-four percent (7/16) of cheetahs had detectable FCoV in feces, and the proportion of positive samples for individual animals ranged from 13 to 93%. Cheetahs shed virus persistently, intermittently, or rarely over 30-46 days. Fecal RT-nPCR results were used to calculate the probability of correctly identifying a cheetah known to shed virus given multiple hypothetical fecal collection schedules. The most efficient hypothetical fecal sample collection schedule was evaluation of five individual consecutive fecal samples, resulting in a 90% probability of identifying a known shedder. Demographic and management risk factors were not significantly associated (P < or = 0.05) with fecal viral shedding. Because some cheetahs shed virus intermittently to rarely, fecal sampling schedules meant to identify all known shedders would be impractical with current tests and eradication of virus from the population unreasonable. Managing the captive population as endemically infected with FCoV may be a more feasible approach.

Real-time polymerase chain reaction assay for the rapid detection and characterization of chloroquine-resistant Plasmodium falciparum malaria in returned travelers.

PubMed

Farcas, Gabriella A; Soeller, Rainer; Zhong, Kathleen; Zahirieh, Alireza; Kain, Kevin C

2006-03-01

Imported drug-resistant malaria is a growing problem in industrialized countries. Rapid and accurate diagnosis is essential to prevent malaria-associated mortality in returned travelers. However, outside of a limited number of specialized centers, the microscopic diagnosis of malaria is slow, unreliable, and provides little information about drug resistance. Molecular diagnostics have the potential to overcome these limitations. We developed and evaluated a rapid, real-time polymerase chain reaction (PCR) assay to detect Plasmodium falciparum malaria and chloroquine (CQ)-resistance determinants in returned travelers who are febrile. A real-time PCR assay based on detection of the K76T mutation in PfCRT (K76T) of P. falciparum was developed on a LightCycler platform (Roche). The performance characteristics of the real-time assay were compared with those of the nested PCR-restriction fragment-length polymorphism (RFLP) and the sequence analyses of samples obtained from 200 febrile returned travelers, who included 125 infected with P. falciparum (48 of whom were infected CQ-susceptible [K76] and 77 of whom were CQ-resistant [T76] P. falciparum), 22 infected with Plasmodium vivax, 10 infected with Plasmodium ovale, 3 infected with Plasmodium malariae malaria, and 40 infected with other febrile syndromes. All patient samples were coded, and all analyses were performed blindly. The real-time PCR assay detected multiple pfcrt haplotypes associated with CQ resistance in geographically diverse malaria isolates acquired by travelers. Compared with nested-PCR RFLP (the reference standard), the real-time assay was 100% sensitive and 96.2% specific for detection of the P. falciparum K76T mutation. This assay is rapid, sensitive, and specific for the detection and characterization of CQ-resistant P. falciparum malaria in returned travelers. This assay is automated, standardized, and suitable for routine use in clinical diagnostic laboratories.

Detection and clearance of prostate cells subsequent to ultrasound-guided needle biopsy as determined by multiplex nested reverse transcription polymerase chain reaction assay.

PubMed

Price, D K; Clontz, D R; Woodard, W L; Kaufman, J S; Daniels, J M; Stolzenberg, S J; Teigland, C M

1998-08-01

To determine if circulating prostate cells are detectable subsequent to transrectal ultrasound (TRUS)-guided biopsy, and if so, whether cells remain in circulation for up to 4 weeks. Blood samples were drawn from 90 patients with elevated serum prostate-specific antigen (PSA) levels and/or abnormal digital rectal examination. Two samples were drawn from all patients immediately prior to TRUS and 30 minutes postbiopsy. Blood samples were also obtained 1 week postbiopsy from 83 patients, and 1 month postbiopsy from 61 patients. Multiplex nested reverse transcription polymerase chain reaction assay (RT-PCR) for PSA and prostate-specific membrane antigen (PSM) was performed on total ribonucleic acid (RNA) from each sample. Results were reported as positive if at least one of the targets was detected. Of 45 patients with biopsy-proven adenocarcinoma, 22 were RT-PCR positive prebiopsy and all remained positive 30 minutes postbiopsy. Of 23 patients with adenocarcinoma who were RT-PCR negative prebiopsy, 5 (22%) converted to positive 30 minutes postbiopsy (P < 0.001). Four of these 5 patients returned to negative after 1 week or 1 month. Of 45 patients without cancer at biopsy, 32 were RT-PCR negative prebiopsy and 6 (19%) converted to positive 30 minutes postbiopsy (P < 0.001). Although four of six available samples were still positive at 1 week, all four samples available 1 month postbiopsy were negative. Detection of circulating prostate cells subsequent to biopsy occurred in 11 of 55 (20%) previously RT-PCR negative patients, a proportion twice that reported in the literature. We attribute this higher proportion to the simultaneous detection of PSA and PSM mRNA in our multiplex assay. Conversion rates were similar in patients regardless of biopsy result. Testing of serial postbiopsy blood demonstrates clearing of these cells by 4 weeks in most patients.

Detection of Natural Toxoplasma gondii Infection in Chicken in Thika Region of Kenya Using Nested Polymerase Chain Reaction

PubMed Central

Karanja, Simon Muturi; Ngotho, Maina; Kamau, David Muchina; Njuguna, Adele Nyambura

2016-01-01

The detection of Toxoplasma gondii in free-range chickens is a good indicator of possible risk to human beings. The aim of this study was to investigate the occurrence of T. gondii in free-range chicken using polymerase chain reaction (PCR). Brain samples from 105 free-range chickens from three administrative areas in Thika region, Kenya, were collected, DNA-extracted, and analyzed using PCR to detect presence of T. gondii. The overall prevalence of T. gondii in all the three areas was 79.0% (95% CI: 70.0–86.4%) and the prevalence across the three areas was not significantly different (P = 0.5088; χ 2 = 1.354). Female chickens had higher (79.4%) prevalence than males (78.6%), although the difference was not significant (P = 0.922, χ 2 = 0.01). However, chickens that were more than 2 years old had significantly (P = 0.003; χ 2 = 11.87) higher prevalence compared to younger ones. The study indicates that there was a high occurrence of T. gondii infection in free-range chickens from Thika region and that the infection rate is age dependent. Further studies should be carried out to determine the possible role of roaming chickens in the epidemiology of the disease among humans in the area. PMID:27981052

Variability in assays used for detection of lentiviral infection in bobcats (Lynx rufus), pumas (Puma concolor), and ocelots (Leopardus pardalis)

USGS Publications Warehouse

Franklin, S.P.; Troyer, J.L.; TerWee, J.A.; Lyren, L.M.; Kays, R.W.; Riley, S.P.D.; Boyce, W.M.; Crooks, K.R.; VandeWoude, S.

2007-01-01

Although lentiviruses similar to feline immunodeficiency virus (FIV) are known to infect numerous felid species, the relative utility of assays used for detecting lentiviral infection has not been compared for many of these hosts. We tested bobcats (Lynx rufus), pumas (Felis concolor), and ocelots (Leopardus pardalis) for exposure to lentivirus using five different assays: puma lentivirus (PLV), African lion lentivirus (LLV), and domestic cat FIV-based immunoblots, a commercially available enzyme-linked immunosorbent assay (ELISA) kit, and nested polymerase chain reaction (PCR). Puma lentivirus immunoblots identified more seropositive individuals than the other antibody-detection assays. The commercial ELISA provided a fair ability to recognize seropositive samples when compared with PLV immunoblot for screening bobcats and ocelots, but not pumas. Polymerase chain reaction identified fewer positive samples than PLV immunoblot for all three species. Immunoblot results were equivalent whether the sample tested was serum, plasma, or whole blood. The results from this study and previous investigations suggest that the PLV immunoblot has the greatest ability to detect reactive samples when screening wild felids of North America and is unlikely to produce false positive results. However, the commercial ELISA kit may provide ap adequate alternative for screening of some species and is more easily adapted to field conditions. ?? Wildlife Disease Association 2007.

Evidence of West Nile virus infection in Nepal.

PubMed

Rutvisuttinunt, Wiriya; Chinnawirotpisan, Piyawan; Klungthong, Chonticha; Shrestha, Sanjaya Kumar; Thapa, Amod Bahadur; Pant, Arjun; Yingst, Samuel L; Yoon, In-Kyu; Fernandez, Stefan; Pavlin, Julie A

2014-11-27

Acute febrile illness is common among those seeking medical care and is frequently treated empirically with the underlying illness remaining undiagnosed in resource-poor countries. A febrile illness study was conducted 2009-2010 to identify known and unknown pathogens circulating in Nepal. Study methods included diagnostic testing and preliminary ELISA screening of acute and convalescent samples for diseases both known and unknown to be circulating in Nepal, including West Nile virus (WNV). The molecular assays including Polymerase Chain Reaction (PCR), Sanger sequencing and ultra deep sequencing on MiSeq Illumina Platform were conducted to further confirm the presence of WNV. The study enrolled 2,046 patients presenting undifferentiated febrile illness with unknown etiology. Sera from 14 out of 2,046 patients were tested positive for west nile virus (WNV) by nested Reverse Transcription-Polymerase Chain Reaction (RT-PCR). Only two out of 14 cases were confirmed for the presence of WNV by sequencing and identified as WNV lineage 1 phylogentically. The two patients were adult males with fever and no neurological symptoms from Kathmandu and Bharatpur, Nepal. Two out of 2,046 serum samples contained fragments of WNV genome resembling WNV lineage 1, which is evidence of the continued spread of WNV which should be considered a possible illness cause in Nepal.

Detection of Natural Toxoplasma gondii Infection in Chicken in Thika Region of Kenya Using Nested Polymerase Chain Reaction.

PubMed

Mose, John Mokua; Kagira, John Maina; Karanja, Simon Muturi; Ngotho, Maina; Kamau, David Muchina; Njuguna, Adele Nyambura; Maina, Naomi Wangari

2016-01-01

The detection of Toxoplasma gondii in free-range chickens is a good indicator of possible risk to human beings. The aim of this study was to investigate the occurrence of T. gondii in free-range chicken using polymerase chain reaction (PCR). Brain samples from 105 free-range chickens from three administrative areas in Thika region, Kenya, were collected, DNA-extracted, and analyzed using PCR to detect presence of T. gondii . The overall prevalence of T. gondii in all the three areas was 79.0% (95% CI: 70.0-86.4%) and the prevalence across the three areas was not significantly different ( P = 0.5088; χ 2 = 1.354). Female chickens had higher (79.4%) prevalence than males (78.6%), although the difference was not significant ( P = 0.922, χ 2 = 0.01). However, chickens that were more than 2 years old had significantly ( P = 0.003; χ 2 = 11.87) higher prevalence compared to younger ones. The study indicates that there was a high occurrence of T. gondii infection in free-range chickens from Thika region and that the infection rate is age dependent. Further studies should be carried out to determine the possible role of roaming chickens in the epidemiology of the disease among humans in the area.

Detection of Giardia intestinalis in water samples collected from natural water reservoirs and wells in northern and north-eastern Poland using LAMP, real-time PCR and nested PCR.

PubMed

Lass, Anna; Szostakowska, Beata; Korzeniewski, Krzysztof; Karanis, Panagiotis

2017-10-01

Giardia intestinalis is a protozoan parasite, transmitted to humans and animals by the faecal-oral route, mainly through contaminated water and food. Knowledge about the distribution of this parasite in surface water in Poland is fragmentary and incomplete. Accordingly, 36 environmental water samples taken from surface water reservoirs and wells were collected in Pomerania and Warmia-Masuria provinces, Poland. The 50 L samples were filtered and subsequently analysed with three molecular detection methods: loop-mediated isothermal amplification (LAMP), real-time polymerase chain reaction (real-time PCR) and nested PCR. Of the samples examined, Giardia DNA was found in 15 (42%) samples with the use of LAMP; in 12 (33%) of these samples, Giardia DNA from this parasite was also detected using real-time PCR; and in 9 (25%) using nested PCR. Sequencing of selected positive samples confirmed that the PCR products were fragments of the Giardia intestinalis small subunit rRNA gene. Genotyping using multiplex real-time PCR indicated the presence of assemblages A and B, with the latter predominating. The results indicate that surface water in Poland, as well as water taken from surface wells, may be a source of Giardia strains which are potentially pathogenic for humans. It was also demonstrated that LAMP assay is more sensitive than the other two molecular assays.

Clinical Evaluation of a Loop-Mediated Amplification Kit for Diagnosis of Imported Malaria

PubMed Central

Polley, Spencer D.; González, Iveth J.; Mohamed, Deqa; Daly, Rosemarie; Bowers, Kathy; Watson, Julie; Mewse, Emma; Armstrong, Margaret; Gray, Christen; Perkins, Mark D.; Bell, David; Kanda, Hidetoshi; Tomita, Norihiro; Kubota, Yutaka; Mori, Yasuyoshi; Chiodini, Peter L.; Sutherland, Colin J.

2013-01-01

Background. Diagnosis of malaria relies on parasite detection by microscopy or antigen detection; both fail to detect low-density infections. New tests providing rapid, sensitive diagnosis with minimal need for training would enhance both malaria diagnosis and malaria control activities. We determined the diagnostic accuracy of a new loop-mediated amplification (LAMP) kit in febrile returned travelers. Methods. The kit was evaluated in sequential blood samples from returned travelers sent for pathogen testing to a specialist parasitology laboratory. Microscopy was performed, and then malaria LAMP was performed using Plasmodium genus and Plasmodium falciparum–specific tests in parallel. Nested polymerase chain reaction (PCR) was performed on all samples as the reference standard. Primary outcome measures for diagnostic accuracy were sensitivity and specificity of LAMP results, compared with those of nested PCR. Results. A total of 705 samples were tested in the primary analysis. Sensitivity and specificity were 98.4% and 98.1%, respectively, for the LAMP P. falciparum primers and 97.0% and 99.2%, respectively, for the Plasmodium genus primers. Post hoc repeat PCR analysis of all 15 tests with discrepant results resolved 4 results in favor of LAMP, suggesting that the primary analysis had underestimated diagnostic accuracy. Conclusions. Malaria LAMP had a diagnostic accuracy similar to that of nested PCR, with a greatly reduced time to result, and was superior to expert microscopy. PMID:23633403

OPTIMIZING OBSERVER EFFORT FOR FIELD DETECTION OF REPRODUCTIVE EFFECTS IN BIRDS

EPA Science Inventory

Avian nest survival is best viewed as a Markov process with two absorbing states, death and fledging. We present a column-stochastic Markov chain from which all major Mayfield formulations of daily nest-survival can be derived contingent upon the degree of observer knowledge of e...

Molecular detection of various rickettsiae in mites (acari: trombiculidae) in southern Jeolla Province, Korea.

PubMed

Choi, Yeon-Joo; Lee, Eun-Mi; Park, Jin-Mi; Lee, Kyung-Min; Han, Seung-Hoon; Kim, Jae-Kwon; Lee, Seung-Hyun; Song, Hyeon-Je; Choi, Myung-Sik; Kim, Ik-Sang; Park, Kyung-Hee; Jang, Won-Jong

2007-01-01

This study revealed the presence of various rickettsial agents in mites from wild rodents collected in Southern Jeolla Province, Korea, by nested polymerase chain reaction (PCR) and sequence analysis of a partial citrate synthase and rickettsia outer membrane protein B genes. Rickettsial agents closely related to the Rickettsia species TwKM02, R. australis, and the Rickettsia species Cf15 were successfully identified in this study, for the first time in Korea, and R. japonica, R. akari, R. conorii, R. felis, and R. typhi were also detected, as previously described. The data presented in this paper extend knowledge on the geographic distribution of SFG rickettsiae in eastern Asia and it may necessary to consider the role of mites in rickettsial transmission.

Investigation of latent infections caused by cyprinid herpesvirus 3 in koi ( Cyprinus carpio) in southern China.

PubMed

Zheng, Shucheng; Wang, Qing; Bergmann, Sven M; Li, Yingying; Zeng, Weiwei; Wang, Yingying; Liu, Chun; Shi, Cunbin

2017-05-01

Although herpesviruses such as cyprinid herpesvirus 3 (CyHV-3) can establish lifelong latent infections, little is known about latency conditions in farmed koi populations in China. We used nested polymerase chain reaction targeting the TK gene and an indirect antibody ELISA to screen asymptomatic fish obtained from southern China for evidence of CyHV-3 infection. CyHV-3 DNA could be detected either in peripheral blood leukocytes or from gills of asymptomatic koi. Most koi sera did not contain anti-CyHV-3 antibodies; however, 5 samples were ELISA positive, providing evidence of prior CyHV-3 infections. These findings suggest that koi may survive CyHV-3 infections and become virus carriers.

Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis).

PubMed

Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret

2003-12-01

A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

Rapid and sensitive detection of Feline immunodeficiency virus using an insulated isothermal PCR-based assay with a point-of-need PCR detection platform.

PubMed

Wilkes, Rebecca Penrose; Kania, Stephen A; Tsai, Yun-Long; Lee, Pei-Yu Alison; Chang, Hsiu-Hui; Ma, Li-Juan; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2015-07-01

Feline immunodeficiency virus (FIV) is an important infectious agent of cats. Clinical syndromes resulting from FIV infection include immunodeficiency, opportunistic infections, and neoplasia. In our study, a 5' long terminal repeat/gag region-based reverse transcription insulated isothermal polymerase chain reaction (RT-iiPCR) was developed to amplify all known FIV strains to facilitate point-of-need FIV diagnosis. The RT-iiPCR method was applied in a point-of-need PCR detection platform--a field-deployable device capable of generating automatically interpreted RT-iiPCR results from nucleic acids within 1 hr. Limit of detection 95% of FIV RT-iiPCR was calculated to be 95 copies standard in vitro transcription RNA per reaction. Endpoint dilution studies with serial dilutions of an ATCC FIV type strain showed that the sensitivity of lyophilized FIV RT-iiPCR reagent was comparable to that of a reference nested PCR. The established reaction did not amplify any nontargeted feline pathogens, including Felid herpesvirus 1, feline coronavirus, Feline calicivirus, Feline leukemia virus, Mycoplasma haemofelis, and Chlamydophila felis. Based on analysis of 76 clinical samples (including blood and bone marrow) with the FIV RT-iiPCR, test sensitivity was 97.78% (44/45), specificity was 100.00% (31/31), and agreement was 98.65% (75/76), determined against a reference nested-PCR assay. A kappa value of 0.97 indicated excellent correlation between these 2 methods. The lyophilized FIV RT-iiPCR reagent, deployed on a user-friendly portable device, has potential utility for rapid and easy point-of-need detection of FIV in cats. © 2015 The Author(s).

Markov Chain Estimation of Avian Seasonal Fecundity

EPA Science Inventory

To explore the consequences of modeling decisions on inference about avian seasonal fecundity we generalize previous Markov chain (MC) models of avian nest success to formulate two different MC models of avian seasonal fecundity that represent two different ways to model renestin...

Prevalence of equine herpesvirus-1 and equine herpesvirus-4 infections in equidae species in Turkey as determined by ELISA and multiplex nested PCR.

PubMed

Ataseven, Veysel S; Dağalp, Seval B; Güzel, Murat; Başaran, Zeynep; Tan, Mehmet T; Geraghty, Bob

2009-04-01

In this report we examined the presence of specific antibodies against equine herpesvirus type 1 (EHV-1), and equine herpesvirus type 4 (EHV-4) in several equidae, including mules, donkeys, horses. The presence of EHV-1 and EHV-4 in respiratory diseases of equids, and ability of multiplex nested polymerase chain reaction (PCR) screening in simultaneous diagnosis of horses acutely infected by EHV-1 and EHV-4 were also investigated. Sera from 504 horses, mules and donkeys sampled were tested for the presence of EHV-1 and EHV-4 specific antibodies. Blood samples taken from 21 symptomatic horses and nasal swabs taken from 40 symptomatic horses were tested for the presence of EHV-1 and EHV-4 by a multiplex nested PCR. A total of 14.3% (3/21) of buffy coat samples and 32.5% (13/40) nasal swab samples were found to contain EHV-1 DNA, while 19% (4/21) buffy coat samples and 22.5% (9/40) nasal swab samples were found to be positive for EHV-4 DNA. By species, 14.5% of horses, 37.2% of mules and 24.2% of donkeys tested were EHV-1 seropositive. EHV-4 specific antibodies were detected in 237 (81.7%) of 290 horse sera tested. Results from this investigation demonstrate that EHV-1 and EHV-4 are prevalent throughout the equid population, and that donkeys and mules might also represent an important source of infection for other equids. We also showed that the multiplex nested PCR assay might be useful for diagnosis of mixed respiratory infections in horses due to EHV-1 and EHV-4.

Improvement of DGGE analysis by modifications of PCR protocols for analysis of microbial community members with low abundance.

PubMed

Wang, Yong-Feng; Zhang, Fang-Qiu; Gu, Ji-Dong

2014-06-01

Denaturing gradient gel electrophoresis (DGGE) is a powerful technique to reveal the community structures and composition of microorganisms in complex natural environments and samples. However, positive and reproducible polymerase chain reaction (PCR) products, which are difficult to acquire for some specific samples due to low abundance of the target microorganisms, significantly impair the effective applications of DGGE. Thus, nested PCR is often introduced to generate positive PCR products from the complex samples, but one problem is also introduced: The total number of thermocycling in nested PCR is usually unacceptably high, which results in skewed community structures by generation of random or mismatched PCR products on the DGGE gel, and this was demonstrated in this study. Furthermore, nested PCR could not resolve the uneven representative issue with PCR products of complex samples with unequal richness of microbial population. In order to solve the two problems in nested PCR, the general protocol was modified and improved in this study. Firstly, a general PCR procedure was used to amplify the target genes with the PCR primers without any guanine cytosine (GC) clamp, and then, the resultant PCR products were purified and diluted to 0.01 μg ml(-1). Subsequently, the diluted PCR products were utilized as templates to amplify again with the same PCR primers with the GC clamp for 17 cycles, and the products were finally subjected to DGGE analysis. We demonstrated that this is a much more reliable approach to obtain a high quality DGGE profile with high reproducibility. Thus, we recommend the adoption of this improved protocol in analyzing microorganisms of low abundance in complex samples when applying the DGGE fingerprinting technique to avoid biased results.

Quantification of periodontal pathogens in vascular, blood, and subgingival samples from patients with peripheral arterial disease or abdominal aortic aneurysms.

PubMed

Figuero, Elena; Lindahl, Christeel; Marín, María José; Renvert, Stefan; Herrera, David; Ohlsson, Ola; Wetterling, Thomas; Sanz, Mariano

2014-09-01

The aim of this investigation is to quantify periodontal pathogens (Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Campylobacter rectus, and Tannerella forsythia) in vascular, blood, and subgingival samples. As a secondary objective, two molecular bacterial identification methods (nested polymerase chain reaction [PCR] and quantitative PCR [qPCR]) are compared. Seventy consecutive patients provided a vascular lesion, a blood sample, and 36 subgingival samples. Bacterial DNA was extracted, and qPCR was used to determine the prevalence and amounts of the target pathogens in each sample. Nested PCR was performed only in the samples from vascular lesions. Periodontal examination was performed in 42 patients. Mann-Whitney U or χ(2) tests were used to compare microbiologic results according to periodontal diagnosis. All targeted periodontal pathogens (A. actinomycetemcomitans, P. gingivalis, T. forsythia, or C. rectus) were detected in subgingival samples, with a prevalence rate of 72.2%, 47.2%, 74.3%, and 82.9%, respectively. In 7.1% and 11.4% of vascular and blood samples, bacterial DNA was detected. One patient was positive for A. actinomycetemcomitans in the three types of samples. No differences were found in the levels of targeted bacteria when comparing patients with and without periodontitis. Prevalence rates obtained with nested PCR were significantly higher than those obtained with qPCR. The presence of A. actinomycetemcomitans was demonstrated in vascular, blood, and subgingival samples in one of 36 patients. These results, although with a very low frequency, may support the hypothesis of a translocation of periodontal pathogens from subgingival microbiota to the bloodstream and then to atheromatous plaques in carotid or other peripheral arteries. Nested PCR is not an adequate method for identifying DNA of periodontal pathogens in low quantities because of the high number of false-negative results.

Urine-Based Nested PCR for the Diagnosis of Mycobacterium tuberculosis: A Comparative Study Between HIV-Positive and HIV-Negative Patients.

PubMed

Jamshidi Makiani, Mahin; Davoodian, Parivash; Baghershiroodi, Mahnaz; Nejatizadeh, Abdol Azim; Fakkhar, Farideh; Zangeneh, Mehrangiz; Jahangiri, Nadia

2016-08-01

While tuberculosis (TB) can be diagnosed by microscopy and culture, the sensitivity of Ziehl-Neelsen staining is variable and culture results require 4 - 8 weeks to be determined. Polymerase chain reaction (PCR) and its modifications, including nested PCR, might be promising methods for the rapid diagnosis of TB. This study aimed to evaluate the performance of nested PCR on urine samples of human immunodeficiency virus (HIV)-positive and -negative patients with different manifestations of clinical TB. In a prospective study, three early-morning urine samples from 100 patients with pulmonary TB (PTB) or extrapulmonary TB (EPTB) were evaluated using a molecular target with insertion element IS6110, specific to the Mycobacterium tuberculosis genome, and nested PCR was performed. The results were analyzed with SPSS version 22. A total of 100 patients, including 74 (74%) with PTB and 26 (26%) with EPTB, were enrolled. Positive smears were seen in 38 patients (38%). Lymph nodes were the most commonly involved organ in 14 of the 26 (53.8%) EPTB patients (13.5%). Seven (23.1%) of the EPTB patients were HIV-positive. Urine PCR was positive in only 28 patients (28%). Seven HIV-positive patients with PTB showed positive urine PCR results. Moreover, PCR results were positive in only one of the seven HIV-positive subjects with EPTB. Positive PCR results were found in 20 of the 73 HIV-negative patients (27.4%) and in 8 of the 27 HIV-positive patients (29.6%). Therefore, there was no significant difference between the HIV-negative and HIV-positive patients for urine PCR (sensitivity 29.6%, specificity 72.6%; positive and negative predictive values 28% and 72%, respectively; P = 0.138). Nested PCR showed the same sensitivity in HIV-positive and HIV-negative patients. It can be applied as a rapid technique for the diagnosis of TB.

Coagulation of linear carbon molecules into nanoparticles: a molecular dynamics study

NASA Astrophysics Data System (ADS)

Yamaguchi, Yasutaka; Wakabayashi, Tomonari

2004-04-01

Using molecular dynamics (MD) simulations, the coagulation of carbon chain molecules that occurs on the subliming surface of a carbon-containing rare-gas matrix is investigated. Intermolecular connections with dangling bonds enhance the sublimation of the matrix and that results in the emission of a layer of nested carbon chains into vacuum at a velocity about 100 m/s. The following conversion from carbon sp- to more stable sp 2-type bonds heats up the carbon material above 3000 K. During this process, the nested carbon layer self-anneals via a graphitic mono-layer into a conjunct array of particles with a dimension about 10 nm.

The development of loop-mediated isothermal amplification targeting alpha-tubulin DNA for the rapid detection of Plasmodium vivax.

PubMed

Dinzouna-Boutamba, Sylvatrie-Danne; Yang, Hye-Won; Joo, So-Young; Jeong, Sookwan; Na, Byoung-Kuk; Inoue, Noboru; Lee, Won-Ki; Kong, Hyun-Hee; Chung, Dong-Il; Goo, Youn-Kyoung; Hong, Yeonchul

2014-06-30

Malaria that is caused by Plasmodium vivax is the most widely distributed human malaria. Its recent resurgence in many parts of the world, including the Republic of Korea (ROK), emphasizes the importance of improved access to the early and accurate detection of P. vivax to reduce disease burden. In this study, a rapid and efficient loop-mediated isothermal amplification (LAMP)-based method was developed and validated using blood samples from malaria-suspected patients. A LAMP assay targeting the α-tubulin gene for the detection of P. vivax was developed with six primers that recognize different regions of the target gene. The diagnostic performance of the α-tubulin LAMP assay was compared to three other tests: microscopic examinations, rapid diagnostic tests (RDTs), and nested polymerase chain reactions (PCRs) using 177 whole blood specimens obtained from ROK military personnel from May to December 2011. The α-tubulin LAMP assay was highly sensitive with a detection limit of 100 copies of P. vivax α-tubulin gene per reaction within 50 min. It specifically amplified the target gene only from P. vivax. Validation of the α-tubulin LAMP assay showed that the assay had the highest sensitivity (P < 0.001 versus microscopy; P = 0.0023 versus RDT) when nested PCR was used as the gold standard and better agreement (concordance: 94.9%, kappa value: 0.865) with nested PCR than RDT and microscopy. A Receiver Operation Characteristics analysis showed that the diagnostic accuracy of the α-tubulin LAMP assay for vivax malaria was higher (Area Under Curve = 0.908) than RDT and microscopy. This study showed that the P. vivax α-tubulin LAMP assay, which can be used to diagnose early infections of vivax malaria, is an alternative molecular diagnostic tool and a point-of-care test that may help to prevent transmission in endemic areas.

Application of loop-mediated isothermal amplification for malaria diagnosis during a follow-up study in São Tomé.

PubMed

Lee, Pei-Wen; Ji, Dar-Der; Liu, Chia-Tai; Rampao, Herodes S; do Rosario, Virgilio E; Lin, I-Feng; Shaio, Men-Fang

2012-12-06

A reliable and simple test for the detection of malaria parasite is crucial in providing effective treatment and therapeutic follow-up, especially in malaria elimination programmes. A comparison of four methods, including nested polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) were used for the malaria diagnosis and treatment follow-up in São Tomé and Príncipe, during a successful pre-elimination campaign. During the period September to November 2009, blood samples from 128 children (five to 14 years old) with temperature ≥38°C (tympanic) in the District of Agua Grande were examined using four different methods, i.e., histidine-rich protein 2 (HRP-2) based rapid diagnostic tests (HRP-2-RDTs), optical microscopy, nested PCR, and LAMP. First-line treatment with artesunate-amodiaquine was given for uncomplicated malaria and intravenous quinine was given for complicated malaria. Children with persistent positivity for malaria by microscopy, or either by nested PCR, or by LAMP on day 7 were given second-line treatment with artemether-lumefantrine. Treatment follow-up was made weekly, for up to four weeks. On day 0, positive results for HRP-2-RDTs, microscopy, nested PCR, and LAMP, were 68(53%), 47(37%), 64(50%), and 65(51%), respectively. When nested PCR was used as a reference standard, only LAMP was comparable; both HRP-2-RDTs and microscopy had moderate sensitivity; HRP-2-RDTs had poor positive predictive value (PPV) and a moderate negative predictive value (NPV) for the treatment follow-up. Seventy-one children with uncomplicated malaria and eight children with complicated falciparum malaria were diagnosed based on at least one positive result from the four tests as well as clinical criteria. Twelve of the 79 children receiving first-line treatment had positive results by nested PCR on day 7 (nested PCR-corrected day 7 cure rate was 85%). After the second-line treatment, nested PCR/LAMP-corrected day 28 cure rate was 83% for these 12 children. HRP-2-RDTs have similar sensitivity as microscopy but less specificity. However, as compared to nested PCR, the poor sensitivity of HRP-2-RDTs indicates that low parasitaemia may not be detected after treatment, as well as the low specificity of HRP-2-RDTs indicates it cannot be applied for treatment follow-up. LAMP has similar sensitivity and specificity to nested PCR. With high PPV and NPV, LAMP is simpler and faster as compared to nested PCR with the advantage of detecting low parasitaemia becoming a potential point-of-care test for treatment follow-up.

Application of loop-mediated isothermal amplification for malaria diagnosis during a follow-up study in São Tomé

PubMed Central

2012-01-01

Background A reliable and simple test for the detection of malaria parasite is crucial in providing effective treatment and therapeutic follow-up, especially in malaria elimination programmes. A comparison of four methods, including nested polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) were used for the malaria diagnosis and treatment follow-up in São Tomé and Príncipe, during a successful pre-elimination campaign. Method During the period September to November 2009, blood samples from 128 children (five to 14 years old) with temperature ≥38°C (tympanic) in the District of Agua Grande were examined using four different methods, i.e., histidine-rich protein 2 (HRP-2) based rapid diagnostic tests (HRP-2-RDTs), optical microscopy, nested PCR, and LAMP. First-line treatment with artesunate-amodiaquine was given for uncomplicated malaria and intravenous quinine was given for complicated malaria. Children with persistent positivity for malaria by microscopy, or either by nested PCR, or by LAMP on day 7 were given second-line treatment with artemether-lumefantrine. Treatment follow-up was made weekly, for up to four weeks. Results On day 0, positive results for HRP-2-RDTs, microscopy, nested PCR, and LAMP, were 68(53%), 47(37%), 64(50%), and 65(51%), respectively. When nested PCR was used as a reference standard, only LAMP was comparable; both HRP-2-RDTs and microscopy had moderate sensitivity; HRP-2-RDTs had poor positive predictive value (PPV) and a moderate negative predictive value (NPV) for the treatment follow-up. Seventy-one children with uncomplicated malaria and eight children with complicated falciparum malaria were diagnosed based on at least one positive result from the four tests as well as clinical criteria. Twelve of the 79 children receiving first-line treatment had positive results by nested PCR on day 7 (nested PCR-corrected day 7 cure rate was 85%). After the second-line treatment, nested PCR/LAMP-corrected day 28 cure rate was 83% for these 12 children. Conclusions HRP-2-RDTs have similar sensitivity as microscopy but less specificity. However, as compared to nested PCR, the poor sensitivity of HRP-2-RDTs indicates that low parasitaemia may not be detected after treatment, as well as the low specificity of HRP-2-RDTs indicates it cannot be applied for treatment follow-up. LAMP has similar sensitivity and specificity to nested PCR. With high PPV and NPV, LAMP is simpler and faster as compared to nested PCR with the advantage of detecting low parasitaemia becoming a potential point-of-care test for treatment follow-up. PMID:23217163

Microbiological and fermentative properties of baker's yeast starter used in breadmaking.

PubMed

Reale, A; Di Renzo, T; Succi, M; Tremonte, P; Coppola, R; Sorrentino, E

2013-08-01

This study assessed the levels of microbial contaminants in liquid, compressed and dry commercial baker's yeasts used as starters in breadmaking. Eumycetes, Enterobacteriaceae, total and fecal coliforms, Bacillus spp., and lactic acid bacteria (LAB), in particular enterococci, were quantified. Results obtained in this study highlighted that baker's yeast could represent a potential vehicle of spoilage and undesirable microorganisms into the baking environment, even if these do not influence the leavening activity in the dough, as ascertained by rheofermentometer analysis. Different microbial groups, such as spore-forming bacteria and moulds, were found in baker's yeast starters. Moreover, different species of LAB, which are considered the main contaminants in large-scale yeast fermentations, were isolated and identified by Denaturing Gradient Gel Electrophoresis (DGGE) and 16S rDNA sequencing. The most recurrent species were Lactobacillus plantarum, Enterococcus faecalis, and Enterococcus durans, isolated from both compressed and dry starters, whereas strains belonging to Leuconostoc and Pediococcus genera were found only in dry ones. Nested-Polymerase Chain Reaction (Nested-PCR) and Randomly Amplified Polymorphic DNA-PCR (RAPD-PCR) were also used to highlight the biodiversity of the different commercial yeast strains, and to ascertain the culture purity. © 2013 Institute of Food Technologists®

High occurrence of Helicobacter pylori in raw goat, sheep and cow milk inferred by glmM gene: a risk of food-borne infection?

PubMed

Quaglia, N C; Dambrosio, A; Normanno, G; Parisi, A; Patrono, R; Ranieri, G; Rella, A; Celano, G V

2008-05-10

Helicobacter pylori is an organism widespread in humans and sometimes responsible for serious illnesses, such as gastric and duodenal ulcers, MALToma and even gastric cancer. It has been hypothesized that the infection route by H. pylori involves multiple pathways including food-borne transmission, as the microorganism has been detected from foods such as sheep and cow milk. This work reports the results of a survey conducted in order to investigate the presence of H. pylori in raw goat, sheep and cow milk produced in Southern Italy, employing a Nested Polymerase Chain Reaction (Nested-PCR) assay for the detection of the phosphoglucosamine mutase gene (glmM), as screening method followed by conventional bacteriological isolation. Out of the 400 raw milk samples examined, 139 (34.7%) resulted positive for the presence of glmM gene, but no strains were isolated. In this work H. pylori DNA has been firstly detected from 41 (25.6%) raw goat milk samples. The results deserve further investigations on the contamination source/s of the milk samples and on the major impact that it may have on consumers.

Detection of the agents of human ehrlichioses in ixodid ticks from California.

PubMed

Kramer, V L; Randolph, M P; Hui, L T; Irwin, W E; Gutierrez, A G; Vugia, D J

1999-01-01

A study was conducted in northern California to estimate the prevalence and distribution in ixodid ticks of the rickettsial agents of human monocytic (HME) and human granulocytic (HGE) ehrlichioses. More than 650 ixodid ticks were collected from 17 sites in six California counties over a 15-month period. Ehrlichia chaffeensis, the causative agent of HME, was detected by a nested polymerase chain reaction (PCR) in Ixodes pacificus (minimum infection rate [MIR] = 13.3%) and Dermacentor variabilis (infection rate=20.0%) from a municipal park in Santa Cruz County. The HGE agent was detected by nested PCR in I. pacificus adults from a heavily used recreational area in Alameda County (MIR = 4.7%) and a semirural community in Sonoma County (MIR = 6.7%). Evidence of infection with Ehrlichia spp. was not detected in D. occidentalis adults or I. pacificus nymphs. This study represents the first detection of E. chaffeensis in California ticks and the first report of infection in Ixodes spp. The competency of I. pacificus to be coinfected with and to transmit multiple disease agents, including those of human ehrlichioses and Lyme disease, has yet to be determined.

Edible bird’s nest attenuates procoagulation effects of high-fat diet in rats

PubMed Central

Yida, Zhang; Imam, Mustapha Umar; Ismail, Maznah; Ismail, Norsharina; Hou, Zhiping

2015-01-01

Edible bird’s nest (EBN) is popular in Asia, and has long been used traditionally as a supplement. There are, however, limited evidence-based studies on its efficacy. EBN has been reported to improve dyslipidemia, which is closely linked to hypercoagulation states. In the present study, the effects of EBN on high-fat diet- (HFD-) induced coagulation in rats were evaluated. Rats were fed for 12 weeks with HFD alone or in combination with simvastatin or EBN. Food intake was estimated, and weight measurements were made during the experimental period. After sacrifice, serum oxidized low-density lipoprotein (oxLDL), adiponectin, leptin, von willibrand factor, prostacyclin, thromboxane and lipid profile, and whole blood coagulation indices (bleeding time, prothrombin time, activated partial thromboplastin time, red blood count count, and platelet count) were estimated. Furthermore, hepatic expression of coagulation-related genes was evaluated using multiplex polymerase chain reaction. The results indicated that EBN could attenuate HFD-induced hypercholesterolemia and coagulation similar to simvastatin, partly through transcriptional regulation of coagulation-related genes. The results suggested that EBN has the potential for lowering the risk of cardiovascular disease-related hypercoagulation due to hypercholesterolemia. PMID:26251574

Development and validation of a real-time PCR assay for the detection of Toxoplasma gondii DNA in animal and meat samples.

PubMed

Marino, Anna Maria Fausta; Percipalle, Maurizio; Giunta, Renato Paolo; Salvaggio, Antonio; Caracappa, Giulia; Alfonzetti, Tiziana; Aparo, Alessandra; Reale, Stefano

2017-03-01

We report a rapid and reliable method for the detection of Toxoplasma gondii in meat and animal tissues based on real-time polymerase chain reaction (PCR). Samples were collected from cattle, small ruminants, horses, and pigs raised or imported into Sicily, Italy. All DNA preparations were assayed by real-time PCR tests targeted to a 98-bp long fragment in the AF 529-bp repeat element and to the B1 gene using specific primers. Diagnostic sensitivity (100%), diagnostic specificity (100%), limit of detection (0.01 pg), efficiency (92-109%), and precision (mean coefficient of variation = 0.60%), repeatability (100%), reproducibility (100%), and robustness were evaluated using 240 DNA extracted samples (120 positives and 120 negative as per the OIE nested PCR method) from different matrices. Positive results were confirmed by the repetition of both real-time and nested PCR assays. Our study demonstrates the viability of a reliable, rapid, and specific real-time PCR on a large scale to monitor contamination with Toxoplasma cysts in meat and animal specimens. This validated method can be used for postmortem detection in domestic and wild animals and for food safety purposes.

Molecular characterization of Orientia tsutsugamushi serotypes causing scrub typhus outbreak in southern region of Andhra Pradesh, India.

PubMed

Usha, K; Kumar, E; Kalawat, Usha; Kumar, B Siddhartha; Chaudhury, A; Gopal, D V R Sai

2016-10-01

Scrub typhus is a vector-borne zoonotic infection caused by Orientiatsutsugamushi. Local epidemiology of the circulating serotypes of scrub typhus is not available from most parts of India. We conducted this study for the diagnosis of scrub typhus using IgM ELISA and to detect O. tsutsugamushi serotypes circulating in southern Andhra Pradesh, India. Samples were collected from patients clinically suspected to have scrub typhus and were subjected to IgM ELISA to measure IgM antibodies against O. tsutsugamushi. Nested polymerase chain reaction (PCR) was performed targeting strain-specific regions in ELISA-positive samples. Of a total of 663 samples, 258 (38.91%) were found to be positive by IgM ELISA. Serotypes could be detected in 230 (34.69%) samples only. Only two serotypes, Karp and Kawasaki, were found in the serum samples, with the former being predominant. The dual infection of Karp and Kawasaki serotypes was found in seven patients. Other serotypes such as Gilliam, Kuroki and Kato were not detected in the samples. The nested PCR products proved useful in presumptively identifying the endemic O. tsutsugamushi serotypes. The present study could be significant in understanding scrub typhus epidemiology in this region.

Monitoring of Bt11 and Bt176 genetically modified maize in food sold commercially in Brazil from 2005 to 2007.

PubMed

Dinon, Andréia Z; Bosco, Kenia T; Arisi, Ana Carolina M

2010-07-01

The first genetically modified (GM) maize lines were approved for trading in Brazil after December 2007 and they were T25, MON810, Bt11, NK603 and GA21. The polymerase chain reaction (PCR) method was employed to monitor the presence of Bt11 and nested PCR was used to detect the presence of Bt176 in 81 maize-derived products (maize flour, corn meal, maize flour flakes and polenta) that were sold in Brazilian market from 2005 to 2007, before the release of GM maize in Brazil. The PCR detection limit for Bt11 was 10 g kg(-1) and for nested PCR of Bt176 it was 1 g kg(-1). All Brazilian samples analyzed showed no positive signal for these GM maize events. Bt11 and Bt176 GM maize lines were not detected by specific PCR in 81 maize-derived food samples sold in Brazil from 2005 to 2007, before the commercial release of GM maize in Brazil. These Brazilian food industries were in compliance with the rules stipulated by the current legislation with respect to consumer requirements about GMO labeling.

Seasonal abundance and potential of Japanese encephalitis virus infection in mosquitoes at the nesting colony of ardeid birds, Thailand.

PubMed

Changbunjong, Tanasak; Weluwanarak, Thekhawet; Taowan, Namaoy; Suksai, Parut; Chamsai, Tatiyanuch; Sedwisai, Poonyapat

2013-03-01

To investigate the abundance and seasonal dynamics of mosquitoes, and to detect Japanese encephalitis virus (JEV) in these mosquitoes at the nesting colony of ardeid birds. Mosquitoes were collected bimonthly from July 2009 to May 2010 by Centers for Disease Control. Light traps and dry ice, as a source of CO2, were employed to attract mosquitoes. Mosquitoes were first identified, pooled into groups of upto 50 mosquitoes by species, and tested for JEV infection by viral isolation and reverse transcriptase polymerase chain reaction. A total of 20 370 mosquitoes comprising 14 species in five genera were collected. The five most abundant mosquito species collected were Culex tritaeniorhynchus (95.46%), Culex vishnui (2.68%), Culex gelidus (0.72%), Anopheles peditaeniatus (0.58%) and Culex quinquefasciatus (0.22%). Mosquito peak densities were observed in July. All of 416 mosquito pools were negative for JEV. This study provides new information about mosquito species and status of JEV infection in mosquitoes in Thailand. Further study should be done to continue a close survey for the presence of this virus in the ardeid birds.

Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning

PubMed Central

Meghdadi, Hossein; Khosravi, Azar D.; Ghadiri, Ata A.; Sina, Amir H.; Alami, Ameneh

2015-01-01

Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39–31.27% for rpoB-PCR, 36.44–60.83% for IS6110- PCR, 75.29–92.93% for nested-rpoB PCR, and 87.98–99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100% specificity of each PCR method were calculated as 69.15–100%. Our results indicated that nested-rpoB PCR combined with TA cloning and sequencing is a preferred method for the detection of MTB DNA in EPTB samples with high sensitivity and specificity which confirm the histopathology results. PMID:26191059

Detection of Mycobacterium tuberculosis in extrapulmonary biopsy samples using PCR targeting IS6110, rpoB, and nested-rpoB PCR Cloning.

PubMed

Meghdadi, Hossein; Khosravi, Azar D; Ghadiri, Ata A; Sina, Amir H; Alami, Ameneh

2015-01-01

Present study was aimed to examine the diagnostic utility of polymerase chain reaction (PCR) and nested PCR techniques for the detection of Mycobacterium tuberculosis (MTB) DNA in samples from patients with extra pulmonary tuberculosis (EPTB). In total 80 formalin-fixed, paraffin-embedded (FFPE) samples comprising 70 samples with definite diagnosis of EPTB and 10 samples from known non- EPTB on the basis of histopathology examination, were included in the study. PCR amplification targeting IS6110, rpoB gene and nested PCR targeting the rpoB gene were performed on the extracted DNAs from 80 FFPE samples. The strong positive samples were directly sequenced. For negative samples and those with weak band in nested-rpoB PCR, TA cloning was performed by cloning the products into the plasmid vector with subsequent sequencing. The 95% confidence intervals (CI) for the estimates of sensitivity and specificity were calculated for each method. Fourteen (20%), 34 (48.6%), and 60 (85.7%) of the 70 positive samples confirmed by histopathology, were positive by rpoB-PCR, IS6110-PCR, and nested-rpoB PCR, respectively. By performing TA cloning on samples that yielded weak (n = 8) or negative results (n = 10) in the PCR methods, we were able to improve their quality for later sequencing. All samples with weak band and 7 out of 10 negative samples, showed strong positive results after cloning. So nested-rpoB PCR cloning revealed positivity in 67 out of 70 confirmed samples (95.7%). The sensitivity of these combination methods was calculated as 95.7% in comparison with histopathology examination. The CI for sensitivity of the PCR methods were calculated as 11.39-31.27% for rpoB-PCR, 36.44-60.83% for IS6110- PCR, 75.29-92.93% for nested-rpoB PCR, and 87.98-99.11% for nested-rpoB PCR cloning. The 10 true EPTB negative samples by histopathology, were negative by all tested methods including cloning and were used to calculate the specificity of the applied methods. The CI for 100% specificity of each PCR method were calculated as 69.15-100%. Our results indicated that nested-rpoB PCR combined with TA cloning and sequencing is a preferred method for the detection of MTB DNA in EPTB samples with high sensitivity and specificity which confirm the histopathology results.

Hepatitis C virus RNA detection in serum and peripheral blood mononuclear cells of patients with hepatitis C

PubMed Central

Zhou, Ping; Cai, Qing; Chen, You-Chun; Zhang, Mu-Sen; Guan, Jian; Li, Xiao-Juan

1997-01-01

AIM: To investigate the existence and clinical significance of hepatitis C virus (HCV) RNA in the serum and peripheral blood mononuclear cells (PBMC) of patients with hepatitis C. METHODS: HCV RNA was detected by nested polymerase chain reaction (Nested PCR) in serum and in PBMC of 46 patients with acute hepatitis C (AHC) and in 42 patients with chronic hepatitis C (CHC). RESULTS: The positive rate of HCV RNA in PBMC of patients with CHC was markedly higher than that of patients with AHC (P < 0.01). The positive rates of HCV RNA in serum of patients with AHC and CHC and in PBMC of patients with CHC were significantly higher than those of anti-HCV positive patients with normal alanine aminotransferase (ALT) levels (P < 0.01). HCV RNA was negative in the serum of two patients, but could be detected in PBMC. In 12 patients, anti HCV was negative while HCV RNA was positive in serum. CONCLUSION: (1) detection of serum HCV RNA by nested PCR might be helpful in the early diagnosis of anti-HCV negative hepatitis C; (2) liver damage in patients with hepatitis C might be correlated with HCV-viremia; (3) infection of PBMC by HCV might play an important role in chronic liver damage in patients with HCV and in the chronicity of its clinical course; and (4) PBMC might be considered as a “reservoir” for HCV. PMID:27041960

Detection of Rickettsia rickettsii, Rickettsia parkeri, and Rickettsia akari in Skin Biopsy Specimens Using a Multiplex Real-time Polymerase Chain Reaction Assay

PubMed Central

Denison, Amy M.; Amin, Bijal D.; Nicholson, William L.; Paddock, Christopher D.

2015-01-01

Background Rickettsia rickettsii, Rickettsia parkeri, and Rickettsia akari are the most common causes of spotted fever group rickettsioses indigenous to the United States. Infected patients characteristically present with a maculopapular rash, often accompanied by an inoculation eschar. Skin biopsy specimens are often obtained from these lesions for diagnostic evaluation. However, a species-specific diagnosis is achieved infrequently from pathologic specimens because immunohistochemical stains do not differentiate among the causative agents of spotted fever group rickettsiae, and existing polymerase chain reaction (PCR) assays generally target large gene segments that may be difficult or impossible to obtain from formalin-fixed tissues. Methods This work describes the development and evaluation of a multiplex real-time PCR assay for the detection of these 3 Rickettsia species from formalin-fixed, paraffin-embedded (FFPE) skin biopsy specimens. Results The multiplex PCR assay was specific at discriminating each species from FFPE controls of unrelated bacterial, viral, protozoan, and fungal pathogens that cause skin lesions, as well as other closely related spotted fever group Rickettsia species. Conclusions This multiplex real-time PCR demonstrates greater sensitivity than nested PCR assays in FFPE tissues and provides an effective method to specifically identify cases of Rocky Mountain spotted fever, rickettsialpox, and R. parkeri rickettsiosis by using skin biopsy specimens. PMID:24829214

Development and validation of a novel hydrolysis probe real-time polymerase chain reaction for agamid adenovirus 1 in the central bearded dragon (Pogona vitticeps).

PubMed

Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X

2015-03-01

Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. © 2015 The Author(s).

Detection of novel strains genetically related to Anaplasma platys in Tunisian one-humped camels (Camelus dromedarius).

PubMed

Belkahia, Hanène; Ben Said, Mourad; Sayahi, Lotfi; Alberti, Alberto; Messadi, Lilia

2015-10-29

Little information is currently available regarding the presence of Anaplasma species in North African dromedaries. To fill this gap in knowledge, the prevalence, risk factors, and genetic diversity of Anaplasma species were investigated in Tunisian dromedary camels. A total of 226 camels from three different bioclimatic areas were sampled and tested for the presence of Anaplasma species by quantitative polymerase chain reaction (qPCR) and nested polymerase chain reaction (nPCR) assays. Detected Anaplasma strains were characterized by 16S rRNA sequence analysis. Overall infection rate of Anaplasma spp. was 17.7%, and was significantly higher in females. Notably, A. marginale, A. centrale, A. bovis, and A. phagocytophilum were not detected. Animals were severely infested by three tick species belonging to the genus Hyalomma (H. dromedarii, H. impeltatum, and H. excavatum). Alignment, similarity comparison, and phylogenetic analysis of the 16S rRNA sequence variants obtained in this study suggest that Tunisian dromedaries are infected by more than one novel Anaplasma strain genetically related to A. platys. This study reports the presence of novel Anaplasma sp. strains genetically related to A. platys in dromedaries from various bioclimatic areas of Tunisia. Findings raise new concerns about the specificity of the direct and indirect diagnostic tests routinely used to detect different Anaplasma species in ruminants and provide useful molecular information to elucidate the evolutionary history of bacterial species related to A. platys.

Cardiomyogenic Differentiation in Cardiac Myxoma Expressing Lineage-Specific Transcription Factors

PubMed Central

Kodama, Hiroaki; Hirotani, Takashi; Suzuki, Yusuke; Ogawa, Satoshi; Yamazaki, Kazuto

2002-01-01

We investigated five cases of cardiac myxoma and one case of cardiac undifferentiated sarcoma by light and electron microscopy, in situ hybridization, immunohistochemical staining, and reverse transcriptase-polymerase chain reaction for cardiomyocyte-specific transcription factors, Nkx2.5/Csx, GATA-4, MEF2, and eHAND. Conventional light microscopy revealed that cardiac myxoma and sarcoma cells presented variable cellular arrangements and different histological characteristics. Ultrastructurally, some of the myxoma cells exhibited endothelium-like or immature mesenchymal cell differentiation. Immunohistochemistry for Nkx2.5/Csx, GATA-4, and eHAND was slightly to intensely positive in all myxoma cases. MEF2 immunoreactivity was observed in all cases including the case of sarcoma, thus suggesting myogenic differentiation of myxoma or sarcoma cells. In situ hybridization for Nkx2.5/Csx also revealed that all myxoma cells, but not sarcoma cells, expressed mRNA of the cardiac homeobox gene, Nkx2.5/Csx. Furthermore, nested reverse transcriptase-polymerase chain reaction from formalin-fixed, paraffin-embedded tissue was performed and demonstrated that the Nkx2.5/Csx and eHAND gene product to be detected in all cases, and in three of six cases, respectively. In conclusion, cardiac myxoma cells were found to express various amounts of cardiomyocyte-specific transcription factor gene products at the mRNA and protein levels, thus suggesting cardiomyogenic differentiation. These results support the concept that cardiac myxoma might arise from mesenchymal cardiomyocyte progenitor cells. PMID:12163362

Variability in nest survival rates and implications to nesting studies

USGS Publications Warehouse

Klett, A.T.; Johnson, D.H.

1982-01-01

We used four reasonably large samples (83-213) of Mallard (Anas platyrhynchos) and Blue-winged Teal (A. discors) nests on an interstate highway right-of-way in southcentral North Dakota to evaluate potential biases in hatch-rate estimates. Twelve consecutive, weekly searches for nests were conducted with a cable-chain drag in 1976 and 1977. Nests were revisited at weekly intervals. Four methods were used to estimate hatch rates for the four data sets: the Traditional Method, the Mayfield Method, and two modifications of the Mayfield Method that are sometimes appropriate when daily mortality rates of nests are not constant. Hatch rates and the average age of nests at discovery declined as the interval between searches decreased, suggesting that mortality rates were not constant in our samples. An analysis of variance indicated that daily mortality rates varied with the age of nests in all four samples. Mortality was generally highest during the early laying period, moderately high during the late laying period, and lowest during incubation. We speculate that this relationship of mortality to nest age might be due to the presence of hens at nests or to differences in the vulnerability of nest sites to predation. A modification of the Mayfield Method that accounts for age-related variation in nest mortality was most appropriate for our samples. We suggest methods for conducting nesting studies and estimating nest success for species possessing similar nesting habits.

Phenotypic plasticity of nest timing in a post-glacial landscape: how do reptiles adapt to seasonal time constraints?

PubMed

Edge, Christopher B; Rollinson, Njal; Brooks, Ronald J; Congdon, Justin D; Iverson, John B; Janzen, Fredric J; Litzgus, Jacqueline D

2017-02-01

Life histories evolve in response to constraints on the time available for growth and development. Nesting date and its plasticity in response to spring temperature may therefore be important components of fitness in oviparous ectotherms near their northern range limit, as reproducing early provides more time for embryos to complete development before winter. We used data collected over several decades to compare air temperature and nest date plasticity in populations of painted turtles and snapping turtles from a relatively warm environment (southeastern Michigan) near the southern extent of the last glacial maximum to a relatively cool environment (central Ontario) near the northern extent of post-glacial recolonization. For painted turtles, population-level differences in reaction norm elevation for two phenological traits were consistent with adaptation to time constraints, but no differences in reaction norm slopes were observed. For snapping turtle populations, the difference in reaction norm elevation for a single phenological trait was in the opposite direction of what was expected under adaptation to time constraints, and no difference in reaction norm slope was observed. Finally, among-individual variation in individual plasticity for nesting date was detected only in the northern population of snapping turtles, suggesting that reaction norms are less canalized in this northern population. Overall, we observed evidence of phenological adaptation, and possibly maladaptation, to time constraints in long-lived reptiles. Where present, (mal)adaptation occurred by virtue of differences in reaction norm elevation, not reaction norm slope. Glacial history, generation time, and genetic constraint may all play an important role in the evolution of phenological timing and its plasticity in long-lived reptiles. © 2016 by the Ecological Society of America.

Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nasarabadi, Shanavaz

2011-01-11

A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

Molecular detection of mixed infections with multiple dengue virus serotypes in suspected dengue samples in Tamaulipas, Mexico.

PubMed

Requena-Castro, Rocío; Reyes-López, Miguel Ángel; Rodríguez-Reyna, Rosa Eminé; Palma-Nicolás, Prisco; Bocanegra-García, Virgilio

2017-07-01

This study aimed to detect dengue virus (DENV) serotypes in serum samples obtained in Matamoros Tamaulipas, Mexico, and to determine the concordance of conventional nested reverse transcriptase polymerase chain reaction (RT-PCR) and a serological test [enzyme-linked immunosorbent assay (ELISA NS1)]. Here, we detected mixed infections consisting of four serotypes of DENV. The most prevalent serotype was DENV-1, followed by DENV-4. This is the first report of DENV-4 in our region. Mixed infections were also detected in 21.5% of samples, and the predominant coinfection consisted of DENV-1 and DENV-2. Therefore, continuous epidemiological surveillance of DENV in this area is required to predict future forms of dengue heterologous infections and the effect of this on health care.

Bovine immunodeficiency-like virus: inactivation in milk by pasteurisation.

PubMed

Venables, C; Lysons, R; Horigan, M; Stagg, D; Dawson, M

1997-03-15

Bioassay was used to determine whether bovine immunodeficiency-like virus (BIV) in milk was inactivated by pasteurisation. Three groups of three calves were inoculated with virus (BIV isolate FL112), milk seeded with virus and milk seeded with virus that had been pasteurised before inoculation, respectively. Seroconversion to BIV was monitored for 12 months by an indirect immunofluorescence assay. The presence of BIV proviral DNA in peripheral blood was determined by a nested polymerase chain reaction (PCR). The animals were euthanized and virus isolation and PCR were attempted on peripheral blood mononunclear cells, prescapular lymph node and spleen. Transmission of BIV was confirmed in the groups that were inoculated with the virus and with the virus in milk, but no evidence of its transmission was demonstrated in the group that received the pasteurised inoculum.

Tsutsugamushi disease caused by Shimokoshi-type Orientia tsutsugamushi: the first report in Western Japan.

PubMed

Ikegaya, Satoshi; Iwasaki, Hiromichi; Takada, Nobuhiro; Yamamoto, Seigo; Ueda, Takanori

2013-06-01

An 85-year-old female farmer was admitted to our hospital for fever, general fatigue, and skin rash. Cephalosporin was not effective and minocycline was dramatically effective. An eschar was discovered on her inguinal region after the defervescence. Laboratory examination of serum taken 12 days after onset of the illness showed elevated titers of antibodies against the Shimokoshi strain of Orientia tsutsugamushi. The gene sequence analysis of specimen from the patient's eschar revealed high similarity to the Shimokoshi strain by nested polymerase chain reaction. Therefore, this patient was diagnosed as a case of Shimokoshi-type tsutsugamushi disease, which has not previously been reported in Western Japan. Recently, cases of this type have also been confirmed in northeastern Japan, suggesting the need for further epidemiological studies.

Comparison of various primer sets for detection of Toxoplasma gondii by polymerase chain reaction in fetal tissues from naturally aborted foxes.

PubMed

Smielewska-Loś, E

2003-01-01

Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.

Primate-to-Human Retroviral Transmission in Asia

PubMed Central

Engel, Gregory A.; Schillaci, Michael A.; Rompis, Aida; Putra, Artha; Suaryana, Komang Gde; Fuentes, Agustin; Beer, Brigitte; Hicks, Sarah; White, Robert; Wilson, Brenda; Allan, Jonathan S.

2005-01-01

We describe the first reported transmission to a human of simian foamy virus (SFV) from a free-ranging population of nonhuman primates in Asia. The transmission of an exogenous retrovirus, SFV, from macaques (Macaca fascicularis) to a human at a monkey temple in Bali, Indonesia, was investigated with molecular and serologic techniques. Antibodies to SFV were detected by Western blotting of serum from 1 of 82 humans tested. SFV DNA was detected by nested polymerase chain reaction (PCR) from the blood of the same person. Cloning and sequencing of PCR products confirmed the virus's close phylogenetic relationship to SFV isolated from macaques at the same temple. This study raises concerns that persons who work at or live around monkey temples are at risk for infection with SFV. PMID:16022776

Multiple eschars in scrub typhus: a case report.

PubMed

Koraluru, Munegowda; Nandigam, Manideep; Bairy, Indira; Vidyasagar, Sudha; Varma, Muralidhar

2017-01-01

Eschar in scrub typhus aids in early diagnosis and institution of appropriate therapy; however, the eschar positivity rates vary greatly in endemic regions. Multiple eschars in scrub typhus are a rare presentation. Our patient presented with fever and multiple eschars and was empirically started on doxycycline. Nested polymerase chain reaction from all the four eschars and from EDTA blood were positive for 56-kDa type-specific antigen which is specific for Orientia tsutsugamushi The patient recovered completely after 7 days of antibiotic treatment. He was from an area where scrub typhus was not observed previously. An eschar in an acute febrile patient from the "tsutsugamushi triangle" is a valuable sign in scrub typhus diagnosis. A search for multiple eschars in scrub typhus must be made by clinicians. © The Author(s) 2016.

Prize to a Faculty Member for Research in an Undergraduate: Chaotic mixing and front propagation

NASA Astrophysics Data System (ADS)

Solomon, Tom

2014-03-01

We present results from a series of experiments - all done with undergraduate students - on chaotic fluid mixing and the effects of fluid flows on the behavior of reaction systems. Simple, well-ordered laminar fluid flows can give rise to fluid mixing with complexity far beyond that of the underlying flow, with tracers that separate exponentially in time and invariant manifolds that act as barriers to transport. Recently, we have studied how fluid mixing affects the propagation of reaction fronts in a flow. This is an issue with applications to a wide range of systems including microfluidic chemical reactors, blooms of phytoplankton in the oceans, and the spreading of a disease in a moving population. To analyze and predict the behavior of the fronts, we generalize tools developed to describe passive mixing. In particular, the concept of an invariant manifold is expanded to account for reactive burning. ``Burning invariant manifolds'' (BIMs) are predicted and measured experimentally as structures in the flow that act as one-way barriers that block the motion of reaction fronts. We test these ideas experimentally in three fluid flows: (a) and chain of alternating vortices; (b) an extended, spatially-random pattern of vortices; and (c) a time-independent, three-dimensional, nested vortex flow. The reaction fronts are produced chemically with variations of the well-known Belousov-Zhabotinsky reaction. Supported by Research Corporation and the National Science Foundation.

Detritus cast from heron nests as an indicator of food chain contamination. [Radioactivity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rickard, W.H.; Hedlund, J.D.; Schreckhise, R.G.

Approximately 40 pairs of great blue herons nest in a single colony on the Hanford Reservation in south-central Washington. Over a two-month period in the 1975 nesting season, 170 g/m/sup 2/ of detritus, dry weight, were collected on cheesecloth blankets placed on the ground beneath the nesting colony. Seven gamma-emitting radionuclides commonly associated with airborne debris (fallout) were measured in the heron detritus. Cesium-137 was the most abundant man-induced radionuclide measured in the detritus averaging 18 picocuries per gram dry weight. Regular surveillance of heron detritus appears as a useful way to measure contaminants in heron foods gathered from themore » surrounding environment.« less

Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

PubMed

Garg, Pankaj

2017-07-01

Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

Rapid detection of fungal keratitis with DNA-stabilizing FTA filter paper.

PubMed

Menassa, Nardine; Bosshard, Philipp P; Kaufmann, Claude; Grimm, Christian; Auffarth, Gerd U; Thiel, Michael A

2010-04-01

Purpose. Polymerase chain reaction (PCR) is increasingly important for the rapid detection of fungal keratitis. However, techniques of specimen collection and DNA extraction before PCR may interfere with test sensitivity. The purpose of this study was to investigate the use of DNA-stabilizing FTA filter paper (Indicating FTA filter paper; Whatman International, Ltd., Maidstone, UK) for specimen collection without DNA extraction in a single-step, nonnested PCR for fungal keratitis. Methods. Specimens were collected from ocular surfaces with FTA filter discs, which automatically lyse collected cells and stabilize nucleic acids. Filter discs were directly used in single-step PCR reactions to detect fungal DNA. Test sensitivity was evaluated with serial dilutions of Candida albicans, Fusarium oxysporum, and Aspergillus fumigatus cultures. Test specificity was analyzed by comparing 196 and 155 healthy individuals from Switzerland and Egypt, respectively, with 15 patients with a diagnosis of microbial keratitis. Results. PCR with filter discs detected 3 C. albicans, 25 F. oxysporum, and 125 A. fumigatus organisms. In healthy volunteers, fungal PCR was positive in 1.0% and 8.4% of eyes from Switzerland and Egypt, respectively. Fungal PCR remained negative in 10 cases of culture-proven bacterial keratitis, became positive in 4 cases of fungal keratitis, but missed 1 case of culture-proven A. fumigatus keratitis. Conclusions. FTA filter paper for specimen collection together with direct PCR is a promising method of detecting fungal keratitis. The analytical sensitivity is high without the need for a semi-nested or nested second PCR, the clinical specificity is 91.7% to 99.0%, and the method is rapid and inexpensive.

Detection of Torque teno sus virus types 1 and 2 by nested polymerase chain reaction in sera of sows at parturition and of their newborn piglets immediately after birth without suckling colostrum and at 24 hr after suckling colostrum.

PubMed

Tshering, Chenga; Takagi, Mitsuhiro; Deguchi, Eisaburo

2012-03-01

This study was performed to clarify the sow-to-fetus transmission pathway of Torque teno sus virus (TTSuV) types 1 (TTSuV1) and 2 (TTSuV2). For this purpose, detection of TTSuV1 and TTSuV2 (TTSuVs) in sera of 6 sows (Sows 1-6) at parturition and in sera of their newborn piglets immediately after birth without suckling colostrum was performed by nested polymerase chain reaction (nPCR). These sows were bred using semen that had tested negative for TTSuVs. In a TTSuV1- and TTSuV2-positive sow (Sow 1), TTSuV1 and TTSuV2 were detected in 4 and 5 of 12 newborn littermates, respectively. In a TTSuV1-positive sow (Sow 2), TTSuV1 was detected in 1 of 8 newborn littermates. In 4 TTSuV1- and TTSuV2-negative sows (Sows 3-6), TTSuV1 was detected in 6 out of the 25 newborn piglets of 3 sows (Sows 3-5), while TTSuVs were not detected in all 13 piglets of 1 sow (Sow 6). In addition, to investigate the possibility of a sow-to-piglet transmission pathway of TTSuV via colostrum, TTSuV1 and TTSuV2 in sera of 12 newborn piglets from Sows 1-3 were examined by nPCR. Immediately after birth without suckling colostrum, TTSuV1 and TTSuV2 were not detected in 10 and 8 of 12 newborn piglets, respectively; however, at 24 hr after suckling colostrum, TTSuV1 was detected in 6 piglets, while TTSuV2 was not detected in any piglets. These results confirmed the existence of a sow-to-fetus transmission pathway of TTSuV during normal pregnancy and suggested a possibility of sow-to-piglet transmission of TTSuV via colostrum.

Detection and characterization of cry1Ac transgene construct in Bt cotton: multiple polymerase chain reaction approach.

PubMed

Singh, Chandra K; Ojha, Abhishek; Kachru, Devendra N

2007-01-01

To comply with international labeling regulations for genetically modified (GM) crops and food, and to enable proper identification of GM organisms (GMOs), effective methodologies and reliable approaches are needed. The spurious and unapproved GM planting has contributed to crop failures and commercial losses. To ensure effective and genuine GM cultivation, a methodology is needed to detect and identify the trait of interest and concurrently evaluate the structural and functional stability of the transgene insert. A multiple polymerase chain reaction (PCR) approach was developed for detection, identification, and gene stability confirmation of cry1Ac transgene construct in Bt cotton. As many as 9 samples of Bt cotton hybrid seeds comprising 3 approved Bt hybrids, MECH-12Bt, MECH-162Bt, MECH-184Bt, and a batch of 6 nonapproved Bt hybrids were tested. Initially, single standard PCR assays were run to amplify predominant GM DNA sequences (CaMV 35S promoter, nos terminator, and npt-II marker gene); a housekeeping gene, Gossypium hirsutum fiber-specific acyl carrier protein gene (acp1); a trait-specific transgene (cry1Ac); and a sequence of 7S 3' transcription terminator which specifically borders with 3' region of cry1Ac transgene cassette. The concurrent amplification of all sequences of the entire cassette was performed by 3 assays, duplex, triplex, and quadruplex multiplex PCR assays, under common assay conditions. The identity of amplicons was reconfirmed by restriction endonuclease digestion profile. The 2 distinct transgene cassettes, cry1Ac and npt-II, of the Bt cotton were amplified using the respective forward primer of promoter and reverse primer of terminator. The resultant amplicons were excised, eluted, and purified. The purified amplicons served as template for nested PCR assays. The nested PCR runs confirmed the transgene construct orientation and identity. The limit of detection as established by our assay for GM trait (cry1Ac) was 0.1%. This approach can be adopted as a standard procedure for complete molecular characterization of Bt cotton. These assays will be of interest and use to importers, breeders, research laboratories, safety regulators, and food processors for detection of cry1Ac bearing GMOs.

Detection of Orientia tsutsugamushi (Rickettsiales: rickettsiaceae) in unengorged chiggers (Acari: Trombiculidae) from Oita Prefecture, Japan, by nested polymerase chain reaction.

PubMed

Pham, X D; Otsuka, Y; Suzuki, H; Takaoka, H

2001-03-01

The current study surveyed the 56-kDa type-specific antigen (TSA) gene DNAs of Orientia tsutsugamushi (Hayashi) in approximately 4.000 unengorged chiggers obtained from the soil or ground surface in an endemic and a nonendemic area of the Tsutsugamushi disease in Oita Prefecture, southwestern Japan, by nested polymerase chain reaction (PCR). Serotypes of O. tsutsugamushi were identified by restriction fragment-length polymorphism (RFLP) analysis. In the endemic area, 242 pools from five species [234 pools of Leptotrombidium scutellare (Nagayo, Miyagawa, Mitamura, Tamiya and Tenjin), two L. pallidum (Nagayo, Miyagawa, Mitamura and Tamiya), four L. kitasatoi (Fukuzumi & Obata), one L. fuji (Kuwata, Berge and Philip), and one Neotrombicula japonica (Tanaka, Kaiwa, Teramura and Kagaya)] were tested, and eight (seven pools of L. scutellare and one N. japonica) were positive for O. tsutsugamushi. Among the seven positive pools of L. scutellare, the distribution of serotypes was as follows: Kuroki (4), Gilliam (1), Karp (1), and Kawasaki (1). The first two serotypes (Kuroki and Gilliam) were identified for the first time in this species. In the nonendemic area, 128 pools from eight species were tested, and 13 were positive for O. tsutsugamushi. The positive rate was as follows: L. pallidum (4/41). L. kitasatoi (1/18), Gahrliepia saduski Womersley (2/10), L. fuji (4/50), L. himizu (Sasa, Kumada, Hayashi, Enomoto, Fukuzumi and Obata) (1/2), and Miyatrombicula kochiensis (Sasa, Kawashima and Egashira) (1/3). The latter three species were shown for the first time to harbor O. tsutsugamushi. All ofthe positive pools were Kuroki, except for two pools (one L. pallidum and one L. fuji), which were Gilliam (this serotype was also detected for the first time in L. pallidum). Further analysis revealed no differences in the nucleotide sequences (125 bp of variable domain 1 of TSA gene) of the same serotypes (i.e., Kuroki and Gilliam) among the positive samples. These data indicate that O. tsutsugamushi was widely distributed in various trombiculid species, even in the nonendemic area. The data are also suggestive of a possible horizontal transmission of O. tsutsugamushi among trombiculid species.

Nested Fork-Join Queuing Networks and Their Application to Mobility Airfield Operations Analysis.

DTIC Science & Technology

1997-03-01

shortest queue length. Setia , Squillante, and Tripathi [109] extend Makowski and Nelson’s work by performing a quantitative assessment of a range of...Markov chains." Numerical Solution of Markov Chains, edited by W. J. Stewart, 63- 88. Basel: Marcel Dekker, 1991. [109] Setia , S. K., and others

Effects of grazing on nesting by upland sandpipers in southcentral North Dakota

USGS Publications Warehouse

Bowen, Bonnie S.; Kruse, Arnold D.

1993-01-01

Grazing by livestock is often used to reduce litter, improve plant vigor, and alter plant species composition, but additional information is needed on the effects of these management practices on upland-nesting birds. Thus, we conducted an experimental study of the effect of grazing on nest density and nest success of upland sandpipers (Bartramia longicauda) in southcentral North Dakota from 1981 to 1987. Our experimental design consisted of 4 treatments and 1 control, each applied to 1 field in each of 3 study areas. The treatments represented options available to grassland managers: spring grazing, autumn grazing, autumn-and-spring grazing, season-long grazing, and control (ungrazed during the study). Nests (n = 342) were found by searching study areas with a cable-chain drag. Nest density was lower (P = 0.006) for treatments where cattle were present (spring, autumn-and-spring, and season-long) than where cattle were not present (autumn and control) during the nesting season. We concluded that grazing during the nesting season reduced the nest density of upland sandpipers. Nest success varied among years (P = 0.01) and was low in the first year of grazing and higher at the end of the study period. We found little evidence that the grazing treatment influenced nest success. We recommend that public lands with breeding populations of upland sandpipers include a complex of fields under various management practices, including fields undisturbed during the nesting season.

Hepatitis E Virus in Wild Boar in Northwest Poland: Sensitivity of Methods of Detection.

PubMed

Dorn-In, Samart; Schwaiger, Karin; Twarużek, Magdalena; Grajewski, Jan; Gottschalk, Christoph; Gareis, Manfred

2017-02-01

In northwest Poland, 163 blood and 53 fecal samples of wild boars were collected in winter 2012/13 and 2013/14. All blood samples were tested for the presence of hepatitis E virus (HEV) ribonucleic acid (RNA) by two reverse transcription-polymerase chain reaction (RT-PCR) based methods and by anti-HEV IgG enzyme-linked immunosorbent assay (ELISA). About 17.2% of blood samples were seropositive. One-step nested RT-PCR turned out to be too insensitive (11.6% were positive). Therefore a two-step nested RT-PCR was applied where 25.8% of the blood samples were tested positive for HEV RNA. About 50.0% of blood samples positive in ELISA were also positive in two-step nested RT-PCR. The prevalence of HEV RNA in feces was 9.4%. Based on the results of blood (ELISA, PCR) and fecal (PCR) tests, the overall prevalence of HEV in wild boars in northwest Poland was 36.8%. There was no correlation between the ELISA results and the presence of HEV RNA in plasma or in feces. According to the sequencing results of 348 bp PCR products of HEV, there were four different subtypes identified. Reports on the prevalence of HEV in wild boar populations are varying due to different sensitivities of the detection methods. However, this study reveals based on a highly sensitive method that HEV is widely spread in wild boar populations in the northwestern region of Poland and posing a potential risk to the consumer of game meat.

Rapid and sensitive detection of Curvularia lunata associated with maize leaf spot based on its Clg2p gene using semi-nested PCR.

PubMed

Hou, J M; Ma, B C; Zuo, Y H; Guo, L L; Gao, S G; Wang, Y Y; Liu, T

2013-04-01

Curvularia lunata (Wakker) Boed, the causative agent of Curvularia leaf spot in maize, was determined according to conidiophore and conidium morphology in a previous study. In the current study, a sensitive polymerase chain reaction assay was developed for the detection of C. lunata. Two specific forward (ClgD1/ClgD2) and one reverse primers (ClgD3) were designed based on a Ras-related (Clg2p) gene. Eight C. lunata isolates that represent different virulent strains in maize, six other Curvularia spp., and 22 fungal plant pathogens were used to test the specificity of the primers. PCR amplification using ClgD1/ClgD3 as the first-round primers resulted in an 870-bp band from the C. lunata isolates. The detection sensitivity using ClgD1/ClgD3 was 100 pg of genomic DNA. In the second round of PCR, a 1 : 50 dilution of the first-round PCR products was used as a template with the ClgD2/ClgD3 primer pair, which increased the detection sensitivity to 1 fg. This semi-nested PCR procedure could also be used to detect C. lunata from infected maize leaves. The proposed PCR-based assay may be used for diagnosing and monitoring maize Curvularia leaf spot. The semi-nested PCR assay may provide researchers and laboratory technologists a tool to rapidly detect C. lunata, which causes maize Curvularia leaf spot, compared with histological examination. © 2012 The Society for Applied Microbiology.

Detection of AR-V7 mRNA in whole blood may not predict the effectiveness of novel endocrine drugs for castration-resistant prostate cancer.

PubMed

Takeuchi, Takumi; Okuno, Yumiko; Hattori-Kato, Mami; Zaitsu, Masayoshi; Mikami, Koji

2016-01-01

A splice variant of androgen receptor (AR), AR-V7, lacks in androgen-binding portion and leads to aggressive cancer characteristics. Reverse transcription-polymerase chain reactions (PCRs) and subsequent nested PCRs for the amplification of AR-V7 and prostate-specific antigen (PSA) transcripts were done for whole blood of patients with prostate cancer and male controls. With primary reverse transcription PCRs, AR-V7 and PSA were detected in 4.5% and 4.7% of prostate cancer, respectively. With nested PCRs, AR-V7 messenger RNA (mRNA) was positive in 43.8% of castration-sensitive prostate cancer and 48.1% of castration-resistant prostate cancer (CRPC), while PSA mRNA was positive in 6.3% of castration-sensitive prostate cancer and 18.5% of CRPC. Whole-blood samples of controls showed AR-V7 mRNA expression by nested PCR. Based on multivariate analysis, expression of AR-V7 mRNA in whole blood was not significantly correlated with clinical parameters and PSA mRNA in blood, while univariate analysis showed a correlation between AR-V7 mRNA and metastasis at initial diagnosis. Detection of AR-V7 mRNA did not predict the reduction of serum PSA in patients with CRPC following abiraterone and enzalutamide administration. In conclusion, AR-V7 mRNA expression in normal hematopoietic cells may have annihilated the manifestation of aggressiveness of prostate cancer and the prediction of the effectiveness of abiraterone and enzalutamide by the assessment of AR-V7 mRNA in blood.

Molecular Identification of an Invasive Wood-Boring Insect Lyctus brunneus (Coleoptera: Bostrichidae: Lyctinae) Using Frass by Loop-Mediated Isothermal Amplification and Nested PCR Assays.

PubMed

Ide, Tatsuya; Kanzaki, Natsumi; Ohmura, Wakako; Okabe, Kimiko

2016-03-27

Lyctus brunneus(Stephens) is one of the most destructive and worldwide invasive pests of seasoned woods for wooden products. This and other pestLyctusspecies have had their distribution expanded by international and domestic human transportation of infested wood and wood products. Rapid detection and accurate identification ofLyctusspecies are effective tools for helping to eradicate them in new introduction sites. The accurate species-level identification of adults requires expert knowledge about their morphology. However, it takes much time and effort to recover suitable adult specimens because they are borers inside wood. Frass ofLyctusspecies can easily be detected and recovered in and around infested wood. Thus, frass was tested to see if it was a suitable sample to allow development of a rapid and technically easy molecular detection and identification method forL.brunneus.Species-specific primers were designed from the cytochrome c oxidase subunit I region ofL.brunneusand used in development and testing of methods for successfully identifying them from their frass using the loop-mediated isothermal amplification (LAMP) or species-specific nested polymerase chain reaction (PCR) assays. The LAMP assay was faster and more sensitive for detecting the presence of DNA derived fromL.brunneusin their frass than the nested PCR assay. These methodologies will be applicable for the rapid detection and identification of other wood-boring invasive pests in regulatory applications. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Partial characterization of new adenoviruses found in lizards.

PubMed

Ball, Inna; Behncke, Helge; Schmidt, Volker; Geflügel, F T A; Papp, Tibor; Stöhr, Anke C; Marschang, Rachel E

2014-06-01

In the years 2011-2012, a consensus nested polymerase chain reaction was used for the detection of adenovirus (AdV) infection in reptiles. During this screening, three new AdVs were detected. One of these viruses was detected in three lizards from a group of green striped tree dragons (Japalura splendida). Another was detected in a green anole (Anolis carolinensis). A third virus was detected in a Jackson's chameleon (Chamaeleo jacksonii). Analysis of a portion of the DNA-dependent DNA polymerase genes of each of these viruses revealed that they all were different from one another and from all previously described reptilian AdVs. Phylogenetic analysis of the partial DNA polymerase gene sequence showed that all newly detected viruses clustered within the genus Atadenovirus. This is the first description of AdVs in these lizard species.

Paper-based archiving of biological samples from fish for detecting betanodavirus.

PubMed

Navaneeth Krishnan, A; Bhuvaneswari, T; Ezhil Praveena, P; Jithendran, K P

2016-07-01

This study was carried out to evaluate the efficiency of the Flinders Technology Associates (FTA(®)) card (Whatman(®)) as a sampling device and storage platform for RNA from betanodavirus-infected biological samples (viz., larvae, broodstock, cell culture supernatants and rearing seawater spiked with infected materials). The study showed that FTA cards can be used to detect betanodaviruses by reverse transcription-polymerase chain reaction (RT-PCR). The diagnostic efficiency of RT-PCR from all sample types on FTA cards decreased after 21 days of storage at 4 °C, although the virus could be detected up to 28 days by nested RT-PCR. The FTA card protocol thus provides a supplementary method for quick and easy collection of samples, preservation of RNA on a dry storage basis, and detection of betanodavirus-infected fish.

Detection of Rickettsia rickettsii, Rickettsia parkeri, and Rickettsia akari in skin biopsy specimens using a multiplex real-time polymerase chain reaction assay.

PubMed

Denison, Amy M; Amin, Bijal D; Nicholson, William L; Paddock, Christopher D

2014-09-01

Rickettsia rickettsii, Rickettsia parkeri, and Rickettsia akari are the most common causes of spotted fever group rickettsioses indigenous to the United States. Infected patients characteristically present with a maculopapular rash, often accompanied by an inoculation eschar. Skin biopsy specimens are often obtained from these lesions for diagnostic evaluation. However, a species-specific diagnosis is achieved infrequently from pathologic specimens because immunohistochemical stains do not differentiate among the causative agents of spotted fever group rickettsiae, and existing polymerase chain reaction (PCR) assays generally target large gene segments that may be difficult or impossible to obtain from formalin-fixed tissues. This work describes the development and evaluation of a multiplex real-time PCR assay for the detection of these 3 Rickettsia species from formalin-fixed, paraffin-embedded (FFPE) skin biopsy specimens. The multiplex PCR assay was specific at discriminating each species from FFPE controls of unrelated bacterial, viral, protozoan, and fungal pathogens that cause skin lesions, as well as other closely related spotted fever group Rickettsia species. This multiplex real-time PCR demonstrates greater sensitivity than nested PCR assays in FFPE tissues and provides an effective method to specifically identify cases of Rocky Mountain spotted fever, rickettsialpox, and R. parkeri rickettsiosis by using skin biopsy specimens. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Rhinovirus viremia in children with respiratory infections.

PubMed

Xatzipsalti, Maria; Kyrana, Serena; Tsolia, Mariza; Psarras, Stelios; Bossios, Apostolos; Laza-Stanca, Vasile; Johnston, Sebastian L; Papadopoulos, Nikolaos G

2005-10-15

Viremia has been implicated in many viral infections; however, viremia due to rhinovirus (RV; rhinoviremia) has been considered not to occur in normal individuals. To evaluate whether RV enters the bloodstream and identify the possible risk factors. Nasopharyngeal washes (NPWs) of 221 children with respiratory infections were examined for the presence of RV by reverse transcription-polymerase chain reaction. Blood from 88 children, whose NPW was RV-positive, and 31 of RV-negative control subjects was subsequently examined for the presence of RV in the blood by semi-nested reverse transcription-polymerase chain reaction. Rhinoviremia was then correlated with clinical characteristics of the disease. RV was detected in the blood of 10 out of 88 NPW RV-positive cases (11.4%): 7 of 28 children with asthma exacerbations (25.0%), 2 of 26 with common cold (7.7%), 1 of 25 with bronchiolitis (4.0%), and 0 of 9 with pneumonia (0%). All NPW RV-negative cases were negative in the blood. The proportion of rhinoviremia in children with asthma exacerbation was significantly higher compared with children suffering from the other diseases (25 vs. 5%, p = 0.01). Significant risk factors were: sampling

Simple model of inhibition of chain-branching combustion processes

NASA Astrophysics Data System (ADS)

Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.

2017-11-01

A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.

Processing multiple non-adjacent dependencies: evidence from sequence learning

PubMed Central

de Vries, Meinou H.; Petersson, Karl Magnus; Geukes, Sebastian; Zwitserlood, Pienie; Christiansen, Morten H.

2012-01-01

Processing non-adjacent dependencies is considered to be one of the hallmarks of human language. Assuming that sequence-learning tasks provide a useful way to tap natural-language-processing mechanisms, we cross-modally combined serial reaction time and artificial-grammar learning paradigms to investigate the processing of multiple nested (A1A2A3B3B2B1) and crossed dependencies (A1A2A3B1B2B3), containing either three or two dependencies. Both reaction times and prediction errors highlighted problems with processing the middle dependency in nested structures (A1A2A3B3_B1), reminiscent of the ‘missing-verb effect’ observed in English and French, but not with crossed structures (A1A2A3B1_B3). Prior linguistic experience did not play a major role: native speakers of German and Dutch—which permit nested and crossed dependencies, respectively—showed a similar pattern of results for sequences with three dependencies. As for sequences with two dependencies, reaction times and prediction errors were similar for both nested and crossed dependencies. The results suggest that constraints on the processing of multiple non-adjacent dependencies are determined by the specific ordering of the non-adjacent dependencies (i.e. nested or crossed), as well as the number of non-adjacent dependencies to be resolved (i.e. two or three). Furthermore, these constraints may not be specific to language but instead derive from limitations on structured sequence learning. PMID:22688641

Transovarial transmission of dengue 1 virus in Aedes aegypti larvae: real-time PCR analysis in a Brazilian city with high mosquito population density.

PubMed

Moraes, Alexsander; Cortelli, Filipe C; Miranda, Taís B; Aquino, Davi R; Cortelli, José R; Guimarães, Maria Isabel A; Costa, Fernando O; Cortelli, Sheila C

2018-06-01

Transovarial transmission is among the reported factors able to influence environmental maintenance of dengue virus (DENV). Endemic areas with active transmission of dengue are suitable for studying transovarial transmission. Brazil is a country where dengue is endemic and where DENV-1 is the most common disease-related virus serotype. This study aimed to identify transovarial transmission of DENV-1 in Aedes aegypti larvae by reverse-transcriptase nested real-time polymerase chain reaction. Between March and October 2016, Culicidae larvae were collected using traps in 3 locations in Taubaté, São Paulo, Brazil, which has a high occurrence of dengue. The collected larvae were sacrificed in the 3rd or 4th larval stage, classified, and stored at -20 °C. The A. aegypti larvae samples (n = 910) were separated into 91 pools of 10 specimens each from which RNA was extracted, reverse transcribed into cDNA, and analyzed by nested qPCR. None of the pools tested positive for DENV-1. Due to the absence of detectable virus in the evaluated samples, we concluded that transovarial transmission may not be the primary mechanism for maintenance of DENV-1 in this particular environment.

Bench-top validation testing of selected immunological and molecular Renibacterium salmoninarum diagnostic assays by comparison with quantitative bacteriological culture

USGS Publications Warehouse

Elliott, D.G.; Applegate, L.J.; Murray, A.L.; Purcell, M.K.; McKibben, C.L.

2013-01-01

No gold standard assay exhibiting error-free classification of results has been identified for detection of Renibacterium salmoninarum, the causative agent of salmonid bacterial kidney disease. Validation of diagnostic assays for R. salmoninarum has been hindered by its unique characteristics and biology, and difficulties in locating suitable populations of reference test animals. Infection status of fish in test populations is often unknown, and it is commonly assumed that the assay yielding the most positive results has the highest diagnostic accuracy, without consideration of misclassification of results. In this research, quantification of R. salmoninarum in samples by bacteriological culture provided a standardized measure of viable bacteria to evaluate analytical performance characteristics (sensitivity, specificity and repeatability) of non-culture assays in three matrices (phosphate-buffered saline, ovarian fluid and kidney tissue). Non-culture assays included polyclonal enzyme-linked immunosorbent assay (ELISA), direct smear fluorescent antibody technique (FAT), membrane-filtration FAT, nested polymerase chain reaction (nested PCR) and three real-time quantitative PCR assays. Injection challenge of specific pathogen-free Chinook salmon, Oncorhynchus tshawytscha (Walbaum), with R. salmoninarum was used to estimate diagnostic sensitivity and specificity. Results did not identify a single assay demonstrating the highest analytical and diagnostic performance characteristics, but revealed strengths and weaknesses of each test.

Prevalence of Anaplasma, Bartonella and Borrelia Species in Haemaphysalis longicornis collected from goats in North Korea

PubMed Central

Kang, Jun-Gu; Ko, Sungjin; Smith, W. Barney; Kim, Heung-Chul; Lee, In-Yong

2016-01-01

North Korea is located on the northern part of the Korean Peninsula in East Asia. While tick-borne pathogens of medical and veterinary importance have been reported from China and South Korea, they have not been reported from North Korea. To screen for zoonotic tick-borne pathogens in North Korea, ticks were collected from domestic goats. A total of 292 (27 nymph, 26 male, 239 female) Haemaphysalis (H.) longicornis were collected and assayed individually for selected tick-borne pathogens. A total of 77 (26.4%) were positive for Anaplasma bovis, followed by Bartonella (B.) grahamii (15, 5.1%), Anaplasma phagocytophilum (12, 4.1%), Bartonella henselae (10, 3.4%), and Borrelia spp. (3, 1.0%) based on 16S ribosomal RNA and ITS species-specific nested polymerase chain reaction. Using the groEL-based nested PCR, a total of 6 and 1 H. longicornis were positive for B. grahamii and B. henselae, respectively. All products were sequenced and demonstrated 100% identity and homology with previously reported sequences from other countries in GenBank. This is the first report of the detection of tick-borne pathogens in the North Korea and suggests that farm animals may act as reservoirs for zoonotic tick-borne pathogens. PMID:26645342

Herpesviruses in Abscesses and Cellulitis of Endodontic Origin

PubMed Central

Chen, Vicky; Chen, Yanwen; Li, Hong; Kent, Karla; Baumgartner, J. Craig; Machida, Curtis A.

2009-01-01

Acute apical abscesses and cellulitis are severe endodontic diseases caused by opportunistic bacteria with possible co-infection with latent herpesviruses. The objectives of this study are to identify herpesviruses, including human cytomegalovirus (HCMV), Epstein-Barr virus (EBV), herpes simplex virus-1 (HSV-1) and Varicella zoster virus (VZV), in patients (n=31) presenting with acute apical abscesses and cellulitis of endodontic origin. Primary and nested polymerase chain reaction (PCR) was conducted using virus-specific primers and DNA isolated from cell-free abscess fluid. From patients exhibiting concurrent spontaneous pain (n=28), nine abscesses contained HCMV, two abscesses contained EBV, one abscess contained HSV-1, and no abscesses contained VZV. Control PCR using genomic or recombinant templates demonstrated detection limits to a single genomic copy of HCMV, 100 genomic copies for EBV, and 1-10 copies for HSV-1, with no cross-amplification between herpesviral DNA targets. Nested PCR was required for detection of herpesviral DNA in the abscess specimens, indicating that these viruses were present in low copy number. Filtration of abscess specimens and virus transfer experiments using human fibroblastic MRC-5 cells confirmed the presence of HCMV particles in several abscess specimens. We conclude that herpesviruses are present, but not required for development of acute apical abscesses and cellulitis of endodontic origin. PMID:19166769

Prevalence of Anaplasma, Bartonella and Borrelia Species in Haemaphysalis longicornis collected from goats in North Korea.

PubMed

Kang, Jun-Gu; Ko, Sungjin; Smith, W Barney; Kim, Heung-Chul; Lee, In-Yong; Chae, Joon-Seok

2016-06-30

North Korea is located on the northern part of the Korean Peninsula in East Asia. While tick-borne pathogens of medical and veterinary importance have been reported from China and South Korea, they have not been reported from North Korea. To screen for zoonotic tick-borne pathogens in North Korea, ticks were collected from domestic goats. A total of 292 (27 nymph, 26 male, 239 female) Haemaphysalis (H.) longicornis were collected and assayed individually for selected tick-borne pathogens. A total of 77 (26.4%) were positive for Anaplasma bovis, followed by Bartonella (B.) grahamii (15, 5.1%), Anaplasma phagocytophilum (12, 4.1%), Bartonella henselae (10, 3.4%), and Borrelia spp. (3, 1.0%) based on 16S ribosomal RNA and ITS species-specific nested polymerase chain reaction. Using the groEL-based nested PCR, a total of 6 and 1 H. longicornis were positive for B. grahamii and B. henselae, respectively. All products were sequenced and demonstrated 100% identity and homology with previously reported sequences from other countries in GenBank. This is the first report of the detection of tick-borne pathogens in the North Korea and suggests that farm animals may act as reservoirs for zoonotic tick-borne pathogens.

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

Chain-reaction crash in traffic flow controlled by taillights

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-02-01

We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.

Learning and discrimination of cuticular hydrocarbons in a social insect

PubMed Central

van Wilgenburg, Ellen; Felden, Antoine; Choe, Dong-Hwan; Sulc, Robert; Luo, Jun; Shea, Kenneth J.; Elgar, Mark A.; Tsutsui, Neil D.

2012-01-01

Social insect cuticular hydrocarbon (CHC) mixtures are among the most complex chemical cues known and are important in nest-mate, caste and species recognition. Despite our growing knowledge of the nature of these cues, we have very little insight into how social insects actually perceive and discriminate among these chemicals. In this study, we use the newly developed technique of differential olfactory conditioning to pure, custom-designed synthetic colony odours to analyse signal discrimination in Argentine ants, Linepithema humile. Our results show that tri-methyl alkanes are more easily learned than single-methyl or straight-chain alkanes. In addition, we reveal that Argentine ants can discriminate between hydrocarbons with different branching patterns and the same chain length, but not always between hydrocarbons with the same branching patterns but different chain length. Our data thus show that biochemical characteristics influence those compounds that ants can discriminate between, and which thus potentially play a role in chemical signalling and nest-mate recognition. PMID:21831880

ONR Far East Scientific Information Bulletin

DTIC Science & Technology

1990-09-01

In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by

Aspergillus fumigatus and other thermophilic fungi in nests of wetland birds.

PubMed

Korniłłowicz-Kowalska, Teresa; Kitowski, Ignacy

2013-02-01

A study was performed on the numbers and species diversity of thermophilic fungi (growing at 45 °C in vitro) in 38 nests of 9 species of wetland birds, taking into account the physicochemical properties of the nests and the bird species. It was found that in nests with the maximum weight (nests of Mute Swan), the number and diversity of thermophilic fungi were significantly greater than in other nests, with lower weight. The diversity of the thermophilic biota was positively correlated with the individual mass of bird and with the level of phosphorus in the nests. The dominant species within the mycobiota under study was Aspergillus fumigatus which inhabited 95% of the nests under study, with average frequency of ca. 650 cfu g(-1) of dry mass of the nest material. In a majority of the nests studied (nests of 7 bird species), the share of A. fumigatus exceeded 50% of the total fungi growing at 45 °C. Significantly higher frequencies of the fungal species were characteristic of the nests of small and medium-sized piscivorous species, compared with the other bird species. The number of A. fumigatus increased with increase in the moisture level of the nests, whereas the frequency of occurrence of that opportunistic pathogen, opposite to the general frequency of thermophilic mycobiota, was negatively correlated with the level of phosphorus in the nest material, and with the body mass and length of the birds. The authors indicate the causes of varied growth of thermophilic fungi in nests of wetland birds and, in particular, present a discussion of the causes of accumulation of A. fumigatus, the related threats to the birds, and its role as a source of transmission in the epidemiological chain of aspergillosis.

Effect of perception irregularity on chain-reaction crash in low visibility

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-06-01

We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.

Genetic Diversity of Plasmodium falciparum Merozoite Surface Protein-1 Block 2 in Sites of Contrasting Altitudes and Malaria Endemicities in the Mount Cameroon Region

PubMed Central

Wanji, Samuel; Kengne-Ouafo, Arnaud J.; Joan Eyong, Ebanga E.; Kimbi, Helen K.; Tendongfor, Nicholas; Ndamukong-Nyanga, Judith L.; Nana-Djeunga, Hugues C.; Bourguinat, Catherine; Sofeu-Feugaing, David D.; Charvet, Claude L.

2012-01-01

The present study analyzed the relationship between the genetic diversity of Plasmodium falciparum and parasitologic/entomologic indices in the Mount Cameroon region by using merozoite surface protein 1 as a genetic marker. Blood samples were collected from asymptomatic children from three altitude zones (high, intermediate, and low). Parasitologic and entomologic indices were determined by microscopy and landing catch mosquito collection/circumsporozoite protein–enzyme-linked immunosorbent assay, respectively. A total of 142 randomly selected P. falciparum-positive blood samples were genotyped by using a nested polymerase chain reaction–based technique. K-1 polymerase chain reaction products were also sequenced. As opposed to high altitude, the highest malaria prevalence (70.65%) and entomologic inoculation rate (2.43 infective/bites/night) were recorded at a low altitude site. Seven (18.91%), 22 (36.66%), and 19 (42.22%) samples from high, intermediate, and low altitudes, respectively, contained multiclonal infections. A new K-1 polymorphism was identified. This study shows a positive non-linear association between low/intermediate altitude (high malaria transmission) and an increase in P. falciparum merozoite surface protein 1 block 2 polymorphisms. PMID:22556072

Significance of detecting circulating hepatocellular carcinoma cells in peripheral blood of hepatocellular carcinoma patients by nested reverse transcription-polymerase chain reaction and its clinical value: a retrospective study.

PubMed

Liu, Yang; Wang, Yue-ru; Wang, Long; Song, Rui-mei; Zhou, Bo; Song, Zhen-shun

2014-01-01

Circulating hepatocellular carcinoma cells may be detected by reverse transcription-polymerase chain reaction. We investigated the relationship between circulating hepatocellular carcinoma cells and hepatoma patient survival after different managements and survival periods. Peripheral vein blood (5 ml) samples were obtained from 113 patients with hepatocellular carcinoma and from 33 control subjects (9 with liver cirrhosis after hepatitis B, 14 with chronic hepatitis B, 10 healthy individuals) between January 1, 2009, and December 31, 2013. To detect circulating hepatocellular carcinoma cells in peripheral blood, alpha-fetoprotein messenger RNA was amplified from total RNA extracted from whole blood by reverse transcription-polymerase chain reaction. Alpha-fetoprotein messenger RNA was detected in 59 blood samples from the hepatocellular carcinoma patients (59/113, 52.2%). In contrast, there were no clinical control subjects whose samples showed detectable alpha-fetoprotein messenger RNA. The presence of alpha-fetoprotein messenger RNA in blood seemed to be correlated with the stage (by TNM classification) of hepatocellular carcinoma, serum alpha-fetoprotein value, and the presence of intrahepatic metastasis, portal vein thrombosis, tumor diameter and/or distant metastasis. In addition, alpha-fetoprotein messenger RNA was detected in the blood of 25 patients showing distant metastasis at extrahepatic organs (100%), in contrast to 32 of 88 cases without metastasis (36.4%). All the patients with hepatocellular carcinoma were followed. Seventeen patients with resection of a T 2 stage hepatocellular carcinoma had a survival of 3.2 years after surgical management, 38 cases with resection of a T3 stage hepatocellular carcinoma had a 1.3-year survival, and only 37 cases with T4 stage disease after different treatments except surgery survived for 0.6 years (P <0.01). The presence of alpha-fetoprotein messenger RNA in peripheral blood may be an indicator of circulating hepatocellular carcinoma cells, which might predict hematogenous spreading metastasis in patients with hepatocellular carcinoma and may be a poor prognostic factor for hepatocellular carcinoma patients.

Chain-reaction crash on a highway in high visibility

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2016-05-01

We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

No association between Epstein-Barr Virus and Mouse Mammary Tumor Virus with Breast Cancer in Mexican Women

NASA Astrophysics Data System (ADS)

Morales-Sánchez, Abigail; Molina-Muñoz, Tzindilú; Martínez-López, Juan L. E.; Hernández-Sancén, Paulina; Mantilla, Alejandra; Leal, Yelda A.; Torres, Javier; Fuentes-Pananá, Ezequiel M.

2013-10-01

Breast cancer is the most frequent malignancy affecting women worldwide. It has been suggested that infection by Epstein Barr Virus (EBV), Mouse Mammary Tumor Virus or a similar virus, MMTV-like virus (MMTV-LV), play a role in the etiology of the disease. However, studies looking at the presence of these viruses in breast cancer have produced conflicting results, and this possible association remains controversial. Here, we used polymerase chain reaction assay to screen specific sequences of EBV and MMTV-LV in 86 tumor and 65 adjacent tissues from Mexican women with breast cancer. Neither tumor samples nor adjacent tissue were positive for either virus in a first round PCR and only 4 tumor samples were EBV positive by a more sensitive nested PCR. Considering the study's statistical power, these results do not support the involvement of EBV and MMTV-LV in the etiology of breast cancer.

Detection of Ehrlichia chaffeensis in adult and nymphal stage lone star ticks (Amblyomma americanum) from Long Island, New York

USGS Publications Warehouse

Mixson, T.R.; Ginsberg, H.S.; Campbell, S.R.; Sumner, J.W.; Paddock, C.D.

2004-01-01

The lone star tick, Amblyomma americanum (L.), has increased in abundance in several regions of the northeastern United States, including areas of Long Island, NY. Adult and nymphal stage A. americanum collected from several sites on Long Island were evaluated for infection with Ehrlichia chaffeensis, the causative agent of human monocytic ehrlichiosis (HME), by using a nested polymerase chain reaction assay. Fifty-nine (12.5%) of ,17.3 adults and eight of 11.3 pools of five nymphs each (estimated minimum prevalence of infection 1.4%) contained DNA of E. chaffeensis. These data, coupled with the documented expansion of lone star tick populations in the northeastern United States, confirm that E. chaffeensis is endemic to many areas of Long Island and that HME should be considered among the differential diagnoses of the many distinct tick-borne diseases that occur in this region.

Detection of hepatitis E virus (HEV) through the different stages of pig manure composting plants

PubMed Central

García, M; Fernández-Barredo, S; Pérez-Gracia, M T

2014-01-01

Hepatitis E virus (HEV) is an increasing cause of acute hepatitis in industrialized countries. The aim of this study was to evaluate the presence of HEV in pig manure composting plants located in Spain. For this purpose, a total of 594 samples were taken in 54 sampling sessions from the different stages of composting treatment in these plants as follows: slurry reception ponds, anaerobic ponds, aerobic ponds, fermentation zone and composting final products. HEV was detected by reverse transcription polymerase chain reaction (RT-nested PCR) in four (80%) of five plants studied, mainly in the first stages of the process. HEV was not detected in any final product (compost) sample, destined to be commercialized as a soil fertilizer, suggesting that composting is a suitable method to eliminate HEV and thus, to reduce the transmission of HEV from pigs to humans. PMID:24206540

Torque teno virus infection in male commercial sex workers in Surakarta Indonesia

NASA Astrophysics Data System (ADS)

Prasetyo, Afiono Agung; Luvi, Sabrina Damara; Hartono, Sari, Yulia

2017-02-01

The molecular epidemiology data of torque teno virus (TTV) in Indonesia is very rare. This study evaluated the prevalence of TTV in male commercial sex workers, as one of the high risk community for blood borne viruses pathogens in Surakarta, Indonesia. All blood samples collected from male commercial sex workers in Surakarta in 2009-2013 were tested by nested polymerase chain reaction (PCR). The amplified PCR products were molecularly cloned and subjected to sequence analysis. TTV DNA was detected in 80.9% (72/89) samples. Furthermore, the molecular characterization revealed that the most prevalent was genogroup 3, followed by genogroup 2 and l, respectively. TTV was detected in male commercial sex workers in Surakarta with high infection rate. Further investigation about TTV circulation in Indonesian population is needed in order to provide additional information about the genetic variability and TTV epidemiology in Indonesia, especially in the high risk communities.

[Effect of fluoride on gut microflora of silkworm (Bombyx mori)].

PubMed

Li, Guannan; Xia, Xuejuan; Sendegeya, Parfait; Zhao, Huanhuan; Long, Yaohang; Zhu, Yong

2015-07-04

We examined the effect of fluoride on gut microflora of silkworm. After DNA extraction and PCR amplification, clone libraries of 16S rRNA gene fragment were constructed. Amplified ribosomal DNA restriction analysis (ARDRA) was performed by digestion of the 16S rRNA gene, and each unique restriction fragment polymorphism pattern was designated as an operational taxonomic unit (OTU). A total of 14 OTUs were identified from intestinal samples of both T6 and 734. Phylogenetic trees of bacterial 16S rRNA nucleotide sequences were constructed and analyzed. Furthermore, the dominant bacteria were studied by the nested polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DDGE) technology. After fluorosis, the flora of Enterococcus and Bacillus reduced. However, the flora of Staphylococcus increased. Fluoride can destroy the balance of microflora in the gut of silkworm by changing the bacteria diversity and proportion, which has bigger effect to 734 than T6.

Detection and molecular identification of Cryptosporidium species in laboratory rats (Rattus norvegicus) in Ibadan, Nigeria

PubMed

Ayinmode, Adekunle Bamidele; Ogbonna, Nkeiruka Fortunate; Widmer, Giovanni

To study the occurrence of Cryptosporidium infection in laboratory rats (Rattus norvegicus) raised for experimental usage, 134 faecal samples were obtained from two rearing houses in Ibadan and examined for the presence of Cryptosporidium oocyst using the modified acid fast staining technique. Cryptosporidium species in 2 samples positive for microscopy were further characterized by a nested polymerase chain reaction (PCR) amplifying the 18S rRNA gene. Two of 134 samples were positive for the Cryptosporidium oocysts. Sequencing of the small-subunit rRNA amplicons identified the species in the two PCR positive samples as Cryptosporidium andersoni and Cryptosporidium rat genotype. These findings showed that laboratory rat is a potential reservoir for diverse Cryptosporidium species and suggests that laboratory rats should be screened for Cryptosporidium infection prior to experiments, especially where pathogen free animals are not available. This the first report to identify Cryptosporidium species infecting laboratory rats in Nigeria.

[Real-time PCR detection of Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae DNA in clinical specimens].

PubMed

Vacková, Z; Lžičařová, D; Stock, N K; Kozáková, J

2015-10-01

The study aim was to implement a molecular real-time polymerase chain reaction (PCR) assay recommended by the CDC (Centers for Disease Control and Prevention) for the detection of Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae in clinical (culture negative) specimens from patients with suspected invasive bacterial disease. Clinical specimens are referred to the National Reference Laboratory (NRL) for Meningococcal Infections, Unit for Airborne Bacterial Infections, Centre for Epidemiology and Microbiology, National Institute of Public Health from various regions of the Czech Republic. Clinical specimens are, in particular, cerebrospinal fluid, anti-coagulated blood or serum and, exceptionally, post-mortem specimens. The NRL has implemented molecular diagnosis of these bacterial pathogens involved in meningitis and sepsis from clinical specimens since 1999. The first diagnostic method was semi-nested PCR followed by electrophoretic analysis. In 2014, a molecular qualitative real-time PCR assay was implemented.

Molecular identification of Giardia and Cryptosporidium from dogs and cats

PubMed Central

Sotiriadou, Isaia; Pantchev, Nikola; Gassmann, Doreen; Karanis, Panagiotis

2013-01-01

The aim of the present study was to diagnose the presence of Giardia cysts and Cryptosporidium oocysts in household animals using nested polymerase chain reaction (PCR) and sequence analysis. One hundred faecal samples obtained from 81 dogs and 19 cats were investigated. The Cryptosporidium genotypes were determined by sequencing a fragment of the small subunit (SSU) rRNA gene, while the Giardia Assemblages were determined through analysis of the glutamate dehydrogenase (GDH) locus. Isolates from five dogs and two cats were positive by PCR for the presence of Giardia, and their sequences matched the zoonotic Assemblage A of Giardia. Cryptosporidium spp. isolated from one dog and one cat were both found to be C. parvum. One dog isolate harboured a mixed infection of C. parvum and Giardia Assemblage A. These findings support the growing evidence that household animals are potential reservoirs of the zoonotic pathogens Giardia spp. and Cryptosporidium spp. for infections in humans. PMID:23477297

Torque Teno Virus in HIV-infected transgender in Surakarta, Indonesia

NASA Astrophysics Data System (ADS)

Hartono; Agung Prasetyo, Afiono; Fanani, Mohammad

2018-05-01

Torque Teno Virus (TTV) is a circular single-stranded DNA virus that may co-infected with human immunodeficiency virus (HIV), especially in the high-risk community e.g. the transgender performing high-riskbehavior. TTV shows an increased viremia in HIV patients and maybe influence the HIV clinical progression. Blood samples collected from transgender performing high-riskbehavior in Surakarta were tested by serological and molecular assays to detect the presence of HIV infection. The blood samples with HIV positive status were then tested by a nested polymerase chain reaction (PCR) to detect the presentation of TTV DNA. The amplified PCR products were molecularly cloned and subjected to sequence analysis. TTV DNA was detected in 40.0% HIV-positive samples. The molecular characterization revealed that the most prevalent was genogroup 3, followed by genogroup 2 and 1, respectively. TTV was detected in HIV-infected transgender performing high-riskbehavior in Surakarta with high infection rate.

Effect of vehicular size on chain-reaction crash

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-11-01

We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

Kinetic aspects of chain growth in Fischer-Tropsch synthesis.

PubMed

Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M

2017-04-28

Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.

Are Nested Networks More Robust to Disturbance? A Test Using Epiphyte-Tree, Comensalistic Networks

PubMed Central

Piazzon, Martín; Larrinaga, Asier R.; Santamaría, Luis

2011-01-01

Recent research on ecological networks suggests that mutualistic networks are more nested than antagonistic ones and, as a result, they are more robust against chains of extinctions caused by disturbances. We evaluate whether mutualistic networks are more nested than comensalistic and antagonistic networks, and whether highly nested, host-epiphyte comensalistic networks fit the prediction of high robustness against disturbance. A review of 59 networks including mutualistic, antagonistic and comensalistic relationships showed that comensalistic networks are significantly more nested than antagonistic and mutualistic networks, which did not differ between themselves. Epiphyte-host networks from old-growth forests differed from those from disturbed forest in several topological parameters based on both qualitative and quantitative matrices. Network robustness increased with network size, but the slope of this relationship varied with nestedness and connectance. Our results indicate that interaction networks show complex responses to disturbances, which influence their topology and indirectly affect their robustness against species extinctions. PMID:21589931

Prevalence of tick-borne encephalitis virus in ixodid ticks collected from the republic of Korea during 2011-2012.

PubMed

Yun, Seok-Min; Song, Bong Gu; Choi, Wooyoung; Park, Won Il; Kim, Sung Yun; Roh, Jong Yul; Ryou, Jungsang; Ju, Young Ran; Park, Chan; Shin, E-Hyun

2012-12-01

In this study, we demonstrated that TBEV-infected ticks have been distributed in the ROK, combined with our previous results. These results suggest that TBEV may exist in the ROK, and H. longicornis, H. flava, and I. nipponensis may be potential vectors of TBEV. In addition, these results emphasize the need for further epidemiological research of TBEV. We examined for the presence of RNA of TBEV by reverse transcriptase-nested polymerase chain reaction (RT-nested PCR) using ixodid ticks captured in 25 localities of 10 provinces. Ticks were collected by the flagging and dragging method or using sentinel BG traps at forests, grass thickets, and grassland. A total of 13,053 ticks belonging to two genera and four species were collected and pooled (1292 pools), according to collection site, species of tick, and developmental stage. Among 1292 pools, the envelope (E) protein gene of TBEV was detected using RT-nested PCR in 10 pools (3 pools of the 1,331 adult ticks and 7 pools of the 11,169 nymph ticks) collected from Gangwon-do province, Jeonrabuk-do province, and Jeju Island. The minimum infection rates for TBEV of Haemaphysalis longicornis, Haemaphysalis flava, and Ixodes nipponensis were 0.06%, 0.17%, and 2.38%, respectively. Phylogenetic analysis based on the partial E protein gene was performed to identify relationships between the TBEV strains. This showed that 10 Korean strains clustered with the Western subtype. In this study, we investigated the prevalence of tick-borne encephalitis virus (TBEV) in ixodid ticks from various regions of the Republic of Korea (ROK) during 2011-2012 to identify whether TBEV is circulating and to determine the endemic regions of TBEV.

A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene.

PubMed

Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

2016-07-01

The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.

Comparison between single PCR and nested PCR in detection of human papilloma viruses in paraffin-embedded OSCC and fresh oral mucosa.

PubMed

Jalouli, Miranda; Jalouli, Jamshid; Ibrahim, Salah O; Hirsch, Jan-Michaél; Sand, Lars

2015-01-01

Infection with human papilloma virus (HPV) has been implicated as one of the risk factors for the development of oropharyngeal cancer. Many different HPV tests exist, and information regarding their specific technical, analytical, and clinical properties is increasing. This study aimed to compare the level of detection of HPV using two reliable polymerase chain reaction (PCR) methods, nested PCR (NPCR) and single PCR (SPCR), in archival paraffin-embedded oral squamous cell carcinoma (OSCC) samples and fresh oral mucosa specimens. The presence of HPV genome in two groups of tissue samples was analyzed: (i) 57 paraffin-embedded OSCC samples from Sudan and (ii) eight healthy fresh oral mucosal samples from Swedish volunteers. The specimens were tested by SPCR with primer pair MY9/MY11 and NPCR using GP5+/GP6+ primer sets. Eighteen (32%) out of the 57 paraffin-embedded OSCC samples, and five (62%) out of the eight fresh clinically healthy samples were found to be HPV-positive with NPCR. With SPCR, four (7%) out of the paraffin-embedded OSCC samples were HPV-positive. A statistically significant difference between HPV-positive and -negative samples was found when comparing NPCR and SPCR in OSCC and fresh oral mucosa (p<0.0001). The comparative test between SPCR and NPCR showed 100% sensitivity and 69% specificity for OSCC. The use of the GP5+/GP6+ nested PCR increased the positivity rate, efficiency rate and sensitivity of HPV detection in oral samples significantly and should be considered as the method of choice. Copyright © 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Detection and molecular characterization of Babesia, Theileria, and Hepatozoon species in hard ticks collected from Kagoshima, the southern region in Japan.

PubMed

Masatani, Tatsunori; Hayashi, Kei; Andoh, Masako; Tateno, Morihiro; Endo, Yasuyuki; Asada, Masahito; Kusakisako, Kodai; Tanaka, Tetsuya; Gokuden, Mutsuyo; Hozumi, Nodoka; Nakadohzono, Fumiko; Matsuo, Tomohide

2017-06-01

To reveal the distribution of tick-borne parasites, we established a novel nested polymerase chain reaction (PCR) system to detect the most common agents of tick-borne parasitic diseases, namely Babesia, Theileria, and Hepatozoon parasites. We collected host-seeking or animal-feeding ticks in Kagoshima Prefecture, the southernmost region of Kyusyu Island in southwestern Japan. Twenty of the total of 776 tick samples displayed a specific band of the appropriate size (approximately 1.4-1.6kbp) for the 18S rRNA genes in the novel nested PCR (20/776: 2.58%). These PCR products have individual sequences of Babesia spp. (from 8 ticks), Theileria spp. (from 9 ticks: one tick sample including at least two Theileria spp. sequences), and Hepatozoon spp. (from 3 ticks). Phylogenetic analyses revealed that these sequences were close to those of undescribed Babesia spp. detected in feral raccoons in Japan (5 sequences; 3 sequences being identical), Babesia gibsoni-like parasites detected in pigs in China (3 sequences; all sequences being identical), Theileria spp. detected in sika deer in Japan and China (10 sequences; 2 sequences being identical), Hepatozoon canis (one sequence), and Hepatozoon spp. detected in Japanese martens in Japan (two sequences). In summary, we showed that various tick-borne parasites exist in Kagoshima, the southern region in Japan by using the novel nested PCR system. These including undescribed species such as Babesia gibsoni-like parasites previously detected in pigs in China. Importantly, our results revealed new combinations of ticks and protozoan parasites in southern Japan. The results of this study will aid in the recognition of potential parasitic animal diseases caused by tick-borne parasites. Copyright © 2017 Elsevier GmbH. All rights reserved.

A survey of microbial community diversity in marine sediments impacted by petroleum hydrocarbons from the Gulf of Mexico and Atlantic shorelines, Texas to Florida

USGS Publications Warehouse

Lisle, John T.; Stellick, Sarah H.

2011-01-01

Microbial community genomic DNA was extracted from sediment samples collected along the Gulf of Mexico and Atlantic coasts from Texas to Florida. Sample sites were identified as being ecologically sensitive and (or) as having high potential of being impacted by Macondo-1 (M-1) well oil from the Deepwater Horizon blowout. The diversity within the microbial communities associated with the collected sediments provides a baseline dataset to which microbial community-diversity data from impacted sites could be compared. To determine the microbial community diversity in the samples, genetic fingerprints were generated and compared. Specific sequences within the community genomic DNA were first amplified using the polymerase chain reaction (PCR) with a primer set that provides possible resolution to the species level. A second nested PCR was performed on the primary PCR products using a primer set on which a GC-clamp was attached to one of the primers. The nested PCR products were separated using denaturing-gradient gel electrophoresis (DGGE) that resolves the nested PCR products based on sequence dissimilarities (or similarities), forming a genomic fingerprint of the microbial diversity within the respective samples. Samples with similar fingerprints were grouped and compared to oil-fingerprint data from the same sites (Rosenbauer and others, 2011). The microbial community fingerprints were generally grouped into sites that had been shown to contain background concentrations of non-Deepwater Horizon oil. However, these groupings also included sites where no oil signature was detected. This report represents some of the first information on naturally occurring microbial communities in sediment from shorelines along the Gulf of Mexico and Atlantic coasts from Texas to Florida.

Understanding Predictability of the Ocean

DTIC Science & Technology

2011-09-30

information if it does not display a currently valid OMB control number. 1. REPORT DATE 30 SEP 2011 2. REPORT TYPE 3. DATES COVERED 00-00-2011 to 00-00...source of barotropic-to-baroclinic tidal energy conversion. In the region around the islands, the internal tidal energy is as much as 50% of the...PacIOOS currently employs four nested ROMS models: 4km island-chain, 1km Oahu, 100m Oahu South-Shore, and 80m Oahu West-Coast. Each grid is nested in

Evaluation of the utility of conventional polymerase chain reaction for detection and species differentiation in human hookworm infections.

PubMed

Chidambaram, Meenachi; Parija, Subhash Chandra; Toi, Pampa Ch; Mandal, Jharna; Sankaramoorthy, Dhanalakshmi; George, Santosh; Natarajan, Mailan; Padukone, Shashiraja

2017-01-01

Human hookworm infection is caused mainly by Necator americanus and Ancylostoma duodenale . Among the zoonotic hookworm species, only Ancylostoma ceylanicum causes potent human infections where dogs and cats act as reservoir of infection. Hence, species differentiation is imperative because the eradication of both anthroponotic and zoonotic hookworm depends on the concurrent human and animal health programs, hygienic practices, and mass drug administration for humans and dogs. This study was performed to evaluate the utility of polymerase chain reaction (PCR) for detection of hookworm infections. A total of 209 stool samples were collected and subjected to stool microscopy, Kato-Katz method to identify the intensity of the infection, coproculture for L3 larval identification and species differentiation and semi-nested PCR with sequencing. The prevalence of hookworm was estimated as 7.6%. Highest hookworm prevalence was seen in 20-30 years of age group. Majority of the infections were mild intensity infections. Sensitivity of stool microscopy was found to be 81.2% and the specificity was 100%. Sensitivity of Kato-Katz method was 87.5% and specificity was 100%. True positivity by agar plate culture was 83.3% and false positivity rate was 16.6%. Stool microscopy is the major mode of detection, but it has a higher false negative rate. Coproculture is time-consuming and needs the expertise to differentiate the species. On the other hand, PCR is known to be a sensitive, specific, and a reliable investigative tool which can help in diagnosis as well as in species differentiation.

Novel Mutations in pncA Gene of Pyrazinamide Resistant Clinical Isolates of Mycobacterium tuberculosis.

PubMed

Kahbazi, Manijeh; Sarmadian, Hossein; Ahmadi, Azam; Didgar, Farshideh; Sadrnia, Maryam; Poolad, Toktam; Arjomandzadegan, Mohammad

2018-04-16

In clinical isolates of Mycobacterium tuberculosis (MTB), resistance to pyrazinamide occurs by mutations in any positions of the pncA gene (NC_000962.3) especially in nucleotides 359 and 374. In this study we examined the pncA gene sequence in clinical isolates of MTB. Genomic DNA of 33 clinical isolates of MTB was extracted by the Chelex100 method. The polymerase chain reactions (PCR) were performed using specific primers for amplification of 744 bp amplicon comprising the coding sequences (CDS) of the pncA gene. PCR products were sequenced by an automated sequencing Bioscience system. Additionally, semi Nested-allele specific (sNASP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods were carried out for verification of probable mutations in nucleotides 359 and 374. Sequencing results showed that from 33 MTB clinical isolates, nine pyrazinamide-resistant isolates have mutations. Furthermore, no mutation was detected in 24 susceptible strains in the entire 561 bp of the pncA gene. Moreover, new mutations of G→A at position 3 of the pncA gene were identified in some of the resistant isolates. Results showed that the sNASP method could detect mutations in nucleotide 359 and 374 of the pncA gene, but the PCR-RFLP method by the SacII enzyme could not detect these mutations. In conclusion, the identification of new mutations in the pncA gene confirmed the probable occurrence of mutations in any nucleotides of the pncA gene sequence in resistant isolates of MTB.

Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

PubMed

Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

2015-01-01

Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

Herpesviruses viral loads and levels of proinflammatory cytokines in apical periodontitis.

PubMed

Jakovljevic, A; Knezevic, A; Nikolic, N; Soldatovic, I; Jovanovic, T; Milasin, J; Andric, M

2018-07-01

This study aimed to analyse Epstein-Barr virus (EBV) and human cytomegalovirus (HCMV) viral loads in symptomatic and asymptomatic apical periodontitis lesions, to determine levels of TNF-α, IL-1β and IL-6 in these lesions and to investigate a possible correlation between herpesviral copy numbers and levels of proinflammatory cytokines. A total of 100 samples of apical periodontitis were subjected to HCMV and EBV copy numbers analysis by nested polymerase chain reaction (PCR) and TaqMan real-time PCR. The concentrations of TNF-α, IL-1β and IL-6 were determined by ELISA method. SPSS software was used for statistical analysis. There were no significant differences in the occurrence of EBV and HCMV between symptomatic and asymptomatic periapical lesions (p = .686, p = .879, respectively). Only 12 of 74 EBV (16.2%) and four of 54 HCMV (13.5%) nested PCR-positive samples showed increased viral copy numbers above the limit of 125 copies/ml. There was no significant correlation between the levels of analysed proinflammatory cytokines and herpesviral copy numbers in our sample. The observed low viral loads point to a relatively rare occurrence of active EBV and HCMV infection in our sample. Latent herpesviral infection does not enhance the production of investigated proinflammatory cytokines. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd. All rights reserved.

Molecular detection and drug resistance of Mycobacterium tuberculosis complex from cattle at a dairy farm in the Nkonkobe region of South Africa: a pilot study.

PubMed

Silaigwana, Blessing; Green, Ezekiel; Ndip, Roland N

2012-06-01

Mycobacterium tuberculosis complex (MTBC) causes tuberculosis (TB) in humans and animals. We investigated the presence of MTBC in cattle milk and its drug resistance using polymerase chain reaction (PCR). Two hundred samples (100 mL each) were obtained from a dairy farm in the Nkonkobe region of South Africa. The samples were processed using the modified Petroff method. DNA was isolated using a Zymo Bacterial DNA kit and amplified using Seeplex(®) MTB Nested ACE assay. The Genotype(®) Mycobacterium tuberculosis-multidrug resistantplus (MTBDRplus) assay was used to perform drug susceptibility and detection of mutations conferring resistance to isoniazid (INH) and rifampicin (RIF). Eleven samples tested positive for MTBC DNA using the Seeplex(®) MTB Nested ACE assay. The Genotype(®) MTBDRplus assay showed that 10/11 samples were resistant to both INH and RIF i.e., multi-drug resistant (MDR). The most and least frequent rpoB mutations detected in RIF resistant samples were H526Y (9/10) and D516V (2/10) respectively. None of the INH resistant samples harbored mutations in the katG gene. However, all of them harbored the T8A mutation in the inhA gene. These results have clinical and epidemiological significance and calls for further studies and necessary actions to delineate the situation.

Molecular detection and genetic characterization of Toxoplasma gondii infection in sika deer (Cervus nippon) in China.

PubMed

Cong, Wei; Qin, Si-Yuan; Meng, Qing-Feng; Zou, Feng-Cai; Qian, Ai-Dong; Zhu, Xing-Quan

2016-04-01

The objective of the present study was to investigate the prevalence and genetic characterization of Toxoplasma gondii infection in sika deer in China. During August 2014 to November 2014, a total of 450 tissue samples coming from 150 sika deer were collected to detect the T. gondii B1 gene using a nested PCR, and the positive samples were genotyped at 11 genetic markers (SAG1, 5'- and 3'-SAG2, alternative SAG2, SAG3, BTUB, GRA6, L358, PK1, c22-8, c29-2, and Apico) using multilocus polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technology. Seventeen of 150 sika deer (11.33%) were tested positive by nested PCR. Six DNA samples from the 17 positive samples were completely typed, in which 4 samples from lung tissues, and 2 from muscular tissues, were identified as ToxoDB Genotype #9 (http://toxodb.org/toxo/). The results of the present study revealed the existence of T. gondii infection in sika deer in China, which provided the information of T. gondii genetic diversity in this host species. This study also indicated that ToxoDB Genotype #9 has a wide distribution in sika deer that could be potential reservoirs for T. gondii transmission, which may pose a threat to human health. Copyright © 2016 Elsevier B.V. All rights reserved.

Occurrence of two newly named oral treponemes - Treponema parvum and Treponema putidum - in primary endodontic infections.

PubMed

Rôças, I N; Siqueira, J F

2005-12-01

Recent evidence from molecular genetic studies has revealed that oral Treponema species are involved in infections of endodontic origin. This study assessed the occurrence of two newly named oral treponemes - Treponema parvum and Treponema putidum - in primary endodontic infections using a culture-independent identification technique. Genomic DNA was isolated directly from clinical samples, and a 16S rRNA gene-based nested polymerase chain reaction (PCR) assay was used to determine the presence of T. parvum and T. putidum. Species-specific primer pairs were developed by aligning closely related 16S rRNA gene sequences. The specificity for each primer pair was validated by running PCR against a panel of oral bacteria and by sequence analysis of PCR products from positive clinical samples. T. parvum was detected in 52% of the root canals associated with chronic apical periodontitis, in 20% of the cases diagnosed as acute apical periodontitis, and in no abscessed case. In general, T. parvum was detected in 26% of the samples from primary endodontic infections. T. putidum was found in only one case of acute apical periodontitis (2% of the total number of cases investigated). The devised nested PCR protocol was able to identify both T. parvum and T. putidum directly in clinical samples and demonstrated that these two treponemes can take part in endodontic infections.

Data in support of the detection of genetically modified organisms (GMOs) in food and feed samples.

PubMed

Alasaad, Noor; Alzubi, Hussein; Kader, Ahmad Abdul

2016-06-01

Food and feed samples were randomly collected from different sources, including local and imported materials from the Syrian local market. These included maize, barley, soybean, fresh food samples and raw material. GMO detection was conducted by PCR and nested PCR-based techniques using specific primers for the most used foreign DNA commonly used in genetic transformation procedures, i.e., 35S promoter, T-nos, epsps, cryIA(b) gene and nptII gene. The results revealed for the first time in Syria the presence of GM foods and feeds with glyphosate-resistant trait of P35S promoter and NOS terminator in the imported soybean samples with high frequency (5 out of the 6 imported soybean samples). While, tests showed negative results for the local samples. Also, tests revealed existence of GMOs in two imported maize samples detecting the presence of 35S promoter and nos terminator. Nested PCR results using two sets of primers confirmed our data. The methods applied in the brief data are based on DNA analysis by Polymerase Chain Reaction (PCR). This technique is specific, practical, reproducible and sensitive enough to detect up to 0.1% GMO in food and/or feedstuffs. Furthermore, all of the techniques mentioned are economic and can be applied in Syria and other developing countries. For all these reasons, the DNA-based analysis methods were chosen and preferred over protein-based analysis.

Diagnosis and prevalence of Theileria equi horses in western Mexico by nested PCR.

PubMed

Ayala-Valdovinos, Miguel Angel; Lemus-Flores, Clemente; Galindo-García, Jorge; Bañuelos-Pineda, Jacinto; Rodríguez-Carpena, Javier Germán; Sánchez-Chiprés, David; Duifhuis-Rivera, Theodor

2017-02-01

Theileria equi infection prevalence was calculated from 1000 blood samples obtained from apparently healthy horses in western Mexico. Samples were sent to the Animal Biotechnology Laboratory of the University of Guadalajara (Mexico) for T. equi diagnosis. Nested polymerase chain reaction (nPCR) was used as a diagnostic method to detect pathogen DNA. Using primers for the merozoite antigen-1 (EMA-1) gene, 19.70±2.47% of the horses (95% CI, 17.23-22.17%) tested positive for T. equi. There was no significant association between gender and T. equi infection. However, prevalence was higher among stabled horses (25.81%) than that among grazing horses (15.02%). The positivity rate was also higher among Quarter Horse (24.70%), Lusitano (35.90%), and Costa Rican Saddle Horse (47.37%) breeds than that among the other seven breeds investigated in this study. The percentage of T. equi infection was higher among adult horses (≥ 4years old, 25.05%) than that among colts and fillies (2-4years old, 15.48%), yearlings (1-2years old, 10.49%), and foals (<1year old, 10.34%). This is the first study of T. equi infection prevalence among horses in Mexico by nPCR . The results indicate that the equine piroplasmosis (EP) caused by T. equi is enzootic in western Mexico. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Model-free learning on robot kinematic chains using a nested multi-agent topology

NASA Astrophysics Data System (ADS)

Karigiannis, John N.; Tzafestas, Costas S.

2016-11-01

This paper proposes a model-free learning scheme for the developmental acquisition of robot kinematic control and dexterous manipulation skills. The approach is based on a nested-hierarchical multi-agent architecture that intuitively encapsulates the topology of robot kinematic chains, where the activity of each independent degree-of-freedom (DOF) is finally mapped onto a distinct agent. Each one of those agents progressively evolves a local kinematic control strategy in a game-theoretic sense, that is, based on a partial (local) view of the whole system topology, which is incrementally updated through a recursive communication process according to the nested-hierarchical topology. Learning is thus approached not through demonstration and training but through an autonomous self-exploration process. A fuzzy reinforcement learning scheme is employed within each agent to enable efficient exploration in a continuous state-action domain. This paper constitutes in fact a proof of concept, demonstrating that global dexterous manipulation skills can indeed evolve through such a distributed iterative learning of local agent sensorimotor mappings. The main motivation behind the development of such an incremental multi-agent topology is to enhance system modularity, to facilitate extensibility to more complex problem domains and to improve robustness with respect to structural variations including unpredictable internal failures. These attributes of the proposed system are assessed in this paper through numerical experiments in different robot manipulation task scenarios, involving both single and multi-robot kinematic chains. The generalisation capacity of the learning scheme is experimentally assessed and robustness properties of the multi-agent system are also evaluated with respect to unpredictable variations in the kinematic topology. Furthermore, these numerical experiments demonstrate the scalability properties of the proposed nested-hierarchical architecture, where new agents can be recursively added in the hierarchy to encapsulate individual active DOFs. The results presented in this paper demonstrate the feasibility of such a distributed multi-agent control framework, showing that the solutions which emerge are plausible and near-optimal. Numerical efficiency and computational cost issues are also discussed.

Detection of Mycobacterium bovis in Bovine and Bubaline Tissues Using Nested-PCR for TbD1

PubMed Central

Araújo, Cristina P.; Osório, Ana Luiza A. R.; Jorge, Kláudia S. G.; Ramos, Carlos Alberto N.; Filho, Antonio Francisco S.; Vidal, Carlos Eugênio S.; Roxo, Eliana; Nishibe, Christiane; Almeida, Nalvo F.; Júnior, Antônio A. F.; Silva, Marcio R.; Neto, José Diomedes B.; Cerqueira, Valíria D.; Zumárraga, Martín J.; Araújo, Flábio R.

2014-01-01

In the present study, a nested-PCR system, targeting the TbD1 region, involving the performance of conventional PCR followed by real-time PCR, was developed to detect Mycobacterium bovis in bovine/bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. In terms of analytical sensitivity, the DNA of M. bovis AN5 was detected up to 1.56 ng with conventional PCR, 97.6 pg with real-time PCR, and 1.53 pg with nested-PCR in the reaction mixture. The nested-PCR exhibited 100% analytical specificity for M. bovis when tested with the DNA of reference strains of environmental mycobacteria and closely-related Actinomycetales. A clinical sensitivity value of 76.0% was detected with tissue samples from animals that exhibited positive results in the comparative intradermal tuberculin test (CITT), as well as from those with lesions compatible with tuberculosis (LCT) that rendered positive cultures. A clinical specificity value of 100% was detected with tissue samples from animals with CITT- results, with no visible lesions (NVL) and negative cultures. No significant differences were found between the nested-PCR and culture in terms of detecting CITT+ animals with LCT or with NVL. No significant differences were recorded in the detection of CITT- animals with NVL. However, nested-PCR detected a significantly higher number of positive animals than the culture in the group of animals exhibiting LCT with no previous records of CITT. The use of the nested-PCR assay to detect M. bovis in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis. PMID:24618787

Detection of Mycobacterium bovis in bovine and bubaline tissues using nested-PCR for TbD1.

PubMed

Araújo, Cristina P; Osório, Ana Luiza A R; Jorge, Kláudia S G; Ramos, Carlos Alberto N; Filho, Antonio Francisco S; Vidal, Carlos Eugênio S; Roxo, Eliana; Nishibe, Christiane; Almeida, Nalvo F; Júnior, Antônio A F; Silva, Marcio R; Neto, José Diomedes B; Cerqueira, Valíria D; Zumárraga, Martín J; Araújo, Flábio R

2014-01-01

In the present study, a nested-PCR system, targeting the TbD1 region, involving the performance of conventional PCR followed by real-time PCR, was developed to detect Mycobacterium bovis in bovine/bubaline tissue homogenates. The sensitivity and specificity of the reactions were assessed with DNA samples extracted from tuberculous and non-tuberculous mycobacteria, as well as other actinomycetales species and DNA samples extracted directly from bovine and bubaline tissue homogenates. In terms of analytical sensitivity, the DNA of M. bovis AN5 was detected up to 1.56 ng with conventional PCR, 97.6 pg with real-time PCR, and 1.53 pg with nested-PCR in the reaction mixture. The nested-PCR exhibited 100% analytical specificity for M. bovis when tested with the DNA of reference strains of environmental mycobacteria and closely-related Actinomycetales. A clinical sensitivity value of 76.0% was detected with tissue samples from animals that exhibited positive results in the comparative intradermal tuberculin test (CITT), as well as from those with lesions compatible with tuberculosis (LCT) that rendered positive cultures. A clinical specificity value of 100% was detected with tissue samples from animals with CITT- results, with no visible lesions (NVL) and negative cultures. No significant differences were found between the nested-PCR and culture in terms of detecting CITT+ animals with LCT or with NVL. No significant differences were recorded in the detection of CITT- animals with NVL. However, nested-PCR detected a significantly higher number of positive animals than the culture in the group of animals exhibiting LCT with no previous records of CITT. The use of the nested-PCR assay to detect M. bovis in tissue homogenates provided a rapid diagnosis of bovine and bubaline tuberculosis.

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

PubMed

Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

2016-12-01

To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

Press Releases | Argonne National Laboratory

Science.gov Websites

Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

Nested Interrupt Analysis of Low Cost and High Performance Embedded Systems Using GSPN Framework

NASA Astrophysics Data System (ADS)

Lin, Cheng-Min

Interrupt service routines are a key technology for embedded systems. In this paper, we introduce the standard approach for using Generalized Stochastic Petri Nets (GSPNs) as a high-level model for generating CTMC Continuous-Time Markov Chains (CTMCs) and then use Markov Reward Models (MRMs) to compute the performance for embedded systems. This framework is employed to analyze two embedded controllers with low cost and high performance, ARM7 and Cortex-M3. Cortex-M3 is designed with a tail-chaining mechanism to improve the performance of ARM7 when a nested interrupt occurs on an embedded controller. The Platform Independent Petri net Editor 2 (PIPE2) tool is used to model and evaluate the controllers in terms of power consumption and interrupt overhead performance. Using numerical results, in spite of the power consumption or interrupt overhead, Cortex-M3 performs better than ARM7.

Variation in clutch size in relation to nest size in birds

PubMed Central

Møller, Anders P; Adriaensen, Frank; Artemyev, Alexandr; Bańbura, Jerzy; Barba, Emilio; Biard, Clotilde; Blondel, Jacques; Bouslama, Zihad; Bouvier, Jean-Charles; Camprodon, Jordi; Cecere, Francesco; Charmantier, Anne; Charter, Motti; Cichoń, Mariusz; Cusimano, Camillo; Czeszczewik, Dorota; Demeyrier, Virginie; Doligez, Blandine; Doutrelant, Claire; Dubiec, Anna; Eens, Marcel; Eeva, Tapio; Faivre, Bruno; Ferns, Peter N; Forsman, Jukka T; García-Del-Rey, Eduardo; Goldshtein, Aya; Goodenough, Anne E; Gosler, Andrew G; Góźdź, Iga; Grégoire, Arnaud; Gustafsson, Lars; Hartley, Ian R; Heeb, Philipp; Hinsley, Shelley A; Isenmann, Paul; Jacob, Staffan; Järvinen, Antero; Juškaitis, Rimvydas; Korpimäki, Erkki; Krams, Indrikis; Laaksonen, Toni; Leclercq, Bernard; Lehikoinen, Esa; Loukola, Olli; Lundberg, Arne; Mainwaring, Mark C; Mänd, Raivo; Massa, Bruno; Mazgajski, Tomasz D; Merino, Santiago; Mitrus, Cezary; Mönkkönen, Mikko; Morales-Fernaz, Judith; Morin, Xavier; Nager, Ruedi G; Nilsson, Jan-Åke; Nilsson, Sven G; Norte, Ana C; Orell, Markku; Perret, Philippe; Pimentel, Carla S; Pinxten, Rianne; Priedniece, Ilze; Quidoz, Marie-Claude; Remeš, Vladimir; Richner, Heinz; Robles, Hugo; Rytkönen, Seppo; Senar, Juan Carlos; Seppänen, Janne T; da Silva, Luís P; Slagsvold, Tore; Solonen, Tapio; Sorace, Alberto; Stenning, Martyn J; Török, János; Tryjanowski, Piotr; van Noordwijk, Arie J; von Numers, Mikael; Walankiewicz, Wiesław; Lambrechts, Marcel M

2014-01-01

Nests are structures built to support and protect eggs and/or offspring from predators, parasites, and adverse weather conditions. Nests are mainly constructed prior to egg laying, meaning that parent birds must make decisions about nest site choice and nest building behavior before the start of egg-laying. Parent birds should be selected to choose nest sites and to build optimally sized nests, yet our current understanding of clutch size-nest size relationships is limited to small-scale studies performed over short time periods. Here, we quantified the relationship between clutch size and nest size, using an exhaustive database of 116 slope estimates based on 17,472 nests of 21 species of hole and non-hole-nesting birds. There was a significant, positive relationship between clutch size and the base area of the nest box or the nest, and this relationship did not differ significantly between open nesting and hole-nesting species. The slope of the relationship showed significant intraspecific and interspecific heterogeneity among four species of secondary hole-nesting species, but also among all 116 slope estimates. The estimated relationship between clutch size and nest box base area in study sites with more than a single size of nest box was not significantly different from the relationship using studies with only a single size of nest box. The slope of the relationship between clutch size and nest base area in different species of birds was significantly negatively related to minimum base area, and less so to maximum base area in a given study. These findings are consistent with the hypothesis that bird species have a general reaction norm reflecting the relationship between nest size and clutch size. Further, they suggest that scientists may influence the clutch size decisions of hole-nesting birds through the provisioning of nest boxes of varying sizes. PMID:25478150

Variation in clutch size in relation to nest size in birds.

PubMed

Møller, Anders P; Adriaensen, Frank; Artemyev, Alexandr; Bańbura, Jerzy; Barba, Emilio; Biard, Clotilde; Blondel, Jacques; Bouslama, Zihad; Bouvier, Jean-Charles; Camprodon, Jordi; Cecere, Francesco; Charmantier, Anne; Charter, Motti; Cichoń, Mariusz; Cusimano, Camillo; Czeszczewik, Dorota; Demeyrier, Virginie; Doligez, Blandine; Doutrelant, Claire; Dubiec, Anna; Eens, Marcel; Eeva, Tapio; Faivre, Bruno; Ferns, Peter N; Forsman, Jukka T; García-Del-Rey, Eduardo; Goldshtein, Aya; Goodenough, Anne E; Gosler, Andrew G; Góźdź, Iga; Grégoire, Arnaud; Gustafsson, Lars; Hartley, Ian R; Heeb, Philipp; Hinsley, Shelley A; Isenmann, Paul; Jacob, Staffan; Järvinen, Antero; Juškaitis, Rimvydas; Korpimäki, Erkki; Krams, Indrikis; Laaksonen, Toni; Leclercq, Bernard; Lehikoinen, Esa; Loukola, Olli; Lundberg, Arne; Mainwaring, Mark C; Mänd, Raivo; Massa, Bruno; Mazgajski, Tomasz D; Merino, Santiago; Mitrus, Cezary; Mönkkönen, Mikko; Morales-Fernaz, Judith; Morin, Xavier; Nager, Ruedi G; Nilsson, Jan-Åke; Nilsson, Sven G; Norte, Ana C; Orell, Markku; Perret, Philippe; Pimentel, Carla S; Pinxten, Rianne; Priedniece, Ilze; Quidoz, Marie-Claude; Remeš, Vladimir; Richner, Heinz; Robles, Hugo; Rytkönen, Seppo; Senar, Juan Carlos; Seppänen, Janne T; da Silva, Luís P; Slagsvold, Tore; Solonen, Tapio; Sorace, Alberto; Stenning, Martyn J; Török, János; Tryjanowski, Piotr; van Noordwijk, Arie J; von Numers, Mikael; Walankiewicz, Wiesław; Lambrechts, Marcel M

2014-09-01

Nests are structures built to support and protect eggs and/or offspring from predators, parasites, and adverse weather conditions. Nests are mainly constructed prior to egg laying, meaning that parent birds must make decisions about nest site choice and nest building behavior before the start of egg-laying. Parent birds should be selected to choose nest sites and to build optimally sized nests, yet our current understanding of clutch size-nest size relationships is limited to small-scale studies performed over short time periods. Here, we quantified the relationship between clutch size and nest size, using an exhaustive database of 116 slope estimates based on 17,472 nests of 21 species of hole and non-hole-nesting birds. There was a significant, positive relationship between clutch size and the base area of the nest box or the nest, and this relationship did not differ significantly between open nesting and hole-nesting species. The slope of the relationship showed significant intraspecific and interspecific heterogeneity among four species of secondary hole-nesting species, but also among all 116 slope estimates. The estimated relationship between clutch size and nest box base area in study sites with more than a single size of nest box was not significantly different from the relationship using studies with only a single size of nest box. The slope of the relationship between clutch size and nest base area in different species of birds was significantly negatively related to minimum base area, and less so to maximum base area in a given study. These findings are consistent with the hypothesis that bird species have a general reaction norm reflecting the relationship between nest size and clutch size. Further, they suggest that scientists may influence the clutch size decisions of hole-nesting birds through the provisioning of nest boxes of varying sizes.

DIM SUM: demography and individual migration simulated using a Markov chain.

PubMed

Brown, Jeremy M; Savidge, Kevin; McTavish, Emily Jane B

2011-03-01

An increasing number of studies seek to infer demographic history, often jointly with genetic relationships. Despite numerous analytical methods for such data, few simulations have investigated the methods' power and robustness, especially when underlying assumptions have been violated. DIM SUM (Demography and Individual Migration Simulated Using a Markov chain) is a stand-alone Java program for the simulation of population demography and individual migration while recording ancestor-descendant relationships. It does not employ coalescent assumptions or discrete population boundaries. It is extremely flexible, allowing the user to specify border positions, reactions of organisms to borders, local and global carrying capacities, individual dispersal kernels, rates of reproduction and strategies for sampling individuals. Spatial variables may be specified using image files (e.g., as exported from gis software) and may vary through time. In combination with software for genetic marker simulation, DIM SUM will be useful for testing phylogeographic (e.g., nested clade phylogeographic analysis, coalescent-based tests and continuous-landscape frameworks) and landscape-genetic methods, specifically regarding violations of coalescent assumptions. It can also be used to explore the qualitative features of proposed demographic scenarios (e.g. regarding biological invasions) and as a pedagogical tool. DIM SUM (with user's manual) can be downloaded from http://code.google.com/p/bio-dimsum. © 2010 Blackwell Publishing Ltd.

Introduction to Polymer Chemistry.

ERIC Educational Resources Information Center

Harris, Frank W.

1981-01-01

Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

Polymerization as a Model Chain Reaction

ERIC Educational Resources Information Center

Morton, Maurice

1973-01-01

Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

DOE R&D Accomplishments Database

Weinberg, Alvin M.; Noderer, L. C.

1951-05-15

The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

Communicating food safety, authenticity and consumer choice. Field experiences.

PubMed

Syntesa, Heiner Lehr

2013-04-01

The paper reviews patented and non-patented technologies, methods and solutions in the area of food traceability. It pays special attention to the communication of food safety, authenticity and consumer choice. Twenty eight recent patents are reviewed in the areas of (secure) identification, product freshness indicators, meat traceability, (secure) transport of information along the supply chain, country/region/place of origin, automated authentication, supply chain management systems, consumer interaction systems. In addition, solutions and pilot projects are described in the areas of Halal traceability, traceability of bird's nests, cold chain management, general food traceability and other areas.

Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins

NASA Astrophysics Data System (ADS)

Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John

2017-01-01

DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2014 CFR

2014-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2013 CFR

2013-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2012 CFR

2012-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

Emilio Segrè and Spontaneous Fission

Science.gov Websites

fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

Adaptation of a visualized loop-mediated isothermal amplification technique for field detection of Plasmodium vivax infection.

PubMed

Tao, Zhi-Yong; Zhou, Hua-Yun; Xia, Hui; Xu, Sui; Zhu, Han-Wu; Culleton, Richard L; Han, Eun-Taek; Lu, Feng; Fang, Qiang; Gu, Ya-Ping; Liu, Yao-Bao; Zhu, Guo-Ding; Wang, Wei-Ming; Li, Ju-Lin; Cao, Jun; Gao, Qi

2011-06-21

Loop-mediated isothermal amplification (LAMP) is a high performance method for detecting DNA and holds promise for use in the molecular detection of infectious pathogens, including Plasmodium spp. However, in most malaria-endemic areas, which are often resource-limited, current LAMP methods are not feasible for diagnosis due to difficulties in accurately interpreting results with problems of sensitive visualization of amplified products, and the risk of contamination resulting from the high quantity of amplified DNA produced. In this study, we establish a novel visualized LAMP method in a closed-tube system, and validate it for the diagnosis of malaria under simulated field conditions. A visualized LAMP method was established by the addition of a microcrystalline wax-dye capsule containing the highly sensitive DNA fluorescence dye SYBR Green I to a normal LAMP reaction prior to the initiation of the reaction. A total of 89 blood samples were collected on filter paper and processed using a simple boiling method for DNA extraction, and then tested by the visualized LAMP method for Plasmodium vivax infection. The wax capsule remained intact during isothermal amplification, and released the DNA dye to the reaction mixture only when the temperature was raised to the melting point following amplification. Soon after cooling down, the solidified wax sealed the reaction mix at the bottom of the tube, thus minimizing the risk of aerosol contamination. Compared to microscopy, the sensitivity and specificity of LAMP were 98.3% (95% confidence interval (CI): 91.1-99.7%) and 100% (95% CI: 88.3-100%), and were in close agreement with a nested polymerase chain reaction method. This novel, cheap and quick visualized LAMP method is feasible for malaria diagnosis in resource-limited field settings.

Clear Cell Carcinoma of the Penis: An HPV-related Variant of Squamous Cell Carcinoma: A Report of 3 Cases.

PubMed

Sanchez, Diego F; Rodriguez, Ingrid M; Piris, Adriano; Cañete, Sofía; Lezcano, Cecilia; Velazquez, Elsa F; Fernandez-Nestosa, Maria J; Mendez-Pena, Javier E; Hoang, Mai P; Cubilla, Antonio L

2016-07-01

Penile clear cell carcinoma originating in skin adnexal glands has been previously reported. Here, we present 3 morphologically distinctive penile tumors with prominent clear cell features originating not in the penile skin but in the mucosal tissues of the glans surface squamous epithelium. Clinical and pathologic features were evaluated. Immunohistochemical stains were GATA3 and p16. Human papilloma virus (HPV) detection by in situ hybridization was performed in 3 cases, and whole-tissue section-polymerase chain reaction was performed in 1 case. Patients' ages were 52, 88, and 95 years. Tumors were large and involved the glans and coronal sulcus in all cases. Microscopically, nonkeratinizing clear cells predominated. Growth was in solid nests with comedo-like or geographic necrosis. Focal areas of invasive warty or basaloid carcinomas showing in addition warty or basaloid penile intraepithelial neoplasia were present in 2 cases. There was invasion of corpora cavernosa, lymphatic vessels, veins, and perineural spaces in all cases. p16 was positive, and GATA3 stain was negative in the 3 cases. HPV was detected in 3 cases by in situ hybridization and in 1 case by polymerase chain reaction. Differential diagnoses included other HPV-related penile carcinomas, skin adnexal tumors, and metastatic renal cell carcinoma. Features that support primary penile carcinoma were tumor location, concomitant warty and/or basaloid penile intraepithelial neoplasia, and HPV positivity. Clinical groin metastases were present in all cases, pathologically confirmed in 1. Two patients died from tumor dissemination at 9 and 12 months after penectomy. Clear cell carcinoma, another morphologic variant related to HPV, originates in the penile mucosal surface and is probably related to warty carcinomas.

[Studies on the novel association of human herpesvirus-7 with skin diseases].

PubMed

Vág, Tibor; Sonkoly, Enikó; Kemény, Béla; Kárpáti, Sarolta; Horváth, Attila; Ongrádi, József

2003-08-17

Human herpesvirus 7 in pityriasis rosea, this and other viruses in papular-purpuric gloves-and-socks syndrome have been implicated, but their primary or recurrent infections are still in question. In one available blood sample, therefore, IgM, IgG and its high avidity fraction characteristic for recurrent infections were quantitated by indirect immunofluorescence. Peripheral lymphocytes were subjected to nested polymerase chain reaction to detect viral DNA, or cocultivated with several cell cultures. One third of 33 pityriasis rosea patients had elevated IgM, another third had elevated IgG without high avidity molecules to human herpesvirus 7 suggesting primary infection. Thirty percent of controls, more than half of the patients had virtual DNA in their lymphocytes, but only one in 5 skin biopsy specimens were PCR positive. All three co-cultivation attempts yielded viruses extremely rapidly, verified by electron microscopy, polymerase chain reaction and monoclonal antibodies as human herpesvirus 7. These are the first isolates in the geographical regions of Hungary. These data suggest that pityriasis rosea is the consequence of a primary human herpesvirus 7 infection in seronegative adults, and only occasionally is due to virus reactivation. One patient with gloves-and-socks syndrome had an acute, another patient had a persistent coinfection with human herpesvirus 7 and parvovirus B19, two others had a primary herpesvirus 7 infection. Interestingly, this disease might be elicited by both viruses individually or in synergism. Neither human herpesvirus 7 nor parvovirus B19 infect skin cells, but both can be detected in the infiltrating lymphocytes of skin eruptions, in which they induce an altered mediator production, that might be responsible for the general and local symptoms.

Matrilineage differentiation of the genus Tetragonisca using mitochondrial DNA markers and the polymerase chain reaction-restriction fragment length polymorphism technique.

PubMed

Santos, S A; Bronzato, A R; Moreira, B M T; Araujo, K F; Ronqui, L; Mangolin, C A; Toledo, V A A; Ruvolo-Takasusuki, M C C

2015-10-21

The Meliponinae are important pollinators of plant species, and one of the most managed species is Tetragonisca angustula. Initially, two subspecies were identified in T. angustula: T. angustula angustula and T. angustula fiebrigi. Subsequently, T. a. fiebrigi was considered a species, based on the coloration of its mesepisternum. The objective of the present study was to obtain genetic markers that could differentiate the two species by amplifying regions of mitochondrial DNA and conducting polymerase chain reaction-restriction fragment length polymorphism analysis. Worker bees were collected in three Brazilian states: Paraná (Maringá, Altônia, and Foz do Iguaçu), São Paulo (Dracena, São Carlos, and Santa Cruz do Rio Pardo), and Rondônia (Ariquemes). Ten pairs of insect heterologous primers were tested and four were used (primer pair 1, ND2 and COI; primer pair 2, COI; primer pair 8, 16S and 12S; and primer pair 9, COII). For the restriction analysis, 13 enzymes were tested: EcoRI, EcoRV, HindIII, HinfI, RsaI, PstI, XbaI, HaeIII, ClaI, XhoI, BglII, PvuII, and ScaI. Markers were obtained (primer pair 8 cleaved with EcoRV and XbaI and primer pair 9 cleaved with HaeIII, RsaI, and XbaI) that enabled matrilineage identification in the nests studied, which confirmed that hybridization could occur between both Tetragonisca species. The beginning of speciation was probably recent, and secondary contact has resulted in crosses between T. angustula females and T. fiebrigi males. Because of this hybridization, it would be appropriate to consider them as two subspecies of T. angustula.

Detection of Viral Hemorrhagic Septicemia Virus by Quantitative Reverse Transcription Polymerase Chain Reaction from Two Fish Species at Two Sites in Lake Superior

USGS Publications Warehouse

Cornwell, Emily R.; Eckerlin, Geofrey E.; Getchell, Rodman G.; Groocock, Geoffrey H.; Thompson, Tarin M.; Batts, William N.; Casey, Rufina N.; Kurath, Gael; Winton, James R.; Bowser, Paul R.; Bain, Mark B.; Casey, James W.

2011-01-01

Viral hemorrhagic septicemia virus (VHSV) was first detected in the Laurentian Great Lakes in 2005 during a mortality event in the Bay of Quinte, Lake Ontario. Subsequent analysis of archived samples determined that the first known isolation of VHSV in the Laurentian Great Lakes was from a muskellunge Esox masquinongy collected in Lake St. Clair in 2003. By the end of 2008, mortality events and viral isolations had occurred in all of the Laurentian Great Lakes except Lake Superior. In 2009, a focused disease surveillance program was designed to determine whether VHSV was also present in Lake Superior. In this survey, 874 fish from 7 sites along the U.S. shoreline of Lake Superior were collected during June 2009. Collections were focused on nearshore species known to be susceptible to VHSV. All fish were dissected individually by using aseptic techniques and were tested for the presence of VHSV genetic material by use of a quantitative reverse transcription (qRT) polymerase chain reaction (PCR) targeting the viral nucleoprotein gene. Seventeen fish from two host species at two different sites tested positive at low levels for VHSV. All attempts to isolate virus in cell culture were unsuccessful. However, the presence of viral RNA was confirmed independently in five fish by using a nested PCR that targeted the glycoprotein (G) gene. Partial G gene sequences obtained from three fish were identical to the corresponding sequence from the original 2003 VHSV isolate (MI03) from muskellunge. These detections represent the earliest evidence for the presence of VHSV in Lake Superior and illustrate the utility of the highly sensitive qRT-PCR assay for disease surveillance in aquatic animals.

Chain Reaction Polymerization.

ERIC Educational Resources Information Center

McGrath, James E.

1981-01-01

The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

Characterizing Chain Processes in Visible Light Photoredox Catalysis

PubMed Central

Cismesia, Megan A.

2015-01-01

The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708

A family of glycoproteins (GP55), which inhibit neurite outgrowth, are members of the Ig superfamily and are related to OBCAM, neurotrimin, LAMP and CEPU-1.

PubMed

Wilson, D J; Kim, D S; Clarke, G A; Marshall-Clarke, S; Moss, D J

1996-12-01

We have previously identified a glycosylphosphatidylinositol-linked glycoprotein of 55 kDa (GP55) which inhibits neurite outgrowth. We now provide evidence that GP55, isolated from adult chick brain, consists of at least two bands, both of which are active, i.e., block outgrowth of neurites from chick dorsal root ganglion neurons. An antiserum raised against the adult proteins reverses the inhibition and preliminary experiments suggest that GP55 is restricted to the nervous system, increases during development from very low levels at embryonic day 10 and is most abundant after hatching. Immunofluorescence reveals that GP55 is expressed on neurons cultured from an embryonic day 14 chick brain but is barely detectable on embryonic day 10 dorsal root ganglion neurons or embryonic day 8 forebrain neurons; the neurons which respond to substrate-bound GP55. Peptide sequencing revealed considerable homology with OBCAM, a protein previously identified on the basis of binding opiates. Nested polymerase chain reaction using primers to the OBCAM sequence and internal primers to GP55 peptides produced two different polymerase chain reaction fragments with homology to OBCAM. A full length clone (E19S) corresponding to one polymerase chain reaction product and a partial length clone (E14S) corresponding to the second have been isolated from an embryonic chick brain library. Both are members of the immunoglobulin superfamily and have (or are expected to have) three C2 domains. E19S has 90% homology with LAMP at the amino acid level. This sequence only partially matches the peptides from the adult protein and hence is probably not a major component of the adult proteins. E14S (GP55-A) has 83% homology to OBCAM at the amino acid level over the region sequenced. The sequence matches several of the peptides from the adult protein and is hence likely to correspond to a major component of the adult proteins. Thus members of the GP55 family are related to OBCAM, neurotrimin, LAMP and a recently discovered chick protein CEPU-1. Our results suggest molecules within this family are capable of acting as cell adhesion molecules and inhibitors of neurite outgrowth.

Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

2016-09-15

It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

[Optimized application of nested PCR method for detection of malaria].

PubMed

Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C

2017-04-28

Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P < 0.05). Conclusion The optimized PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.

Injection drug use facilitates hepatitis C virus infection of peripheral blood mononuclear cells.

PubMed

Resti, Massimo; Azzari, Chiara; Moriondo, Maria; Betti, Letizia; Sforzi, Idanna; Novembre, Elio; Vierucci, Alberto

2002-08-01

Infection of peripheral blood mononuclear cells (PBMCs) with hepatitis C virus (HCV) has been demonstrated and has been found to play a role in relapse of HCV disease and vertical transmission of HCV. Injection drug use is thought to impair function of the immune system and induce tolerance to viruses; therefore, HCV infection of PBMCs could be more likely to occur in injection drug users (IDUs) with HCV infection. Of 108 women who tested negative for human immunodeficiency virus type 1 and positive for HCV RNA, 51 had a history of injection drug use and 57 had no known risk factor for HCV infection. HCV infection was found, by nested reverse-transcription polymerase chain reaction analysis, in the PBMCs of 33 IDUs and of 13 non-IDUs (P=.00003). No correlation was found between infection of the PBMCs and HCV genotype or virus load. Route of transmission and viral factors, as well as immunologic dysfunction, may play a role in viral tropism.

Genetic diversity of Hepatozoon spp. in coyotes from the south-central United States.

PubMed

Starkey, Lindsay A; Panciera, Roger J; Paras, Kelsey; Allen, Kelly E; Reiskind, Michael H; Reichard, Mason V; Johnson, Eileen M; Little, Susan E

2013-04-01

To better define the strains and species of Hepatozoon that infect coyotes in the south-central United States, whole blood and muscle samples were collected from 44 coyotes from 6 locations in Oklahoma and Texas. Samples were evaluated by a nested polymerase chain reaction (PCR) using primers amplifying a variable region of the apicomplexan 18S rRNA gene as well as histopathology (muscle only) for presence of tissue cysts. Hepatozoon spp. infections were identified in 79.5% (35/44) of coyotes tested including 27 of 44 (61.4%) whole blood samples and 17 of 44 (38.6%) muscle samples tested by PCR and 23 of 44 (52.3%) muscle samples evaluated by histological examination. Analysis revealed 19 distinct sequences comprising 3 major clusters of Hepatozoon spp., i.e., 1 most closely related to Hepatozoon americanum, another most closely related to Hepatozoon canis , and the third an intermediate between the 2 groups. The diversity of Hepatozoon spp. in wild canids appears greater than previously recognized and warrants further investigation.

Mixed Ehrlichia canis, Hepatozoon canis, and presumptive Anaplasma phagocytophilum infection in a dog.

PubMed

Mylonakis, Mathio E; Koutinas, Alex F; Baneth, Gad; Polizopoulou, Zoe; Fytianou, Anna

2004-01-01

A 5-month-old, female, mongrel dog was admitted to the Clinic of Companion Animal Medicine, Aristotle University of Thessaloniki, Greece, with depression, anorexia, fever, peripheral lymphadenopathy, splenomegaly, oculonasal discharge, nonregenerative anemia, and mild thrombocytopenia. Cytology of Giemsa-stained buffy coat, bone marrow, and lymph node aspiration smears revealed numerous morulae in mononuclear leukocytes and in neutrophils, and Hepatozoon canis gamonts in neutrophils. The dog was seropositive to Ehrlichia canis (immunofluorescence assay [IFA]) and Hepatozoon canis (ELISA) but not to Anaplasma phagocytophilum (IFA). A nested polymerase chain reaction performed on bone marrow aspirates was positive for E canis. This method was not applied for the detection of A phagocytophilum. Treatment with doxycycline and imidocarb dipropionate resulted in both clinical and parasitologic cure. This is the first reported case of a mixed infection with E canis, H canis, and presumptive A phagocytophilum. The findings emphasize the value of cytology in offering a quick and inexpensive diagnosis in mixed tick-borne infections of dogs.

Development of a PCR Diagnostic System for Iris yellow spot tospovirus in Quarantine

PubMed Central

Shin, Yong-Gil; Rho, Jae-Young

2014-01-01

Iris yellow spot virus (IYSV) is a plant pathogenic virus which has been reported to continuously occur in onion bulbs, allium field crops, seed crops, lisianthus, and irises. In South Korea, IYSV is a “controlled” virus that has not been reported, and inspection is performed when crops of the genus Iris are imported into South Korea. In this study, reverse-transcription polymerase chain reaction (RT-PCR) and nested PCR inspection methods, which can detect IYSV, from imported crops of the genus Iris at quarantine sites, were developed. In addition, a modified positive plasmid, which can be used as a positive control during inspection, was developed. This modified plasmid can facilitate a more accurate inspection by enabling the examination of a laboratory contamination in an inspection system. The inspection methods that were developed in this study are expected to contribute, through the prompt and accurate inspection of IYSV at quarantine sites to the plant quarantine in South Korea. PMID:25506310

Fusion of NUP98 and the SET binding protein 1 (SETBP1) gene in a paediatric acute T cell lymphoblastic leukaemia with t(11;18)(p15;q12).

PubMed

Panagopoulos, Ioannis; Kerndrup, Gitte; Carlsen, Niels; Strömbeck, Bodil; Isaksson, Margareth; Johansson, Bertil

2007-01-01

Three NUP98 chimaeras have previously been reported in T cell acute lymphoblastic leukaemia (T-ALL): NUP98/ADD3, NUP98/CCDC28A, and NUP98/RAP1GDS1. We report a T-ALL with t(11;18)(p15;q12) resulting in a novel NUP98 fusion. Fluorescent in situ hybridisation showed NUP98 and SET binding protein 1(SETBP1) fusion signals; other analyses showed that exon 12 of NUP98 was fused in-frame with exon 5 of SETBP1. Nested polymerase chain reaction did not amplify the reciprocal SETBP1/NUP98, suggesting that NUP98/SETBP1 transcript is pathogenetically important. SETBP1 has previously not been implicated in leukaemias; however, it encodes a protein that specifically interacts with SET, fused to NUP214 in a case of acute undifferentiated leukaemia.

Association of human herpesvirus 6 subtypes with symptomatic apical periodontitis.

PubMed

Hernádi, Katinka; Csoma, Eszter; Adám, Balázs; Szalmás, Anita; Gyöngyösi, Eszter; Veress, György; Ildikó-Márton; Kónya, József

2011-09-01

The occurrence of human herpesvirus (HHV) 6 subtypes A and B in apical periodontitis was determined. The relationship of HHV-6 subtypes to other disease associated herpesviruses, i.e., Epstein-Barr virus (EBV) and human cytomegalovirus, was also investigated. Forty apical periodontitis samples (17 symptomatic and 23 asymptomatic) and 40 healthy pulp control samples were collected. Nested polymerase chain reaction was used to detect HHV-6 DNA. HHV-6 DNA was observed in significantly higher frequencies in apical periodontitis samples than in control samples (20% vs. 2.5%; P = .03). Further classification of apical lesions revealed that subtype B of HHV-6 was significantly associated with large-sized and symptomatic lesions (P < .01). Thirty-one apical lesions (77%) harbored ≥1 of the tested herpesviruses: EBV was the most frequent herpesvirus (72.5%) in apical periodontitis, followed by HHV-6 (20%). Our findings suggest that EBV and HHV-6B infections can be associated with symptomatic apical periodontitis. Copyright © 2011 Mosby, Inc. All rights reserved.

Prevalence and clonal analysis of Porphyromonas gingivalis in primary endodontic infections.

PubMed

Siqueira, José F; Rôças, Isabela N; Silva, Marlei G

2008-11-01

This study investigated the prevalence of Porphyromonas gingivalis in 62 teeth with primary endodontic infections by using a species-specific 16S rRNA gene-based nested polymerase chain reaction assay. P. gingivalis isolates recovered from 2 infected root canals were also analyzed for clonal diversity by using arbitrarily primed PCR. Overall, P. gingivalis was found in 48% of the samples. This species was specifically detected in 36% of canals of teeth with chronic apical periodontitis, in 46% of the cases of acute apical periodontitis, and in 67% of acute apical abscesses. P. gingivalis was significantly more frequent in abscess aspirates than in canals of teeth with chronic apical periodontitis (P < .05). Typing of colonies retrieved from 2 infected canals revealed 2 clones per individual. These findings confirmed that P. gingivalis can be an important endodontic pathogen, mostly associated with acute abscesses, and demonstrated that different clonal types of this species can colonize the root canal in the same individual.

Development and application of a selective detection method for genetically modified soy and soy-derived products.

PubMed

Hoef, A M; Kok, E J; Bouw, E; Kuiper, H A; Keijer, J

1998-10-01

A method has been developed to distinguish between traditional soy beans and transgenic Roundup Ready soy beans, i.e. the glyphosate ('Roundup') resistant soy bean variety developed by Monsanto Company. Glyphosate resistance results from the incorporation of an Agrobacterium-derived 5-enol-pyruvyl-shikimate-3-phosphatesynthase (EPSPS) gene. The detection method developed is based on a nested Polymerase Chain Reaction (PCR) procedure. Ten femtograms of soy bean DNA can be detected, while, starting from whole soy beans, Roundup Ready DNA can be detected at a level of 1 Roundup Ready soy bean in 5000 non-GM soy beans (0.02% Roundup Ready soy bean). The method has been applied to samples of soy bean, soy-meal pellets and soy bean flour, as well as a number of processed complex products such as infant formula based on soy, tofu, tempeh, soy-based desserts, bakery products and complex meat and meat-replacing products. The results obtained are discussed with respect to practical application of the detection method developed.

Detection of Neospora caninum DNA by polymerase chain reaction in bats from Southern China.

PubMed

Wang, Xu; Li, Jianhua; Gong, Pengtao; Li, Xianhe; Zhang, Li; He, Biao; Xu, Lin; Yang, Zhengtao; Liu, Quan; Zhang, Xichen

2018-03-23

Neospora caninum is an intracellular protozoan that infects many domestic and wild animals. Domestic dogs and other canids function as definitive hosts, while other mammals serve as natural intermediate hosts. In the present study, the brain tissues of bats collected in Yunnan Province, Southern China were tested by N. caninum specific-nested PCR, targeting the Nc-5 gene and the internal transcribed spacer 1 (ITS1) region of the ribosomal DNA to determine whether bats could be infected with N. caninum. N. caninum DNA was detected in 1.8% (4/227) of bats, i.e., 1.7% (1/60) in Rousettus leschenaultia, 1.7% (1/58) in Hipposideros pomona, 2.9% (2/69) in Rhinolophus pusillus, and none (0/40) in Myotis daubentoniid. The findings of the present study are only the first indication that bats could serve as an intermediate host, and further studies are necessary to confirm whether bats are involved in the transmission of N. caninum infections. Copyright © 2018 Elsevier B.V. All rights reserved.

Identification of Naegleria fowleri in warm ground water aquifers.

PubMed

Laseke, Ian; Korte, Jill; Lamendella, Regina; Kaneshiro, Edna S; Marciano-Cabral, Francine; Oerther, Daniel B

2010-01-01

The free-living amoeba Naegleria fowleri was identified as the etiological agent of primary amoebic meningoencephalitis that caused the deaths of two children in Peoria, Arizona, in autumn of 2002. It was suspected that the source of N. fowleri was the domestic water supply, which originates from ground water sources. In this study, ground water from the greater Phoenix Metropolitan area was tested for the presence of N. fowleri using a nested polymerase chain reaction approach. Phylogenetic analyses of 16S rRNA sequences of bacterial populations in the ground water were performed to examine the potential link between the presence of N. fowleri and bacterial groups inhabiting water wells. The results showed the presence of N. fowleri in five out of six wells sampled and in 26.6% of all ground water samples tested. Phylogenetic analyses showed that beta- and gamma-proteobacteria were the dominant bacterial populations present in the ground water. Bacterial community analyses revealed a very diverse community structure in ground water samples testing positive for N. fowleri.

Prevalence of Torque teno virus in healthy donors of Paraná State, southern Brazil

PubMed Central

Mazzola, Jocimara Costa; Saito, Patrícia Keiko; Yamakawa, Roger Haruki; Watanabe, Maria Angélica Ehara; da Silva Junior, Waldir Veríssimo; Matta, Alessandra Cristina Gobbi; Borelli, Sueli Donizete

2015-01-01

Objective To determine the prevalence of the Torque teno virus in healthy donors in the northern and northwestern regions of the state of Paraná, southern Brazil. Methods The Torque teno virus was detected by a nested polymerase chain reaction using a set of oligoprimers for the N22 region. Results The prevalence of the virus was 69% in 551 healthy blood donors in southern Brazil. There was no statistically significant difference between the presence of the virus and the variables gender, ethnicity and marital status. There was significant difference in the prevalence of the virus regarding the age of the donors (p-value = 0.024) with a higher incidence (74.7%) in 18- to 24-year-old donors. Conclusion A high prevalence of Torque teno virus was observed in the population studied. Further studies are needed to elucidate the routes of contamination and the clinical implications of the virus in the healthy population. PMID:26408369

Molecular evidence of Chlamydophila pneumoniae infection in reptiles in Argentina.

PubMed

Frutos, María C; Monetti, Marina S; Ré, Viviana E; Cuffini, Cecilia G

2014-01-01

In the central area of Argentina, the epidemiological and molecular characteristics of Chlamydophila pneumoniae infections in reptiles are still unknown. A nested polymerase chain reaction of the rpoB gene was used to detect C. pneumoniae in cloacal swab samples from 19 reptiles at a recreational area. Eleven (57.89%) reptiles were positive; the sequencing and phylogenetic analysis confirmed the presence of this bacterium. Neither C. pneumoniae DNA in the caregivers pharynges nor IgM antibodies anti-C. pneumoniae in their serum samples were detected; however, caregivers presented very high titers of IgG anti-C. pneumoniae. The detection of C. pneumoniae DNA in reptiles demonstrated the circulation of this agent in the recreational area and could be responsible for the exacerbated immune response of the personnel handling the reptiles, which suggests a potential zoonotic cycle. This is the first report of the detection of C. pneumoniae in reptiles in Argentina. Copyright © 2014 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

Recent Advances in the Diagnosis of Pneumocystis Pneumonia.

PubMed

Song, Yinggai; Ren, Yi; Wang, Xiaowen; Li, Ruoyu

2016-01-01

Pneumocystis jirovecii is a prototypical opportunistic pathogen, causing an asymptomatic or mild infection in normal hosts and fulminating pneumonia (Pneumocystis pneumonia, PCP) in immunocompromised hosts. PCP is a leading cause of morbidity and mortality in immunocompromised patients such as AIDS patients. Microscopic detection of cysts and trophic forms of P. jirovecii in respiratory secretions is simple and useful but may underestimate the P. jirovecii infection. Conventional polymerase chain reaction (PCR) and nested PCR increase the sensitivity and specificity to identify PCP and provide an approach to discriminate PCP from pulmonary P. jirovecii colonization, but the targeted genes and cut-off value from quantitative real-time PCR remain to be determined. Serum (1-3)-β-D-glucan level and the specific serum antibody titer are ancillary indicators for PCP diagnosis. The successful cultivation of P. jirovecii in vitro is an important progress for PCP research. The diagnosis of PCP relies on the combination of these laboratory examinations as well as the clinical presentations.

The root-vole Microtus oeconomus (Pallas, 1776): a new potential reservoir of Anaplasma phagocytophilum.

PubMed

Grzeszczuk, A; Karbowiak, G; Ziarko, S; Kovalchuk, O

2006-01-01

Anaplasma phagocytophilum infection is a recently emerged tick-borne zoonosis. The bacterium's reservoirs likely comprise cervids, some ruminants, rodents, and perhaps other small and intermediate-size mammals; the main vector in Europe is the Ixodes ricinus tick. The Białowieza Primeval Forest is an ecosystem with a known prevalence of tick-borne pathogens. We studied the root-vole Microtus oeconomus to evaluate the natural infection of A. phagocytophilum. Intragranulocytic bacterial clusters (morulae) were not seen, but the A. phagocytophilum-specific nested polymerase chain reaction (PCR) product, targeting the rrs gene, was detected in two out of 30 rodent samples (GenBank accession nos. DQ361024 and DQ361025). Twenty-six root vole (86.6%) hosted ticks, mainly Dermacentor reticulatus larvae and nymphs. Only two rodents were parasitazed by I. ricinus single larvae. These data show the presence of natural infection of A. phagocytophilum among the root-vole M. oeconomus in the Białowieza Primeval Forest ecosystem.

[Whipple's disease associated with opportunistic infections].

PubMed

Meier-Willersen, H J; Maiwald, M; von Herbay, A

1993-06-11

A 36-year-old man, with a history of recurrent respiratory infection, dermatomycosis, arthralgia and abnormal stools for 12 years, developed a febrile illness (up to 40 degrees C). A Serratia marcescens septicaemia responded to antibiotics. Four months later cervical and abdominal lymph-adenopathies were noticed. Cervical lymph node biopsy revealed lymphadenitis with epithelioid cell nests. Duodenoscopy with biopsy demonstrated Whipple's disease associated with lambliasis. Electron-microscopy showed rod-shaped bacteria typical of Whipple's disease, and Giardia lamblia. Using the polymerase chain reaction, Whipple-specific DNA fragments of 284 base pairs from the genome of the Whipple bacterium (Tropheryma whippelii) were demonstrated. Antibiotic treatment with Ampicillin (2 g three times daily) and ceftriaxone (2 g once daily) i.v. for 21 days, followed by oral ofloxacin (200 mg daily) and co-trimoxazole (three times daily 800 mg sulfamethoxazole and 160 mg trimethoprim), brought about remission of Whipple's disease. Long-term antibiotic treatment was continued with co-trimoxazole. Lambliasis recurred after 3 and 5 months, despite treatment with metronidazole, 250 mg three times daily for 7 days.

Identification of a recently active Prunus-specific non-autonomous Mutator element with considerable genome shaping force.

PubMed

Halász, Júlia; Kodad, Ossama; Hegedűs, Attila

2014-07-01

Miniature inverted-repeat transposable elements (MITEs) are known to contribute to the evolution of plants, but only limited information is available for MITEs in the Prunus genome. We identified a MITE that has been named Falling Stones, FaSt. All structural features (349-bp size, 82-bp terminal inverted repeats and 9-bp target site duplications) are consistent with this MITE being a putative member of the Mutator transposase superfamily. FaSt showed a preferential accumulation in the short AT-rich segments of the euchromatin region of the peach genome. DNA sequencing and pollination experiments have been performed to confirm that the nested insertion of FaSt into the S-haplotype-specific F-box gene of apricot resulted in the breakdown of self-incompatibility (SI). A bioinformatics-based survey of the known Rosaceae and other genomes and a newly designed polymerase chain reaction (PCR) assay verified the Prunoideae-specific occurrence of FaSt elements. Phylogenetic analysis suggested a recent activity of FaSt in the Prunus genome. The occurrence of a nested insertion in the apricot genome further supports the recent activity of FaSt in response to abiotic stress conditions. This study reports on a presumably active non-autonomous Mutator element in Prunus that exhibits a major indirect genome shaping force through inducing loss-of-function mutation in the SI locus. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Performance of nested RT-PCR on CSF for tuberculous meningitis diagnosis in HIV-infected patients.

PubMed

Gualberto, F A S; Gonçalves, M G; Fukasawa, L O; Santos, A M Ramos Dos; Sacchi, C T; Harrison, L H; Boulware, D R; Vidal, J E

2017-10-01

Timely diagnosis of tuberculous meningitis (TBM) in patients with human immunodeficiency virus (HIV) infection remains a challenge. Despite the current scale-up of the Xpert® MTB/RIF assay, other molecular diagnostic tools are necessary, particularly in referral centres in low- and middle-income countries without Xpert testing. To determine the diagnostic performance of nested real-time polymerase chain reaction (nRT-PCR) in HIV-infected TBM patients categorised according to standardised clinical case definitions. Based on clinical, laboratory and imaging data, HIV-infected patients with suspected TBM were prospectively categorised as 'definite TBM', 'probable TBM', 'possible TBM' or 'not TBM'. We evaluated nRT-PCR sensitivity and specificity in diagnosing TBM among definite TBM cases, and among definite + probable TBM cases. Ninety-two participants were enrolled in the study. nRT-PCR sensitivity for definite TBM (n = 8) was 100% (95%CI 67-100) and 86% (95%CI 60-96) for both definite and probable TBM (n = 6). Assuming that 'not TBM' patients (n = 74) were true-negatives, nRT-PCR specificity was 100% (95%CI 95-100). The possible TBM group (n = 4) had no nRT-PCR positives. The nRT-PCR is a useful rule-in test for HIV-infected patients with TBM according to international consensus case definitions. As nRT-PCR cannot exclude TBM, studies comparing and combining nRT-PCR with other assays are necessary for a rule-out test.

Study on the relationship between Helicobacter pylori in the dental plaque and the occurrence of dental caries or oral hygiene index.

PubMed

Liu, Ying; Lin, Huanjian; Bai, Yang; Qin, Xiaoshu; Zheng, Xin; Sun, Yong; Zhang, Yali

2008-08-01

The aims of our study were to determine the presence of Helicobacter pylori DNA in the dental plaque of Chinese children aged 3-6 years by nested polymerase chain reaction (PCR) and to investigate the relationship between this infection and the occurrence of dental caries or oral hygiene index. Two hundred and fourteen children from a kindergarten in Guangzhou City of China were evaluated. The children's plaques were assessed by plaque indices of Quigley-Hein. Dental plaque was analyzed using nested PCR for two sets of primers directed to the 860-bp fragment of H. pylori genomic DNA, which have been reported to be highly sensitive and specific by other researchers. H. pylori was detected in dental plaque samples from 126 children, and 70 children with dental caries carried H. pylori in dental plaque. Of these children without infection, only 36 of 88 suffered dental caries. Besides, the average dental plaque index of 126 H. pylori-positive children was higher than that of 88 children without infection. In the present study, there was a significant correlation between H. pylori infection and dental caries or dental hygiene. The oral cavity may be a reservoir for H. pylori infection in children. H. pylori in dental plaque may play a role in the occurrence of dental caries, and poor oral hygiene may represent a risk factor for H. pylori in the oral cavity.

Occurency of Giardia duodenalis assemblages in river water sources of Black Sea, Turkey.

PubMed

Koloren, Zeynep; Seferoğlu, Onuralp; Karanis, Panagiotis

2016-12-01

A total of 420 environmental water samples and 120 drinking water samples from 45 different sampling sites of the Black Sea in Turkey were collected between 2012 and 2014. Genomic DNA was isolated from all the investigated water samples and comparativelly analyzed by Loop-mediated isothermal amplification (LAMP) of the elongation factor 1 Alfa (EF1α) gene, and by nested Polymerase Chain Reaction (nPCR) of the small subunit (SSU) rRNA and semi-nested PCR (snPCR) of the glutamate dehydrogenase gene (GDH). 141 (58.7%), 125 (52.1%) and 120 (50%) samples respectivelly were positive by each method. Out of 240 environmental samples collected from 25 sites of Samsun Province have been found positive for G. duodenalis by LAMP, nPCR and snPCR, respectively. 55 (30.5%), 50 (27.8%) and 47 (26.1%) of 180 environmental samples collected from 20 other sampling sites of Giresun Province were positive for Giardia by LAMP, nPCR and snPCR, respectively. Five PCR products from different samples of the Giresun Province and 10 other samples from the Samsun Province were found positive for G. duodenalis assemblage B. Five PCR products from Giresun Province and 5 samples from Samsun Province were found positive for G. duodenalis assemblage A. This is the first report about G. duodenalis assemblages A and B from water samples investigations in Black Sea of Turkey. Copyright © 2016 Elsevier B.V. All rights reserved.

PCR-based diagnosis, molecular characterization and detection of atypical strains of avian Chlamydia psittaci in companion and wild birds.

PubMed

Madani, S A; Peighambari, S M

2013-02-01

Chlamydiosis is one of the most important infectious diseases of birds. In this study, 253 clinical samples were taken from 27 bird species belonging to seven orders. Thirty-two (12.6%) samples were positive for Chlamydia psittaci major outer membrane gene (ompA) DNA by a nested polymerase chain reaction (PCR). Twelve nested PCR-positive specimens were typed by ompA gene-based PCR-restricted fragment length polymorphism, using CTU/CTL primers and AluI restriction enzyme. Four restriction patterns were identified, including genotype A (two specimens from an African grey parrot [Psittacus erithacus] and a lorikeet [Trichoglossus haematodus]), genotype B (two specimens from a rock dove [Columbia livia] and a canary [Serinus canaria]), a third new restriction pattern (six specimens from African grey parrots), and a fourth new restriction pattern (two specimens from a ring-necked parakeet [Psittacula krameri] and an Alexandrine parakeet [Psittacula eupatria]). The third and the fourth restriction patterns are suggested to be provisional genotypes I and J, respectively. Partial sequencing of the ompA gene of seven specimens completely correlated with the results of PCR-restricted fragment length polymorphism and confirmed the presence of genotypes A and B and the two new provisional genotypes I and J. The two new genotypes have the closest identity with C. psittaci genotype F and Chlamydia abortus, respectively. From an evolutionary perspective, both new genotypes, particularly genotype J, are intermediate between the two species, C. psittaci and C. abortus.

Detection of Babesia caballi and Theileria equi in Blood from Equines from Four Indigenous Communities in Costa Rica.

PubMed

Posada-Guzmán, María Fernanda; Dolz, Gaby; Romero-Zúñiga, Juan José; Jiménez-Rocha, Ana Eugenia

2015-01-01

A cross-sectional study was carried out in four indigenous communities of Costa Rica to detect presence and prevalence of Babesia caballi and Theileria equi and to investigate factors associated with presence of these hemoparasites. General condition of horses (n = 285) was evaluated, and hematocrits and hemoglobin were determined from blood samples of 130 horses, which were also analyzed using blood smears, nested polymerase chain reaction (PCR), and immunosorbent assay (c-ELISA). The general condition of the horses (n = 285) in terms of their body and coat was between regular and poor, and hematocrit and hemoglobin average values were low (19% and 10.65 g/dL, resp.). Erythrocyte inclusions were observed in 32 (24.6%) of the samples. Twenty-six samples (20.0%) gave positive results for B. caballi and 60 (46.2%) for T. equi; 10 horses (7.7%) showed mixed infection, when analyzed by PCR. Using c-ELISA, it was found that 90 (69.2%) horses had antibodies against B. caballi and 115 (88.5%) against T. equi, while 81 (62.3%) showed mixed reactions. There were no factors associated with the presence of B. caballi and T. equi. These results contrast with results previously obtained in equines in the Central Valley of Costa Rica.

Detection of Babesia caballi and Theileria equi in Blood from Equines from Four Indigenous Communities in Costa Rica

PubMed Central

Posada-Guzmán, María Fernanda; Romero-Zúñiga, Juan José; Jiménez-Rocha, Ana Eugenia

2015-01-01

A cross-sectional study was carried out in four indigenous communities of Costa Rica to detect presence and prevalence of Babesia caballi and Theileria equi and to investigate factors associated with presence of these hemoparasites. General condition of horses (n = 285) was evaluated, and hematocrits and hemoglobin were determined from blood samples of 130 horses, which were also analyzed using blood smears, nested polymerase chain reaction (PCR), and immunosorbent assay (c-ELISA). The general condition of the horses (n = 285) in terms of their body and coat was between regular and poor, and hematocrit and hemoglobin average values were low (19% and 10.65 g/dL, resp.). Erythrocyte inclusions were observed in 32 (24.6%) of the samples. Twenty-six samples (20.0%) gave positive results for B. caballi and 60 (46.2%) for T. equi; 10 horses (7.7%) showed mixed infection, when analyzed by PCR. Using c-ELISA, it was found that 90 (69.2%) horses had antibodies against B. caballi and 115 (88.5%) against T. equi, while 81 (62.3%) showed mixed reactions. There were no factors associated with the presence of B. caballi and T. equi. These results contrast with results previously obtained in equines in the Central Valley of Costa Rica. PMID:26649225

Rapid and sensitive detection of mink circovirus by recombinase polymerase amplification.

PubMed

Ge, Junwei; Shi, Yunjia; Cui, Xingyang; Gu, Shanshan; Zhao, Lili; Chen, Hongyan

2018-06-01

To date, the pathogenic role of mink circovirus (MiCV) remains unclear, and its prevalence and economic importance are unknown. Therefore, a rapid and sensitive molecular diagnosis is necessary for disease management and epidemiological surveillance. However, only PCR methods can identify MiCV infection at present. In this study, we developed a nested PCR and established a novel recombinase polymerase amplification (RPA) assay for MiCV detection. Sensitivity analysis showed that the detection limit of nested PCR and RPA assay was 10 1 copies/reaction, and these methods were more sensitive than conventional PCR, which has a detection limit of 10 5 copies/reaction. The RPA assay had no cross-reactivity with other related viral pathogens, and amplification was completed in less than 20 min with a simple device. Further assessment of clinical samples showed that the two assays were accurate in identifying positive and negative conventional PCR samples. The detection rate of MiCV by the RPA assay in clinical samples was 38.09%, which was 97% consistent with that by the nested PCR. The developed nested PCR is a highly sensitive tool for practical use, and the RPA assay is a simple, sensitive, and potential alternative method for rapid and accurate MiCV diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.

SpaceNet: Modeling and Simulating Space Logistics

NASA Technical Reports Server (NTRS)

Lee, Gene; Jordan, Elizabeth; Shishko, Robert; de Weck, Olivier; Armar, Nii; Siddiqi, Afreen

2008-01-01

This paper summarizes the current state of the art in interplanetary supply chain modeling and discusses SpaceNet as one particular method and tool to address space logistics modeling and simulation challenges. Fundamental upgrades to the interplanetary supply chain framework such as process groups, nested elements, and cargo sharing, enabled SpaceNet to model an integrated set of missions as a campaign. The capabilities and uses of SpaceNet are demonstrated by a step-by-step modeling and simulation of a lunar campaign.

Nest signature changes throughout colony cycle and after social parasite invasion in social wasps

PubMed Central

Blancato, Giuliano; Picchi, Laura; Lucas, Christophe

2017-01-01

Social insects recognize their nestmates by means of a cuticular hydrocarbon signature shared by colony members, but how nest signature changes across time has been rarely tested in longitudinal studies and in the field. In social wasps, the chemical signature is also deposited on the nest surface, where it is used by newly emerged wasps as a reference to learn their colony odor. Here, we investigate the temporal variations of the chemical signature that wasps have deposited on their nests. We followed the fate of the colonies of the social paper wasp Polistes biglumis in their natural environment from colony foundation to decline. Because some colonies were invaded by the social parasite Polistes atrimandibularis, we also tested the effects of social parasites on the nest signature. We observed that, as the season progresses, the nest signature changed; the overall abundance of hydrocarbons as well as the proportion of longer-chain and branched hydrocarbons increased. Where present, social parasites altered the host-nest signature qualitatively (adding parasite-specific alkenes) and quantitatively (by interfering with the increase in overall hydrocarbon abundance). Our results show that 1) colony odor is highly dynamic both in colonies controlled by legitimate foundresses and in those controlled by social parasites; 2) emerged offspring contribute little to colony signature, if at all, in comparison to foundresses; and 3) social parasites, that later mimic host signature, initially mark host nests with species-specific hydrocarbons. This study implies that important updating of the neural template used in nestmate recognition should occur in social insects. PMID:29261775

Use of female nest characteristics in the sexual behaviour of male sockeye salmon

USGS Publications Warehouse

Hamon, T.R.; Foote, C.J.; Brown, G.S.

1999-01-01

On three island beaches in Iliamna Lake, Alaska, large numbers of male sockeye salmon gathered and spawned in artificial excavations that mimicked a female's nest immediately prior to spawning, while apparently ignoring the control site. The number of males attracted was correlated positively with changes in the operational sex ratio. In contrast, on the mainland beach examined, no reaction to the artificial nests was apparent. The results are discussed in terms of mate searching behaviour by males, the duration of the spawning period, and associated selection pressures on males to use characteristics of their environment that provide information on availability of females.

A survey of alterations in microbial community diversity in marine sediments in response to oil from the Deepwater Horizon spill: Northern Gulf of Mexico shoreline, Texas to Florida

USGS Publications Warehouse

Lisle, John T.

2011-01-01

Microbial community genomic DNA was extracted from sediment samples collected from the northern Gulf of Mexico (NGOM) coast. These samples had a high probability of being impacted by Macondo-1 (M-1) well oil from the Deepwater Horizon (DWH) drilling site. The hypothesis for this project was that presence of M-1 oil in coastal sediments would significantly alter the diversity within the microbial communities associated with the impacted sediments. To determine if community-level changes did or did not occur following exposure to M-1 oil, microbial community-diversity fingerprints were generated and compared. Specific sequences within the community's genomic DNA were first amplified using the polymerase chain reaction (PCR) using a primer set that provides possible resolution to the species level. A second nested PCR that was performed on the primary PCR products using a primer set on which a GC-clamp was attached to one of the primers. These nested PCR products were separated using denaturing-gradient gel electrophoresis (DGGE) that resolves the nested PCR products based on sequence dissimilarities (or similarities), forming a genomic fingerprint of the microbial diversity within the respective samples. Sediment samples with similar fingerprints were grouped and compared to oil-fingerprint data from Rosenbauer and others (2010). The microbial community fingerprints grouped closely when identifying those sites that had been impacted by M-1 oil (N=12) and/or some mixture of M-1 and other oil (N=4), based upon the oil fingerprints. This report represents some of the first information on naturally occurring microbial communities in sediment from shorelines along the NGOM coast. These communities contain microbes capable of degrading oil and related hydrocarbons, making this information relevant to response and recovery of the NGOM from the DWH incident.

Peroxy radical detection by chemical amplification (PERCA)

NASA Technical Reports Server (NTRS)

Stedman, D. H.

1986-01-01

Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.

Selecting surrogate endpoints for estimating pesticide effects on avian reproductive success

EPA Science Inventory

A Markov chain nest productivity model (MCnest) has been developed for projecting the effects of a specific pesticide-use scenario on the annual reproductive success of avian species of concern. A critical element in MCnest is the use of surrogate endpoints, defined as measured ...

Molecular phylogenetic, morphological, and mycotoxin data support reidentification of the Quorn mycoprotein fungus as Fusarium venenatum.

PubMed

O'Donnell, K; Cigelnik, E; Casper, H H

1998-02-01

Molecular phylogenetic, morphological, and mycotoxin data were obtained in order to investigate the relationships and identity of the Quorn mycoprotein fungus within Fusarium and to examine Quorn strains and commercial Quorn food products for trichothecene mycotoxins. Phylogenetic analyses of aligned DNA sequences obtained via the polymerase chain reaction from the nuclear 28S ribosomal DNA, nuclear ribosomal internal transcribed spacer region, and beta-tubulin gene exons and introns indicate that the Quorn fungus is Fusarium venenatum, rather than F. graminearum as previously reported. All of the Quorn strains examined were morphologically degenerate aconidial colonial mutants except for NRRL 25139, which produced chlamydospores in recurved terminal chains together with mostly 5-septate sporodochial conidia on doliform monophialides diagnostic of F. venenatum. Bootstrap and decay analyses provide strong support for a monophyletic lineage containing F. venenatum and several other type A trichothecene-producing species, while reference strains of F. graminearum were nested in a separate clade of species that produce type B trichothecenes and/or zearalenone. Analysis of mycotoxins from rice cultures inoculated with Quorn strain NRRL 25416 revealed that four type A trichothecenes are produced, but at low levels relative to strain NRRL 22198 of F. venenatum. No trichothecene mycotoxins, however, were detected from the analysis of three commercial Quorn products marketed for human consumption in England.

Tangled nonlinear driven chain reactions of all optical singularities

NASA Astrophysics Data System (ADS)

Vasil'ev, V. I.; Soskin, M. S.

2012-03-01

Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

Can avian reproductive outcomes estimated with MCnest be made more robust using stochastic parameterizations?

EPA Science Inventory

The Markov chain nest productivity model, or MCnest, is a set of algorithms for integrating the results of avian toxicity tests with reproductive life-history data to project the relative magnitude of chemical effects on avian reproduction. The mathematical foundation of MCnest i...

Real-time PCR and its application to mumps rapid diagnosis.

PubMed

Jin, L; Feng, Y; Parry, R; Cui, A; Lu, Y

2007-11-01

A real-time polymerase chain reaction assay was initially developed in China to detect mumps genome. The primers and TaqMan-MGB probe were selected from regions of the hemagglutinin gene of mumps virus. The primers and probe for the real-time PCR were evaluated by both laboratories in China and in the UK using three different pieces of equipment, LightCycler (Roche), MJ DNA Engine Option 2 (BIO-RAD) and TaqMan (ABI Prism) on different samples. The reaction was performed with either a one-step (China) or two-step (UK) process. The sensitivity (10 copies) was estimated using a serial dilution of constructed mumps-plasmid DNA and a linear standard curve was obtained between 10 and 10(7) DNA copies/reaction, which can be used to quantify viral loads. The detection limit on cell culture-grown virus was approximately 2 pfu/ml with a two-step assay on TaqMan, which was equivalent to the sensitivity of the nested PCR routinely used in the UK. The specificity was proved by testing a range of respiratory viruses and several genotypes of mumps strains. The concentration of primers and probe is 22 pmol and 6.25 or 7 pmol respectively for a 25 microl reaction. The assay took 3 hr from viral RNA extraction to complete the detection using any of the three pieces of equipment. Three hundred forty-one (35 in China and 306 in the UK) clinical specimens were tested, the results showing that this real-time PCR assay is suitable for rapid and accurate detection of mumps virus RNA in various types of clinical specimens. (c) 2007 Wiley-Liss, Inc.

Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

PubMed

Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

2018-06-01

Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

New construction of eigenstates and separation of variables for SU( N) quantum spin chains

NASA Astrophysics Data System (ADS)

Gromov, Nikolay; Levkovich-Maslyuk, Fedor; Sizov, Grigory

2017-09-01

We conjecture a new way to construct eigenstates of integrable XXX quantum spin chains with SU( N) symmetry. The states are built by repeatedly acting on the vacuum with a single operator B good( u) evaluated at the Bethe roots. Our proposal serves as a compact alternative to the usual nested algebraic Bethe ansatz. Furthermore, the roots of this operator give the separated variables of the model, explicitly generalizing Sklyanin's approach to the SU( N) case. We present many tests of the conjecture and prove it in several special cases. We focus on rational spin chains with fundamental representation at each site, but expect many of the results to be valid more generally.

Topological dynamics of optical singularities in speckle-fields induced by photorefractive scattering in a LiNbO{sub 3} : Fe crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vasil'ev, Vasilii I; Soskin, M S

2013-02-28

A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less

An O(n(5)) algorithm for MFE prediction of kissing hairpins and 4-chains in nucleic acids.

PubMed

Chen, Ho-Lin; Condon, Anne; Jabbari, Hosna

2009-06-01

Efficient methods for prediction of minimum free energy (MFE) nucleic secondary structures are widely used, both to better understand structure and function of biological RNAs and to design novel nano-structures. Here, we present a new algorithm for MFE secondary structure prediction, which significantly expands the class of structures that can be handled in O(n(5)) time. Our algorithm can handle H-type pseudoknotted structures, kissing hairpins, and chains of four overlapping stems, as well as nested substructures of these types.

Exploring Nested Reaction Fronts to Understand How Oxygen Cracks Rocks, Carbonic and Sulfuric Acids Dissolve Rocks, and Water Transports Rocks during Weathering

NASA Astrophysics Data System (ADS)

Brantley, S. L.; Gu, X.; Sullivan, P. L.; Kim, H.; Stinchcomb, G. E.; Lebedeva, M.; Balashov, V. N.

2016-12-01

To first order, weathering is the reaction of rocks with oxidants (oxygen, nitrate, etc.), acids (carbonic, sulfuric, and organic acids), and water. To explore weathering we have been studying the depth intervals in soils, saprolite, and weathering rock where mineral reactions are localized - "reaction fronts". We limit the study to ridges or catchments in climates where precipitation is greater than potential evapotranspiration. For example, in the Susquehanna Shale Hills Critical Zone Observatory, we observe reaction fronts that generally define very rough surfaces in 3D that mimic the land surface topography, although with lower relief. Overall, the fronts form nested curved surfaces. In Shale Hills, the deepest reaction fronts are oxidation of pyrite, and dissolution of carbonate. The carbonate is inferred to dissolve at least partly due to the sulfuric acid produced by the pyrite. In addition to pyrite, chlorite also starts to oxidize at the water table. We hypothesize that these dissolution and oxidation reactions open pores and cause microfracturing that open the rock to infiltration of advecting meteoric waters. At much shallower depths, illite is observed to dissolve. In Shale Hills, these reaction fronts - pyrite, carbonate, illite - separate over meters beneath the ridges. Such separated reaction fronts have also been observed in other fractured lithologies where oxidation is the deepest reaction and is associated with weathering-induced fractures. In contrast, in some massive mafic rocks, reaction fronts are almost co-located. By studying the geometry of reaction fronts, it may be possible to elucidate the relative importance of how oxygen cracks rocks; carbonic, organic, and sulfuric acids dissolve rocks; and water mobilizes rock materials during weathering.

Nested-PCR assay for detection of Schistosoma japonicum infection in domestic animals.

PubMed

Zhang, Xin; He, Chuan-Chuan; Liu, Jin-Ming; Li, Hao; Lu, Ke; Fu, Zhi-Qiang; Zhu, Chuan-Gang; Liu, Yi-Ping; Tong, Lai-Bao; Zhou, De-Bao; Zha, Li; Hong, Yang; Jin, Ya-Mei; Lin, Jiao-Jiao

2017-04-13

Schistosomiasis japonica is a common zoonosis. Domestic animals are the primary source of infection and play an important role in disease transmission. The prevalence and infectivity of this disease in domestic animals in China have significantly decreased and, for this reason, diagnostics with a higher sensitivity have become increasingly necessary. It was reported that polymerase chain reaction (PCR)-based methods could be used to detect schistosome infection in humans and animals and presented a high sensitivity and specificity. The present study aimed to develop a PCR-based method for detection of Schistosoma japonicum infection in domestic animals. A specific nested-PCR assay was developed to detect S. japonicum infection in domestic animals via amplification of a 231-bp DNA fragment of retrotransposon SjR2. The developed assay was first used in sera and dry blood filter paper (DBFP) from goats and buffaloes at different time points of infection. Then, 78 DBFPs from 39 artificially-infected bovines at 14 and 28 days post-infection and 42 DBFPs from schistosome-negative bovines from the city of Huangshan in the Anhui province were used to evaluate the diagnostic validity. Furthermore, this assay was used to detect S. japonicum infection in domestic animals in Dongzhi and Wangjiang counties. The expected PCR product was detected in eggs and adult worms of S. japonicum and blood samples from S. japonicum-infected goats and water buffaloes, but not from Fasciola and Haemonchus contortus worms. The nested-PCR assay could detect the target S. japonicum DNA in DBFPs from goats and buffaloes after day 3 post-infection. The sensitivity in buffaloes at 14 and 28 days post-infection was 92.30% (36/39) and 100% (39/39), respectively. The specificity was 97.60% (41/42). The positivity rates in Dongzhi and Wangjiang counties were 6.00% and 8.00% in bovines and 22.00% and 16.67% in goats, respectively. The positivity rates in goats in both counties were higher than those in bovines with a significant difference in Dongzhi County but not in Wangjiang County (P < 0.05 and P = 0.23, respectively). Our results suggest that the developed nested-PCR assay may be used for the diagnosis of S. japonicum infection in domestic animals, and the control of S. japonicum infection in goats should be paid more attention.

Evaluation of Line Immunoassay to Detect HTLV-1 Infection in an Endemic Area, Southwestern Japan; Comparison with Polymerase Chain Reaction and Western Blot.

PubMed

Umeki, Kazumi; Umekita, Kunihiko; Hashikura, Yuuki; Yamamoto, Ikuo; Kubo, Kazuyoshi; Nagatomo, Yasuhiro; Okayama, Akihiko

2017-02-01

Human T-lymphotropic virus type 1 (HTLV-1) has been recognized as a cause of adult T-cell leukemia/lymphoma, HTLV-1-associated myelopathy/tropical spastic paraparesis, and HTLV-1-associated uveitis. HTLV-1 infection is normally detected by screening for HTLV-1 antibodies, and positive samples are confirmed by Western blot (WB). However, WB fails to confirm some samples that were positive for HTLV-1 antibodies on screening. Line immunoassay (LIA) is commonly used in Europe and Brazil, but not in Japan. Therefore, we evaluated the performance of LIA as a method of confirming HTLV-1 antibodies using samples in Japan. LIA was compared with polymerase chain reaction (PCR) and WB using 50 negative and 70 positive samples tested by chemiluminescent enzyme immunoassay (CLEIA) in Miyazaki, Japan, an HTLV-1 endemic area. LIA (INNO-LIA HTLVI/II Score) and WB (Problot HTLV-I) were performed according to the manufacturer's instructions. Real-time PCR for HTLV-1 pX region was performed using DNA derived from white blood cells. The samples that tested negative by real-time PCR were further tested by nested PCR. All 50 CLEIA negative samples were determined to be negative by LIA and PCR. Of the 70 positive samples, 66 tested positive by both of LIA and PCR. Three samples tested negative by LIA and PCR, and the remaining sample (PCR negative) showed non-specific staining in LIA and WB. WB showed more indeterminate results than LIA. Gp21 antibody in LIA demonstrated a high ability to discriminate between positive and negative PCR results. Furthermore, the degree of gp21 antibody reaction by LIA showed correlation with HTLV-1 proviral loads (PVLs). Our results indicate that LIA performs well in confirming HTLV-1 seropositivity by showing a low incidence of indeterminate results and good agreement with PCR using samples in Japan, although the number of samples tested was small. In addition, semi-quantitative antibody titer to gp21 correlated well with HTLV-1 PVLs. Further study including larger samples is necessary to determine the positioning of LIA for HTLV-1 detection in Japan.

Acetylene chain reaction on hydrogenated boron nitride monolayers: a density functional theory study.

PubMed

Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru

2017-11-28

Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.

Correlation between genetic variability and virulence factors in clinical strains of Malassezia pachydermatis of animal origin.

PubMed

Buommino, Elisabetta; Nocera, Francesca Paola; Parisi, Annamaria; Rizzo, Antonietta; Donnarumma, Giovanna; Mallardo, Karina; Fiorito, Filomena; Baroni, Adone; De Martino, Luisa

2016-07-01

Malassezia pachydermatis is a yeast belonging to the microbiota of the skin and mucous membranes of dog and cat, but it can also act as pathogen, causing dermatitis. The aim of this work was to evaluate the genetic variability of M. pachydermatis strains isolated from symptomatic dogs and cats and determine a correlation between genotype and phenotype. For this purpose eleven strains of M. pachydermatis were molecularly classified by nested-polymerase chain reaction (nested-PCR) based on ITS-1 and ITS-2 regions, specific for fungal rRNA genes. Furthermore, random amplification of polymorphic DNA (RAPD) was applied for genetic typing of M. pachydermatis isolates identifying four different genotypes. Strains belonging to genotype 1 produced the highest amount of biofilm and phospholipase activity. The inflammatory response induced by M. pachydermatis strains in immortalized human keratinocytes (HaCat cells) was significantly different when we compared the results obtained from each strain. In particular, HaCat cells infected with the strains belonging to genotypes 1 and 2 triggered the highest levels of increase in TLR-2, IL-1β, IL-6, IL-8, COX-2 and MMP-9 expression. By contrast, cells infected with the strains of genotype 3 and those of genotype 4 did not significantly induce TLR-2 and cytokines. The results obtained might suggest a possible association between genotype and virulence factors expressed by M. pachydermatis strains. This highlights the need for a more accurate identification of the yeast to improve the therapeutic approach and to monitor the onset of human infections caused by this emergent zoonotic pathogen.

Factors Affecting Detection of Hepatitis E Virus on Canadian Retail Pork Chops and Pork Livers Assayed Using Real-Time RT-PCR.

PubMed

Wilhelm, B J; Leblanc, D; Avery, B; Pearl, D L; Houde, A; Rajić, A; McEwen, S A

2016-03-01

We collected 599 Canadian retail pork chops and 283 pork livers routinely (usually weekly) from April 2011 to March 2012 using the Canadian Integrated Program for Antimicrobial Resistance Surveillance (CIPARS) retail sampling platform. Samples were assayed using validated real-time (q) reverse transcriptase polymerase chain reaction (RT-PCR) and nested classical RT-PCR for the detection of hepatitis E virus (HEV), porcine enteric calicivirus (PEC) and rotavirus (RV). The presence of Escherichia coli, Salmonella spp. and Campylobacter spp. was measured on a subset of our samples. Exact logistic regression models were fitted for predictors for HEV detection, for each assay. For both assays, sample type (pork chop versus liver) was a significant predictor for HEV RNA detection. For nested classical RT-PCR but not qRT-PCR, region of sample collection was a significant predictor (P = 0.008) of HEV detection. Odds of HEV detection were greatest in spring relative to other seasons. E. coli was a significant predictor for HEV RNA detection using the qRT-PCR (P = 0.03). Overall, the prevalence of E. coli, Salmonella spp. and Campylobacter spp. was significantly greater than HEV, PEC or RV on our retail pork samples. Our sparse data set for the detection of PEC and RV precluded modelling of risk factors for the detection of these viruses. © 2015 Zoonoses and Public Health © 2015 Her Majesty the Queen in Right of Canada Reproduced with the permission of the Minister of the Public Health Agency of Canada.

Supplement to Theory of Neutron Chain Reactions

DOE R&D Accomplishments Database

Weinberg, Alvin M.; Noderer, L. C.

1952-05-26

General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

PubMed

Zhou, Yu; Pearson, John E; Auerbach, Anthony

2005-12-01

We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

PubMed

Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

2017-11-01

Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

The first report of detection of a phytoplasma in olive trees in a botanic collection in Iran.

PubMed

Ahangaran, A; Khezri, S; Habibi, M Koohi; Alizadeh, A; Mohammadi, Gh Mosahebi

2006-01-01

In a survey in 2005 some symptoms were observed on three olive trees in a collection of different olive cultivars in one of the central provinces in Iran (Yazd Province). Affected trees exhibited a variable range of symptoms: dwarfing, shoot proliferation, internode shortening, small leaves, leaf rolling, abortive buds, appearance of very small shoots, hypertrophied, and die- back. The possibility of association of a phytoplasma with the disease was evaluated using polymerase chain reaction (PCR). Total DNA was extracted from midribs of symptomatic and healthy olive plants using phytoplasma enriched procedure and tested for the presence of phytoplasma by nested-PCR using phytoplasmal- universal primers R16F2/R16R2, followed by primers fU5/rU3 which amplify 1200 and 880bp DNA fragments of 16SrDNA, respectively. PCR resulted in amplification of expected DNA fragments in symptomatic but not in healthy olive by both primer pairs. On the basis of symptoms and positive reaction in PCR, these plants can be infected with a phytoplasma. This is the first report of olive trees phytoplasmal disease in Iran. Identification of the agent and its comparison with other phytoplasmal isolates reported from other plants (hosts) in Iran are being studied. Based on the quarantine requirements, one of these trees was eradicated and two of them were transplanted in an isolated green house for further studies.

Genotypic Characterization of Cryptosporidium hominis from Water Samples in São Paulo, Brazil

PubMed Central

Araújo, Ronalda S.; Dropa, Milena; Fernandes, Licia N.; Carvalho, Terezinha T.; Sato, Maria Inês Z.; Soares, Rodrigo M.; Matté, Glavur R.; Matté, Maria Helena

2011-01-01

The protozoan parasite Cryptosporidium has emerged as one of the most important water contaminants, causing waterborne outbreaks of diarrheal diseases worldwide. The small size of oocysts under the microscope and the possibility of changes in characteristics of oocysts, mainly in environmental samples, make the taxonomy of the genus difficult if morphologic characteristics are considered. This limitation encouraged the application of molecular methods to identify this microorganism. The aim of this study was to detect and identify by nested-polymerase chain reaction oocysts of Cryptosporidium present in water samples in the state of São Paulo, Brazil. Water samples were concentrated through a membrane filter, DNA was extracted by using a standard technique, and both amplification reactions used forward and reverse oligonucleotides that were complementary to Cryptosporidium 18S ribosomal RNA gene sequences. Thirty water samples from different sites of collection in the state of São Paulo were evaluated. Cryptosporidium oocysts were detected in 30% of the samples. By genoptyping, C. hominis and Cryptosporidium sp. were identified in recreational water and C. meleagridis was identified in surface water samples. This is the first report of C. hominis in environmental samples in Brazil. Although identification of Cryptosporidium is still a difficult task, molecular methods are essential for specific identification and are a helpful tool to aid to understand the epidemiology of this parasite in Brazil. PMID:22049036

An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.

PubMed

Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján

2016-02-20

In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.

Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

PubMed

Umamaheswari, A; Venkateswarlu, K

2004-06-01

Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Cloning and heterologous expression of chlorophyll a synthase in Rhodobacter sphaeroides.

PubMed

Ipekoğlu, Emre M; Göçmen, Koray; Öz, Mehmet T; Gürgan, Muazzez; Yücel, Meral

2017-03-01

Rhodobacter sphaeroides is a purple non-sulfur bacterium which photoheterotrophically produces hydrogen from organic acids under anaerobic conditions. A gene coding for putative chlorophyll a synthase (chlG) from cyanobacterium Prochlorococcus marinus was amplified by nested polymerase chain reaction and cloned into an inducible-expression plasmid which was subsequently transferred to R. sphaeroides for heterologous expression. Induced expression of chlG in R. sphaeroides led to changes in light absorption spectrum within 400-700 nm. The hydrogen production capacity of the mutant strain was evaluated on hydrogen production medium with 15 mM malate and 2 mM glutamate. Hydrogen yield and productivity were increased by 13.6 and 22.6%, respectively, compared to the wild type strain. The results demonstrated the feasibility of genetic engineering to combine chlorophyll and bacteriochlorophyll biosynthetic pathways which utilize common intermediates. Heterologous expression of key enzymes from biosynthetic pathways of various pigments is proposed here as a general strategy to improve absorption spectra and yield of photosynthesis and hydrogen gas production in bacteria. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The involvement of immunoglobulin E isotype switch in scleroderma skin tissue.

PubMed

Ohtsuka, Tsutomu; Yamazaki, Soji

2005-08-01

The involvement of mast cell, which is activated by immunoglobulin E (IgE), has been reported in the formation of systemic sclerosis (SSc) abnormality. IgE is generated with isotype switch. During isotype switch, switch circles resulting from direct mu to epsilon, or from sequential mu to gamma via epsilon switching will be created. We studied whether switching occurs in SSc. We used nested polymerase chain reaction to analyze the S fragments from switch circles. Fifty-two patients with SSc, and 62 healthy women were studied. Neither of 62 normal skin tissues showed direct switch, nor sequential switch. Neither of seven normal whole blood cells showed direct switch, nor sequential switch. In 52SSc skin tissues, three (5.8%) showed direct switch, and two (3.8%) showed sequential switch. As a result, five (9.6%) of SSc skin tissue showed immunogobulin E class switch. These results were confirmed by DNA sequencing. These results demonstrated that isotype switch to the epsilon locus achieved by direct and/or sequential switch are involved in SSc skin.

Infection of aquatic insects with trematode metacercariae carrying Ehrlichia risticii, the cause of Potomac horse fever.

PubMed

Chae, J S; Pusterla, N; Johnson, E; Derock, E; Lawler, S P; Madigan, J E

2000-07-01

We provide evidence of Ehrlichia risticii Holland, the agent of Potomac horse fever, in trematode stages found in aquatic insects collected from a pasture stream in northern California, using nested polymerase chain reaction (PCR) amplification and sequence analyses of the 16S rRNA, 51 kDa major antigen and groEL heat shock protein genes. E. risticii was detected in metacercariae found in the immatures and adults of the following insects: caddisflies (Trichoptera), mayflies (Ephemeroptera), damselflies (Odonata, Zygoptera), dragonflies (Odonata, Anisoptera), and stoneflies (Plecoptera). The prevalence of E. risticii was 31.9% (n = 454 individuals) in aquatic insects (13 of 17 species were positive). Prevalence within orders was as follows: 43.5% (n = 207) in caddisflies, 15.2% (n = 92) in mayflies, 13.9% (n = 115) in damselflies, 10.0% (n = 10) in dragonflies, and 80.0% (n = 30) in stoneflies. This study demonstrates a broad intermediate host range for trematodes that act as vector for E. risticii. Insects are likely to play an important role in the epidemiology of this disease.

Prevalence of feline leukaemia provirus DNA in feline lymphomas.

PubMed

Weiss, Alexander Th A; Klopfleisch, Robert; Gruber, Achim D

2010-12-01

A significant drop in the prevalence of feline leukaemia virus (FeLV) antigenaemic cats and antigen-associated lymphomas has been observed after the introduction of FeLV vaccination and antigen-testing with removal of persistently antigenaemic cats. However, recent reports have indicated that regressively infected cats may contain FeLV provirus DNA and that lymphoma development may be associated with the presence of provirus alone. In the present study, we investigated the presence of FeLV antigen and provirus DNA in 50 lymphomas by immunohistochemistry and semi-nested polymerase chain reaction, respectively. Interestingly, almost 80% of T-cell lymphomas and 60% of B-cell lymphomas contained provirus DNA while only 21% of T-cell lymphomas and 11% of B-cell lymphomas expressed FeLV antigen. In conclusion, our results support previous hypotheses that vaccination and removal of persistently antigenaemic cats have led to a drop in FeLV antigen-expressing lymphomas. However, FeLV provirus DNA is still present in a high percentage of feline lymphomas. Copyright © 2010 ISFM and AAFP. Published by Elsevier Ltd. All rights reserved.

Lymphomatoid papulosis with pseudocarcinomatous hyperplasia in a 7-year-old girl: a case report.

PubMed

Xiong, Jingshu; Ma, Yiping; Chen, Hao; Xu, Xiulian; Sun, Jianfang

2016-05-01

Lymphomatoid papulosis (LyP) belongs to the group of cutaneous CD30+ lymphoproliferative disorders. Pseudocarcinomatous hyperplasia has rarely been reported in patients with LyP. In this report, we describe a case of LyP presenting as pseudocarcinomatous hyperplasia. The patient was a 7-year-old girl who presented with a recurrent papulonodular eruption on her face and trunk for 2 months. Histopathologic examination revealed an irregular growth of hyperkeratotic epidermis into the whole dermal layer with marked nests of squamous cells in the background of diffuse atypical lymphoid cells, eosinophils and neutrophils. The large atypical cells were positive for CD30 and CD3, but negative for CD4, CD5, CD8, CD20 and CD56. A TCR-γ clone was identified by polymerase chain reaction (PCR). The correct diagnosis in cases of LyP with overlying pseudocarcinomatous epithelial hyperplasia can be very difficult both clinically and histopathologically. Clinical and histopathologic characteristics should be integrated to avoid an erroneous diagnosis of squamous cell carcinoma or keratoacanthoma. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Prevalence of Toxoplasma gondii infection in feral cats in Seoul, Korea.

PubMed

Lee, Sang-Eun; Kim, Neung-Hee; Chae, Hee-Sun; Cho, Shin-Hyeong; Nam, Ho-Woo; Lee, Won-Ja; Kim, Sun-Heung; Lee, Jung-Hark

2011-02-01

The present study assessed the prevalence of Toxoplasma gondii infection in feral cat populations in Seoul using enzyme-linked immunosorbent assay (ELISA) and nested polymerase chain reaction (PCR). A total of 456 feral cats from 17 wards in Seoul was surveyed. The overall prevalence of T. gondii infection was 15.8% (69/456) by ELISA and 17.5% (80/456) by PCR; by gender, 17% (44/259) by ELISA and 16.2% (42/259) by PCR in males and 14.3% (28/196) by ELISA and 19.4% (38/196) by PCR in females. On a baseline of the Han River, prevalence was 15.1% (29/192) by ELISA and 15.6% (30/192) by PCR in the upper region and 16.4% (43/264) by ELISA and 18.9% (50/264) by PCR in the lower area. This suggested that toxoplasmosis is widespread throughout Seoul's feral cat population and it is critical that the city institute policies for the control of the feral cat population to reduce the risk of toxoplasmosis transmission to animals, including humans.

European Bat Lyssavirus Infection in Spanish Bat Populations

PubMed Central

Amengual, Blanca; Abellán, Carlos; Bourhy, Hervé

2002-01-01

From 1992 to 2000, 976 sera, 27 blood pellets, and 91 brains were obtained from 14 bat species in 37 localities in Spain. Specific anti-European bat lyssavirus 1 (EBL1)-neutralizing antibodies have been detected in Myotis myotis, Miniopterus schreibersii, Tadarida teniotis, and Rhinolophus ferrumequinum in the region of Aragon and the Balearic Islands. Positive results were also obtained by nested reverse transcription-polymerase chain reaction on brain, blood pellet, lung, heart, tongue, and esophagus-larynx-pharynx of M. myotis, Myotis nattereri, R. ferrumequinum, and M. schreibersii. Determination of nucleotide sequence confirmed the presence of EBL1 RNA in the different tissues. In one colony, the prevalence of seropositive bats over time corresponded to an asymmetrical curve, with a sudden initial increase peaking at 60% of the bats, followed by a gradual decline. Banded seropositive bats were recovered during several years, indicating that EBL1 infection in these bats was nonlethal. At least one of this species (M. schreibersii) is migratory and thus could be partially responsible for the dissemination of EBL1 on both shores of the Mediterranean Sea. PMID:11971777

Pulmonary Histoplasmosis in a Japanese Man Infected During Travel to Mexico and Management of His Wife's Condition: A Case Report.

PubMed

Asahata-Tago, Sayaka; Hirai, Yuji; Ainoda, Yusuke; Fujita, Takahiro; Muraosa, Yasunori; Kamei, Katsuhiko; Wakayama, Megumi; Shibuya, Kazutoshi; Kikuchi, Ken

2016-01-01

We report herein on the case of a 33-year-old Japanese man in whom an abnormal shadow was detected on chest radiography during a medical checkup after a 1-year-stay in Mexico. Chest computed tomography showed a nodule in the left lower lobe adjacent to the visceral pleura. Histopathologic examination of a thoracoscopic partial pulmonary resection specimen showed coagulation necrosis with a number of yeast-like forms on Grocott staining. In addition, serum anti-Histoplasma antibody positivity was detected with an enzyme-linked immunosorbent assay, and Histoplasma-specific nested real-time polymerase chain reaction results were positive in the pulmonary region. Finally, pulmonary histoplasmosis was diagnosed, and treatment with itraconazole was initiated. The patient's wife who had accompanied him to Mexico was asymptomatic and was not found to have histoplasmosis based on diagnostic imaging and serological findings. Although rare in Japan, histoplasmosis should be considered in the differential diagnosis of pulmonary lesions in patients who have returned from travel to endemic areas.

Detection and differentiation of Entamoeba histolytica and Entamoeba dispar isolates in clinical samples by PCR.

PubMed

Helmy, Moshira M F; Rashed, Laila A; Abdel-Fattah, Hisham S

2007-04-01

A total of 140 out of 180 outpatients attended MISR University for Science and Technology Hospital complained of abdominal pain, diarrhoea and/or dysentery. Stool examination showed 47 (33.6%) had Entamoeba sp., 36 (25.7%) had cysts and 11 (7.9%) had trophozoites. Of 40 asymptomatic ones, 4 (10%) had cysts. A total of 51 positive stool samples for Entamoeba sp. (40 cysts & 11 trophozoites) were tested by Ne-sted Polymerase Chain Reaction (N-PCR) and Restriction Enzyme Digestion (RED) to clarify true E. histolytica from E. dispar. The results showed that 9/51 (17.6%) had E. dispar, while 31 (60.8%) had E. histolytica and 11 (21.6%) had dual infection with both E. histolytica and E. dispar. All E. histolytica PCR proved cases were from the symptomatic group, 11 had trophozoites and 34 had cysts. Thus, the result showed the potential use of molecular tools in detection of E. histolytica and E. dispar, and is a promising tool for epidemiology, particularly to differentiate pathogenic and non pathogenic Entamoeba sp.

Rubella virus as a possible etiological agent of Fuchs heterochromic iridocyclitis.

PubMed

Suzuki, Jun; Goto, Hiroshi; Komase, Katsuhiro; Abo, Hitoshi; Fujii, Kaoru; Otsuki, Noriyuki; Okamoto, Kiyoko

2010-10-01

To determine whether rubella virus is involved in the pathogenesis of Fuchs heterochromic iridocyclitis (FHI). Fourteen patients (14 eyes) diagnosed with FHI based on characteristic ocular manifestations and eight control subjects were studied. Aqueous humor (AH) samples from 14 FHI patients and one vitreous sample from a FHI patient were analyzed for intraocular antibody production against rubella virus by calculation of the Goldmann-Witmer coefficient (GWC). Viral detection by nested polymerase chain reaction and isolation by culture in RK-13 cells were conducted in nine FHI patients. In addition to laboratory examinations, medical history of rubella virus vaccination was also obtained. Ten patients with FHI examined showed intraocular synthesis of rubella virus antibodies (GWC > 3). A high index of rubella virus antibody production was also found in the vitreous sample (GWC = 30.6). GWC in all control subjects were below detectable level. The rubella genome was detected in two of nine patients, and rubella virus was isolated from one of nine patients with FHI. None of the patients with FHI had been vaccinated against rubella. Our laboratory data strongly suggest a relationship between FHI and rubella virus.

Detection of Toxoplasma gondii DNA in Brazilian oysters (Crassostrea rhizophorae).

PubMed

Ribeiro, L A; Santos, L K N S S; Brito, P A; Maciel, B M; Da Silva, A V; Albuquerque, G R

2015-05-04

The aim of this study was to detect evidence of Toxoplasma gondii using polymerase chain reaction (PCR)-based techniques in oysters (Crassostrea rhizophorae) obtained from the southern coastal region of Bahia, Brazil. A total of 624 oysters were collected, and the gills and digestive glands were dissected. Each tissue sample was separated into pools containing tissues (of the same type) from three animals, leading to a total of 416 experimental samples for analysis (208 samples each from the gills and digestive glands). Molecular analysis using PCR-based detection of the T. gondii AF 146527 repetitive fragment yielded negative results for all samples. However, when nested-PCR was used for detection of the T. gondii SAG-1 gene, 17 samples were positive, with the gills being the tissue with maximal detection of the parasite. These positive results were confirmed by sample sequencing. It is therefore suggested that C. rhizophorae oysters are capable of filtering and retaining T. gondii oocysts in their tissue. This represents a risk to public health because they are traditionally ingested in natura.

Solid-Pattern Desmoplastic Small Round Cell Tumor.

PubMed

Ali, Ahmed; Mohamed, Mustafa; Chisholm, Julia; Thway, Khin

2017-04-01

Desmoplastic small round cell tumor (DSRCT) is an aggressive small round cell sarcoma that typically occurs intra-abdominally in adolescents and young adults, and is characterized by a recurrent t(11;22)(p13;q12) translocation leading to generation of the EWSR1-WT1 fusion gene, which codes for a chimeric protein with transcriptional regulatory activity. DSRCT has a characteristic histologic appearance of nests of uniform small cells within prominent fibroblastic stroma and immunohistochemically it shows multidirectional differentiation, with expression of epithelial, neural, and muscle markers. We illustrate a case of DSRCT that presented as a large intra-abdominal mass, which harbored EWSR1 rearrangement by fluorescence in situ hybridization and EWSR1-WT1 fusion transcripts by reverse transcription-polymerase chain reaction (RT-PCR), and which histologically had an entirely solid morphology, lacking evidence of desmoplastic stroma. This purely solid variant emphasizes that even when occurring at a typical location, DSRCT may be difficult to recognize when lacking nonclassical morphology. This is of clinical relevance, as DSRCT with this pattern could be misdiagnosed as Ewing sarcoma if RT-PCR is not performed, with resulting prognostic and therapeutic implications.

Detection of Plasmodium sp. in capybara.

PubMed

dos Santos, Leonilda Correia; Curotto, Sandra Mara Rotter; de Moraes, Wanderlei; Cubas, Zalmir Silvino; Costa-Nascimento, Maria de Jesus; de Barros Filho, Ivan Roque; Biondo, Alexander Welker; Kirchgatter, Karin

2009-07-07

In the present study, we have microscopically and molecularly surveyed blood samples from 11 captive capybaras (Hydrochaeris hydrochaeris) from the Sanctuary Zoo for Plasmodium sp. infection. One animal presented positive on blood smear by light microscopy. Polymerase chain reaction was carried out accordingly using a nested genus-specific protocol, which uses oligonucleotides from conserved sequences flanking a variable sequence region in the small subunit ribosomal RNA (ssrRNA) of all Plasmodium organisms. This revealed three positive animals. Products from two samples were purified and sequenced. The results showed less than 1% divergence between the two capybara sequences. When compared with GenBank sequences, a 55% similarity was obtained to Toxoplasma gondii and a higher similarity (73-77.2%) was found to ssrRNAs from Plasmodium species that infect reptile, avian, rodents, and human beings. The most similar Plasmodium sequence was from Plasmodium mexicanum that infects lizards of North America, where around 78% identity was found. This work is the first report of Plasmodium in capybaras, and due to the low similarity with other Plasmodium species, we suggest it is a new species, which, in the future could be denominated "Plasmodium hydrochaeri".

Human enteric viruses in groundwater indicate offshore transport of human sewage to coral reefs of the Upper Florida Keys.

PubMed

Futch, J Carrie; Griffin, Dale W; Lipp, Erin K

2010-04-01

To address the issue of human sewage reaching corals along the main reef of the Florida Keys, samples were collected from surface water, groundwater and coral [surface mucopolysaccharide layers (SML)] along a 10 km transect near Key Largo, FL. Samples were collected semi-annually between July 2003 and September 2005 and processed for faecal indicator bacteria (faecal coliform bacteria, enterococci and Clostridium perfringens) and human-specific enteric viruses (enterovirus RNA and adenovirus DNA) by (RT)-nested polymerase chain reaction. Faecal indicator bacteria concentrations were generally higher nearshore and in the coral SML. Enteric viruses were evenly distributed across the transect stations. Adenoviruses were detected in 37 of 75 samples collected (49.3%) whereas enteroviruses were only found in 8 of 75 samples (10.7%). Both viruses were detected twice as frequently in coral compared with surface water or groundwater. Offshore, viruses were most likely to be found in groundwater, especially during the wet summer season. These data suggest that polluted groundwater may be moving to the outer reef environment in the Florida Keys.

Human enteric viruses in groundwater indicate offshore transport of human sewage to coral reefs of the Upper Florida Keys

USGS Publications Warehouse

Futch, J. Carrie; Griffin, Dale W.; Lipp, Erin K.

2010-01-01

To address the issue of human sewage reaching corals along the main reef of the Florida Keys, samples were collected from surface water, groundwater and coral [surface mucopolysaccharide layers (SML)] along a 10 km transect near Key Largo, FL. Samples were collected semi-annually between July 2003 and September 2005 and processed for faecal indicator bacteria (faecal coliform bacteria, enterococci and Clostridium perfringens) and human-specific enteric viruses (enterovirus RNA and adenovirus DNA) by (RT)-nested polymerase chain reaction. Faecal indicator bacteria concentrations were generally higher nearshore and in the coral SML. Enteric viruses were evenly distributed across the transect stations. Adenoviruses were detected in 37 of 75 samples collected (49.3%) whereas enteroviruses were only found in 8 of 75 samples (10.7%). Both viruses were detected twice as frequently in coral compared with surface water or groundwater. Offshore, viruses were most likely to be found in groundwater, especially during the wet summer season. These data suggest that polluted groundwater may be moving to the outer reef environment in the Florida Keys.

Generation of the novel monoclonal antibody against TLS/EWS-CHOP chimeric oncoproteins that is applicable to one of the most sensitive assays for myxoid and round cell liposarcomas.

PubMed

Oikawa, Kosuke; Ishida, Tsuyoshi; Imamura, Tetsuo; Yoshida, Keiichi; Takanashi, Masakatsu; Hattori, Hiroyuki; Ishikawa, Akio; Fujita, Koji; Yamamoto, Kengo; Matsubayashi, Jun; Kuroda, Masahiko; Mukai, Kiyoshi

2006-03-01

The fusion oncoproteins, TLS-CHOP and EWS-CHOP, are characteristic markers for myxoid and round cell liposarcomas (MLS/RCLS). Especially, the peptide sequence of 26 amino acids corresponding to the normally untranslated CHOP exon 2 and parts of exon 3 (5'-UTR) is a unique structure for these chimeric proteins. In this report, we have generated monoclonal antibodies against the unique peptide sequence of TLS/EWS-CHOP oncoproteins. These antibodies reacted with TLS-CHOP fusion protein, but not reacted with normal TLS and CHOP proteins by Western blot analysis. In addition, one of the antibodies also recognized the chimeric oncoprotein in archival paraffin-embedded tissue samples of MLS/RCLS. The oncoprotein was detectable by the antibody even in the paraffin-embedded tissue samples whose mRNAs were too degraded to be detected by a nested reverse transcription-polymerase chain reaction-based assay. Thus, the molecular assay using the novel antibody is expected to be one of the most sensitive diagnostic assays for MLS/RCLS.

PREVALENCE OF HUMAN ENTEROVIRUS AMONG PATIENTS WITH HAND, FOOT, AND MOUTH DISEASE AND HERPANGINA IN THAILAND, 2013.

PubMed

Mauleekoonphairoj, John; Puenpa, Jiratchaya; Korkong, Sumeth; Vongpunsawad, Sompong; Poovorawan, Yong

2015-11-01

Human enterovirus (EV) infection causes hand, foot, and mouth disease (HFMD) and herpangina (HA). We studied the prevalence of enterovirus (EV) among patients with HFMD and HA in Thailand during 2013. We conducted a study in archived specimens of patients sent for screening for enterovirus. A total of 203 clinical specimens from 184 individuals with painful blister in the oropharynx and on the palms, soles, knees, elbows or buttock were examined by semi-nested polymerase chain reaction (PCR) for the 5'UTR and VP1 genes of EV. Eighty-six samples were positive: EV71 was detected in 14 (30%), CV-A8 in 12 (26%) and CV-A16 in 10 (21%). Classification of EV species detected revealed that 46 specimens were EV-A, 14 specimens were EV-B, 1 specimen was EV-D, and 16 specimens were positive for unclassified enterovirus. The majority of individuals with EV infection were aged 2-6 years. Multiple EV-A serotypes were detected among HFMD and HA patients in our study.

Reconstituted immunity against persistent parvovirus B19 infection in a patient with acquired immunodeficiency syndrome after highly active antiretroviral therapy.

PubMed

Chen, M Y; Hung, C C; Fang, C T; Hsieh, S M

2001-05-01

We discovered a patient with AIDS with persistent B19 infection who had slow resolution of anemia after he commenced receiving HAART without intravenous immunoglobulin. The patient's anemia recurred when the initial course of HAART failed, but it remitted slowly after salvage therapy was instituted. However, circulating B19 was still detectable by nested polymerase chain reaction 1 year after commencement of salvage therapy. Immunoglobulin G and immunoglobulin M antibodies against B19 were not detected by means of enzyme-linked immunosorbent assay when the anemia initially resolved, but they were detected after the patient commenced receiving salvage therapy. The absence of antibody response after the initial remission of parvovirus B19 infection suggested that cellular immunity was an important component of reconstituted immune function against B19 after the patient received HAART. The humoral response that was restored later was abnormal; it had strong reactivity to nonstructural protein NS-1 and poor generation of neutralizing antibodies against linear epitopes unique to minor capsid protein VP1.

[A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].

PubMed

Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng

2013-10-18

To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.

Seasonal shifts in sex ratios are mediated by maternal effects and fluctuating incubation temperatures.

PubMed

Carter, Amanda W; Bowden, Rachel M; Paitz, Ryan T

2017-04-01

Sex-specific maternal effects can be adaptive sources of phenotypic plasticity. Reptiles with temperature-dependent sex determination (TSD) are a powerful system to investigate such maternal effects because offspring phenotype, including sex, can be sensitive to maternal influences such as oestrogens and incubation temperatures.In red-eared slider turtles ( Trachemys scripta ), concentrations of maternally derived oestrogens and incubation temperatures increase across the nesting season; we wanted to determine if sex ratios shift in a seasonally concordant manner, creating the potential for sex-specific maternal effects, and to define the sex ratio reaction norms under fluctuating temperatures across the nesting season.Eggs from early and late season clutches were incubated under a range of thermally fluctuating temperatures, maternally derived oestradiol concentrations were quantified via radioimmunoassay, and hatchling sex was identified. We found that late season eggs had higher maternal oestrogen concentrations and were more likely to produce female hatchlings. The sex ratio reaction norm curves systematically varied with season, such that with even a slight increase in temperature (0.5°C), late season eggs produced up to 49% more females than early season eggs.We found a seasonal shift in sex ratios which creates the potential for sex-specific phenotypic matches across the nesting season driven by maternal effects. We also describe, for the first time, systematic variation in the sex ratio reaction norm curve within a single population in a species with TSD.

The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

PubMed

Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

2006-07-01

We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

Fine-scale thermal adaptation in a green turtle nesting population

PubMed Central

Weber, Sam B.; Broderick, Annette C.; Groothuis, Ton G. G.; Ellick, Jacqui; Godley, Brendan J.; Blount, Jonathan D.

2012-01-01

The effect of climate warming on the reproductive success of ectothermic animals is currently a subject of major conservation concern. However, for many threatened species, we still know surprisingly little about the extent of naturally occurring adaptive variation in heat-tolerance. Here, we show that the thermal tolerances of green turtle (Chelonia mydas) embryos in a single, island-breeding population have diverged in response to the contrasting incubation temperatures of nesting beaches just a few kilometres apart. In natural nests and in a common-garden rearing experiment, the offspring of females nesting on a naturally hot (black sand) beach survived better and grew larger at hot incubation temperatures compared with the offspring of females nesting on a cooler (pale sand) beach nearby. These differences were owing to shallower thermal reaction norms in the hot beach population, rather than shifts in thermal optima, and could not be explained by egg-mediated maternal effects. Our results suggest that marine turtle nesting behaviour can drive adaptive differentiation at remarkably fine spatial scales, and have important implications for how we define conservation units for protection. In particular, previous studies may have underestimated the extent of adaptive structuring in marine turtle populations that may significantly affect their capacity to respond to environmental change. PMID:21937495

Polymerase chain reaction for Mycobacterium tuberculosis DNA detection from ocular fluids in patients with various types of choroiditis in a referral eye center in India

PubMed Central

Biswas, Jyotirmay; Kazi, Mohmmad Salman; Agarwal, Vishvesh Ashokkumar; Alam, Md. Shahid; Therese, K Lily

2016-01-01

Aims: The aim of this study was to detect Mycobacterium tuberculosis (MTB) DNA with polymerase chain reaction (PCR) in aqueous or vitreous samples of patients suffering from choroiditis presumed to be infectious origin. Settings and Design: Hospital-based, retrospective case–control study. Subjects and Methods: In all, forty eyes of forty patients with choroiditis divided into two groups – Group A (serpiginous-like choroiditis, ampiginous choroiditis, multifocal choroiditis) and Group B (choroidal abscess, miliary tuberculosis (TB), choroidal tubercle) were analyzed retrospectively. In 27 controls (patients without uveitis undergoing phacoemulsification), anterior chamber aspirate was done and sample subjected to real-time PCR. Patients underwent nested PCR for MTB using IS6110 and MPB64 primers from aqueous (n = 39) or vitreous (n = 1). All patients underwent detailed ophthalmological examination by slit-lamp biomicroscopy, fundus examination by indirect ophthalmoscopy, and fundus photograph and fundus fluorescein angiography if required. Statistical Analysis: Positive results of PCR for MTB within the group and between two groups were statistically analyzed using Chi-square test. Results: There were 25 males and 15 females. Mean age at presentation was 34.66 years (range, 14–62). PCR positivity rates were 41.3% (n = 12/29) and 81.82% (n = 9/11) in Groups A and B, respectively. No controls had PCR-positive result. Comparison of PCR positivity rates showed statistically significant difference between Groups A and B (P = 0.028). Systemic TB was detected in 57.14% (n = 12/21) of all PCR-positive cases (Group A - 33.3%, n = 4/12; Group B - 88.9%, n = 8/9). Systemic antitubercular treatment (ATT) for 9 months and oral steroids were successful in resolution of choroiditis in all PCR-positive patients (n = 21) without disease recurrence. Conclusions: Eyes with choroiditis of suspected/presumed tubercular origin should be subjected to PCR for diagnosis of TB and subjected to ATT for prevention of recurrences. PMID:28112131

Multiple gastrointestinal stromal tumors in type I neurofibromatosis: a pathologic and molecular study.

PubMed

Yantiss, Rhonda K; Rosenberg, Andrew E; Sarran, Lisa; Besmer, Peter; Antonescu, Cristina R

2005-04-01

Multiple gastrointestinal stromal tumors typically occur in familial form associated with KIT receptor tyrosine kinase or platelet-derived growth factor receptor-alpha (PDGFRA) germline mutations, but may also develop in the setting of type 1 neurofibromatosis. The molecular abnormalities of gastrointestinal stromal tumors arising in neurofibromatosis have not been extensively studied. We identified three patients with type 1 neuro-fibromatosis and multiple small intestinal stromal tumors. Immunostains for CD117, CD34, desmin, actins, S-100 protein, and keratins were performed on all of the tumors. DNA was extracted from representative paraffin blocks from separate tumor nodules in each case and subjected to a nested polymerase chain reaction, using primers for KIT exons 9, 11, 13, and 17 and PDGFRA exons 12 and 18, followed by direct sequencing. The mean patient age was 56 years (range: 37-86 years, male/female ratio: 2/1). One patient had three tumors, one had five, and one had greater than 10 tumor nodules, all of which demonstrated histologic features characteristic of gastrointestinal stromal tumors and stained strongly for CD117 and CD34. One patient died of disease at 35 months, one was disease free at 12 months and one was lost to follow-up. DNA extracts from 10 gastrointestinal stromal tumors (three from each of two patients and four from one patient) were subjected to polymerase chain reactions and assessed for mutations. All of the tumors were wild type for KIT exons 9, 13, and 17 and PDGFRA exons 12 and 18. Three tumors from one patient had identical point mutations in KIT exon 11, whereas the other tumors were wild type at this locus. We conclude that, although most patients with type 1 neurofibromatosis and gastrointestinal stromal tumors do not have KIT or PDGFRA mutations, KIT germline mutations might be implicated in the pathogenesis of gastrointestinal stromal tumors in some patients.

Utility of nested polymerase chain reaction over the microscopy and immuno-chromatographic test in the detection of Plasmodium species and their clinical spectrum.

PubMed

Ranjan, P; Ghoshal, U

2016-09-01

Though demonstration of Plasmodium parasite in peripheral blood on microscopy remains gold standard, it may miss some patients resulting in delay in instituting life-saving therapy. Studies on polymerase chain reaction (PCR), a highly sensitive and specific technique that also discriminates among different species of malaria parasite, are scanty. Hence, we aimed to evaluate the role of PCR in diagnosis and species identification of Plasmodium. Of 2186 febrile patients with clinical suspicion of malaria screened between July 2013 to February 2015, 561 patients fulfilled inclusion criteria. Microscopy, rapid diagnostic test (RDT) and PCR were performed to identify the parasite. Plasmodium was detected in 64/561 (11.40 %), 92/561 (16.40 %) and 78/561 (13.90 %) cases using microscopy, RDT and PCR, respectively. Of 78 positive cases by PCR, 47 (60.25 %) were confirmed as Plasmodium falciparum (P. falciparum), 28 (35.89 %) were Plasmodium vivax (P. vivax) and 3 (3.84 %) had mixed infections. Sensitivity and specificity of microscopy and RDT were 82.10 %, 100 % and 98.70 %, 96.90 %, respectively (p = 0.139). Of total 93 patients, 67 (72.04 %) were classified as complicated and 26 (27.96 %) were as uncomplicated. Creatinine (p = <0.001), conjugated bilirubin (p = 0.003) and total bilirubin (p = <0.001) level was elevated in complicated malaria along with renal (65 %) and liver dysfunction (25 %). In the present study, P. falciparum was responsible for 40/67 (59.70 %) cases of complicated malaria; P. vivax was also found in 17/67 (25.37 %) complicated cases using PCR. The findings highlight the alarming number of complicated vivax malaria in addition to falciparum. Moreover, PCR proved to be highly sensitive and specific test for detecting Plasmodium species.

Posttransplant lymphoproliferative disorder in a kidney-pancreas transplanted recipient: simultaneous development of clonal lymphoid B-cell proliferation of host and donor origin.

PubMed

Heyny-von Haussen, Roland; Klingel, Karin; Riegel, Werner; Kandolf, Reinhard; Mall, Gerhard

2006-07-01

Posttransplant lymphoproliferative disorders (PTLDs) are lymphoid proliferations or lymphomas that develop as a consequence of immunosuppression after solid organ or bone marrow transplantation and are mostly associated with an Epstein-Barr virus infection. The morphologic categories include different types of benign and malignant lymphoid proliferations. The majority of PTLDs is of B-cell origin with clonal rearrangements of the immunoglobulin genes. The PTLDs in solid organ transplants are reported to be either of host or of donor origin. Donor-related PTLDs frequently involve the allograft. We report a case of a 52-year-old woman recipient who developed simultaneously PTLDs in several organs 5 month after receiving a sex-mismatched renal and pancreas allograft. Immunosuppression regimen comprised antithymocyte globulin, tacrolimus, mycophenolate mofetil, and steroids. Pathologic features appeared as polymorphic PTLDs in the renal allograft, liver, and central nervous system (CNS). Molecular genetic studies revealed different clonal immunoglobulin heavy chain gene rearrangements in all 3 organs as determined by polymerase chain reaction (PCR). Epstein-Barr virus were detected by nested PCR and in situ hybridization in all 3 tumors. The PTLDs in liver and CNS were of host origin whereas the allograft kidney PTLD was found to originate from the male donor as shown by the simultaneous detection of female and male sex chromosomes by PCR and fluorescence in situ hybridization. The recipient died in consequence of the CNS involvement, after intracerebral hemorrhage with uncal and tonsillar herniation.

Modeling sustainability in renewable energy supply chain systems

NASA Astrophysics Data System (ADS)

Xie, Fei

This dissertation aims at modeling sustainability of renewable fuel supply chain systems against emerging challenges. In particular, the dissertation focuses on the biofuel supply chain system design, and manages to develop advanced modeling framework and corresponding solution methods in tackling challenges in sustaining biofuel supply chain systems. These challenges include: (1) to integrate "environmental thinking" into the long-term biofuel supply chain planning; (2) to adopt multimodal transportation to mitigate seasonality in biofuel supply chain operations; (3) to provide strategies in hedging against uncertainty from conversion technology; and (4) to develop methodologies in long-term sequential planning of the biofuel supply chain under uncertainties. All models are mixed integer programs, which also involves multi-objective programming method and two-stage/multistage stochastic programming methods. In particular for the long-term sequential planning under uncertainties, to reduce the computational challenges due to the exponential expansion of the scenario tree, I also developed efficient ND-Max method which is more efficient than CPLEX and Nested Decomposition method. Through result analysis of four independent studies, it is found that the proposed modeling frameworks can effectively improve the economic performance, enhance environmental benefits and reduce risks due to systems uncertainties for the biofuel supply chain systems.

Polymerase chain reaction system

DOEpatents

Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

2004-03-02

A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

2013-06-28

Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

Control and reduction of peak temperature in self-curing resins.

PubMed

Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A

2009-07-01

INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.

Modeling competitive substitution in a polyelectrolyte complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu

2015-12-28

We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less

Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

PubMed

Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

2011-03-14

Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Hybrid chalcogenide nanoparticles: 2D-WS2 nanocrystals inside nested WS2 fullerenes.

PubMed

Hoshyargar, Faegheh; Corrales, Tomas P; Branscheid, Robert; Kolb, Ute; Kappl, Michael; Panthöfer, Martin; Tremel, Wolfgang

2013-10-28

The MOCVD assisted formation of nested WS2 inorganic fullerenes (IF-WS2) was performed by enhancing surface diffusion with iodine, and fullerene growth was monitored by taking TEM snapshots of intermediate products. The internal structure of the core-shell nanoparticles was studied using scanning electron microscopy (SEM) after cross-cutting with a focused ion beam (FIB). Lamellar reaction intermediates were found occluded in the fullerene particles. In contrast to carbon fullerenes, layered metal chalcogenides prefer the formation of planar, plate-like structures where the dangling bonds at the edges are stabilized by excess S atoms. The effects of the reaction and annealing temperatures on the composition and morphology of the final product were investigated, and the strength of the WS2 shell was measured by intermittent contact-mode AFM. The encapsulated lamellar structures inside the hollow spheres may lead to enhanced tribological activities.

Silicon-based sleeve devices for chemical reactions

DOEpatents

Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

1996-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Silicon-based sleeve devices for chemical reactions

DOEpatents

Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

1996-12-31

A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

PubMed

Chen, Y T; Mercer, G O; Chen, Y

1993-11-01

Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

PubMed

Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

2016-10-01

The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

PubMed

Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

2002-07-01

Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

Organic reactions mediated by electrochemically generated ArS+.

PubMed

Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi

2011-04-21

Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.

Comparison of clinical performance of antigen based-enzyme immunoassay (EIA) and major outer membrane protein (MOMP)-PCR for detection of genital Chlamydia trachomatis infection.

PubMed

Nateghi Rostami, Mahmoud; Hossein Rashidi, Batool; Aghsaghloo, Fatemeh; Nazari, Razieh

2016-06-01

Chlamydia trachomatis is the most common sexually transmitted bacterial pathogen worldwide. Early detection and treatment of C.trachomatis genital infection prevent serious reproductive complications. Performances of enzyme immunoassay (EIA) and major outer membrane protein (MOMP)-polymerase chain reaction (PCR) for diagnosis of genital C.trachomatis infection in women were compared. In this cross sectional study a total of 518 women volunteers were included (33.67±8.3 yrs) who had been referred to Gynecology clinics of Qom province, Iran, were included. Endocervical swab specimens were collected to detect lipopolysaccharide (LPS) antigen in EIA and to amplify MOMP gene of C.trachomatis in PCR. Results were confirmed using ompI nested-PCR. Sensitivity, specificity, positive (PPV) and negative predictive values (NPV) were calculated for performance of the tests. Odds ratios were determined using binary logistic regression analysis. In total, 37 (7.14%) cases were positive by EIA and/or MOMP-PCR. All discrepant results were confirmed by nested-PCR. Sensitivity, specificity, PPV and NPV values of EIA were 59.46%, 100%, 100% and 96.98%, and those of MOMP-PCR were 97.30%, 100%, 100%, 99.79%, respectively. Reproductive complications including 2.7% ectopic pregnancy, 5.4% stillbirth, 5.4% infertility, and 10.8% PROM were recorded. The risk of developing chlamydiosis was increased 4.8-fold in volunteers with cervicitis (p<0.05; OR 4.80; 95% CI 1.25-18.48). C.trachomatis infection should be regarded in women of reproductive ages especially those with cervicitis. Primary screening of women by using the low cost antigen-EIA is recommended; however, due to the low sensitivity of Ag-EIA, verification of the negative results by a DNA amplification method is needed.

Viral-bacterial associations in acute apical abscesses.

PubMed

Ferreira, Dennis C; Rôças, Isabela N; Paiva, Simone S M; Carmo, Flávia L; Cavalcante, Fernanda S; Rosado, Alexandre S; Santos, Kátia R N; Siqueira, José F

2011-08-01

Viral-bacterial and bacterial synergism have been suggested to contribute to the pathogenesis of several human diseases. This study sought to investigate the possible associations between 9 candidate endodontic bacterial pathogens and 9 human viruses in samples from acute apical abscesses. DNA extracts from purulent exudate aspirates of 33 cases of acute apical abscess were surveyed for the presence of 9 selected bacterial species using a 16S ribosomal RNA gene-based nested polymerase chain reaction (PCR) approach. Single or nested PCR assays were used for detection of the human papillomavirus (HPV) and herpesviruses types 1 to 8. Two-thirds of the abscess samples were positive for at least one of the target viruses. Specifically, the most frequently detected viruses were HHV-8 (54.5%); HPV (9%); and varicella zoster virus (VZV), Epstein-Barr virus (EBV), and HHV-6 (6%). Bacterial DNA was present in all cases and the most prevalent bacterial species were Treponema denticola (70%), Tannerella forsythia (67%), Porphyromonas endodontalis (67%), Dialister invisus (61%), and Dialister pneumosintes (57.5%). HHV-8 was positively associated with 7 of the target bacterial species and HPV with 4, but all these associations were weak. Several bacterial pairs showed a moderate positive association. Viral coinfection was found in 6 abscess cases, but no significant viral association could be determined. Findings demonstrated that bacterial and viral DNA occurred concomitantly in two-thirds of the samples from endodontic abscesses. Although this may suggest a role for viruses in the etiology of apical abscesses, the possibility also exists that the presence of viruses in abscess samples is merely a consequence of the bacterially induced disease process. Further studies are necessary to clarify the role of these viral-bacterial interactions, if any, in the pathogenesis of acute apical abscesses. Copyright © 2011 Mosby, Inc. All rights reserved.

Epidemiology and Clinical Burden of Malaria in the War-Torn Area, Orakzai Agency in Pakistan.

PubMed

Karim, Asad Mustafa; Hussain, Irfan; Malik, Sumera Kausar; Lee, Jung Hun; Cho, Ill Hwan; Kim, Young Bae; Lee, Sang Hee

2016-01-01

Military conflict has been a major challenge in the detection and control of emerging infectious diseases such as malaria. It poses issues associated with enhancing emergence and transmission of infectious diseases by destroying infrastructure and collapsing healthcare systems. The Orakzai agency in Pakistan has witnessed a series of intense violence and destruction. Military conflicts and instability in Afghanistan have resulted in the migration of refugees into the area and possible introduction of many infectious disease epidemics. Due to the ongoing violence and Talibanization, it has been a challenge to conduct an epidemiological study. All patients were sampled within the transmission season. After a detailed clinical investigation of patients, data were recorded. Baseline venous blood samples were taken for microscopy and nested polymerase chain reaction (nPCR) analysis. Plasmodium species were detected using nested PCR (nPCR) and amplification of the small subunit ribosomal ribonucleic acid (ssrRNA) genes using the primer pairs. We report a clinical assessment of the epidemic situation of malaria caused by Plasmodium vivax (86.5%) and Plasmodium falciparum (11.79%) infections with analysis of complications in patients such as decompensated shock (41%), anemia (8.98%), hypoglycaemia (7.3%), multiple convulsions (6.7%), hyperpyrexia (6.17%), jaundice (5%), and hyperparasitaemia (4.49%). This overlooked distribution of P. vivax should be considered by malaria control strategy makers in the world and by the Government of Pakistan. In our study, children were the most susceptible population to malaria infection while they were the least expected to use satisfactory prevention strategies in such a war-torn deprived region. Local health authorities should initiate malaria awareness programs in schools and malaria-related education should be further promoted at the local level reaching out to both children and parents.

Recilia banda Kramer (Hemiptera: Cicadellidae), a vector of Napier stunt phytoplasma in Kenya

NASA Astrophysics Data System (ADS)

Obura, Evans; Midega, Charles A. O.; Masiga, Daniel; Pickett, John A.; Hassan, Mohamed; Koji, Shinsaku; Khan, Zeyaur R.

2009-10-01

Napier grass ( Pennisetum purpureum) is the most important fodder crop in smallholder dairy production systems in East Africa, characterized by small zero-grazing units. It is also an important trap crop used in the management of cereal stemborers in maize in the region. However, production of Napier grass in the region is severely constrained by Napier stunt disease. The etiology of the disease is known to be a phytoplasma, 16SrXI strain. However, the putative insect vector was yet unknown. We sampled and identified five leafhopper and three planthopper species associated with Napier grass and used them as candidates in pathogen transmission experiments. Polymerase chain reaction (PCR), based on the highly conserved 16S gene, primed by P1/P6-R16F2n/R16R2 nested primer sets was used to diagnose phytoplasma on test plants and insects, before and after transmission experiments. Healthy plants were exposed for 60 days to insects that had fed on diseased plants and acquired phytoplasma. The plants were then incubated for another 30 days. Nested PCR analyses showed that 58.3% of plants exposed to Recilia banda Kramer (Hemiptera: Cicadellidae) were positive for phytoplasma and developed characteristic stunt disease symptoms while 60% of R. banda insect samples were similarly phytoplasma positive. We compared the nucleotide sequences of the phytoplasma isolated from R. banda, Napier grass on which these insects were fed, and Napier grass infected by R. banda, and found them to be virtually identical. The results confirm that R. banda transmits Napier stunt phytoplasma in western Kenya, and may be the key vector of Napier stunt disease in this region.

Disease Burden of Dengue in the Philippines: Adjusting for Underreporting by Comparing Active and Passive Dengue Surveillance in Punta Princesa, Cebu City.

PubMed

Undurraga, Eduardo A; Edillo, Frances E; Erasmo, Jonathan Neil V; Alera, Maria Theresa P; Yoon, In-Kyu; Largo, Francisco M; Shepard, Donald S

2017-04-01

AbstractDengue virus (DENV) is a serious threat to public health. Having reliable estimates of the burden of dengue is important to inform policy and research, but surveillance systems are not designed to capture all symptomatic DENV infections. We derived the rate of reporting of dengue by comparing active surveillance of symptomatic DENV infections in a prospective community-based seroepidemiological cohort study ( N = 1008) of acute febrile illness in Punta Princesa, Cebu City, Philippines, with passive surveillance data from the Cebu City Health Department. Febrile episodes detected in a weekly follow-up of participants were tested for serotype-specific DENV by hemi-nested reverse transcription-polymerase chain reaction (nested RT-PCR) and acute/convalescent blood samples tested by dengue IgM/IgG enzyme immunoassay. We estimated the burden of dengue in the Philippines in disability-adjusted life years (DALYs), and conducted a probabilistic sensitivity analysis using Monte-Carlo simulations to address uncertainty. The results showed a 21% cumulative reporting rate of symptomatic DENV infections, equivalent to an expansion factor of 4.7 (95% certainty level [CL]: 2.2-15.1). Based on surveillance data in the Philippines for 2010-2014, we estimated 794,255 annual dengue episodes (95% CL: 463,000-2,076,000) and a disease burden of 535 (95% CL: 380-994) DALYs per million population using age weights and time discounting and 997 (95% CL: 681-1,871) DALYs per million population without age and time adjustments. Dengue imposes a substantial burden in the Philippines; almost 10 times higher than estimated for rabies, about twice the burden of intestinal fluke infections, and about 10% of the burden of tuberculosis. Our estimates should inform policy makers and raise awareness among the public.

The prevalence of Human Papilloma Virus (HPV) infection in the oligospermic and azoospermic men.

PubMed

Nasseri, Sherko; Monavari, Seyed Hamidreza; Keyvani, Hossein; Nikkhoo, Bahram; Vahabpour Roudsari, Rouhollah; Khazeni, Mohammad

2015-01-01

Human papilloma virus (HPV) infection is one of the most common sexually transmitted diseases that affects men like women and infected cutaneous and mucosal squamous epithelium. The aim of the present study was to determine the prevalence of HPV in the semen of oligospermic, azoospermic and normal patients. From June 2012 to June 2013, a total of 90 individuals were enrolled in this cross sectional comparative study. The participants were classified into three groups (oligospermia, azoosprmia and normal). This classification was based on a new WHO reference values for human semen characteristics published on 2010. After extraction of DNA from specimens L1 gene of HPV was amplified by nested polymerase chain reaction (Nested-PCR) and the PCR products of positive specimens were genotyped using INNO-LiPA HPV Genotyping Extra assay. Among 50 confirmed oligospermic male, 15 were HPV DNA positive (30%). In azoospemic group we had 8 HPV DNA positive (40%) and in normal group just 3 of 20(15%) samples were positive. Statistical assessment was done with SPSS v.15. Chi-square test showed no significant relationship between 3 groups results. Based on independent samples t-test, we found statistical significant relationship for sperm count (p<0.05) and sperm motility (slow) (p<0.05) in oligospermic group positive samples compared with negative. In the present study, 13 HPV genotypes were detected among positive samples. HPV genotypes 16, 45 in the high risk group and 6,11,42 in the low risk group were more frequent than the others. The current study shows that HPV infection can affect on sperm count and motility and decrease count of sperm cell and decrease motility capability of these cells.

Molecular Screening and Genotyping of Cryptosporidium Species in Household Dogs and In-Contact Children in Egypt: Risk Factor Analysis and Zoonotic Importance.

PubMed

Gharieb, Rasha M A; Merwad, Abdallah M A; Saleh, Ayman A; El-Ghany, Amany M Abd

2018-06-12

Cryptosporidiosis is a parasitic zoonosis implicated in severe diarrhoea in pets and humans. This study aimed to determine the prevalence and genotypes of Cryptosporidium spp. in household dogs and in-contact children, and the risk factors associated with infection in children in Sharkia Province, Egypt. Fecal samples of 100 children (2-12 years old) and 50 dogs (3 months-1 year old) were randomly collected from both rural (children: n = 85, dogs: n = 40) and urban (children: n = 15, dogs: n = 10) households. Initial parasite detection was done by light microscopy, while, genotyping was based on molecular diagnostic assays. The overall prevalence of Cryptosporidium spp. infection in children was 35% using microscopy and 14% using nested polymerase chain reaction (PCR). In dogs, it was 34% using microscopy and 24% using nested PCR. Cryptosporidium spp. from children were identified as distinct genotypes, with the predominance of human genotype I (Cryptosporidium hominis) over the zoonotic genotype II (Cryptosporidium parvum). Moreover, only zoonotic genotype II (C. parvum) was identified in dog samples. The significant risk factors associated with the prevalence of Cryptosporidium infection in children were the presence of diarrheal episodes during time of survey, improper disposal of garbage, and dog feces and contact with other livestock (p ≤ 0.05). This study concluded that the existence of C. parvum in children and dogs residing the same households confirm the zoonotic transmission and its public health significance. Also, the study recommended the necessity of hygienic disposal of dog feces and preventing direct contact of dogs with other livestock.

Molecular characterization of Toxocara spp. eggs isolated from public parks and playgrounds in Shiraz, Iran.

PubMed

Choobineh, M; Mikaeili, F; Sadjjadi, S M; Ebrahimi, S; Iranmanesh, S

2018-05-07

Human toxocariasis, a worldwide parasitic disease, is caused by the larval stage of intestinal nematodes of dogs and cats, namely Toxocara canis and Toxocara cati. Human infection occurs by the accidental ingestion of embryonated eggs present in the soil, vegetables or on other contaminated surfaces, as well as via consumption of uncooked paratenic hosts, such as bird meat and giblets. The objective of this study was to evaluate the contamination of soil in public parks and playgrounds in Shiraz using microscopy and molecular methods. A total of 150 soil samples were collected from public parks and playgrounds in various areas of Shiraz, southern Iran. The samples were treated with saturated zinc sulphate solution, and Toxocara spp. eggs were detected by microscopic observation followed by nested polymerase chain reaction (PCR). To differentiate T. canis and T. cati eggs from each other, PCR restriction fragment length polymorphism (RFLP) of the internal transcribed spacer (ITS)-rDNA region by SalI endonuclease enzyme was used. PCR-sequencing was performed to confirm the results of the PCR-RFLP method. Based on the flotation results of the 150 soil samples, six (4%) were found to be positive for Toxocara spp. eggs, whereas nested-PCR showed 24 samples to be positive (16%). Based on the PCR-RFLP method and the sequence of the ITS-rDNA region, a total of 23 out of 24 isolates were confirmed as T. cati and one out of 24 as T. canis. The results showed a higher number of soil samples to be positive for Toxocara by the molecular method than microscopy, and higher T. cati infection in soil samples, which could have an important role in human infection with toxocariasis in this region.

Spectrum of lesions derived from branchial arches occurring in the thyroid: from solid cell nests to tumors.

PubMed

Srbecka, Kristyna; Michalova, Kvetoslava; Curcikova, Radmila; Michal, Michael; Dubova, Magdalena; Svajdler, Marian; Michal, Michal; Daum, Ondrej

2017-09-01

There is a group of lesions in the head and neck region derived from branchial arches and related structures which, when inflamed, are characterized by the formation of cysts lined by squamous or glandular epithelium and surrounded by a heavy inflammatory infiltrate rich in germinal centers. In the thyroid, the main source of various structures which may cause diagnostic dilemma is the ultimobranchial body. To investigate the spectrum of such thyroid lesions, the consultation files were reviewed for thyroid samples containing pathological structures regarded to arise from the ultimobranchial body. Positive reaction with antibodies against CK5/6, p63, galectin 3, and CEA, and negative reaction with antibodies against thyroglobulin, TTF-1, and calcitonin were used to confirm the diagnosis. The specific subtype of the ultimobranchial body-derived lesion was then determined based on histological examination of H&E-stained slides. Twenty-one cases of ultimobranchial body-derived lesions were retrieved from the consultation files, 20 of them along with clinical information (M/F = 6/14, mean age 55 years, range 36-68 years). Lesions derived from the ultimobranchial body were classified as follows: (hyperplastic) solid cell nests (nine cases), solid cell nests with focal cystic change (five cases), cystic solid cell nests (two cases), branchial cleft-like cyst (four cases), and finally a peculiar Warthin tumor-like lesion (one case). We suggest that the common denominator of these structures is that they all arise due to activation of inflammatory cells around the vestigial structures, which leads to cystic dilatation and proliferation of the epithelial component.

Accurate, simple, and inexpensive assays to diagnose F8 gene inversion mutations in hemophilia A patients and carriers.

PubMed

Dutta, Debargh; Gunasekera, Devi; Ragni, Margaret V; Pratt, Kathleen P

2016-12-27

The most frequent mutations resulting in hemophilia A are an intron 22 or intron 1 gene inversion, which together cause ∼50% of severe hemophilia A cases. We report a simple and accurate RNA-based assay to detect these mutations in patients and heterozygous carriers. The assays do not require specialized equipment or expensive reagents; therefore, they may provide useful and economic protocols that could be standardized for central laboratory testing. RNA is purified from a blood sample, and reverse transcription nested polymerase chain reaction (RT-NPCR) reactions amplify DNA fragments with the F8 sequence spanning the exon 22 to 23 splice site (intron 22 inversion test) or the exon 1 to 2 splice site (intron 1 inversion test). These sequences will be amplified only from F8 RNA without an intron 22 or intron 1 inversion mutation, respectively. Additional RT-NPCR reactions are then carried out to amplify the inverted sequences extending from F8 exon 19 to the first in-frame stop codon within intron 22 or a chimeric transcript containing F8 exon 1 and the VBP1 gene. These latter 2 products are produced only by individuals with an intron 22 or intron 1 inversion mutation, respectively. The intron 22 inversion mutations may be further classified (eg, as type 1 or type 2, reflecting the specific homologous recombination sites) by the standard DNA-based "inverse-shifting" PCR assay if desired. Efficient Bcl I and T4 DNA ligase enzymes that cleave and ligate DNA in minutes were used, which is a substantial improvement over previous protocols that required overnight incubations. These protocols can accurately detect F8 inversion mutations via same-day testing of patient samples.

Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.

PubMed

Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin

2017-08-01

Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.

Simultaneous Detection of 13 Key Bacterial Respiratory Pathogens by Combination of Multiplex PCR and Capillary Electrophoresis.

PubMed

Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu

2017-08-01

Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

Surfactant-controlled polymerization of semiconductor clusters to quantum dots through competing step-growth and living chain-growth mechanisms.

PubMed

Evans, Christopher M; Love, Alyssa M; Weiss, Emily A

2012-10-17

This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.

Kinetics of Chemical Reactions in Flames

NASA Technical Reports Server (NTRS)

Zeldovich, Y.; Semenov, N.

1946-01-01

In part I of the paper the theory of flame propagation is developed along the lines followed by Frank-Kamenetsky and one of the writers. The development of chain processes in flames is considered. A basis is given for the application of the method of stationary concentrations to reactions in flames; reactions with branching chains are analyzed. The case of a diffusion coefficient different from the coefficient of temperature conductivity is considered.

A model to predict the thermal reaction norm for the embryo growth rate from field data.

PubMed

Girondot, Marc; Kaska, Yakup

2014-10-01

The incubation of eggs is strongly influenced by temperature as observed in all species studied to date. For example, incubation duration, sexual phenotype, growth, and performances in many vertebrate hatchlings are affected by incubation temperature. Yet it is very difficult to predict temperature effect based on the temperature within a field nest, as temperature varies throughout incubation. Previous works used egg incubation at constant temperatures in the laboratory to evaluate the dependency of growtProd. Type: FTPh rate on temperature. However, generating such data is time consuming and not always feasible due to logistical and legislative constraints. This paper therefore presents a methodology to extract the thermal reaction norm for the embryo growth rate directly from a time series of incubation temperatures recorded within natural nests. This methodology was successfully applied to the nests of the marine turtle Caretta caretta incubated on Dalyan Beach in Turkey, although it can also be used for any egg-laying species, with some of its limitations being discussed in the paper. Knowledge about embryo growth patterns is also important when determining the thermosensitive period for species with temperature-dependent sex determination. Indeed, in this case, sexual phenotype is sensitive to temperature only during this window of embryonic development. Copyright © 2014 Elsevier Ltd. All rights reserved.

Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

USDA-ARS?s Scientific Manuscript database

This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

[Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

PubMed

Wang, F; Zhang, Y Q; Ding, J; Yu, L X

2017-10-18

To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

Blood-based cerebral biomarkers in preeclampsia: Plasma concentrations of NfL, tau, S100B and NSE during pregnancy in women who later develop preeclampsia - A nested case control study.

PubMed

Bergman, Lina; Zetterberg, Henrik; Kaihola, Helena; Hagberg, Henrik; Blennow, Kaj; Åkerud, Helena

2018-01-01

To evaluate if concentrations of the neuronal proteins neurofilament light chain and tau are changed in women developing preeclampsia and to evaluate the ability of a combination of neurofilament light chain, tau, S100B and neuron specific enolase in identifying neurologic impairment before diagnosis of preeclampsia. A nested case-control study within a longitudinal study cohort was performed. 469 healthy pregnant women were enrolled between 2004-2007 and plasma samples were collected at gestational weeks 10, 25, 28, 33 and 37. Plasma concentrations of tau and neurofilament light chain were analyzed in 16 women who eventually developed preeclampsia and 36 controls throughout pregnancy with single molecule array (Simoa) method and compared within and between groups. S100B and NSE had been analyzed previously in the same study population. A statistical model with receiving characteristic operation curve was constructed with the four biomarkers combined. Plasma concentrations of neurofilament light chain were significantly increased in women who developed preeclampsia in gestational week 33 (11.85 ng/L, IQR 7.48-39.93 vs 6.80 ng/L, IQR 5.65-11.40) and 37 (22.15 ng/L, IQR 10.93-35.30 vs 8.40 ng/L, IQR 6.40-14.30) and for tau in gestational week 37 (4.33 ng/L, IQR 3.97-12.83 vs 3.77 ng/L, IQR 1.91-5.25) in contrast to healthy controls. A combined model for preeclampsia with tau, neurofilament light chain, S100B and neuron specific enolase in gestational week 25 displayed an area under the curve of 0.77, in week 28 it was 0.75, in week 33 it was 0.89 and in week 37 it was 0.83. Median week for diagnosis of preeclampsia was at 38 weeks of gestation. Concentrations of both tau and neurofilament light chain are increased in the end of pregnancy in women developing preeclampsia in contrast to healthy pregnancies. Cerebral biomarkers might reflect cerebral involvement before onset of disease.

Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

PubMed

Igarashi, T; Yamamoto, A; Goto, N

1996-10-01

Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

PubMed

Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

2017-01-01

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

Structure–Function Studies of Hydrophobic Residues That Clamp a Basic Glutamate Side Chain during Catalysis by Triosephosphate Isomerase

PubMed Central

2016-01-01

Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328

Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates.

PubMed

Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M

2013-03-28

This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

Comparison of nested PCR and qPCR for the detection and quantitation of BoHV6 DNA.

PubMed

Kubiś, Piotr; Materniak, Magdalena; Kuźmak, Jacek

2013-12-01

Nested PCR and qPCR (quantitative PCR) tests based on glycoprotein B (gB) gene were designed for detecting Bovine herpesvirus 6 (BoHV6) in bovine whole blood samples and wild ruminant blood clots (deer and roe-deer). This virus, commonly known as BLHV (bovine lymphotropic herpesvirus) belongs to the Herpesviridae family, subfamily Gammaherpesvirinae and Macavirus genus. DNA isolated from 92 dairy cow blood samples and 69 wild ruminant clots were examined for the presence of BoHV6 using nested PCR and qPCR tests. Viral DNA was detected by using nested PCR in 59 out of 92 bovine blood samples (64.1%), and by qPCR in 68 out of 92 bovine blood samples (73.9%), but none out of 69 DNA samples isolated from wild ruminant blood clots, was positive in both assays. The specificity of nested PCR and qPCR was confirmed by using BoHV1, BoHV4, BoHV6, BFV, BIV, and BLV DNA. The sensitivity of nested PCR and qPCR was determined using a serially 10-fold diluted vector pCR2.1HgB (2 × 10(0)-2 × 10(6)copies/reaction). In this testing, qPCR was more sensitive than the nested PCR, detecting two copies of BoHV6 whilst the limit of detection for nested PCR was 20 copies. In all qPCR assays, the coefficients of determination (R(2)) ranged between 0.990 and 0.999, and the calculated amplification efficiencies (Eff%) within the range of 89.7-106.9. The intra- and inter-assay CV (coefficient of variation) values did not exceed 4%. Copyright © 2013 Elsevier B.V. All rights reserved.

Microfabricated electrochemiluminescence cell for chemical reaction detection

DOEpatents

Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

2003-01-01

A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions

NASA Astrophysics Data System (ADS)

Zlokazov, V. B.; Utyonkov, V. K.

2017-07-01

The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.

A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

NASA Astrophysics Data System (ADS)

Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua

2017-08-01

Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.

Problem-Solving Test: Real-Time Polymerase Chain Reaction

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

EPA Science Inventory

Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

ERIC Educational Resources Information Center

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

EPA Science Inventory

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

USDA-ARS?s Scientific Manuscript database

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

PubMed

Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

2005-03-01

We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

EPA Science Inventory

A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

EPA Science Inventory

Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

Integration within the Felsenstein equation for improved Markov chain Monte Carlo methods in population genetics

PubMed Central

Hey, Jody; Nielsen, Rasmus

2007-01-01

In 1988, Felsenstein described a framework for assessing the likelihood of a genetic data set in which all of the possible genealogical histories of the data are considered, each in proportion to their probability. Although not analytically solvable, several approaches, including Markov chain Monte Carlo methods, have been developed to find approximate solutions. Here, we describe an approach in which Markov chain Monte Carlo simulations are used to integrate over the space of genealogies, whereas other parameters are integrated out analytically. The result is an approximation to the full joint posterior density of the model parameters. For many purposes, this function can be treated as a likelihood, thereby permitting likelihood-based analyses, including likelihood ratio tests of nested models. Several examples, including an application to the divergence of chimpanzee subspecies, are provided. PMID:17301231

THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST

PubMed Central

Keil, Harry; Wasserman, David; Dawson, Charles R.

1944-01-01

1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415

THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST.

PubMed

Keil, H; Wasserman, D; Dawson, C R

1944-10-01

1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.

Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

PubMed Central

deWit, D; Wootton, M; Allan, B; Steyn, L

1993-01-01

A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

[A study on identification of edible bird's nests by DNA barcodes].

PubMed

Chen, Yue-Juan; Liu, Wen-Jian; Chen, Dan-Na; Chieng, Sing-Hock; Jiang, Lin

2017-12-01

To provide theoretical basis for the traceability and quality evaluation of edible bird's nests (EBNs), the Cytb sequence was applied to identify the origin of EBNs. A total of 39 experiment samples were collected from Malaysia, Indonesia, Vietnam and Thailand. Genomic DNA was extracted for the PCR reaction. The amplified products were sequenced. 36 sequences were downloaded from Gen Bank including edible nest swiftlet, black nest swiftlet, mascarene swiftlet, pacific swiftlet and germain's swiftlet. MEGA 7.0 was used to analyze the distinction of sequences by the method of calculating the distances in intraspecific and interspecific divergences and constructing NJ and UPMGA phylogenetic tree based on Kimera-2-parameter model. The results showed that 39 samples were from three kinds of EBNs. Interspecific divergences were significantly greater than the intraspecific one. Samples could be successfully distinguished by NJ and UPMGA phylogenetic tree. In conclusion, Cytb sequence could be used to distinguish the origin of EBNs and it is efficient for tracing the origin species of EBNs. Copyright© by the Chinese Pharmaceutical Association.

Facile synthesis of bird's nest-like TiO2 microstructure with exposed (001) facets for photocatalytic degradation of methylene blue

NASA Astrophysics Data System (ADS)

Zhang, Guozhong; Zhang, Shuqu; Wang, Longlu; Liu, Ran; Zeng, Yunxiong; Xia, Xinnian; Liu, Yutang; Luo, Shenglian

2017-01-01

The scrupulous design of hierarchical structure and highly active crystal facets exposure is essential for the creation of photocatalytic system. However, it is still a big challenge for scrupulous design of TiO2 architectures. In this paper, bird's nest-like anatase TiO2 microstructure with exposed highly active (001) surface has been successfully synthesized by a facile one-step solvothermal method. Methylene blue (MB) is chosen as a model pollutant to evaluate photocatalytic activity of as-obtained TiO2 samples. The results show that the photocatalytic activity of the bird's nest-like sample is more excellent than P25 in the degradation of MB due to high specific surface area and highly active (001) crystal facets exposure when tested under simulated solar light. Besides, it can be readily separated from the photocatalytic system by sedimentation after photocatalytic reaction, which is a significant advantage against conventional powder photocatalyst. The bird's nest-like microspheres with novel structure may have potential application in photocatalysis and other fields.

Microfabricated sleeve devices for chemical reactions

DOEpatents

Northrup, M. Allen

2003-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Novel approach based on one-tube nested PCR and a lateral flow strip for highly sensitive diagnosis of tuberculous meningitis.

PubMed

Sun, Yajuan; Chen, Jiajun; Li, Jia; Xu, Yawei; Jin, Hui; Xu, Na; Yin, Rui; Hu, Guohua

2017-01-01

Rapid and sensitive detection of Mycobacterium tuberculosis (M. Tb) in cerebrospinal fluid is crucial in the diagnosis of tuberculous meningitis (TBM), but conventional diagnostic technologies have limited sensitivity and specificity or are time-consuming. In this work, a novel, highly sensitive molecular diagnostic method, one-tube nested PCR-lateral flow strip test (OTNPCR-LFST), was developed for detecting M. tuberculosis. This one-tube nested PCR maintains the sensitivity of conventional two-step nested PCR and reduces both the chance of cross-contamination and the time required for analysis. The PCR product was detected by a lateral flow strip assay, which provided a basis for migration of the test to a point-of-care (POC) microfluidic format. The developed assay had an improved sensitivity compared with traditional PCR, and the limit of detection was up to 1 fg DNA isolated from M. tuberculosis. The assay was also specific for M. tuberculosis, and no cross-reactions were found in other non-target bacteria. The application of this technique to clinical samples was successfully evaluated, and OTNPCR-LFST showed 89% overall sensitivity and 100% specificity for TBM patients. This one-tube nested PCR-lateral flow strip assay is useful for detecting M. tuberculosis in TBM due to its rapidity, high sensitivity and simple manipulation.

Improved assay to detect Plasmodium falciparum using an uninterrupted, semi-nested PCR and quantitative lateral flow analysis

PubMed Central

2013-01-01

Background A rapid, non-invasive, and inexpensive point-of-care (POC) diagnostic for malaria followed by therapeutic intervention would improve the ability to control infection in endemic areas. Methods A semi-nested PCR amplification protocol is described for quantitative detection of Plasmodium falciparum and is compared to a traditional nested PCR. The approach uses primers that target the P. falciparum dihydrofolate reductase gene. Results This study demonstrates that it is possible to perform an uninterrupted, asymmetric, semi-nested PCR assay with reduced assay time to detect P. falciparum without compromising the sensitivity and specificity of the assay using saliva as a testing matrix. Conclusions The development of this PCR allows nucleic acid amplification without the need to transfer amplicon from the first PCR step to a second reaction tube with nested primers, thus reducing both the chance of contamination and the time for analysis to < two hours. Analysis of the PCR amplicon yield was adapted to lateral flow detection using the quantitative up-converting phosphor (UCP) reporter technology. This approach provides a basis for migration of the assay to a POC microfluidic format. In addition the assay was successfully evaluated with oral samples. Oral fluid collection provides a simple non-invasive method to collect clinical samples. PMID:23433252

Comparison of sampling techniques for Bayesian parameter estimation

NASA Astrophysics Data System (ADS)

Allison, Rupert; Dunkley, Joanna

2014-02-01

The posterior probability distribution for a set of model parameters encodes all that the data have to tell us in the context of a given model; it is the fundamental quantity for Bayesian parameter estimation. In order to infer the posterior probability distribution we have to decide how to explore parameter space. Here we compare three prescriptions for how parameter space is navigated, discussing their relative merits. We consider Metropolis-Hasting sampling, nested sampling and affine-invariant ensemble Markov chain Monte Carlo (MCMC) sampling. We focus on their performance on toy-model Gaussian likelihoods and on a real-world cosmological data set. We outline the sampling algorithms themselves and elaborate on performance diagnostics such as convergence time, scope for parallelization, dimensional scaling, requisite tunings and suitability for non-Gaussian distributions. We find that nested sampling delivers high-fidelity estimates for posterior statistics at low computational cost, and should be adopted in favour of Metropolis-Hastings in many cases. Affine-invariant MCMC is competitive when computing clusters can be utilized for massive parallelization. Affine-invariant MCMC and existing extensions to nested sampling naturally probe multimodal and curving distributions.

Enzymatic preparation of structured oils containing short-chain fatty acids.

PubMed

Kanda, Ayato; Namiki, Fusako; Hara, Setsuko

2010-01-01

Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.

An ab initio molecular dynamics and density functional theory study of the formation of phosphate chains from metathiophosphates.

PubMed

Mosey, Nicholas J; Woo, Tom K

2006-09-04

The reactions that occur between metathiophosphate (MTP) molecules are identified and examined through ab initio molecular dynamics simulations and static quantum chemical calculations at the density functional level of theory. The simulations show that certain types of MTPs can react to yield phosphate chains, while others only dimerize. These differences are rationalized in terms of reaction energies and the electronic structures of these molecules. In the reaction leading to the formation of phosphate chains, the reactive center, a tri-coordinate phosphorus atom, is continually regenerated. A polymerization mechanism linking MTPs to phosphate chains is developed on the basis of these results. This information sheds light on the underlying processes that may be responsible for the formation of phosphates under high-temperature conditions and may prove useful in the development of protocols for the rational synthesis of complex phosphate structures.

DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

EPA Science Inventory

The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

29 CFR 1910.155 - Scope, application and definitions applicable to this subpart.

Code of Federal Regulations, 2010 CFR

2010-07-01

... by inhibiting the chemical chain reaction of fuel and oxygen. It is also known as...F3) which is a medium for extinguishing fires by inhibiting the chemical chain reaction of fuel and..., odorless, electrically nonconductive inert gas (chemical formula CO2) that is a medium for extinguishing...

Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

ERIC Educational Resources Information Center

Phelps, Tara L.; And Others

1996-01-01

Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

Determining Annealing Temperatures for Polymerase Chain Reaction

ERIC Educational Resources Information Center

Porta, Angela R.; Enners, Edward

2012-01-01

The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

USDA-ARS?s Scientific Manuscript database

A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.

PubMed

Borkar, Santosh Ramdas; Aidhen, Indrapal Singh

2017-04-18

Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.

The Bethe ansatz

NASA Astrophysics Data System (ADS)

Levkovich-Maslyuk, Fedor

2016-08-01

We give a pedagogical introduction to the Bethe ansatz techniques in integrable QFTs and spin chains. We first discuss and motivate the general framework of asymptotic Bethe ansatz for the spectrum of integrable QFTs in large volume, based on the exact S-matrix. Then we illustrate this method in several concrete theories. The first case we study is the SU(2) chiral Gross-Neveu model. We derive the Bethe equations via algebraic Bethe ansatz, solving in the process the Heisenberg XXX spin chain. We discuss this famous spin chain model in some detail, covering in particular the coordinate Bethe ansatz, some properties of Bethe states, and the classical scaling limit leading to finite-gap equations. Then we proceed to the more involved SU(3) chiral Gross-Neveu model and derive the Bethe equations using nested algebraic Bethe ansatz to solve the arising SU(3) spin chain. Finally we show how a method similar to the Bethe ansatz works in a completely different setting, namely for the 1D oscillator in quantum mechanics.

Multi-scale modeling of diffusion-controlled reactions in polymers: renormalisation of reactivity parameters.

PubMed

Everaers, Ralf; Rosa, Angelo

2012-01-07

The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.

Temperature control apparatus

DOEpatents

Northrup, M. Allen

2003-08-05

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Uptake of planar polychlorinated biphenyls and 2,3,7,8-substituted polychlorinated dibenzofurans and dibenzo-p-dioxins by birds nesting in the lower Fox River and Green Bay, Wisconsin, USA

USGS Publications Warehouse

Ankley, Gerald T.; Niemi, Gerald J.; Lodge, Keith B.; Harris, Hallett J.; Beaver, Donald L.; Tillitt, Donald E.; Schwartz, Ted R.; Giesy, John P.; Jones, Paul D.; Hagley, Cynthia

1993-01-01

The uptake of persistent polychlorinated hydrocarbons (PCHs) by four avian species was investigated at upper trophic levels of two aquatic food chains of the lower Fox River and Green Bay, Wisconsin. Accumulation of total and specific planar polychlorinated biphenyls (PCBs), polychlorinated dibenzofurans (PCDFs), polychlorinated dibenzo-p-dioxin (PCDDs), and H411E rat hepatoma cell bioassay-derived 2,37,8-tetrachlorodibenzop-dioxin equivalents (TCDD-EQ) was evaluated in Forster's tern (Sterna forsteri) and common tern (Sterna hirundo) chicks, and in tree swallow (Tachycineta bicolor) and red-winged blackbird (Agelaius phoeniceus) nestlings from colonies nesting in several locations within the watershed. Concentrations of the PCHs were greatest in eggs and chicks of the two tern species, less in the tree swallows and least in the red-winged blackbirds. Young of all four species accumulated total PCBs, PCB congeners 77, 105, 126, and 169, and TCDD-EQ. The young birds also accumulated small concentrations of several 2,3,7,8-sbustituted PCDF and PCDD congeners. Uptake rates for certain of the PCHs for the Forster's tern chicks were: 15 μg/day for total PCBs, 70, 200, 6.5, and 0.14 ng/day for PCB congeners 77, 105, 126, and 169, respectively, and 270 μg/day for TCDD-EQ. Principal components analysis revealed that the patterns of PCH concentrations in the samples were influenced by species of bird, their age (or length of exposure) and nesting location. Collectively, our findings demonstrate that exposure of avian species to contaminants derived from aquatic food chains can be characterized and quantified for the purposes of ecological risk assessment.

Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

PubMed

Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

2013-09-15

We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

PubMed Central

Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

2015-01-01

Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

Detection and genetic analysis of aquabirnaviruses in subclinically infected aquarium fish.

PubMed

Shin, Sang Phil; Gomez, Dennis Kaw; Kim, Ji Hyung; Choresca, Casiano Hermorpia; Han, Jee Eun; Jun, Jin Woo; Park, Se Chang

2011-03-01

Aquabirnaviruses (ABVs) cause serious diseases in a variety of fish species used worldwide in aquaculture and have been isolated from a variety of healthy fish and shellfish species. The type species of ABV is Infectious pancreatic necrosis virus (IPNV), which is the causative agent of a highly contagious disease in juvenile salmonid fish. Marine birnaviruses (MABVs) have been isolated from various marine fish and shellfish. In Korea, ABV infection has been identified in several fish and shellfish. The current study presents sequence data from nested polymerase chain reaction products of 3 ABV strains obtained from different species of asymptomatic aquarium fish collected from a private commercial aquarium in Korea. Phylogenetic analysis of these strains, based on the partial nucleotide sequence of the VP2/NS junction, placed them within the genogroup VII (95-99% bootstrap confidence), which also contains MABV. The subclinically infected fish may be a source of MABV infection for other susceptible fish species inside the aquarium and potentially represent a serious challenge for the management of MABV infections. Additionally, the presence of MABV in these subclinically infected aquarium fish imported from other countries indicates that there is a need for the establishment of appropriate quarantine practices.

In situ PCR detection of phytoplasma DNA in embryos from coconut palms with lethal yellowing disease.

PubMed

Cordova, Ivan; Jones, Phil; Harrison, Nigel A; Oropeza, Carlos

2003-03-01

SUMMARY DNA of the lethal yellowing (LY) phytoplasma was detected in 13 of 72 embryos from fruits of four diseased Atlantic tall coconut palms by polymerase chain reaction (PCR) assays employing phytoplasma universal rRNA primer pair P1/P7, nested LY group-specific rRNA primer pair 503f/LY16Sr or LY phytoplasma-specific nonribosomal primer pair LYF1/R1. Phytoplasma distribution in sectioned tissues from six PCR positive embryos was determined by in situ PCR and digoxigenin-11-deoxy-UTP (Dig) labelling of amplification products. Dig-labeled DNA products detected by colourimetric assay were clearly evident on sections from the same three embryos investigated in detail by in situ PCRs employing primer pairs P1/P7 or LYF1/R1. Deposition of blue-green stain on sections as a result of each assay was restricted to areas of the embryos corresponding to the plumule and cells ensheathing it. By comparison, similarly treated embryo sections derived from fruits of a symptomless Atlantic tall coconut palm were consistently devoid of any stain. Presence of phytoplasma DNA in embryo tissues suggests the possible potential for seed transmission which remains to be demonstrated.

Mediterranean diet and telomere length in Nurses' Health Study: population based cohort study.

PubMed

Crous-Bou, Marta; Fung, Teresa T; Prescott, Jennifer; Julin, Bettina; Du, Mengmeng; Sun, Qi; Rexrode, Kathryn M; Hu, Frank B; De Vivo, Immaculata

2014-12-02

To examine whether adherence to the Mediterranean diet was associated with longer telomere length, a biomarker of aging. Population based cohort study. Nurses' Health Study, an ongoing prospective cohort study of 121,700 nurses enrolled in 1976; in 1989-90 a subset of 32,825 women provided blood samples. 4676 disease-free women from nested case-control studies within the Nurses' Health Study with telomere length measured who also completed food frequency questionnaires. Association between relative telomere lengths in peripheral blood leukocytes measured by quantitative real time polymerase chain reaction and Alternate Mediterranean Diet score calculated from self reported dietary data. Greater adherence to the Mediterranean diet was associated with longer telomeres after adjustment for potential confounders. Least squares mean telomere length z scores were -0.038 (SE 0.035) for the lowest Mediterranean diet score groups and 0.072 (0.030) for the highest group (P for trend = 0.004). In this large study, greater adherence to the Mediterranean diet was associated with longer telomeres. These results further support the benefits of adherence to the Mediterranean diet for promoting health and longevity. © Crous-Bou et al 2014.

Comparative sequence analyses of sixteen reptilian paramyxoviruses

USGS Publications Warehouse

Ahne, W.; Batts, W.N.; Kurath, G.; Winton, J.R.

1999-01-01

Viral genomic RNA of Fer-de-Lance virus (FDLV), a paramyxovirus highly pathogenic for reptiles, was reverse transcribed and cloned. Plasmids with significant sequence similarities to the hemagglutinin-neuraminidase (HN) and polymerase (L) genes of mammalian paramyxoviruses were identified by BLAST search. Partial sequences of the FDLV genes were used to design primers for amplification by nested polymerase chain reaction (PCR) and sequencing of 518-bp L gene and 352-bp HN gene fragments from a collection of 15 previously uncharacterized reptilian paramyxoviruses. Phylogenetic analyses of the partial L and HN sequences produced similar trees in which there were two distinct subgroups of isolates that were supported with maximum bootstrap values, and several intermediate isolates. Within each subgroup the nucleotide divergence values were less than 2.5%, while the divergence between the two subgroups was 20-22%. This indicated that the two subgroups represent distinct virus species containing multiple virus strains. The five intermediate isolates had nucleotide divergence values of 11-20% and may represent additional distinct species. In addition to establishing diversity among reptilian paramyxoviruses, the phylogenetic groupings showed some correlation with geographic location, and clearly demonstrated a low level of host species-specificity within these viruses. Copyright (C) 1999 Elsevier Science B.V.

Prevalence of human papillomavirus and Epstein-Barr virus in salivary gland diseases.

PubMed

Lin, Frank Cheau-Feng; Chen, Pei-Liang; Tsao, Tang-Yi; Li, Chia-Ru; Jeng, Kee-Ching; Tsai, Stella Chin-Shaw

2014-10-01

The roles of human papillomavirus (HPV) and Epstein-Barr virus (EBV) in head and neck neoplasms have been well reported, but little is known about their relationship with salivary gland tumours. This study investigated the presence of HPV and EBV in salivary gland diseases. The presence of HPV 16/18 and EBV was analysed in archival pathological specimens collected from patients who had undergone surgery for salivary gland diseases. HPV 16/18 DNA was detected using nested polymerase chain reaction (PCR) and further confirmed with immunohistochemistry. EBV DNA was detected using real-time PCR. A total of 61 pathological specimens were examined: 39.5% (15/38) of pleomorphic adenomas, 33.3% (3/9) of Warthin's tumours, 33.3% (one of 3) of mucoepidermoid carcinomas, and 25.0% (one of 4) of benign lymphoepithelial lesions were positive for high-risk HPV 16/18. Only two Warthin's tumours were positive for EBV. The infectious nature of salivary gland neoplasms was revealed by the high prevalence of HPV infection, and the specific presence of EBV in Warthin's tumours, suggesting a potential role for HPV and EBV in salivary gland diseases. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

Detection of Puumala virus in the tissue of infected naturally rodent hosts in the area of central Dinarides.

PubMed

Dervović, Edina; Hukić, Mirsada

2016-04-01

Hantaviruses are the causative agents of haemorrhagic fever with renal syndrome (HFRS) in Euroasia and of hantavirus cardiopulmonary syndrome (HCPS) in the North, Central and South America. HFRS is endemic in the Balkan Peninsula, where sporadic cases or outbreaks have been reported. Puumala virus (PUUV) is the causative agent of nephropathia epidemica (NE), a mild form of HFRS. PUUV is carried by the bank voles (Myodes glareolus). In this study, we investigated viral RNA from 76 tissues samples (lung n=30, heart n=6, liver n=18 and kidney n=22) of infected naturally rodent hosts in the area of Central Dinarides caught in live traps. Puumala virus was extracted from 34,7% (16/46) rodents by nested reverse transcriptase polymerase chain reaction (RT-PCR) and real-time RT-PCR. Overall, 18 (21,4%) specimens of internal organs (kidney n=8, liver n=6, heart n=2 and lung n=2) were positive for PUUV. It was shown a high rodent infestation rate in a relatively low number of rodent and their organs, although mice were not caught during the time of high density population of host rodents. Copyright © 2016 Elsevier B.V. All rights reserved.

Detection of Mycobacterium leprae DNA in nine-banded armadillos (Dasypus novemcinctus) from the Andean region of Colombia.

PubMed

Cardona-Castro, N; Beltrán, J C; Ortiz-Bernal, A; Vissa, V

2009-12-01

To use DNA detection methodologies to test for M. leprae in nine-banded armadillos inhabiting forested regions located around the cities and towns where leprosy patients have been identified. Ear lobe biopsies of 22 nine-banded armadillos were studied during a 2 year period. The biopsies were processed for DNA extraction and amplification by nested polymerase chain reaction (N-PCR) of a fragment of the high copy DNA locus of M. leprae known as R-LEP. Nine of the 22 (40.9%) armadillos evaluated showed positive signals for M. leprae. Sequencing confirmed that PCR products were identical to the corresponding region of M. leprae DNA. In Colombia, South America, the consumption of and contact with the nine-banded armadillo (Dasypus novemcinctus) are common, ignoring the fact that this animal can host and be a possible zoonotic reservoir of Mycobacterium leprae, the causal agent of leprosy. This is the first study demonstrating that M. leprae is present in nine-banded armadillos in a region of Colombia using specific DNA detection. The possibility of leprosy transmission due to contact and consumption of armadillo meat or use of blood for therapeutic purposes should be further investigated.

Detection of Mogibacterium timidum in subgingival biofilm of aggressive and non-diabetic and diabetic chronic periodontitis patients

PubMed Central

Casarin, Renato Corrêa Viana; Saito, Daniel; Santos, Vanessa Renata; Pimentel, Suzana Peres; Duarte, Poliana Mendes; Casati, Márcio Zaffalon; Gonçalves, Reginaldo Bruno

2012-01-01

The aim of the present study was to evaluate the frequency of detection of Mogibacterium timidum in subgingival samples of subjects with generalized aggressive periodontitis (GAgP) and uncontrolled diabetic and non-diabetic subjects with generalized chronic periodontitis (GChP). 48 patients with GAgP, 50 non-diabetic and 39 uncontrolled (glycated hemoglobin >7%) type 2 diabetic subjects with GChP were enrolled in this study. Subgingival biofilm were collected from deep pockets (probing depth > 7 mm). After DNA extraction, M. timidum was detected by Nested Polymerase Chain Reaction and chi-square test was used to data analysis (p>0.05). There were no differences in the frequency of detection of M. timidum between subjects with GAgP (35%) and non-diabetic subjects with GChP (40%) (p>0.05). The frequency of detection of M. timidum was significantly higher in deep pockets of diabetic subjects with GChP (56%) when compared to GAgP (p<0.05), but similar to non-diabetic subjects with GChP (p>0.05). The frequency of detection of M. timidum was higher in subjects GChP presenting uncontrolled type 2 diabetes mellitus, when compared to GAgP subjects. PMID:24031909

Detection of Mogibacterium timidum in subgingival biofilm of aggressive and non-diabetic and diabetic chronic periodontitis patients.

PubMed

Casarin, Renato Corrêa Viana; Saito, Daniel; Santos, Vanessa Renata; Pimentel, Suzana Peres; Duarte, Poliana Mendes; Casati, Márcio Zaffalon; Gonçalves, Reginaldo Bruno

2012-07-01

The aim of the present study was to evaluate the frequency of detection of Mogibacterium timidum in subgingival samples of subjects with generalized aggressive periodontitis (GAgP) and uncontrolled diabetic and non-diabetic subjects with generalized chronic periodontitis (GChP). 48 patients with GAgP, 50 non-diabetic and 39 uncontrolled (glycated hemoglobin >7%) type 2 diabetic subjects with GChP were enrolled in this study. Subgingival biofilm were collected from deep pockets (probing depth > 7 mm). After DNA extraction, M. timidum was detected by Nested Polymerase Chain Reaction and chi-square test was used to data analysis (p>0.05). There were no differences in the frequency of detection of M. timidum between subjects with GAgP (35%) and non-diabetic subjects with GChP (40%) (p>0.05). The frequency of detection of M. timidum was significantly higher in deep pockets of diabetic subjects with GChP (56%) when compared to GAgP (p<0.05), but similar to non-diabetic subjects with GChP (p>0.05). The frequency of detection of M. timidum was higher in subjects GChP presenting uncontrolled type 2 diabetes mellitus, when compared to GAgP subjects.

Investigation into the possibility of vertical transmission of avian bornavirus in free-ranging Canada geese (Branta canadensis).

PubMed

Delnatte, Pauline; Nagy, Eva; Ojkic, Davor; Crawshaw, Graham; Smith, Dale A

2014-01-01

To investigate the possibility of in ovo infection with avian bornavirus (ABV) in wild Canada geese (Branta canadensis), 53 eggs were opportunistically collected at various stages of embryonic development from 16 free-ranging goose nests at a large urban zoo site where ABV infection is known to be present in this species. ABV RNA was detected in the yolk of one of three unembryonated eggs using real-time reverse transcription polymerase chain reaction. ABV RNA was not identified in the brains from 23 newly hatched goslings or 19 embryos, nor from three early whole embryos. Antibodies against ABV were not detected in the plasma of any of the hatched goslings using an enzyme-linked immunosorbent assay. Possible reasons for the failure to detect ABV RNA in hatchlings or embryos include low sample size, eggs deriving from parents not actively infected with ABV, the testing of only brain tissue, and failure of the virus to replicate in Canada goose embryos. In conclusion, this preliminary investigation demonstrating the presence of ABV RNA in the yolk of a Canada goose egg provides the first evidence for the potential for vertical transmission of ABV in waterfowl.

Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

PubMed

Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

2001-10-31

Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

Dengue virus 4 (DENV-4) re-emerges after 30 years in Brazil: cocirculation of DENV-2, DENV-3, and DENV-4 in Bahia.

PubMed

Campos, Gubio Soares; Pinho, Aryane Cruz Oliveira; Brandão, Claudio Jose de Freitas; Bandeira, Antonio Carlos; Sardi, Silvia Ines

2015-01-01

Dengue fever (DF) is a mosquito-borne viral disease of great concern in tropical and subtropical regions of the world. One important cause of the increase in DF is rapid development and urbanization has led to proliferation of the Aedes aegypti mosquito, the vector responsible for transmission of the illness. Surveillance of dengue virus (DENV) infection in Brazil shows the predominance of DENV-1, DENV-2, and DENV-3 until 2010. This study reports the reappearance of DENV-4 in Brazil for the first time in 30 years. Serum samples were collected from individuals (n = 214) exhibiting fever and muscular pain in Bahia, Brazil, during 2011-2012. These samples were subjected to reverse transcription-polymerase chain reaction (RT-PCR)/nested PCR, which revealed that 82% of samples were positive for DENV-4; most were older age groups and exhibited a serological pattern consistent with a primary infection. The cocirculation of multiple DENV serotypes within the same city places the population at risk for a fatal form of the disease. Therefore, with the increasing incidence of severe DF cases, early diagnosis will be a priority for public health efforts in Brazil.

Human papilloma virus 18 detection in oral squamous cell carcinoma and potentially malignant lesions using saliva samples.

PubMed

Goot-Heah, Khor; Kwai-Lin, Thong; Froemming, Gabriele Ruth Anisah; Abraham, Mannil Thomas; Nik Mohd Rosdy, Nik Mohd Mazuan; Zain, Rosnah Binti

2012-01-01

Oral cancer has become one of the most prevalent cancers worldwide and human Papillomavirus is one of the risk factors for developing oral cancer. For this study HPV18 was chosen as it is one of the high risk HPV types and may lead to carcinogenesis. However, prevalence of HPV18 infection in Oral Squamous Cell Carcinoma in Malaysia remains unclear. This study aimed to investigate the viral load of HPV18 DNA in OSCC and potentially malignant lesions using saliva samples. Genomic DNAs of thirty saliva samples of normal subjects and thirty saliva samples compromised of 16 samples from potentially malignant lesions and 14 of OSCC patients were amplified for HPV18 DNA using a nested polymerase chain reaction analysis. All PCR products were then analyzed using the Bioanalyzer to confirm presence of HPV18 DNA. From thirty patients examined, only one of 30 (3.3%) cases was found to be positive for HPV18 in this study. The finding of this study revealed that there is a low viral detection of HPV18 in Malaysian OSCC by using saliva samples, suggesting that prevalence of HPV18 may not be important in this group of Malaysian OSCC.

The advantages of haplotype analysis of the promoter region of the human apolipoprotein E gene.

PubMed

McLaughlin, D P; Sharma, A; McGinley, A; Samra, G S

2001-12-15

Polymorphisms in the regulatory region of the human apolipoprotein E gene (gene, APOE; protein, apoE) have been implicated in Alzheimer's disease. Here we describe in detail the advantages of a simple method for haplotype analysis of this region (at -491 and -427 bases relative to the transcription start site of the gene). The promoter region of the APOE gene was amplified by polymerase chain reaction (PCR) and this fragment was then used as a template for PCR with "nested" primers to generate a 228-bp product incorporating both the -491 and the -427 loci. PCR products were then digested with DraI and AluI together and subjected to polyacrylamide gel electrophoresis. The distinct pattern of bands appearing on the gel was then used to ascribe [-491,-427] haplotypes to each subject, from which -491 and -427 genotypes were inferred. -491 and -427 genotypes were also confirmed by digestion with DraI alone or AluI alone. Haplotype analysis was successful in all 20 samples analyzed and was 100% consistent with genotyping. We suggest that this is a reliable, time-saving method that the will be useful in large-scale APOE promoter genotyping studies. (c)2001 Elsevier Science.

Additional burden of asymptomatic and sub-patent malaria infections during low transmission season in forested tribal villages in Chhattisgarh, India.

PubMed

Chourasia, Mehul Kumar; Raghavendra, Kamaraju; Bhatt, Rajendra M; Swain, Dipak Kumar; Meshram, Hemraj M; Meshram, Jayant K; Suman, Shrity; Dubey, Vinita; Singh, Gyanendra; Prasad, Kona Madhavinadha; Kleinschmidt, Immo

2017-08-08

The burden of sub-patent malaria is difficult to recognize in low endemic areas due to limitation of diagnostic tools, and techniques. Polymerase chain reaction (PCR), a molecular based technique, is one of the key methods for detection of low parasite density infections. The study objective was to assess the additional burden of asymptomatic and sub-patent malaria infection among tribal populations inhabiting three endemic villages in Keshkal sub-district, Chhattisgarh, India. A cross-sectional survey was conducted in March-June 2016, during the low transmission season, to measure and compare prevalence of malaria infection using three diagnostics: rapid diagnostic test, microscopy and nested-PCR. Out of 437 individuals enrolled in the study, 103 (23.6%) were malaria positive by PCR and/or microscopy of whom 89.3% were Plasmodium falciparum cases, 77.7% were afebrile and 35.9% had sub-patent infections. A substantial number of asymptomatic and sub-patent malaria infections were identified in the survey. Hence, strategies for identifying and reducing the hidden burden of asymptomatic and sub-patent infections should focus on forest rural tribal areas using more sensitive molecular diagnostic methods to curtail malaria transmission.

Performance of a histidine-rich protein 2 rapid diagnostic test, Paracheck Pf®, for detection of malaria infections in Ugandan pregnant women.

PubMed

Dhorda, Mehul; Piola, Patrice; Nyehangane, Dan; Tumwebaze, Benon; Nalusaji, Aisha; Nabasumba, Carolyn; Turyakira, Eleanor; McGready, Rose; Ashley, Elizabeth; Guerin, Philippe J; Snounou, Georges

2012-01-01

Improved laboratory diagnosis is critical to reduce the burden of malaria in pregnancy. Peripheral blood smears appear less sensitive than Plasmodium falciparum histidine-rich protein 2-based rapid diagnostic tests (RDTs) for placental malaria infections in studies conducted at delivery. In this study, 81 women in Uganda in the second or third trimester of pregnancy were followed-up until delivery. At each visit, peripheral blood was tested by blood smear, RDT, and nested species-specific polymerase chain reaction (PCR). Sensitivity and specificity of the tests was calculated with PCR, which detected 22 infections of P. falciparum, as the gold standard. The sensitivity and specificity of blood smears were 36.4% (95% confidence interval [CI] = 18.0-59.2%) and 99.6% (95% CI = 97.7-100%), respectively. The corresponding values for RDT were 31.8% (95% CI = 14.7-54.9%) and 100% (95% CI = 98.3-100%). The RDTs could replace blood smears for diagnosis of malaria in pregnancy by virtue of their relative ease of use. Field-based sensitive tests for malaria in pregnancy are urgently needed.

Survey for the presence of Naegleria fowleri amebae in lake water used to cool reactors at a nuclear power generating plant.

PubMed

Jamerson, Melissa; Remmers, Kenneth; Cabral, Guy; Marciano-Cabral, Francine

2009-04-01

Water from Lake Anna in Virginia, a lake that is used to cool reactors at a nuclear power plant and for recreational activities, was assessed for the presence of Naegleria fowleri, an ameba that causes primary amebic meningoencephalitis (PAM). This survey was undertaken because it has been reported that thermally enriched water fosters the propagation of N. fowleri and, hence, increases the risk of infection to humans. Of 16 sites sampled during the summer of 2007, nine were found to be positive for N. fowleri by a nested polymerase chain reaction assay. However, total ameba counts, inclusive of N. fowleri, never exceeded 12/50 mL of lake water at any site. No correlation was obtained between the conductivity, dissolved oxygen, temperature, and pH of water and presence of N. fowleri. To date, cases of PAM have not been reported from this thermally enriched lake. It is postulated that predation by other protozoa and invertebrates, disturbance of the water surface from recreational boating activities, or the presence of bacterial or fungal toxins, maintain the number N. fowleri at a low level in Lake Anna.

An improved reaction path optimization method using a chain of conformations

NASA Astrophysics Data System (ADS)

Asada, Toshio; Sawada, Nozomi; Nishikawa, Takuya; Koseki, Shiro

2018-05-01

The efficient fast path optimization (FPO) method is proposed to optimize the reaction paths on energy surfaces by using chains of conformations. No artificial spring force is used in the FPO method to ensure the equal spacing of adjacent conformations. The FPO method is applied to optimize the reaction path on two model potential surfaces. The use of this method enabled the optimization of the reaction paths with a drastically reduced number of optimization cycles for both potentials. It was also successfully utilized to define the MEP of the isomerization of the glycine molecule in water by FPO method.

Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions

NASA Astrophysics Data System (ADS)

Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.

2018-05-01

It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

A multistage stochastic programming model for a multi-period strategic expansion of biofuel supply chain under evolving uncertainties

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Fei; Huang, Yongxi

Here, we develop a multistage, stochastic mixed-integer model to support biofuel supply chain expansion under evolving uncertainties. By utilizing the block-separable recourse property, we reformulate the multistage program in an equivalent two-stage program and solve it using an enhanced nested decomposition method with maximal non-dominated cuts. We conduct extensive numerical experiments and demonstrate the application of the model and algorithm in a case study based on the South Carolina settings. The value of multistage stochastic programming method is also explored by comparing the model solution with the counterparts of an expected value based deterministic model and a two-stage stochastic model.

A multistage stochastic programming model for a multi-period strategic expansion of biofuel supply chain under evolving uncertainties

DOE PAGES

Xie, Fei; Huang, Yongxi

2018-02-04

Here, we develop a multistage, stochastic mixed-integer model to support biofuel supply chain expansion under evolving uncertainties. By utilizing the block-separable recourse property, we reformulate the multistage program in an equivalent two-stage program and solve it using an enhanced nested decomposition method with maximal non-dominated cuts. We conduct extensive numerical experiments and demonstrate the application of the model and algorithm in a case study based on the South Carolina settings. The value of multistage stochastic programming method is also explored by comparing the model solution with the counterparts of an expected value based deterministic model and a two-stage stochastic model.

Ufd2p synthesizes branched ubiquitin chains to promote the degradation of substrates modified with atypical chains

PubMed Central

Liu, Chao; Liu, Weixiao; Ye, Yihong; Li, Wei

2017-01-01

Ubiquitination of a subset of proteins by ubiquitin chain elongation factors (E4), represented by Ufd2p in Saccharomyces cerevisiae, is a pivotal regulator for many biological processes. However, the mechanism of Ufd2p-mediated ubiquitination is largely unclear. Here, we show that Ufd2p catalyses K48-linked multi-monoubiquitination on K29-linked ubiquitin chains assembled by the ubiquitin ligase (Ufd4p), resulting in branched ubiquitin chains. This reaction depends on the interaction of K29-linked ubiquitin chains with two N-terminal loops of Ufd2p. Only following the addition of K48-linked ubiquitin to substrates modified with K29-linked ubiquitin chains, can the substrates be escorted to the proteasome for degradation. We demonstrate that this ubiquitin chain linkage switching reaction is essential for ERAD, oleic acid and acid pH resistance in yeast. Thus, our results suggest that Ufd2p functions by switching ubiquitin chain linkages to allow the degradation of proteins modified with a ubiquitin linkage, which is normally not targeted to the proteasome. PMID:28165462

Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

Identification of Brucella spp. by using the polymerase chain reaction.

PubMed Central

Herman, L; De Ridder, H

1992-01-01

The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

Detection of Listeria monocytogenes by using the polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bessesen, M.T.; Luo, Q.; Blaser, M.J.

1990-09-01

A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

PubMed

Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

2012-07-09

Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

9 CFR 145.33 - Terminology and classification; flocks and products.

Code of Federal Regulations, 2010 CFR

2010-01-01

.... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

Parallel and automated library synthesis of 2-long alkyl chain benzoazoles and azole[4,5-b]pyridines under microwave irradiation.

PubMed

Martínez-Palou, Rafael; Zepeda, L Gerardo; Höpfl, Herbert; Montoya, Ascensión; Guzmán-Lucero, Diego J; Guzmán, Javier

2005-01-01

A versatile route to 40-membered library of 2-long alkyl chain substituted benzoazoles (1 and 2) and azole[4,5-b]pyridines (3 and 4) via microwave-assisted combinatorial synthesis was developed. The reactions were carried out in both monomode and multimode microwave oven. With the latter, all reactions were performed in high-throughput experimental settings consisting of an 8 x 5 combinatorial library designed to synthesize 40 compounds. Each step, from the addition of reagents to the recovery of final products, was automated. The microwave-assisted N-long chain alkylation reactions of 2-alkyl-1H-benzimidazole (1) and 2-alkyl-1H-benzimidazole[4,5-b] pyridines (3) were also studied.

Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

PubMed Central

Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

2011-01-01

Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

Immediate hypersensitivity to moxifloxacin with tolerance to ciprofloxacin: report of three cases and review of the literature.

PubMed

Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth

2010-04-01

To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.

Control Transfer in Operating System Kernels

DTIC Science & Technology

1994-05-13

microkernel system that runs less code in the kernel address space. To realize the performance benefit of allocating stacks in unmapped kseg0 memory, the...review how I modified the Mach 3.0 kernel to use continuations. Because of Mach’s message-passing microkernel structure, interprocess communication was...critical control transfer paths, deeply- nested call chains are undesirable in any case because of the function call overhead. 4.1.3 Microkernel Operating

Optimized nested Markov chain Monte Carlo sampling: theory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coe, Joshua D; Shaw, M Sam; Sewell, Thomas D

2009-01-01

Metropolis Monte Carlo sampling of a reference potential is used to build a Markov chain in the isothermal-isobaric ensemble. At the endpoints of the chain, the energy is reevaluated at a different level of approximation (the 'full' energy) and a composite move encompassing all of the intervening steps is accepted on the basis of a modified Metropolis criterion. By manipulating the thermodynamic variables characterizing the reference system we maximize the average acceptance probability of composite moves, lengthening significantly the random walk made between consecutive evaluations of the full energy at a fixed acceptance probability. This provides maximally decorrelated samples ofmore » the full potential, thereby lowering the total number required to build ensemble averages of a given variance. The efficiency of the method is illustrated using model potentials appropriate to molecular fluids at high pressure. Implications for ab initio or density functional theory (DFT) treatment are discussed.« less

The influence of slavemaking lifestyle, caste and sex on chemical profiles in Temnothorax ants: insights into the evolution of cuticular hydrocarbons

PubMed Central

Kleeberg, Isabelle

2017-01-01

Chemical communication is central for the formation and maintenance of insect societies. Generally, social insects only allow nest-mates into their colony, which are recognized by their cuticular hydrocarbons (CHCs). Social parasites, which exploit insect societies, are selected to circumvent host recognition. Here, we studied whether chemical strategies to reduce recognition evolved convergently in slavemaking ants, and whether they extend to workers, queens and males alike. We studied CHCs of three social parasites and their related hosts to investigate whether the parasitic lifestyle selects for specific chemical traits that reduce host recognition. Slavemaker profiles were characterized by shorter-chained hydrocarbons and a shift from methyl-branched alkanes to n-alkanes, presumably to reduce recognition cue quantity. These shifts were consistent across independent origins of slavery and were found in isolated ants and those emerging in their mother colony. Lifestyle influenced profiles of workers most profoundly, with little effect on virgin queen profiles. We detected an across-species caste signal, with workers, for which nest-mate recognition is particularly important, carrying more and longer-chained hydrocarbons and males exhibiting a larger fraction of n-alkanes. This comprehensive study of CHCs across castes and species reveals how lifestyle-specific selection can result in convergent evolution of chemical phenotypes. PMID:28298345

Rapid identification of Mycobacterium avium ssp paratuberculosis laboratory strains by IS900-Nested polymerase chain reaction.

PubMed

Taheri, Mohammad Mohammad; Mosavari, Nader; Feizabadi, Mohammad Mehdi; Tadayon, Keyvan; Keshavarz, Rouholah; Pajoohi, Reza Aref; Soleimani, Kioomars; Pour, Shojaat Dashti

2016-12-01

Mycobacterium avium ssp paratuberculosis (MAP) causes paratuberculosis (Johne's disease) in ruminants. As a species, M. avium comprises M. avium subsp. hominissuis and a number of clones that are known to have evolved from this subspecies, namely M. avium subsp. avium (MAA), M. avium subsp. silvaticum, and MAP. Despite the very high genomic similarity of MAP and MAA, the insertion sequence IS900, which is 1,451-bp long, is now understood to be exclusively present in 10-20 copies in the genome of MAP. In the present study, a multidiscipline polymerase chain reaction (PCR)-based algorithm targeting16SrRNA, IS6110, IS901, IS1245, and IS900 markers has been employed to differentiate between six laboratory strains of M. avium complex (including MAP 316F, III&V, and 2e plus MAA D4), Mycobacterium tuberculosis DT, and Mycobacterium bovis AN5 strains used at the Razi Institute (Tehran, Iran) for the preparation of paratuberculin, avian, human, and bovine tuberculin, respectively. Three laboratory strains of III&V, 2e, and 316F were subcultured on Herrold's egg yolk medium, whereas the MAA strain of D4 along with M. bovis AN5 and M. tuberculosis DT were subcultured on Lowenstein-Jensen slopes. All the inoculated culture tubes were incubated for 8weeks at 37°C. Eventually, their genomic DNA was extracted according to the method of van Soolingen. Five individual PCRs were conducted on these templates to amplify 16SrRNA (genus-specific marker shared by all mycobacteria), IS900 (MAP-specific marker), IS901 (MAA-specific marker), IS1245 (M. avium complex (MAC)-specific marker), and IS6110 (M. tuberculosis complex (MTC)-specific marker) loci. Consequently, a 543-bp amplicon was amplified by all the six strains in PCR against 16SrRNA, an indication of their identity as members of Mycobacterium genus. A 245-bp fragment was detected in only IS6110-PCR with M. bovis AN5 as well as M. tuberculosis DT. In the IS1245 assessment, the MAA strain of D4 produced a 427-bp amplicon, whereas none of the other studied strains produced this amplicon. A 1,108-bp amplicon fragment of the IS901 marker was successfully produced by MAA strain, whereas no PCR product was achieved in amplification of all the three MAP strains. In IS900-nested PCR, the three MAP strains produced the expected 400-bp and 298-bp fragments CONCLUTION: However, no amplification was observed with other strains. Two main achievements of this work are the development of an efficient means of differentiation between the six Razi laboratory mycobacterial strains and characterization of the genomic profile of these strains, a capability that is vital when cross contamination is potentially an important concern. Copyright © 2016.

New polymer systems: Chain extension by dianhydrides

NASA Technical Reports Server (NTRS)

Rhein, R. A.; Ingham, J. D.

1972-01-01

The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.

Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

PubMed

Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

2014-07-24

This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

Sleeve reaction chamber system

DOEpatents

Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

2009-08-25

A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

PubMed

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

USDA-ARS?s Scientific Manuscript database

Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

DOEpatents

Wigner, E.P.; Weinberg, A.M.

1961-01-24

A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

EPA Science Inventory

This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

ERIC Educational Resources Information Center

Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

2006-01-01

We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

PubMed

Adewale, B; Mafe, M A; Oyerinde, J P O

2005-01-01

Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

PubMed

Ragheb, Suzan Mohammed; Jimenez, Luis

Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

[The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

PubMed

Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

2014-04-01

The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

PubMed Central

Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

2014-01-01

A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

Safety of medium-chain triglycerides used as an intraocular tamponading agent in an experimental vitrectomy model rabbit.

PubMed

Auriol, Sylvain; Mahieu, Laurence; Brousset, Pierre; Malecaze, François; Mathis, Véronique

2013-01-01

To evaluate safety of medium-chain triglycerides used as a possible intraocular tamponading agent. A 20-gauge pars plana vitrectomy was performed in the right eye of 28 rabbits. An ophthalmologic examination was performed every week until rabbits were killed. At days 7, 30, 60, and 90, rabbits were killed and the treated eyes were examined macroscopically and prepared for histologic examination. Principal outcome was retinal toxicity evaluated by light and electron microscopy, and secondary outcomes were the presence of medium-chain triglyceride emulsification, inflammatory reactions, and the development of cataract. Histologic examination did not reveal any retinal toxicity. Two cases of moderate emulsification were observed, but in these cases, emulsification was caused by the perioperative injection of the agent and did not increase during the postoperative period. We noted 13 cases of inflammatory reaction in vitreous cavity and no case of inflammatory reaction in anterior chamber. Two eyes developed cataract as a result of perioperative trauma to the lens with the vitreous cutter and not secondary to the presence of medium-chain triglycerides in the vitreous cavity. Medium-chain triglycerides did not induce morphologic evidence of retinal toxicity. The results suggest that medium-chain triglycerides could be a promising alternative intraocular tamponading agent for the treatment of retinal detachments.

Ecology of mangroves in the Jewfish Chain, Exuma, Bahamas

USGS Publications Warehouse

Wilcox, L. V.; Yocom, Thomas G.; Forbes, A. M.

1976-01-01

The structure and function of mangrove communities in the Jewfish Chain, Exumas, Bahamas, were investigated for 3-1/2 years. Mangrove vegetation in the Jewfish Chain is similar to that in all the Caribbean-Florida area; Rhizophora mangle L. dominates and is interspersed with Avicennia germinans (L.) Lamk. and Laguncularia racemosa (L.) Gaertn. There is no apparent zonation of these three species. The mangrove communities in the Jewfish Chain occur only where they are protected from prevailing winds, storms, and tides, although all are periodically devastated by hurricanes. We found little or no evidence of coast building within these protected locations. The importance of the mangroves appears to be in providing protection and food for other flora and fauna within this unique ecosystem. Twenty-four species of algae were found in the mangroves, 9 of which had not previously been reported from the Bahamas. Distribution of these algae appears to be correlated to incident solar radiation, desiccation, and tide level. A total of 56 species of fish were found in the mangroves, 2 of which were not previously known from the Bahamas. Many fish taken were juveniles, suggesting that mangroves are a nursery ground for numerous species. Nine species of molluscs were found. Each species had a distinct distribution pattern relative to distance from the seaward edge of the mangroves, as well as a distinct vertical distribution pattern. Seventeen species of decapod crustaceans were recorded. Though several species of birds were noted in the mangroves, three species were most abundant: the white-crowned pigeon (Columba leucocephala) uses the mangrove for nesting but feeds in nearby shrub-thorn communities; the gray kingbird (Tyrannus dominicensis) and green heron (Butorides virescens) nest and feed in the mangroves. Our data do not completely describe a stereotyped mangrove community in the Bahamas, but they do give an indication of community structure and suggest several aspects of function.

Novel approach based on one-tube nested PCR and a lateral flow strip for highly sensitive diagnosis of tuberculous meningitis

PubMed Central

Sun, Yajuan; Chen, Jiajun; Li, Jia; Xu, Yawei; Jin, Hui; Xu, Na; Yin, Rui

2017-01-01

Rapid and sensitive detection of Mycobacterium tuberculosis (M. Tb) in cerebrospinal fluid is crucial in the diagnosis of tuberculous meningitis (TBM), but conventional diagnostic technologies have limited sensitivity and specificity or are time-consuming. In this work, a novel, highly sensitive molecular diagnostic method, one-tube nested PCR-lateral flow strip test (OTNPCR-LFST), was developed for detecting M. tuberculosis. This one-tube nested PCR maintains the sensitivity of conventional two-step nested PCR and reduces both the chance of cross-contamination and the time required for analysis. The PCR product was detected by a lateral flow strip assay, which provided a basis for migration of the test to a point-of-care (POC) microfluidic format. The developed assay had an improved sensitivity compared with traditional PCR, and the limit of detection was up to 1 fg DNA isolated from M. tuberculosis. The assay was also specific for M. tuberculosis, and no cross-reactions were found in other non-target bacteria. The application of this technique to clinical samples was successfully evaluated, and OTNPCR-LFST showed 89% overall sensitivity and 100% specificity for TBM patients. This one-tube nested PCR-lateral flow strip assay is useful for detecting M. tuberculosis in TBM due to its rapidity, high sensitivity and simple manipulation. PMID:29084241

Neutron-deficient superheavy nuclei obtained in the 240Pu+48Ca reaction

NASA Astrophysics Data System (ADS)

Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu. Ts.; Rykaczewski, K. P.; Abdullin, F. Sh.; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu. S.; Voinov, A. A.; Subbotin, V. G.; Sukhov, A. M.; Karpov, A. V.; Popeko, A. G.; Sabel'nikov, A. V.; Svirikhin, A. I.; Vostokin, G. K.; Hamilton, J. H.; Kovrizhnykh, N. D.; Schlattauer, L.; Stoyer, M. A.; Gan, Z.; Huang, W. X.; Ma, L.

2018-01-01

We present new results from investigations of the 240Pu+48Ca reaction at a projectile energy of 250 MeV. Three new decay chains of 285Fl were detected with decay properties mostly consistent with those measured in earlier studies. An additional chain was observed where the nuclei may decay through energy levels different from those of the other six chains registered so far. The cross section of the 240Pu(48Ca,3 n )285Fl reaction was measured to be 0 .58-0.33+0.60pb , which is a factor of about 4-5 lower than that measured in the previous experiment at 245 MeV beam energy [V. K. Utyonkov et al., Phys. Rev. C 92, 034609 (2015)., 10.1103/PhysRevC.92.034609], consistent with expectations. The origin of an additional chain consisting of a recoil, α particle, and fission event is analyzed. The assignment of 25 short-lived SF events observed in this experiment is also discussed.

Autocatalytic formation of an iron(IV)-oxo complex via scandium ion-promoted radical chain autoxidation of an iron(II) complex with dioxygen and tetraphenylborate.

PubMed

Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi

2014-06-04

A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.

A new real-time PCR protocol for detection of avian haemosporidians.

PubMed

Bell, Jeffrey A; Weckstein, Jason D; Fecchio, Alan; Tkach, Vasyl V

2015-07-19

Birds possess the most diverse assemblage of haemosporidian parasites; including three genera, Plasmodium, Haemoproteus, and Leucocytozoon. Currently there are over 200 morphologically identified avian haemosporidian species, although true species richness is unknown due to great genetic diversity and insufficient sampling in highly diverse regions. Studies aimed at surveying haemosporidian diversity involve collecting and screening samples from hundreds to thousands of individuals. Currently, screening relies on microscopy and/or single or nested standard PCR. Although effective, these methods are time and resource consuming, and in the case of microscopy require substantial expertise. Here we report a newly developed real-time PCR protocol designed to quickly and reliably detect all three genera of avian haemosporidians in a single biochemical reaction. Using available DNA sequences from avian haemosporidians we designed primers R330F and R480RL, which flank a 182 base pair fragment of mitochondrial conserved rDNA. These primers were initially tested using real-time PCR on samples from Malawi, Africa, previously screened for avian haemosporidians using traditional nested PCR. Our real time protocol was further tested on 94 samples from the Cerrado biome of Brazil, previously screened using a single PCR assay for haemosporidian parasites. These samples were also amplified using modified nested PCR protocols, allowing for comparisons between the three different screening methods (single PCR, nested PCR, real-time PCR). The real-time PCR protocol successfully identified all three genera of avian haemosporidians from both single and mixed infections previously detected from Malawi. There was no significant difference between the three different screening protocols used for the 94 samples from the Brazilian Cerrado (χ(2) = 0.3429, df = 2, P = 0.842). After proving effective, the real-time protocol was used to screen 2113 Brazilian samples, identifying 693 positive samples. Our real-time PCR assay proved as effective as two widely used molecular screening techniques, single PCR and nested PCR. However, the real-time protocol has the distinct advantage of detecting all three genera in a single reaction, which significantly increases efficiency by greatly decreasing screening time and cost. Our real-time PCR protocol is therefore a valuable tool in the quickly expanding field of avian haemosporidian research.

Design of a species-specific PCR method for the detection of the heat-resistant fungi Talaromyces macrosporus and Talaromyces trachyspermus.

PubMed

Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y

2018-01-01

Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage production. © 2017 The Authors. Letters in Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

Evaluation of short purification cycles in naturally contaminated Mediterranean mussels (Mytilus galloprovincialis) harvested in Sardinia (Italy).

PubMed

Sferlazzo, Giovanni; Meloni, Domenico; Lamon, Sonia; Marceddu, Marta; Mureddu, Anna; Consolati, Simonetta Gianna; Pisanu, Margherita; Virgilio, Sebastiano

2018-09-01

The aim of the present study was to investigate the effect of short purification cycles on the safety of naturally contaminated Mytilus galloprovincialis from harvesting areas of the Gulf of Olbia (Sardinia, Italy). Samples from ten batches of mussels were collected before, during and after purification treatment at two purification centres (A-B). All the samples were analysed for Escherichia coli and Salmonella spp according to Council Regulation (EC) 2285/2015. Detection and enumeration of Vibrio spp were performed according to previously published methods. Presumptive identification of Vibrio spp isolates were performed by means of conventional biochemical tests and polymerase chain reaction. The presence of Hepatitis A virus was detected by nested reverse transcriptase-polymerase chain reaction. Environmental parameters (water temperature and salinity) were also recorded. The results of Escherichia coli counts showed the overall efficacy of the short purification cycles; a purification cycle of 8 h led to a rapid decline in the concentration. The decrease in Escherichia coli counts does not correlate with the presence of naturally occurring vibrios, the decline of which occurs at an even slower rate. The average contamination levels for Vibrio spp before purification were 8.20 ± 0.47 and 7.99 ± 0.62 Log 10  CFU/g in samples collected at purification plants A and B, respectively. After purification, the average contamination levels were 8.10 ± 0.60 Log 10  CFU/g at purification plant A and 7.85 ± 0.57 Log 10  CFU/g at purification plant B. The contaminated samples revealed the presence of Vibrio alginolyticus (n=21), Vibrio fluvialis (n=12), Vibrio cholerae (n=4), Vibrio parahaemolyticus (n=2) and Vibrio vulnificus (n=1). The Vibrio parahaemolyticus isolates carried the tdh or the trh genes. None of the isolates was tdh+/trh+. Salmonella spp and Hepatitis A virus were not detected. The adoption of short purification cycles for Mytilus galloprovincialis in the presence of pathogenic vibrios might not be sufficient to guarantee the safety of consumers. Copyright © 2018 Elsevier Ltd. All rights reserved.

An outbreak of West Nile Virus infection in the region of Monastir, Tunisia, 2003

PubMed Central

Riabi, Samira; Gaaloul, Imed; Mastouri, Maha; Hassine, Mohsen; Aouni, Mahjoub

2014-01-01

Background A West Nile (WN) fever epidemic occurred in the region of Monastir, Tunisia, between August and October 2003. Aim of the study We attempt to describe the epidemiology, clinical presentation, and outcome of patients with confirmed West Nile virus (WNV) infection. Methods Three groups of specimens were prepared. One was made up of serum only (n  =  43), the other of cerebrospinal fluid (CSF) only (n  =  30), and the third group was made up of both (n  =  40). These specimens were obtained from 113 patients. A serological diagnosis and evidence of WNV genome by nested reverse-transcriptase polymerase chain reaction (nRT-PCR) and TaqMan reverse transcription-polymerase chain reaction (RT-PCR) were carried out. Results Thirty-eight cases (33.6%) were serologically positive. Results of nRT-PCR showed a total of 10 positive cases of WNV (8.8%) detected in group 1 (n  =  1/43), group 2 (n  =  5/30), and group 3 (n  =  4/40) whereas the PCR TaqMan showed 18 positive samples (15.9%) found in group 1 (n  =  3/43), group 2 (n  =  9/30), and group 3 (n  =  6/40). All TaqMan PCR positive cases were nRT-PCR positive. In addition, four serologically probable cases were confirmed by TaqMan PCR. The attempts to isolate WNV by cell culture were unsuccessful. Considering the results of TaqMan assay and the serological diagnosis, WNV infection was confirmed in a total of 42 patients. The main clinical presentations were meningoencephalitis (40%), febrile disease (95%), and meningitis (36%). Eight patients (19%) died. The highest case-fatality rates occurred among patients aged ≧55 years. The phylogenetic analysis revealed that isolates of WNV were closely related to the Tunisian strain 1997 (PAH001) and the Israeli one (Is-98). Conclusions West Nile virus is a reemerging global pathogen that remains an important public health challenge in the next decade. PMID:24766339

Terminal alkenes as versatile chemical reporter groups for metabolic oligosaccharide engineering.

PubMed

Späte, Anne-Katrin; Schart, Verena F; Schöllkopf, Sophie; Niederwieser, Andrea; Wittmann, Valentin

2014-12-08

The Diels-Alder reaction with inverse electron demand (DAinv reaction) of 1,2,4,5-tetrazines with electron rich or strained alkenes was proven to be a bioorthogonal ligation reaction that proceeds fast and with high yields. An important application of the DAinv reaction is metabolic oligosaccharide engineering (MOE) which allows the visualization of glycoconjugates in living cells. In this approach, a sugar derivative bearing a chemical reporter group is metabolically incorporated into cellular glycoconjugates and subsequently derivatized with a probe by means of a bioorthogonal ligation reaction. Here, we investigated a series of new mannosamine and glucosamine derivatives with carbamate-linked side chains of varying length terminated by alkene groups and their suitability for labeling cell-surface glycans. Kinetic investigations showed that the reactivity of the alkenes in DAinv reactions increases with growing chain length. When applied to MOE, one of the compounds, peracetylated N-butenyloxycarbonylmannosamine, was especially well suited for labeling cell-surface glycans. Obviously, the length of its side chain represents the optimal balance between incorporation efficiency and speed of the labeling reaction. Sialidase treatment of the cells before the bioorthogonal labeling reaction showed that this sugar derivative is attached to the glycans in form of the corresponding sialic acid derivative and not epimerized to another hexosamine derivative to a considerable extent. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Method for polymer synthesis in a reaction well

DOEpatents

Brennan, Thomas M.

1998-01-01

A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

Method for polymer synthesis in a reaction well

DOEpatents

Brennan, T.M.

1998-09-29

A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

PubMed Central

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

Treesearch

David E. Schreiber; Karen J. Garner; James M. Slavicek

1997-01-01

Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

Detection of Plasmodium falciparum DNA in saliva samples stored at room temperature: potential for a non-invasive saliva-based diagnostic test for malaria.

PubMed

Mfuh, Kenji O; Tassi Yunga, Samuel; Esemu, Livo F; Bekindaka, Obase Ngemani; Yonga, Jessica; Djontu, Jean Claude; Mbakop, Calixt D; Taylor, Diane W; Nerurkar, Vivek R; Leke, Rose G F

2017-10-27

Current malaria diagnostic methods require blood collection, that may be associated with pain and the risk of transmitting blood-borne pathogens, and often create poor compliance when repeated sampling is needed. On the other hand, the collection of saliva is minimally invasive; but saliva has not been widely used for the diagnosis of malaria. The aim of this study was to evaluate the diagnostic performance of saliva collected and stored at room temperature using the OMNIgene ® •ORAL kit for diagnosing Plasmodium falciparum malaria. Paired blood and saliva samples were collected from 222 febrile patients in Cameroon. Saliva samples were collected using the OMNIgene ® •ORAL (OM-501) kit and stored at room temperature for up to 13 months. Thick blood film microscopy (TFM) was used to detect P. falciparum blood-stage parasites in blood. Detection of P. falciparum DNA in blood and saliva was based on amplification of the multi-copy 18 s rRNA gene using the nested-polymerase chain reaction (nPCR). Prevalence of malaria detected by TFM, nPCR-saliva and nPCR-blood was 22, 29, and 35%, respectively. Using TFM as the gold standard, the sensitivity of nPCR-saliva and nPCR-blood in detecting P. falciparum was 95 and 100%, respectively; with corresponding specificities of 93 and 87%. When nPCR-blood was used as gold standard, the sensitivity of nPCR-saliva and microscopy was 82 and 68%, respectively; whereas, the specificity was 99 and 100%, respectively. Nested PCR-saliva had a very good agreement with both TFM (kappa value 0.8) and blood PCR (kappa value 0.8). At parasitaemia > 10,000 parasites/µl of blood, the sensitivity of nPCR-saliva was 100%. Nested PCR-saliva detected 16 sub-microscopic malaria infections. One year after sample collection, P. falciparum DNA was detected in 80% of saliva samples stored at room temperature. Saliva can potentially be used as an alternative non-invasive sample for the diagnosis of malaria and the OMNIgene ® •ORAL kit is effective at transporting and preserving malaria parasite DNA in saliva at room temperature. The technology described in this study for diagnosis of malaria in resource-limited countries adds on to the armamentarium needed for elimination of malaria.

Field evaluation of the photo-induced electron transfer fluorogenic primers (PET) real-time PCR for the detection of Plasmodium falciparum in Tanzania.

PubMed

Talundzic, Eldin; Maganga, Mussa; Masanja, Irene M; Peterson, David S; Udhayakumar, Venkatachalam; Lucchi, Naomi W

2014-01-27

Accurate diagnosis of malaria infections remains challenging, especially in the identification of submicroscopic infections. New molecular diagnostic tools that are inexpensive, sensitive enough to detect low-level infections and suitable in laboratory settings of resource-limited countries are required for malaria control and elimination programmes. Here the diagnostic potential of a recently developed photo-induced electron transfer fluorogenic primer (PET) real-time polymerase chain reaction (PCR) called PET-PCR was investigated. This study aimed to (i) evaluate the use of this assay as a method for the detection of both Plasmodium falciparum and other Plasmodium species infections in a developing country's diagnostic laboratory; and, (ii) determine the assay's sensitivity and specificity compared to a nested 18S rRNA PCR. Samples used in this study were obtained from a previous study conducted in the region of Iringa, Tanzania. A total of 303 samples from eight health facilities in Tanzania were utilized for this evaluation. All samples were screened using the multiplex PET-PCR assay designed to detect Plasmodium genus and P. falciparum initially in laboratory in Tanzania and then repeated at a reference laboratory at the CDC in the USA. Microscopy data was available for all the 303 samples. A subset of the samples were tested in a blinded fashion to find the sensitivity and specificity of the PET-PCR compared to the nested 18S rRNA PCR. Compared to microscopy, the PET-PCR assay was 59% more sensitive in detecting P. falciparum infections. The observed sensitivity and specificity were 100% (95% confidence interval (CI0.95) = 94-100%) and (CI0.95 = 96-100%), respectively, for the PET-PCR assay when compared to nested 18S rRNA PCR. When compared to 18S rRNA PCR, microscopy had a low sensitivity of 40% (CI0.95 = 23-61%) and specificity of 100% (CI0.95 = 96-100%). The PET-PCR results performed in the field laboratory in Tanzania were in 100% concordance with the results obtained at the reference laboratory in the USA. The PET-PCR is a new molecular diagnostic tool with similar performance characteristics as commonly used PCR methods that is less expensive, easy to use, and amiable to large scale-surveillance studies in developing country settings.

The Beta-Delayed Proton and Gamma Decay of 27P for Nuclear Astrophysics

NASA Astrophysics Data System (ADS)

McCleskey, E.; Banu, A.; McCleskey, M.; Roeder, B.; Saastamoinen, A.; Spiridon, A.; Trache, L.; Tribble, R. E.; Davinson, T.; Doherty, D.; Lotay, G. J.; Wallace, J.; Woods, P. J.

2013-10-01

The main creation site of 26Al is currently under debate. The reactions for its creation or destruction are also not completely known. When 26Al is created in novae, the reaction chain is: 24Mg(p,γ)25Al(β + v)25Mg(p,γ)26Al, but this chain can be by-passed by another chain: 25Al(p,γ)26Si(p,γ)27P and it can also be destroyed directly. Another way to by-pass it is through 26mAl(p,γ)27Si* which is dominated by resonant capture. Using the Momentum Achromat Recoil Spectrometer (MARS) at the Texas A&M Cyclotron Institute and inverse kinematics, this destruction reaction was studied by the beta-delayed proton and gamma decay of 27P. Due to selection rules, states populated above the proton threshold in the compound system (27Si*) can decay to 26mAl, which are the states of interest for the capture reaction. James Madison University, VA, USA.

Paired analysis of TCRα and TCRβ chains at the single-cell level in mice

PubMed Central

Dash, Pradyot; McClaren, Jennifer L.; Oguin, Thomas H.; Rothwell, William; Todd, Brandon; Morris, Melissa Y.; Becksfort, Jared; Reynolds, Cory; Brown, Scott A.; Doherty, Peter C.; Thomas, Paul G.

2010-01-01

Characterizing the TCRα and TCRβ chains expressed by T cells responding to a given pathogen or underlying autoimmunity helps in the development of vaccines and immunotherapies, respectively. However, our understanding of complementary TCRα and TCRβ chain utilization is very limited for pathogen- and autoantigen-induced immunity. To address this problem, we have developed a multiplex nested RT-PCR method for the simultaneous amplification of transcripts encoding the TCRα and TCRβ chains from single cells. This multiplex method circumvented the lack of antibodies specific for variable regions of mouse TCRα chains and the need for prior knowledge of variable region usage in the TCRβ chain, resulting in a comprehensive, unbiased TCR repertoire analysis with paired coexpression of TCRα and TCRβ chains with single-cell resolution. Using CD8+ CTLs specific for an influenza epitope recovered directly from the pneumonic lungs of mice, this technique determined that 25% of such effectors expressed a dominant, nonproductively rearranged Tcra transcript. T cells with these out-of-frame Tcra mRNAs also expressed an alternate, in-frame Tcra, whereas approximately 10% of T cells had 2 productive Tcra transcripts. The proportion of cells with biallelic transcription increased over the course of a response, a finding that has implications for immune memory and autoimmunity. This technique may have broad applications in mouse models of human disease. PMID:21135507

Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen

NASA Astrophysics Data System (ADS)

Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.

2017-12-01

The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.

Additional chain-branching pathways in the low-temperature oxidation of branched alkanes

DOE PAGES

Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; ...

2015-12-31

Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C 8H 14O 4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C 8H 16O 5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C 8H 16O 5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O 2 addition, intramolecular isomerization, and OH release; C 8H 14O 4 species are proposed to result from subsequent reactions of C 8H 16O 5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less

An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

PubMed Central

Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

2005-01-01

Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

Blood grouping based on PCR methods and agarose gel electrophoresis.

PubMed

Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

2015-01-01

The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

Excitation wavelength dependence of excited state intramolecular proton transfer reaction of 4'-N,N-diethylamino-3-hydroxyflavone in room temperature ionic liquids studied by optical Kerr gate fluorescence measurement.

PubMed

Suda, Kayo; Terazima, Masahide; Sato, Hirofumi; Kimura, Yoshifumi

2013-10-17

Excited state intramolecular proton transfer reactions (ESIPT) of 4'-N,N-diethylamino-3-hydroxyflavone (DEAHF) in ionic liquids have been studied by steady-state and time-resolved fluorescence measurements at different excitation wavelengths. Steady-state measurements show the relative yield of the tautomeric form to the normal form of DEAHF decreases as excitation wavelength is increased from 380 to 450 nm. The decrease in yield is significant in ionic liquids that have cations with long alkyl chains. The extent of the decrease is correlated with the number of carbon atoms in the alkyl chains. Time-resolved fluorescence measurements using optical Kerr gate spectroscopy show that ESIPT rate has a strong excitation wavelength dependence. There is a large difference between the spectra at a 200 ps delay from different excitation wavelengths in each ionic liquid. The difference is pronounced in ionic liquids having a long alkyl chain. The equilibrium constant in the electronic excited state obtained at a 200 ps delay and the average reaction rate are also correlated with the alkyl chain length. Considering the results of the steady-state fluorescence and time-resolved measurements, the excitation wavelength dependence of ESIPT is explained by state selective excitation due to the difference of the solvation, and the number of alkyl chain carbon atoms is found to be a good indicator of the effect of inhomogeneity for this reaction.

Structural basis for Diels-Alder ribozyme-catalyzed carbon-carbon bond formation

PubMed Central

Serganov, Alexander; Keiper, Sonja; Malinina, Lucy; Tereshko, Valentina; Skripkin, Eugene; Höbartner, Claudia; Polonskaia, Anna; Phan, Anh Tuân; Wombacher, Richard; Micura, Ronald; Dauter, Zbigniew; Jäschke, Andres; Patel, Dinshaw J

2015-01-01

The majority of structural efforts addressing RNA’s catalytic function have focused on natural ribozymes, which catalyze phosphodiester transfer reactions. By contrast, little is known about how RNA catalyzes other types of chemical reactions. We report here the crystal structures of a ribozyme that catalyzes enantioselective carbon-carbon bond formation by the Diels-Alder reaction in the unbound state and in complex with a reaction product. The RNA adopts a λ-shaped nested pseudoknot architecture whose preformed hydrophobic pocket is precisely complementary in shape to the reaction product. RNA folding and product binding are dictated by extensive stacking and hydrogen bonding, whereas stereoselection is governed by the shape of the catalytic pocket. Catalysis is apparently achieved by a combination of proximity, complementarity and electronic effects. We observe structural parallels in the independently evolved catalytic pocket architectures for ribozyme- and antibody-catalyzed Diels-Alder carbon-carbon bond-forming reactions. PMID:15723077