Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

PubMed

Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

2017-11-01

Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

An ab initio molecular dynamics and density functional theory study of the formation of phosphate chains from metathiophosphates.

PubMed

Mosey, Nicholas J; Woo, Tom K

2006-09-04

The reactions that occur between metathiophosphate (MTP) molecules are identified and examined through ab initio molecular dynamics simulations and static quantum chemical calculations at the density functional level of theory. The simulations show that certain types of MTPs can react to yield phosphate chains, while others only dimerize. These differences are rationalized in terms of reaction energies and the electronic structures of these molecules. In the reaction leading to the formation of phosphate chains, the reactive center, a tri-coordinate phosphorus atom, is continually regenerated. A polymerization mechanism linking MTPs to phosphate chains is developed on the basis of these results. This information sheds light on the underlying processes that may be responsible for the formation of phosphates under high-temperature conditions and may prove useful in the development of protocols for the rational synthesis of complex phosphate structures.

Regeneration of cello-oligomers via selective depolymerization of cellulose fibers derived from printed paper wastes.

PubMed

Voon, Lee Ken; Pang, Suh Cem; Chin, Suk Fun

2016-05-20

Cellulose extracted from printed paper wastes were selectively depolymerized under controlled conditions into cello-oligomers of controllable chain lengths via dissolution in an ionic liquid, 1-allyl-3-methylimidazolium chloride (AMIMCl), and in the presence of an acid catalyst, Amberlyst 15DRY. The depolymerization process was optimized against reaction temperature, concentration of acid catalyst, and reaction time. Despite rapid initial depolymerization process, the rate of cellulose depolymerization slowed down gradually upon prolonged reaction time, with 75.0 wt% yield of regenerated cello-oligomers (mean Viscosimetric Degree of Polymerization value of 81) obtained after 40 min. The depolymerization of cellulose fibers at 80 °C appeared to proceed via a second-order kinetic reaction with respect to the catalyst concentration of 0.23 mmol H3O(+). As such, the cellulose depolymerization process could afford some degree of control on the degree of polymerization or chain lengths of cello-oligomers formed. Copyright © 2016 Elsevier Ltd. All rights reserved.

Microfabricated sleeve devices for chemical reactions

DOEpatents

Northrup, M. Allen

2003-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Temperature control apparatus

DOEpatents

Northrup, M. Allen

2003-08-05

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Sustainable Engineering and Improved Recycling of PET for High-Value Applications: Transforming Linear PET to Lightly Branched PET with a Novel, Scalable Process

NASA Astrophysics Data System (ADS)

Pierre, Cynthia; Torkelson, John

2009-03-01

A major challenge for the most effective recycling of poly(ethylene terephthalate) concerns the fact that initial melt processing of PET into a product leads to substantial degradation of molecular weight. Thus, recycled PET has insufficient melt viscosity for reuse in high-value applications such as melt-blowing of PET bottles. Academic and industrial research has tried to remedy this situation by synthesis and use of ``chain extenders'' that can lead to branched PET (with higher melt viscosity than the linear recycled PET) via condensation reactions with functional groups on the PET. Here we show that simple processing of PET via solid-state shear pulverization (SSSP) leads to enhanced PET melt viscosity without need for chemical additives. We hypothesize that this branching results from low levels of chain scission accompanying SSSP, leading to formation of polymeric radicals that participate in chain transfer and combination reactions with other PET chains and thereby to in situ branch formation. The pulverized PET exhibits vastly enhanced crystallization kinetics, eliminating the need to employ cold crystallization to achieve maximum PET crystallinity. Results of SSSP processing of PET will be compared to results obtained with poly(butylene terephthalate).

Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen

NASA Astrophysics Data System (ADS)

Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.

2017-12-01

The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.

Is the Reaction of C3N(-) with C2H2 a Possible Process for Chain Elongation in Titan's Ionosphere?

PubMed

Lindén, Fredrik; Alcaraz, Christian; Ascenzi, Daniela; Guillemin, Jean-Claude; Koch, Leopold; Lopes, Allan; Polášek, Miroslav; Romanzin, Claire; Žabka, Jan; Zymak, Illia; Geppert, Wolf D

2016-07-14

The reaction of C3N(-) with acetylene was studied using three different experimental setups, a triple quadrupole mass spectrometer (Trento), a tandem quadrupole mass spectrometer (Prague), and the "CERISES" guided ion beam apparatus at Orsay. The process is of astrophysical interest because it can function as a chain elongation mechanism to produce larger anions that have been detected in Titan's ionosphere by the Cassini Plasma Spectrometer. Three major products of primary processes, C2H(-), CN(-), and C5N(-), have been identified, whereby the production of the cyanide anion is probably partly due to collisional induced dissociation. The formations of all these products show considerable reaction thresholds and also display comparatively small cross sections. Also, no strong signals of anionic products for collision energies lower than 1 eV have been observed. Ab initio calculations have been performed to identify possible pathways leading to the observed products of the title reaction and to elucidate the thermodynamics of these processes. Although the productions of CN(-) and C5N(-) are exoergic, all reaction pathways have considerable barriers. Overall, the results of these computations are in agreement with the observed reaction thresholds. Due to the existence of considerable reaction energy barriers and the small observed cross sections, the title reaction is not very likely to play a major role in the buildup of large anions in cold environments like the interstellar medium or planetary and satellite ionospheres.

Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nasarabadi, Shanavaz

2011-01-11

A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

Ufd2p synthesizes branched ubiquitin chains to promote the degradation of substrates modified with atypical chains

PubMed Central

Liu, Chao; Liu, Weixiao; Ye, Yihong; Li, Wei

2017-01-01

Ubiquitination of a subset of proteins by ubiquitin chain elongation factors (E4), represented by Ufd2p in Saccharomyces cerevisiae, is a pivotal regulator for many biological processes. However, the mechanism of Ufd2p-mediated ubiquitination is largely unclear. Here, we show that Ufd2p catalyses K48-linked multi-monoubiquitination on K29-linked ubiquitin chains assembled by the ubiquitin ligase (Ufd4p), resulting in branched ubiquitin chains. This reaction depends on the interaction of K29-linked ubiquitin chains with two N-terminal loops of Ufd2p. Only following the addition of K48-linked ubiquitin to substrates modified with K29-linked ubiquitin chains, can the substrates be escorted to the proteasome for degradation. We demonstrate that this ubiquitin chain linkage switching reaction is essential for ERAD, oleic acid and acid pH resistance in yeast. Thus, our results suggest that Ufd2p functions by switching ubiquitin chain linkages to allow the degradation of proteins modified with a ubiquitin linkage, which is normally not targeted to the proteasome. PMID:28165462

Sleeve reaction chamber system

DOEpatents

Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

2009-08-25

A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

PubMed

Garg, Pankaj

2017-07-01

Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

Prediction of Chain Propagation Rate Constants of Polymerization Reactions in Aqueous NIPAM/BIS and VCL/BIS Systems.

PubMed

Kröger, Leif C; Kopp, Wassja A; Leonhard, Kai

2017-04-06

Microgels have a wide range of possible applications and are therefore studied with increasing interest. Nonetheless, the microgel synthesis process and some of the resulting properties of the microgels, such as the cross-linker distribution within the microgels, are not yet fully understood. An in-depth understanding of the synthesis process is crucial for designing tailored microgels with desired properties. In this work, rate constants and reaction enthalpies of chain propagation reactions in aqueous N-isopropylacrylamide/N,N'-methylenebisacrylamide and aqueous N-vinylcaprolactam/N,N'-methylenebisacrylamide systems are calculated to identify the possible sources of an inhomogeneous cross-linker distribution in the resulting microgels. Gas-phase reaction rate constants are calculated from B2PLYPD3/aug-cc-pVTZ energies and B3LYPD3/tzvp geometries and frequencies. Then, solvation effects based on COSMO-RS are incorporated into the rate constants to obtain the desired liquid-phase reaction rate constants. The rate constants agree with experiments within a factor of 2-10, and the reaction enthalpies deviate less than 5 kJ/mol. Further, the effect of rate constants on the microgel growth process is analyzed, and it is shown that differences in the magnitude of the reaction rate constants are a source of an inhomogeneous cross-linker distribution within the resulting microgel.

On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

NASA Astrophysics Data System (ADS)

Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

2015-07-01

Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

METHOD OF OPERATING NUCLEAR REACTORS

DOEpatents

Untermyer, S.

1958-10-14

A method is presented for obtaining enhanced utilization of natural uranium in heavy water moderated nuclear reactors by charging the reactor with an equal number of fuel elements formed of natural uranium and of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction. The reactor is operated until the rate of burnup of plutonium equals its rate of production, the fuel elements are processed to recover plutonium, the depleted uranium is discarded, and the remaining uranium is formed into fuel elements. These fuel elements are charged into a reactor along with an equal number of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction, and reuse of the uranium is continued as aforesaid until it wlll no longer support a chain reaction when combined with an equal quantity of natural uranium.

Chemical reactions directed Peptide self-assembly.

PubMed

Rasale, Dnyaneshwar B; Das, Apurba K

2015-05-13

Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.

Chemical Reactions Directed Peptide Self-Assembly

PubMed Central

Rasale, Dnyaneshwar B.; Das, Apurba K.

2015-01-01

Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly. PMID:25984603

Process for biological material carbon-carbon bond formation

DOEpatents

Hollingsworth, R.I.; Jung, S.; Mindock, C.A.

1998-12-22

A process for providing vicinal dimethyl long chain between alkyl groups of organic compounds is described. The process uses intact or disrupted cells of various species of bacteria, particularly Thermoanaerobacter sp., Sarcina sp. and Butyrivibrio sp. The process can be conducted in an aqueous reaction mixture at room temperatures. 8 figs.

Process for biological material carbon-carbon bond formation

DOEpatents

Hollingsworth, Rawle I.; Jung, Seunho; Mindock, Carol A.

1998-01-01

A process for providing vicinal dimethyl long chain between alkyl groups of organic compounds is described. The process uses intact or disrupted cells of various species of bacteria, particularly Thermoanaerobacter sp., Sarcina sp. and Butyrivibrio sp. The process can be conducted in an aqueous reaction mixture at room temperatures.

Hybrid RTM process: Monitoring and processing of composites based on reactive thermoplastic systems

NASA Astrophysics Data System (ADS)

Dkier, Mohamed; Lamnawar, Khalid; Maazouz, Abderrahim

2017-10-01

In this work, hybrid process coupling "Reactive Extrusion" and "Resin Transfer Molding" machine (T-ERTM) equipped with an instrumented mold was designed and developed. Polyamides model matrix according to two kinds of polymerizations were studied as well anionic and chain extension reactions. For the former, different ratios of catalyst and activator were investigated. For the latter, various formulations of prepolymer with chain extender (CA) were studied at different stoichiometry ratios and temperatures. Since that both reaction kinetics are very fast to be monitored at short times by usual technics, the chemo-rheological evolutions were firstly studied ex-situ by coupling rheology with FTIR and dielectric spectroscopy (DRS). Secondly, the T-ERTM process with an "instrumented mold" was developed with specific dielectric sensors in order to in-situ track viscosity and reaction evolution. The in-situ results corroborate the ex-situ ones aforementioned. Overall, a processing window was obtained for each reactive system to ensure a good preform impregnation for the manufacturing of complex and continuous glass fiber-reinforced parts. Herein, the Time-Temperature-Transformation-equivalent diagrams were established to obtain Thermoplastic composites with tailored mechanical and physical properties.

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

Chain-reaction crash in traffic flow controlled by taillights

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-02-01

We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.

Nuclear astrophysics with radioactive ions at FAIR

NASA Astrophysics Data System (ADS)

Reifarth, R.; Altstadt, S.; Göbel, K.; Heftrich, T.; Heil, M.; Koloczek, A.; Langer, C.; Plag, R.; Pohl, M.; Sonnabend, K.; Weigand, M.; Adachi, T.; Aksouh, F.; Al-Khalili, J.; AlGarawi, M.; AlGhamdi, S.; Alkhazov, G.; Alkhomashi, N.; Alvarez-Pol, H.; Alvarez-Rodriguez, R.; Andreev, V.; Andrei, B.; Atar, L.; Aumann, T.; Avdeichikov, V.; Bacri, C.; Bagchi, S.; Barbieri, C.; Beceiro, S.; Beck, C.; Beinrucker, C.; Belier, G.; Bemmerer, D.; Bendel, M.; Benlliure, J.; Benzoni, G.; Berjillos, R.; Bertini, D.; Bertulani, C.; Bishop, S.; Blasi, N.; Bloch, T.; Blumenfeld, Y.; Bonaccorso, A.; Boretzky, K.; Botvina, A.; Boudard, A.; Boutachkov, P.; Boztosun, I.; Bracco, A.; Brambilla, S.; Briz Monago, J.; Caamano, M.; Caesar, C.; Camera, F.; Casarejos, E.; Catford, W.; Cederkall, J.; Cederwall, B.; Chartier, M.; Chatillon, A.; Cherciu, M.; Chulkov, L.; Coleman-Smith, P.; Cortina-Gil, D.; Crespi, F.; Crespo, R.; Cresswell, J.; Csatlós, M.; Déchery, F.; Davids, B.; Davinson, T.; Derya, V.; Detistov, P.; Diaz Fernandez, P.; DiJulio, D.; Dmitry, S.; Doré, D.; Dueñas, J.; Dupont, E.; Egelhof, P.; Egorova, I.; Elekes, Z.; Enders, J.; Endres, J.; Ershov, S.; Ershova, O.; Fernandez-Dominguez, B.; Fetisov, A.; Fiori, E.; Fomichev, A.; Fonseca, M.; Fraile, L.; Freer, M.; Friese, J.; Borge, M. G.; Galaviz Redondo, D.; Gannon, S.; Garg, U.; Gasparic, I.; Gasques, L.; Gastineau, B.; Geissel, H.; Gernhäuser, R.; Ghosh, T.; Gilbert, M.; Glorius, J.; Golubev, P.; Gorshkov, A.; Gourishetty, A.; Grigorenko, L.; Gulyas, J.; Haiduc, M.; Hammache, F.; Harakeh, M.; Hass, M.; Heine, M.; Hennig, A.; Henriques, A.; Herzberg, R.; Holl, M.; Ignatov, A.; Ignatyuk, A.; Ilieva, S.; Ivanov, M.; Iwasa, N.; Jakobsson, B.; Johansson, H.; Jonson, B.; Joshi, P.; Junghans, A.; Jurado, B.; Körner, G.; Kalantar, N.; Kanungo, R.; Kelic-Heil, A.; Kezzar, K.; Khan, E.; Khanzadeev, A.; Kiselev, O.; Kogimtzis, M.; Körper, D.; Kräckmann, S.; Kröll, T.; Krücken, R.; Krasznahorkay, A.; Kratz, J.; Kresan, D.; Krings, T.; Krumbholz, A.; Krupko, S.; Kulessa, R.; Kumar, S.; Kurz, N.; Kuzmin, E.; Labiche, M.; Langanke, K.; Lazarus, I.; Le Bleis, T.; Lederer, C.; Lemasson, A.; Lemmon, R.; Liberati, V.; Litvinov, Y.; Löher, B.; Lopez Herraiz, J.; Münzenberg, G.; Machado, J.; Maev, E.; Mahata, K.; Mancusi, D.; Marganiec, J.; Martinez Perez, M.; Marusov, V.; Mengoni, D.; Million, B.; Morcelle, V.; Moreno, O.; Movsesyan, A.; Nacher, E.; Najafi, M.; Nakamura, T.; Naqvi, F.; Nikolski, E.; Nilsson, T.; Nociforo, C.; Nolan, P.; Novatsky, B.; Nyman, G.; Ornelas, A.; Palit, R.; Pandit, S.; Panin, V.; Paradela, C.; Parkar, V.; Paschalis, S.; Pawłowski, P.; Perea, A.; Pereira, J.; Petrache, C.; Petri, M.; Pickstone, S.; Pietralla, N.; Pietri, S.; Pivovarov, Y.; Potlog, P.; Prokofiev, A.; Rastrepina, G.; Rauscher, T.; Ribeiro, G.; Ricciardi, M.; Richter, A.; Rigollet, C.; Riisager, K.; Rios, A.; Ritter, C.; Rodriguez Frutos, T.; Rodriguez Vignote, J.; Röder, M.; Romig, C.; Rossi, D.; Roussel-Chomaz, P.; Rout, P.; Roy, S.; Söderström, P.; Saha Sarkar, M.; Sakuta, S.; Salsac, M.; Sampson, J.; Sanchez, J.; Rio Saez, del; Sanchez Rosado, J.; Sanjari, S.; Sarriguren, P.; Sauerwein, A.; Savran, D.; Scheidenberger, C.; Scheit, H.; Schmidt, S.; Schmitt, C.; Schnorrenberger, L.; Schrock, P.; Schwengner, R.; Seddon, D.; Sherrill, B.; Shrivastava, A.; Sidorchuk, S.; Silva, J.; Simon, H.; Simpson, E.; Singh, P.; Slobodan, D.; Sohler, D.; Spieker, M.; Stach, D.; Stan, E.; Stanoiu, M.; Stepantsov, S.; Stevenson, P.; Strieder, F.; Stuhl, L.; Suda, T.; Sümmerer, K.; Streicher, B.; Taieb, J.; Takechi, M.; Tanihata, I.; Taylor, J.; Tengblad, O.; Ter-Akopian, G.; Terashima, S.; Teubig, P.; Thies, R.; Thoennessen, M.; Thomas, T.; Thornhill, J.; Thungstrom, G.; Timar, J.; Togano, Y.; Tomohiro, U.; Tornyi, T.; Tostevin, J.; Townsley, C.; Trautmann, W.; Trivedi, T.; Typel, S.; Uberseder, E.; Udias, J.; Uesaka, T.; Uvarov, L.; Vajta, Z.; Velho, P.; Vikhrov, V.; Volknandt, M.; Volkov, V.; von Neumann-Cosel, P.; von Schmid, M.; Wagner, A.; Wamers, F.; Weick, H.; Wells, D.; Westerberg, L.; Wieland, O.; Wiescher, M.; Wimmer, C.; Wimmer, K.; Winfield, J. S.; Winkel, M.; Woods, P.; Wyss, R.; Yakorev, D.; Yavor, M.; Zamora Cardona, J.; Zartova, I.; Zerguerras, T.; Zgura, M.; Zhdanov, A.; Zhukov, M.; Zieblinski, M.; Zilges, A.; Zuber, K.

2016-01-01

The nucleosynthesis of elements beyond iron is dominated by neutron captures in the s and r processes. However, 32 stable, proton-rich isotopes cannot be formed during those processes, because they are shielded from the s-process flow and r-process, β-decay chains. These nuclei are attributed to the p and rp process. For all those processes, current research in nuclear astrophysics addresses the need for more precise reaction data involving radioactive isotopes. Depending on the particular reaction, direct or inverse kinematics, forward or time-reversed direction are investigated to determine or at least to constrain the desired reaction cross sections. The Facility for Antiproton and Ion Research (FAIR) will offer unique, unprecedented opportunities to investigate many of the important reactions. The high yield of radioactive isotopes, even far away from the valley of stability, allows the investigation of isotopes involved in processes as exotic as the r or rp processes.

Chain photoreduction of CCl3F in TiO2 suspensions: enhancement induced by O2.

PubMed

Winkelmann, Kurt; Calhoun, Robert L; Mills, German

2006-12-28

Trichlorofluoromethane (CFC 11) was photoreduced in aqueous suspensions of TiO2 particles containing HCO2- ions and air. Dissolved O2 inhibited the reaction during an induction period that preceded the rapid formation of chloride ions. Reaction rates were higher in systems containing O2 as compared to analogous reactions that occurred in anaerobic suspensions. High photonic efficiencies of Cl- formation (> or =15) were achieved using suspensions with pH > or = 5. As was the case for studies with air-free suspensions, reactions are best described using a photoinitiated chain mechanism that produced CHCl2F and Cl- during the propagation steps. The enhanced yields obtained in the presence of air are attributed to the removal by O2 of electrons trapped in the oxide, which are converted first into H2O2 and then into reducing radicals that participate in the chain process. Enhanced yields of Freon photoreduction were also observed during illumination of air-free suspensions containing hydrogen peroxide, which were interpreted using a similar mechanism.

Effect of perception irregularity on chain-reaction crash in low visibility

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-06-01

We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.

Flow-through polymerase chain reaction inside a seamless 3D helical microreactor fabricated utilizing a silicone tube and a paraffin mold.

PubMed

Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon

2015-03-07

We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).

Computational study on UV curing characteristics in nanoimprint lithography: Stochastic simulation

NASA Astrophysics Data System (ADS)

Koyama, Masanori; Shirai, Masamitsu; Kawata, Hiroaki; Hirai, Yoshihiko; Yasuda, Masaaki

2017-06-01

A computational simulation model of UV curing in nanoimprint lithography based on a simplified stochastic approach is proposed. The activated unit reacts with a randomly selected monomer within a critical reaction radius. Cluster units are chained to each other. Then, another monomer is activated and the next chain reaction occurs. This process is repeated until a virgin monomer disappears within the reaction radius or until the activated monomers react with each other. The simulation model well describes the basic UV curing characteristics, such as the molecular weight distributions of the reacted monomers and the effect of the initiator concentration on the conversion ratio. The effects of film thickness on UV curing characteristics are also studied by the simulation.

On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+{sup 11}B process

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belyaev, V. S.; Krainov, V. P., E-mail: vpkrainov@mail.ru; Zagreev, B. V.

2015-07-15

Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+{sup 11}B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from {sup 11}B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+{sup 11}B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons amongmore » fusion products. Nuclear reactions that follow the p+{sup 11}B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+{sup 11}B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.« less

Open Markov Processes and Reaction Networks

ERIC Educational Resources Information Center

Swistock Pollard, Blake Stephen

2017-01-01

We begin by defining the concept of "open" Markov processes, which are continuous-time Markov chains where probability can flow in and out through certain "boundary" states. We study open Markov processes which in the absence of such boundary flows admit equilibrium states satisfying detailed balance, meaning that the net flow…

Chain-reaction crash on a highway in high visibility

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2016-05-01

We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

One-step production of long-chain hydrocarbons from waste-biomass-derived chemicals using bi-functional heterogeneous catalysts.

PubMed

Wen, Cun; Barrow, Elizabeth; Hattrick-Simpers, Jason; Lauterbach, Jochen

2014-02-21

In this study, we demonstrate the production of long-chain hydrocarbons (C8+) from 2-methylfuran (2MF) and butanal in a single step reactive process by utilizing a bi-functional catalyst with both acid and metallic sites. Our approach utilizes a solid acid for the hydroalkylation function and as a support as well as a transition metal as hydrodeoxygenation catalyst. A series of solid acids was screened, among which MCM-41 demonstrated the best combination of activity and stability. Platinum nanoparticles were then incorporated into the MCM-41. The Pt/MCM-41 catalyst showed 96% yield for C8+ hydrocarbons and the catalytic performance was stable over four reaction cycles of 20 hour each. The reaction pathways for the production of long-chain hydrocarbons is probed with a combination of infrared spectroscopy and steady-state reaction experiments. It is proposed that 2MF and butanal go through hydroalkylation first on the acid site followed by hydrodeoxygenation to produce the hydrocarbon fuels.

Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

PubMed

Bridge, Julia A

2017-01-01

The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

Bio-based phenolic-branched-chain fatty acid isomers synthesized from vegetable oils and natural monophenols using modified h+-ferrierite zeolite

USDA-ARS?s Scientific Manuscript database

A new group of phenolic branched-chain fatty acids (n-PBC-FA), hybrid molecules of natural monophenols (i.e., thymol, carvacrol and creosote) and mixed fatty acid (i.e., derived from soybean and safflower oils), were efficiently produced through a process known as arylation. The reaction involves a...

Effect of vehicular size on chain-reaction crash

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-11-01

We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

Characterization of milled solid residue from cypress liquefaction in sub- and super ethanol.

PubMed

Liu, Hua-Min; Liu, Yu-Lan

2014-01-01

Cypress liquefaction in sub- and super ethanol was carried out in an autoclave at various temperatures. Milled solid residue (MSR) was isolated from solid residue remaining from the liquefaction process, and its chemical characteristics was comparatively investigated with milled wood lignin (MWL) of cypress by sugar analysis, elemental analysis, FT-IR analysis, gel permeation chromatography, and NMR analysis. Results showed that there were two reactions (de-polymerization and re-polymerization) during the cypress liquefaction in sub- and super ethanol and the re-polymerization reactions were the main reaction at 220-260°C. Considering the stability of side-chain, the stability of lignin side-chain in cypress during liquefaction process in ethanol could be sequenced as follows: β-5>β-β'>β-O-4'. The MSR were mainly from the decomposition and re-polymerization of lignin. This study suggests that characterization of MSR provides a promising method to investigate the mechanisms of cypress liquefaction in ethanol. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

PubMed

Brzezinski, Jennifer L

2006-01-01

The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

Ionizing radiation-induced destruction of benzene and dienes in aqueous media.

PubMed

Al-Sheikhly, Mohamad; Poster, Dianne L; An, Jung-Chul; Neta, Pedatsur; Silverman, Joseph; Huie, Robert E

2006-05-01

Pulse radiolysis with spectrophotometric and conductometric detection was utilized to study the formation and reactions of radicals from benzene and dienes in aqueous solutions. The benzene OH adduct, *C6H6OH, reacts with O2 (k = 3 x 10(8) L mol(-1) s(-1)) in a reversible reaction. The peroxyl radical, HOC6H6O2*, undergoes O2*- elimination, bimolecular decay, and reaction with benzene to initiate a chain reaction, depending on the dose rate, benzene concentration, and pH. The occurrence of the chain reaction is demonstrated in low-dose-rate gamma radiolysis experiments where the consumption of O2 was monitored. 1,4-Cyclohexadiene, 1,4-hexadiene, and 1,4-pentadiene form OH-adducts and undergo H-abstraction by O*- radicals. The OH-adducts react with O2 to form peroxyl radicals. These peroxyl radicals, however, do not undergo unimolecular O2*- elimination but rather decay by second-order processes, which lead to subsequent steps of O2*- elimination.

The Synergize effect of Chain extender to Phosporic acid catalyst to the ultimate property of Soy-Polyurethane

NASA Astrophysics Data System (ADS)

Elvistia Firdaus, Flora

2016-04-01

The polyurethanes (PUs) foam were made from vegetable oil; a soybean based polyol. The foams were categorized into flexible and semi rigid. This research is manufacturally designed polyurethane foams by a process requiring the reaction of mixture of 2, 4- and 2, 6-Toluene di Isocyanate isomers, soy polyol in the presence of other ingredients. The objective of this work was to functionalized soy-polyol using phosporic acid catalyst and chain extender, study their collaborative reaction in producing ultimate property of PU foam. Correlates the foam morphology images in accordance to mechanical properties of foams.

Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

PubMed

Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

2015-01-01

Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

NASA Technical Reports Server (NTRS)

Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

1998-01-01

Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

Orientation of chain molecules in ionotropic gels: a Brownian dynamics model

NASA Astrophysics Data System (ADS)

Woelki, Stefan; Kohler, Hans-Helmut

2003-09-01

As is known from birefringence measurements, polysaccharide molecules of ionotropic gels are preferentially orientated normal to the direction of gel growth. In this paper the orientation effect is investigated by means of an off-lattice Brownian dynamics model simulating the gel formation process. The model describes the integration of a single coarse grained phantom chain into the growing gel. The equations of motion of the chain are derived. The computer simulations show that, during the process of integration, the chain is contracting normal to the direction of gel growth. A scaling relation is obtained for the degree of contraction as a function of the length parameters of the chain, the velocity of the gel formation front and the rate constant of the crosslinking reaction. It is shown that the scaling relation, if applied to the example of ionotropic copper alginate gel, leads to reasonable predictions of the time course of the degree of contraction of the alginate chains.

Self-assembly and photoluminescence evolution of hydrophilic and hydrophobic quantum dots in sol–gel processes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Ping, E-mail: mse_yangp@ujn.edu.cn; Matras-Postolek, Katarzyna; Song, Xueling

2015-10-15

Graphical abstract: Highly luminescent quantum dots (QDs) with tunable photoluminescence (PL) wavelength were assembled into various morphologies including chain, hollow spheres, fibers, and ring structures through sol–gel processes. The PL properties during assembly as investigated. - Highlights: • Highly luminescent quantum dots (QDs) were synthesized from several ligands. • The evolution of PL in self-assembly via sol–gel processes was investigated. • CdTe QDs were assembled into a chain by controlling hydrolysis and condensation reactions. • Hollow spheres, fibers, and ring structures were created via CdSe/ZnS QDs in sol–gel processes. - Abstract: Highly luminescent quantum dots (QDs) with tunable photoluminescence (PL)more » wavelength were synthesized from several ligands to investigate the PL evolution in QD self-assembly via sol–gel processes. After ligand exchange, CdTe QDs were assembled into a chain by controlling the hydrolysis and condensation reaction of 3-mercaptopropyl-trimethoxysilane. The chain was then coated with a SiO{sub 2} shell from tetraethyl orthosilicate (TEOS). Hollow spheres, fibers, and ring structures were created from CdSe/ZnS QDs via various sol–gel processes. CdTe QDs revealed red-shifted and narrowed PL spectrum after assembly compared with their initial one. In contrast, the red-shift of PL spectra of CdSe/ZnS QDs is small. By optimizing experimental conditions, SiO{sub 2} spheres with multiple CdSe/ZnS QDs were fabricated using TEOS and MPS. The QDs in these SiO{sub 2} spheres retained their initial PL properties. This result is useful for application because of their high stability and high PL efficiency of 33%.« less

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

PubMed

Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

2016-12-01

To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

Press Releases | Argonne National Laboratory

Science.gov Websites

Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

Role of catechol in the radical reduction of B-alkylcatecholboranes in presence of methanol.

PubMed

Povie, Guillaume; Villa, Giorgio; Ford, Leigh; Pozzi, Davide; Schiesser, Carl H; Renaud, Philippe

2010-02-07

Mechanistic investigations on the previously reported reduction of B-alkylcatecholboranes in the presence of methanol led to the disclosure of a new mechanism involving catechol as a reducing agent. More than just revising the mechanism of this reaction, we disclose here the surprising role of catechol, a chain breaking antioxidant, which becomes a source of hydrogen atoms in an efficient radical chain process.

ε-Poly-l-Lysine Peptide Chain Length Regulated by the Linkers Connecting the Transmembrane Domains of ε-Poly-l-Lysine Synthetase

PubMed Central

Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime

2014-01-01

ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. PMID:24907331

Transformation of soybean Gy3 gene into Artemisaarenaria mediated by corona discharge

NASA Astrophysics Data System (ADS)

Chao, Lu-meng; Na, Ri; Xue, Dan; Xu, Yongze; Liu, Teng

2013-03-01

In order to improve the protein content of desert plant, a method of genetic transformation mediated by corona discharge was established. Artemisia seeds were processed in corona electric field for 120 min at 12 kV, and then soaked in 0.1 SSC media that contained Soybean Gy3 gene DNA to incubate for 12 h at 26 °C. Finally the seeds were inoculated on the differentiation medium. Polymerase Chain Reaction (PCR) and Reverse Transcription Polymerase Chain Reaction (RT-PCR) detection showed that the Soybean Gy3 gene had been successfully introduced into genomic DNA of the regenerated plants of Artemisaarenaria. The study provided a new way for corona discharge in plant genetic modification.

Introduction to Polymer Chemistry.

ERIC Educational Resources Information Center

Harris, Frank W.

1981-01-01

Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation.

PubMed

Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum

2014-08-01

A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.

Polymerization as a Model Chain Reaction

ERIC Educational Resources Information Center

Morton, Maurice

1973-01-01

Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

Detection of tobacco rattle virus RNA in processed potato chips displaying symptoms of corky ringspot disease

USDA-ARS?s Scientific Manuscript database

A portion of genomic RNA 1 of tobacco rattle tobravirus (TRV) was amplified by reverse transcription polymerase chain reaction from each of eight processed potato chips from three different bags purchased at three locations. The positive chips all had symptoms typical of corky ringspot disease, cau...

Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins

NASA Astrophysics Data System (ADS)

Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John

2017-01-01

DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.

Presidential Green Chemistry Challenge: 2013 Greener Synthetic Pathways Award

EPA Pesticide Factsheets

Presidential Green Chemistry Challenge 2013 award winner, Life Technologies, developed a one-pot synthesis for polymerase chain reaction (PCR), which is a much more efficient process that prevents about 1.5 million pounds of hazardous waste a year.

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2014 CFR

2014-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2013 CFR

2013-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2012 CFR

2012-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

Emilio Segrè and Spontaneous Fission

Science.gov Websites

fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

Conformational Flexibility of Metazoan Fatty Acid Synthase Enables Catalysis

PubMed Central

Brignole, Edward J.; Smith, Stuart; Asturias, Francisco J.

2008-01-01

The metazoan cytosolic fatty acid synthase (FAS) contains all of the enzymes required for de novo fatty acid biosynthesis covalently linked around two reaction chambers. While the 3D architecture of FAS has been mostly defined, it is unclear how reaction intermediates can transfer between distant catalytic domains. Using single-particle electron microscopy we have identified a near continuum of conformations consistent with remarkable flexibility of FAS. The distribution of conformations was influenced by the presence of substrates and altered by different catalytic mutations suggesting a direct correlation between conformation and specific enzymatic activities. 3D reconstructions were interpreted by docking high-resolution structures of individual domains and illustrate that the substrate loading and condensation domains dramatically swing and swivel to access substrates within either reaction chamber. Concomitant rearrangement of the β-carbon processing domains synchronizes acyl-chain reduction in one chamber with acyl-chain elongation in the other. PMID:19151726

Facile preparation of cobaltocenium-containing polyelectrolyte via click chemistry and RAFT polymerization.

PubMed

Yan, Yi; Zhang, Jiuyang; Qiao, Yali; Tang, Chuanbing

2014-01-01

A facile method to prepare cationic cobaltocenium-containing polyelectrolyte is reported. Cobaltocenium monomer with methacrylate is synthesized by copper-catalyzed azide-alkyne cycloaddition (CuAAC) reaction between 2-azidoethyl methacrylate and ethynylcobaltocenium hexafluorophosphate. Further controlled polymerization is achieved by reversible addition-fragmentation chain transfer polymerization (RAFT) by using cumyl dithiobenzoate (CDB) as a chain transfer agent. Kinetic study demonstrates the controlled/living process of polymerization. The obtained side-chain cobaltocenium-containing polymer is a metal-containing polyelectrolyte that shows characteristic redox behavior of cobaltocenium. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effect of Heterogeneous Chemical Reactions on the Köhler Activation of Aqueous Organic Aerosols.

PubMed

Djikaev, Yuri S; Ruckenstein, Eli

2018-05-03

We study some thermodynamic aspects of the activation of aqueous organic aerosols into cloud droplets considering the aerosols to consist of liquid solution of water and hydrophilic and hydrophobic organic compounds, taking into account the presence of reactive species in the air. The hydrophobic (surfactant) organic molecules on the surface of such an aerosol can be processed by chemical reactions with some atmospheric species; this affects the hygroscopicity of the aerosol and hence its ability to become a cloud droplet either via nucleation or via Köhler activation. The most probable pathway of such processing involves atmospheric hydroxyl radicals that abstract hydrogen atoms from hydrophobic organic molecules located on the aerosol surface (first step), the resulting radicals being quickly oxidized by ubiquitous atmospheric oxygen molecules to produce surface-bound peroxyl radicals (second step). These two reactions play a crucial role in the enhancement of the Köhler activation of the aerosol and its evolution into a cloud droplet. Taking them and a third reaction (next in the multistep chain of relevant heterogeneous reactions) into account, one can derive an explicit expression for the free energy of formation of a four-component aqueous droplet on a ternary aqueous organic aerosol as a function of four independent variables of state of a droplet. The results of numerical calculations suggest that the formation of cloud droplets on such (aqueous hydrophilic/hydrophobic organic) aerosols is most likely to occur as a Köhler activation-like process rather than via nucleation. The model allows one to determine the threshold parameters of the system necessary for the Köhler activation of such aerosols, which are predicted to be very sensitive to the equilibrium constant of the chain of three heterogeneous reactions involved in the chemical aging of aerosols.

DFT-based prediction of reactivity of short-chain alcohol dehydrogenase

NASA Astrophysics Data System (ADS)

Stawoska, I.; Dudzik, A.; Wasylewski, M.; Jemioła-Rzemińska, M.; Skoczowski, A.; Strzałka, K.; Szaleniec, M.

2017-06-01

The reaction mechanism of ketone reduction by short chain dehydrogenase/reductase, ( S)-1-phenylethanol dehydrogenase from Aromatoleum aromaticum, was studied with DFT methods using cluster model approach. The characteristics of the hydride transfer process were investigated based on reaction of acetophenone and its eight structural analogues. The results confirmed previously suggested concomitant transfer of hydride from NADH to carbonyl C atom of the substrate with proton transfer from Tyr to carbonyl O atom. However, additional coupled motion of the next proton in the proton-relay system, between O2' ribose hydroxyl and Tyr154 was observed. The protonation of Lys158 seems not to affect the pKa of Tyr154, as the stable tyrosyl anion was observed only for a neutral Lys158 in the high pH model. The calculated reaction energies and reaction barriers were calibrated by calorimetric and kinetic methods. This allowed an excellent prediction of the reaction enthalpies (R2 = 0.93) and a good prediction of the reaction kinetics (R2 = 0.89). The observed relations were validated in prediction of log K eq obtained for real whole-cell reactor systems that modelled industrial synthesis of S-alcohols.

Process for crosslinking and extending conjugated diene-containing polymers

NASA Technical Reports Server (NTRS)

Bell, Vernon L. (Inventor); Havens, Stephen J. (Inventor)

1977-01-01

A process using a Diels-Alder reaction which increases the molecular weight and/or crosslinks polymers by reacting the polymers with bisunsaturated dienophiles is developed. The polymer comprises at least 75% by weight based on the reaction product, has a molecular weight of at least 5000 and a plurality of conjugated 1,3-diene systems incorporated into the molecular structure. A dienophile reaction with the conjugated 1,3-diene of the polymer is at least 1% by weight based on the reaction product. Examples of the polymer include polyesters, polyamides, polyethers, polysulfones and copolymers. The bisunsaturated dienophiles may include bis-maleimides, bis maleic and bis tumaric esters and amides. This method for expanding the molecular weight chains of the polymers, preferable thermoplastics, is advantageous for processing or fabricating thermoplastics. A low molecular weight thermoplastic is converted to a high molecular weight plastic having improved strength and toughness for use in the completed end use article.

Digital PCR Quantitation of Muscle Mitochondrial DNA: Age, Fiber Type, and Mutation-Induced Changes.

PubMed

Herbst, Allen; Widjaja, Kevin; Nguy, Beatrice; Lushaj, Entela B; Moore, Timothy M; Hevener, Andrea L; McKenzie, Debbie; Aiken, Judd M; Wanagat, Jonathan

2017-10-01

Definitive quantitation of mitochondrial DNA (mtDNA) and mtDNA deletion mutation abundances would help clarify the role of mtDNA instability in aging. To more accurately quantify mtDNA, we applied the emerging technique of digital polymerase chain reaction to individual muscle fibers and muscle homogenates from aged rodents. Individual fiber mtDNA content correlated with fiber type and decreased with age. We adapted a digital polymerase chain reaction deletion assay that was accurate in mixing experiments to a mutation frequency of 0.03% and quantitated an age-induced increase in deletion frequency from rat muscle homogenates. Importantly, the deletion frequency measured in muscle homogenates strongly correlated with electron transport chain-deficient fiber abundance determined by histochemical analyses. These data clarify the temporal accumulation of mtDNA deletions that lead to electron chain-deficient fibers, a process culminating in muscle fiber loss. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

ε-Poly-L-lysine peptide chain length regulated by the linkers connecting the transmembrane domains of ε-Poly-L-lysine synthetase.

PubMed

Hamano, Yoshimitsu; Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime

2014-08-01

ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Polyphosphate kinase: demonstration that short chain polyphosphate serves as a primer for the enzymatic synthesis of polyphosphate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robinson, N.A.; Wood, H.G.

1986-05-01

Polyphosphate (poly(P)) kinase, isolated from Propionibacterium shermanii, catalyzes the following reaction: poly(P/sub n/) + ATPin equilibriumpoly(P/sub n+1/) + ADP. The authors have purified this enzyme to 90% homogeneity and have shown it to be composed of 2-3 identical subunits of M/sub r/ 80,000. Investigation of the reaction mechanism by product analysis has revealed that the elongation phase is processive whereby successive elongation occurs without release of intermediate sizes until very long chains are formed. The initiation phase of synthesis has been investigated using (/sup 32/P) poly(P) primer of chain length 11-60. It is incorporated into long chain poly(P) and themore » /sup 32/P has been shown, by use of poly(P) glucokinase, to be localized at the end of the molecule. Calculation of average chain length based upon the incorporation of /sup 32/P, however, yields a value approx.3 fold higher than the value calculated by another method using poly(P) glucokinase. This result indicates that initiation of poly(P) synthesis occurs by at least one other route which does not involve short chain poly(P) primers. The effect of temperature and concentration of poly(P) primer upon the average chain length of poly(P) synthesized was also investigated. A general trend was observed in which the chain length of the synthesized poly(P) decreased as either temperature or concentration or primer was increased.« less

Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

2016-09-15

It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

Mitochondrial respiratory chain complexes as sources and targets of thiol-based redox-regulation.

PubMed

Dröse, Stefan; Brandt, Ulrich; Wittig, Ilka

2014-08-01

The respiratory chain of the inner mitochondrial membrane is a unique assembly of protein complexes that transfers the electrons of reducing equivalents extracted from foodstuff to molecular oxygen to generate a proton-motive force as the primary energy source for cellular ATP-synthesis. Recent evidence indicates that redox reactions are also involved in regulating mitochondrial function via redox-modification of specific cysteine-thiol groups in subunits of respiratory chain complexes. Vice versa the generation of reactive oxygen species (ROS) by respiratory chain complexes may have an impact on the mitochondrial redox balance through reversible and irreversible thiol-modification of specific target proteins involved in redox signaling, but also pathophysiological processes. Recent evidence indicates that thiol-based redox regulation of the respiratory chain activity and especially S-nitrosylation of complex I could be a strategy to prevent elevated ROS production, oxidative damage and tissue necrosis during ischemia-reperfusion injury. This review focuses on the thiol-based redox processes involving the respiratory chain as a source as well as a target, including a general overview on mitochondria as highly compartmentalized redox organelles and on methods to investigate the redox state of mitochondrial proteins. This article is part of a Special Issue entitled: Thiol-Based Redox Processes. Copyright © 2014 Elsevier B.V. All rights reserved.

Atomistic Model for the Polyamide Formation from β-Lactam Catalyzed by Candida Antarctica Lipase B

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baum, Iris; Elsasser, Brigitta M.; Schwab, Leendert

2011-04-01

Candida antarctica lipase B (CALB) is an established biocatalyst for a variety of transesterification, amidation, and polymerization reactions. In contrast to polyesters, polyamides are not yet generally accessible via enzymatic polymerization. In this regard, an enzyme-catalyzed ring-opening polymerization of {beta}-lactam (2-azetidinone) using CALB is the first example of an enzymatic polyamide formation yielding unbranched poly({beta}-alanine), nylon 3. The performance of this polymerization, however, is poor, considering the maximum chain length of 18 monomer units with an average length of 8, and the molecular basis of the reaction so far is not understood. We have employed molecular modeling techniques using dockingmore » tools, molecular dynamics, and QM/MM procedures to gain insight into the mechanistic details of the various reaction steps involved. As a result, we propose a catalytic cycle for the oligomerization of {beta}-lactam that rationalizes the activation of the monomer, the chain elongation by additional {beta}-lactam molecules, and the termination of the polymer chain. In addition, the processes leading to a premature chain termination are studied. Particularly, the QM/MM calculation enables an atomistic description of all eight steps involved in the catalytic cycle, which features an in situ-generated {beta}-alanine as the elongating monomer and which is compatible with the experimental findings.« less

Clonal T-Cell Receptor γ-Chain Gene Rearrangements in Differential Diagnosis of Lymphomatoid Papulosis From Skin Metastasis of Nodal Anaplastic Large-Cell Lymphoma

PubMed Central

Akilov, Oleg E.; Pillai, Raju K.; Grandinetti, Lisa M.; Kant, Jeffrey A.; Geskin, Larisa

2012-01-01

Background In patients with a history of nodal anaplastic large-cell lymphoma (ALCL), differentiation of type C lymphomatoid papulosis from cutaneous involvement of systemic ALCL may be challenging because the 2 entities may exhibit identical histologic features. Although metastatic ALCL generally carries the same clone as the primary lymphoma, expression of a distinct clone likely represents a distinct process. Observations A 54-year-old white man had a history of anaplastic lymphoma kinase 1–negative ALCL in the right inguinal lymph node 6 years ago. A complete response was achieved after 6 cycles of CHOP (cyclophosphamide, doxorubicin, vincristine [Oncovin], and prednisone administered in 21-day cycles) and radiation therapy. After 3½ years, the patient observed waxing and waning papules and nodules. Examination of the biopsy specimen revealed a dense CD30+ lymphocytic infiltrate; no evidence of systemic malignancy was evident on positron emission tomography. Although clinically the presentation was consistent with lymphomatoid papulosis, metastatic ALCL had to be excluded. Polymerase chain reaction analysis with T-cell receptor γ-chain gene rearrangement (TCR-γR) was performed on the original lymph node and new skin lesions. Results of the TCR-γR analysis were positive for clonality in both lesions. However, separate clonal processes were identified. The identification of distinct clones supported the clinical impression of lymphomatoid papulosis. Conclusion Polymerase chain reaction analysis of TCR-γR is a useful method for distinguishing different clonal processes and is recommended when differentiation of primary and secondary lymphoproliferative disorders is required. PMID:21844453

Evaluating Polarization Data

NASA Astrophysics Data System (ADS)

Ireland, D. G.

2018-07-01

A method is presented, which ensures that different polarization observables describing one reaction channel are consistent with each other. Using the connection of the observables to the same underlying reaction amplitudes, a constrained estimate of the observables is carried out using a Markov Chain Monte Carlo method. Initial results indicate that the new estimates are guaranteed to be physical, and will remove the need for artificial fudge factors when these processed data are used in subsequent fits.

On-site identification of meat species in processed foods by a rapid real-time polymerase chain reaction system.

PubMed

Furutani, Shunsuke; Hagihara, Yoshihisa; Nagai, Hidenori

2017-09-01

Correct labeling of foods is critical for consumers who wish to avoid a specific meat species for religious or cultural reasons. Therefore, gene-based point-of-care food analysis by real-time Polymerase Chain Reaction (PCR) is expected to contribute to the quality control in the food industry. In this study, we perform rapid identification of meat species by our portable rapid real-time PCR system, following a very simple DNA extraction method. Applying these techniques, we correctly identified beef, pork, chicken, rabbit, horse, and mutton in processed foods in 20min. Our system was sensitive enough to detect the interfusion of about 0.1% chicken egg-derived DNA in a processed food sample. Our rapid real-time PCR system is expected to contribute to the quality control in food industries because it can be applied for the identification of meat species, and future applications can expand its functionality to the detection of genetically modified organisms or mutations. Copyright © 2017 Elsevier Ltd. All rights reserved.

A Model of Risk Analysis in Analytical Methodology for Biopharmaceutical Quality Control.

PubMed

Andrade, Cleyton Lage; Herrera, Miguel Angel De La O; Lemes, Elezer Monte Blanco

2018-01-01

One key quality control parameter for biopharmaceutical products is the analysis of residual cellular DNA. To determine small amounts of DNA (around 100 pg) that may be in a biologically derived drug substance, an analytical method should be sensitive, robust, reliable, and accurate. In principle, three techniques have the ability to measure residual cellular DNA: radioactive dot-blot, a type of hybridization; threshold analysis; and quantitative polymerase chain reaction. Quality risk management is a systematic process for evaluating, controlling, and reporting of risks that may affects method capabilities and supports a scientific and practical approach to decision making. This paper evaluates, by quality risk management, an alternative approach to assessing the performance risks associated with quality control methods used with biopharmaceuticals, using the tool hazard analysis and critical control points. This tool provides the possibility to find the steps in an analytical procedure with higher impact on method performance. By applying these principles to DNA analysis methods, we conclude that the radioactive dot-blot assay has the largest number of critical control points, followed by quantitative polymerase chain reaction, and threshold analysis. From the analysis of hazards (i.e., points of method failure) and the associated method procedure critical control points, we conclude that the analytical methodology with the lowest risk for performance failure for residual cellular DNA testing is quantitative polymerase chain reaction. LAY ABSTRACT: In order to mitigate the risk of adverse events by residual cellular DNA that is not completely cleared from downstream production processes, regulatory agencies have required the industry to guarantee a very low level of DNA in biologically derived pharmaceutical products. The technique historically used was radioactive blot hybridization. However, the technique is a challenging method to implement in a quality control laboratory: It is laborious, time consuming, semi-quantitative, and requires a radioisotope. Along with dot-blot hybridization, two alternatives techniques were evaluated: threshold analysis and quantitative polymerase chain reaction. Quality risk management tools were applied to compare the techniques, taking into account the uncertainties, the possibility of circumstances or future events, and their effects upon method performance. By illustrating the application of these tools with DNA methods, we provide an example of how they can be used to support a scientific and practical approach to decision making and can assess and manage method performance risk using such tools. This paper discusses, considering the principles of quality risk management, an additional approach to the development and selection of analytical quality control methods using the risk analysis tool hazard analysis and critical control points. This tool provides the possibility to find the method procedural steps with higher impact on method reliability (called critical control points). Our model concluded that the radioactive dot-blot assay has the larger number of critical control points, followed by quantitative polymerase chain reaction and threshold analysis. Quantitative polymerase chain reaction is shown to be the better alternative analytical methodology in residual cellular DNA analysis. © PDA, Inc. 2018.

Silane cross-linkable ethylene-propylene elastomer compositions prepared by reactive processing

NASA Astrophysics Data System (ADS)

Kozawa, Eiji; Nakajima, Yasuo; Kim, Jae Kyung

2015-05-01

Thermoplastic Elastomers (TPEs) have received attention as the alternative materials of EPDM due to an advantage for mass production. In recent years, by the progress of polymerization technology, Ethylene-propylene Elastomer (EP), one of the TPEs, is beginning to be applied to many products because of its good properties as rubber. However, as much as a complete replacement for EPDM, it is not provided with sufficient properties. In such circumstance, we found that EP's performance properties can be further enhanced via chemical modification such as cross-linking. The advent of a newer technique, involving the grafting of organo-functional silane onto the polymer chain in the reaction extrusion process is more attractive due to various industrial advantages. Although the functionalization of the EP by silane grafting through reactive processing is very useful, the silane grafting process of EP has a difficulty. It is most likely a consequence of the nature of the PP chain scission (β-scission), which is the dominant reaction in PP when subjected to free radicals at elevated temperature during processing. Therefore, the objective of our current work is to investigate a reactive extrusion process for the silane cross-linkable EP while minimizing the degradation, as well as evaluate the properties of the modified polymer.

The Gaseous Explosive Reaction : the Effect of Pressure on the Rate of Propagation of the Reaction Zone and upon the Rate of Molecular Transformation

NASA Technical Reports Server (NTRS)

Stevens, F W

1932-01-01

This study of gaseous explosive reaction has brought out a number of important fundamental characteristics of the explosive reaction indicating that the basal processes of the transformation are much simpler and corresponds more closely to the general laws and principles of ordinary transformations than is usually supposed. The report calls attention to the point that the rate of molecular transformation within the zone was found in all cases to be proportional to pressure, that the transformation within the zone is the result of binary impacts. This result is of unusual interest in the case of the reaction of heavy hydrocarbon fuels and the reaction mechanism proposed by the recent kinetic theory of chain reactions.

A new era for homolytic aromatic substitution: replacing Bu3SnH with efficient light-induced chain reactions.

PubMed

Gurry, Michael; Aldabbagh, Fawaz

2016-04-28

Herein is a pertinent review of recent photochemical homolytic aromatic substitution (HAS) literature. Issues with using the reductant Bu3SnH in an oxidative process where the net loss of a hydrogen atom occurs is discussed. Nowadays more efficient light-induced chain reactions are used resulting in HAS becoming a synthetic mechanism of choice rivaling organometallic, transition-metal and electrophilic aromatic substitution protocols. The review includes aromatic substitution as part of a tandem or cascade reaction, Pschorr reaction, as well as HAS facilitated by ipso-substitution, and Smiles rearrangement. Recently visible-light photoredox catalysis, which is carried out at room temperature has become one of the most important means of aromatic substitution. The main photoredox catalysts used are polypyridine complexes of Ru(ii) and Ir(iii), although eosin Y is an alternative allowing metal-free HAS. Other radical initiator-free aromatic substitutions have used 9-mesityl-10-methylacridinium ion and N,N-bis(2,6-diisopropylphenyl)perylene-3,4,9,10-bis(dicarboximide) as the photoredox catalyst, UV-light, photoinduced electron-transfer, zwitterionic semiquinone radical anions, and Barton ester intermediates.

Primary photochemical processes for Pt(iv) diazido complexes prospective in photodynamic therapy of tumors.

PubMed

Shushakov, Anton A; Pozdnyakov, Ivan P; Grivin, Vjacheslav P; Plyusnin, Victor F; Vasilchenko, Danila B; Zadesenets, Andrei V; Melnikov, Alexei A; Chekalin, Sergey V; Glebov, Evgeni M

2017-07-25

Diazide diamino complexes of Pt(iv) are considered as prospective prodrugs in oxygen-free photodynamic therapy (PDT). Primary photophysical and photochemical processes for cis,trans,cis-[Pt(N 3 ) 2 (OH) 2 (NH 3 ) 2 ] and trans,trans,trans-[Pt(N 3 ) 2 (OH) 2 (NH 3 ) 2 ] complexes were studied by means of stationary photolysis, nanosecond laser flash photolysis and ultrafast kinetic spectroscopy. The process of photolysis is multistage. The first stage is the photosubstitution of an azide ligand to a water molecule. This process was shown to be a chain reaction involving redox stages. Pt(iv) and Pt(iii) intermediates responsible for the chain propagation were recorded using ultrafast kinetic spectroscopy and nanosecond laser flash photolysis. The mechanism of photosubstitution is proposed.

The actin multigene family and livestock speciation using the polymerase chain reaction.

PubMed

Fairbrother, K S; Hopwood, A J; Lockley, A K; Bardsley, R G

1998-01-01

Actins constitute a family of highly-conserved multifunctional intracellular proteins, best known as myofibrillar components in striated muscle fibres. Most vertebrate genomes contain numerous actin genes with high sequence homology in protein coding regions but considerable variability in intron number and sizes. This genetic diversity can be utilised for livestock speciation purposes. The high sequence conservation has enabled a single pair of oligonucleotides to be used to prime the polymerase chain reaction (PCR) with DNA extracted from all animals so far studied. Multiple amplification products were obtained which on gel electrophoresis constituted characteristic species-specific 'fingerprints'. The patterns were reproducible, did not vary between individuals of the same breed or between different breeds within a species, and could be generated even from heat-processed muscle held at 120 degrees C for one hour. Given the capacity of PCR to amplify relatively short sequences in highly-degraded DNA, this approach may be suitable for authentication of processed meat products.

Temperature-programmed natural convection for micromixing and biochemical reaction in a single microfluidic chamber.

PubMed

Kim, Sung-Jin; Wang, Fang; Burns, Mark A; Kurabayashi, Katsuo

2009-06-01

Micromixing is a crucial step for biochemical reactions in microfluidic networks. A critical challenge is that the system containing micromixers needs numerous pumps, chambers, and channels not only for the micromixing but also for the biochemical reactions and detections. Thus, a simple and compatible design of the micromixer element for the system is essential. Here, we propose a simple, yet effective, scheme that enables micromixing and a biochemical reaction in a single microfluidic chamber without using any pumps. We accomplish this process by using natural convection in conjunction with alternating heating of two heaters for efficient micromixing, and by regulating capillarity for sample transport. As a model application, we demonstrate micromixing and subsequent polymerase chain reaction (PCR) for an influenza viral DNA fragment. This process is achieved in a platform of a microfluidic cartridge and a microfabricated heating-instrument with a fast thermal response. Our results will significantly simplify micromixing and a subsequent biochemical reaction that involves reagent heating in microfluidic networks.

Evolution of material properties during free radical photopolymerization

NASA Astrophysics Data System (ADS)

Wu, Jiangtao; Zhao, Zeang; Hamel, Craig M.; Mu, Xiaoming; Kuang, Xiao; Guo, Zaoyang; Qi, H. Jerry

2018-03-01

Photopolymerization is a widely used polymerization method in many engineering applications such as coating, dental restoration, and 3D printing. It is a complex chemical and physical process, through which a liquid monomer solution is rapidly converted to a solid polymer. In the most common free-radical photopolymerization process, the photoinitiator in the solution is exposed to light and decomposes into active radicals, which attach to monomers to start the polymerization reaction. The activated monomers then attack Cdbnd C double bonds of unsaturated monomers, which leads to the growth of polymer chains. With increases in the polymer chain length and the average molecular weight, polymer chains start to connect and form a network structure, and the liquid polymer solution becomes a dense solid. During this process, the material properties of the cured polymer change dramatically. In this paper, experiments and theoretical modeling are used to investigate the free-radical photopolymerization reaction kinetics, material property evolution and mechanics during the photopolymerization process. The model employs the first order chemical reaction rate equations to calculate the variation of the species concentrations. The degree of monomer conversion is used as an internal variable that dictates the mechanical properties of the cured polymer at different curing states, including volume shrinkage, glass transition temperature, and nonlinear viscoelastic properties. To capture the nonlinear behavior of the cured polymer under low temperature and finite deformation, a multibranch nonlinear viscoelastic model is developed. A phase evolution model is used to describe the mechanics of the coupling between the crosslink network evolution and mechanical loading during the curing process. The comparison of the model and the experimental results indicates that the model can capture property changes during curing. The model is further applied to investigate the internal stress of a thick sample caused by volume shrinkage during photopolymerization. Changes in the conversion degree gradient and the internal stress during photopolymerization are determined using FEM simulation. The model can be extended to many photocuring processes, such as photopolymerization 3D printing, surface coating and automotive part curing processes.

Investigating the nature of palladium chain-walking in the enantioselective redox-relay Heck reaction of alkenyl alcohols.

PubMed

Hilton, Margaret J; Xu, Li-Ping; Norrby, Per-Ola; Wu, Yun-Dong; Wiest, Olaf; Sigman, Matthew S

2014-12-19

The mechanism of the redox-relay Heck reaction was investigated using deuterium-labeled substrates. Results support a pathway through a low energy palladium-alkyl intermediate that immediately precedes product formation, ruling out a tautomerization mechanism. DFT calculations of the relevant transition structures at the M06/LAN2DZ+f/6-31+G* level of theory show that the former pathway is favored by 5.8 kcal/mol. Palladium chain-walking toward the alcohol, following successive β-hydride eliminations and migratory insertions, is also supported in this study. The stereochemistry of deuterium labels is determined, lending support that the catalyst remains bound to the substrate during the relay process and that both cis- and trans-alkenes form from β-hydride elimination.

In Situ Solid-State Reactions Monitored by X-ray Absorption Spectroscopy: Temperature-Induced Proton Transfer Leads to Chemical Shifts.

PubMed

Stevens, Joanna S; Walczak, Monika; Jaye, Cherno; Fischer, Daniel A

2016-10-24

The dramatic colour and phase alteration with the solid-state, temperature-dependent reaction between squaric acid and 4,4'-bipyridine has been probed in situ with X-ray absorption spectroscopy. The electronic and chemical sensitivity to the local atomic environment through chemical shifts in the near-edge X-ray absorption fine structure (NEXAFS) revealed proton transfer from the acid to the bipyridine base through the change in nitrogen protonation state in the high-temperature form. Direct detection of proton transfer coupled with structural analysis elucidates the nature of the solid-state process, with intermolecular proton transfer occurring along an acid-base chain followed by a domino effect to the subsequent acid-base chains, leading to the rapid migration along the length of the crystal. NEXAFS thereby conveys the ability to monitor the nature of solid-state chemical reactions in situ, without the need for a priori information or long-range order. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

On the complex •OH/•O--induced free radical chemistry of arylalkylamines with special emphasis on the contribution of the alkylamine side chain.

PubMed

Szabó, László; Mile, Viktória; Tóth, Tünde; Balogh, György T; Földes, Tamás; Takács, Erzsébet; Wojnárovits, László

2017-02-01

A full account of the • OH-induced free radical chemistry of an arylalkylamine is given taking all the possible reaction pathways quantitatively into consideration. Such knowledge is indispensable when the alkylamine side chain plays a crucial role in biological activity. The fundamental reactions are investigated on the model compound N-methyl-3-phenypropylamine (MPPA), and extended to its biologically active analog, to the antidepressant fluoxetine (FLX). Pulse radiolysis techniques were applied including redox titration and transient spectral analysis supplemented with DFT calculations. The contribution of the amine moiety to the free radical-induced oxidation mechanism appeared to be appreciable. • O - was used to observe hydrogen atom abstraction events at pH 14 giving rise to the strongly reducing α-aminoalkyl radicals (∼38% of the radical yield) and to benzyl (∼4%), β-aminoalkyl (∼24%), and aminyl radicals (∼31%) of MPPA. One-electron transfer was also observed yielding aminium radicals with low efficiency (∼3%). In the • OH-induced oxidation protonated α-aminoalkyl (∼49%), β-aminoalkyl (∼27%), benzyl radicals (∼4%), and aminium radicals (∼5%) are initially generated on the side chain of MPPA at pH 6, whereas hydroxycyclohexadienyl radicals (∼15%) were also produced. These initial events are followed by complex protonation-deprotonation reactions establishing acid-base equilibria; however, these processes are limited by the transient nature of the radicals and the kinetics of the ongoing reactions. The contribution of the radicals from the side chain alkylamine substituent of FLX totals up to ∼54% of the initially available oxidant yield.

Systematic development of reduced reaction mechanisms for dynamic modeling

NASA Technical Reports Server (NTRS)

Frenklach, M.; Kailasanath, K.; Oran, E. S.

1986-01-01

A method for systematically developing a reduced chemical reaction mechanism for dynamic modeling of chemically reactive flows is presented. The method is based on the postulate that if a reduced reaction mechanism faithfully describes the time evolution of both thermal and chain reaction processes characteristic of a more complete mechanism, then the reduced mechanism will describe the chemical processes in a chemically reacting flow with approximately the same degree of accuracy. Here this postulate is tested by producing a series of mechanisms of reduced accuracy, which are derived from a full detailed mechanism for methane-oxygen combustion. These mechanisms were then tested in a series of reactive flow calculations in which a large-amplitude sinusoidal perturbation is applied to a system that is initially quiescent and whose temperature is high enough to start ignition processes. Comparison of the results for systems with and without convective flow show that this approach produces reduced mechanisms that are useful for calculations of explosions and detonations. Extensions and applicability to flames are discussed.

Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

PubMed

Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

2018-06-01

Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

Topological dynamics of optical singularities in speckle-fields induced by photorefractive scattering in a LiNbO{sub 3} : Fe crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vasil'ev, Vasilii I; Soskin, M S

2013-02-28

A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less

Dissolution of covalent adaptable network polymers in organic solvent

NASA Astrophysics Data System (ADS)

Yu, Kai; Yang, Hua; Dao, Binh H.; Shi, Qian; Yakacki, Christopher M.

2017-12-01

It was recently reported that thermosetting polymers can be fully dissolved in a proper organic solvent utilizing a bond-exchange reaction (BER), where small molecules diffuse into the polymer, break the long polymer chains into short segments, and eventually dissolve the network when sufficient solvent is provided. The solvent-assisted dissolution approach was applied to fully recycle thermosets and their fiber composites. This paper presents the first multi-scale modeling framework to predict the dissolution kinetics and mechanics of thermosets in organic solvent. The model connects the micro-scale network dynamics with macro-scale material properties: in the micro-scale, a model is developed based on the kinetics of BERs to describe the cleavage rate of polymer chains and evolution of chain segment length during the dissolution. The micro-scale model is then fed into a continuum-level model with considerations of the transportation of solvent molecules and chain segments in the system. The model shows good prediction on conversion rate of functional groups, degradation of network mechanical properties, and dissolution rate of thermosets during the dissolution. It identifies the underlying kinetic factors governing the dissolution process, and reveals the influence of different material and processing variables on the dissolution process, such as time, temperature, catalyst concentration, and chain length between cross-links.

Measurement of peroxy radicals in the urban atmosphere by PERCA-LIF technique

NASA Astrophysics Data System (ADS)

Sadanaga, Y.; Matsumoto, J.; Sakurai, K.; Kato, S.; Nomaguchi, T.; Bandow, H.; Kajii, Y.

2002-12-01

A new instrument has been developed for measuring peroxy radicals (RO2) using the Chemical Amplifier-Laser Induced Fluorescence (PERCA-LIF) technique. RO2 was converted to NO2 via a chain reaction by the addition of NO and CO in a 1/4" Teflon tube. NO2 was detected by LIF using Nd:YAG laser (532 nm, 5W at 10kHz). More selective detection of NO2 is enabled by the LIF than by luminol chemiluminescence because of free from the interference by other oxidants when using luminol. LIF technique can be more sensitive detection of NO2 than the luminol detector. Optimum conditions were investigated by varying reaction time (i.e. the length of reaction tube) and the concentrations of NO and CO. Maximum chain length of approximately 300 was obtained in dry conditions using a H2O/O2 simultaneous photolysis method. Experiments were performed to characterize the dependence of the chain length on humidity for this instrument. In August 2002, RO2 measurements were performed in Osaka using this method. Maximum concentrations of RO2 in the daytime were approximately 100 pptv. Nighttime observations were also conducted and significant concentrations of RO2 were detected just after the sunset. Existence of formation processes in the dark condition was investigated.

The Role of the Side Chain on the Performance of N-type Conjugated Polymers in Aqueous Electrolytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giovannitti, Alexander; Maria, Iuliana P.; Hanifi, David

Here, we report a design strategy that allows the preparation of solution processable n-type materials from low boiling point solvents for organic electrochemical transistors (OECTs). The polymer backbone is based on NDI-T2 copolymers where a branched alkyl side chain is gradually exchanged for a linear ethylene glycol-based side chain. A series of random copolymers was prepared with glycol side chain percentages of 0, 10, 25, 50, 75, 90, and 100 with respect to the alkyl side chains. These were characterized to study the influence of the polar side chains on interaction with aqueous electrolytes, their electrochemical redox reactions, and performancemore » in OECTs when operated in aqueous electrolytes. We observed that glycol side chain percentages of >50% are required to achieve volumetric charging, while lower glycol chain percentages show a mixed operation with high required voltages to allow for bulk charging of the organic semiconductor. A strong dependence of the electron mobility on the fraction of glycol chains was found for copolymers based on NDI-T2, with a significant drop as alkyl side chains are replaced by glycol side chains.« less

The Role of the Side Chain on the Performance of N-type Conjugated Polymers in Aqueous Electrolytes.

PubMed

Giovannitti, Alexander; Maria, Iuliana P; Hanifi, David; Donahue, Mary J; Bryant, Daniel; Barth, Katrina J; Makdah, Beatrice E; Savva, Achilleas; Moia, Davide; Zetek, Matyáš; Barnes, Piers R F; Reid, Obadiah G; Inal, Sahika; Rumbles, Garry; Malliaras, George G; Nelson, Jenny; Rivnay, Jonathan; McCulloch, Iain

2018-05-08

We report a design strategy that allows the preparation of solution processable n-type materials from low boiling point solvents for organic electrochemical transistors (OECTs). The polymer backbone is based on NDI-T2 copolymers where a branched alkyl side chain is gradually exchanged for a linear ethylene glycol-based side chain. A series of random copolymers was prepared with glycol side chain percentages of 0, 10, 25, 50, 75, 90, and 100 with respect to the alkyl side chains. These were characterized to study the influence of the polar side chains on interaction with aqueous electrolytes, their electrochemical redox reactions, and performance in OECTs when operated in aqueous electrolytes. We observed that glycol side chain percentages of >50% are required to achieve volumetric charging, while lower glycol chain percentages show a mixed operation with high required voltages to allow for bulk charging of the organic semiconductor. A strong dependence of the electron mobility on the fraction of glycol chains was found for copolymers based on NDI-T2, with a significant drop as alkyl side chains are replaced by glycol side chains.

The Role of the Side Chain on the Performance of N-type Conjugated Polymers in Aqueous Electrolytes

DOE PAGES

Giovannitti, Alexander; Maria, Iuliana P.; Hanifi, David; ...

2018-04-24

Here, we report a design strategy that allows the preparation of solution processable n-type materials from low boiling point solvents for organic electrochemical transistors (OECTs). The polymer backbone is based on NDI-T2 copolymers where a branched alkyl side chain is gradually exchanged for a linear ethylene glycol-based side chain. A series of random copolymers was prepared with glycol side chain percentages of 0, 10, 25, 50, 75, 90, and 100 with respect to the alkyl side chains. These were characterized to study the influence of the polar side chains on interaction with aqueous electrolytes, their electrochemical redox reactions, and performancemore » in OECTs when operated in aqueous electrolytes. We observed that glycol side chain percentages of >50% are required to achieve volumetric charging, while lower glycol chain percentages show a mixed operation with high required voltages to allow for bulk charging of the organic semiconductor. A strong dependence of the electron mobility on the fraction of glycol chains was found for copolymers based on NDI-T2, with a significant drop as alkyl side chains are replaced by glycol side chains.« less

10 CFR 810.3 - Definitions.

Code of Federal Regulations, 2014 CFR

2014-01-01

... “production accelerator” and which is designed or used for the purpose of producing or processing special... means an agreement with another nation or group of nations concluded under sections 123 or 124 of the..., designed or used to sustain nuclear fission in a self-supporting chain reaction. Open meeting means a...

Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

ERIC Educational Resources Information Center

Robertson, Amber L.; Phillips, Allison R.

2008-01-01

Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel…

Cutting Up Text To Make Moveable, Magnetic Diagrams: A Way of Teaching and Assessing Biological Processes.

ERIC Educational Resources Information Center

Britton, Lynda A.; Wandersee, James H.

1997-01-01

Describes a method of cutting up pages in texts to make moveable, magnetic cards that can be used for instruction and assessment. Uses the diagrammatic illustrations associated with the complicated biotechnology procedures of the polymerase chain reaction and restriction fragment length polymorphism. (JRH)

Optimization of the performance of the polymerase chain reaction in silicon-based microstructures.

PubMed Central

Taylor, T B; Winn-Deen, E S; Picozza, E; Woudenberg, T M; Albin, M

1997-01-01

We have demonstrated the ability to perform real-time homogeneous, sequence specific detection of PCR products in silicon microstructures. Optimal design/ processing result in equivalent performance (yield and specificity) for high surface-to-volume silicon structures as compared to larger volume reactions in polypropylene tubes. Amplifications in volumes as small as 0.5 microl and thermal cycling times reduced as much as 5-fold from that of conventional systems have been demonstrated for the microstructures. PMID:9224619

Process for the preparation of fluorine containing crosslinked elastomeric polytriazine and product so produced

NASA Technical Reports Server (NTRS)

Rosser, R. W.; Korus, R. A. (Inventor)

1980-01-01

Crosslinking elastomeric polytriazines are prepared by a 4 step procedure which consists of (1) forming a poly(imidoylamidine) by the reaction, under reflux conditions, of anhydrous ammonia with certain perfluorinated alkyl or alkylether dinitriles; (2) forming a linear polytriazine by cyclizing the imidoylamidine linkages by reaction with certain perfluorinated alkyl or alkylether acid anhydrides or halides; (3) extending the linear polytriazine chain by further refluxing in anhydrous ammonia; and (4) heating to cyclize the new imidoylamidine and thereby crosslink the polymer.

Ubiquitin Chains Modified by the Bacterial Ligase SdeA Are Protected from Deubiquitinase Hydrolysis.

PubMed

Puvar, Kedar; Zhou, Yiyang; Qiu, Jiazhang; Luo, Zhao-Qing; Wirth, Mary J; Das, Chittaranjan

2017-09-12

The SidE family of Legionella pneumophila effectors is a unique group of ubiquitin-modifying enzymes. Along with catalyzing NAD + -dependent ubiquitination of certain host proteins independent of the canonical E1/E2/E3 pathway, they have also been shown to produce phosphoribosylated free ubiquitin. This modified ubiquitin product is incompatible with conventional E1/E2/E3 ubiquitination processes, with the potential to lock down various cellular functions that are dependent on ubiquitin signaling. Here, we show that in addition to free ubiquitin, Lys63-, Lys48-, Lys11-, and Met1-linked diubiquitin chains are also modified by SdeA in a similar fashion. Both the proximal and distal ubiquitin moieties are targeted in the phosphoribosylation reaction. Furthermore, this renders the ubiquitin chains unable to be processed by a variety of deubiquitinating enzymes. These observations broaden the scope of SdeA's modulatory functions during Legionella infection.

Non-equilibrium kinetics of plasma-assisted combustion: the role of electronically excited atoms and molecules

NASA Astrophysics Data System (ADS)

Popov, Nikolay

2016-09-01

A review of experimental and theoretical investigations of the effect of electronically excited atoms and molecules on the induction delay time and on the shift of the ignition temperature threshold of combustible mixtures is presented. At relatively low initial gas temperature, the effect of excited O(1D) atoms on the oxidation and reforming of combustible mixtures is quite significant due to the high rates of reactions of O(1D) atoms with hydrogen and hydrocarbon molecules. The singlet oxygen molecules, O2(a1Δg) , participate both in chain initiation and chain branching reactions, but the effect of O2(a1Δg) in the ignition processes is generally less important compared to the oxygen atoms. To reduce the ignition delay time and decrease the temperature threshold of fuel-air mixtures, the use of gas discharges with relatively high E/N values is recommended. In this case the reactions of electronically excited N2(A3Σu+ , B3πg , C3πu , a'1Σu-) molecules, and atomic particles in ground and electronically excited states are extremely important. The energy stored in electronic excitation of atoms and molecules is spent on the additional dissociation of oxygen and fuel molecules, on the fast gas heating, and finally to the triggering of chain branching reactions. This work was partially supported by AOARD AFOSR, FA2386-13-1-4064 grant and Linked International Laboratory LIA KaPPA (France-Russia).

Acetylene chain reaction on hydrogenated boron nitride monolayers: a density functional theory study.

PubMed

Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru

2017-11-28

Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.

Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

PubMed

Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

2008-12-01

One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

Gelation-driven selection in dynamic covalent C 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 C/CN exchange.

PubMed

Liang, Chunshuang; Kulchat, Sirinan; Jiang, Shimei; Lehn, Jean-Marie

2017-10-01

Knoevenagel barbiturate derivatives bearing long alkyl chains were proven to form organogels in suitable solvents based on supramolecular interactions. Their reaction with imines allows for component exchange through CC/CN recombination. The effect of various parameters (solvents, chain length, and temperature) on the CC/CN exchange reaction has been studied. Mixing Knoevenagel compound K and imine I-16 in a 1 : 1 ratio generated a constitutional dynamic library containing the four constituents K , I-16 , K'-16 , and I' . The reversible exchange reaction was monitored by 1 H-NMR, showing marked changes in the fractions of the four constituents on sol-gel interconversion as a function of temperature. The library composition changed from statistical distribution of the four constituents in the sol state to selective amplification of the gel forming K'-16 constituent together with that of its agonist I' . The process amounts to self-organization driven component selection in a constitutional dynamic organogel system undergoing gelation. This process displays up-regulation of the gel-forming constituent by component redistribution through reversible covalent connections.

Supplement to Theory of Neutron Chain Reactions

DOE R&D Accomplishments Database

Weinberg, Alvin M.; Noderer, L. C.

1952-05-26

General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

PubMed

Zhou, Yu; Pearson, John E; Auerbach, Anthony

2005-12-01

We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

Effects of a Protic Ionic Liquid on the Reaction Pathway during Non-Aqueous Sol–Gel Synthesis of Silica: A Raman Spectroscopic Investigation

PubMed Central

Martinelli, Anna

2014-01-01

The reaction pathway during the formation of silica via a two-component “non-aqueou” sol-gel synthesis is studied by in situ time-resolved Raman spectroscopy. This synthetic route is followed with and without the addition of the protic ionic liquid 1-ethylimidazolium bis(trifluoromethanesulfonyl)imide (C2HImTFSI) in order to investigate its effect on the reaction pathway. We demonstrate that Raman spectroscopy is suitable to discriminate between different silica intermediates, which are produced and consumed at different rates with respect to the point of gelation. We find that half-way to gelation monomers and shorter chains are the most abundant silica species, while the formation of silica rings strongly correlates to the sol-to-gel transition. Thus, curling up of linear chains is here proposed as a plausible mechanism for the formation of small rings. These in turn act as nucleation sites for the condensation of larger rings and thus the formation of the open and polymeric silica network. We find that the protic ionic liquid does not change the reaction pathway per se, but accelerates the cyclization process, intermediated by the faster inclusion of monomeric species. PMID:24743891

Markov chain aggregation and its applications to combinatorial reaction networks.

PubMed

Ganguly, Arnab; Petrov, Tatjana; Koeppl, Heinz

2014-09-01

We consider a continuous-time Markov chain (CTMC) whose state space is partitioned into aggregates, and each aggregate is assigned a probability measure. A sufficient condition for defining a CTMC over the aggregates is presented as a variant of weak lumpability, which also characterizes that the measure over the original process can be recovered from that of the aggregated one. We show how the applicability of de-aggregation depends on the initial distribution. The application section is devoted to illustrate how the developed theory aids in reducing CTMC models of biochemical systems particularly in connection to protein-protein interactions. We assume that the model is written by a biologist in form of site-graph-rewrite rules. Site-graph-rewrite rules compactly express that, often, only a local context of a protein (instead of a full molecular species) needs to be in a certain configuration in order to trigger a reaction event. This observation leads to suitable aggregate Markov chains with smaller state spaces, thereby providing sufficient reduction in computational complexity. This is further exemplified in two case studies: simple unbounded polymerization and early EGFR/insulin crosstalk.

Controlled grafting of comb copolymer brushes on poly(tetrafluoroethylene) films by surface-initiated living radical polymerizations.

PubMed

Yu, W H; Kang, E T; Neoh, K G

2005-01-04

Surface modification of poly(tetrafluoroethylene) (PTFE) films by well-defined comb copolymer brushes was carried out. Peroxide initiators were generated directly on the PTFE film surface via radio frequency Ar plasma pretreatment, followed by air exposure. Poly(glycidyl methacrylate) (PGMA) brushes were first prepared by surface-initiated reversible addition-fragmentation chain transfer polymerization from the peroxide initiators on the PTFE surface in the presence of a chain transfer agent. Kinetics study revealed a linear increase in the graft concentration of PGMA with the reaction time, indicating that the chain growth from the surface was consistent with a "controlled" or "living" process. alpha-Bromoester moieties were attached to the grafted PGMA by reaction of the epoxide groups with 2-bromo-2-methylpropionic acid. The comb copolymer brushes were subsequently prepared via surface-initiated atom transfer radical polymerization of two hydrophilic vinyl monomers, including poly(ethylene glycol) methyl ether methacrylate and sodium salt of 4-styrenesulfonic acid. The chemical composition of the modified PTFE surfaces was characterized by X-ray photoelectron spectroscopy.

An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.

PubMed

Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján

2016-02-20

In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.

Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

PubMed

Umamaheswari, A; Venkateswarlu, K

2004-06-01

Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Real-Time PCR (qPCR) Primer Design Using Free Online Software

ERIC Educational Resources Information Center

Thornton, Brenda; Basu, Chhandak

2011-01-01

Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

Technical Application of Nuclear Fission

NASA Astrophysics Data System (ADS)

Denschlag, J. O.

The chapter is devoted to the practical application of the fission process, mainly in nuclear reactors. After a historical discussion covering the natural reactors at Oklo and the first attempts to build artificial reactors, the fundamental principles of chain reactions are discussed. In this context chain reactions with fast and thermal neutrons are covered as well as the process of neutron moderation. Criticality concepts (fission factor η, criticality factor k) are discussed as well as reactor kinetics and the role of delayed neutrons. Examples of specific nuclear reactor types are presented briefly: research reactors (TRIGA and ILL High Flux Reactor), and some reactor types used to drive nuclear power stations (pressurized water reactor [PWR], boiling water reactor [BWR], Reaktor Bolshoi Moshchnosti Kanalny [RBMK], fast breeder reactor [FBR]). The new concept of the accelerator-driven systems (ADS) is presented. The principle of fission weapons is outlined. Finally, the nuclear fuel cycle is briefly covered from mining, chemical isolation of the fuel and preparation of the fuel elements to reprocessing the spent fuel and conditioning for deposit in a final repository.

Cell death in a harmful algal bloom causing species Alexandrium tamarense upon an algicidal bacterium induction.

PubMed

Zhang, Huajun; Lv, Jinglin; Peng, Yun; Zhang, Su; An, Xinli; Xu, Hong; Zhang, Jun; Tian, Yun; Zheng, Wei; Zheng, Tianling

2014-09-01

Harmful algal blooms occur throughout the world, destroying aquatic ecosystems and threatening human health. The culture supernatant of the marine algicidal bacteria DHQ25 was able to lysis dinoflagellate Alexandrium tamarense. Loss of photosynthetic pigments, accompanied by a decline in Photosystem II (PSII) photochemical efficiency (Fv/Fm), in A. tamarense was detected under bacterial supernatant stress. Transmission electron microscope analysis showed obvious morphological modifications of chloroplast dismantling as a part of the algicidal process. The PSII electron transport chain was seriously blocked, with its reaction center damaged. This damage was detected in a relative transcriptional level of psbA and psbD genes, which encode the D1 and D2 proteins in the PSII reaction center. And the block in the electron transport chain of PSII might generate excessive reactive oxygen species (ROS) which could destroy the membrane system and pigment synthesis and activated enzymic antioxidant systems including superoxide dismutase (SOD) and catalase (CAT). This study indicated that marine bacteria with indirect algicidal activity played an important role in the changes of photosynthetic process in a harmful algal bloom species.

A multiple multicomponent approach to chimeric peptide-peptoid podands.

PubMed

Rivera, Daniel G; León, Fredy; Concepción, Odette; Morales, Fidel E; Wessjohann, Ludger A

2013-05-10

The success of multi-armed, peptide-based receptors in supramolecular chemistry traditionally is not only based on the sequence but equally on an appropriate positioning of various peptidic chains to create a multivalent array of binding elements. As a faster, more versatile and alternative access toward (pseudo)peptidic receptors, a new approach based on multiple Ugi four-component reactions (Ugi-4CR) is proposed as a means of simultaneously incorporating several binding and catalytic elements into organizing scaffolds. By employing α-amino acids either as the amino or acid components of the Ugi-4CRs, this multiple multicomponent process allows for the one-pot assembly of podands bearing chimeric peptide-peptoid chains as appended arms. Tripodal, bowl-shaped, and concave polyfunctional skeletons are employed as topologically varied platforms for positioning the multiple peptidic chains formed by Ugi-4CRs. In a similar approach, steroidal building blocks with several axially-oriented isocyano groups are synthesized and utilized to align the chimeric chains with conformational constrains, thus providing an alternative to the classical peptido-steroidal receptors. The branched and hybrid peptide-peptoid appendages allow new possibilities for both rational design and combinatorial production of synthetic receptors. The concept is also expandable to other multicomponent reactions. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Circulating polymerase chain reaction chips utilizing multiple-membrane activation

NASA Astrophysics Data System (ADS)

Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

2007-02-01

This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

Quantum Mechanics and Molecular Mechanics Study of the Catalytic Mechanism of Human AMSH-LP Domain Deubiquitinating Enzymes.

PubMed

Zhu, Wenyou; Liu, Yongjun; Ling, Baoping

2015-08-25

Deubiquitinating enzymes (DUBs) catalyze the cleavage of the isopeptide bond in polyubiquitin chains to control and regulate the deubiquitination process in all known eukaryotic cells. The human AMSH-LP DUB domain specifically cleaves the isopeptide bonds in the Lys63-linked polyubiquitin chains. In this article, the catalytic mechanism of AMSH-LP has been studied using a combined quantum mechanics and molecular mechanics method. Two possible hydrolysis processes (Path 1 and Path 2) have been considered. Our calculation results reveal that the activation of Zn(2+)-coordinated water molecule is the essential step for the hydrolysis of isopeptide bond. In Path 1, the generated hydroxyl first attacks the carbonyl group of Gly76, and then the amino group of Lys63 is protonated, which is calculated to be the rate limiting step with an energy barrier of 13.1 kcal/mol. The energy barrier of the rate limiting step and the structures of intermediate and product are in agreement with the experimental results. In Path 2, the protonation of amino group of Lys63 is prior to the nucleophilic attack of activated hydroxyl. The two proton transfer processes in Path 2 correspond to comparable overall barriers (33.4 and 36.1 kcal/mol), which are very high for an enzymatic reaction. Thus, Path 2 can be ruled out. During the reaction, Glu292 acts as a proton transfer mediator, and Ser357 mainly plays a role in stabilizing the negative charge of Gly76. Besides acting as a Lewis acid, Zn(2+) also influences the reaction by coordinating to the reaction substrates (W1 and Gly76).

Application of the BAX for screening/genus Listeria polymerase chain reaction system for monitoring Listeria species in cold-smoked fish and in the smoked fish processing environment.

PubMed

Norton, D M; McCamey, M; Boor, K J; Wiedmann, M

2000-03-01

The cold-smoked fish industry was used as a model for the development of a system for monitoring Listeria spp. in foods and in the food processing environment. A total of 214 samples including raw fish, fish during the cold-smoking process, finished product, and environmental samples were collected from three processing facilities over two visits to each facility. Samples were screened for Listeria spp. using the BAX for Screening/genus Listeria polymerase chain reaction system (PCR) and by culture. Listeria spp., confirmed by the API Listeria test strip or by a PCR assay targeting the L. monocytogenes hlyA gene, were isolated from a total of 89 (41.6%) samples. Of these, 80 samples also tested positive for Listeria spp. using the BAX system. Specifically, 42 (55.3%) environmental samples (n = 76), 11 (25.6%) raw materials samples (n = 43), 20 (35.1%) samples from fish in various stages of processing (n = 57), and 7 (18.4%) finished product samples (n = 38) tested positive for Listeria spp. using the BAX system. Five (4.0%) of the 125 culture-negative samples yielded BAX system-positive results. Listeria isolates from each of nine culture-positive/BAX system-negative samples yielded a positive reaction when tested in pure culture by the BAX system, suggesting that our false-negative results were likely due to the presence of low Listeria numbers in the initial enrichment as opposed to nonreacting isolates. The employment of alternative enrichment protocols, such as the two-step enrichment recommended by the manufacturer, may increase the sensitivity of the assay.

Colorimetric detection of mercury ion based on unmodified gold nanoparticles and target-triggered hybridization chain reaction amplification

NASA Astrophysics Data System (ADS)

Wang, Qing; Yang, Xiaohan; Yang, Xiaohai; Liu, Pei; Wang, Kemin; Huang, Jin; Liu, Jianbo; Song, Chunxia; Wang, Jingjing

2015-02-01

A novel unmodified gold nanoparticles (AuNPs)-based colorimetric strategy for label-free, specific and sensitive mercury ion (Hg2+) detection was demonstrated by using thymine-Hg2+-thymine (T-Hg2+-T) recognition mechanism and hybridization chain reaction (HCR) amplification strategy. In this protocol, a structure-switching probe (H0) was designed to recognize Hg2+ and then propagated a chain reaction of hybridization events between two other hairpin probes (H1 and H2). In the absence of Hg2+, all hairpin probes could stably coexist in solution, the exposed sticky ends of hairpin probes were capable of stabilizing AuNPs. As a result, salt-induced AuNPs aggregation could be effectively prevented. In the presence of Hg2+, thymine bases of H0 could specifically interact with Hg2+ to form stable T-Hg2+-T complex. Consequently, the hairpin structure of H0 probe was changed. As H1/H2 probes were added, the HCR process could be triggered and nicked double-helixes were formed. Since it was difficult for the formed nicked double-helixes to inhibit salt-induced AuNPs aggregation, a red-to-blue color change was observed in the colloid solution as the salt concentration increased. With the elegant amplification effect of HCR, a detection limit of around 30 nM was achieved (S/N = 3), which was about 1-2 orders of magnitudes lower than that of previous unmodified AuNPs-based colorimetric methods. By using the T-Hg2+-T recognition mechanism, high selectivity was also obtained. As an unmodified AuNPs-based colorimetric strategy, the system was simple in design, convenient in operation, and eliminated the requirements of separation processes, chemical modifications, and sophisticated instrumentations.

Initiation reactions in acetylene pyrolysis

DOE PAGES

Zador, Judit; Fellows, Madison D.; Miller, James A.

2017-05-10

In gas-phase combustion systems the interest in acetylene stems largely from its role in molecular weight growth processes. The consensus is that above 1500 K acetylene pyrolysis starts mainly with the homolytic fission of the C–H bond creating an ethynyl radical and an H atom. However, below ~1500 K this reaction is too slow to initiate the chain reaction. It has been hypothesized that instead of dissociation, self-reaction initiates this process. Nevertheless, rigorous theoretical or direct experimental evidence is lacking, to an extent that even the molecular mechanism is debated in the literature. In this work we use rigorous abmore » initio transition-state theory master equation methods to calculate pressure- and temperature-dependent rate coefficients for the association of two acetylene molecules and related reactions. We establish the role of vinylidene, the high-energy isomer of acetylene in this process, compare our results with available experimental data, and assess the competition between the first-order and second-order initiation steps. As a result, we also show the effect of the rapid isomerization among the participating wells and highlight the need for time-scale analysis when phenomenological rate coefficients are compared to observed time scales in certain experiments.« less

Peroxy radical measurements with NCAR's chemical amplifier

NASA Technical Reports Server (NTRS)

Cantrell, Christopher; Shetter, Richard; Calvert, Jack G.

1994-01-01

The present NCAR instrument for HO2/RO2 measurements has been described previously. It is based on the reactions involving HO2, RO2, and HO radicals with CO and NO. Since (HO2) + (RO2) + (HO) is much greater than (HO) for most atmospheres, it is useful as a peroxy radical detector. Operation of the instrument depends on the creation of a chemical chain reaction which is initiated as HO2 and RO2 radicals in ambient air encounter added NO gas; this forms an NO2 molecule and an HO or RO radical: HO2(RO2) + NO yields HO(RO) + NO2. RO radicals react relatively efficiently with O2 to form an HO2 radical, and subsequently an HO-radical, by reaction with NO. CO gas added to the reaction chamber during part of the operating cycle, recycles the HO to HO2; HO + CO (+O2) yields HO2 + CO2. The reaction sequence may form several hundred NO2 molecules per HO2 (RO2) originally present, before chain termination occurs. The added CO is replaced by N2 addition periodically so that the chain reaction is suppressed, and a 'blank' signal resulting from NO2, O3 and possibly other NO2-forming species (non-chain processes) in ambient air is recorded. The difference between the signal with and without CO is proportional to the peroxy radical concentration. The NO2 produced is monitored using a sensitive luminol chemiluminescence detector system. In the NCAR instrument the length of the amplification chain is determined using a stable source of HO2 radicals (H2O2 thermal decomposition); the ratio of the signal seen with CO present to that with N2 present gives the sensitivity of the instrument to HO2 (molecules of NO2 formed/peroxy radical). The instrument is automated to carry out in hourly repeated cycles: (1) chain length determination; (2) NO2 calibration; and (3) linearity check on the response of signals. One minute averages of signals are normally recorded. The sensitivity of the instrument to detect peroxy radicals is in the pptv range. The present instrument has operated continuously (24 hr/day) in the field studies which extended over a period of several weeks. The major advantages of this instrument are as follows: (1) its relative simplicity; (2) low power requirements; and (3) its rapid response to all types of peroxy radicals--HO2, CH3O2 and the higher alkyl and acyl peroxy radicals; however not all RO2 species generate HO2 radicals with perfect efficiency and hence have somewhat lower response/molecule than HO2 radicals.

[The development and implementation of polymerase chain reaction to detect in real-time operation mode yersinia pestis in field material].

PubMed

Afanas'ev, M V; Chipanin, E V; Shestakov, V E; Denisov, A V; Fomina, L A; Ostiak, A S; Balakhonov, S V

2013-03-01

The article presents the results of development and practical implementation of system of polymerase chain reaction testing in real-time operation mode to detect agent of plague infield material. In laboratory conditions the system demonstrated good results and hence it was applied in conditions of field laboratory of epidemiologic team during planned epizootologic examination of Gorno-Altaisk hot spot of plague. The sampling consisted of more than 1400 objects. It was demonstrated that high sensitivity and specificity is immanent to proposed system. The adaptation of the system to the real time amplifier "Smart Cycler" (Cephid, USA) having some specific technical characteristics makes it possible to consider the proposed test-system as an effective sensitive and precise instrument for screening studies in the process of regular epizootologic examinations of hot spots of plague.

Polymerase chain reaction: A molecular diagnostic tool in periodontology

PubMed Central

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

Polymerase chain reaction: A molecular diagnostic tool in periodontology.

PubMed

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

Theory and applications of the polymerase chain reaction.

PubMed

Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

1990-04-01

The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

Sulfur Dioxide Accelerates the Heterogeneous Oxidation Rate of Organic Aerosol by Hydroxyl Radicals

DOE PAGES

Richards-Henderson, Nicole K.; Goldstein, Allen H.; Wilson, Kevin R.

2016-03-08

There remains considerable uncertainty in how anthropogenic gas phase emissions alter the oxidative aging of organic aerosols in the troposphere. Here we observe a 10-20 fold acceleration in the effective heterogeneous OH oxidation rate of organic aerosol in the presence of SO 2. This acceleration originates from the radical chain reactions propagated by alkoxy radicals, which are formed efficiently inside the particle by the reaction of peroxy radicals with SO 2. As the OH approaches atmospheric concentrations, the radical chain length increases, transforming the aerosol at rates predicted to be up to 10 times the OH-aerosol collision frequency. Model predictions,more » constrained by experiments over orders of magnitude changes in [OH] and [SO 2], suggest that in polluted regions the heterogeneous processing of organic aerosols by OH ([SO 2] ≥ 40 ppb) occur on similar time scales as analogous gas-phase oxidation reactions. These results provide evidence for a previously unidentified mechanism by which organic aerosol oxidation is enhanced by anthropogenic gas phase emissions. (Chemical Equation Presented).« less

Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico.

PubMed

Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M

1993-01-01

A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

Forecasting Science and Technology for the Department of Defense

DTIC Science & Technology

2009-12-01

Watson and Francis Crick announced that they had elucidated the structure of DNA and had therefore “discovered the secret of life.” While this was a...an organic chemist, figured out a process by which very small quantities of DNA could be amplified with high fidelity. This process, known as...polymerase chain reaction (PCR), for the first time, allowed scientists to produce DNA in large quantities. Roughly during this period, Leroy Hood and

A screening method for the detection of the 35S promoter and the nopaline synthase terminator in genetically modified organisms in a real-time multiplex polymerase chain reaction using high-resolution melting-curve analysis.

PubMed

Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko

2009-11-01

To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.

Copolymer Synthesis and Characterization by Post-Polymerization Modification

NASA Astrophysics Data System (ADS)

Galvin, Casey James

This PhD thesis examines the physical behavior of surface-grafted polymer assemblies (SGPAs) derived from post-polymerization modification (PPM) reactions in aqueous and vapor enriched environments, and offers an alternative method of creating SGPAs using a PPM approach. SGPAs comprise typically polymer chains grafted covalently to solid substrates. These assemblies show promise in a number of applications and technologies due to the stability imparted by the covalent graft and ability to modify interfacial properties and stability. SGPAs also offer a set of rich physics to explore in fundamental investigations as a result of confining macromolecules to a solid substrate. PPM reactions (also called polymer analogous reactions) apply small molecule organic chemistry reactions to the repeat units of polymer chains in order to generate new chemistries. By applying a PPM strategy to SGPAs, a wide variety of functional groups can be introduced into a small number of well-studied and well-behaved model polymer systems. This approach offers the advantage of holding constant other properties of the SGPA (e.g., molecular weight, MW, and grafting density, sigma) to isolate the effect of chemistry on physical behavior. Using a combination of PPM and fabrication methods that facilitate the formation of SPGAs with position-dependent gradual variation of sigma on flat impenetrable substrate, the influence of polymer chemistry and sigma is examined on the stability of weak polyelectrolyte brushes in aqueous environments at different pH levels. Degrafting of polymer chains in SGPAs exhibits a complex dependence on side chain chemistry, sigma, pH and the charge fraction (alpha) within the brush. Results of these experiments support a proposed mechanism of degrafting, wherein extension of the grafted chains away from the substrate generates tension along the polymer backbone, which activates the grafting chemistry for hydrolysis. The implications of these findings are important in developing technologies that use SGPAs in aqueous environments, and point to a need for potential alternative grafting chemistries. The behavior of SGPAs in vapor environments remains an underexplored phenomenon. By changing systematically the chemistry of SGPAs derived from a parent sample, the influence of side chain functional groups on the swelling of weak and strong polyelectrolyte brushes in the presence of water, methanol and ethanol vapors is explored. The extent of swelling and solvent uptake depends strongly on the chemistry in the polymer side chain and of the solvent. Despite bearing a permanent electrostatic charge in the side chain, the strong polyelectrolyte brushes exhibit no behavior typical of polyelectrolytes in water due to no dissociation of the counterion. Of particular interest is the behavior in humid environments of an SGPA bearing a zwitterionic group in its side chain, which results in exposure of electrostatic charges without counterions. Using substrates bearing the aforementioned sigma gradient of polymeric grafts, evidence of inter- and intramolecular complex formation is presented. Finally, a method of developing SGPAs by polymerizing bulk polymer chains through surface-grafted monomers (SGMs) is described. The SGMs are incorporated onto a solid substrate using the same PPM reaction employed in the degrafting and vapor swelling experiments, highlighting the versatility of PPM. The thickness of these SGPAs is correlated to the bulk polymer chains MW, suggesting this technique can be used in existing industrial bulk polymerization processes.

Second-Order Biomimicry: In Situ Oxidative Self-Processing Converts Copper(I)/Diamine Precursor into a Highly Active Aerobic Oxidation Catalyst.

PubMed

McCann, Scott D; Lumb, Jean-Philip; Arndtsen, Bruce A; Stahl, Shannon S

2017-04-26

A homogeneous Cu-based catalyst system consisting of [Cu(MeCN) 4 ]PF 6 , N , N '-di- tert -butylethylenediamine (DBED), and p -( N , N -dimethylamino)pyridine (DMAP) mediates efficient aerobic oxidation of alcohols. Mechanistic study of this reaction shows that the catalyst undergoes an in situ oxidative self-processing step, resulting in conversion of DBED into a nitroxyl that serves as an efficient cocatalyst for aerobic alcohol oxidation. Insights into this behavior are gained from kinetic studies, which reveal an induction period at the beginning of the reaction that correlates with the oxidative self-processing step, EPR spectroscopic analysis of the catalytic reaction mixture, which shows the buildup of the organic nitroxyl species during steady state turnover, and independent synthesis of oxygenated DBED derivatives, which are shown to serve as effective cocatalysts and eliminate the induction period in the reaction. The overall mechanism bears considerable resemblance to enzymatic reactivity. Most notable is the "oxygenase"-type self-processing step that mirrors generation of catalytic cofactors in enzymes via post-translational modification of amino acid side chains. This higher-order function within a synthetic catalyst system presents new opportunities for the discovery and development of biomimetic catalysts.

Formation of Anionic C, N-bearing Chains in the Interstellar Medium via Reactions of H- with HC x N for Odd-valued x from 1 to 7

NASA Astrophysics Data System (ADS)

Gianturco, F. A.; Satta, M.; Yurtsever, E.; Wester, R.

2017-11-01

We investigate the relative efficiencies of low-temperature chemical reactions in the interstellar medium with H- anion reacting in the gas phase with cyanopolyyne neutral molecules, leading to the formation of anionic {{{C}}}x{{{N}}}- linear chains of different lengths and of H2. All the reactions turn out to be without barriers, highly exothermic reactions that provide a chemical route to the formation of anionic chains of the same length. Some of the anions have been observed in the dark molecular clouds and in the diffuse interstellar envelopes. Quantum calculations are carried out for the corresponding reactive potential energy surfaces for all the odd-numbered members of the series (x = 1, 3, 5, 7). We employ the minimum energy paths to obtain the relevant transition state configurations and use the latter within the variational transition state model to obtain the chemical rates. The present results indicate that at typical temperatures around 100 K, a set of significantly larger rate values exists for x = 3 and x = 5, while the rate values are smaller for CN- and {{{C}}}7{{{N}}}-. At those temperatures, however, all the rates turn out to be larger than the estimates in the current literature for the radiative electron attachment (REA) rates, thus indicating the greater importance of the present chemical path with respect to REA processes at those temperatures. The physical reasons for our findings are discussed in detail and linked with the existing observational findings.

Aqueous Processing for Printed Organic Electronics: Conjugated Polymers with Multistage Cleavable Side Chains

PubMed Central

2017-01-01

The ability to process conjugated polymers via aqueous solution is highly advantageous for reducing the costs and environmental hazards of large scale roll-to-roll processing of organic electronics. However, maintaining competitive electronic properties while achieving aqueous solubility is difficult for several reasons: (1) Materials with polar functional groups that provide aqueous solubility can be difficult to purify and characterize, (2) many traditional coupling and polymerization reactions cannot be performed in aqueous solution, and (3) ionic groups, though useful for obtaining aqueous solubility, can lead to a loss of solid-state order, as well as a screening of any applied bias. As an alternative, we report a multistage cleavable side chain method that combines desirable aqueous processing attributes without sacrificing semiconducting capabilities. Through the attachment of cleavable side chains, conjugated polymers have for the first time been synthesized, characterized, and purified in organic solvents, converted to a water-soluble form for aqueous processing, and brought through a final treatment to cleave the polymer side chains and leave behind the desired electronic material as a solvent-resistant film. Specifically, we demonstrate an organic soluble polythiophene that is converted to an aqueous soluble polyelectrolyte via hydrolysis. After blade coating from an aqueous solution, UV irradiation is used to cleave the polymer’s side chains, resulting in a solvent-resistant, electroactive polymer thin film. In application, this process results in aqueous printed materials with utility for solid-state charge transport in organic field effect transistors (OFETs), along with red to colorless electrochromism in ionic media for color changing displays, demonstrating its potential as a universal method for aqueous printing in organic electronics. PMID:28979937

Aqueous Processing for Printed Organic Electronics: Conjugated Polymers with Multistage Cleavable Side Chains.

PubMed

Schmatz, Brian; Yuan, Zhibo; Lang, Augustus W; Hernandez, Jeff L; Reichmanis, Elsa; Reynolds, John R

2017-09-27

The ability to process conjugated polymers via aqueous solution is highly advantageous for reducing the costs and environmental hazards of large scale roll-to-roll processing of organic electronics. However, maintaining competitive electronic properties while achieving aqueous solubility is difficult for several reasons: (1) Materials with polar functional groups that provide aqueous solubility can be difficult to purify and characterize, (2) many traditional coupling and polymerization reactions cannot be performed in aqueous solution, and (3) ionic groups, though useful for obtaining aqueous solubility, can lead to a loss of solid-state order, as well as a screening of any applied bias. As an alternative, we report a multistage cleavable side chain method that combines desirable aqueous processing attributes without sacrificing semiconducting capabilities. Through the attachment of cleavable side chains, conjugated polymers have for the first time been synthesized, characterized, and purified in organic solvents, converted to a water-soluble form for aqueous processing, and brought through a final treatment to cleave the polymer side chains and leave behind the desired electronic material as a solvent-resistant film. Specifically, we demonstrate an organic soluble polythiophene that is converted to an aqueous soluble polyelectrolyte via hydrolysis. After blade coating from an aqueous solution, UV irradiation is used to cleave the polymer's side chains, resulting in a solvent-resistant, electroactive polymer thin film. In application, this process results in aqueous printed materials with utility for solid-state charge transport in organic field effect transistors (OFETs), along with red to colorless electrochromism in ionic media for color changing displays, demonstrating its potential as a universal method for aqueous printing in organic electronics.

Donor-π-Acceptor Polymer with Alternating Triarylborane and Triphenylamine Moieties.

PubMed

Li, Haiyan; Jäkle, Frieder

2010-05-12

A luminescent main chain donor-π-acceptor-type polymer (4) was prepared via organometallic polycondensation reaction followed by post modification. With both electron-rich amine and electron-deficient borane moieties embedded in the main chain, 4 exhibits an interesting ambipolar character: it can be reduced and oxidized electrochemically at moderate potentials and shows a strong solvatochromic effect in the emission spectra. Complexation studies show that 4 selectively binds to fluoride and cyanide; quantitative titration with cyanide reveals a two-step binding process. Copyright © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Measurements and analysis of alpha-induced reactions of importance for nuclear astrophysics

NASA Astrophysics Data System (ADS)

de Messieres, Genevieve Escande

2011-11-01

Reactions during stellar helium burning are of primary importance for understanding nucleosynthesis. A detailed understanding of the critical reaction chain 4He(2alpha, gamma)12C( alpha, gamma)16O(alpha, gamma) 20Ne is necessary both because it is the primary energy source and because it determines the ratio of 12C to 16O produced, which in turn significantly effects subsequent nucleosynthesis. Also during Helium burning, the reactions 22Ne(alpha, n)25Mg and 22Ne(alpha, gamma )26Mg are crucial in determining the amount of neutrons available for the astrophysical s-process. This thesis presents new experimental results concerning the 16O(alpha, gamma) 20Ne, 22Ne(alpha, n)25Mg, and 22Ne(alpha, gamma)26Mg reaction rates. These results are then applied to the calculation of the associated stellar reaction rates in order to achieve better accuracy.

Standard Gibbs free energies of reactions of ozone with free radicals in aqueous solution: quantum-chemical calculations.

PubMed

Naumov, Sergej; von Sonntag, Clemens

2011-11-01

Free radicals are common intermediates in the chemistry of ozone in aqueous solution. Their reactions with ozone have been probed by calculating the standard Gibbs free energies of such reactions using density functional theory (Jaguar 7.6 program). O(2) reacts fast and irreversibly only with simple carbon-centered radicals. In contrast, ozone also reacts irreversibly with conjugated carbon-centered radicals such as bisallylic (hydroxycylohexadienyl) radicals, with conjugated carbon/oxygen-centered radicals such as phenoxyl radicals, and even with nitrogen- oxygen-, sulfur-, and halogen-centered radicals. In these reactions, further ozone-reactive radicals are generated. Chain reactions may destroy ozone without giving rise to products other than O(2). This may be of importance when ozonation is used in pollution control, and reactions of free radicals with ozone have to be taken into account in modeling such processes.

Polymerase chain reaction system

DOEpatents

Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

2004-03-02

A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

2013-06-28

Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

Control and reduction of peak temperature in self-curing resins.

PubMed

Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A

2009-07-01

INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.

Compositional and stable carbon isotopic fractionation during non-autocatalytic thermochemical sulfate reduction by gaseous hydrocarbons

USGS Publications Warehouse

Xia, Xinyu; Ellis, Geoffrey S.; Ma, Qisheng; Tang, Yongchun

2014-01-01

The possibility of autocatalysis during thermochemical sulfate reduction (TSR) by gaseous hydrocarbons was investigated by examination of previously reported laboratory and field data. This reaction was found to be a kinetically controlled non-autocatalytic process, and the apparent lack of autocatalysis is thought to be due to the absence of the required intermediate species. Kinetic parameters for chemical and carbon isotopic fractionations of gaseous hydrocarbons affected by TSR were calculated and found to be consistent with experimentally derived values for TSR involving long-chain hydrocarbons. Model predictions based on these kinetic values indicate that TSR by gaseous hydrocarbon requires high-temperature conditions. The oxidation of C2–5 hydrocarbons by sulfate reduction is accompanied by carbon isotopic fractionation with the residual C2–5 hydrocarbons becoming more enriched in 13C. Kinetic parameters were calculated for the stable carbon isotopic fractionation of gaseous hydrocarbons that have experienced TSR. Model predictions based on these kinetics indicate that it may be difficult to distinguish the effects of TSR from those of thermal maturation at lower levels of hydrocarbon oxidation; however, unusually heavy δ13C2+ values (>−10‰) can be diagnostic of high levels of conversion (>50%). Stoichiometric and stable carbon isotopic data show that methane is stable under the investigated reaction conditions and is likely a product of TSR by other gaseous hydrocarbons rather than a significant reactant. These results indicate that the overall TSR reaction mechanism for oxidation of organic substrates containing long-chain hydrocarbons involves three distinct phases as follows: (1) an initial slow and non-autocatalytic stage characterized by the reduction of reactive sulfate by long-chain saturated hydrocarbons; (2) a second autocatalytic reaction phase dominated by reactions involving reduced sulfur species and partially oxidized hydrocarbons; (3) and a final, or late-stage, TSR reaction in which hydrocarbon oxidation continues at a slower rate via the non-autocatalytic reduction of sulfate by gaseous hydrocarbons.

Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

PubMed

Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

2011-03-14

Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Selective Transformation of β-Lactam Antibiotics by Peroxymonosulfate: Reaction Kinetics and Nonradical Mechanism.

PubMed

Chen, Jiabin; Fang, Cong; Xia, Wenjun; Huang, Tianyin; Huang, Ching-Hua

2018-02-06

While the β-lactam antibiotics are known to be susceptible to oxidative degradation by sulfate radical (SO 4 •- ), here we report that peroxymonosulfate (PMS) exhibits specific high reactivity toward β-lactam antibiotics without SO 4 •- generation for the first time. Apparent second-order reaction constants (k 2,app ) were determined for the reaction of PMS with three penicillins, five cephalosporins, two carbapenems, and several structurally related chemicals. The pH-dependency of k 2,app could be well modeled based on species-specific reactions. On the basis of reaction kinetics, stoichiometry, and structure-activity assessment, the thioether sulfur, on the six- or five-membered rings (penicillins and cephalosporins) and the side chain (carbapenems), was the main reaction site for PMS oxidation. Cephalosporins were more reactive toward PMS than penicillins and carbapenems, and the presence of a phenylglycine side chain significantly enhanced cephalosporins' reactivity toward PMS. Product analysis indicated oxidation of β-lactam antibiotics to two stereoisomeric sulfoxides. A radical scavenging study and electron paramagnetic resonance (EPR) technique confirmed lack of involvement of radical species (e.g., SO 4 •- ). Thus, the PMS-induced oxidation of β-lactam antibiotics was proposed to proceed through a nonradical mechanism involving direct two-electron transfer along with the heterolytic cleavage of the PMS peroxide bond. The new findings of this study are important for elimination of β-lactam antibiotic contamination, because PMS exhibits specific high reactivity and suffers less interference from the water matrix than the radical process.

Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

PubMed

Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

2012-12-01

Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Clean synthesis of biolubricant range esters using novel liquid lipase enzyme in solvent free medium.

PubMed

Trivedi, Jayati; Aila, Mounika; Sharma, Chandra Dutt; Gupta, Piyush; Kaul, Savita

2015-01-01

In view of the rising global problems of environment pollution and degradation, the present process provides a 'green solution' to the synthesis of higher esters of lubricant range, more specifically in the range C12-C36, using different combinations of acids and alcohols, in a single step reaction. The esters produced are biodegradable in nature and have a plethora of uses, such as in additives, as lubricating oils and other hydraulic fluids. The enzymatic esterification was performed using liquid (non-immobilized or free) lipase enzyme, without any additional organic solvent. Soluble lipase proves to be superior to immobilized enzymes as it is more cost effective and provides a faster process for the production of higher esters of lubricant range. An interesting finding was, that the lipase enzyme showed higher conversion rates with increasing carbon number of straight chain alcohols and acids. Reactions were carried out for the optimization of initial water concentration, temperature, pH of the substrate mixture and the chain length of the substrates. Under optimized conditions, the method was suitable to achieve ~ 99% conversion. Thus, the process provides an environment friendly, enzymatic alternative to the chemical route which is currently used in the industrial synthesis of lubricant components.

The long underestimated carbonyl function of carbohydrates – an organocatalyzed shot into carbohydrate chemistry.

PubMed

Mahrwald, R

2015-09-21

The aggressive and strong development of organocatalysis provides several protocols for the convenient utilization of the carbonyl function of unprotected carbohydrates in C-C-bond formation processes. These amine-catalyzed mechanisms enable multiple cascade-protocols for the synthesis of a wide range of carbohydrate-derived compound classes. Several, only slightly different protocols, have been developed for the application of 1,3-dicarbonyl compounds in the stereoselective chain-elongation of unprotected carbohydrates and the synthesis of highly functionalized C-glycosides of defined configuration. In addition, C-glycosides can also be accessed by amine-catalyzed reactions with methyl ketones. By a one-pot cascade reaction of isocyanides with unprotected aldoses and amino acids access to defined configured glycopeptide mimetics is achieved. Depending on the reaction conditions different origins to control the installation of configuration during the bond-formation process were observed.

Vibrational non-equilibrium in the hydrogen-oxygen reaction. Comparison with experiment

NASA Astrophysics Data System (ADS)

Skrebkov, Oleg V.

2015-03-01

A theoretical model is proposed for the chemical and vibrational kinetics of hydrogen oxidation based on consistent accounting of the vibrational non-equilibrium of the HO2 radical that forms as a result of the bimolecular recombination H+O2 → HO2. In the proposed model, the chain branching H+O2 = O+OH and inhibiting H+O2+M = HO2+M formal reactions are treated (in the terms of elementary processes) as a single multi-channel process of forming, intramolecular energy redistribution between modes, relaxation, and unimolecular decay of the comparatively long-lived vibrationally excited HO2 radical, which is able to react and exchange energy with the other components of the mixture. The model takes into account the vibrational non-equilibrium of the starting (primary) H2 and O2 molecules, as well as the most important molecular intermediates HO2, OH, O2(1Δ), and the main reaction product H2O. It is shown that the hydrogen-oxygen reaction proceeds in the absence of vibrational equilibrium, and the vibrationally excited HO2(v) radical acts as a key intermediate in a fundamentally important chain branching process and in the generation of electronically excited species O2(1Δ), O(1D), and OH(2Σ+). The calculated results are compared with the shock tube experimental data for strongly diluted H2-O2 mixtures at 1000 < T < 2500 K, 0.5 < p < 4 atm. It is demonstrated that this approach is promising from the standpoint of reconciling the predictions of the theoretical model with experimental data obtained by different authors for various compositions and conditions using different methods. For T < 1500 K, the nature of the hydrogen-oxygen reaction is especially non-equilibrium, and the vibrational non-equilibrium of the HO2 radical is the essence of this process. The quantitative estimation of the vibrational relaxation characteristic time of the HO2 radical in its collisions with H2 molecules has been obtained as a result of the comparison of different experimental data on induction time measurements with the relevant calculations.

Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

PubMed

Chen, Y T; Mercer, G O; Chen, Y

1993-11-01

Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

PubMed

Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

2016-10-01

The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

PubMed

Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

2002-07-01

Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

Organic reactions mediated by electrochemically generated ArS+.

PubMed

Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi

2011-04-21

Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.

Enhanced analysis of real-time PCR data by using a variable efficiency model: FPK-PCR

PubMed Central

Lievens, Antoon; Van Aelst, S.; Van den Bulcke, M.; Goetghebeur, E.

2012-01-01

Current methodology in real-time Polymerase chain reaction (PCR) analysis performs well provided PCR efficiency remains constant over reactions. Yet, small changes in efficiency can lead to large quantification errors. Particularly in biological samples, the possible presence of inhibitors forms a challenge. We present a new approach to single reaction efficiency calculation, called Full Process Kinetics-PCR (FPK-PCR). It combines a kinetically more realistic model with flexible adaptation to the full range of data. By reconstructing the entire chain of cycle efficiencies, rather than restricting the focus on a ‘window of application’, one extracts additional information and loses a level of arbitrariness. The maximal efficiency estimates returned by the model are comparable in accuracy and precision to both the golden standard of serial dilution and other single reaction efficiency methods. The cycle-to-cycle changes in efficiency, as described by the FPK-PCR procedure, stay considerably closer to the data than those from other S-shaped models. The assessment of individual cycle efficiencies returns more information than other single efficiency methods. It allows in-depth interpretation of real-time PCR data and reconstruction of the fluorescence data, providing quality control. Finally, by implementing a global efficiency model, reproducibility is improved as the selection of a window of application is avoided. PMID:22102586

A Complementary Isothermal Amplification Method to the U.S. EPA Quantitative Polymerase Chain Reaction Approach for the Detection of Enterococci in Environmental Waters

PubMed Central

2017-01-01

We report a novel molecular assay, based on helicase-dependent amplification (HDA), for the detection of enterococci as markers for fecal pollution in water. This isothermal assay targets the same Enterococcus 23S rRNA gene region as the existing quantitative polymerase chain reaction (qPCR) assays of U.S. Environmental Protection Agency Methods 1611 and 1609 but can be entirely performed on a simple heating block. The developed Enterococcus HDA assay successfully discriminated 15 enterococcal from 15 non-enterococcal reference strains and reliably detected 48 environmental isolates of enterococci. The limit of detection was 25 target copies per reaction, only 3 times higher than that of qPCR. The applicability of the assay was tested on 30 environmental water sample DNA extracts, simulating a gradient of fecal pollution. Despite the isothermal nature of the reaction, the HDA results were consistent with those of the qPCR reference. Given this performance, we conclude that the developed Enterococcus HDA assay has great potential as a qualitative molecular screening method for resource-limited settings when combined with compatible up- and downstream processes. This amplification strategy can pave the way for developing a new generation of rapid, low-cost, and field-deployable molecular diagnostic tools for water quality monitoring. PMID:28541661

Investigation of Thermochemistry Associated with the Carbon–Carbon Coupling Reactions of Furan and Furfural Using ab Initio Methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Cong; Assary, Rajeev S.; Curtiss, Larry A.

2014-06-26

Upgrading of furan and small oxygenates obtained from the decomposition of cellulosic materials via formation of carbon-carbon bonds is critical to effective conversion of biomass to liquid transportation fuels. Simulation-driven molecular level understanding of carbon-carbon bond formation is required to design efficient catalysts and processes. Accurate quantum chemical methods are utilized here to predict the reaction energetics for conversion of furan (C4H4O) to C5-C8 ethers and the transformation of furfural (C5H6O2) to C13-C26 alkanes. Furan, can be coupled with various C1 to C4 lower molecular weight carbohydrates obtained from the pyrolysis via Diels-Alder type reactions in the gas phase tomore » produce C5-C8 cyclic ethers. The computed reaction barriers for these reactions (~25 kcal/mol) are lower than the cellulose activation or decomposition reactions (~50 kcal/mol). Cycloaddition of C5-C8 cyclo-ethers with furans can also occur in the gas phase, and the computed activation energy is similar to that of the first Diels-Alder reaction. Furfural, obtained from biomass, can be coupled with aldehydes or ketones with α-hydrogen atoms to form longer chain aldol products and these aldol products can undergo vapor phase hydrocycloaddition (activation barrier of ~20 kcal/mol) to form the precursors of C26 cyclic hydrocarbons. These thermochemical studies provide the basis for further vapor phase catalytic studies required for upgrading of furans/furfurals to longer chain hydrocarbons.« less

Need of a consistent and convenient nucleus identification in ENDF files for the automatic construction of the depletion chains

NASA Astrophysics Data System (ADS)

Mosca, Pietro; Mounier, Claude

2016-03-01

The automatic construction of evolution chains recently implemented in GALILEE system is based on the analysis of several ENDF files : the multigroup production cross sections present in the GENDF files processed by NJOY from the ENDF evaluation, the decay file and the fission product yields (FPY) file. In this context, this paper highlights the importance of the nucleus identification to properly interconnect the data mentioned above. The first part of the paper describes the present status of the nucleus identification among the several ENDF files focusing, in particular, on the use of the excited state number and of the isomeric state number. The second part reviews the problems encountered during the automatic construction of the depletion chains using recent ENDF data. The processing of the JEFF-3.1.1, ENDF/B-VII.0 (decay and FPY) and the JEFF-3.2 (production cross section) points out problems about the compliance or not of the nucleus identifiers with the ENDF-6 format and sometimes the inconsistencies among the various ENDF files. In addition, the analysis of EAF-2003 and EAF-2010 shows some incoherence between the ZA product identifier and the reaction identifier MT for the reactions (n, pα) and (n, 2np). As a main result of this work, our suggestion is to change the ENDF format using systematically the isomeric state number to identify the nuclei. This proposal is already compliant to a huge amount ENDF data that are not in agreement with the present ENDF format. This choice is the most convenient because, ultimately, it allows one to give human readable names to the nuclei of the depletion chains.

A parallel algorithm for step- and chain-growth polymerization in molecular dynamics.

PubMed

de Buyl, Pierre; Nies, Erik

2015-04-07

Classical Molecular Dynamics (MD) simulations provide insight into the properties of many soft-matter systems. In some situations, it is interesting to model the creation of chemical bonds, a process that is not part of the MD framework. In this context, we propose a parallel algorithm for step- and chain-growth polymerization that is based on a generic reaction scheme, works at a given intrinsic rate and produces continuous trajectories. We present an implementation in the ESPResSo++ simulation software and compare it with the corresponding feature in LAMMPS. For chain growth, our results are compared to the existing simulation literature. For step growth, a rate equation is proposed for the evolution of the crosslinker population that compares well to the simulations for low crosslinker functionality or for short times.

A parallel algorithm for step- and chain-growth polymerization in molecular dynamics

NASA Astrophysics Data System (ADS)

de Buyl, Pierre; Nies, Erik

2015-04-01

Classical Molecular Dynamics (MD) simulations provide insight into the properties of many soft-matter systems. In some situations, it is interesting to model the creation of chemical bonds, a process that is not part of the MD framework. In this context, we propose a parallel algorithm for step- and chain-growth polymerization that is based on a generic reaction scheme, works at a given intrinsic rate and produces continuous trajectories. We present an implementation in the ESPResSo++ simulation software and compare it with the corresponding feature in LAMMPS. For chain growth, our results are compared to the existing simulation literature. For step growth, a rate equation is proposed for the evolution of the crosslinker population that compares well to the simulations for low crosslinker functionality or for short times.

Free radical reaction characteristics of coal low-temperature oxidation and its inhibition method.

PubMed

Li, Zenghua; Kong, Biao; Wei, Aizhu; Yang, Yongliang; Zhou, Yinbo; Zhang, Lanzhun

2016-12-01

Study on the mechanism of coal spontaneous combustion is significant for controlling fire disasters due to coal spontaneous combustion. The free radical reactions can explain the chemical process of coal at low-temperature oxidation. Electron spin resonance (ESR) spectroscopy was used to measure the change rules of the different sorts and different granularity of coal directly; ESR spectroscopy chart of free radicals following the changes of temperatures was compared by the coal samples applying air and blowing nitrogen, original coal samples, dry coal samples, and demineralized coal samples. The fragmentation process was the key factor of producing and initiating free radical reactions. Oxygen, moisture, and mineral accelerated the free radical reactions. Combination of the free radical reaction mechanism, the mechanical fragmentation leaded to the elevated CO concentration, fracturing of coal pillar was more prone to spontaneous combustion, and spontaneous combustion in goaf accounted for a large proportion of the fire in the mine were explained. The method of added diphenylamine can inhibit the self-oxidation of coal effectively, the action mechanism of diphenylamine was analyzed by free radical chain reaction, and this research can offer new method for the development of new flame retardant.

Surfactant-controlled polymerization of semiconductor clusters to quantum dots through competing step-growth and living chain-growth mechanisms.

PubMed

Evans, Christopher M; Love, Alyssa M; Weiss, Emily A

2012-10-17

This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.

Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

USDA-ARS?s Scientific Manuscript database

This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

[Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

PubMed

Wang, F; Zhang, Y Q; Ding, J; Yu, L X

2017-10-18

To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

The role of living/controlled radical polymerization in the formation of improved imprinted polymers.

PubMed

Salian, Vishal D; Vaughan, Asa D; Byrne, Mark E

2012-06-01

In this work, living/controlled radical polymerization (LRP) is compared with conventional free radical polymerization in the creation of highly and weakly cross-linked imprinted poly(methacrylic acid-co-ethylene glycol dimethacrylate) networks. It elucidates, for the first time, the effect of LRP on the chain level and begins to explain why the efficiency of the imprinting process is improved using LRP. Imprinted polymers produced via LRP exhibited significantly higher template affinity and capacity compared with polymers prepared using conventional methods. The use of LRP in the creation of highly cross-linked imprinted polymers resulted in a fourfold increase in binding capacity without a decrease in affinity; whereas weakly cross-linked gels demonstrated a nearly threefold increase in binding capacity at equivalent affinity when LRP was used. In addition, by adjusting the double bond conversion, we can choose to increase either the capacity or the affinity in highly cross-linked imprinted polymers, thus allowing the creation of imprinted polymers with tailorable binding parameters. Using free radical polymerization in the creation of polymer chains, as the template-monomer ratio increased, the average molecular weight of the polymer chains decreased despite a slight increase in the double bond conversion. Thus, the polymer chains formed were shorter but greater in number. Using LRP neutralized the effect of the template. The addition of chain transfer agent resulted in slow, uniform, simultaneous chain growth, resulting in the formation of longer more monodisperse chains. Reaction analysis revealed that propagation time was extended threefold in the formation of highly cross-linked polymers when LRP techniques were used. This delayed the transition to the diffusion-controlled stage of the reaction, which in turn led to the observed enhanced binding properties, decreased polydispersity in the chains, and a more homogeneous macromolecular architecture. Copyright © 2012 John Wiley & Sons, Ltd.

Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

PubMed

Igarashi, T; Yamamoto, A; Goto, N

1996-10-01

Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

PubMed

Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

2017-01-01

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

Structure–Function Studies of Hydrophobic Residues That Clamp a Basic Glutamate Side Chain during Catalysis by Triosephosphate Isomerase

PubMed Central

2016-01-01

Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328

Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates.

PubMed

Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M

2013-03-28

This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions

NASA Astrophysics Data System (ADS)

Zlokazov, V. B.; Utyonkov, V. K.

2017-07-01

The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.

A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

NASA Astrophysics Data System (ADS)

Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua

2017-08-01

Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.

Problem-Solving Test: Real-Time Polymerase Chain Reaction

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

EPA Science Inventory

Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

ERIC Educational Resources Information Center

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

EPA Science Inventory

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

USDA-ARS?s Scientific Manuscript database

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

PubMed

Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

2005-03-01

We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

EPA Science Inventory

A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

Trends and advances in food analysis by real-time polymerase chain reaction.

PubMed

Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

2016-05-01

Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

A generic rate equation for catalysed, template-directed polymerisation.

PubMed

Hofmeyr, Jan-Hendrik S; Gqwaka, Olona P C; Rohwer, Johann M

2013-09-02

Biosynthetic networks link to growth and reproduction processes through template-directed synthesis of macromolecules such as polynucleotides and polypeptides. No rate equation exists that captures this link in a way that it can effectively be incorporated into a single computational model of the overall process. This paper describes the derivation of such a generic steady-state rate equation for catalysed, template-directed polymerisation reactions with varying monomer stoichiometry and varying chain length. The derivation is based on a classical Michaelis-Menten mechanism with template binding and an arbitrary number of chain elongation steps that produce a polymer composed of an arbitrary number of monomer types. The rate equation only requires the identity of the first dimer in the polymer sequence; for the remainder only the monomer composition needs be known. Further simplification of a term in the denominator yielded an equation requiring no positional information at all, only the monomer composition of the polymer; this equation still gave an excellent estimate of the reaction rate provided that either the monomer concentrations are at least half-saturating, or the polymer is very long. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Study of the nucleon radiative captures 8Li(n,γ)9Li, 9Be(p,γ)10B, 10Be(n,γ)11Be, 10B(p,γ)11C, and 16O(p,γ)17F at thermal and astrophysical energies

NASA Astrophysics Data System (ADS)

Dubovichenko, Sergey; Dzhazairov-Kakhramanov, Albert

We have studied the neutron-capture reactions 8Li(n,γ)9Li and its role in the primordial nucleosynthesis. The n +8Li →9Li + γ reaction has a significant astrophysical interest because it includes one of the variants of chain of primordial nucleosynthesis processes of the Universe and thermonuclear reactions in type II supernovae. Furthermore, we consider the 9Be(p,γ)10B reaction in the astrophysical energy range in the modified potential cluster model (MPCM) with splitting of orbital states according to Young tableaux and, in some cases, with forbidden states (FS). The reaction 9Be(p,γ)10B plays an important role in primordial and stellar nucleosynthesis of light elements in the p shell. Hydrogen burning in second-generation stars occurs via the proton-proton (pp) chain and CNO cycle, with the 9Be(p,γ)10B reaction serving as an intermediate link between these cycles. Furthermore, the possibility of describing available experimental data for the total reaction cross-sections of neutron radiative capture on 10Be at thermal and astrophysical energies has been shown. This reaction is a part of one of the variants of the chain of primordial nucleosynthesis of the Universe due to which the elements with a mass of A > 11-12 may be formed. The results in the field of study of thermonuclear proton-capture reaction on 10B at ultralow, i.e., astrophysical energies will be presented further. The possibility of description of the experimental data for the astrophysical S-factor of the proton radiative capture on 16O to the ground state (GS) of 17F was considered in the frame of the MPCM with FS and classification of the states according to Young tableaux. It was shown that on the basis of the E1 transitions from the states of p16O scattering to the GS of 17F in the p16O channel generally succeed to explain the value of measured cross-sections at astrophysical energies.

An enzyme-free flow cytometric bead assay for the sensitive detection of microRNAs based on click nucleic acid ligation-mediated signal amplification.

PubMed

Qi, Yan; Qiu, Liying; Fan, Wenjiao; Liu, Chenghui; Li, Zhengping

2017-08-07

A versatile flow cytometric bead assay (FCBA) coupled with a completely enzyme-free signal amplification mechanism is developed for the sensitive detection of microRNAs (miRNAs). This new strategy integrates click chemistry-mediated ligation chain reaction (CLCR) with hybridization chain reaction (HCR) for enzyme-free signal amplification on magnetic beads (MBs), and a flow cytometer for the robust fluorescence readout of the MBs. Firstly, target miRNA can initiate CLCR on the surface of MBs based on the click chemical ligation between dibenzocyclooctyne (DBCO)- and azide-modified single-stranded DNA (ssDNA) probes, and the amount of ligated ssDNA sequences on the MBs will be proportional to the dosage of target miRNA. Afterward, each of the ligated ssDNA products can trigger a cascade chain reaction of hybridization events between two alternating fluorophore-tagged hairpin probes, resulting in another signal amplification pathway with an amplified accumulation of fluorophores on the MBs. Finally, the fluorophore-anchored MBs are directly and rapidly analyzed by using a flow cytometer without any separation or elution processes. Herein, the click nucleic acid ligation only occurs on the surface of MBs, so the nonspecific ligations are greatly inhibited compared with that of ligation reaction performed in homogeneous solution. Furthermore, the signal amplification by CLCR-HCR is highly efficient but totally enzyme-free, which may overcome the potential drawbacks of conventional enzyme-catalyzed signal amplification protocols and lead to a high sensitivity. The CLCR-HCR-based FCBA has pushed the detection limit of let-7a miRNA down to the femtomolar (fM) level, showing great potential in miRNA-related biological studies and disease diagnosis.

Synthesis of perfluoroalkylene dianilines

NASA Technical Reports Server (NTRS)

Paciorek, K. L.; Ito, T. I.; Harris, D. H.; Beechan, C. M.; Nakaham, J. H.; Kratzer, R. H.

1981-01-01

The objective of this contrast was to optimize and scale-up the synthesis of 2,2-bis(4-aminophenyl)-hexafluoropropane and 1,3-bis(4-aminophenyl)hexafluoropropane, as well as to explore avenues to other perfluoroalkyl-bridged dianilines. Routes other than Friedel-Crafts reaction leading to 2,2-bis(4-aminophenyl)hexafluoropropane were investigated. The processes utilizing bisphenol-AF were all unsuccessful; reactions aimed at the production of 4-(hexafluoro-2-halo-isopropyl)aniline from the hydroxyl intermediate failed to yield the desired products. Tailoring the conditions of the Friedel-Crafts reaction of 4-(hexafluoro-2-hydroxyisopropyl)aniline, aniline, and aluminum chloride by using hydrochloride salts and selecting optimum reagent ratios, reaction times, and temperature resulted in approx. 20% yield of pure crystallized 2,2-bis(4-aminophenyl)hexafluoropropane in 0.2 mole reaction batches. Yields up to approx. 40% were realized in small, approx. 0.01 mole, batches. The synthesis of 1,3-bis(4-aminophenyl)hexafluoropropane starting with perfluoroglutarimidine was reinvestigated. The yield of the 4-step reaction sequence giving 1,3-bis(4-acetamidophenyl)hexafluoropropane was raised to 44%. The yield of the subsequent hydrolysis process was improved by a factor of approx. 2. Approaches to prepare other perfluoroalkyl-bridged dianilines were unsuccessful. Reactions reported to proceed readily with trifluoromethyl substituents failed when longer chain perfluoroalkyl groups were employed.

Reaction-mediated entropic effect on phase separation in a binary polymer system

NASA Astrophysics Data System (ADS)

Sun, Shujun; Guo, Miaocai; Yi, Xiaosu; Zhang, Zuoguang

2017-10-01

We present a computer simulation to study the phase separation behavior induced by polymerization in a binary system comprising polymer chains and reactive monomers. We examined the influence of interaction parameter between components and monomer concentration on the reaction-induced phase separation. The simulation results demonstrate that increasing interaction parameter (enthalpic effect) would accelerate phase separation, while entropic effect plays a key role in the process of phase separation. Furthermore, scanning electron microscopy observations illustrate identical morphologies as found in theoretical simulation. This study may enrich our comprehension of phase separation in polymer mixture.

[Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

PubMed

Iván, Kristóf; Maráz, Anna

2015-12-20

Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

Using dual-polarization interferometry to study surface-initiated DNA hybridization chain reactions in real time.

PubMed

Huang, Fujian; Xu, Pingping; Liang, Haojun

2014-01-15

In this study we used dual-polarization interferometry to investigate DNA hybridization chain reactions (HCRs) at solid-liquid interfaces. We monitored the effects of variations in mass, thickness, and density of the immobilized initiator on the subsequent HCRs at various salt concentrations. At low salt concentrations, the single-stranded DNA (ssDNA) initiator was attached uniformly to the chip surface. At high salt concentrations, it lay on the surface at the onset of the immobilization process, but the approaching ssDNA forced the pre-immobilized ssDNA strands to extend into solution as a result of increased electrostatic repulsion between the pre-adsorbed and approaching ssDNA chains. Injection of a mixture of H1 and H2 increased the mass and thickness of the films initially, but thereafter the thickness decreased. These changes indicate that the long double-stranded DNA that formed lay on the surface, rather than extended into the solution, thereby suppressing the subsequent initiation activity of the released single-strand parts of H1 and H2. Increasing the salt concentration increased the HCR efficiency and reaction rate. The HCR efficiency of the initiator ssDNA immobilized on its 5' end was higher than that immobilized on its 3' end, suggesting that the released single-strand parts of H1 and H2 close to the chip surface decreased the initiation activity relative to those of the ones extending into solution. © 2013 Elsevier B.V. All rights reserved.

Ring-rearrangement metathesis of nitroso Diels-Alder cycloadducts.

PubMed

Vincent, Guillaume; Kouklovsky, Cyrille

2011-03-01

Strained nitroso Diels-Alder bicyclo[2.2.1] or [2.2.2] adducts functionalized with alkene side chains of diverse length undergo a ring-rearrangement metathesis process with external alkenes and Grubbs II or Hoveyda-Grubbs II ruthenium catalysts, under microwave irradiation or classical heating, to deliver cis-fused bicycles of various ring sizes, which contain a N-O bond. These scaffolds are of synthetic relevance for the generation of molecular diversity and to the total synthesis of alkaloids. The observation of unexpected reactions, such as epimerization or one-carbon homologation of the alkene side chain, is also reported. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Efficiency of photochemical stages of photosynthesis in purple bacteria (a critical survey).

PubMed

Borisov, A Yu

2014-03-01

Based on currently available data, the energy transfer efficiency in the successive photophysical and photochemical stages has been analyzed for purple bacteria. This analysis covers the stages starting from migration of the light-induced electronic excitations from the bulk antenna pigments to the reaction centers up to irreversible stage of the electron transport along the transmembrane chain of cofactors-carriers. Some natural factors are revealed that significantly increase the rates of efficient processes in these stages. The influence on their efficiency by the "bottleneck" in the energy migration chain is established. The overall quantum yield of photosynthesis in these stages is determined.

Second-Order Biomimicry: In Situ Oxidative Self-Processing Converts Copper(I)/Diamine Precursor into a Highly Active Aerobic Oxidation Catalyst

PubMed Central

2017-01-01

A homogeneous Cu-based catalyst system consisting of [Cu(MeCN)4]PF6, N,N′-di-tert-butylethylenediamine (DBED), and p-(N,N-dimethylamino)pyridine (DMAP) mediates efficient aerobic oxidation of alcohols. Mechanistic study of this reaction shows that the catalyst undergoes an in situ oxidative self-processing step, resulting in conversion of DBED into a nitroxyl that serves as an efficient cocatalyst for aerobic alcohol oxidation. Insights into this behavior are gained from kinetic studies, which reveal an induction period at the beginning of the reaction that correlates with the oxidative self-processing step, EPR spectroscopic analysis of the catalytic reaction mixture, which shows the buildup of the organic nitroxyl species during steady state turnover, and independent synthesis of oxygenated DBED derivatives, which are shown to serve as effective cocatalysts and eliminate the induction period in the reaction. The overall mechanism bears considerable resemblance to enzymatic reactivity. Most notable is the “oxygenase”-type self-processing step that mirrors generation of catalytic cofactors in enzymes via post-translational modification of amino acid side chains. This higher-order function within a synthetic catalyst system presents new opportunities for the discovery and development of biomimetic catalysts. PMID:28470049

THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST

PubMed Central

Keil, Harry; Wasserman, David; Dawson, Charles R.

1944-01-01

1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415

THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST.

PubMed

Keil, H; Wasserman, D; Dawson, C R

1944-10-01

1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.

Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

PubMed Central

deWit, D; Wootton, M; Allan, B; Steyn, L

1993-01-01

A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

Highly efficient reversible addition-fragmentation chain-transfer polymerization in ethanol/water via flow chemistry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ye, Piaoran; Cao, Peng -Fei; Su, Zhe

Here, utilization of a flow reactor under high pressure allows highly efficient polymer synthesis via reversible addition–fragmentation chain-transfer (RAFT) polymerization in an aqueous system. Compared with the batch reaction, the flow reactor allows the RAFT polymerization to be performed in a high-efficiency manner at the same temperature. The adjustable pressure of the system allows further elevation of the reaction temperature and hence faster polymerization. Other reaction parameters, such as flow rate and initiator concentration, were also well studied to tune the monomer conversion and the molar mass dispersity (Ð) of the obtained polymers. Gel permeation chromatography, nuclear magnetic resonance (NMR),more » and Fourier transform infrared spectroscopies (FTIR) were utilized to monitor the polymerization process. With the initiator concentration of 0.15 mmol L –1, polymerization of poly(ethylene glycol) methyl ethermethacrylate with monomer conversion of 52% at 100 °C under 73 bar can be achieved within 40 min with narrow molar mass dispersity (D) Ð (<1.25). The strategy developed here provides a method to produce well-defined polymers via RAFT polymerization with high efficiency in a continuous manner.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wujcik, Kevin H.; Wang, Dunyang Rita; Pascal, Tod A.

Lithium sulfur (Li-S) batteries are well known for their high theoretical specific capacities, but are plagued with scientific obstacles that make practical implementation of the technology impossible. The success of Li-S batteries will likely necessitate the use of thick sulfur cathodes that enable high specific energy densities. However, little is known about the fundamental reaction mechanisms and chemical processes that take place in thick cathodes, as most research has focused on studying thinner cathodes that enable high performance. In this study, in situ X-ray absorption spectroscopy at the sulfur K-edge is used to examine the back of a 115 μmmore » thick Li-S cathode during discharge. Our results show that in such systems, where electrochemical reactions between sulfur and lithium are likely to proceed preferentially toward the front of the cathode, lithium polysulfide dianions formed in this region diffuse to the back of the cathode during discharge. We show that high conversion of elemental sulfur is achieved by chemical reactions between elemental sulfur and polysulfide dianions of intermediate chain length (Li 2S x, 4 ≤ x ≤ 6). Our work suggests that controlling the formation and diffusion of intermediate chain length polysulfide dianions is crucial for insuring full utilization of thick sulfur cathodes.« less

Linked strategy for the production of fuels via formose reaction

PubMed Central

Deng, Jin; Pan, Tao; Xu, Qing; Chen, Meng-Yuan; Zhang, Ying; Guo, Qing-Xiang; Fu, Yao

2013-01-01

Formose reaction converts formaldehyde to carbohydrates. We found that formose reaction can be used linking the biomass gasification with the aqueous-phase processing (APP) to produce liquid transportation fuel in three steps. First, formaldehyde from syn-gas was converted to triose. This was followed by aldol condensation and dehydration to 4-hydroxymethylfurfural (4-HMF). Finally, 4-HMF was hydrogenated to produce 2,4-dimethylfuran (2,4-DMF) or C9-C15 branched-chain alkanes as liquid transportation fuels. In the linked strategy, high energy-consuming pretreatment as well as expensive and polluting hydrolysis of biomass were omitted, but the high energy recovery of APP was inherited. In addition, the hexoketoses via formose reaction could be converted to HMFs directly without isomerization. A potential platform molecule 4-HMF was formed simultaneously in APP. PMID:23393625

ReaDDy - A Software for Particle-Based Reaction-Diffusion Dynamics in Crowded Cellular Environments

PubMed Central

Schöneberg, Johannes; Noé, Frank

2013-01-01

We introduce the software package ReaDDy for simulation of detailed spatiotemporal mechanisms of dynamical processes in the cell, based on reaction-diffusion dynamics with particle resolution. In contrast to other particle-based reaction kinetics programs, ReaDDy supports particle interaction potentials. This permits effects such as space exclusion, molecular crowding and aggregation to be modeled. The biomolecules simulated can be represented as a sphere, or as a more complex geometry such as a domain structure or polymer chain. ReaDDy bridges the gap between small-scale but highly detailed molecular dynamics or Brownian dynamics simulations and large-scale but little-detailed reaction kinetics simulations. ReaDDy has a modular design that enables the exchange of the computing core by efficient platform-specific implementations or dynamical models that are different from Brownian dynamics. PMID:24040218

Label-Free Fluorescent DNA Dendrimers for microRNA Detection Based On Nonlinear Hybridization Chain Reaction-Mediated Multiple G-Quadruplex with Low Background Signal.

PubMed

Xue, Qingwang; Liu, Chunxue; Li, Xia; Dai, Li; Wang, Huaisheng

2018-04-18

Various fluorescent sensing systems for miRNA detection have been developed, but they mostly contain enzymatic amplification reactions and label procedures. The strict reaction conditions of tool enzymes and the high cost of labeling limit their potential applications, especially in complex biological matrices. Here, we have addressed the difficult problems and report a strategy for label-free fluorescent DNA dendrimers based on enzyme-free nonlinear hybridization chain reaction (HCR)-mediated multiple G-quadruplex for simple, sensitive, and selective detection of miRNAs with low-background signal. In the strategy, a split G-quadruplex (3:1) sequence is ingeniously designed at both ends of two double-stranded DNAs, which is exploited as building blocks for nonlinear HCR assembly, thereby acquiring a low background signal. A hairpin switch probe (HSP) was employed as recognition and transduction element. Upon sensing the target miRNA, the nonlinear HCR assembly of two blocks (blocks-A and blocks-B) was initiated with the help of two single-stranded DNA assistants, resulting in chain-branching growth of DNA dendrimers with multiple G-quadruplex incorporation. With the zinc(II)-protoporphyrin IX (ZnPPIX) selectively intercalated into the multiple G-quadruplexes, fluorescent DNA dendrimers were obtained, leading to an exponential fluorescence intensity increase. Benefiting from excellent performances of nonlinear HCR and low background signal, this strategy possesses the characteristics of a simplified reaction operation process, as well as high sensitivity. Moreover, the proposed fluorescent sensing strategy also shows preferable selectivity, and can be implemented without modified DNA blocks. Importantly, the strategy has also been tested for miRNA quantification with high confidence in breast cancer cells. Thus, this proposed strategy for label-free fluorescent DNA dendrimers based on a nonlinear HCR-mediated multiple G-quadruplex will be turned into an alternative approach for simple, sensitive, and selective miRNA quantification.

Enzymatic preparation of structured oils containing short-chain fatty acids.

PubMed

Kanda, Ayato; Namiki, Fusako; Hara, Setsuko

2010-01-01

Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.

DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

EPA Science Inventory

The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

29 CFR 1910.155 - Scope, application and definitions applicable to this subpart.

Code of Federal Regulations, 2010 CFR

2010-07-01

... by inhibiting the chemical chain reaction of fuel and oxygen. It is also known as...F3) which is a medium for extinguishing fires by inhibiting the chemical chain reaction of fuel and..., odorless, electrically nonconductive inert gas (chemical formula CO2) that is a medium for extinguishing...

Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

ERIC Educational Resources Information Center

Phelps, Tara L.; And Others

1996-01-01

Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

Determining Annealing Temperatures for Polymerase Chain Reaction

ERIC Educational Resources Information Center

Porta, Angela R.; Enners, Edward

2012-01-01

The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

USDA-ARS?s Scientific Manuscript database

A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.

PubMed

Borkar, Santosh Ramdas; Aidhen, Indrapal Singh

2017-04-18

Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.

Multi-scale modeling of diffusion-controlled reactions in polymers: renormalisation of reactivity parameters.

PubMed

Everaers, Ralf; Rosa, Angelo

2012-01-07

The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.

Summary of Research/Publications

NASA Technical Reports Server (NTRS)

1997-01-01

Summary of research/publications include:(1) Comment on broadening of water microwave lines by collisions with helium atoms; (2) Calculations of ion-molecule deuterium fractionation reactions involving HD; (3) Ab initio predictions on the rotational spectra of carbon-chain carbene molecules; (4) Theoretical IR spectra of ionized naphthalene; (5) Improved collisional excitation rates for interstellar water; (6) Calculations on the competition between association and reaction for C3H+ + H2; (7) Theoretical infrared spectra of some model polycyclic aromatic hydrocarbons: effect of ionization; (8) Calculations concerning interstellar isomeric abundance ratios for C3H and C3H2; (9) New calculations on the ion-molecule processes C2H2+ + H2 C2H3+ + H and C2H2+ + H2 C2H4+; (10) Anisotropic rigid rotor potential energy function for H2O-H2; (11) A correlated ab initio study of linear carbon-chain radicals CnH (n=2-7); (12) Ab initio characterization of MgCCH, MgCCH+, and MgC2 and pathways to their formation in the interstellar medium; (13) Why HOC+ is detectable in interstellar clouds: The rate of the reaction between HOC+ and H2; (14) A correlated ab initio study of the X 2A 1 and A 2E states of MgCH3; (15) On the stability of interstellar carbon clusters: The rate of the reaction between C3 and O; and (16) The rate of the reaction between CN and C2H2 at interstellar temperatures.

Design of multi-phase dynamic chemical networks

NASA Astrophysics Data System (ADS)

Chen, Chenrui; Tan, Junjun; Hsieh, Ming-Chien; Pan, Ting; Goodwin, Jay T.; Mehta, Anil K.; Grover, Martha A.; Lynn, David G.

2017-08-01

Template-directed polymerization reactions enable the accurate storage and processing of nature's biopolymer information. This mutualistic relationship of nucleic acids and proteins, a network known as life's central dogma, is now marvellously complex, and the progressive steps necessary for creating the initial sequence and chain-length-specific polymer templates are lost to time. Here we design and construct dynamic polymerization networks that exploit metastable prion cross-β phases. Mixed-phase environments have been used for constructing synthetic polymers, but these dynamic phases emerge naturally from the growing peptide oligomers and create environments suitable both to nucleate assembly and select for ordered templates. The resulting templates direct the amplification of a phase containing only chain-length-specific peptide-like oligomers. Such multi-phase biopolymer dynamics reveal pathways for the emergence, self-selection and amplification of chain-length- and possibly sequence-specific biopolymers.

Understanding disordered and unfolded proteins using single-molecule FRET and polymer theory.

PubMed

Hofmann, Hagen

2016-11-17

Understanding protein folding and the functional properties of intrinsically disordered proteins (IDPs) requires detailed knowledge of the forces that act in polypeptide chains. These forces determine the dimensions and dynamics of unfolded and disordered proteins and have been suggested to impact processes such as the coupled binding and folding of IDPs, or the rate of protein folding reactions. Much of the progress in understanding the physical and chemical properties of unfolded and intrinsically disordered polypeptide chains has been made possible by the recent developments in single-molecule fluorescence techniques. However, the interpretation of the experimental results requires concepts from polymer physics in order to be understood. Here, I review some of the theories used to describe the dimensions of unfolded polypeptide chains under varying solvent conditions together with their more recent application to experimental data.

Usage of DNA Fingerprinting Technology for Quality Control in Molecular Lab Bench Work.

PubMed

McIntosh, Linda Y; Lal, Janella E; Qin, Dahui

2018-01-01

One of the major quality assurance (QA) goals in many molecular laboratories is to avoid sample pipetting errors on the lab bench; especially when pipetting into multiwell plates. A pipetting error can cause a switch in patient samples, which can lead to recording the wrong results for the patient samples involved. Such pipetting errors are difficult to identify when it happens in lab bench work. DNA fingerprinting is a powerful tool in determining sample identities. Our laboratory has explored the usage of this technology in our QA process and successfully established that DNA fingerprinting can be used to monitor possible sample switch in gene rearrangement lab bench work. We use florescent light to quench the florescence in the gene rearrangement polymerase chain reaction products. After that, DNA fingerprinting technology is used to identify the sample DNA in the gene rearrangement polymerase chain reaction plate. The result is compared with the corresponding patient's blood sample DNA to determine whether there is a sample switch during the lab bench work.

Multiplex polymerase chain reaction detection of black-pigmented bacteria in infections of endodontic origin.

PubMed

Seol, Jung-Hwan; Cho, Byung-Hoon; Chung, Chong-Pyoung; Bae, Kwang-Shik

2006-02-01

The purpose of this study was to detect the presence of Porphyromonas endodontalis, P. gingivalis, Prevotella intermedia, P. nigrescens, and P. tannerae from clinical samples using multiplex polymerase chain reactions (PCR). Two different multiplex PCR protocols were used (one for the two Porphyromonas species and the other for the three Prevotella species), each one using a primer pair specific for each target species. The results were compared to those of the conventional culture procedures. Microbial samples were taken aseptically from 40 infected root canals and abscesses from patients. Samples were cultured in an anaerobic condition for conventional identification using a Rapid ID 32 A kit. Multiplex PCR was processed using the DNA extracted from each sample. At least one of the five species of black-pigmented bacteria (BPB) were detected in 65% (26 of 40) of the samples using multiplex PCR, and in 15% (6 of 40) using the conventional culture procedures. Multiplex PCR was more rapid, sensitive, specific, and effective in detecting BPB than the conventional culture procedures.

[Usefulness of conventional polymerase chain reaction for the detection of Mycoplasma hominis, Ureaplasma spp. and Trichomonas vaginalis in female outpatient's genital samples].

PubMed

Alarcón, Gonzalo; Barraza, Gabriela; Vera, Andrea; Wozniak, Aniela; García, Patricia

2016-02-01

Trichomonas vaginalis, Mycoplasma hominis and Ureaplasma spp. are microorganisms responsible for genitourinary and pregnancy pathologies. Nucleic acid amplification methods have shown several advantages, but have not been widely studied for the detection of these microorganisms. To implement a conventional polymerase chain reaction (PCR) for the detection of the microorganisms and to compare its results versus the methods currently used at our laboratory. 91 available samples were processed by PCR, culture (M. hominis y Ureaplasma spp.) and wet mount (T vaginalis). Results were compared and statistically analyzed by kappa agreement test. 85, 80 and 87 samples resulted in agreement for the detection of M. hominis, Ureaplasma spp. y T. vaginalis, respectively. For M. hominis and Ureaplasma spp., agreement was substantial, whereas for T. vaginalis it was moderate, however, for the latter, PCR detected more cases than wet mount. We recommend the implementation of PCR for detection of T. vaginalis whereas culture kit is still a useful method for the other microorganisms.

Single quantum dot analysis enables multiplexed point mutation detection by gap ligase chain reaction.

PubMed

Song, Yunke; Zhang, Yi; Wang, Tza-Huei

2013-04-08

Gene point mutations present important biomarkers for genetic diseases. However, existing point mutation detection methods suffer from low sensitivity, specificity, and a tedious assay processes. In this report, an assay technology is proposed which combines the outstanding specificity of gap ligase chain reaction (Gap-LCR), the high sensitivity of single-molecule coincidence detection, and the superior optical properties of quantum dots (QDs) for multiplexed detection of point mutations in genomic DNA. Mutant-specific ligation products are generated by Gap-LCR and subsequently captured by QDs to form DNA-QD nanocomplexes that are detected by single-molecule spectroscopy (SMS) through multi-color fluorescence burst coincidence analysis, allowing for multiplexed mutation detection in a separation-free format. The proposed assay is capable of detecting zeptomoles of KRAS codon 12 mutation variants with near 100% specificity. Its high sensitivity allows direct detection of KRAS mutation in crude genomic DNA without PCR pre-amplification. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Mechanism of the coupling of diazonium to single-walled carbon nanotubes and its consequences.

PubMed

Schmidt, Grégory; Gallon, Salomé; Esnouf, Stéphane; Bourgoin, Jean-Philippe; Chenevier, Pascale

2009-01-01

On the tube: The coupling of diazonium ions onto single-walled carbon nanotubes is shown to proceed through a radical chain reaction by kinetic analysis of the absorption peak drop (see picture). Radical species are also revealed by ESR. Metallic (m) nanotubes play a special catalytic role in the functionalization of semiconducting (sc) nanotubes.Due to its simplicity and versatility, diazonium coupling is the most widely used method for carbon nanotube (CNT) functionalization to increase CNT processability and add new functionalities. Yet, its mechanism is so far mostly unknown. Herein, we use kinetic analysis to shed light on this complex mechanism. A free-radical chain reaction is revealed by absorption spectroscopy and ESR. Metallic CNTs are shown to play an unexpected catalytic role. The step determining the selectivity towards metallic CNTs is identified by a Hammett correlation. A mechanistic model is proposed that predicts reactivity and selectivity as a function of diazonium electrophilicity and metallic-to-semiconducting CNT ratio, thus opening perspectives of controlled high-yield functionalization and purification.

Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

PubMed

Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

2014-01-01

Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

Prediction of FAD binding sites in electron transport proteins according to efficient radial basis function networks and significant amino acid pairs.

PubMed

Le, Nguyen-Quoc-Khanh; Ou, Yu-Yen

2016-07-30

Cellular respiration is a catabolic pathway for producing adenosine triphosphate (ATP) and is the most efficient process through which cells harvest energy from consumed food. When cells undergo cellular respiration, they require a pathway to keep and transfer electrons (i.e., the electron transport chain). Due to oxidation-reduction reactions, the electron transport chain produces a transmembrane proton electrochemical gradient. In case protons flow back through this membrane, this mechanical energy is converted into chemical energy by ATP synthase. The convert process is involved in producing ATP which provides energy in a lot of cellular processes. In the electron transport chain process, flavin adenine dinucleotide (FAD) is one of the most vital molecules for carrying and transferring electrons. Therefore, predicting FAD binding sites in the electron transport chain is vital for helping biologists understand the electron transport chain process and energy production in cells. We used an independent data set to evaluate the performance of the proposed method, which had an accuracy of 69.84 %. We compared the performance of the proposed method in analyzing two newly discovered electron transport protein sequences with that of the general FAD binding predictor presented by Mishra and Raghava and determined that the accuracy of the proposed method improved by 9-45 % and its Matthew's correlation coefficient was 0.14-0.5. Furthermore, the proposed method enabled reducing the number of false positives significantly and can provide useful information for biologists. We developed a method that is based on PSSM profiles and SAAPs for identifying FAD binding sites in newly discovered electron transport protein sequences. This approach achieved a significant improvement after we added SAAPs to PSSM features to analyze FAD binding proteins in the electron transport chain. The proposed method can serve as an effective tool for predicting FAD binding sites in electron transport proteins and can help biologists understand the functions of the electron transport chain, particularly those of FAD binding sites. We also developed a web server which identifies FAD binding sites in electron transporters available for academics.

Antioxidant pool in beer and kinetics of EPR spin-trapping.

PubMed

Kocherginsky, Nikolai M; Kostetski, Yuri Yu; Smirnov, Alex I

2005-08-24

The kinetics of spin-trap adduct formation in beer oxidation exhibits an induction period if the reaction is carried out at elevated temperatures and in the presence of air. This lag period lasts until the endogenous antioxidants are almost completely depleted, and its duration is used as an indicator of the flavor stability and shelf life of beer. This paper demonstrates that the total kinetics of the process can be characterized by three parameters-the lag period, the rate of spin-trap adduct formation, and, finally, the steady-state spin-adduct concentration. A steady-state chain reaction mechanism is described, and quantitative estimates of the main kinetic parameters such as the initiation rate, antioxidant pool, effective content of organic molecules participating in the chain reactions, and the rate constant of the 1-hydroxyethyl radical EtOH(*) spin-adduct disappearance are given. An additional new dimensionless parameter is suggested to characterize the antioxidant pool-the product of the lag time and the rate of spin-trap radical formation immediately after the lag time, normalized by the steady-state concentration of the adducts. The results of spin-tapping EPR experiments are compared with the nitroxide reduction kinetics measured in the same beer samples. It is shown that although the kinetics of nitroxide reduction in beer can be used to evaluate the reducing power of beer, the latter parameter does not correlate with the antioxidant pool. The relationship of free radical processes, antioxidant pool, reducing power, and beer staling is discussed.

Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

PubMed

Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

2013-09-15

We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

PubMed Central

Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

2015-01-01

Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

Central catalytic domain of BRAP (RNF52) recognizes the types of ubiquitin chains and utilizes oligo-ubiquitin for ubiquitylation

PubMed Central

Hanada, Kazuharu; Ohsawa, Noboru

2017-01-01

Really interesting new gene (RING)-finger protein 52 (RNF52), an E3 ubiquitin ligase, is found in eukaryotes from yeast to humans. Human RNF52 is known as breast cancer type 1 susceptibility protein (BRCA1)-associated protein 2 (BRAP or BRAP2). The central catalytic domain of BRAP comprises four subdomains: nucleotide-binding α/β plait (NBP), really interesting new gene (RING) zinc finger, ubiquitin-specific protease (UBP)-like zinc finger (ZfUBP), and coiled-coil (CC). This domain architecture is conserved in RNF52 orthologs; however, the domain's function in the ubiquitin system has not been delineated. In the present study, we discovered that the RNF52 domain, comprising NBP–RING–ZfUBP–CC, binds to ubiquitin chains (oligo-ubiquitin) but not to the ubiquitin monomers, and can utilize various ubiquitin chains for ubiquitylation and auto-ubiquitylation. The RNF52 domain preferentially bound to M1- and K63-linked di-ubiquitin chains, weakly to K27-linked chains, but not to K6-, K11-, or K48-linked chains. The binding preferences of the RNF52 domain for ubiquitin-linkage types corresponded to ubiquitin usage in the ubiquitylation reaction, except for K11-, K29-, and K33-linked chains. Additionally, the RNF52 domain directly ligated the intact M1-linked, tri-, and tetra-ubiquitin chains and recognized the structural alterations caused by the phosphomimetic mutation of these ubiquitin chains. Full-length BRAP had nearly the same specificity for the ubiquitin-chain types as the RNF52 domain alone. Mass spectrometry analysis of oligomeric ubiquitylation products, mediated by the RNF52 domain, revealed that the ubiquitin-linkage types and auto-ubiquitylation sites depend on the length of ubiquitin chains. Here, we propose a model for the oligomeric ubiquitylation process, controlled by the RNF52 domain, which is not a sequential assembly process involving monomers. PMID:28768733

Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter... of high-processivity polymerase with novel internal amplification controls for rapid and specific detection.

USDA-ARS?s Scientific Manuscript database

Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowl...

An improved reaction path optimization method using a chain of conformations

NASA Astrophysics Data System (ADS)

Asada, Toshio; Sawada, Nozomi; Nishikawa, Takuya; Koseki, Shiro

2018-05-01

The efficient fast path optimization (FPO) method is proposed to optimize the reaction paths on energy surfaces by using chains of conformations. No artificial spring force is used in the FPO method to ensure the equal spacing of adjacent conformations. The FPO method is applied to optimize the reaction path on two model potential surfaces. The use of this method enabled the optimization of the reaction paths with a drastically reduced number of optimization cycles for both potentials. It was also successfully utilized to define the MEP of the isomerization of the glycine molecule in water by FPO method.

Platypus chain reaction: directional and ordered meiotic pairing of the multiple sex chromosome chain in Ornithorhynchus anatinus.

PubMed

Daish, Tasman; Casey, Aaron; Grützner, Frank

2009-01-01

Monotremes are phylogenetically and phenotypically unique animals with an unusually complex sex chromosome system that is composed of ten chromosomes in platypus and nine in echidna. These chromosomes are alternately linked (X1Y1, X2Y2, ...) at meiosis via pseudoautosomal regions and segregate to form spermatozoa containing either X or Y chromosomes. The physical and epigenetic mechanisms involved in pairing and assembly of the complex sex chromosome chain in early meiotic prophase I are completely unknown. We have analysed the pairing dynamics of specific sex chromosome pseudoautosomal regions in platypus spermatocytes during prophase of meiosis I. Our data show a highly coordinated pairing process that begins at the terminal Y5 chromosome and completes with the union of sex chromosomes X1Y1. The consistency of this ordered assembly of the chain is remarkable and raises questions about the mechanisms and factors that regulate the differential pairing of sex chromosomes and how this relates to potential meiotic silencing mechanisms and alternate segregation.

Low-energy (anti)neutrino physics with Borexino: Neutrinos from the primary proton-proton fusion process in the Sun

NASA Astrophysics Data System (ADS)

Mosteiro, P.; Bellini, G.; Benziger, J.; Bick, D.; Bonfini, G.; Bravo, D.; Caccianiga, B.; Cadonati, L.; Calaprice, F.; Caminata, A.; Cavalcante, P.; Chavarría, Á.; Chepurnov, A.; D'Angelo, D.; Davini, S.; Derbin, A.; Empl, A.; Etenko, A.; Fomenko, K.; Franco, D.; Gabriele, F.; Galbiati, C.; Gazzana, S.; Ghiano, C.; Giammarchi, M.; Göger-Neff, M.; Goretti, A.; Gromov, M.; Hagner, C.; Hungerford, E.; Ianni, Al.; Ianni, An.; Kobychev, V.; Korablëv, D.; Korga, G.; Kryn, D.; Laubenstein, M.; Lehnert, B.; Lewke, T.; Litvinovich, E.; Lombardi, F.; Lombardi, P.; Ludhova, L.; Lukyanchenko, G.; Machulin, I.; Manecki, S.; Maneschg, W.; Marcocci, S.; Meindl, Q.; Meroni, E.; Meyer, M.; Miramonti, L.; Misiaszek, M.; Montuschi, M.; Muratova, V.; Oberauer, L.; Obolensky, M.; Ortica, F.; Otis, K.; Pallavicini, M.; Papp, L.; Perasso, L.; Pocar, A.; Ranucci, G.; Razeto, A.; Re, A.; Romani, A.; Rossi, N.; Saldanha, R.; Salvo, C.; Schönert, S.; Simgen, H.; Skorokhvatov, M.; Smirnov, O.; Sotnikov, A.; Sukhotin, S.; Suvorov, Y.; Tartaglia, R.; Testera, G.; Vignaud, D.; Vogelaar, R. B.; von Feilitzsch, F.; Wang, H.; Winter, J.; Wojcik, M.; Wright, A.; Wurm, M.; Zaimidoroga, O.; Zavatarelli, S.; Zuber, K.; Zuzel, G.

2015-08-01

The Sun is fueled by a series of nuclear reactions that produce the energy that makes it shine. The primary reaction is the fusion of two protons into a deuteron, a positron and a neutrino. These neutrinos constitute the vast majority of neutrinos reaching Earth, providing us with key information about what goes on at the core of our star. Several experiments have now confirmed the observation of neutrino oscillations by detecting neutrinos from secondary nuclear processes in the Sun; this is the first direct spectral measurement of the neutrinos from the keystone proton-proton fusion. This observation is a crucial step towards the completion of the spectroscopy of pp-chain neutrinos, as well as further validation of the LMA-MSW model of neutrino oscillations.

Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

A de novo transcriptome and valid reference genes for quantitative real-time PCR in Colaphellus bowringi.

PubMed

Tan, Qian-Qian; Zhu, Li; Li, Yi; Liu, Wen; Ma, Wei-Hua; Lei, Chao-Liang; Wang, Xiao-Ping

2015-01-01

The cabbage beetle Colaphellus bowringi Baly is a serious insect pest of crucifers and undergoes reproductive diapause in soil. An understanding of the molecular mechanisms of diapause regulation, insecticide resistance, and other physiological processes is helpful for developing new management strategies for this beetle. However, the lack of genomic information and valid reference genes limits knowledge on the molecular bases of these physiological processes in this species. Using Illumina sequencing, we obtained more than 57 million sequence reads derived from C. bowringi, which were assembled into 39,390 unique sequences. A Clusters of Orthologous Groups classification was obtained for 9,048 of these sequences, covering 25 categories, and 16,951 were assigned to 255 Kyoto Encyclopedia of Genes and Genomes pathways. Eleven candidate reference gene sequences from the transcriptome were then identified through reverse transcriptase polymerase chain reaction. Among these candidate genes, EF1α, ACT1, and RPL19 proved to be the most stable reference genes for different reverse transcriptase quantitative polymerase chain reaction experiments in C. bowringi. Conversely, aTUB and GAPDH were the least stable reference genes. The abundant putative C. bowringi transcript sequences reported enrich the genomic resources of this beetle. Importantly, the larger number of gene sequences and valid reference genes provide a valuable platform for future gene expression studies, especially with regard to exploring the molecular mechanisms of different physiological processes in this species.

Electromagnetic Basis of Metabolism and Heredity

NASA Technical Reports Server (NTRS)

Freund, Friedemann; Stolc, Viktor

2016-01-01

Living organisms control their cellular biological clocks to maintain functional oscillation of the redox cycle, also called the "metabolic cycle" or "respiratory cycle". Organization of cellular processes requires parallel processing on a synchronized time-base. These clocks coordinate the timing of all biochemical processes in the cell, including energy production, DNA replication, and RNA transcription. When this universal time keeping function is perturbed by exogenous induction of reactive oxygen species (ROS), the rate of metabolism changes. This causes oxidative stress, aging and mutations. Therefore, good temporal coordination of the redox cycle not only actively prevents chemical conflict between the reductive and oxidative partial reactions; it also maintains genome integrity and lifespan. Moreover, this universal biochemical rhythm can be disrupted by ROS induction in vivo. This in turn can be achieved by blocking the electron transport chain either endogenously or exogenously by various metabolites, e.g. hydrogen sulfide (H2S), highly diffusible drugs, and carbon monoxide (CO). Alternatively, the electron transport in vivo can be attenuated via a coherent or interfering transfer of energy from exogenous ultralow frequency (ULF) and extremely low frequency (ELF) electromagnetic (EM) fields, suggesting that-on Earth-such ambient fields are an omnipresent (and probably crucially important) factor for the time-setting basis of universal biochemical reactions in living cells. Our work demonstrated previously un-described evidence for quantum effects in biology by electromagnetic coupling below thermal noise at the universal electron transport chain (ETC) in vivo.

Annihilation of photochemical reactivity of photo-alignment layer.

PubMed

Hong, S H; Hwang, Y J; Lee, S G; Shin, D M

2008-09-01

The gas-polymer and liquid-polymer interfacial reactions of photosensitive polyimide can annihilate photo-reactive carbon-carbon double bonds, which remain after photo-alignment process. The annihilation processes dramatically affect voltage holding ratio and reorientation of photo-active functional groups. Photochemical dimerizations were identified using UV-visible and FT-IR spectroscopy. Polyimide films containing cinnamate groups were irradiated by linear polarized ultra violet (LPUV) light. Schadt et al. claims that the photo-alignment results from the anisotropy depletion of the cinnamate side chains as a consequence of the (2+2) cycloaddition reactions. The photo-aligned polyimide induces the orientation of nematic liquid crystals perpendicular to the polarization axis. However, the un-reacted photo-sensitive functional groups generate problems such as image sticking and reduced contrast ratio. Voltage holding ratio and photo-fading observed from photo-alignment layer can be dramatically improved by annihilation process of remnant photoreactive groups.

Characterization of polymer composites during autoclave manufacturing by Fourier transform Raman spectroscopy

NASA Astrophysics Data System (ADS)

Farquharson, Stuart; Smith, Wayne W.; Rigas, Elias J.; Granville, Dana

2001-02-01

12 The superior engineering properties of fiber reinforced polymer matrix composites, primarily the high strength-to- weight ratio, make them suitable to applications ranging from sporting goods to aircraft components (e.g. helicopter blades). Unfortunately, consistent fabrication of components with desired mechanical properties has proven difficult, and has led to high production costs. This is largely due to the inability to monitor and control polymer cure, loosely defined as the process of polymer chain extension and cross- linking. Even with stringent process control, slight variations in the pre-polymer formulations (e.g. prepreg) can influence reaction rates, reaction mechanisms, and ultimately, product properties. In an effort to optimize the performance of thermoset composite, we have integrated fiber optic probes between the plies of laminates and monitored cure by Raman spectroscopy, with the eventual goal of process control. Here we present real-time measurements of two high performance aerospace companies cured within an industrial autoclave.

In Situ X-ray Absorption Spectroscopy Studies of Discharge Reactions in a Thick Cathode of a Lithium Sulfur Battery

DOE PAGES

Wujcik, Kevin H.; Wang, Dunyang Rita; Pascal, Tod A.; ...

2016-12-01

Lithium sulfur (Li-S) batteries are well known for their high theoretical specific capacities, but are plagued with scientific obstacles that make practical implementation of the technology impossible. The success of Li-S batteries will likely necessitate the use of thick sulfur cathodes that enable high specific energy densities. However, little is known about the fundamental reaction mechanisms and chemical processes that take place in thick cathodes, as most research has focused on studying thinner cathodes that enable high performance. In this study, in situ X-ray absorption spectroscopy at the sulfur K-edge is used to examine the back of a 115 μmmore » thick Li-S cathode during discharge. Our results show that in such systems, where electrochemical reactions between sulfur and lithium are likely to proceed preferentially toward the front of the cathode, lithium polysulfide dianions formed in this region diffuse to the back of the cathode during discharge. We show that high conversion of elemental sulfur is achieved by chemical reactions between elemental sulfur and polysulfide dianions of intermediate chain length (Li 2S x, 4 ≤ x ≤ 6). Our work suggests that controlling the formation and diffusion of intermediate chain length polysulfide dianions is crucial for insuring full utilization of thick sulfur cathodes.« less

Photoisomerization of alfa calcidol by a sensitized quantum chain reaction.

PubMed

Estruch, Gastón A; Aramendía, Pedro F

2012-01-01

The production of vitamin D3 is a pharmaceutically relevant process, producing high added-value products. Precursors are extracts from vegetal origin but bearing mainly an E geometry in the 5,6 double bond. The synthesis of vitamin D3 (5-E-α-calcidol) with the correct Z stereochemistry in the 5,6 double bond from the E isomer using anthracene and triethylamine (TEA) as the sensitizer system was studied from the kinetic and mechanistic point of view. The sensitized isomerization of E-calcidol by irradiation of anthracene takes place only in deoxygenated solution and yields the Z isomer in ca 5% yield in the photostationary state. When TEA is added to the system, the E-Z reaction is not inhibited by oxygen any more, the quantum yield of photoisomerization to the Z isomer grows linearly with the concentration of E-calcidol, while conversions higher than 95% to the Z isomer are reached in the photostationary state and E-Z quantum yields as high as 45 at [E-calcidol] = 25 mM are reached. If TEA is replaced by 1,4-diazabicyclo[2.2.2]octane, the reaction rate drops to one-third at the same amine concentration. The observations can be explained by a quantum chain reaction mechanism. The high conversion achieved eliminates the need of isomer separation. © 2011 Wiley Periodicals, Inc. Photochemistry and Photobiology © 2011 The American Society of Photobiology.

{sup 110,116}Cd({alpha},{alpha}){sup 110,116}Cd elastic scattering and systematic investigation of elastic {alpha} scattering cross sections along the Z=48 isotopic and N=62 isotonic chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kiss, G. G.; Fueloep, Zs.; Gyuerky, Gy.

2011-06-15

The elastic scattering cross sections for the reactions {sup 110,116}Cd({alpha},{alpha}){sup 110,116}Cd at energies above and below the Coulomb barrier are presented to provide a sensitive test for the {alpha}-nucleus optical potential parameter sets. Additional constraints for the optical potential are taken from the analysis of elastic scattering excitation functions at backward angles which are available in literature. Moreover, the variation of the elastic {alpha} scattering cross sections along the Z=48 isotopic and N=62 isotonic chain is investigated by the study of the ratios of the {sup 106,110,116}Cd({alpha},{alpha}){sup 106,110,116}Cd scattering cross sections at E{sub cm{approx_equal}}15.6and18.8 MeV and the ratio of themore » {sup 110}Cd({alpha},{alpha}){sup 110}Cd and {sup 112}Sn({alpha},{alpha}){sup 112}Sn reaction cross sections at E{sub cm{approx_equal}}18.8 MeV, respectively. These ratios are sensitive probes for the {alpha}-nucleus optical potential parametrizations. The potentials under study are a basic prerequisite for the prediction of {alpha}-induced reaction cross sections (e.g., for the calculation of stellar reaction rates in the astrophysical p or {gamma} process).« less

Production of polyimide ceria nanocomposites by development of molecular hook technology in nano-sonochemistry.

PubMed

Hatami, Mehdi

2018-06-01

Poly(amic acid), the precursor of polyimide (PI), was used for the preparation of PI/CeO 2 nanocomposites (NC)s by ultrasonic assisted technique via insertion of the surface modified CeO 2 nanoparticles (NP)s into PI matrix. In the preparation stages, in the first, the modifications of CeO 2 NPs by using hexadecyltrimethoxysilane (HDTMS) as a binder were targeted using ultrasonic waves. In the second step, newly designed PI structure was formed from the sonochemical imidization process as a molecular hook. In this step two different reactions were occurred. The acetic acid elimination reaction in the main chain of macromolecule, and the acetylation reaction in the side chains of poly(amic acid) were accomplished. By acetylation process the hook structure was created for trapping of the modified nanoparticles. In the final step the preparation of PI NCs were achieved by sonochemical process. The structural and thermal properties of pure PI and PI/CeO 2 NCs were studied by several techniques such as fourier transform infrared spectroscopy (FT-IR), nuclear magnetic resonance spectroscopy (NMR), field emission scanning electron microscopy (FE-SEM), transmission electron microscopy (TEM), atomic force microscopy (AFM), X-ray diffraction (XRD), and thermal analyses. FT-IR and 1 H NMR spectra confirmed the success in preparation of PI matrix. The FE-SEM, TEM, and AFM analyses showed the uniform distribution of CeO 2 NPs in PI matrix. The XRD patterns of NCs show the presence of crystalline CeO 2 NPs in amorphous PI matrix. The thermal analysis results reveal that, with increases in the content of CeO 2 NPs in PI matrix, the thermally stability factors of samples were improved. Copyright © 2018 Elsevier B.V. All rights reserved.

Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

Identification of Brucella spp. by using the polymerase chain reaction.

PubMed Central

Herman, L; De Ridder, H

1992-01-01

The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

Detection of Listeria monocytogenes by using the polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bessesen, M.T.; Luo, Q.; Blaser, M.J.

1990-09-01

A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

PubMed

Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

2012-07-09

Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

9 CFR 145.33 - Terminology and classification; flocks and products.

Code of Federal Regulations, 2010 CFR

2010-01-01

.... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

Parallel and automated library synthesis of 2-long alkyl chain benzoazoles and azole[4,5-b]pyridines under microwave irradiation.

PubMed

Martínez-Palou, Rafael; Zepeda, L Gerardo; Höpfl, Herbert; Montoya, Ascensión; Guzmán-Lucero, Diego J; Guzmán, Javier

2005-01-01

A versatile route to 40-membered library of 2-long alkyl chain substituted benzoazoles (1 and 2) and azole[4,5-b]pyridines (3 and 4) via microwave-assisted combinatorial synthesis was developed. The reactions were carried out in both monomode and multimode microwave oven. With the latter, all reactions were performed in high-throughput experimental settings consisting of an 8 x 5 combinatorial library designed to synthesize 40 compounds. Each step, from the addition of reagents to the recovery of final products, was automated. The microwave-assisted N-long chain alkylation reactions of 2-alkyl-1H-benzimidazole (1) and 2-alkyl-1H-benzimidazole[4,5-b] pyridines (3) were also studied.

Immediate hypersensitivity to moxifloxacin with tolerance to ciprofloxacin: report of three cases and review of the literature.

PubMed

Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth

2010-04-01

To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.

No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

PubMed

D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

2006-10-01

Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

Non-detection of HC11N towards TMC-1: constraining the chemistry of large carbon-chain molecules

NASA Astrophysics Data System (ADS)

Loomis, Ryan A.; Shingledecker, Christopher N.; Langston, Glen; McGuire, Brett A.; Dollhopf, Niklaus M.; Burkhardt, Andrew M.; Corby, Joanna; Booth, Shawn T.; Carroll, P. Brandon; Turner, Barry; Remijan, Anthony J.

2016-12-01

Bell et al. reported the first detection of the cyanopolyyne HC11N towards the cold dark cloud TMC-1; no subsequent detections have been reported towards any source. Additional observations of cyanopolyynes and other carbon-chain molecules towards TMC-1 have shown a log-linear trend between molecule size and column density, and in an effort to further explore the underlying chemical processes driving this trend, we have analysed Green Bank Telescope observations of HC9N and HC11N towards TMC-1. Although we find an HC9N column density consistent with previous values, HC11N is not detected and we derive an upper limit column density significantly below that reported in Bell et al. Using a state-of-the-art chemical model, we have investigated possible explanations of non-linearity in the column density trend. Despite updating the chemical model to better account for ion-dipole interactions, we are not able to explain the non-detection of HC11N, and we interpret this as evidence of previously unknown carbon-chain chemistry. We propose that cyclization reactions may be responsible for the depleted HC11N abundance, and that products of these cyclization reactions should be investigated as candidate interstellar molecules.

Interconnection of reactive oxygen species chemistry across the interfaces of atmospheric, environmental, and biological processes.

PubMed

Anglada, Josep M; Martins-Costa, Marilia; Francisco, Joseph S; Ruiz-López, Manuel F

2015-03-17

Oxidation reactions are ubiquitous and play key roles in the chemistry of the atmosphere, in water treatment processes, and in aerobic organisms. Ozone (O3), hydrogen peroxide (H2O2), hydrogen polyoxides (H2Ox, x > 2), associated hydroxyl and hydroperoxyl radicals (HOx = OH and HO2), and superoxide and ozonide anions (O2(-) and O3(-), respectively) are the primary oxidants in these systems. They are commonly classified as reactive oxygen species (ROS). Atmospheric chemistry is driven by a complex system of chain reactions of species, including nitrogen oxides, hydroxyl and hydroperoxide radicals, alkoxy and peroxy radicals, and ozone. HOx radicals contribute to keeping air clean, but in polluted areas, the ozone concentration increases and creates a negative impact on plants and animals. Indeed, ozone concentration is used to assess air quality worldwide. Clouds have a direct effect on the chemical composition of the atmosphere. On one hand, cloud droplets absorb many trace atmospheric gases, which can be scavenged by rain and fog. On the other hand, ionic species can form in this medium, which makes the chemistry of the atmosphere richer and more complex. Furthermore, recent studies have suggested that air-cloud interfaces might have a significant impact on the overall chemistry of the troposphere. Despite the large differences in molecular composition, concentration, and thermodynamic conditions among atmospheric, environmental, and biological systems, the underlying chemistry involving ROS has many similarities. In this Account, we examine ROS and discuss the chemical characteristics common to all of these systems. In water treatment, ROS are key components of an important subset of advanced oxidation processes. Ozonation, peroxone chemistry, and Fenton reactions play important roles in generating sufficient amounts of hydroxyl radicals to purify wastewater. Biochemical processes within living organisms also involve ROS. These species can come from pollutants in the environment, but they can also originate endogenously, initiated by electron reduction of molecular oxygen. These molecules have important biological signaling activities, but they cause oxidative stress when dysfunction within the antioxidant system occurs. Excess ROS in living organisms can lead to problems, such as protein oxidation-through either cleavage of the polypeptide chain or modification of amino acid side chains-and lipid oxidation.

Scope and mechanism in palladium-catalyzed isomerizations of highly substituted allylic, homoallylic, and alkenyl alcohols.

PubMed

Larionov, Evgeny; Lin, Luqing; Guénée, Laure; Mazet, Clément

2014-12-03

Herein we report the palladium-catalyzed isomerization of highly substituted allylic alcohols and alkenyl alcohols by means of a single catalytic system. The operationally simple reaction protocol is applicable to a broad range of substrates and displays a wide functional group tolerance, and the products are usually isolated in high chemical yield. Experimental and computational mechanistic investigations provide complementary and converging evidence for a chain-walking process consisting of repeated migratory insertion/β-H elimination sequences. Interestingly, the catalyst does not dissociate from the substrate in the isomerization of allylic alcohols, whereas it disengages during the isomerization of alkenyl alcohols when additional substituents are present on the alkyl chain.

Modular in situ-Functionalization Strategy: Multicomponent Polymerization via Palladium/Norbornene Cooperative Catalysis.

PubMed

Yoon, Ki-Young; Dong, Guangbin

2018-05-23

Herein, we report the palladium/norbornene cooperatively catalyzed polymerization, which simplifies synthesis of functional aromatic polymers, including conjugated polymers. Specifically, an A2B2C-type multicomponent polymerization is developed using ortho-amination/ipso-alkynylation reaction for preparing various amine-functionalized arylacetylene-containing polymers. Within a single catalytic cycle, the amine side-chains are site-selectively installed in situ via C-H activation during the polymerization process, which represents a major difference from conventional cross-coupling polymerizations. This in situ-functionalization strategy enables modular incorporation of functional side-chains from simple monomers, thereby conveniently affording a diverse range of functional polymers. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

New polymer systems: Chain extension by dianhydrides

NASA Technical Reports Server (NTRS)

Rhein, R. A.; Ingham, J. D.

1972-01-01

The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.

Mechanism and kinetics of low-temperature oxidation of a biodiesel surrogate: methyl propanoate radicals with oxygen molecule.

PubMed

Le, Xuan T; Mai, Tam V T; Ratkiewicz, Artur; Huynh, Lam K

2015-04-23

This paper presents a computational study on the low-temperature mechanism and kinetics of the reaction between molecular oxygen and alkyl radicals of methyl propanoate (MP), which plays an important role in low-temperature oxidation and/or autoignition processes of the title fuel. Their multiple reaction pathways either accelerate the oxidation process via chain branching or inhibit it by forming relatively stable products. The potential energy surfaces of the reactions between three primary MP radicals and molecular oxygen, namely, C(•)H2CH2COOCH3 + O2, CH3C(•)HCOOCH3 + O2, and CH3CH2COOC(•)H2 + O2, were constructed using the accurate composite CBS-QB3 method. Thermodynamic properties of all species as well as high-pressure rate constants of all reaction channels were derived with explicit corrections for tunneling and hindered internal rotations. Our calculation results are in good agreement with a limited number of scattered data in the literature. Furthermore, pressure- and temperature-dependent rate constants for all reaction channels on the multiwell-multichannel potential energy surfaces were computed with the quantum Rice-Ramsperger-Kassel (QRRK) and the modified strong collision (MSC) theories. This procedure resulted in a thermodynamically consistent detailed kinetic submechanism for low-temperature oxidation governed by the title process. A simplified mechanism, which consists of important reactions, is also suggested for low-temperature combustion at engine-like conditions.

Deuterium and carbon-13 NMR of the solid polymorphism of benzenehexoyl hexa-n-hexanoate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lifshitz, E.; Goldfarb,, D.; Vega, S.

Deuterium and carbon-13 NMR of specifically labeled benzenehexoyl hexa-n-hexanoate in the various solid-state phases are reported. The spectra exhibit dynamic line shapes which change discontinuously at the phase transitions. The results are interpreted in terms of sequential melting of the side chains on going from the low-temperature solid phases IV, III, etc., toward the liquid. In phase IV the molecules are very nearly static, except for fast rotation of the methyl groups about their C/sub 3/ axes. The results in phase III were quantitatively interpreted in terms of a two-site isomerization process involving simultaneous rotation by 95/sup 0/ about C/submore » 1/-C/sub 2/ and transition from gtg to g'g't (or equivalently g'tg' to ggt) for the rest of the chain. The specific rate of this reaction at 0/sup 0/C is approx. 10/sup 5/s/sup -1/. In phase II additional chain isomerization processes set-in which were, however, not analyzed quantitatively. Further motional modes, involving reorientation of whole chains about their C/sup ar/-O bonds, appear on going to phase I. In all solid phases the benzene ring remains static.« less

Ortho and parahydrogen in interstellar material

NASA Technical Reports Server (NTRS)

Reeves, R. R.; Harteck, P.

1979-01-01

The ortho/para molecular hydrogen ratio in the interstellar medium is considered. It is shown that the ortho/para ratio will be 3:1 in practically all chemical reactions, even at relatively low temperatures. Two examples of exothermic processes that will result in the formation of a 3:1 ortho:para ratio, corresponding to a high-temperature equilibrium, are examined: H2 formation via three-body or surface recombination and catalytic recombination involving electrons and H(-) ions. Gas-phase scrambling ion reactions are also discussed, and it is suggested that virtually all the H2 equilibrated via scrambling reactions involving H(+) and H3(+) ions should exist as parahydrogen in the J ? 0 quantum state. Arguments are given that deuterium cannot interfere with the long scrambling chain that results in parahydrogen formation.

Photo- and radiation chemical induced degradation of lignin model compounds.

PubMed

Lanzalunga; Bietti, M

2000-07-01

The basic mechanistic aspects of the photo- and radiation chemistry of lignin model compounds (LMCs) are discussed with respect to important processes related to lignin degradation. Several reactions occur after direct irradiation, photosensitized or radiation chemically induced oxidation of LMCs. Direct irradiation studies on LMCs have provided supportive evidence for the involvement of hydrogen abstraction reactions from phenols, beta-cleavage of substituted alpha-aryloxyacetophenones and cleavage of ketyl radicals (formed by photoreduction of aromatic ketones or hydrogen abstraction from arylglycerol beta-aryl ethers) in the photoyellowing of lignin rich pulps. Photosensitized and radiation chemically induced generation of reactive oxygen species and their reaction with LMCs are reviewed. The side-chain reactivity of LMC radical cations, generated by radiation chemical means, is also discussed in relation with the enzymatic degradation of lignin.

Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

PubMed

Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

2014-07-24

This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

Effects of reaction-kinetic parameters on modeling reaction pathways in GaN MOVPE growth

NASA Astrophysics Data System (ADS)

Zhang, Hong; Zuo, Ran; Zhang, Guoyi

2017-11-01

In the modeling of the reaction-transport process in GaN MOVPE growth, the selections of kinetic parameters (activation energy Ea and pre-exponential factor A) for gas reactions are quite uncertain, which cause uncertainties in both gas reaction path and growth rate. In this study, numerical modeling of the reaction-transport process for GaN MOVPE growth in a vertical rotating disk reactor is conducted with varying kinetic parameters for main reaction paths. By comparisons of the molar concentrations of major Ga-containing species and the growth rates, the effects of kinetic parameters on gas reaction paths are determined. The results show that, depending on the values of the kinetic parameters, the gas reaction path may be dominated either by adduct/amide formation path, or by TMG pyrolysis path, or by both. Although the reaction path varies with different kinetic parameters, the predicted growth rates change only slightly because the total transport rate of Ga-containing species to the substrate changes slightly with reaction paths. This explains why previous authors using different chemical models predicted growth rates close to the experiment values. By varying the pre-exponential factor for the amide trimerization, it is found that the more trimers are formed, the lower the growth rates are than the experimental value, which indicates that trimers are poor growth precursors, because of thermal diffusion effect caused by high temperature gradient. The effective order for the contribution of major species to growth rate is found as: pyrolysis species > amides > trimers. The study also shows that radical reactions have little effect on gas reaction path because of the generation and depletion of H radicals in the chain reactions when NH2 is considered as the end species.

The growth of carbon chains in IRC +10216 mapped with ALMA⋆

PubMed Central

Agúndez, M.; Cernicharo, J.; Quintana-Lacaci, G.; Castro-Carrizo, A.; Velilla Prieto, L.; Marcelino, N.; Guélin, M.; Joblin, C.; Martín-Gago, J. A.; Gottlieb, C. A.; Patel, N. A.; McCarthy, M. C.

2017-01-01

Linear carbon chains are common in various types of astronomical molecular sources. Possible formation mechanisms involve both bottom-up and top-down routes. We have carried out a combined observational and modeling study of the formation of carbon chains in the C-star envelope IRC +10216, where the polymerization of acetylene and hydrogen cyanide induced by ultraviolet photons can drive the formation of linear carbon chains of increasing length. We have used ALMA to map the emission of λ 3 mm rotational lines of the hydrocarbon radicals C2H, C4H, and C6H, and the CN-containing species CN, C3N, HC3N, and HC5N with an angular resolution of ~1″. The spatial distribution of all these species is a hollow, 5-10″ wide, spherical shell located at a radius of 10-20″ from the star, with no appreciable emission close to the star. Our observations resolve the broad shell of carbon chains into thinner sub-shells which are 1-2″ wide and not fully concentric, indicating that the mass loss process has been discontinuous and not fully isotropic. The radial distributions of the species mapped reveal subtle differences: while the hydrocarbon radicals have very similar radial distributions, the CN-containing species show more diverse distributions, with HC3N appearing earlier in the expansion and the radical CN extending later than the rest of the species. The observed morphology can be rationalized by a chemical model in which the growth of polyynes is mainly produced by rapid gas-phase chemical reactions of C2H and C4H radicals with unsaturated hydrocarbons, while cyanopolyynes are mainly formed from polyynes in gas-phase reactions with CN and C3N radicals. PMID:28469283

Internal Light Source-Driven Photoelectrochemical 3D-rGO/Cellulose Device Based on Cascade DNA Amplification Strategy Integrating Target Analog Chain and DNA Mimic Enzyme.

PubMed

Lan, Feifei; Liang, Linlin; Zhang, Yan; Li, Li; Ren, Na; Yan, Mei; Ge, Shenguang; Yu, Jinghua

2017-11-01

In this work, a chemiluminescence-driven collapsible greeting card-like photoelectrochemical lab-on-paper device (GPECD) with hollow channel was demonstrated, in which target-triggering cascade DNA amplification strategy was ingeniously introduced. The GPECD had the functions of reagents storage and signal collection, and the change of configuration could control fluidic path, reaction time and alterations in electrical connectivity. In addition, three-dimentional reduced graphene oxide affixed Au flower was in situ grown on paper cellulose fiber for achieving excellent conductivity and biocompatibility. The cascade DNA amplification strategy referred to the cyclic formation of target analog chain and its trigger action to hybridization chain reaction (HCR), leading to the formation of numerous hemin/G-quadruplex DNA mimic enzyme with the presence of hemin. Subjected to the catalysis of hemin/G-quadruplex, the strong chemiluminiscence of luminol-H 2 O 2 system was obtained, which then was used as internal light source to excite photoactive materials realizing the simplification of instrument. In this analyzing process, thrombin served as proof-of-concept, and the concentration of target was converted into the DNA signal output by the specific recognition of aptamer-protein and target analog chain recycling. The target analog chain was produced in quantity with the presence of target, which further triggered abundant HCR and introduced hemin/G-quadruplex into the system. The photocurrent signal was obtained after the nitrogen-doped carbon dots sensitized ZnO was stimulated by chemiluminescence. The proposed GPECD exhibited excellent specificity and sensitivity toward thrombin with a detection limit of 16.7 fM. This judiciously engineered GPECD paved a luciferous way for detecting other protein with trace amounts in bioanalysis and clinical biomedicine.

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

PubMed

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

USDA-ARS?s Scientific Manuscript database

Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

DOEpatents

Wigner, E.P.; Weinberg, A.M.

1961-01-24

A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

EPA Science Inventory

This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

ERIC Educational Resources Information Center

Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

2006-01-01

We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

PubMed

Adewale, B; Mafe, M A; Oyerinde, J P O

2005-01-01

Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

PubMed

Ragheb, Suzan Mohammed; Jimenez, Luis

Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

[The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

PubMed

Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

2014-04-01

The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

PubMed Central

Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

2014-01-01

A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

AJIPHASE®: A Highly Efficient Synthetic Method for One-Pot Peptide Elongation in the Solution Phase by an Fmoc Strategy.

PubMed

Takahashi, Daisuke; Inomata, Tatsuji; Fukui, Tatsuya

2017-06-26

We previously reported an efficient peptide synthesis method, AJIPHASE®, that comprises repeated reactions and isolations by precipitation. This method utilizes an anchor molecule with long-chain alkyl groups as a protecting group for the C-terminus. To further improve this method, we developed a one-pot synthesis of a peptide sequence wherein the synthetic intermediates were isolated by solvent extraction instead of precipitation. A branched-chain anchor molecule was used in the new process, significantly enhancing the solubility of long peptides and the operational efficiency compared with the previous method, which employed precipitation for isolation and a straight-chain aliphatic group. Another prerequisite for this solvent-extraction-based strategy was the use of thiomalic acid and DBU for Fmoc deprotection, which facilitates the removal of byproducts, such as the fulvene adduct. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Safety of medium-chain triglycerides used as an intraocular tamponading agent in an experimental vitrectomy model rabbit.

PubMed

Auriol, Sylvain; Mahieu, Laurence; Brousset, Pierre; Malecaze, François; Mathis, Véronique

2013-01-01

To evaluate safety of medium-chain triglycerides used as a possible intraocular tamponading agent. A 20-gauge pars plana vitrectomy was performed in the right eye of 28 rabbits. An ophthalmologic examination was performed every week until rabbits were killed. At days 7, 30, 60, and 90, rabbits were killed and the treated eyes were examined macroscopically and prepared for histologic examination. Principal outcome was retinal toxicity evaluated by light and electron microscopy, and secondary outcomes were the presence of medium-chain triglyceride emulsification, inflammatory reactions, and the development of cataract. Histologic examination did not reveal any retinal toxicity. Two cases of moderate emulsification were observed, but in these cases, emulsification was caused by the perioperative injection of the agent and did not increase during the postoperative period. We noted 13 cases of inflammatory reaction in vitreous cavity and no case of inflammatory reaction in anterior chamber. Two eyes developed cataract as a result of perioperative trauma to the lens with the vitreous cutter and not secondary to the presence of medium-chain triglycerides in the vitreous cavity. Medium-chain triglycerides did not induce morphologic evidence of retinal toxicity. The results suggest that medium-chain triglycerides could be a promising alternative intraocular tamponading agent for the treatment of retinal detachments.

Ostertagia circumcincta: isolation of a partial cDNA encoding an unusual member of the mitochondrial processing peptidase subfamily of M16 metallopeptidases.

PubMed

Walker, J; Tait, A

1997-11-01

A reverse-transcriptase polymerase chain reaction (PCR) procedure was used to isolate an Ostertagia circumcincta partial cDNA encoding a protein with general primary sequence features characteristic of members of the mitochondrial processing peptidase (MPP) subfamily of M16 metallopeptidases. The structural relationships of the predicted protein (Oc MPPX) with MPP subfamily proteins from other species (including the model free-living nematode Caenorhabditis elegans) were examined, and Northern analysis confirmed the expression of the Oc mppx gene in adult nematodes.

The hydrodeoxygenation of bioderived furans into alkanes.

PubMed

Sutton, Andrew D; Waldie, Fraser D; Wu, Ruilian; Schlaf, Marcel; Silks, Louis A Pete; Gordon, John C

2013-05-01

The conversion of biomass into fuels and chemical feedstocks is one part of a drive to reduce the world's dependence on crude oil. For transportation fuels in particular, wholesale replacement of a fuel is logistically problematic, not least because of the infrastructure that is already in place. Here, we describe the catalytic defunctionalization of a series of biomass-derived molecules to provide linear alkanes suitable for use as transportation fuels. These biomass-derived molecules contain a variety of functional groups, including olefins, furan rings and carbonyl groups. We describe the removal of these in either a stepwise process or a one-pot process using common reagents and catalysts under mild reaction conditions to provide n-alkanes in good yields and with high selectivities. Our general synthetic approach is applicable to a range of precursors with different carbon content (chain length). This allows the selective generation of linear alkanes with carbon chain lengths between eight and sixteen carbons.

The hydrodeoxygenation of bioderived furans into alkanes

NASA Astrophysics Data System (ADS)

Sutton, Andrew D.; Waldie, Fraser D.; Wu, Ruilian; Schlaf, Marcel; ‘Pete' Silks, Louis A.; Gordon, John C.

2013-05-01

The conversion of biomass into fuels and chemical feedstocks is one part of a drive to reduce the world's dependence on crude oil. For transportation fuels in particular, wholesale replacement of a fuel is logistically problematic, not least because of the infrastructure that is already in place. Here, we describe the catalytic defunctionalization of a series of biomass-derived molecules to provide linear alkanes suitable for use as transportation fuels. These biomass-derived molecules contain a variety of functional groups, including olefins, furan rings and carbonyl groups. We describe the removal of these in either a stepwise process or a one-pot process using common reagents and catalysts under mild reaction conditions to provide n-alkanes in good yields and with high selectivities. Our general synthetic approach is applicable to a range of precursors with different carbon content (chain length). This allows the selective generation of linear alkanes with carbon chain lengths between eight and sixteen carbons.

Resonant electron capture by aspartame and aspartic acid molecules.

PubMed

Muftakhov, M V; Shchukin, P V

2016-12-30

The processes for dissociative electron capture are the key mechanisms for decomposition of biomolecules, proteins in particular, under interaction with low-energy electrons. Molecules of aspartic acid and aspartame, i.e. modified dipeptides, were studied herein to define the impact of the side functional groups on peptide chain decomposition in resonant electron-molecular reactions. The processes of formation and decomposition of negative ions of both aspartame and aspartic acid were studied by mass spectrometry of negative ions under resonant electron capture. The obtained mass spectra were interpreted under thermochemical analysis by quantum chemical calculations. Main channels of negative molecular ions fragmentation were found and characteristic fragment ions were identified. The СООН fragment of the side chain in aspartic acid is shown to play a key role like the carboxyl group in amino acids and aliphatic oligopeptides. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Neutron-deficient superheavy nuclei obtained in the 240Pu+48Ca reaction

NASA Astrophysics Data System (ADS)

Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu. Ts.; Rykaczewski, K. P.; Abdullin, F. Sh.; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu. S.; Voinov, A. A.; Subbotin, V. G.; Sukhov, A. M.; Karpov, A. V.; Popeko, A. G.; Sabel'nikov, A. V.; Svirikhin, A. I.; Vostokin, G. K.; Hamilton, J. H.; Kovrizhnykh, N. D.; Schlattauer, L.; Stoyer, M. A.; Gan, Z.; Huang, W. X.; Ma, L.

2018-01-01

We present new results from investigations of the 240Pu+48Ca reaction at a projectile energy of 250 MeV. Three new decay chains of 285Fl were detected with decay properties mostly consistent with those measured in earlier studies. An additional chain was observed where the nuclei may decay through energy levels different from those of the other six chains registered so far. The cross section of the 240Pu(48Ca,3 n )285Fl reaction was measured to be 0 .58-0.33+0.60pb , which is a factor of about 4-5 lower than that measured in the previous experiment at 245 MeV beam energy [V. K. Utyonkov et al., Phys. Rev. C 92, 034609 (2015)., 10.1103/PhysRevC.92.034609], consistent with expectations. The origin of an additional chain consisting of a recoil, α particle, and fission event is analyzed. The assignment of 25 short-lived SF events observed in this experiment is also discussed.

Synthesis of structured triacylglycerols enriched in n-3 fatty acids by immobilized microbial lipase.

PubMed

Araújo, Maria Elisa Melo Branco de; Campos, Paula Renata Bueno; Alberto, Thiago Grando; Contesini, Fabiano Jares; Carvalho, Patrícia de Oliveira

The search for new biocatalysts has aroused great interest due to the variety of micro-organisms and their role as enzyme producers. Native lipases from Aspergillus niger and Rhizopus javanicus were used to enrich the n-3 long-chain polyunsaturated fatty acids content in the triacylglycerols of soybean oil by acidolysis with free fatty acids from sardine oil in solvent-free media. For the immobilization process, the best lipase/support ratios were 1:3 (w/w) for Aspergillus niger lipase and 1:5 (w/w) for Rhizopus javanicus lipase using Amberlite MB-1. Both lipases maintained constant activity for 6 months at 4°C. Reaction time, sardine-free fatty acids:soybean oil mole ratio and initial water content of the lipase were investigated to determine their effects on n-3 long-chain polyunsaturated fatty acids incorporation into soybean oil. Structured triacylglycerols with 11.7 and 7.2% of eicosapentaenoic acid+docosahexaenoic acid were obtained using Aspergillus niger lipase and Rhizopus javanicus lipase, decreasing the n-6/n-3 fatty acids ratio of soybean oil (11:1 to 3.5:1 and 4.7:1, respectively). The best reaction conditions were: initial water content of lipase of 0.86% (w/w), sardine-free faty acids:soybean oil mole ratio of 3:1 and reaction time of 36h, at 40°C. The significant factors for the acidolysis reaction were the sardine-free fatty acids:soybean oil mole ratio and reaction time. The characterization of structured triacylglycerols was obtained using easy ambient sonic-spray ionization mass spectrometry. The enzymatic reaction led to the formation of many structured triacylglycerols containing eicosapentaenoic acid, docosahexaenoic acid or both polyunsaturated fatty acids. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Autocatalytic formation of an iron(IV)-oxo complex via scandium ion-promoted radical chain autoxidation of an iron(II) complex with dioxygen and tetraphenylborate.

PubMed

Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi

2014-06-04

A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.

Structural investigation of nonpolar sulfur cross-linked macromolecules in petroleum

NASA Astrophysics Data System (ADS)

Adam, P.; Schmid, J. C.; Mycke, B.; Strazielle, C.; Connan, J.; Huc, A.; Riva, A.; Albrecht, P.

1993-07-01

A novel hexane-soluble nonpolar macromolecular fraction (NPMF) has been found to occur in substantial amounts (up to 32%) in sulfur-rich crude oils and a rock extract. It is highly aliphatic and has a molecular weight culminating at several thousand mass units, as proven by spectroscopic and molecular weight studies. C-S bond hydrogenolysis of NPMF with Raney nickel as a catalyst yields high proportions of aliphatic hydrocarbons in which long linear, acyclic polyisoprenoid and carotenoid chains usually predominate (except in one case) over polycyclic structures, such as steroids and hopanoids. Hence, NPMF consists mainly of macromolecules composed of low molecular weight hydrocarbon subunits cross-linked with sulfide bridges. Use of deuterated Raney nickel indicated in one case (Rozel Point oil) that the long chains and some hopanoids are multiattached to the macromolecular network, whereas other structural subunits, such as steroids or gammacerane, are essentially monoattached. Detailed structural determinations of the hydrocarbon "building blocks" of NPMF give information on their origin and the mode of formation of these macromolecules in the subsurface. Indeed, most of the building blocks can be related to algal (e.g., long linear chains, steroids, β-carotene, and related carotenoids) or bacterial (e.g., acyclic and monocyclic carotenoids, long-chain acyclic isoprenoids) precursors which essentially exist in living organisms as monounsaturated or polyunsaturated species or are easily transformed into such species by diagenetic processes (e.g., steroids). It appears that these alkenes or polyenes become selectively trapped into a macromolecular network by reaction with inorganic sulfur species produced by bacteria in a kind of natural, low-temperature, vulcanization process. This process could start at early diagenesis already in the water column or eventually continue in the bottom sediment. Although its exact nature is yet unknown, it seems likely that the cross-linking reaction can be initiated by the cleavage of sulfur species in a radical type mechanism. The alkanes formed upon desulfurization of NPMF usually represent much higher amounts than the free alkanes of the samples and show a dramatically different composition. They may deliver very useful, complementary information in studies related to source and palaeoenvironment.

Terminal alkenes as versatile chemical reporter groups for metabolic oligosaccharide engineering.

PubMed

Späte, Anne-Katrin; Schart, Verena F; Schöllkopf, Sophie; Niederwieser, Andrea; Wittmann, Valentin

2014-12-08

The Diels-Alder reaction with inverse electron demand (DAinv reaction) of 1,2,4,5-tetrazines with electron rich or strained alkenes was proven to be a bioorthogonal ligation reaction that proceeds fast and with high yields. An important application of the DAinv reaction is metabolic oligosaccharide engineering (MOE) which allows the visualization of glycoconjugates in living cells. In this approach, a sugar derivative bearing a chemical reporter group is metabolically incorporated into cellular glycoconjugates and subsequently derivatized with a probe by means of a bioorthogonal ligation reaction. Here, we investigated a series of new mannosamine and glucosamine derivatives with carbamate-linked side chains of varying length terminated by alkene groups and their suitability for labeling cell-surface glycans. Kinetic investigations showed that the reactivity of the alkenes in DAinv reactions increases with growing chain length. When applied to MOE, one of the compounds, peracetylated N-butenyloxycarbonylmannosamine, was especially well suited for labeling cell-surface glycans. Obviously, the length of its side chain represents the optimal balance between incorporation efficiency and speed of the labeling reaction. Sialidase treatment of the cells before the bioorthogonal labeling reaction showed that this sugar derivative is attached to the glycans in form of the corresponding sialic acid derivative and not epimerized to another hexosamine derivative to a considerable extent. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Hybridization chain reaction-based instantaneous derivatization technology for chemiluminescence detection of specific DNA sequences.

PubMed

Wang, Xin; Lau, Choiwan; Kai, Masaaki; Lu, Jianzhong

2013-05-07

We propose here a new amplifying strategy that uses hybridization chain reaction (HCR) to detect specific sequences of DNA, where stable DNA monomers assemble on the magnetic beads only upon exposure to a target DNA. Briefly, in the HCR process, two complementary stable species of hairpins coexist in solution until the introduction of initiator reporter strands triggers a cascade of hybridization events that yield nicked double helices analogous to alternating copolymers. Moreover, a "sandwich-type" detection strategy is employed in our design. Magnetic beads, which are functionalized with capture DNA, are reacted with the target, and sandwiched with the above nicked double helices. Then, chemiluminescence (CL) detection proceeds via an instantaneous derivatization reaction between a specific CL reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG), and the guanine nucleotides within the target DNA, reporter strands and DNA monomers for the generation of light. Our results clearly show that the amplification detection of specific sequences of DNA achieves a better performance (e.g. wide linear response range, low detection limit, and high specificity) as compared to the traditional sandwich type (capture/target/reporter) assays. Upon modification, the approach presented could be extended to detect other types of targets. We believe that this simple technique is promising for improving medical diagnosis and treatment.

A non-radioisotopic quantitative competitive polymerase chain reaction method: application in measurement of human herpesvirus 7 load.

PubMed

Kidd, I M; Clark, D A; Emery, V C

2000-06-01

Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed.

Human papillomavirus type 2 associated with pyogenic granuloma in patients without clinical evidence of warts.

PubMed

Vázquez-Martínez, Osvaldo T; González-Betancourt, Anajulia; Barboza-Cerda, María Carmen; González-González, Sergio E; Lugo-Trampe, Ángel; Welsh, Oliverio; Rojas-Martínez, Augusto; Martínez-Rodríguez, Herminia G; Ocampo-Candiani, Jorge; Ortiz-López, Rocío

2016-07-01

Pyogenic granuloma is a non-neoplastic lesion that frequently occurs in the skin and mucous membranes of children and pregnant women. The anatomical sites of pyogenic granulomas overlap with those of wart infections caused by the human papillomavirus (HPV). This study assessed the presence of HPV DNA in pyogenic granuloma samples by polymerase chain reaction. Eighteen pyogenic granuloma biopsies from patients without a clinical history or evidence of verruca in the studied area were tested for the presence of the HPV genome. The presence of HPV DNA was screened by three independent polymerase chain reaction reactions using standard consensus primer sets targeted to the L1 or E1 consensus regions of HPV genome. The HPV DNA-positive samples were genotyped using methodologies enabling the identification of up to 30 HPVs, including oncogenic, nononcogenic, and cutaneous viral types. The HPV DNA was detected in 44.4% (eight of 18) of the samples, with HPV-2 being the only type in the eight HPV DNA-positive samples. Contamination with HPV-2 sequences throughout the entire process was reliably eliminated. This report is the first to suggest an association between HPV-2 and pyogenic granuloma. This relationship is similar to that observed between HPV-2 and nongenital warts. © 2015 The International Society of Dermatology.

Food labeling issues in patients with severe food allergies: solving a hamlet-like doubt.

PubMed

Fierro, Vincenzo; Di Girolamo, Francesco; Marzano, Valeria; Dahdah, Lamia; Mennini, Maurizio

2017-06-01

We review the laws on labeling in the international community, the difficulties they pose to the food manufacturers to prepare the food labels and the methodologies to determine the concentration of potential allergens in foods. European Food Safety Authority and International Life Sciences Institute Europe are evaluating strategies to identify the threshold level of allergen that can trigger a reaction in individuals. The most used techniques to detect the presence of protein in food are Enzyme-linked immunosorbent assay, polymerase chain reaction and real time polymerase chain reaction. Researchers are now trying to apply proteomics to estimate the amount of protein within the food.In order to protect the health of consumers, the Codex Alimentarius Commission updates constantly the list of allergens. In response to these regulations, some industries have also added some precautionary allergen labeling (PAL). It was generally agreed that PAL statements needed to be visible, simple, and safe. It was suggested that PAL be standardized, an action that would occur if the 'Voluntary Incidental Trace Allergen Labelling' process was made mandatory. So far, no laboratory technique is able to reassure the consumers about the composition of foods found on the packaging. International authorities produced increasingly stringent laws, but more is still to do.

ETMB-RBF: discrimination of metal-binding sites in electron transporters based on RBF networks with PSSM profiles and significant amino acid pairs.

PubMed

Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

2013-01-01

Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation-reduction reactions. In these oxidation-reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins.

ETMB-RBF: Discrimination of Metal-Binding Sites in Electron Transporters Based on RBF Networks with PSSM Profiles and Significant Amino Acid Pairs

PubMed Central

Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

2013-01-01

Background Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation–reduction reactions. In these oxidation–reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. Methods We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. Results We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. Conclusions We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins. PMID:23405059

A facile method to synthesize boron-doped Ni/Fe alloy nano-chains as electrocatalyst for water oxidation

NASA Astrophysics Data System (ADS)

Yang, Yisu; Zhuang, Linzhou; Lin, Rijia; Li, Mengran; Xu, Xiaoyong; Rufford, Thomas E.; Zhu, Zhonghua

2017-05-01

We report a novel magnetic field assisted chemical reduction method for the synthesis of boron-doped Ni/Fe nano-chains as promising catalysts for the oxygen evolution reaction (OER). The boron-doped Ni/Fe nano-chains were synthesised in a one step process at room temperature using NaBH4 as a reducing agent. The addition of boron reduced the magnetic moment of the intermediate synthesis products and produced nano-chains with a high specific surface area of 73.4 m2 g-1. The boron-doped Ni/Fe nano-chains exhibited catalytic performance superior to state-of-the-art Ba0.5Sr0.5Co0.8Fe0.2O3-δ perovskite and RuO2 noble metal oxide catalysts. The mass normalized activity of the boron-doped Ni/Fe nano-chains measured at an overpotential of 0.35 V was 64.0 A g-1, with a Tafel slope of only 40 mV dec-1. The excellent performance of the boron-doped Ni/Fe nano-chains can be attributed to the uniform elemental distribution and highly amorphous structure of the B-doped nano-chains. These results provide new insights into the effect of doping transition-metal based OER catalysts with non-metallic elements. The study demonstrates a facile approach to prepare transition metal nano-chains using magnetic field assisted chemical reduction method as cheap and highly active catalysts for electrochemical water oxidation.

Chemical reactions occurring during direct solar reduction of CO2.

PubMed

Lyma, J L; Jensen, R J

2001-09-28

At high temperatures carbon dioxide may absorb solar radiation and react to form carbon monoxide and molecular oxygen. The CO, so produced, may be converted by well-established means to a combustible fuel, such as methanol. We intend to make a future demonstration of the solar reduction of CO2 based on these processes. This paper, however, addresses only the problem of preserving, or even enhancing, the initial photolytic CO by quenching the hot gas with colder H2O or CO2. We present model calculations with a reaction mechanism used extensively in other calculations. If a CO2 gas stream is heated and photolyzed by intense solar radiation and then allowed to cool slowly, it will react back to the initial CO2 by a series of elementary chemical reactions. The back reaction to CO2 can be terminated with the rapid addition of CO2, water, or a mixture. Calculations show that a three-fold quench with pure CO2 will stop the reactions and preserve over 90% of the initial photolytic CO. We find that water has one of two effects. It can either increase the CO level, or it can catalyze the recombination of O and CO to CO2. The gas temperature is the determining factor. If the quench gas is not sufficient to keep the temperature below approximately 1100 K, a chain-branching reaction dominates and the reaction to CO2 occurs. If the temperature stays below that level a chain terminating reaction dominates and the CO is increased. The former case occurs below approximately a fourfold quench with a water/CO2 mixture. The later case occurs when the quench is greater than fourfold. We conclude that CO2, H2O, or a mixture may quench the hot gas stream photolyzed by solar radiation and preserve the photolytic CO.

Method for polymer synthesis in a reaction well

DOEpatents

Brennan, Thomas M.

1998-01-01

A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

Method for polymer synthesis in a reaction well

DOEpatents

Brennan, T.M.

1998-09-29

A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

PubMed Central

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

Treesearch

David E. Schreiber; Karen J. Garner; James M. Slavicek

1997-01-01

Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

Synthesis of nonionic-anionic colloidal systems based on alkaline and ammonium β-nonylphenol polyethyleneoxy (n = 3-20) propionates/dodecylbenzenesulfonates with prospects for food hygiene

PubMed Central

2012-01-01

Background The main objective of this work was to obtain a binary system of surface-active components (nonionic soap – alkaline and/or ammonium dodecylbenzenesulfonate) with potential competences in food hygiene, by accessing a scheme of classical reactions (cyanoethylation, total acid hydrolysis and stoichiometric neutralization with inorganic alkaline and/or organic ammonium bases) adapted to heterogeneously polyethoxylated nonylphenols (n = 3-20). In the processing system mentioned, dodecylbenzenesulfonic acid, initially the acid catalyst for the exhaustive hydrolysis of β-nonylphenolpolyethyleneoxy (n = 3-20) propionitriles, becomes together with the nonionic soap formed the second surface-active component of the binary system. Results In the reaction scheme adopted the influence of the main operating (duration, temperature, molar ratio of reagents) and structural parameters (degree of oligomerization of the polyoxyethylene chain) on the processing yields for the synthetic steps was followed. The favorable role of the polyoxyethylene chain size is remarked, through its specific conformation and its alkaline cations sequestration competences on the yields of cyanoethylation, but also the beneficial influence of phase-transfer catalysts in the total acid hydrolysis step. The chemical stability of dodecylbenzenesulfonic acid (DBSH) at the temperature and strongly acidic pH of the reaction environment is confirmed. The controlled change of the amount of DBSH in the final binary system will later confer it potential colloidal competences in food hygiene receipts. Conclusions The preliminary synthetic tests performed confirmed the prospect of obtaining a broad range of useful colloidal competences in various food hygiene scenarios. PMID:22958389

High-throughput microfluidic single-cell digital polymerase chain reaction.

PubMed

White, A K; Heyries, K A; Doolin, C; Vaninsberghe, M; Hansen, C L

2013-08-06

Here we present an integrated microfluidic device for the high-throughput digital polymerase chain reaction (dPCR) analysis of single cells. This device allows for the parallel processing of single cells and executes all steps of analysis, including cell capture, washing, lysis, reverse transcription, and dPCR analysis. The cDNA from each single cell is distributed into a dedicated dPCR array consisting of 1020 chambers, each having a volume of 25 pL, using surface-tension-based sample partitioning. The high density of this dPCR format (118,900 chambers/cm(2)) allows the analysis of 200 single cells per run, for a total of 204,000 PCR reactions using a device footprint of 10 cm(2). Experiments using RNA dilutions show this device achieves shot-noise-limited performance in quantifying single molecules, with a dynamic range of 10(4). We performed over 1200 single-cell measurements, demonstrating the use of this platform in the absolute quantification of both high- and low-abundance mRNA transcripts, as well as micro-RNAs that are not easily measured using alternative hybridization methods. We further apply the specificity and sensitivity of single-cell dPCR to performing measurements of RNA editing events in single cells. High-throughput dPCR provides a new tool in the arsenal of single-cell analysis methods, with a unique combination of speed, precision, sensitivity, and specificity. We anticipate this approach will enable new studies where high-performance single-cell measurements are essential, including the analysis of transcriptional noise, allelic imbalance, and RNA processing.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yao, Kaisheng; Henan Normal University, School of Chemistry and Environmental Science, Key Laboratory of Green Chemical Media and Reactions, Xin xiang, Henan 453007; Lu, Weiwei

A novel method was proposed for successful fabrication of CuS nanostructures with various morphologies. At the ionic liquids (ILs)-modulated CHCl{sub 3}-H{sub 2}O interface, copper cupferronate [Cu(cup){sub 2}] in CHCl{sub 3} reacted with thiourea in water to generate CuS nanostructures via a solvothermal reaction process. The effects of alkyl chain length of imidazolium cations and nature of anions of the ILs, molar ratio of Cu(cup){sub 2} to thiourea, the reaction temperature and time on the morphology of the products were studied systematically. It was shown that by changing alkyl chain length of imidazolium cations and nature of anions of the ILs,more » CuS nanostructures with various morphologies, including flowers, urchins, large nanodisks and nanoparticles, could be obtained at the liquid-liquid interface, and the ILs played important template roles in directing the formation of CuS nanostructures. Furthermore, the as-prepared CuS samples exhibited high catalytic activity for photodegradation of methyl orange and thermal decomposition of ammonium perchlorate. - Graphical abstract: At the ionic liquids-modulated CHCl{sub 3}-H{sub 2}O interface, the CuS nanostructures with the various morphologies of flowers, urchins, large nanodisks and nanoparticles have been successfully prepared via a solvothermal reaction process. Highlights: Black-Right-Pointing-Pointer The properties of oil-H{sub 2}O interface can be modulated by employing different ILs. Black-Right-Pointing-Pointer The modulated interface has been used to prepare CuS nanostructures with various morphologies. Black-Right-Pointing-Pointer The CuS samples exhibited high catalytic activity for the photodegradation of methyl orange.« less

The Beta-Delayed Proton and Gamma Decay of 27P for Nuclear Astrophysics

NASA Astrophysics Data System (ADS)

McCleskey, E.; Banu, A.; McCleskey, M.; Roeder, B.; Saastamoinen, A.; Spiridon, A.; Trache, L.; Tribble, R. E.; Davinson, T.; Doherty, D.; Lotay, G. J.; Wallace, J.; Woods, P. J.

2013-10-01

The main creation site of 26Al is currently under debate. The reactions for its creation or destruction are also not completely known. When 26Al is created in novae, the reaction chain is: 24Mg(p,γ)25Al(β + v)25Mg(p,γ)26Al, but this chain can be by-passed by another chain: 25Al(p,γ)26Si(p,γ)27P and it can also be destroyed directly. Another way to by-pass it is through 26mAl(p,γ)27Si* which is dominated by resonant capture. Using the Momentum Achromat Recoil Spectrometer (MARS) at the Texas A&M Cyclotron Institute and inverse kinematics, this destruction reaction was studied by the beta-delayed proton and gamma decay of 27P. Due to selection rules, states populated above the proton threshold in the compound system (27Si*) can decay to 26mAl, which are the states of interest for the capture reaction. James Madison University, VA, USA.

Ternary Phase-Separation Investigation of Sol-Gel Derived Silica from Ethyl Silicate 40

PubMed Central

Wang, Shengnan; Wang, David K.; Smart, Simon; Diniz da Costa, João C.

2015-01-01

A ternary phase-separation investigation of the ethyl silicate 40 (ES40) sol-gel process was conducted using ethanol and water as the solvent and hydrolysing agent, respectively. This oligomeric silica precursor underwent various degrees of phase separation behaviour in solution during the sol-gel reactions as a function of temperature and H2O/Si ratios. The solution composition within the immiscible region of the ES40 phase-separated system shows that the hydrolysis and condensation reactions decreased with decreasing reaction temperature. A mesoporous structure was obtained at low temperature due to weak drying forces from slow solvent evaporation on one hand and formation of unreacted ES40 cages in the other, which reduced network shrinkage and produced larger pores. This was attributed to the concentration of the reactive sites around the phase-separated interface, which enhanced the condensation and crosslinking. Contrary to dense silica structures obtained from sol-gel reactions in the miscible region, higher microporosity was produced via a phase-separated sol-gel system by using high H2O/Si ratios. This tailoring process facilitated further condensation reactions and crosslinking of silica chains, which coupled with stiffening of the network, made it more resistant to compression and densification. PMID:26411484

Redox regulation of mitochondrial function with emphasis on cysteine oxidation reactions.

PubMed

Mailloux, Ryan J; Jin, Xiaolei; Willmore, William G

2014-01-01

Mitochondria have a myriad of essential functions including metabolism and apoptosis. These chief functions are reliant on electron transfer reactions and the production of ATP and reactive oxygen species (ROS). The production of ATP and ROS are intimately linked to the electron transport chain (ETC). Electrons from nutrients are passed through the ETC via a series of acceptor and donor molecules to the terminal electron acceptor molecular oxygen (O2) which ultimately drives the synthesis of ATP. Electron transfer through the respiratory chain and nutrient oxidation also produces ROS. At high enough concentrations ROS can activate mitochondrial apoptotic machinery which ultimately leads to cell death. However, if maintained at low enough concentrations ROS can serve as important signaling molecules. Various regulatory mechanisms converge upon mitochondria to modulate ATP synthesis and ROS production. Given that mitochondrial function depends on redox reactions, it is important to consider how redox signals modulate mitochondrial processes. Here, we provide the first comprehensive review on how redox signals mediated through cysteine oxidation, namely S-oxidation (sulfenylation, sulfinylation), S-glutathionylation, and S-nitrosylation, regulate key mitochondrial functions including nutrient oxidation, oxidative phosphorylation, ROS production, mitochondrial permeability transition (MPT), apoptosis, and mitochondrial fission and fusion. We also consider the chemistry behind these reactions and how they are modulated in mitochondria. In addition, we also discuss emerging knowledge on disorders and disease states that are associated with deregulated redox signaling in mitochondria and how mitochondria-targeted medicines can be utilized to restore mitochondrial redox signaling.

Protein control of true, gated, and coupled electron transfer reactions.

PubMed

Davidson, Victor L

2008-06-01

Electron transfer (ET) through and between proteins is a fundamental biological process. The rates of ET depend upon the thermodynamic driving force, the reorganization energy, and the degree of electronic coupling between the reactant and product states. The analysis of protein ET reactions is complicated by the fact that non-ET processes might influence the observed ET rate in kinetically complex biological systems. This Account describes studies of the methylamine dehydrogenase-amicyanin-cytochrome c-551i protein ET complex that have revealed the influence of several features of the protein structure on the magnitudes of the physical parameters for true ET reactions and how they dictate the kinetic mechanisms of non-ET processes that sometimes influence protein ET reactions. Kinetic and thermodynamic studies, coupled with structural information and biochemical data, are necessary to fully describe the ET reactions of proteins. Site-directed mutagenesis can be used to elucidate specific structure-function relationships. When mutations selectively alter the electronic coupling, reorganization energy, or driving force for the ET reaction, it becomes possible to use the parameters of the ET process to determine how specific amino acid residues and other features of the protein structure influence the ET rates. When mutations alter the kinetic mechanism for ET, one can determine the mechanisms by which non-ET processes, such as protein conformational changes or proton transfers, control the rates of ET reactions and how specific amino acid residues and certain features of the protein structure influence these non-ET reactions. A complete description of the mechanism of regulation of biological ET reactions enhances our understanding of metabolism, respiration, and photosynthesis at the molecular level. Such information has important medical relevance. Defective protein ET leads to production of the reactive oxygen species and free radicals that are associated with aging and many disease states. Defective ET within the respiratory chain also causes certain mitochondrial myopathies. An understanding of the mechanisms of regulation of protein ET is also of practical value because it provides a logical basis for the design of applications utilizing redox enzymes, such as enzyme-based electrode sensors and fuel cells.

Additional chain-branching pathways in the low-temperature oxidation of branched alkanes

DOE PAGES

Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; ...

2015-12-31

Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C 8H 14O 4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C 8H 16O 5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C 8H 16O 5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O 2 addition, intramolecular isomerization, and OH release; C 8H 14O 4 species are proposed to result from subsequent reactions of C 8H 16O 5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less

An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

PubMed Central

Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

2005-01-01

Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

Blood grouping based on PCR methods and agarose gel electrophoresis.

PubMed

Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

2015-01-01

The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

Excitation wavelength dependence of excited state intramolecular proton transfer reaction of 4'-N,N-diethylamino-3-hydroxyflavone in room temperature ionic liquids studied by optical Kerr gate fluorescence measurement.

PubMed

Suda, Kayo; Terazima, Masahide; Sato, Hirofumi; Kimura, Yoshifumi

2013-10-17

Excited state intramolecular proton transfer reactions (ESIPT) of 4'-N,N-diethylamino-3-hydroxyflavone (DEAHF) in ionic liquids have been studied by steady-state and time-resolved fluorescence measurements at different excitation wavelengths. Steady-state measurements show the relative yield of the tautomeric form to the normal form of DEAHF decreases as excitation wavelength is increased from 380 to 450 nm. The decrease in yield is significant in ionic liquids that have cations with long alkyl chains. The extent of the decrease is correlated with the number of carbon atoms in the alkyl chains. Time-resolved fluorescence measurements using optical Kerr gate spectroscopy show that ESIPT rate has a strong excitation wavelength dependence. There is a large difference between the spectra at a 200 ps delay from different excitation wavelengths in each ionic liquid. The difference is pronounced in ionic liquids having a long alkyl chain. The equilibrium constant in the electronic excited state obtained at a 200 ps delay and the average reaction rate are also correlated with the alkyl chain length. Considering the results of the steady-state fluorescence and time-resolved measurements, the excitation wavelength dependence of ESIPT is explained by state selective excitation due to the difference of the solvation, and the number of alkyl chain carbon atoms is found to be a good indicator of the effect of inhomogeneity for this reaction.

Isothermal Maxwell demon as a quantum ``sewing machine''

NASA Astrophysics Data System (ADS)

Čápek, V.

1998-04-01

A model of an open microscopic quantum system interacting with an isothermal bath and able to bind actively particles from a reservoir to their even excited bound states at the cost of the bath energy is presented. The binding (potentially important in, e.g., chain reactions-hence ``sewing'') is due to dynamic processes in a central part of the system accompanying the particle transfer. The outcome thus challenges the second law of thermodynamics.

Atomic-Oxygen Effects on POSS Polyimides in Low Earth Orbit

DTIC Science & Technology

2012-01-11

one. Figure 2. Reaction scheme for the synthesis of the N-[(hepta-isobutylPOSS) propyl ]-3,5- diaminobenzamide monomer used to prepare side-chain (SC...atomic oxygen. Earlier results from laboratory- and space-based studies are given, as well as new information on the synthesis and in-space...methods.39,40 Polyimide synthesis and processing was pioneered by workers at Dupont in the 1950’s, with Kapton being the first commercially

Stability in chemical and biological systems: Multistage polyenzymatic reactions

NASA Astrophysics Data System (ADS)

Varfolomeev, S. D.; Lukovenkov, A. V.

2010-08-01

General principles of the theory of stability of solutions to differential equations are considered. The stability of equations describing the dynamics of changes in reagent concentrations in polyenzymatic biochemical chains is analyzed. Various mechanisms of formation of stable and unstable stationary states are considered, and unbalanced regimes and collapse are analyzed. The influence of systems of toxins and drugs on stability is studied. An interpretation of pathological processes based on stability theory is given.

Nonproductive events in ring-closing metathesis using ruthenium catalysts.

PubMed

Stewart, Ian C; Keitz, Benjamin K; Kuhn, Kevin M; Thomas, Renee M; Grubbs, Robert H

2010-06-30

The relative TONs of productive and nonproductive metathesis reactions of diethyl diallylmalonate are compared for eight different ruthenium-based catalysts. Nonproductive cross metathesis is proposed to involve a chain-carrying ruthenium methylidene. A second more-challenging substrate (dimethyl allylmethylallylmalonate) that forms a trisubstituted olefin product is used to further delineate the effect of catalyst structure on the relative efficiencies of these processes. A steric model is proposed to explain the observed trends.

Characterization of the Aerobic Oxidation of cis-Dichloroethene and Vinyl Chloride in Support of Bioremediation of Chloroethene-Contaminated Sites

DTIC Science & Technology

2004-11-05

perchloroethylene) PCR polymerase chain reaction SERDP Strategic Environmental Research and Development Program TCE trichloroethene VC vinyl chloride iv...from one of the enrichments, which was inoculated with activated carbon from a pump-and-treat plant (Dortmund, Germany) processing chloroethene...dependent enzyme activity in extracts from VC and ethene-grown cells 8 (Coleman and Spain, 2003a). PCR amplifications using primers targeted at

A Bullet-Block Experiment that Explains the Chain Fountain

NASA Astrophysics Data System (ADS)

Pantaleone, J.; Smith, R.

2018-05-01

It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.

DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

PubMed

Focke, Felix; Haase, Ilka; Fischer, Markus

2011-01-26

Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

Pilot study of the utility and acceptability of tampon sampling for the diagnosis of Neisseria gonorrhoeae and Chlamydia trachomatis infections by duplex realtime polymerase chain reaction in United Kingdom sex workers.

PubMed

Kimmitt, P T; Tabrizi, S N; Crosatti, M; Garland, S M; Schober, P C; Rajakumar, K; Chapman, C A

2010-04-01

We aimed to evaluate the acceptability of self-collected tampon samples for the screening of female sex workers for sexually transmitted infections. We recruited 65 sex workers, and 63 agreed to provide tampon samples. The tampon samples were processed by realtime polymerase chain reaction (PCR) targeting Neisseria gonorrhoeae and Chlamydia trachomatis. Urethral and endocervical swabs were also obtained from 61 of 63 participants and tested using culture (N. gonorrhoeae) and the BD ProbeTec strand displacement amplification (SDA) (C. trachomatis) assay. Tampon sampling was preferred by 95% of the women and all favoured being tested away from genitourinary medicine clinics; the most common reasons cited were avoidance of embarrassment (40%) and convenience (30%). Besides near-universal acceptability of tampon sampling, the tampon sampling-PCR approach described in this study appeared to have enhanced sensitivity compared with conventional testing, suggesting the possibility of a residual hidden burden of N. gonorrhoeae and/or C. trachomatis genital infections in UK female sex workers.

Radical formation, chemical processing, and explosion of interstellar grains

NASA Technical Reports Server (NTRS)

Greenberg, J. M.

1976-01-01

The ultraviolet radiation in interstellar space is shown to create a sufficient steady-state density of free radicals in the grain mantle material consisting of oxygen, carbon, nitrogen, and hydrogen to satisfy the critical condition for initiation of chain reactions. The criterion for minimum critical particle size for maintaining the chain reaction is of the order of the larger grain sizes in a distribution satisfying the average extinction and polarization measures. The triggering of the explosion of interstellar grains leading to the ejection of complex interstellar molecules is shown to be most probable where the grains are largest and where radiation is suddenly introduced; i.e., in regions of new star formation. Similar conditions prevail at the boundaries between very dark clouds and H II regions. When the energy released by the chemical activity of the free radicals is inadequate to explode the grain, the resulting mantle material must consist of extremely large organic molecules which are much more resistant to the hostile environment of H II regions than the classical dirty-ice mantles made up of water, methane, and ammonia.

Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics.

PubMed

Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

2014-02-20

Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

Simplified transient isotachophoresis/capillary gel electrophoresis method for highly sensitive analysis of polymerase chain reaction samples on a microchip with laser-induced fluorescence detection.

PubMed

Liu, Dayu; Ou, Ziyou; Xu, Mingfei; Wang, Lihui

2008-12-19

We present a sensitive, simple and robust on-chip transient isotachophoresis/capillary gel electrophoresis (tITP/CGE) method for the analysis of polymerase chain reaction (PCR) samples. Using chloride ions in the PCR buffer and N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES) in the background electrolyte, respectively, as the leading and terminating electrolytes, the tITP preconcentration was coupled with CGE separation with double-T shaped channel network. The tITP/CGE separation was carried out with a single running buffer. The separation process involved only two steps that were performed continuously with the sequential switching of four voltage outputs. The tITP/CGE method showed an analysis time and a separation efficiency comparable to those of standard CGE, while the signal intensity was enhanced by factors of over 20. The limit of detection of the chip-based tITP/CGE method was estimated to be 1.1 ng/mL of DNA in 1x PCR buffer using confocal fluorescence detection following 473 nm laser excitation.

Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

NASA Astrophysics Data System (ADS)

Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

2014-02-01

Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

Influence of side chain conformation and configuration on glycosyl donor reactivity and selectivity as illustrated by sialic acid donors epimeric at the 7-position.

PubMed

Kancharla, Pavan K; Crich, David

2013-12-18

Two N-acetyl 4O,5N-oxazolidinone-protected sialyl thioglycosides epimeric at the 7-position have been synthesized and their reactivity and stereoselectivity in glycosylation reactions have been compared. It is demonstrated that the natural 7S-donor is both more reactive and more α-selective than the unnatural 7R-isomer. The difference in reactivity is attributed to the side chain conformation and specifically to the proximity of O7 to the anomeric center. In the natural 7S-isomer, O7 is closer to the anomeric center than in its unnatural 7R-epimer and, therefore, better able to support incipient positive charge at the locus of reaction. The difference in selectivity is also attributed to the side conformation, which in the unnatural 7R-series is placed perpendicularly above the α-face of the donor and so shields it to a greater extent than in the 7S-series. These observations are consistent with earlier conclusions on the influence of the side chain conformation on reactivity and selectivity derived from conformationally locked models in the glucose and galactose series and corroborate the suggestion that those effects are predominantly stereoelectronic rather than torsional. The possible relevance of side chain conformation as a factor in the influence of glycosylation stereoselectivity by remote protecting groups and as a control element in enzymic processes for glycosidic bond formation and hydrolysis are discussed. Methods for assignment of the anomeric configuration in the sialic acid glycosides are critically surveyed.

Chemical Modification of Polysaccharides

PubMed Central

Cumpstey, Ian

2013-01-01

This review covers methods for modifying the structures of polysaccharides. The introduction of hydrophobic, acidic, basic, or other functionality into polysaccharide structures can alter the properties of materials based on these substances. The development of chemical methods to achieve this aim is an ongoing area of research that is expected to become more important as the emphasis on using renewable starting materials and sustainable processes increases in the future. The methods covered in this review include ester and ether formation using saccharide oxygen nucleophiles, including enzymatic reactions and aspects of regioselectivity; the introduction of heteroatomic nucleophiles into polysaccharide chains; the oxidation of polysaccharides, including oxidative glycol cleavage, chemical oxidation of primary alcohols to carboxylic acids, and enzymatic oxidation of primary alcohols to aldehydes; reactions of uronic-acid-based polysaccharides; nucleophilic reactions of the amines of chitosan; and the formation of unsaturated polysaccharide derivatives. PMID:24151557

Sustainable synthesis of aldehydes, ketones or acids from neat alcohols using nitrogen dioxide gas, and related reactions.

PubMed

Naimi-Jamal, M Reza; Hamzeali, Hamideh; Mokhtari, Javad; Boy, Jürgen; Kaupp, Gerd

2009-01-01

Benzylic alcohols are quantitatively oxidized by gaseous nitrogen dioxide to give pure aromatic aldehydes. The reaction gas mixtures are transformed to nitric acid, which renders the processes free of waste. The exothermic gas-liquid or gas-solid reactions profit from the solubility of nitrogen dioxide in the neat benzylic alcohols. The acid formed impedes further oxidation of the benzaldehydes. The neat isolated benzaldehydes and nitrogen dioxide quantitatively give the benzoic acids. Solid long-chain primary alcohols are directly and quantitatively oxidized with nitrogen dioxide gas to give the fatty acids in the solid state. The oxidations with ubiquitous nitrogen dioxide are extended to solid heterocyclic thioamides, which gives disulfides, and to diphenylamine, which gives tetraphenylhydrazine. These sustainable (green) specific oxidation procedures produce no dangerous residues from the oxidizing agent or from auxiliaries.

Numerical simulation of transport and sequential biodegradation of chlorinated aliphatic hydrocarbons using CHAIN_2D

NASA Astrophysics Data System (ADS)

Schaerlaekens, J.; Mallants, D.; Imûnek, J.; van Genuchten, M. Th.; Feyen, J.

1999-12-01

Microbiological degradation of perchloroethylene (PCE) under anaerobic conditions follows a series of chain reactions, in which, sequentially, trichloroethylene (TCE), cis-dichloroethylene (c-DCE), vinylchloride (VC) and ethene are generated. First-order degradation rate constants, partitioning coefficients and mass exchange rates for PCE, TCE, c-DCE and VC were compiled from the literature. The parameters were used in a case study of pump-and-treat remediation of a PCE-contaminated site near Tilburg, The Netherlands. Transport, non-equilibrium sorption and biodegradation chain processes at the site were simulated using the CHAIN_2D code without further calibration. The modelled PCE compared reasonably well with observed PCE concentrations in the pumped water. We also performed a scenario analysis by applying several increased reductive dechlorination rates, reflecting different degradation conditions (e.g. addition of yeast extract and citrate). The scenario analysis predicted considerably higher concentrations of the degradation products as a result of enhanced reductive dechlorination of PCE. The predicted levels of the very toxic compound VC were now an order of magnitude above the maximum permissible concentration levels.

Central catalytic domain of BRAP (RNF52) recognizes the types of ubiquitin chains and utilizes oligo-ubiquitin for ubiquitylation.

PubMed

Shoji, Shisako; Hanada, Kazuharu; Ohsawa, Noboru; Shirouzu, Mikako

2017-09-07

Really interesting new gene (RING)-finger protein 52 (RNF52), an E3 ubiquitin ligase, is found in eukaryotes from yeast to humans. Human RNF52 is known as breast cancer type 1 susceptibility protein (BRCA1)-associated protein 2 (BRAP or BRAP2). The central catalytic domain of BRAP comprises four subdomains: nucleotide-binding α/β plait (NBP), really interesting new gene (RING) zinc finger, ubiquitin-specific protease (UBP)-like zinc finger (ZfUBP), and coiled-coil (CC). This domain architecture is conserved in RNF52 orthologs; however, the domain's function in the ubiquitin system has not been delineated. In the present study, we discovered that the RNF52 domain, comprising NBP-RING-ZfUBP-CC, binds to ubiquitin chains (oligo-ubiquitin) but not to the ubiquitin monomers, and can utilize various ubiquitin chains for ubiquitylation and auto-ubiquitylation. The RNF52 domain preferentially bound to M1- and K63-linked di-ubiquitin chains, weakly to K27-linked chains, but not to K6-, K11-, or K48-linked chains. The binding preferences of the RNF52 domain for ubiquitin-linkage types corresponded to ubiquitin usage in the ubiquitylation reaction, except for K11-, K29-, and K33-linked chains. Additionally, the RNF52 domain directly ligated the intact M1-linked, tri-, and tetra-ubiquitin chains and recognized the structural alterations caused by the phosphomimetic mutation of these ubiquitin chains. Full-length BRAP had nearly the same specificity for the ubiquitin-chain types as the RNF52 domain alone. Mass spectrometry analysis of oligomeric ubiquitylation products, mediated by the RNF52 domain, revealed that the ubiquitin-linkage types and auto-ubiquitylation sites depend on the length of ubiquitin chains. Here, we propose a model for the oligomeric ubiquitylation process, controlled by the RNF52 domain, which is not a sequential assembly process involving monomers. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

Radiolysis of N-acetyl amino acids as model compounds for radiation degradation of polypeptides

NASA Astrophysics Data System (ADS)

Wayne Garrett, R.; Hill, David J. T.; Ho, Sook-Ying; O'Donnell, James H.; O'Sullivan, Paul W.; Pomery, Peter J.

Radiation chemical yields of (i) the volatile radiolysis products and (ii) the trapped free radicals from the y-radiolysis of the N-acetyl derivatives of glycine, L-valine, L-phenylalanine and L-tyrosine in the polycrystalline state have been determined at room temperature (303 K). Carbon dioxide was found to be the major molecular product for all these compounds with G(CO 2) varying from 0.36 for N-acetyl-L-tyrosine to 8 for N-acetyl-L-valine. There was evidence for some scission of the N-C α bond, indicated by the production of acetamide and the corresponding aliphatic acid, but the determination reaction was found to be of much lesser importance than the decarboxylation reaction. A protective effect of the aromatic ring in N-acetyl-L-phenylalanine and in N-acetyl-L-tyrosine was indicated by the lower yields of volatile products for these compounds. The yields of trapped free radicals were found to vary with the nature of the amino acid side chain, increasing with chain length and chain branching. The radical yields were decreased by incorporation of an aromatic moiety in the side chain, this effect being greater for the tyrosyl side chain than for the phenyl side chain. The G(R·) values showed a good correlation with G(CO 2) indicating that a common reaction may be involved in radical production and carbon dioxide formation.

THE RADIATIVE NEUTRON CAPTURE ON 2H, 6Li, 7Li, 12C AND 13C AT ASTROPHYSICAL ENERGIES

NASA Astrophysics Data System (ADS)

Dubovichenko, Sergey; Dzhazairov-Kakhramanov, Albert; Burkova, Natalia

2013-05-01

The continued interest in the study of radiative neutron capture on atomic nuclei is due, on the one hand, to the important role played by this process in the analysis of many fundamental properties of nuclei and nuclear reactions, and, on the other hand, to the wide use of the capture cross-section data in the various applications of nuclear physics and nuclear astrophysics, and, also, to the importance of the analysis of primordial nucleosynthesis in the Universe. This paper is devoted to the description of results for the processes of the radiative neutron capture on certain light atomic nuclei at thermal and astrophysical energies. The consideration of these processes is done within the framework of the potential cluster model (PCM), general description of which was given earlier. The methods of usage of the results obtained, based on the phase shift analysis intercluster potentials, are demonstrated in calculations of the radiative capture characteristics. The considered capture reactions are not part of stellar thermonuclear cycles, but involve in the basic reaction chain of primordial nucleosynthesis in the course of the Universe formation.

Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

EPA Science Inventory

The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

Highly efficient preparation of selectively isotope cluster-labeled long chain fatty acids via two consecutive C(sp3)-C(sp3) cross-coupling reactions.

PubMed

Lethu, Sébastien; Matsuoka, Shigeru; Murata, Michio

2014-02-07

An efficient synthesis involving two copper-catalyzed alkyl-alkyl coupling reactions has been designed to easily access doubly isotope-labeled fatty acids. Such NMR- and IR-active compounds were obtained in excellent overall yields and will be further used for determining the conformation of an alkyl chain of lipidic biomolecules upon interaction with proteins.

Fluidics platform and method for sample preparation and analysis

DOEpatents

Benner, W. Henry; Dzenitis, John M.; Bennet, William J.; Baker, Brian R.

2014-08-19

Herein provided are fluidics platform and method for sample preparation and analysis. The fluidics platform is capable of analyzing DNA from blood samples using amplification assays such as polymerase-chain-reaction assays and loop-mediated-isothermal-amplification assays. The fluidics platform can also be used for other types of assays and analyzes. In some embodiments, a sample in a sealed tube can be inserted directly. The following isolation, detection, and analyzes can be performed without a user's intervention. The disclosed platform may also comprises a sample preparation system with a magnetic actuator, a heater, and an air-drying mechanism, and fluid manipulation processes for extraction, washing, elution, assay assembly, assay detection, and cleaning after reactions and between samples.

Polymer-based microfluidic chips for isothermal amplification of nucleic acids

NASA Astrophysics Data System (ADS)

Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

2017-11-01

Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

Polymerase chain reaction with phase change as intrinsic thermal control

NASA Astrophysics Data System (ADS)

Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

2013-04-01

This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

Photochemical reaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen) with basic amino acids and dipeptides.

PubMed

Suzuki, Tadashi; Shinoda, Mio; Osanai, Yohei; Isozaki, Tasuku

2013-08-22

Photoreaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen, KP) with basic amino acids (histidine, lysine, and arginine) and dipeptides (carnosine and anserine) including a histidine moiety in phosphate buffer solution (pH 7.4) has been investigated with transient absorption spectroscopy. With UV irradiation KP(-) gave rise to a carbanion through a decarboxylation reaction, and the carbanion easily abstracted a proton from the surrounding molecule to yield a 3-ethylbenzophenone ketyl biradical (EBPH). The dipeptides as well as the basic amino acids were found to accelerate the proton transfer reaction whereas alanine and glycine had no effect on the reaction, revealing that these amino acids having a protonated side chain act as a proton donor. The formation quantum yield of EBPH was estimated to be fairly large by means of an actinometrical method with benzophenone, and the bimolecular reaction rate constant for the proton transfer between the carbanion and the protonated basic amino acids or the protonated dipeptides was successfully determined. It has become apparent that the bimolecular reaction rate constant for the proton transfer depended on the acid dissociation constant for the side chain of the amino acids for the first time. This reaction mechanism was interpreted by difference of the heat of reaction for each basic amino acid based on the thermodynamical consideration. These results strongly suggest that the side chain of the basic amino acid residue in protein should play an important role for photochemistry of KP in vivo.

FACTORS AFFECTING THE CHAIN LENGTH OF GROUP A STREPTOCOCCI

PubMed Central

Ekstedt, Richard D.; Stollerman, Gene H.

1960-01-01

Group A streptococci which grew in long chains in the presence of homologous anti-M antibody were split into their original length by the addition of an excess of homologous M protein to the culture. The chain-splitting reaction showed temperature and pH optima (37°C., 7.5) and was completely inhibited at 0°C. or by heat-killing the long chains at 56°C. prior to the addition of M protein. Addition of sublethal doses of HgCl2, or of penicillin, inhibited the chain-splitting reaction. Pneumococci behaved in entirely comparable fashion to streptococci in similar experiments. Virulent strains of streptococci formed the shortest chains when broth media was enriched with serum. The chain-shortening effect of serum enrichment of the media was most apparent with encapsulated strains and under cultural conditions that favored capsule formation. Loss of capsules by mutation or by unfavorable growth conditions resulted in increase in chain length. The activity of the chain-splitting mechanism seemed to be independent of M protein, however, since encapsulated M-negative variants also formed very short chain in serum-enriched media. The physical presence of the capsule was not essential for chain shortening since enzymatic removal of the capsule with hyaluronidase during growth did not affect chain length. These results strongly suggest that chain-splitting of streptococci and pneumococci occurs by an active metabolic mechanism, presumably enzymatic, which is inhibited by the union of surface antigens with specific antibody. PMID:13726267

Assessing the influence of side-chain and main-chain aromatic benzyltrimethyl ammonium on anion exchange membranes.

PubMed

Li, Xiuhua; Nie, Guanghui; Tao, Jinxiong; Wu, Wenjun; Wang, Liuchan; Liao, Shijun

2014-05-28

3,3'-Di(4″-methyl-phenyl)-4,4'-difluorodiphenyl sulfone (DMPDFPS), a new monomer with two pendent benzyl groups, was easily prepared by Suzuki coupling reaction in high yield. A series of side-chain type ionomers (PAES-Qs) containing pendant side-chain benzyltrimethylammonium groups, which linked to the backbone by alkaline resisting conjugated C-C bonds, were synthesized via polycondensation, bromination, followed by quaternization and alkalization. To assess the influence of side-chain and main-chain aromatic benzyltrimethylammonium on anion exchange membranes (AEMs), the main-chain type ionomers (MPAES-Qs) with the same backbone were synthesized following the similar procedure. GPC and (1)H NMR results indicate that the bromination shows no reaction selectivity of polymer configurations and ionizations of the side-chain type polymers display higher conversions than that of the main-chain type ones do. These two kinds of AEMs were evaluated in terms of ion exchange capacity (IEC), water uptake, swelling ratio, λ, volumetric ion exchange capacity (IECVwet), hydroxide conductivity, mechanical and thermal properties, and chemical stability, respectively. The side-chain type structure endows AEMs with lower water uptake, swelling ratio and λ, higher IECVwet, much higher hydroxide conductivity, more robust dimensional stability, mechanical and thermal properties, and higher stability in hot alkaline solution. The side-chain type cationic groups containing molecular configurations have the distinction of being practical AEMs and membrane electrode assemblies of AEMFCs.

Variance-reduced simulation of lattice discrete-time Markov chains with applications in reaction networks

NASA Astrophysics Data System (ADS)

Maginnis, P. A.; West, M.; Dullerud, G. E.

2016-10-01

We propose an algorithm to accelerate Monte Carlo simulation for a broad class of stochastic processes. Specifically, the class of countable-state, discrete-time Markov chains driven by additive Poisson noise, or lattice discrete-time Markov chains. In particular, this class includes simulation of reaction networks via the tau-leaping algorithm. To produce the speedup, we simulate pairs of fair-draw trajectories that are negatively correlated. Thus, when averaged, these paths produce an unbiased Monte Carlo estimator that has reduced variance and, therefore, reduced error. Numerical results for three example systems included in this work demonstrate two to four orders of magnitude reduction of mean-square error. The numerical examples were chosen to illustrate different application areas and levels of system complexity. The areas are: gene expression (affine state-dependent rates), aerosol particle coagulation with emission and human immunodeficiency virus infection (both with nonlinear state-dependent rates). Our algorithm views the system dynamics as a ;black-box;, i.e., we only require control of pseudorandom number generator inputs. As a result, typical codes can be retrofitted with our algorithm using only minor changes. We prove several analytical results. Among these, we characterize the relationship of covariances between paths in the general nonlinear state-dependent intensity rates case, and we prove variance reduction of mean estimators in the special case of affine intensity rates.

Polymeric cobalt(ii) thiolato complexes - syntheses, structures and properties of [Co(SMes)2] and [Co(SPh)2NH3].

PubMed

Eichhöfer, Andreas; Buth, Gernot

2016-11-01

Reactions of [Co(N(SiMe 3 ) 2 ) 2 thf] with 2.1 equiv. of MesSH (Mes = C 6 H 2 -2,4,6-(CH 3 ) 3 ) yield dark brown crystals of the one dimensional chain compound [Co(SMes) 2 ]. In contrast reactions of [Co(N(SiMe 3 ) 2 ) 2 thf] with 2.1 equiv. of PhSH result in the formation of a dark brown almost X-ray amorphous powder of 'Co(SPh) 2 '. Addition of aliquots of CH 3 OH to the latter reaction resulted in the almost quantitative formation of crystalline ammonia thiolato complexes either [Co(SPh) 2 (NH 3 ) 2 ] or [Co(SPh) 2 NH 3 ]. Single crystal XRD reveals that [Co(SPh) 2 NH 3 ] forms one-dimensional chains in the crystal via μ 2 -SPh bridges whereas [Co(SPh) 2 (NH 3 ) 2 ] consists at a first glance of isolated distorted tetrahedral units. Magnetic measurements suggest strong antiferromagnetic coupling for the two chain compounds [Co(SMes) 2 ] (J = -38.6 cm -1 ) and [Co(SPh) 2 NH 3 ] (J = -27.1 cm -1 ). Interestingly, also the temperature dependence of the susceptibility of tetrahedral [Co(SPh) 2 (NH 3 ) 2 ] shows an antiferromagnetic transition at around 6 K. UV-Vis-NIR spectra display d-d bands in the NIR region between 500 and 2250 nm. Thermal gravimetric analysis of [Co(SPh) 2 (NH 3 ) 2 ] and [Co(SPh) 2 NH 3 ] reveals two well separated cleavage processes for NH 3 and SPh 2 upon heating accompanied by the stepwise formation of 'Co(SPh) 2 ' and cobalt sulfide.

Intact carbohydrate structures as part of the melanoidin skeleton.

PubMed

Cämmerer, Bettina; Jalyschko, Walentina; Kroh, Lothar W

2002-03-27

Model melanoidins from monomeric, oligomeric, and polymeric carbohydrates, and amino acids formed under aqueous as well as water-free reaction conditions, were submitted to acidic catalyzed hydrolysis. Their degradation products were detected qualitatively and quantitatively by HPTLC and HPLC-DAD. A considerable amount of monomer carbohydrates from hydrolysis of model melanoidins formed under water-free reaction conditions was detected. It can be seen clearly that the amount of carbohydrates released increased with increasing degree of polymerization of the carbohydrates used as starting material. In comparison, the hydrolysis of melanoidins formed in aqueous condition resulted in only a small glucose release. It seems that in the Maillard reaction under water-free conditions, a significant amount of di- and oligomer carbohydrates were incorporated into the melanoidin skeleton as complete oligomer with intact glycosidic bond, forming side chains at the melanoidin skeleton. Additional side chains could be formed by transglycosylation reactions. With increasing water content, hydrothermolytic as well as retro-aldol reactions of the starting carbonyl components became significant, and therefore the possibility of forming side chains decreased. The results are consistent with the postulated melanoidin structure being built up mainly from sugar degradation products, probably branched via amino compounds.

Biodiesel production from triolein and short chain alcohols through biocatalysis.

PubMed

Salis, Andrea; Pinna, Marcella; Monduzzi, Maura; Solinas, Vincenzo

2005-09-29

Oleic acid alkyl esters (biodiesel) were synthesised by biocatalysis in solvent-free conditions. Different commercial immobilised lipases, namely Candida antarctica B, Rizhomucor miehei, and Pseudomonas cepacia, were tested towards the reaction between triolein and butanol to produce butyl oleate. Pseudomonas cepacia lipase resulted to be the most active enzyme reaching 100% of conversion after 6h. Different operative conditions such as reaction temperature, water activity, and reagent stoichiometric ratio were investigated and optimised. These conditions were then used to investigate the effect of linear and branched short chain alcohols. Methanol and 2-butanol were the worst alcohols: the former, probably, due to its low miscibility with the oil and the latter because secondary alcohols usually are less reactive than primary alcohols. Conversely, linear and branched primary alcohols with short alkyl chains (C(2)--C(4)) showed high reaction rate and conversion. A mixture of linear and branched short chain alcohols that mimics the residual of ethanol distillation (fusel oil) was successfully used for oleic acid ester synthesis. These compounds are important in biodiesel mixtures since they improve low temperature properties.

METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM

DOEpatents

Fermi, E.; Leverett, M.C.

1957-11-12

This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.

Oxidation mechanism of diethyl ether: a complex process for a simple molecule.

PubMed

Di Tommaso, Stefania; Rotureau, Patricia; Crescenzi, Orlando; Adamo, Carlo

2011-08-28

A large number of organic compounds, such as ethers, spontaneously form unstable peroxides through a self-propagating process of autoxidation (peroxidation). Although the hazards of organic peroxides are well known, the oxidation mechanisms of peroxidizable compounds like ethers reported in the literature are vague and often based on old experiments, carried out in very different conditions (e.g. atmospheric, combustion). With the aim to (partially) fill the lack of information, in this paper we present an extensive Density Functional Theory (DFT) study of autoxidation reaction of diethyl ether (DEE), a chemical that is largely used as solvent in laboratories, and which is considered to be responsible for various accidents. The aim of the work is to investigate the most probable reaction paths involved in the autoxidation process and to identify all potential hazardous intermediates, such as peroxides. Beyond the determination of a complex oxidation mechanism for such a simple molecule, our results suggest that the two main reaction channels open in solution are the direct decomposition (β-scission) of DEE radical issued of the initiation step and the isomerization of the peroxy radical formed upon oxygen attack (DEEOO˙). A simple kinetic evaluation of these two competing reaction channels hints that radical isomerization may play an unexpectedly important role in the global DEE oxidation process. Finally industrial hazards could be related to the hydroperoxide formation and accumulation during the chain propagation step. The resulting information may contribute to the understanding of the accidental risks associated with the use of diethyl ether.

Substrate Trapping in Crystals of the Thiolase OleA Identifies Three Channels That Enable Long Chain Olefin Biosynthesis*

PubMed Central

Goblirsch, Brandon R.; Jensen, Matthew R.; Mohamed, Fatuma A.; Wackett, Lawrence P.; Wilmot, Carrie M.

2016-01-01

Phylogenetically diverse microbes that produce long chain, olefinic hydrocarbons have received much attention as possible sources of renewable energy biocatalysts. One enzyme that is critical for this process is OleA, a thiolase superfamily enzyme that condenses two fatty acyl-CoA substrates to produce a β-ketoacid product and initiates the biosynthesis of long chain olefins in bacteria. Thiolases typically utilize a ping-pong mechanism centered on an active site cysteine residue. Reaction with the first substrate produces a covalent cysteine-thioester tethered acyl group that is transferred to the second substrate through formation of a carbon-carbon bond. Although the basics of thiolase chemistry are precedented, the mechanism by which OleA accommodates two substrates with extended carbon chains and a coenzyme moiety—unusual for a thiolase—are unknown. Gaining insights into this process could enable manipulation of the system for large scale olefin production with hydrocarbon chains lengths equivalent to those of fossil fuels. In this study, mutagenesis of the active site cysteine in Xanthomonas campestris OleA (Cys143) enabled trapping of two catalytically relevant species in crystals. In the resulting structures, long chain alkyl groups (C12 and C14) and phosphopantetheinate define three substrate channels in a T-shaped configuration, explaining how OleA coordinates its two substrates and product. The C143A OleA co-crystal structure possesses a single bound acyl-CoA representing the Michaelis complex with the first substrate, whereas the C143S co-crystal structure contains both acyl-CoA and fatty acid, defining how a second substrate binds to the acyl-enzyme intermediate. An active site glutamate (Gluβ117) is positioned to deprotonate bound acyl-CoA and initiate carbon-carbon bond formation. PMID:27815501

Substrate Trapping in Crystals of the Thiolase OleA Identifies Three Channels That Enable Long Chain Olefin Biosynthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goblirsch, Brandon R.; Jensen, Matthew R.; Mohamed, Fatuma A.

Phylogenetically diverse microbes that produce long chain, olefinic hydrocarbons have received much attention as possible sources of renewable energy biocatalysts. One enzyme that is critical for this process is OleA, a thiolase superfamily enzyme that condenses two fatty acyl-CoA substrates to produce a β-ketoacid product and initiates the biosynthesis of long chain olefins in bacteria. Thiolases typically utilize a ping-pong mechanism centered on an active site cysteine residue. Reaction with the first substrate produces a covalent cysteine-thioester tethered acyl group that is transferred to the second substrate through formation of a carbon-carbon bond. Although the basics of thiolase chemistry aremore » precedented, the mechanism by which OleA accommodates two substrates with extended carbon chains and a coenzyme moiety—unusual for a thiolase—are unknown. Gaining insights into this process could enable manipulation of the system for large scale olefin production with hydrocarbon chains lengths equivalent to those of fossil fuels. In this study, mutagenesis of the active site cysteine in Xanthomonas campestris OleA (Cys143) enabled trapping of two catalytically relevant species in crystals. In the resulting structures, long chain alkyl groups (C12 and C14) and phosphopantetheinate define three substrate channels in a T-shaped configuration, explaining how OleA coordinates its two substrates and product. The C143A OleA co-crystal structure possesses a single bound acyl-CoA representing the Michaelis complex with the first substrate, whereas the C143S co-crystal structure contains both acyl-CoA and fatty acid, defining how a second substrate binds to the acyl-enzyme intermediate. An active site glutamate (Gluβ117) is positioned to deprotonate bound acyl-CoA and initiate carbon-carbon bond formation.« less

Intramolecular Benzoin Reaction Catalyzed by Benzaldehyde Lyase from Pseudomonas Fluorescens Biovar I.

PubMed

Hernández, Karel; Parella, Teodor; Petrillo, Giovanna; Usón, Isabel; Wandtke, Claudia M; Joglar, Jesús; Bujons, Jordi; Clapés, Pere

2017-05-02

Intramolecular benzoin reactions catalyzed by benzaldehyde lyase from Pseudomonas fluorescens biovar I (BAL) are reported. The structure of the substrates envisaged for this reaction consists of two benzaldehyde derivatives linked by an alkyl chain. The structural requirements needed to achieve the intramolecular carbon-carbon bond reaction catalyzed by BAL were established. Thus, a linker consisting of a linear alkyl chain of three carbon atoms connected through ether-type bonds to the 2 and 2' positions of two benzaldehyde moieties, which could be substituted with either Cl, Br, or OCH 3 at either the 3 and 3' or 5 and 5' positions, were suitable substrates for BAL. Reactions with 61-84 % yields of the intramolecular product and ee values between 64 and 98 %, were achieved. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

PubMed

Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

2013-08-01

Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

PubMed

Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

2014-03-01

The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

Preemptive Isolation Precautions of Patients at High Risk for Methicillin-Resistant Staphylococcus aureus in Combination With Ultrarapid Polymerase Chain Reaction Screening as an Effective Tool for Infection Control.

PubMed

Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael

2016-12-01

This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.

Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

PubMed Central

Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

2006-01-01

Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

PubMed

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.

Synthesis of Side-Chain Oxysterols and their Enantiomers through Cross-Metathesis Reactions of Δ22 Steroids

PubMed Central

Brownholland, David P.

2017-01-01

A synthetic route that utilizes a cross-metathesis reaction with Δ22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. PMID:28300584

Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

PubMed

Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

2018-04-25

In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

PubMed

Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

1997-09-01

In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

Analysis of self-oscillating behaviors aimed at the development of a molecular robot with organic acids as fuel

NASA Astrophysics Data System (ADS)

Nakazumi, Tomoka; Hara, Yusuke

2017-09-01

We studied the transmittance self-oscillation of a polymer chain driven by an organic acid as the fuel. The self-oscillating polymer chain consists of 4-acryloylmorpholine (ACMO) and the Ru catalyst (Ru(bpy)3) of the Belousov-Zhabotinsky (BZ) reaction. The transmittance self-oscillating behavior was affected significantly by the temperature. As the amplitude of the transmittance self-oscillation, which is reflected by the aggregation state, decreased with time, the oscillation period also decreased. This trend indicates that the polymer aggregation affects the rate of the BZ reaction significantly. The activation energy of the self-oscillating value was almost the same in the normal BZ reaction, which does not include Ru(bpy)3 complexes in the polymer chains. In addition, we demonstrated the effect of one BZ substrate (sodium bromate or malonic acid) on the transmittance self-oscillation period.

Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

PubMed

Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

2001-03-01

A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

Initiator and Photocatalyst-Free Visible Light Induced One-Pot Reaction: Concurrent RAFT Polymerization and CuAAC Click Reaction.

PubMed

Wang, Jie; Wang, Xinbo; Xue, Wentao; Chen, Gaojian; Zhang, Weidong; Zhu, Xiulin

2016-05-01

A new, visible light-catalyzed, one-pot and one-step reaction is successfully employed to design well-controlled side-chain functionalized polymers, by the combination of ambient temperature revisible addtion-fragmentation chain transfer (RAFT) polymerization and click chemistry. Polymerizations are well controlled in a living way under the irradiation of visible light-emitting diode (LED) light without photocatalyst and initiator, using the trithiocarbonate agent as iniferter (initiator-transfer agent-terminator) agent at ambient temperature. Fourier transfer infrared spectroscopy (FT-IR), NMR, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) data confirm the successful one-pot reaction. Compared to the reported zero-valent metal-catalyzed one-pot reaction, the polymerization rate is much faster than that of the click reaction, and the visible light-catalyzed one-pot reaction can be freely and easily regulated by turning on and off the light. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Prebiotic Synthesis of Autocatalytic Products From Formaldehyde-Derived Sugars as the Carbon and Energy Source

NASA Technical Reports Server (NTRS)

Weber, Arthur L.

2003-01-01

Our research objective is to understand and model the chemical processes on the primitive Earth that generated the first autocatalytic molecules and microstructures involved in the origin of life. Our approach involves: (a) investigation of a model origin-of-life process named the Sugar Model that is based on the reaction of formaldehyde- derived sugars (trioses and tetroses) with ammonia, and (b) elucidation of the constraints imposed on the chemistry of the origin of life by the fixed energies and rates of C,H,O-organic reactions under mild aqueous conditions. Recently, we demonstrated that under mild aqueous conditions the Sugar Model process yields autocatalytic products, and generates organic micropherules (2-20 micron dia.) that exhibit budding, size uniformity, and chain formation. We also discovered that the sugar substrates of the Sugar Model are capable of reducing nitrite to ammonia under mild aqueous conditions. In addition studies done in collaboration with Sandra Pizzarrello (Arizona State University) revealed that chiral amino acids (including meteoritic isovaline) catalyze both the synthesis and specific handedness of chiral sugars. Our systematic survey of the energies and rates of reactions of C,H,O-organic substrates under mild aqueous conditions revealed several general principles (rules) that govern the direction and rate of organic reactions. These reactivity principles constrain the structure of chemical pathways used in the origin of life, and in modern and primitive metabolism.

NASBA: A detection and amplification system uniquely suited for RNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sooknanan, R.; Malek, L.T.

1995-06-01

The invention of PCR (polymerase chain reaction) has revolutionized our ability to amplify and manipulate a nucleic acid sequence in vitro. The commercial rewards of this revolution have driven the development of other nuclei acid amplification and detection methodologies. This has created an alphabet soup of technologies that use different amplification methods, including NASBA (nucleic acid sequence-based amplification), LCR (ligase chain reaction), SDA (strand displacement amplification), QBR (Q-beta replicase), CPR (cycling probe reaction), and bDNA (branched DNA). Despite the differences in their processes, these amplification systems can be separated into two broad categories based on how they achieve their goal:more » sequence-based amplification systems, such as PCR, NASBA, and SDA, amplify a target nucleic acid sequence. Signal-based amplification systems, such as LCR, QBR, CPR and bDNA, amplify or alter a signal from a detection reaction that is target-dependent. While the various methods have relative strengths and weaknesses, only NASBA offers the unique ability to homogeneously amplify an RNA analyte in the presence of homologous genomic DNA under isothermal conditions. Since the detection of RNA sequences almost invariably measures biological activity, it is an excellent prognostic indicator of activities as diverse as virus production, gene expression, and cell viability. The isothermal nature of the reaction makes NASBA especially suitable for large-scale manual screening. These features extend NASBA`s application range from research to commercial diagnostic applications. Field test kits are presently under development for human diagnostics as well as the burgeoning fields of food and environmental diagnostic testing. These developments suggest future integration of NASBA into robotic workstations for high-throughput screening as well. 17 refs., 1 tab.« less

[Treatment of cetyltrimethyl ammonium bromide wastewater by potassium ferrate].

PubMed

Yang, Wei-hua; Wang, Hong-hui; Zeng, Xiao-xu; Huang, Ting-ting

2009-08-15

A novel oxidant potassium ferrate (K2FeO4) was used to remove cetyltrimethyl ammonium bromide (CTAB) at room temperature. The effects of various conditions on the removal ratio, such as reaction time, dosing quantity of K2FeO4 and initial pH, were investigated. The experiments results show that the removal ratio reaches 79.4% when the reaction time is 30 min, the dosing quantity of K2FeO4 to CTAB is 1:1, the initial pH of the solution is 7. In the reaction progress, the oxidation of K2FeO4 and the flocculation of the reduction product have synergistic effect on the removal of CTAB. In addition, infrared spectra of CTAB before and after being treated with K2FeO4 were further studied. The results indicate that the degradation process involves the interruption of chain and the subsequent mineralization to inorganic molecules. Furthermore, the reaction of K2FeO4 and CTAB follows second order kinetics law.

FAST NEUTRONIC REACTOR

DOEpatents

Snell, A.H.

1957-12-01

This patent relates to a reactor and process for carrying out a controlled fast neutron chain reaction. A cubical reactive mass, weighing at least 920 metric tons, of uranium metal containing predominantly U/sup 238/ and having a U/sup 235/ content of at least 7.63% is assembled and the maximum neutron reproduction ratio is limited to not substantially over 1.01 by insertion and removal of a varying amount of boron, the reactive mass being substantially freed of moderator.

Laboratory Processes for Confirmation of Lymphogranuloma Venereum Infection During a 2015 Investigation of a Cluster of Cases in the United States.

PubMed

Kersh, Ellen N; Pillay, Allan; de Voux, Alex; Chen, Cheng

2017-11-01

In September 2015, the Centers for Disease Control and Prevention were notified of a suspected outbreak investigation of lymphogranuloma venereum (LGV) cases by the Michigan Department of Health and Human Services. The Centers for Disease Control and Prevention offered support with a laboratory-developed polymerase chain reaction test for LGV. This note describes the laboratory workflow and procedures used for the laboratory confirmation of LGV infection.

Elastomer toughened polyimide adhesives

NASA Technical Reports Server (NTRS)

St.clair, A. K.; St.clair, T. L. (Inventor)

1983-01-01

A rubber-toughened addition-type polyimide composition is disclosed which has excellent high temperature bonding characteristics in the fully cured state, and improved peel strength and adhesive fracture resistance physical property characteristics. The process for making the improved adhesive involves preparing the rubber containing amic acid prepolymer by chemically reacting an amine-terminated elastomer and an aromatic diamine with an aromatic dianhydride with which a reactive chain stopper anhydride was mixed, and utilizing solvent or mixture of solvents for the reaction.

Development and validation of a novel hydrolysis probe real-time polymerase chain reaction for agamid adenovirus 1 in the central bearded dragon (Pogona vitticeps).

PubMed

Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X

2015-03-01

Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. © 2015 The Author(s).

Low-intensity pulsed ultrasound produced an increase of osteogenic genes expression during the process of bone healing in rats.

PubMed

Fávaro-Pípi, Elaine; Bossini, Paulo; de Oliveira, Poliani; Ribeiro, Juliana Uema; Tim, Carla; Parizotto, Nivaldo A; Alves, Jose Marcos; Ribeiro, Daniel Araki; Selistre de Araújo, Heloísa Sobreiro; Renno, Ana Claudia Muniz

2010-12-01

The aim of this study was to measure the temporal expression of osteogenic genes during the process of bone healing in low-intensity pulsed ultrasound (LIPUS) treated bone defects by means of histopathologic and real-time polymerase chain reaction (PCR) analysis. Animals were randomly distributed into two groups (n = 30): control group (bone defect without treatment) and LIPUS treated (bone defect treated with LIPUS). On days 7, 13 and 25 postinjury, 10 rats per group were sacrificed. Rats were treated with a 30 mW/cm(2) LIPUS. The results pointed out intense new bone formation surrounded by highly vascularized connective tissue presenting a slight osteogenic activity, with primary bone deposition was observed in the group exposed to LIPUS in the intermediary (13 days) and late stages of repair (25 days) in the treated animals. In addition, quantitative real-time polymerase chain reaction (RT-qPCR) showed an upregulation of bone morphogenetic protein 4 (BMP4), osteocalcin and Runx2 genes 7 days after the surgery. In the intermediary period, there was no increase in the expression. The expression of alkaline phosphatase, BMP4 and Runx2 was significantly increased at the last period. Our results indicate that LIPUS therapy improves bone repair in rats and upregulated osteogenic genes, mainly at the late stages of recovery. Copyright © 2010. Published by Elsevier Inc.

Feasibility determination for use of polymerase chain reaction in the U.S. Air Force air-transportable hospital field environment: lessons learned.

PubMed

Niemeyer, D M; Jaffe, R I; Wiggins, L B

2000-11-01

At present, the use of molecular probes and polymerase chain reaction (PCR) for the identification of microorganisms in body fluids or tissues is becoming more commonplace. There is an added advantage when serological or culture methods are difficult, expensive, or unavailable. Slow-growing or fastidious microorganisms, including Mycobacterium tuberculosis, spirochetes, viruses, and the dimorphic fungi, can be detected rapidly using these techniques. The presence of different chromosomal or plasmid-mediated antibiotic-resistant markers can also be determined. PCR is an extremely powerful tool that has been applied to research, and more recently it has been used to augment standard clinical applications. It is a very simple process that can amplify nucleic acid sequences, both DNA and RNA, a million times over. The sensitivity, rapidity, broad applicability, and compactness of this technology make it an ideal candidate for use in the military arena. We recently established a molecular biology laboratory at a Deployable Medical System at the Camp Parks Army Reserve Training Facility in Dublin, California. This article will briefly summarize the use of PCR and its applicability in the air-transportable hospital field environment. Proper handling, processing, and testing as well as the requirements for setting up a molecular biology laboratory will be discussed. Finally, the benefits and disadvantages of using PCR-based techniques in the deployed field environment will be considered.

Quantification of Parvovirus B19 DNA Using COBAS AmpliPrep Automated Sample Preparation and LightCycler Real-Time PCR

PubMed Central

Schorling, Stefan; Schalasta, Gunnar; Enders, Gisela; Zauke, Michael

2004-01-01

The COBAS AmpliPrep instrument (Roche Diagnostics GmbH, D-68305 Mannheim, Germany) automates the entire sample preparation process of nucleic acid isolation from serum or plasma for polymerase chain reaction analysis. We report the analytical performance of the LightCycler Parvovirus B19 Quantification Kit (Roche Diagnostics) using nucleic acids isolated with the COBAS AmpliPrep instrument. Nucleic acids were extracted using the Total Nucleic Acid Isolation Kit (Roche Diagnostics) and amplified with the LightCycler Parvovirus B19 Quantification Kit. The kit combination processes 72 samples per 8-hour shift. The lower detection limit is 234 IU/ml at a 95% hit-rate, linear range approximately 104-1010 IU/ml, and overall precision 16 to 40%. Relative sensitivity and specificity in routine samples from pregnant women are 100% and 93%, respectively. Identification of a persistent parvovirus B19-infected individual by the polymerase chain reaction among 51 anti-parvovirus B19 IgM-negative samples underlines the importance of additional nucleic acid testing in pregnancy and its superiority to serology in identifying the risk of parvovirus B19 transmission via blood or blood products. Combination of the Total Nucleic Acid Isolation Kit on the COBAS AmpliPrep instrument with the LightCycler Parvovirus B19 Quantification Kit provides a reliable and time-saving tool for sensitive and accurate detection of parvovirus B19 DNA. PMID:14736825

Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter with application of high-processivity polymerase and novel internal amplification controls for rapid and specific detection.

PubMed

Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S

2012-02-01

Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications. Published by Elsevier Inc.

Control of polymer network topology in semi-batch systems

NASA Astrophysics Data System (ADS)

Wang, Rui; Olsen, Bradley; Johnson, Jeremiah

Polymer networks invariably possess topological defects: loops of different orders. Since small loops (primary loops and secondary loops) both lower the modulus of network and lead to stress concentration that causes material failure at low deformation, it is desirable to greatly reduce the loop fraction. We have shown that achieving loop fraction close to zero is extremely difficult in the batch process due to the slow decay of loop fraction with the polymer concentration and chain length. Here, we develop a modified kinetic graph theory that can model network formation reactions in semi-batch systems. We demonstrate that the loop fraction is not sensitive to the feeding policy if the reaction volume maintains constant during the network formation. However, if we initially put concentrated solution of small junction molecules in the reactor and continuously adding polymer solutions, the fractions of both primary loop and higher-order loops will be significantly reduced. There is a limiting value (nonzero) of loop fraction that can be achieved in the semi-batch system in condition of extremely slow feeding rate. This minimum loop fraction only depends on a single dimensionless variable, the product of concentration and with single chain pervaded volume, and defines an operating zone in which the loop fraction of polymer networks can be controlled through adjusting the feeding rate of the semi-batch process.

T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

PubMed

Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

2012-01-01

Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

Tested Demonstrations.

ERIC Educational Resources Information Center

Gilbert, George L., Ed.

1983-01-01

Free radical chlorination of methane is used in organic chemistry to introduce free radical/chain reactions. In spite of its common occurrence, demonstrations of the reaction are uncommon. Therefore, such a demonstration is provided, including background information, preparation of reactants/reaction vessel, introduction of reactants, irradiation,…

Efficient sampling of reversible cross-linking polymers: Self-assembly of single-chain polymeric nanoparticles

NASA Astrophysics Data System (ADS)

Oyarzún, Bernardo; Mognetti, Bortolo Matteo

2018-03-01

We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.

Linear free energy relationships between aqueous phase hydroxyl radical reaction rate constants and free energy of activation.

PubMed

Minakata, Daisuke; Crittenden, John

2011-04-15

The hydroxyl radical (HO(•)) is a strong oxidant that reacts with electron-rich sites on organic compounds and initiates complex radical chain reactions in aqueous phase advanced oxidation processes (AOPs). Computer based kinetic modeling requires a reaction pathway generator and predictions of associated reaction rate constants. Previously, we reported a reaction pathway generator that can enumerate the most important elementary reactions for aliphatic compounds. For the reaction rate constant predictor, we develop linear free energy relationships (LFERs) between aqueous phase literature-reported HO(•) reaction rate constants and theoretically calculated free energies of activation for H-atom abstraction from a C-H bond and HO(•) addition to alkenes. The theoretical method uses ab initio quantum mechanical calculations, Gaussian 1-3, for gas phase reactions and a solvation method, COSMO-RS theory, to estimate the impact of water. Theoretically calculated free energies of activation are found to be within approximately ±3 kcal/mol of experimental values. Considering errors that arise from quantum mechanical calculations and experiments, this should be within the acceptable errors. The established LFERs are used to predict the HO(•) reaction rate constants within a factor of 5 from the experimental values. This approach may be applied to other reaction mechanisms to establish a library of rate constant predictions for kinetic modeling of AOPs.

Standard Free Droplet Digital Polymerase Chain Reaction as a New Tool for the Quality Control of High-Capacity Adenoviral Vectors in Small-Scale Preparations

PubMed Central

Boehme, Philip; Stellberger, Thorsten; Solanki, Manish; Zhang, Wenli; Schulz, Eric; Bergmann, Thorsten; Liu, Jing; Doerner, Johannes; Baiker, Armin E.

2015-01-01

Abstract High-capacity adenoviral vectors (HCAdVs) are promising tools for gene therapy as well as for genetic engineering. However, one limitation of the HCAdV vector system is the complex, time-consuming, and labor-intensive production process and the following quality control procedure. Since HCAdVs are deleted for all viral coding sequences, a helper virus (HV) is needed in the production process to provide the sequences for all viral proteins in trans. For the purification procedure of HCAdV, cesium chloride density gradient centrifugation is usually performed followed by buffer exchange using dialysis or comparable methods. However, performing these steps is technically difficult, potentially error-prone, and not scalable. Here, we establish a new protocol for small-scale production of HCAdV based on commercially available adenovirus purification systems and a standard method for the quality control of final HCAdV preparations. For titration of final vector preparations, we established a droplet digital polymerase chain reaction (ddPCR) that uses a standard free-end-point PCR in small droplets of defined volume. By using different probes, this method is capable of detecting and quantifying HCAdV and HV in one reaction independent of reference material, rendering this method attractive for accurately comparing viral titers between different laboratories. In summary, we demonstrate that it is possible to produce HCAdV in a small scale of sufficient quality and quantity to perform experiments in cell culture, and we established a reliable protocol for vector titration based on ddPCR. Our method significantly reduces time and required equipment to perform HCAdV production. In the future the ddPCR technology could be advantageous for titration of other viral vectors commonly used in gene therapy. PMID:25640117

Ultrasensitive and selective signal-on electrochemical DNA detection via exonuclease III catalysis and hybridization chain reaction amplification.

PubMed

Ren, Wang; Gao, Zhong Feng; Li, Nian Bing; Luo, Hong Qun

2015-01-15

This work reported a novel, ultrasensitive, and selective platform for electrochemical detection of DNA, employing an integration of exonuclease III (Exo-III) assisted target recycling and hybridization chain reaction (HCR) for the dual signal amplification strategy. The hairpin capture probe DNA (C-DNA) with an Exo-III 3' overhang end was self-assembled on a gold electrode. In the presence of target DNA (T-DNA), C-DNA hybridized with the T-DNA to form a duplex region, exposing its 5' complementary sequence (initiator). Exo-III was applied to selectively digest duplex region from its 3-hydroxyl termini until the duplex was fully consumed, leaving the remnant initiator. The intact T-DNA spontaneously dissociated from the structure and then initiated the next hybridization process as a result of catalysis of the Exo-III. HCR event was triggered by the initiator and two hairpin helper signal probes labeled with methylene blue, facilitating the polymerization of oligonucleotides into a long nicked dsDNA molecule. The numerous exposed remnant initiators can trigger more HCR events. Because of integration of dual signal amplification and the specific HCR process reaction, the resultant sensor showed a high sensitivity for the detection of the target DNA in a linear range from 1.0 fM to 1.0 nM, and a detection limit as low as 0.2 fM. The proposed dual signal amplification strategy provides a powerful tool for detecting different sequences of target DNA by changing the sequence of capture probe and signal probes, holding a great potential for early diagnosis in gene-related diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

Natural flows of H2-rich fluids in the ophiolites of Oman and the Philippines: Tectonic control of migration pathways and associated diagenetic processes

NASA Astrophysics Data System (ADS)

Deville, E. P.; Prinzhofer, A.; Vacquand, C.; Chavagnac, V.; Monnin, C.; Ceuleneer, G.; Arcilla, C. A.

2009-12-01

We compare the geological environments of sites of emission of natural hydrogen in the Oman ophiolite and the Zambales ophiolite (Luzon, Philippines). The genesis of natural H2 results from the interaction between ultrabasic rocks and aqueous solutions circulating in deep fracture networks, by oxidation of metals (Fe2+, Mn2+) and reduction of water, probably under high temperature conditions. This process generates very reducing conditions capable of destabilizing other molecules (notably reduction of deep CO2 being transformed into CH4 by Fisher-Tropsch type reactions). Nitrogen is also commonly associated to the H2-rich fluids. H2 flows are associated with the expulsion of hyperalkaline waters rich in ions OH- and Ca2+ and characterized by high pH (between 11 and 12). Most alkaline springs are found in the vicinity of major faults and/or lithological discontinuities like the basal thrust plane of the ophiolites and the peridotite-gabbro contact (Moho). Within the fracture networks, gas and water separate probably at shallow depth, i.e. close to the top of the upper aquifer level. Locally high flows of gas migrate vertically through fracture pathways and they are able to inflame spontaneously on the surface. Aqueous fluids tends to migrate laterally in the fracture network toward the creeks where most of the hyperalkaline springs are found. This water circulation induces a chain of diagenetic reactions starting in the fracture systems and continuing at the surface where it leads to the precipitation of calcite, aragonite, brucite and more rarely portlandite. This chain of diagenetic reactions is associated with the capture of the atmospheric CO2 during the precipitation of carbonates.

A real-time polymerase chain reaction-based protocol for low/medium-throughput Y-chromosome microdeletions analysis.

PubMed

Segat, Ludovica; Padovan, Lara; Doc, Darja; Petix, Vincenzo; Morgutti, Marcello; Crovella, Sergio; Ricci, Giuseppe

2012-12-01

We describe a real-time polymerase chain reaction (PCR) protocol based on the fluorescent molecule SYBR Green chemistry, for a low- to medium-throughput analysis of Y-chromosome microdeletions, optimized according to the European guidelines and aimed at making the protocol faster, avoiding post-PCR processing, and simplifying the results interpretation. We screened 156 men from the Assisted Reproduction Unit, Department of Obstetrics and Gynecology, Institute for Maternal and Child Health IRCCS Burlo Garofolo (Trieste, Italy), 150 not presenting Y-chromosome microdeletion, and 6 with microdeletions in different azoospermic factor (AZF) regions. For each sample, the Zinc finger Y-chromosomal protein (ZFY), sex-determining region Y (SRY), sY84, sY86, sY127, sY134, sY254, and sY255 loci were analyzed by performing one reaction for each locus. AZF microdeletions were successfully detected in six individuals, confirming the results obtained with commercial kits. Our real-time PCR protocol proved to be a rapid, safe, and relatively cheap method that was suitable for a low- to medium-throughput diagnosis of Y-chromosome microdeletion, which allows an analysis of approximately 10 samples (with the addition of positive and negative controls) in a 96-well plate format, or approximately 46 samples in a 384-well plate for all markers simultaneously, in less than 2 h without the need of post-PCR manipulation.

Supercoil Formation During DNA Melting

NASA Astrophysics Data System (ADS)

Sayar, Mehmet; Avsaroglu, Baris; Kabakcioglu, Alkan

2009-03-01

Supercoil formation plays a key role in determining the structure-function relationship in DNA. Biological and technological processes, such as protein synthesis, polymerase chain reaction, and microarrays relys on separation of the two strands in DNA, which is coupled to the unwinding of the supercoiled structure. This problem has been studied theoretically via Peyrard-Bishop and Poland-Scheraga type models, which include a simple representation of the DNA structural properties. In recent years, computational models, which provide a more realtistic representaion of DNA molecule, have been used to study the melting behavior of short DNA chains. Here, we will present a new coarse-grained model of DNA which is capable of simulating sufficiently long DNA chains for studying the supercoil formation during melting, without sacrificing the local structural properties. Our coarse-grained model successfully reproduces the local geometry of the DNA molecule, such as the 3'-5' directionality, major-minor groove structure, and the helical pitch. We will present our initial results on the dynamics of supercoiling during DNA melting.

Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.

PubMed

Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C

2012-09-27

We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.

Large enhancement in the heterogeneous oxidation rate of organic aerosols by hydroxyl radicals in the presence of nitric oxide

DOE PAGES

Richards-Henderson, Nicole K.; Goldstein, Allen H.; Wilson, Kevin R.

2015-10-27

In this paper we report an unexpectedly large acceleration in the effective heterogeneous OH reaction rate in the presence of NO. This 10–50 fold acceleration originates from free radical chain reactions, propagated by alkoxy radicals that form inside the aerosol by the reaction of NO with peroxy radicals, which do not appear to produce chain terminating products (e.g., alkyl nitrates), unlike gas phase mechanisms. Lastly, a kinetic model, constrained by experiments, suggests that in polluted regions heterogeneous oxidation plays a much more prominent role in the daily chemical evolution of organic aerosol than previously believed.

Biodegradable polyester-based eco-composites containing hemp fibers modified with macrocyclic oligomers

NASA Astrophysics Data System (ADS)

Conzatti, Lucia; Utzeri, Roberto; Hodge, Philip; Stagnaro, Paola

2016-05-01

An original compatibilizing pathway for hemp fibers/poly(1,4-butylene adipate-co-terephtalate) (PBAT) eco-composites was explored exploiting the capability of macrocyclic oligomers (MCOs), obtained by cyclodepolymerization (CDP) of PBAT at high dilution, of being re-converted into linear chains by entropically-driven ring-opening polymerization (ED-ROP) that occurs simply heating the MCOS in the bulk. CDP reaction of PBAT was carried out varying solvent, catalyst and reaction time. Selected MCOs were used to adjust the conditions of the ED-ROP reaction. The best experimental conditions were then adopted to modify hemp fibers. Eco-composites based on PBAT and hemp fibers as obtained or modified with PBAT macrocyclics or oligomers were prepared by different process strategies. The best fiber-PBAT compatibility was observed when the fibers were modified with PBAT oligomers before incorporation in the polyester matrix.

Prediction of crosslink density of solid propellant binders. [curing of elastomers

NASA Technical Reports Server (NTRS)

Marsh, H. E., Jr.

1976-01-01

A quantitative theory is outlined which allows calculation of crosslink density of solid propellant binders from a small number of predetermined parameters such as the binder composition, the functionality distributions of the ingredients, and the extent of the curing reaction. The parameter which is partly dependent on process conditions is the extent of reaction. The proposed theoretical model is verified by independent measurement of effective chain concentration and sol and gel fractions in simple compositions prepared from model compounds. The model is shown to correlate tensile data with composition in the case of urethane-cured polyether and certain solid propellants. A formula for the branching coefficient is provided according to which if one knows the functionality distributions of the ingredients and the corresponding equivalent weights and can measure or predict the extent of reaction, he can calculate the branching coefficient of such a system for any desired composition.

Elucidation of the Key Role of [Ru(bpy)3 ](2+) in Photocatalyzed RAFT Polymerization.

PubMed

Christmann, Julien; Ibrahim, Ahmad; Charlot, Vincent; Croutxé-Barghorn, Céline; Ley, Christian; Allonas, Xavier

2016-08-04

Photocatalysis reactions using [Ru(II) (bpy)3 ](2+) were studied on the example of visible-light-sensitized reversible addition-fragmentation chain transfer (RAFT) polymerization. Although both photoinduced electron- and energy-transfer mechanisms are able to describe this interaction, no definitive experimental proof has been presented so far. This paper investigates the actual mechanism governing this reaction. A set of RAFT agents was selected, their redox potentials measured by cyclic voltammetry, and relaxed triplet energies calculated by quantum mechanics. Gibbs free-energy values were calculated for both electron- and energy-transfer mechanisms. Quenching rate constants were determined by laser flash photolysis. The results undoubtedly evidence the involvement of a photoinduced energy-transfer reaction. Controlled photopolymerization experiments are discussed in the light of the primary photochemical process and photodissociation ability of RAFT agent triplet states. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Photosynthesis.

PubMed

Johnson, Matthew P

2016-10-31

Photosynthesis sustains virtually all life on planet Earth providing the oxygen we breathe and the food we eat; it forms the basis of global food chains and meets the majority of humankind's current energy needs through fossilized photosynthetic fuels. The process of photosynthesis in plants is based on two reactions that are carried out by separate parts of the chloroplast. The light reactions occur in the chloroplast thylakoid membrane and involve the splitting of water into oxygen, protons and electrons. The protons and electrons are then transferred through the thylakoid membrane to create the energy storage molecules adenosine triphosphate (ATP) and nicotinomide-adenine dinucleotide phosphate (NADPH). The ATP and NADPH are then utilized by the enzymes of the Calvin-Benson cycle (the dark reactions), which converts CO 2 into carbohydrate in the chloroplast stroma. The basic principles of solar energy capture, energy, electron and proton transfer and the biochemical basis of carbon fixation are explained and their significance is discussed. © 2016 The Author(s).

Synthesis of side-chain oxysterols and their enantiomers through cross-metathesis reactions of Δ22 steroids.

PubMed

Brownholland, David P; Covey, Douglas F

2017-05-01

A synthetic route that utilizes a cross-metathesis reaction with Δ 22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. Copyright © 2017 Elsevier Inc. All rights reserved.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

PubMed

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

2014-04-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

PubMed Central

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

2014-01-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

PubMed

Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

2011-11-01

The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

USDA-ARS?s Scientific Manuscript database

The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

Spark Plasma Sintering for Nanostructured Smart Materials

DTIC Science & Technology

2009-03-02

polyester) with excess isocyanate to form a prepolymer , followed by the addition of a short chain diol that acts as a chain extender to link the... prepolymers together. Due to the thermodynamic imicisibility of segments of PU, phase separation into a flexible soft segment (long chain diol) and a...other reactions of the isocyanate groups with the other functional groups in the chain. [Hepburn, 1992] However, during the initial prepolymer

Quantum Chemical Study of CH3 + O2 Combustion Reaction System: Catalytic Effects of Additional CO2 Molecule.

PubMed

Masunov, Artëm E; Wait, Elizabeth; Vasu, Subith S

2017-08-03

The supercritical carbon dioxide diluent is used to control the temperature and to increase the efficiency in oxycombustion fossil fuel energy technology. It may affect the rates of combustion by altering mechanisms of chemical reactions, compared to the ones at low CO 2 concentrations. Here, we investigate potential energy surfaces of the four elementary reactions in the CH 3 + O 2 reactive system in the presence of one CO 2 molecule. In the case of reaction CH 3 + O 2 → CH 2 O + OH (R1 channel), van der Waals (vdW) complex formation stabilizes the transition state and reduces the activation barrier by ∼2.2 kcal/mol. Alternatively, covalently bonded CO 2 may form a six-membered ring transition state and reduce the activation barrier by ∼0.6 kcal/mol. In case of reaction CH 3 + O 2 → CH 3 O + O (R2 channel), covalent participation of CO 2 lowers the barrier for the rate limiting step by 3.9 kcal/mol. This is expected to accelerate the R2 process, important for the branching step of the radical chain reaction mechanism. For the reaction CH 3 + O 2 → CHO + H 2 O (R3 channel) with covalent participation of CO 2 , the activation barrier is lowered by 0.5 kcal/mol. The reaction CH 2 O + OH → CHO + H 2 O (R4 channel) involves hydrogen abstraction from formaldehyde by OH radical. Its barrier is reduced from 7.1 to 0.8 kcal/mol by formation of vdW complex with spectator CO 2 . These new findings are expected to improve the kinetic reaction mechanism describing combustion processes in supercritical CO 2 medium.

Experimental Studies of Light-Ion Nuclear Reactions Using Low-Energy RI Beams

NASA Astrophysics Data System (ADS)

Yamaguchi, H.; Kahl, D.; Hayakawa, S.; Sakaguchi, Y.; Abe, K.; Shimuzu, H.; Wakabayashi, Y.; Hashimoto, T.; Cherubini, S.; Gulino, M.; Spitaleri, C.; Rapisarda, G. G.; La Cognata, M.; Lamia, L.; Romano, S.; Kubono, S.; Iwasa, N.; Teranishi, T.; Kawabata, T.; Kwon, Y. K.; Binh, D. N.; Khiem, L. H.; Duy, N. N.; Kato, S.; Komatsubara, T.; Coc, A.; de Sereville, N.; Hammache, F.; Kiss, G.; Bishop, S.

CRIB (CNS Radio-Isotope Beam separator) is a low-energy RI beam separator of Center for Nuclear Study (CNS), the University of Tokyo. Studies on nuclear astrophysics, nuclear structure, and other interests have been performed using the RI beams at CRIB, forming international collaborations. A striking method to study astrophyiscal reactions involving radioactive nuclei is the thick-target method in inverse kinematics. Several astrophysical alpha-induced reactions have been be studied with that method at CRIB. A recent example is on the α resonant scattering with a radioactive 7Be beam. This study is related to the astrophysical 7Be(α , γ ) reactions, important at hot p-p chain and ν p-process in supernovae. There have been measurements based on several indirect methods, such as the asymptotic normalization coefficient (ANC) and Trojan horse method (THM). The first THM measurement using an RI beam has been performed at CRIB, to study the 18F(p, α )15O reaction at astrophysical energies via the three body reaction 2H(18F, α 15O)n. The 18F(p, α )15O reaction rate is crucial to understand the 511-keV γ -ray production in nova explosion phenomena, and we successfully evaluated the reaction cross section at novae temperature and below experimentally for the first time.

Fundamental Reaction Pathway and Free Energy Profile for Butyrylcholinesterase-Catalyzed Hydrolysis of Heroin

PubMed Central

Qiao, Yan; Han, Keli; Zhan, Chang-Guo

2013-01-01

The pharmacological function of heroin requires an activation process which transforms heroin into 6-monoacetylmorphine (6-MAM) which is the most active form. The primary enzyme responsible for this activation process in human plasma is butyrylcholinesterase (BChE). The detailed reaction pathway of the activation process via BChE-catalyzed hydrolysis has been explored computationally, for the first time, in the present study by performing molecular dynamics simulation and first-principles quantum mechanical/molecular mechanical free energy calculations. It has been demonstrated that the whole reaction process includes acylation and deacylation stages. The acylation consists of two reaction steps, i.e. the nucleophilic attack on the carbonyl carbon of 3-acetyl group of heroin by the hydroxyl oxygen of Ser198 side chain and the dissociation of 6-MAM. The deacylation also consists of two reaction steps, i.e. the nucleophilic attack on the carbonyl carbon of the acyl-enzyme intermediate by a water molecule and the dissociation of the acetic acid from Ser198. The calculated free energy profile reveals that the second transition state (TS2) should be rate-determining. The structural analysis reveals that the oxyanion hole of BChE plays an important role in the stabilization of the rate-determining transition state TS2. The free energy barrier (15.9±0.2 or 16.1±0.2 kcal/mol) calculated for the rate-determining step is in good agreement with the experimentally-derived activation free energy (~16.2 kcal/mol), suggesting that the mechanistic insights obtained from the present computational study are reliable. The obtained structural and mechanistic insights could be valuable for use in future rational design of a novel therapeutic treatment of heroin abuse. PMID:23992153

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

PubMed

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Autoignition of hydrogen in shear flows

NASA Astrophysics Data System (ADS)

Kalbhor, Abhijit; Chaudhuri, Swetaprovo; Chitilappilly, Lazar

2018-05-01

In this paper, we compare the autoignition characteristics of laminar, nitrogen-diluted hydrogen jets in two different oxidizer flow configurations: (a) co-flowing heated air and (b) wake of heated air, using two-dimensional numerical simulations coupled with detailed chemical kinetics. In both cases, autoignition is observed to initiate at locations with low scalar dissipation rates and high HO2 depletion rates. It is found that the induction stage prior to autoignition is primarily dominated by chemical kinetics and diffusion while the improved scalar mixing imparted by the large-scale flow structures controls the ignition progress in later stages. We further investigate the ignition transience and its connection with mixing by varying the initial wake conditions and fuel jet to oxidizer velocity ratios. These studies reveal that the autoignition delay times are independent of initial wake flow conditions. However, with increased jet velocity ratios, the later stages of ignition are accelerated, mainly due to enhanced mixing facilitated by the higher scalar dissipation rates. Furthermore, the sensitivity studies for the jet in wake configuration show a significant reduction in ignition delay even for about 0.14% (by volume) hydrogen dilution in the oxidizer. In addition, the detailed autoignition chemistry and the relative roles of certain radical species in the initiation of the autoignition process in these non-premixed jets are investigated by tracking the evolution of important chain reactions using a Lagrangian particle tracking approach. The reaction H2 + O2 ↔ HO2 + H is recognized to be the dominant chain initiation reaction that provides H radicals essential for the progress of subsequent elementary reactions during the pre-ignition stage.

Selective Catalytic Synthesis Using the Combination of Carbon Dioxide and Hydrogen: Catalytic Chess at the Interface of Energy and Chemistry.

PubMed

Klankermayer, Jürgen; Wesselbaum, Sebastian; Beydoun, Kassem; Leitner, Walter

2016-06-20

The present Review highlights the challenges and opportunities when using the combination CO2 /H2 as a C1 synthon in catalytic reactions and processes. The transformations are classified according to the reduction level and the bond-forming processes, covering the value chain from high volume basic chemicals to complex molecules, including biologically active substances. Whereas some of these concepts can facilitate the transition of the energy system by harvesting renewable energy into chemical products, others provide options to reduce the environmental impact of chemical production already in today's petrochemical-based industry. Interdisciplinary fundamental research from chemists and chemical engineers can make important contributions to sustainable development at the interface of the energetic and chemical value chain. The present Review invites the reader to enjoy this exciting area of "catalytic chess" and maybe even to start playing some games in her or his laboratory. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Peptidomic Approach to Developing ELISAs for the Determination of Bovine and Porcine Processed Animal Proteins in Feed for Farmed Animals.

PubMed

Huet, Anne-Catherine; Charlier, Caroline; Deckers, Elise; Marbaix, Hélène; Raes, Martine; Mauro, Sergio; Delahaut, Philippe; Gillard, Nathalie

2016-11-30

The European Commission (EC) wants to reintroduce nonruminant processed animal proteins (PAPs) safely into the feed chain. This would involve replacing the current ban in feed with a species-to-species ban which, in the case of nonruminants, would only prohibit feeding them with proteins from the same species. To enforce such a provision, there is an urgent need for species-specific methods for detecting PAPs from several species in animal feed and in PAPs from other species. Currently, optical microscopy and the polymerase chain reaction are the officially accepted methods, but they have limitations, and alternative methods are needed. We have developed immunoassays using antibodies raised against targets which are not influenced by high temperature and pressure. These targets were identified in a previous study based on an experimental approach. One optimized competitive ELISA detects bovine PAPs at 2% in plant-derived feed. The detection capability demonstrated on blind samples shows a good correlation with mass spectrometry results.

Density functional computational studies on the glucose and glycine Maillard reaction: Formation of the Amadori rearrangement products

NASA Astrophysics Data System (ADS)

Jalbout, Abraham F.; Roy, Amlan K.; Shipar, Abul Haider; Ahmed, M. Samsuddin

Theoretical energy changes of various intermediates leading to the formation of the Amadori rearrangement products (ARPs) under different mechanistic assumptions have been calculated, by using open chain glucose (O-Glu)/closed chain glucose (A-Glu and B-Glu) and glycine (Gly) as a model for the Maillard reaction. Density functional theory (DFT) computations have been applied on the proposed mechanisms under different pH conditions. Thus, the possibility of the formation of different compounds and electronic energy changes for different steps in the proposed mechanisms has been evaluated. B-Glu has been found to be more efficient than A-Glu, and A-Glu has been found more efficient than O-Glu in the reaction. The reaction under basic condition is the most favorable for the formation of ARPs. Other reaction pathways have been computed and discussed in this work.0

Selective amplification of T-cell receptor variable region species is demonstrable but not essential in early lesions of psoriasis vulgaris: analysis by anchored polymerase chain reaction and hypervariable region size spectratyping.

PubMed

Vekony, M A; Holder, J E; Lee, A J; Horrocks, C; Eperon, I C; Camp, R D

1997-07-01

Several groups have investigated the role of T cells in the pathogenesis of psoriasis by determination of T-cell receptor (TCR) B-chain variable (V) region usage, both in chronic plaque (psoriasis vulgaris) and guttate forms, with various results. Because there are no data on TCR expression in early psoriasis vulgaris, when specific cellular immune events may be expected to be most pronounced, we have analyzed early lesions (less than 3 wk old) of ten patients, with highly reproducible results. We have developed a highly controlled anchored polymerase chain reaction (PCR) method in which TCR beta chain species are all amplified with the same primer pair and products are quantified by dot blot hybridization with BV family-specific oligonucleotide probes. Overexpression of certain TCR BV genes was observed in the majority of lesional biopsies, but in samples in which the expanded BV family formed more than 10% of total lesional BV (half of the samples analyzed), BV2 and BV6 predominated. The consistency of overexpression of these BV species between patients was much less than in previous studies of TCRBV usage in established chronic plaque psoriasis lesions. Complementarity-determining region 3 (CDR3) size spectratyping demonstrated evidence for selective clonal T cell accumulation in less than half of the lesional samples showing BV expansion. These results indicate that selective amplification of TCRBV species occurs in early psoriasis vulgaris but is not essential to the pathogenic process and may be more important in the maintenance or expansion of chronic lesions.

Methanol Cannon Demonstrations Revisited.

ERIC Educational Resources Information Center

Dolson, David A.; And Others

1995-01-01

Describes two variations on the traditional methanol cannon demonstration. The first variation is a chain reaction using real metal chains. The second example involves using easily available components to produce sequential explosions that can be musical in nature. (AIM)

Chemiluminescence development after initiation of Maillard reaction in aqueous solutions of glycine and glucose: nonlinearity of the process and cooperative properties of the reaction system

NASA Astrophysics Data System (ADS)

Voeikov, Vladimir L.; Naletov, Vladimir I.

1998-06-01

Nonenzymatic glycation of free or peptide bound amino acids (Maillard reaction, MR) plays an important role in aging, diabetic complications and atherosclerosis. MR taking place at high temperatures is accompanied by chemiluminescence (CL). Here kinetics of CL development in MR proceeding in model systems at room temperature has been analyzed for the first time. Brief heating of glycine and D-glucose solutions to t greater than 93 degrees Celsius results in their browning and appearance of fluorescencent properties. Developed In solutions rapidly cooled down to 20 degrees Celsius a wave of CL. It reached maximum intensity around 40 min after the reaction mixture heating and cooling it down. CL intensity elevation was accompanied by certain decoloration of the solution. Appearance of light absorbing substances and development of CL depended critically upon the temperature of preincubation (greater than or equal to 93 degrees Celsius), initial pH (greater than or equal to 11,2), sample volume (greater than or equal to 0.5 ml) and reagents concentrations. Dependence of total counts accumulation on a system volume over the critical volume was non-monotonous. After reaching maximum values CL began to decline, though only small part of glucose and glycin had been consumed. Brief heating of such solutions to the critical temperature resulted in emergence of a new CL wave. This procedure could be repeated in one and the same reaction system for several times. Whole CL kinetic curve best fitted to lognormal distribution. Macrokinetic properties of the process are characteristic of chain reactions with delayed branching. Results imply also, that self-organization occurs in this system, and that the course of the process strongly depends upon boundary conditions and periodic interference in its course.

Radiation induced decomposition of chlorinated phenols in water

NASA Astrophysics Data System (ADS)

Getoff, N.; Solar, S.

Experiments with 4-Cl-phenol as a model compound for pesticides were performed under steady-state conditions using deoxygenated solutions as well as such saturated with air, oxygen or oxygen mixed with ozone. The yield of Cl -ions serviced as an indicator for the degradation process. As main products of the first step of decomposition were identified: polyhydroxybenzenes, aldehydes and acids. The yield of aldehydes was studied as a function of the absorbed dose and substrate concentration. In the presence of ozone a chain-reaction of the oxidative pollutant degradation takes place. Transient absorption spectra and kinetics obtained by preliminary pulse radiolysis studies of 4-Cl-phenol in the presence of oxygen as well as probable reaction mechanisms are also presented.

Electronic shift register memory based on molecular electron-transfer reactions

NASA Technical Reports Server (NTRS)

Hopfield, J. J.; Onuchic, Jose Nelson; Beratan, David N.

1989-01-01

The design of a shift register memory at the molecular level is described in detail. The memory elements are based on a chain of electron-transfer molecules incorporated on a very large scale integrated (VLSI) substrate, and the information is shifted by photoinduced electron-transfer reactions. The design requirements for such a system are discussed, and several realistic strategies for synthesizing these systems are presented. The immediate advantage of such a hybrid molecular/VLSI device would arise from the possible information storage density. The prospect of considerable savings of energy per bit processed also exists. This molecular shift register memory element design solves the conceptual problems associated with integrating molecular size components with larger (micron) size features on a chip.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guan, Jiwen; Song, Yang, E-mail: yang.song@uwo.ca; Department of Chemistry, University of Western Ontario, London, Ontario N6A 5B7

The polymerization process of condensed styrene to produce polystyrene as an industrially important polymeric material was investigated using a novel approach by combining external compression with ultraviolet radiation. The reaction evolution was monitored as a function of time and the reaction products were characterized by in situ Fourier transform infrared spectroscopy. By optimizing the loading pressures, we observed highly efficient and selective production of polystyrene of different tacticities. Specifically, at relatively low loading pressures, infrared spectra suggest that styrene monomers transform to amorphous atactic polystyrene (APS) with minor crystalline isotactic polystyrene. In contrast, APS was found to be the solemore » product when polymerization occurs at relatively higher loading pressures. The time-dependent reaction profiles allow the examination of the polymerization kinetics by analyzing the rate constant and activation volume as a function of pressure. As a result, an optimized pressure condition, which allows a barrierless reaction to proceed, was identified and attributed to the very desirable reaction yield and kinetics. Finally, the photoinitiated reaction mechanism and the growth geometry of the polymer chains were investigated from the energy diagram of styrene and by the topology analysis of the crystal styrene. This study shows strong promise to produce functional polymeric materials in a highly efficient and controlled manner.« less

Quasi-free Proton Knockout Reactions on the Oxygen Isotopic Chain

NASA Astrophysics Data System (ADS)

Atar, Leyla; Aumann, Thomas; Bertulani, Carlos; Paschalis, Stefanos; R3B Collaboration

2017-09-01

It is well known from electron-induced knockout data that the single-particle (SP) strength is reduced to about 60-70% for stable nuclei in comparison to the independent particle model due to the presence of short- and long-range correlations. This finding has been confirmed by nuclear knockout reactions using stable and exotic beams, however, with a strong dependency on the proton-neutron asymmetry. The observed strong reduction of SP cross sections for the deeply bound valence nucleons in asymmetric nuclei is theoretically not understood. To understand this dependency quantitatively a complementary approach, quasi-free (QF) knockout reactions in inverse kinematics, is introduced. We have performed a systematic study of spectroscopic strength of oxygen isotopes using QF (p,2p) knockout reactions in complete kinematics at the R3B/LAND setup at GSI with secondary beams containing 13-24O. The oxygen isotopic chain covers a large variation of separ ation energies, which allow a systematic study of SF with respect to isospin asymmetry. We will present results on the (p,2p) cross sections for the entire oxygen isotopic chain obtained from a single experiment. By comparison with the Eikonal reaction theory the SF and reduction factors will be presented. The work is supported by GSI-TU Darmstadt cooperation and BMBF project 05P15RDFN1.

Synthesis of polyrotaxanes from acetyl-β-cyclodextrin

NASA Astrophysics Data System (ADS)

Ristić, I. S.; Nikolić, L.; Nikolić, V.; Ilić, D.; Budinski-Simendić, J.

2011-12-01

Polyrotaxanes are intermediary products in the synthesis of topological gels. They are created by inclusion complex formation of hydrophobic linear macromolecules with cyclodextrins or their derivatives. Then, pairs of cyclodextrin molecules with covalently linkage were practically forming the nodes of the semi-flexible polymer network. Such gels are called topological gels and they can absorb huge quantities of water due to the net flexibility allowing the poly(ethylene oxide) chains to slide through the cyclodextrin cavities, without being pulled out altogether. For polyrotaxane formation poly(ethylene oxide) was used like linear macromolecules. There are hydroxyl groups at poly(ethylene oxide) chains, whereby the linking of the voluminous molecules should be made. To avoid the reaction of cyclodextrin OH groups with stoppers, they should be protected by, e.g., acetylation. In this work, the acetylation of the OH groups of β-cyclodextrin was performed by acetic acid anhydride with iodine as the catalyst. The acetylation reaction was assessed by the FTIR and HPLC method. By the HPLC analysis was found that the acetylation was completed in 20 minutes. Inserting of poly(ethylene oxide) with 4000 g/mol molecule mass into acetyl-β-cyclodextrin with 2:1 poly(ethylene oxide) monomer unit to acetyl-β-cyclodextrin ratio was also monitored by FTIR, and it was found that the process was completed in 12 h at the temperature of 10°C. If the process is performed at temperatures above 10°C, or for periods longer than 12 hours, the process of uncontrolled hydrolysis of acetate groups was initiated.

A chain reaction approach to modelling gene pathways.

PubMed

Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

2012-08-01

BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By applying it to microarray data, the chain reaction model computed a set of reaction rates to examine the effects of three polyphenols (EGCG, genistein, and resveratrol) on gene expression in this pathway during puberty. We first performed statistical analysis to test the time factor on the estrogen synthesis pathway. Global tests were used to evaluate an overall gene expression change during puberty for each experimental group. Then, a chain reaction model was employed to simulate the estrogen synthesis pathway. Specifically, the model computed the reaction rates in a set of ordinary differential equations to describe interactions between genes in the pathway (A reaction rate K of A to B represents gene A will induce gene B per unit at a rate of K; we give details in the "method" section). Since disparate changes of gene expression may cause numerical error problems in solving these differential equations, we used an implicit scheme to address this issue. We first applied the chain reaction model to obtain the reaction rates for the control group. A sensitivity study was conducted to evaluate how well the model fits to the control group data at Day 50. Results showed a small bias and mean square error. These observations indicated the model is robust to low random noises and has a good fit for the control group. Then the chain reaction model derived from the control group data was used to predict gene expression at Day 50 for the three polyphenol groups. If these nutrients affect the estrogen synthesis pathways during puberty, we expect discrepancy between observed and expected expressions. Results indicated some genes had large differences in the EGCG (e.g., Hsd3b and Sts) and the resveratrol (e.g., Hsd3b and Hrmt12) groups. CONCLUSIONS: In the present study, we have presented (I) experimental studies of the effect of nutrient diets on the gene expression changes in a selected estrogen synthesis pathway. This experiment is valuable because it allows us to examine how the nutrient-containing diets regulate gene expression in the estrogen synthesis pathway during puberty; (II) global tests to assess an overall association of this particular pathway with time factor by utilizing generalized linear models to analyze microarray data; and (III) a chain reaction model to simulate the pathway. This is a novel application because we are able to translate the gene pathway into the chemical reactions in which each reaction channel describes gene-gene relationship in the pathway. In the chain reaction model, the implicit scheme is employed to efficiently solve the differential equations. Data analysis results show the proposed model is capable of predicting gene expression changes and demonstrating the effect of nutrient-containing diets on gene expression changes in the pathway. One of the objectives of this study is to explore and develop a numerical approach for simulating the gene expression change so that it can be applied and calibrated when the data of more time slices are available, and thus can be used to interpolate the expression change at a desired time point without conducting expensive experiments for a large amount of time points. Hence, we are not claiming this is either essential or the most efficient way for simulating this problem, rather a mathematical/numerical approach that can model the expression change of a large set of genes of a complex pathway. In addition, we understand the limitation of this experiment and realize that it is still far from being a complete model of predicting nutrient-gene interactions. The reason is that in the present model, the reaction rates were estimated based on available data at two time points; hence, the gene expression change is dependent upon the reaction rates and a linear function of the gene expressions. More data sets containing gene expression at various time slices are needed in order to improve the present model so that a non-linear variation of gene expression changes at different time can be predicted.

Validation of Reference Genes in mRNA Expression Analysis Applied to the Study of Asthma.

PubMed

Segundo-Val, Ignacio San; Sanz-Lozano, Catalina S

2016-01-01

The quantitative Polymerase Chain Reaction is the most used technique for the study of gene expression. To correct putative experimental errors of this technique is necessary normalizing the expression results of the gene of interest with the obtained for reference genes. Here, we describe an example of the process to select reference genes. In this particular case, we select reference genes for expression studies in the peripheral blood mononuclear cells of asthmatic patients.

International Symposium on Gas Kinetics (9th) Held in Bordeaux, France on 20-25 July 1986. Abstracts

DTIC Science & Technology

1986-07-25

J. Chem. Kinet., 14, 933 (1982). Present address: British Gas, London Research Station, Puliham, London, E’ngland. 1 -54 Synthesis and Pyrolysis of...while the cis/trans ratio of 1 - chloropropane is much higher than unity. We were interested In the alternative radical chain process which is strongly...H2 (V = 1 ) reaction and its isotopic analogs. VB. Rozenshtein, Y.M. Gershenzon,A.V. Ivanov, S.D. Ilin, S.I. Kucheryavii and S.Y. Umanskii 10.20

The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

PubMed

Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

2002-03-01

Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

Identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in Mexico.

PubMed

Ortega, Ariadna Flores; Martínez-Castañeda, José Simón; Bautista-Gómez, Linda G; Muñoz, Raúl Fajardo; Hernández, Israel Quijano

This is the first report on circulating canine rotavirus in Mexico. Fifty samples from dogs with gastroenteritis were analyzed used polymerase chain reaction and reverse transcription polymerase chain reaction in order to identify parvovirus and rotavirus, respectively; 7% of dogs were infected with rotavirus exclusively, while 14% were co-infected with both rotavirus and parvovirus; clinical signs in co-infected dogs were more severe. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

PubMed

Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

2016-01-01

American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

Phenylalanine 445 within oxidosqualene-lanosterol cyclase from Saccharomyces cerevisiae influences C-Ring cyclization and deprotonation reactions.

PubMed

Wu, Tung-Kung; Liu, Yuan-Ting; Chiu, Feng-Hsuan; Chang, Cheng-Hsiang

2006-10-12

[reaction: see text] We describe the Saccharomyces cerevisiae oxidosqualene-lanosterol cyclase Phe445 site-saturated mutants that generate truncated tricyclic and altered deprotonation product profiles. Among these mutants, only polar side-chain group substitutions genetically complemented yeast viability and produced spatially related product diversity, supporting the Johnson model that cation-pi interactions between a carbocationic intermediate and an enzyme can be replaced by an electrostatic or polar side chain to stabilize the cationic intermediate, but with product differentiation.

Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

PubMed

Law, Dennis K S; Tsang, Raymond S W

2013-05-01

A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

A computational study of pyrolysis reactions of lignin model compounds

Treesearch

Thomas Elder

2010-01-01

Enthalpies of reaction for the initial steps in the pyrolysis of lignin have been evaluated at the CBS-4m level of theory using fully substituted b-O-4 dilignols. Values for competing unimolecular decomposition reactions are consistent with results previously published for phenethyl phenyl ether models, but with lowered selectivity. Chain propagating reactions of free...

Highly efficient enzymatic synthesis of 2-monoacylglycerides and structured lipids and their production on a technical scale.

PubMed

Pfeffer, Jan; Freund, Andreas; Bel-Rhlid, Rachid; Hansen, Carl-Erik; Reuss, Matthias; Schmid, Rolf D; Maurer, Steffen C

2007-10-01

We report here a two-step process for the high-yield enzymatic synthesis of 2-monoacylglycerides (2-MAG) of saturated as well as unsaturated fatty acids with different chain lengths. The process consists of two steps: first the unselective esterification of fatty acids and glycerol leading to a triacylglyceride followed by an sn1,3-selective alcoholysis reaction yielding 2-monoacylglycerides. Remarkably, both steps can be catalyzed by lipase B from Candida antarctica (CalB). The whole process including esterification and alcoholysis was scaled up in a miniplant to a total volume of 10 l. With this volume, a two-step process catalyzed by CalB for the synthesis of 1,3-oleoyl-2-palmitoylglycerol (OPO) using tripalmitate as starting material was established. On a laboratory scale, we obtained gram quantities of the synthesized 2-monoacylglycerides of polyunsaturated fatty acids such as arachidonic-, docosahexaenoic- and eicosapentaenoic acids and up to 96.4% of the theoretically possible yield with 95% purity. On a technical scale (>100 g of product, >5 l of reaction volume), 97% yield was reached in the esterification and 73% in the alcoholysis and a new promising process for the enzymatic synthesis of OPO was established.

Equilibration of tert-alkylphenols (thermodynamic analysis of the alkylation of phenols using branched-chain olefins)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nesterova, T.N.; Malova, T.N.; Pil'shchikov, V.A.

1985-09-01

The authors describe the results of a study to evaluate the thermodynamic properties of t-Alk phi. These results, combined with earlier results, have enabled the authors to complete a thermodynamic analysis of the process for preparing tertiary alkylphenols which are widely used as additives in lubricating and fuel oils. Research was conducted over a fairly wide temperature range, in which the median temperature value corresponds to the upper temperature limit for a continuous process utilizing a type KU-2 ion-exchange resin catalyst; continuous operations are currently the most widely used method for industrial preparation of alkylphenols. Experimentally determined values of themore » equilibrium constants in a table indicate that they are influenced primarily by the nature of the reaction, and do not depend on the size of the tertiary alkyl substituents. Data in another table demonstrate that the thermodynamic properties of a given reaction are determined by the reaction type and are independent of the size of the tertiary alkylphenols. It was discovered that in order to increase the yield of the desired tert-alkylphenol product, the process should be carried out at the minimum possible temperature, using catalysts which are sufficiently active to guarantee thermodynamic control.« less

Biocatalytic, one-pot diterminal oxidation and esterification of n-alkanes for production of α,ω-diol and α,ω-dicarboxylic acid esters.

PubMed

van Nuland, Youri M; de Vogel, Fons A; Scott, Elinor L; Eggink, Gerrit; Weusthuis, Ruud A

2017-11-01

Direct and selective terminal oxidation of medium-chain n-alkanes is a major challenge in chemistry. Efforts to achieve this have so far resulted in low specificity and overoxidized products. Biocatalytic oxidation of medium-chain n-alkanes - with for example the alkane monooxygenase AlkB from P. putida GPo1- on the other hand is highly selective. However, it also results in overoxidation. Moreover, diterminal oxidation of medium-chain n-alkanes is inefficient. Hence, α,ω-bifunctional monomers are mostly produced from olefins using energy intensive, multi-step processes. By combining biocatalytic oxidation with esterification we drastically increased diterminal oxidation upto 92mol% and reduced overoxidation to 3% for n-hexane. This methodology allowed us to convert medium-chain n-alkanes into α,ω-diacetoxyalkanes and esterified α,ω-dicarboxylic acids. We achieved this in a one-pot reaction with resting-cell suspensions of genetically engineered Escherichia coli. The combination of terminal oxidation and esterification constitutes a versatile toolbox to produce α,ω-bifunctional monomers from n-alkanes. Copyright © 2017 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

Modeling the SOA Forming Potential of Substituted Dihydrofurans from Alkane + OH Reactions in the Atmosphere

NASA Astrophysics Data System (ADS)

Jordan, C. E.; Griffin, R. J.; Lim, Y. B.; Ziemann, P. J.; Atkinson, R.; Arey, J.

2005-12-01

Recent laboratory studies show that δ-hydroxycarbonyls formed in the atmosphere via OH-initiated reactions with alkanes can cyclize then dehydrate to form substituted dihydrofurans. These dihydrofurans are highly reactive, with lifetimes in the atmosphere of 1.3 h (OH), 24 s (NO3), and 7 min (O3). The ability of the δ-hydroxycarbonyls to cyclize and dehydrate has been shown to increase with increasing carbon number. Recent laboratory results show that the secondary organic aerosol (SOA) yields from alkanes also increase with carbon number reaching ~53% for C15. The reaction mechanism proposed based on the chamber results is the basis of the modeling study presented here. We have incorporated this proposed mechanism into the Caltech Atmospheric Chemistry Mechanism (CACM). For computational reasons, similar compounds are lumped together and represented by a single suitable compound. In the present case, alkanes are lumped into 3 groups: short chains (≤C6), medium chains (C7 - C12), and long chains (≥C13). SOA yields obtained in chamber studies increase dramatically from 0.5% for C8 to 25% for C12. The most dramatic increase is observed from C11 (8%) to C13 (~50%). This is attributed to the low volatility of first generation products contributing to the SOA from longer chain alkanes. Here we have studied OH reactions with the substituted dihydrofurans for medium (represented by C10) and long (represented by C16) chain alkanes using CACM along with the aerosol partitioning module MPMPO (Model to Predict the Multi-phase Partitioning of Organics). We will present the results of this modeling study, characterizing the influence of substituted dihydrofurans on the SOA forming potential of alkanes.

Evaluation of coal-related model compounds using a tandem mass spectrometry.

PubMed

Li, Guo-Sheng; Dong, Xueming; Fan, Xing; You, Chun-Yan; Wu, Ge; Zhao, Yun-Peng; Lu, Yao; Wei, Xian-Yong; Ma, Feng-Yun

2018-05-08

Gas chromotography/mass spectrometry (GC/MS) is a routine and basic instrumental method for the analysis of complex coal conversion products in chemical industry. To further enhance practical potentials of GC/MS in chemical industry, a tandem MS method for the selection of ion pair applied in monitoring coal conversions was established by using GC/quadrupole time-of-flight MS (GC/Q-TOF MS). The corresponding fragmentation pathways were explored and suitable ion pairs were screened. Fourteen coal-related model compounds (CRMCs) were analyzed using a GC/Q-TOF MS with different collision induced dissociation (CID) energies (5-20 eV). The fragmentation pathways can offer a better understanding of chemical bond breaking, hydrogen transfer, rearrangement reactions and elimination of neutral fragments for CRMCs during the CID process. The precursor ions of aromatic hydrocarbons without alkyl chain were hard to fragment with a CID energy of 20 eV. But aromatic hydrocarbons with branched chains were prone to fragment via the loss of alkyl chains and further fragmented through ring-open reactions. Compared to C alk -C ar bond, C ar -C ar bond was hard to fragment duo to its high bond dissociation energy. The existence of heteroatoms facilitated fragmentation that was conducive to screening ion pair. The CID technique of GC/Q-TOF MS will contribute to the studies on the organic composition of coals and building monitoring methods for coal conversions via fragmentation and ion pair selection. This article is protected by copyright. All rights reserved.

Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes

NASA Astrophysics Data System (ADS)

Denisov, E. T.; Shestakov, A. F.

2018-05-01

Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

Identifying of meat species using polymerase chain reaction (PCR)

NASA Astrophysics Data System (ADS)

Foong, Chow Ming; Sani, Norrakiah Abdullah

2013-11-01

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

Detection of different Ikaros isoforms in human leukaemias using real-time quantitative polymerase chain reaction.

PubMed

Olivero, S; Maroc, C; Beillard, E; Gabert, J; Nietfeld, W; Chabannon, C; Tonnelle, C

2000-09-01

The Ikaros gene is an essential regulator in development and haematopoiesis. Dysregulated Ikaros gene expression participates in leukaemic processes, as evidenced in animal models, and by analyses of blast-cell populations from leukaemic patients. We used real-time quantitative polymerase chain reaction (PCR) to evaluate the relative abundance of several Ikaros transcript isoforms in a variety of leukaemic-cell samples. Total RNA was isolated from bone-marrow or blood-cell samples collected at diagnosis in children or adult patients, 18 of whom had acute myeloblastic leukaemia (AML), 61 of whom had acute lymphoblastic leukaemia (ALL) and 11 of whom had chronic myeloid leukaemia (CML). The ratio (Ik1 + Ik2)/(Ik1 + Ik2 + Ik4 + Ik7 + Ik8) ranged from 13.5% to 85% and was lower (P < 0. 05) in samples from patients with m-bcr-abl ALL. An alternative splicing resulting in the deletion of 30 nucleotides at the end of exon 6 was observed in leukaemic samples, and in normal thymus and bone marrow. Our results are consistent with previous reports and suggest that the pattern of expression of the different human Ikaros isoforms are not homogeneous among different subsets of leukaemias.

Can collision-induced negative-ion fragmentations of [M-H](-) anions be used to identify phosphorylation sites in peptides?

PubMed

Tran, T T Nha; Wang, Tianfang; Hack, Sandra; Hoffmann, Peter; Bowie, John H

2011-12-15

A joint experimental and theoretical investigation of the fragmentation behaviour of energised [M-H](-) anions from selected phosphorylated peptides has confirmed some of the most complex rearrangement processes yet to be reported for peptide negative ions. In particular: pSer and pThr (like pTyr) may transfer phosphate groups to C-terminal carboxyl anions and to the carboxyl anion side chains of Asp and Glu, and characteristic nucleophilic/cleavage reactions accompany or follow these rearrangements. pTyr may transfer phosphate to the side chains of Ser and Thr. The reverse reaction, namely transfer of a phosphate group from pSer or pThr to Tyr, is energetically unfavourable in comparison. pSer can transfer phosphate to a non-phosphorylated Ser. The non-rearranged [M-H](-) species yields more abundant product anions than its rearranged counterpart. If a peptide containing any or all of Ser, Thr and Tyr is not completely phosphorylated, negative-ion cleavages can determine the number of phosphated residues, and normally the positions of Ser, Thr and Tyr, but not which specific residues are phosphorylated. This is in accord with comments made earlier by Lehmann and coworkers. Copyright © 2011 John Wiley & Sons, Ltd.

High fluorescence emission of carboxylic acid functionalized polystyrene/BaTiO{sub 3} nanocomposites and rare earth metal complexes: Preparation and characterization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cao, X. T.; Showkat, A. M.; Wang, Z.

2015-03-30

Noble fluorescence nanocomposite compound based on barium titanate nanoparticles (BTO), polystyrene (PSt), and terbium ion (Tb{sup 3+}) was synthesized by a combination of surface-initiated reversible addition-fragmentation chain transfer (RAFT) polymerization, Friedel-Crafts alkylation reaction and coordinate chemistry. Initially, a modification of surface of BTO was conducted by an exchange process with S-benzyl S’-trimethoxysilylpropyltrithiocarbonate to create macro-initiator for polymerization of styrene. Subsequently, aryl carboxylic acid functionalized polystyrene grafted barium titanate (BTO-g-PSt-COOH) was generated by substitution reaction between 4-(Chloromethyl) benzoic acid and PSt chains. The coordination of the nanohybrids with Tb{sup 3+} ions afforded fluorescent Tb{sup 3+} tagged aryl carboxylic acid functionalized polystyrenemore » grafted barium titanate (BTO-g-PSt-Tb{sup 3+}) complexes. Structure, morphology, and fluorescence properties of nanohybrid complexes were investigated by respective physical and spectral studies. FT-IR and SEM analyses confirmed the formation of BTO-g-PSt-Tb{sup 3+}nanohybrids. Furthermore, TGA profiles demonstrated the grafting of aryl carboxylic acid functionalized polystyrene on BTO surface. Optical properties of BTO-g-PSt-Tb{sup 3+} complexes were investigated by fluorescence spectroscopy.« less

A Blood-based Test for the Detection of ROS1 and RET Fusion Transcripts from Circulating Ribonucleic Acid Using Digital Polymerase Chain Reaction

PubMed Central

Mellert, Hestia S.; Alexander, Kristin E.; Jackson, Leisa P.; Pestano, Gary A.

2018-01-01

We have developed novel methods for the isolation and characterization of tumor-derived circulating ribonucleic acid (cRNA) for blood-based liquid biopsy. Robust detection of cRNA recovered from blood represents a solution to a critical unmet need in clinical diagnostics. The test begins with the collection of whole blood into blood collection tubes containing preservatives that stabilize cRNA. Cell-free, exosomal, and platelet-associated RNA is isolated from plasma in this test system. The cRNA is reverse transcribed to complementary DNA (cDNA) and amplified using digital polymerase chain reaction (dPCR). Samples are evaluated for both the target biomarker as well as a control gene. Test validation included limit of detection, accuracy, and robustness studies with analytic samples. The method developed as a result of these studies reproducibly detect multiple fusion variants for ROS1 (C-Ros proto-oncogene 1; 8 variants) and RET (rearranged during transfection proto-oncogene; 8 variants). The sample processing workflow has been optimized so that test results can consistently be generated within 72 hours of sample receipt. PMID:29683453

Description of polymerase chain reaction and sequencing DNA Mycobacterium tuberculosis from specimen sputum of tuberculosis patients in Medan

NASA Astrophysics Data System (ADS)

Lily; Siregar, Y.; Ilyas, S.

2018-03-01

This study purposed to describe the product Polymerase Chain Reaction (PCR) and sequencing of DNA Mycobacterium (M.) tuberculosis from sputum of tuberculosis (TB) patients in Medan. Sputum was collected from patients that diagnosed with pulmonary TB by a physician. Specimen processed by PCR method of Li et al. and sequencing at Macrogen Laboratory. All of 12 product PCR were showed brightness bands at 126 base pair (bp). These results indicated similarity to the study of Li et al. Sequencing analysis showed the presence of a mutation and non-mutation groups of M. tuberculosis. The reference and outcome berange of the mutation and non-mutation of M. tuberculosis were 56-107, 59-85, 60-120 and 63-94, respectively. The percentage bp difference between the outcome and references for mutation and non-mutation were 3.448-6.569and 3.278-7.428%, respectively. In conclusion, the successful amplification of PCR products in a 1.5% agarose gel electrophoresis where all 12 sputa contained rpoB-positive M. tuberculosis and 0.644% difference was found between the outcome with reference bp of the mutation and non-mutation M. tuberculosis groups.

Effect of thermal modification on rheological properties of polyethylene blends

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siriprumpoonthum, Monchai; Nobukawa, Shogo; Yamaguchi, Masayuki, E-mail: m-yama@jaist.ac.jp

2014-03-15

We examined the effects of thermal modification under flow field on the rheological properties of linear low-density polyethylene (LLDPE) with high molecular weight, low-density polyethylene (LDPE), and their blends, without thermal stabilizer. Although structural changes during processing are not detected by size extrusion chromatography or nuclear magnetic resonance spectroscopy, linear viscoelastic properties changed greatly, especially for the LLDPE. A cross-linking reaction took place, leading to, presumably, star-shaped long-chain branches. Consequently, the modified LLDPE, having high zero-shear viscosity, became a thermorheologically complex melt. Moreover, it should be noted that the drawdown force, defined as the uniaxial elongational force at a constantmore » draw ratio, was significantly enhanced for the blends. Enhancement of elongational viscosity was also detected. The drawdown force and elongational viscosity are marked for the thermally modified blend as compared with those for the blend of thermally modified pure components. Intermolecular cross-linking reactions between LDPE and LLDPE, yielding polymers with more than two branch points per chain, result in marked strain-hardening in the elongational viscosity behavior even at small strain. The recovery curve of the oscillatory modulus after the shear modification is further evidence of a branched structure.« less

Detection of Mycobacterium avium subsp. paratuberculosis in bovine manure using Whatman FTA card technology and Lightcycler real-time PCR.

PubMed

Jaravata, Carmela V; Smith, Wayne L; Rensen, Gabriel J; Ruzante, Juliana M; Cullor, James S

2006-01-01

A modified forensic DNA extraction and real-time fluorescent polymerase chain reaction assay has been evaluated for the detection of Mycobacterium avium subsp. paratuberculosis (MAP) in bovine fecal samples using primers and fluorescent resonance energy transfer (FRET) probes targeting the IS900 gene sequence of MAP. DNA was successfully extracted from manure samples by utilizing the Whatman FTA card technology, which allows for simple processing and storage of samples at room temperature. The FTA cards were washed and subjected to a Chelex-100 incubation to remove any remaining polymerase chain reaction (PCR) inhibitors and to elute the DNA from the FTA card. This isolated DNA was then subjected to direct real time fluorescent PCR analysis. Detection of MAP DNA from bovine fecal samples spiked with known concentrations of viable MAP cells was obtained. The detection limits of the assay was consistently found to be between 10(2) and 10(4) colony forming units [CFU]/g, with some samples containing as low as 10 CFU/g, yielding positive assay results. This cost-efficient assay allows reporting of results as early as 4 h after fecal collection, which can be particularly useful in highthroughput herd screening.

The plant cell-wall enzyme AtXTH3 catalyses covalent cross-linking between cellulose and cello-oligosaccharide

NASA Astrophysics Data System (ADS)

Shinohara, Naoki; Sunagawa, Naoki; Tamura, Satoru; Yokoyama, Ryusuke; Ueda, Minoru; Igarashi, Kiyohiko; Nishitani, Kazuhiko

2017-04-01

Cellulose is an economically important material, but routes of its industrial processing have not been fully explored. The plant cell wall - the major source of cellulose - harbours enzymes of the xyloglucan endotransglucosylase/hydrolase (XTH) family. This class of enzymes is unique in that it is capable of elongating polysaccharide chains without the requirement for activated nucleotide sugars (e.g., UDP-glucose) and in seamlessly splitting and reconnecting chains of xyloglucan, a naturally occurring soluble analogue of cellulose. Here, we show that a recombinant version of AtXTH3, a thus far uncharacterized member of the Arabidopsis XTH family, catalysed the transglycosylation between cellulose and cello-oligosaccharide, between cellulose and xyloglucan-oligosaccharide, and between xyloglucan and xyloglucan-oligosaccharide, with the highest reaction rate observed for the latter reaction. In addition, this enzyme formed cellulose-like insoluble material from a soluble cello-oligosaccharide in the absence of additional substrates. This newly found activity (designated “cellulose endotransglucosylase,” or CET) can potentially be involved in the formation of covalent linkages between cellulose microfibrils in the plant cell wall. It can also comprise a new route of industrial cellulose functionalization.

Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

PubMed Central

Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

2014-01-01

Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas. PMID:24553130

Serine proteases in rodent hippocampus.

PubMed

Davies, B J; Pickard, B S; Steel, M; Morris, R G; Lathe, R

1998-09-04

Brain serine proteases are implicated in developmental processes, synaptic plasticity, and in disorders including Alzheimer's disease. The spectrum of the major enzymes expressed in brain has not been established previously. We now present a systematic study of the serine proteases expressed in adult rat and mouse hippocampus. Using a combination of techniques including polymerase chain reaction amplification and Northern blotting we show that tissue-type plasminogen activator (t-PA) is the major species represented. Unexpectedly, the next most abundant species were RNK-Met-1, a lymphocyte protease not reported previously in brain, and two new family members, BSP1 (brain serine protease 1) and BSP2. We report full-length sequences of the two new proteases; homologies indicate that these are of tryptic specificity. Although BSP2 is expressed in several brain regions, BSP1 expression is strikingly restricted to hippocampus. Other enzymes represented, but at lower levels, included elastase IV, proteinase 3, complement C2, chymotrypsin B, chymotrypsin-like protein, and Hageman factor. Although thrombin and urokinase-type plasminogen activator were not detected in the primary screen, low level expression was confirmed using specific polymerase chain reaction primers. In contrast, and despite robust expression of t-PA, the usual t-PA substrate plasminogen was not expressed at detectable levels.

Tandem catalysis: a new approach to polymers.

PubMed

Robert, Carine; Thomas, Christophe M

2013-12-21

The creation of polymers by tandem catalysis represents an exciting frontier in materials science. Tandem catalysis is one of the strategies used by Nature for building macromolecules. Living organisms generally synthesize macromolecules by in vivo enzyme-catalyzed chain growth polymerization reactions using activated monomers that have been formed within cells during complex metabolic processes. However, these biological processes rely on highly complex biocatalysts, thus limiting their industrial applications. In order to obtain polymers by tandem catalysis, homogeneous and enzyme catalysts have played a leading role in the last two decades. In the following feature article, we will describe selected published efforts to achieve these research goals.

Raman spectroscopy investigation and improved knowledge on industrial cation-exchange membranes involved in electrodialysis process

NASA Astrophysics Data System (ADS)

Chaouki, M.; Huguet, P.; Bribes, J.-L.

1996-06-01

Raman spectra of three specific, industrial, cation-exchange membranes (CEMs) have shown the existence of an extra vibrational band. The relative intensity of this band is different in each membrane spectrum recorded. Chlorosulfonation of polymeric ethylenetrifluoroethylene (ETFE) film grafted with polystyrene chains is used to obtain these CEMs involved in the electrodialysis process. A Raman study of the above reaction has been undertaken and has shown that non-sulfonated polystyrene rings give rise to this extra vibrational band. Different behavior of CEMs synthesized under similar conditions can be explained by a variable amount of non-sulfonated polystyrene rings contained in these materials.

Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

PubMed

Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

2009-01-01

A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

Cerebral Toxoplasmosis Diagnosed by Nested-polymerase Chain Reaction in a Patient with Rheumatoid Arthritis.

PubMed

Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki

2018-05-15

A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.

Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

PubMed Central

Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

2004-01-01

A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

Indirect studies on astrophysical reactions at the low-energy RI beam separator CRIB

NASA Astrophysics Data System (ADS)

Yamaguchi, H.; Kahl, D.; Hayakawa, S.; Yang, L.; Shimizu, H.; Sakaguchi, Y.; Abe, K.; Wakabayashi, Y.; Hashimoto, T.; Nakao, T.; Kubono, S.; Suhara, T.; Iwasa, N.; Kim, A.; Kim, D. H.; Cha, S. M.; Kwag, M. S.; Lee, J. H.; Lee, E. J.; Chae, K. Y.; Imai, N.; Kitamura, N.; Lee, P.; Moon, J. Y.; Lee, K. B.; Akers, C.; Jung, H. S.; Duy, N. N.; Khiem, L. H.; Lee, C. S.; Cherubini, S.; Gulino, M.; Spitaleri, C.; Rapisarda, G. G.; Cognata, M. La; Lamia, L.; Romano, S.; Coc, A.; de Sereville, N.; Hammache, F.; Kiss, G.; Bishop, S.; Teranishi, T.; Kawabata, T.; Kwon, Y. K.; Binh, D. N.

2018-04-01

Studies on nuclear astrophysics, nuclear structure, and other interests have been performed using the radioactive-isotope (RI) beams at the low-energy RI beam separator CRIB, operated by Center for Nuclear Study (CNS), the University of Tokyo. A type of measurement to study astophysical reactions at CRIB is by the elastic resonant scattering with the thick-target method in inverse kinematics. An example is the α resonant scattering with 7Be beam, related to the astrophysical 7Be(α,γ) reactions, which is relevant in the hot p-p chain and νp-process in supernovae. Other α resonant scattering measurements with 30S, 10Be, 15O, and 18Ne beams have been performed at CRIB, using the thick-target method. There have also been measurements based on other experimental methods. The first Trojan horse method (THM) measurement using an RI beam has been performed at CRIB, to study the 18F(p, α)15O reaction at astrophysical energies via the three body reaction 2H(18F, α15O)n. The 18F(p, α)15O reaction rate is crucial to understand the 511-keV γ-ray production in nova explosion phenomena, and we successfully evaluated the reaction cross section at novae temperature and below experimentally for the first time.

Upgrade of Long-chain Hydrocarbons by Low Pressure Oxygen Plasmas

NASA Astrophysics Data System (ADS)

Patiño, Pedro; Méndez, Bernardo; Gambús, Gloria

1998-10-01

Huge known heavy oil deposits in many countries remain largely untapped. The API gravity of crude oils has been decreasing by about 0.17% per year, this meaning that there will be an urgent need for economically viable new technologies to upgrade the heavy oil for the refineries. The same applies to the residues of several refineries processes. This work will present the results of the application of a plasma process to upgrade long-chain hydrocarbons, namely, tridecane, tetradecane, and squalane (shark oil). They are high boiling point alkanes, the latter being a C_30H_62 with six methyl groups attached to various carbon positions on the chain. An oxygen plasma, created by a high voltage glow discharge, reached the low vapor pressure surface of each liquid hydrocarbon. This (2 mL) was cooled down to temperatures close to its freezing point in a glass reactor. Applied power was 24 W for times of reaction between 30 and 60 minutes and oxygen pressures from 0.1 to 0.4 mbar. Products were analyzed by IR and NMR spectroscopies. The ^1H and ^13C NMR spectra showed that the most important products were secondary alcohols and the corresponding ketones, for tridecane and tetradecane. For squalane, tertiary alcohols were first. Total conversions are tipically 90 to 100%

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Sangmo; Paranthaman, Mariappan Parans; Noh, Tae Won

The voltage spectroscopies in scanning probe microscopy (SPM) techniques are widely used to investigate the electrochemical processes in nanoscale volumes, which are important for current key applications, such as batteries, fuel cells, catalysts, and memristors. The spectroscopic measurements are commonly performed on a grid of multiple points to yield spatially resolved maps of reversible and irreversible electrochemical functionalities. Hence, the spacing between measurement points is an important parameter to be considered, especially for irreversible electrochemical processes. Here, we report nonlocal electrochemical dynamics in chains of Ag particles fabricated by the SPM tip on a silver ion solid electrolyte. When themore » grid spacing is small compared with the size of the formed Ag particles, anomalous chains of unequally sized particles with double periodicity evolve. This behavior is ascribed to a proximity effect during the tip-induced electrochemical process, specifically, size-dependent silver particle growth following the contact between the particles. In addition, fractal shape evolution of the formed Ag structures indicates that the growth-limiting process changes from Ag +/Ag redox reaction to Ag +-ion diffusion with the increase in the applied voltage and pulse duration. Our study shows that characteristic shapes of the electrochemical products are good indicators for determining the underlying growth-limiting process, and emergence of complex phenomena during spectroscopic mapping of electrochemical functionalities.« less

Synthesis of surface-anchored DNA-polymer bioconjugates using reversible addition-fragmentation chain transfer polymerization.

PubMed

He, Peng; He, Lin

2009-07-13

We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.

Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.

PubMed

Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W

2007-04-01

Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.

Reaction pathways of propene pyrolysis.

PubMed

Qu, Yena; Su, Kehe; Wang, Xin; Liu, Yan; Zeng, Qingfeng; Cheng, Laifei; Zhang, Litong

2010-05-01

The gas-phase reaction pathways in preparing pyrolytic carbon with propene pyrolysis have been investigated in detail with a total number of 110 transition states and 50 intermediates. The structure of the species was determined with density functional theory at B3PW91/6-311G(d,p) level. The transition states and their linked intermediates were confirmed with frequency and the intrinsic reaction coordinates analyses. The elementary reactions were explored in the pathways of both direct and the radical attacking decompositions. The energy barriers and the reaction energies were determined with accurate model chemistry method at G3(MP2) level after an examination of the nondynamic electronic correlations. The heat capacities and entropies were obtained with statistical thermodynamics. The Gibbs free energies at 298.15 K for all the reaction steps were reported. Those at any temperature can be developed with classical thermodynamics by using the fitted (as a function of temperature) heat capacities. It was found that the most favorable paths are mainly in the radical attacking chain reactions. The chain was proposed with 26 reaction steps including two steps of the initialization of the chain to produce H and CH(3) radicals. For a typical temperature (1200 K) adopted in the experiments, the highest energy barriers were found in the production of C(3) to be 203.4 and 193.7 kJ/mol. The highest energy barriers for the production of C(2) and C were found 174.1 and 181.4 kJ/mol, respectively. These results are comparable with the most recent experimental observation of the apparent activation energy 201.9 +/- 0.6 or 137 +/- 25 kJ/mol. Copyright 2010 Wiley Periodicals, Inc.

Reactive modification of polyesters and their blends

NASA Astrophysics Data System (ADS)

Wan, Chen

2004-12-01

As part of a broader research effort to investigate the chemical modification of polyesters by reactive processing a low molecular weight (MW) unsaturated polyester (UP) and a higher MW saturated polyester, polyethylene terephthalate (PET), alone or blended with polypropylene (PP) were melt processed in a batch mixer and continuous twin screw extruders. Modification was monitored by on-line rheology and the products were characterized primarily by off-line rheology, morphology and thermal analysis. Efforts were made to establish processing/property relationships and provide an insight of the accompanying structural changes. The overall response of the reactively modified systems was found to be strongly dependent on the component characteristics, blend composition, type and concentrations of reactive additives and processing conditions. The work concluded that UP can be effectively modified through reactive melt processing. Its melt viscosity and MW can be increased through chemical reactions between organic peroxides (POX) and chain unsaturation or between MgO and carboxyl/hydroxyl end groups. Reactive blending of PP/UP blends through peroxide modification gave finer and more uniform morphology than unreacted blends and at a given PP/UP weight ratio more thermoplastic elastomers-like rheological behavior. This is due to the continuously decreasing viscosity ratio of PP/UP towards unity by the competing reactions between POX and the blend components and formation of PP-UP copolymers which serve as in-situ compatibilizers to promote better interfacial adhesion. Kinetics of the competing reactions were analyzed through a developed model. In addition to POX concentration and mixing efficiency, rheology and morphology of UP/PP bends were significantly affected by the addition of inorganic and organic coagents. Addition of coagents such as a difunctional maleimide, MgO and/or an anhydride functionalized PP during reactive blending offers effective means for tailoring the desired rheological and structural characteristics of the final products for potential applications such as low density extrusion foaming or compatibilization of immiscible polymer blends. Important modification conditions through coagents are identified and reaction mechanisms are proposed. A high MW saturated polyester, PET, can also be rheologically modified in extruders through low MW multifunctional anhydride and epoxy compounds by chain extension/branching. Several such modifiers were successfully screened in terms of their reactivity towards PET under controlled reactive extrusion conditions. A dianhydride with medium reactivity was then successfully used in a one-step reactive modification/extrusion foaming process to produce low density foams. A similar process was successfully used to produce small cell size foams from a four component system containing PET, PP and lesser amounts of a low molecular weight multifunctional epoxy compound and an acid functionalized polyolefin, the latter acting as compatibilizers.

Mathematical Modeling of Ammonia Electro-Oxidation on Polycrystalline Pt Deposited Electrodes

NASA Astrophysics Data System (ADS)

Diaz Aldana, Luis A.

The ammonia electrolysis process has been proposed as a feasible way for electrochemical generation of fuel grade hydrogen (H2). Ammonia is identified as one of the most suitable energy carriers due to its high hydrogen density, and its safe and efficient distribution chain. Moreover, the fact that this process can be applied even at low ammonia concentration feedstock opens its application to wastewater treatment along with H 2 co-generation. In the ammonia electrolysis process, ammonia is electro-oxidized in the anode side to produce N2 while H2 is evolved from water reduction in the cathode. A thermodynamic energy requirement of just five percent of the energy used in hydrogen production from water electrolysis is expected from ammonia electrolysis. However, the absence of a complete understanding of the reaction mechanism and kinetics involved in the ammonia electro-oxidation has not yet allowed the full commercialization of this process. For that reason, a kinetic model that can be trusted in the design and scale up of the ammonia electrolyzer needs to be developed. This research focused on the elucidation of the reaction mechanism and kinetic parameters for the ammonia electro-oxidation. The definition of the most relevant elementary reactions steps was obtained through the parallel analysis of experimental data and the development of a mathematical model of the ammonia electro-oxidation in a well defined hydrodynamic system, such as the rotating disk electrode (RDE). Ammonia electro-oxidation to N 2 as final product was concluded to be a slow surface confined process where parallel reactions leading to the deactivation of the catalyst are present. Through the development of this work it was possible to define a reaction mechanism and values for the kinetic parameters for ammonia electro-oxidation that allow an accurate representation of the experimental observations on a RDE system. Additionally, the validity of the reaction mechanism and kinetic parameters were supplemented by means of process scale up, performance evaluation, and hydrodynamic analysis in a flow cell electrolyzer. An adequate simulation of the flow electrolyzer performance was accomplished using the obtained kinetic parameters.

Thermochemistry analyses for transformation of C6 glucose compound into C9, C12 and C15 alkanes using density functional theory

NASA Astrophysics Data System (ADS)

Verma, Anand Mohan; Kishore, Nanda

2017-02-01

The hydrolysis of cellulose fraction of biomass yields C6 glucose which further can be transformed into long-chain hydrocarbons by C-C coupling. In this study, C6 glucose is transformed into three chain alkanes, namely, C9, C12 and C15 using C-C coupling reactions under the gas and aqueous phase milieus. The geometry optimisation and vibrational frequency calculations are carried out at well-known hybrid-GGA functional, B3LYP with the basis set of 6-31+g(d,p) under the density functional theory framework. The single point energetics are calculated at M05-2X/6-311+g(3df,2p) level of theory. All thermochemical properties are calculated over a wide range of temperature between 300 and 900 K at an interval of 100 K. The thermochemistry suggested that the aqueous phase behaviour is suitable for the hydrolysis of sugar into long-chain alkanes compared to gas-phase environment. The hydrodeoxygenation reactions under each reaction pathway are found as most favourable reactions in both phases; however, aqueous phase dominates over gas phase in all discussed thermodynamic parameters.

Catalysis Science Initiative: Catalyst Design by Discovery Informatics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delgass, William Nicholas; Abu-Omar, Mahdi; Caruthers, James

Catalysts selectively enhance the rates of chemical reactions toward desired products. Such reactions provide great benefit to society in major commercial sectors such as energy production, protecting the environment, and polymer products and thereby contribute heavily to the country’s gross national product. Our premise is that the level of fundamental understanding of catalytic events at the atomic and molecular scale has reached the point that more predictive methods can be developed to shorten the cycle time to new processes. The field of catalysis can be divided into two regimes: heterogeneous and homogeneous. For the heterogeneous catalysis regime, we have usedmore » the water-gas shift (WGS) reaction (CO + H2O + CO2 + H2O) over supported metals as a test bed. Detailed analysis and strong coupling of theory with experiment have led to the following conclusions: • The sequence of elementary steps goes through a COOH intermediate • The CO binding energy is a strong function of coverage of CO adsorbed on the surface in many systems • In the case of Au catalysts, the CO adsorption is generally too weak on surface with close atomic packing, but the enhanced binding at corner atoms (which are missing bonding partners) of cubo-octahedral nanoparticles increases the energy to a near optimal value and produces very active catalysts. • Reaction on the metal alone cannot account for the experimental results. The reaction is dual functional with water activation occurring at the metal-support interface. It is clear from our work that the theory component is essential, not only for prediction of new systems, but also for reconciling data and testing hypotheses regarding potential descriptors. Particularly important is the finding that the interface between nano-sized metal particles and the oxides that are used to support them represent a new state of matter in the sense that the interfacial bonding perturbs the chemical state of both metals atoms and the support atoms in the interfacial region. Some of the first theoretical descriptions of this important chemistry and potential new source of control of catalyst properties are be in preparation for submission. On the homogeneous catalysis side, we have used single site olefin polymerization as the testbed. This system is important because changes in a single ligand bonded to the catalytically active metal site can alter the rates of individual steps in the polymerization sequence and thereby change the properties of the resulting polymer, potentially improving its value in a hundred million pound per year industry. We have made a major advance in understanding such systems by developing a population balance kinetic model that allows us to predict the molecular weight distribution (MWD) of the product. That, in turn, allows use of MWD data to fit kinetic parameters. By combining monomer loss data, MWD, measurement of the number of working active sites, and polymer end group analysis, we have a rich data set that is highly discriminating of kinetic mechanism. Thus, we have a robust tool for producing high quality, detailed kinetic parameters, which we have used to refine mechanisms presented in the literature and discover relationships between steric and electronic properties of group IV catalysts and individual rate constants in a number of systems. Our recent work on six-coordinate Zr, Ti, and Hf amine bis(phenolate) systems, we have shown that: • The sterics (bulkiness) of the ligands specifically affect the chain termination reaction • The electron density on the metal controls misinsertion (flipped orientation) of the olefin into the growing polymer • Steric effects related to the size of the ortho ligand on the catalyst have been shown to strongly affect its the degree of dormancy, i.e. tendency to stop reacting • Changes in the size of the amine pendent group on the catalyst can have such a strong effect on chain termination as to change the catalyst from one that produces only oligomers to one that incorporates oligomers in polymer chains to introduce chain branching. These effects control the length of molecular chains, the number of errors in the regularity of the chains, and the variation of chain lengths in the final product distribution. These characteristics, in turn, determine the properties of the resulting polymer material. Predictive modeling of polymerization process cannot be done without the quantitative rate constant determination that our unique and comprehensive approach has produced. This tool, combined with insights on how catalyst chemistry affects the rate constants, is an important step toward establishing the quantitative relationships between catalyst chemistry and polymer properties that will allow more efficient searches for new catalysts and speed the discovery process. Thus, in both the heterogeneous and homogeneous catalysis areas, this work has brought important new understanding to the field. The technical effectiveness of our approach is demonstrated by its success. For heterogeneous catalysis, experimental work alone showed the important of the metal-support interface, but the integration with theory has allowed deeper understanding of the fundamental source of the effects and shown the path for how to use this understanding for discovery. In the case of homogeneous catalysis, methodology for determination of which reactions are needed to account for the data and the extraction of quantitative values for rate constants for those reactions allows accurate modeling of reaction behavior. This allowed correlation of trends in catalyst properties with alterations of specific rates, thus contributing to a data base that will guide catalyst discovery. While not yet realized, the economic benefits of this approach will come in significantly shortened cycle times for discovery and ability to fill product demand at lower price.« less

Vanadium accelerates polymerase chain reaction and expands the applicability of forensic DNA testing.

PubMed

Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko

2013-05-01

Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Kinetics of the Br2-CH3CHO Photochemical Chain Reaction

NASA Technical Reports Server (NTRS)

Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.

1997-01-01

Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).

The study of poly(L-lactide) grafted silica nanoparticles on the film blowing of poly(L-lactide)

NASA Astrophysics Data System (ADS)

Wu, Feng; Liu, Zhengying; Yang, Mingbo

2015-05-01

PLA nanocomposites are prepared by us, and to better develop the function of silica nanoparticle, the surface of silica nanoparticles are modified by introducing PLA chains via "grafting to" method in our research. According to the results of 1H NMR and TGA, it shows that the PLA grafted Silica nanoparticles are successfully synthesized by controlling the reaction condition, and the molecular weight of the grafted PLA chains is relatively as high as 22 400 g/mol. PLA Nanocomposites with modified nanoparticles are prepared using a convenient melt blending method to guarantee well-distribution of the particles. The well-dispersion state of silica nanospheres is confirmed by Scan Electrical Micrograph (SEM) technology. From the dynamic shear rheology tests, the strain and time sweep both reveal that stability networks are formed in these nanocomposites. And the frequency sweep shows that the nanoparticles with long grafted chains dramatically enhanced the storage and viscosity of the pure PLA. The rheology testing suggests that strong particle-matrix interactions between molecularly/nano-level dispersed grafted silica and PLA chains formed; and the elongational viscosity of PLA has been markedly improved with the addition of the nanoparticle. The effect of modified nanoparticles on the thermal properties of PLA has also been studied by us using Differential Scanning Calorimetry (DSC). It reveals that the crystallization rate of PLA has been improved as the long grafted chains play as the nucleation sites for PLA. Finally based on these rheology and crystallization researches, the nanocomposites are used to prepare PLA blowing films. Compared to pure PLA and PLA/unmodified silica nanocomposites, the results show that the stability of the film blowing has been greatly improved and the blow-up ratio has been increased with the addition of PLA grafted nanoparticles. The modified nanoparticles hold significant candidates to improve the thermal stability and the processability of pure PLA, especially used as special processing agent in the field of PLA stretch shaping process.

Electrophilic Cleavage and Functionalization of Polyisobutylenes Bearing Unsaturations in the Backbone and Synthesis of Polymers for this Process

NASA Astrophysics Data System (ADS)

Campbell, Christopher Garrett

Polyisobutylene is a polymer of high commercial and academic interest due to its low cost of synthesis, high gas barrier properties, and high chemical and oxidative stability. Polyisobutylene (PIB) can only be synthesized by the cationic polymerization of isobutylene (IB). Commercial processes are currently only capable of producing monofunctional PIB or copolymers thereof. The living cationic polymerization of isobutylene is capable of producing difunctional telechelic PIB, but at the expense of difficultly or expensively synthesized initiators. Thus there exists a need for new synthetic routes for multifunctional PIBs, which can be adopted on a commercial scale. In the first project, we demonstrated a new reaction, which is a subset of the Friedel Crafts alkylation reaction, in which the alkylating carbocation undergoes a cleavage reaction prior to reaction with the aromatic substrate. This reaction was discovered by the observation that when a PIB containing a large amount of coupled fraction was subjected to a mixture of protic and Lewis acids (HCl/TiCl4) in the presence of an alkoxybenzene compound, the coupled fraction was quantitatively converted to its constituent monofunctional chains, which became functionalized by the alkoxybenzene. In the second project, a commercial polymer, poly(isobutylene- co-isoprene) (butyl rubber) was used as a substrate upon which the aforementioned electrophilic cleavage and functionalization reaction was performed. The goal of this project was to degrade a high molecular weight, main-chain olefin-containing copolymer of isobutylene into low molecular weight difunctional telechelic polyisobutylenes. This general process, though not necessarily proceeding by the aforementioned novel chemical reaction, has been described in the literature as "constructive degradation." Though we were unable to synthesize truly telechelic polyisobutylenes by this method, we were able to demonstrate this method as a viable route to low molecular weight multifunctional PIBs. In the third project, we attempted to synthesize a random copolymer, previously reported by Kennedy et al., of isobutylene and 2,4-dimethyl-1,3-pentadiene (DMPD). The interest in this copolymer was based on its structural similarity to the coupled PIB mentioned in the first project. However, we found that these two monomers are not well suited to the creation of random copolymers due to a large difference in reactivity ratios. The project presented in this chapter was then redirected toward the structural characterization of the products of attempted copolymerization and of the homo-polymerization of DMPD. In the fourth project, we investigated the copolymer of isobutylene and beta-pinene as a substrate for the aforementioned cleavage/functionalization reaction. We were able to synthesize high molecular weight copolymers of these two monomers via slurry polymerization catalyzed by either TiCl4 or ethylaluminum dichloride (EADC), and though the degradation and functionalization kinetics were much slower than for butyl rubber, we did observe a drastic decrease in molecular weight accompanied by functionalization of the polymer, thus proving this chemistry is applicable to copolymers of isobutylene other than butyl rubber.

Process for producing high purity silicon nitride by the direct reaction between elemental silicon and nitrogen-hydrogen liquid reactants

DOEpatents

Pugar, Eloise A.; Morgan, Peter E. D.

1990-01-01

A process is disclosed for producing, at a low temperature, a high purity reaction product consisting essentially of silicon, nitrogen, and hydrogen which can then be heated to produce a high purity alpha silicon nitride. The process comprises: reacting together a particulate elemental high purity silicon with a high purity nitrogen-hydrogen reactant in its liquid state (such as ammonia or hydrazine) having the formula: N.sub.n H.sub.(n+m) wherein: n=1-4 and m=2 when the nitrogen-hydrogen reactant is straight chain, and 0 when the nitrogen-hydrogen reactant is cyclic. High purity silicon nitride can be formed from this intermediate product by heating the intermediate product at a temperature of from about 1200.degree.-1700.degree. C. for a period from about 15 minutes up to about 2 hours to form a high purity alpha silicon nitride product. The discovery of the existence of a soluble Si-N-H intermediate enables chemical pathways to be explored previously unavailable in conventional solid state approaches to silicon-nitrogen ceramics.

Preparation of Microcellular Epoxy Foams through a Limited-Foaming Process: A Contradiction with the Time-Temperature-Transformation Cure Diagram.

PubMed

Wang, Lijun; Zhang, Chun; Gong, Wei; Ji, Yubi; Qin, Shuhao; He, Li

2018-01-01

3D cross-linking networks are generated through chemical reactions between thermosetting epoxy resin and hardener during curing. The curing degree of epoxy material can be increased by increasing curing temperature and/or time. The epoxy material must then be fully cured through a postcuring process to optimize its material characteristics. Here, a limited-foaming method is introduced for the preparation of microcellular epoxy foams (Lim-foams) with improved cell morphology, high thermal expansion coefficient, and good compressive properties. Lim-foams exhibit a lower glass transition temperature (T g ) and curing degree than epoxy foams fabricated through free-foaming process (Fre-foams). Surprisingly, however, the T g of Lim-foams is unaffected by postcuring temperature and time. This phenomenon, which is related to high gas pressure in the bubbles, contradicts that indicated by the time-temperature-transformation cure diagram. High bubble pressure promotes the movement of molecular chains under heating at low temperature and simultaneously suppresses the etherification cross-linking reaction during post-curing. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Process for producing high purity silicon nitride by the direct reaction between elemental silicon and nitrogen-hydrogen liquid reactants

DOEpatents

Pugar, E.A.; Morgan, P.E.D.

1987-09-15

A process is disclosed for producing, at a low temperature, a high purity reaction product consisting essentially of silicon, nitrogen, and hydrogen which can then be heated to produce a high purity alpha silicon nitride. The process comprises: reacting together a particulate elemental high purity silicon with a high purity nitrogen-hydrogen reactant in its liquid state (such as ammonia or hydrazine) having the formula: N/sub n/H/sub (n+m)/ wherein: n = 1--4 and m = 2 when the nitrogen-hydrogen reactant is straight chain, and 0 when the nitrogen-hydrogen reactant is cyclic. High purity silicon nitride can be formed from this intermediate product by heating the intermediate product at a temperature of from about 1200--1700/degree/C for a period from about 15 minutes up to about 2 hours to form a high purity alpha silicon nitride product. The discovery of the existence of a soluble Si/endash/N/endash/H intermediate enables chemical pathways to be explored previously unavailable in conventional solid-state approaches to silicon-nitrogen ceramics

Degradation and half-life of DNA present in biomass from a genetically-modified organism during land application.

PubMed

Halter, Mathew C; Zahn, James A

2017-02-01

White biotechnology has made a positive impact on the chemical industry by providing safer, more efficient chemical manufacturing processes that have reduced the use of toxic chemicals, harsh reaction conditions, and expensive metal catalysts, which has improved alignment with the principles of Green Chemistry. The genetically-modified (GM) biocatalysts that are utilized in these processes are typically separated from high-value products and then recycled, or eliminated. Elimination routes include disposal in sanitary landfills, incineration, use as a fuel, animal feed, or reuse as an agricultural soil amendment or other value-added products. Elimination routes that have the potential to impact the food chain or environment have been more heavily scrutinized for the fate and persistence of biological products. In this study, we developed and optimized a method for monitoring the degradation of strain-specific DNA markers from a genetically-modified organism (GMO) used for the commercial production of 1,3-propanediol. Laboratory and field tests showed that a marker for heterologous DNA in the GM organism was no longer detectable by end-point polymerase chain reaction (PCR) after 14 days. The half-life of heterologous DNA was increased by 17% (from 42.4 to 49.7 h) after sterilization of the soil from a field plot, which indicated that abiotic factors were important in degradation of DNA under field conditions. There was no evidence for horizontal transfer of DNA target sequences from the GMO to viable organisms present in the soil.

Polymerase chain reaction as a prospect for the early diagnosis and prediction of periodontal diseases in adolescents.

PubMed

Birsan, I

2015-02-01

This study was to determine the markers representative of pathogenic periodontal microflora [Prevotella intermedia (P.i), Tannerella forsythia (T.f) [Bacteroides forsythus], Treponema denticola (T.d), Actinobacillus actinomycetemcomitans (A.a), Porphyromonas gingivalis (P.g)] in the dental plaque of adolescents with various degrees of severity of periodontium inflammation. Forty-patients aged 15-16 years of age were examined using PMA, CPI and Green-Vermillion indices (Müller 2001). The hygiene status of each patient was also determined using Durr Dental's Vista Proof intraoral camera (Germany). The polymerase chain reaction (PCR) was performed using a Biometra Thermocycler to detect DNA of pathogenic periodontal bacteria in dental plaque. All marker microorganisms (P.i.+T.f.+T.d.+A.a.+P.g.) were identified in patients diagnosed with periodontitis in dental plaque. A direct correlation between the level of oral hygiene and the severity of the pathological process in it was determined. It was found that the increase in the severity of the disease was accompanied by increased pathogenic periodontal microflora in dental plaque. Identification of periodontal pathogens in dental plaque by PCR greatly enhances the early diagnosis of Cronic cattaral gingivitis (CCG) risk factors in adolescents, and allows for detailed analysis of the relation between each factor and severity of the process. This method may be used for the diagnosis of periodontal diseases, prediction of their future course, and reasonable choice of antimicrobial therapy.

The pyrolytic degradation of wood-derived lignin from pulping process.

PubMed

Shen, D K; Gu, S; Luo, K H; Wang, S R; Fang, M X

2010-08-01

Lignin is a key component in the biomass with a complex polymeric structure of the phenyl-C(3) alkyl units. The kraft lignin from the wood pulping process is tested in TG-FTIR and Py-GC-MS. The samples are pyrolyzed in TGA coupled with FTIR from 30 to 900 degrees C at the heating rate of 20 and 40K/min. The evolution of phenolic compounds in the initial pyrolysis stage of lignin is determined by FTIR, while the second stage is mainly attributed to the production of the low molecular weight species. A bench-scale fast pyrolysis unit is employed to investigate the effect of temperature on the product yield and composition. It is found that the guaiacol-type and syringol-type compounds as the primary products of lignin pyrolysis are predominant in bio-oil, acting as the significant precursors for the formation of the derivatives such as the phenol-, cresol- and catechol-types. A series of free-radical chain-reactions, concerning the cracking of different side-chain structures and the methoxy groups on aromatic ring, are proposed to demonstrate the formation pathways for the typical compounds in bio-oil by closely relating lignin structure to the pyrolytic mechanisms. The methoxy group (-OCH(3)) is suggested to work as an important source for the formation of the small volatile species (CO, CO(2) and CH(4)) through the relevant free radical coupling reactions. (c) 2010 Elsevier Ltd. All rights reserved.

Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase.

PubMed

Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi; Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki; Noda, Mamoru; Igimi, Shizunobu; Ikebukuro, Kazunori

2013-11-01

An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268-luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF-luciferase fusion protein. By means of the automatic analyzer with ZF-luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0×10 to 1.0×10(6) copies. Copyright © 2013 Elsevier B.V. All rights reserved.

Recoil-α-fission and recoil-α-α-fission events observed in the reaction 48Ca + 243Am

NASA Astrophysics Data System (ADS)

Forsberg, U.; Rudolph, D.; Andersson, L.-L.; Di Nitto, A.; Düllmann, Ch. E.; Fahlander, C.; Gates, J. M.; Golubev, P.; Gregorich, K. E.; Gross, C. J.; Herzberg, R.-D.; Heßberger, F. P.; Khuyagbaatar, J.; Kratz, J. V.; Rykaczewski, K.; Sarmiento, L. G.; Schädel, M.; Yakushev, A.; Åberg, S.; Ackermann, D.; Block, M.; Brand, H.; Carlsson, B. G.; Cox, D.; Derkx, X.; Dobaczewski, J.; Eberhardt, K.; Even, J.; Gerl, J.; Jäger, E.; Kindler, B.; Krier, J.; Kojouharov, I.; Kurz, N.; Lommel, B.; Mistry, A.; Mokry, C.; Nazarewicz, W.; Nitsche, H.; Omtvedt, J. P.; Papadakis, P.; Ragnarsson, I.; Runke, J.; Schaffner, H.; Schausten, B.; Shi, Yue; Thörle-Pospiech, P.; Torres, T.; Traut, T.; Trautmann, N.; Türler, A.; Ward, A.; Ward, D. E.; Wiehl, N.

2016-09-01

Products of the fusion-evaporation reaction 48Ca + 243Am were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt, Germany. Amongst the detected thirty correlated α-decay chains associated with the production of element Z = 115, two recoil-α-fission and five recoil- α- α-fission events were observed. The latter five chains are similar to four such events reported from experiments performed at the Dubna gas-filled separator, and three such events reported from an experiment at the Berkeley gas-filled separator. The four chains observed at the Dubna gas-filled separator were assigned to start from the 2n-evaporation channel 289115 due to the fact that these recoil- α- α-fission events were observed only at low excitation energies. Contrary to this interpretation, we suggest that some of these recoil- α- α-fission decay chains, as well as some of the recoil- α- α-fission and recoil-α-fission decay chains reported from Berkeley and in this article, start from the 3n-evaporation channel 288115.

IgE reactivity to alpha1 and alpha2 chains of bovine type 1 collagen in children with bovine gelatin allergy.

PubMed

Sakaguchi, M; Hori, H; Hattori, S; Irie, S; Imai, A; Yanagida, M; Miyazawa, H; Toda, M; Inouye, S

1999-09-01

Anaphylactic reactions to measles, mumps, and rubella vaccines, including gelatin as a stabilizer, have been reported. It had been found that most of these reactions to live vaccines are caused by the bovine gelatin included in these vaccines. Gelatin mainly includes denatured type I collagen, which consists of alpha1 and alpha2 chains. The current study was designed to investigate the IgE reactivity to alpha1 and alpha2 chains of bovine type I collagen in gelatin-sensitive children. Serum samples were taken from 10 children who had anaphylaxis to the vaccines and high levels of specific IgE to bovine gelatin. Bovine type I collagen was isolated from bovine skin and then separated to alpha1 and alpha2 chains by column chromatography. IgE reactivity to denatured type I collagen and its alpha1 and alpha2 chains was analyzed by immunoblotting, ELISA, and histamine release from the mast cells passive sensitized with IgE antibodies in pooled serum of the children. All children had specific IgE to bovine type I collagen. Furthermore, IgE antibodies in their sera reacted with the alpha;2 chain but not with the alpha1 chain. Similarly, the mast cells sensitized with pooled sera in the children showed alpha2 chain-specific histamine release but not alpha1 chain-specific histamine release. In gelatin allergy denatured bovine type I collagen is a major allergen and IgE-binding sites exist in the alpha2 chain of type I collagen.

Detecting Service Chains and Feature Interactions in Sensor-Driven Home Network Services

PubMed Central

Inada, Takuya; Igaki, Hiroshi; Ikegami, Kosuke; Matsumoto, Shinsuke; Nakamura, Masahide; Kusumoto, Shinji

2012-01-01

Sensor-driven services often cause chain reactions, since one service may generate an environmental impact that automatically triggers another service. We first propose a framework that can formalize and detect such service chains based on ECA (event, condition, action) rules. Although the service chain can be a major source of feature interactions, not all service chains lead to harmful interactions. Therefore, we then propose a method that identifies feature interactions within the service chains. Specifically, we characterize the degree of deviation of every service chain by evaluating the gap between expected and actual service states. An experimental evaluation demonstrates that the proposed method successfully detects 11 service chains and 6 feature interactions within 7 practical sensor-driven services. PMID:23012499

Redox regulation of mitochondrial function with emphasis on cysteine oxidation reactions☆

PubMed Central

Mailloux, Ryan J.; Jin, Xiaolei; Willmore, William G.

2013-01-01

Mitochondria have a myriad of essential functions including metabolism and apoptosis. These chief functions are reliant on electron transfer reactions and the production of ATP and reactive oxygen species (ROS). The production of ATP and ROS are intimately linked to the electron transport chain (ETC). Electrons from nutrients are passed through the ETC via a series of acceptor and donor molecules to the terminal electron acceptor molecular oxygen (O2) which ultimately drives the synthesis of ATP. Electron transfer through the respiratory chain and nutrient oxidation also produces ROS. At high enough concentrations ROS can activate mitochondrial apoptotic machinery which ultimately leads to cell death. However, if maintained at low enough concentrations ROS can serve as important signaling molecules. Various regulatory mechanisms converge upon mitochondria to modulate ATP synthesis and ROS production. Given that mitochondrial function depends on redox reactions, it is important to consider how redox signals modulate mitochondrial processes. Here, we provide the first comprehensive review on how redox signals mediated through cysteine oxidation, namely S-oxidation (sulfenylation, sulfinylation), S-glutathionylation, and S-nitrosylation, regulate key mitochondrial functions including nutrient oxidation, oxidative phosphorylation, ROS production, mitochondrial permeability transition (MPT), apoptosis, and mitochondrial fission and fusion. We also consider the chemistry behind these reactions and how they are modulated in mitochondria. In addition, we also discuss emerging knowledge on disorders and disease states that are associated with deregulated redox signaling in mitochondria and how mitochondria-targeted medicines can be utilized to restore mitochondrial redox signaling. PMID:24455476

Anti-knock quality of sugar derived levulinic esters and cyclic ethers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tian, Miao; McCormick, Robert L.; Luecke, Jon

Here, the objective of this paper is to investigate the anti-knock quality of sugar-derived levulinic esters (methyl levulinate (ML) and ethyl levulinate (EL)) and cyclic ethers (furfuryl ethyl ether (FEE) and ethyl tetrahydrofurfuryl ether (ETE)). To this end, combustion experiments were carried out in both an engine and a constant volume autoignition device. The results from both apparati demonstrate that ML, EL and FEE have superior anti-knock quality than the reference Euro95 gasoline. ETE, conversely, performed markedly worse than the reference fuel on both setups and might therefore be a more appropriate fuel for compression ignition engines. The main reasonmore » of the distinctions in anti-knock quality can be found in the molecular structure of the neat biofuels. ML and EL are levulinic esters, with a ketone (C=O) functionality and an ester (C(=O)-O) group on the carbon chain. They can readily produce stable intermediates during the auto-ignition process, thereby slowing down the overall reaction rate. The unsaturated cyclic ether (FEE) has very strong ring C-H bonds. However, the saturated cyclic ether (ETE) has weak ring C-H bonds, which facilitate more readily ring opening reactions. Long side chains on the cyclic ethers further accelerate the reaction rate. Importantly for future research, our results suggest that IQT and engine experiments are interchangeable setups with respect to qualitative anti-knock quality evaluation of novel compounds.« less

Top-Down Charge Transfer Dissociation (CTD) of Gas-Phase Insulin: Evidence of a One-Step, Two-Electron Oxidation Mechanism

NASA Astrophysics Data System (ADS)

Li, Pengfei; Kreft, Iris; Jackson, Glen P.

2018-02-01

Top-down analyses of protonated insulin cations of charge states of 4+, 5+, or 6+ were performed by exposing the isolated precursor ions to a beam of helium cations with kinetic energy of more than 6 keV, in a technique termed charge transfer dissociation (CTD). The 100 ms charge transfer reaction resulted in approximately 20% conversion efficiency to other intact charge exchange products (CTnoD), and a range of low abundance fragment ions. To increase backbone and sulfide cleavages, and to provide better structural information than straightforward MS2 CTD, the CTnoD oxidized products were isolated and subjected to collisional activation at the MS3 level. The MS3 CTD/CID reaction effectively broke the disulfide linkages, separated the two chains, and yielded more structurally informative fragment ions within the inter-chain cyclic region. CTD also provided doubly oxidized intact product ions at the MS2 level, and resonance ejection of the singly oxidized product ion revealed that the doubly oxidized product originates directly from the isolated precursor ion and not from consecutive CTD reactions of a singly oxidized intermediate. MS4 experiments were employed to help identify potential radical cations and diradical cations, but the results were negative or inconclusive. Nonetheless, the two-electron oxidation process is a demonstration of the very large potential energy (>20 eV) available through CTD, and is a notable capability for a 3D ion trap platform.

Influence of the variation potential on photosynthetic flows of light energy and electrons in pea.

PubMed

Sukhova, Ekaterina; Mudrilov, Maxim; Vodeneev, Vladimir; Sukhov, Vladimir

2018-05-01

Local damage (mainly burning, heating, and mechanical wounding) induces propagation of electrical signals, namely, variation potentials, which are important signals during the life of plants that regulate different physiological processes, including photosynthesis. It is known that the variation potential decreases the rate of CO 2 assimilation by the Calvin-Benson cycle; however, its influence on light reactions has been poorly investigated. The aim of our work was to investigate the influence of the variation potential on the light energy flow that is absorbed, trapped and dissipated per active reaction centre in photosystem II and on the flow of electrons through the chloroplast electron transport chain. We analysed chlorophyll fluorescence in pea leaves using JIP-test and PAM-fluorometry; we also investigated delayed fluorescence. The electrical signals were registered using extracellular electrodes. We showed that the burning-induced variation potential stimulated a nonphotochemical loss of energy in photosystem II under dark conditions. It was also shown that the variation potential gradually increased the flow of light energy absorbed, trapped and dissipated by photosystem II. These changes were likely caused by an increase in the fraction of absorbed light distributed to photosystem II. In addition, the variation potential induced a transient increase in electron flow through the photosynthetic electron transport chain. Some probable mechanisms for the influence of the variation potential on the light reactions of photosynthesis (including the potential role of intracellular pH decrease) are discussed in the work.

Anti-knock quality of sugar derived levulinic esters and cyclic ethers

DOE PAGES

Tian, Miao; McCormick, Robert L.; Luecke, Jon; ...

2017-04-22

Here, the objective of this paper is to investigate the anti-knock quality of sugar-derived levulinic esters (methyl levulinate (ML) and ethyl levulinate (EL)) and cyclic ethers (furfuryl ethyl ether (FEE) and ethyl tetrahydrofurfuryl ether (ETE)). To this end, combustion experiments were carried out in both an engine and a constant volume autoignition device. The results from both apparati demonstrate that ML, EL and FEE have superior anti-knock quality than the reference Euro95 gasoline. ETE, conversely, performed markedly worse than the reference fuel on both setups and might therefore be a more appropriate fuel for compression ignition engines. The main reasonmore » of the distinctions in anti-knock quality can be found in the molecular structure of the neat biofuels. ML and EL are levulinic esters, with a ketone (C=O) functionality and an ester (C(=O)-O) group on the carbon chain. They can readily produce stable intermediates during the auto-ignition process, thereby slowing down the overall reaction rate. The unsaturated cyclic ether (FEE) has very strong ring C-H bonds. However, the saturated cyclic ether (ETE) has weak ring C-H bonds, which facilitate more readily ring opening reactions. Long side chains on the cyclic ethers further accelerate the reaction rate. Importantly for future research, our results suggest that IQT and engine experiments are interchangeable setups with respect to qualitative anti-knock quality evaluation of novel compounds.« less

Oligomerization reactions for precursors to secondary organic aerosol: Comparison between two formation mechanisms for the oligomeric hydroxyalkyl hydroperoxides

NASA Astrophysics Data System (ADS)

Zhao, Qiangli; Wang, Weina; Liu, Fengyi; Lü, Jian; Wang, Wenliang

2017-10-01

To better understand the formation mechanism of oligomeric hydroxyalkyl hydroperoxides HOROO(SCI)nH composed of stabilized Criegee intermediate (SCI) as a chain unit, the reactions of SCI with hydroxyalkyl hydroperoxides (HOROOH) and hydroxyalkylperoxy radical (HORO2) as well as HO2 radical were investigated. For the reactions of HORO2 + SCI, two preferred pathways involving a SCI insertion in HOROOH hydroperoxide bond can be found, and the formation of HOROO(SCI)H is the dominant pathway in the reaction of HOCH2(CH3)2COOH + (CH3)2COO. The structures of the HORO2, HOROOH as well as the SCIs play a crucial role in determining the reactivity of the oligomerization. Both the reactions of HORO2 + SCI + HO2 and HOROOH + SCI could be the source of the processors to the formation of secondary organic aerosol (SOA). But from the point of free energy barriers, the formation of HOROO(SCI)H prefers to follow the mechanism involving initiation by the reaction of a HORO2 and a SCI, sequential addition of SCIs, and termination by reaction with the HO2 radical. The rate coefficients show negative temperature dependence and vary in different systems depending on the reactants. The reaction process and constituents of the products can be regulated by temperature and reactants.

Single-Cell RT-PCR in Microfluidic Droplets with Integrated Chemical Lysis.

PubMed

Kim, Samuel C; Clark, Iain C; Shahi, Payam; Abate, Adam R

2018-01-16

Droplet microfluidics can identify and sort cells using digital reverse transcription polymerase chain reaction (RT-PCR) signals from individual cells. However, current methods require multiple microfabricated devices for enzymatic cell lysis and PCR reagent addition, making the process complex and prone to failure. Here, we describe a new approach that integrates all components into a single device. The method enables controlled exposure of isolated single cells to a high pH buffer, which lyses cells and inactivates reaction inhibitors but can be instantly neutralized with RT-PCR buffer. Using our chemical lysis approach, we distinguish individual cells' gene expression with data quality equivalent to more complex two-step workflows. Our system accepts cells and produces droplets ready for amplification, making single-cell droplet RT-PCR faster and more reliable.

Detection of Neisseria meningitidis in cerebrospinal fluid using a multiplex PCR and the Luminex detection technology.

PubMed

Møller, Jens Kjølseth

2012-01-01

Rapid clinical and laboratory diagnoses are the foundation for a successful management of serious infections with Neisseria meningitidis. A species-specific multiplex polymerase chain reaction (PCR) coupled with fluidic microarrays using microbeads (the Luminex xMAP™ Technology) can detect pathogens most frequently found in the cerebrospinal fluid of patients. The Luminex suspension array system uniquely combines flow cytometry, microspheres, laser technology, digital signal processing, and traditional chemistry. In this method, the reaction is carried out in one vessel, in which distinctly color-coded bead sets, each conjugated with a different specific nucleic acid reactant, are hybridized with the PCR products, and a reporter molecule is used to quantify the interaction. The flow-based Luminex array reader identifies each reaction (bead set) after excitation by a red classification laser. Reporter signals from each reaction are simultaneously quantified by fluorescence generated by a green reporter laser. This nonculture, multiplex assay may prove to be an important tool for optimal laboratory diagnosis, not only of meningococcal meningitis, but also of meningitis caused by other bacterial or viral pathogens.

Addressing fluorogenic real-time qPCR inhibition using the novel custom Excel file system 'FocusField2-6GallupqPCRSet-upTool-001' to attain consistently high fidelity qPCR reactions

PubMed Central

Ackermann, Mark R.

2006-01-01

The purpose of this manuscript is to discuss fluorogenic real-time quantitative polymerase chain reaction (qPCR) inhibition and to introduce/define a novel Microsoft Excel-based file system which provides a way to detect and avoid inhibition, and enables investigators to consistently design dynamically-sound, truly LOG-linear qPCR reactions very quickly. The qPCR problems this invention solves are universal to all qPCR reactions, and it performs all necessary qPCR set-up calculations in about 52 seconds (using a pentium 4 processor) for up to seven qPCR targets and seventy-two samples at a time – calculations that commonly take capable investigators days to finish. We have named this custom Excel-based file system "FocusField2-6GallupqPCRSet-upTool-001" (FF2-6-001 qPCR set-up tool), and are in the process of transforming it into professional qPCR set-up software to be made available in 2007. The current prototype is already fully functional. PMID:17033699

Degradation pathway of the naphthalene azo dye intermediate 1-diazo-2- naphthol-4-sulfonic acid using Fenton's reagent.

PubMed

Zhu, Nanwen; Gu, Lin; Yuan, Haiping; Lou, Ziyang; Wang, Liang; Zhang, Xin

2012-08-01

Degradation of naphthalene dye intermediate 1-diazo-2- naphthol-4-sulfonic acid (1,2,4-Acid) by Fenton process has been studied in depth for the purpose of learning more about the reactions involved in the oxidation of 1,2,4-Acid. During 1,2,4-Acid oxidation, the solution color initially takes on a dark red, then to dark black associated with the formation of quinodial-type structures, and then goes to dark brown and gradually disappears, indicating a fast degradation of azo group. The observed color changes of the solution are a result of main reaction intermediates, which can be an indicator of the level of oxidization reached. Nevertheless, complete TOC removal is not accomplished, in accordance with the presence of resistant carboxylic acids at the end of the reaction. The intermediates generated along the reaction time have been identified and quantified. UPLC-(ESI)-TOF-HRMS analysis allows the detection of 19 aromatic compounds of different size and complexity. Some of them share the same accurate mass but appear at different retention time, evidencing their different molecular structures. Heteroatom oxidation products like SO(4)(2-) have also been quantified and explanations of their release are proposed. Short-chain carboxylic acids are detected at long reaction time, as a previous step to complete the process of dye mineralization. Finally, considering all the findings of the present study and previous related works, the evolution from the original 1,2,4-Acid to the final products is proposed in a general reaction scheme. Copyright © 2012 Elsevier Ltd. All rights reserved.

Run-length encoding graphic rules, biochemically editable designs and steganographical numeric data embedment for DNA-based cryptographical coding system.

PubMed

Kawano, Tomonori

2013-03-01

There have been a wide variety of approaches for handling the pieces of DNA as the "unplugged" tools for digital information storage and processing, including a series of studies applied to the security-related area, such as DNA-based digital barcodes, water marks and cryptography. In the present article, novel designs of artificial genes as the media for storing the digitally compressed data for images are proposed for bio-computing purpose while natural genes principally encode for proteins. Furthermore, the proposed system allows cryptographical application of DNA through biochemically editable designs with capacity for steganographical numeric data embedment. As a model case of image-coding DNA technique application, numerically and biochemically combined protocols are employed for ciphering the given "passwords" and/or secret numbers using DNA sequences. The "passwords" of interest were decomposed into single letters and translated into the font image coded on the separate DNA chains with both the coding regions in which the images are encoded based on the novel run-length encoding rule, and the non-coding regions designed for biochemical editing and the remodeling processes revealing the hidden orientation of letters composing the original "passwords." The latter processes require the molecular biological tools for digestion and ligation of the fragmented DNA molecules targeting at the polymerase chain reaction-engineered termini of the chains. Lastly, additional protocols for steganographical overwriting of the numeric data of interests over the image-coding DNA are also discussed.

The Analysis of AGEs and ALEs by Mass Spectrometry: What does the Future Hold?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Metz, Thomas O.

2009-09-15

In 1912, Louis-Camille Maillard described a reaction between amino acids and reducing sugars that produced a discolored (brown) reaction mixture in the presence of heat [1]. This complex network of reactions between reducing sugars and free amine groups on amino acids or proteins came to be known as the Maillard reaction and was the domain of food chemists for the next 50 years. Work in the 1960s began a very exciting era in the field. A few years earlier, several groups [2-5] reported on the heterogeneity of normal human adult hemoglobin (HbA) as determined chromatographically, and Allen et al weremore » the first to use cation-exchange chromatography to separate a previously observed fast moving component (HbAI) into three fractions that they termed AIa, AIb, and AIc. An increase in the fast moving HbAI of four diabetic patients was subsequently reported by Huisman and Dozy in 1962 [6], and the link between diabetes and increased HbAI was later strengthened by Rahbar’s observation of increased HbAI – the majority of which is HbAIc – in 47 cases of diabetes [7]. Bookchin and Gallop determined that HbAIc consisted of a hexose bound to both β-chains [8], and Bunn and colleagues subsequently proposed that glucose binds to the N-terminal amine groups of the β-chain valine residues in the form of a Schiff base, which then rearranges to form an Amadori compound [9]. Thus, while Maillard chemistry was known to occur during the heating and processing of food, the identification of Amadori-modified hemoglobin proved that it also occurred in vivo (after all, as John Baynes likes to point out, humans are essentially low temperature ovens with long cooking cycles!).« less

The possibility of a new resonance of three-body linear chain structure in the reaction 12C+16O at Ec.mapprox-33.5MeV

NASA Astrophysics Data System (ADS)

Kong, Xiangjing; P, L. Li; J, J. Kolata; A, Morsad; L, Goetting; R, A. Kryger; S, Dixit; R, Tighe; W, Chune

1990-05-01

There is a peak in the excitation function of total cross section of low energy α-particles in the reaction 12C+16O at Ec.m approx33.5MeV. The experimental distribution of α-particle emitted event has been obtained. The result of theoretical calculation roughly agrees with experimental data, gives an orientation where three-body resonances can be expected, and the information on internal structure of three-body linear chain molecule.

Interfacial interaction between the epoxidized natural rubber and silica in natural rubber/silica composites

NASA Astrophysics Data System (ADS)

Xu, Tiwen; Jia, Zhixin; Luo, Yuanfang; Jia, Demin; Peng, Zheng

2015-02-01

The epoxidized natural rubber (ENR) as an interfacial modifier was used to improve the mechanical and dynamical mechanical properties of NR/silica composites. In order to reveal the interaction mechanism between ENR and silica, the ENR/Silica model compound was prepared by using an open mill and the interfacial interaction of ENR with silica was investigated by Fourier transform infrared spectroscopy (FTIR), X-ray photoelectron spectroscopy (XPS), transmission electron microscopy (TEM), X-ray diffraction (XRD) and stress-strain testing. The results indicated that the ring-opening reaction occurs between the epoxy groups of ENR chains and Si-OH groups on the silica surfaces and the covalent bonds are formed between two phases, which can improve the dispersion of silica in the rubber matrix and enhance the interfacial combination between rubber and silica. The ring-opening reaction occurs not only in vulcanization process but also in mixing process, meanwhile, the latter seems to be more important due to the simultaneous effects of mechanical force and temperature.

Effects of laser-magnetic blood irradiation in vivo

NASA Astrophysics Data System (ADS)

Zalesskaya, Galina; Ulaschik, Vladimir; Kuchinsky, Andrej; Galay, Olga

2007-06-01

Laser-magnetic field action on blood in vivo was studied within a range 440-650 nm. The primary mechanisms of laser-magnetic blood irradiation in vivo were studied at (1) laser and non-laser irradiation with light of various wavelengths, (2) autohemo-magnetic-therapy, (3) multicolored over-vein irradiation of the blood, (4) the laser-magnetic field actions. Hemoglobin is considered as primary photoacceptor of radiation. The dependence of effectiveness of laser action on light wavelength was compared with known action spectra for blood photostimulation. Magnetic field enhancement of the laser- induced reactions was discussed as result of magnetic field influence on ferromagnetic hem inclusions and on a structure of hemoglobin peptide chains. Hemoglobin oxygenation or deoxygenation processes were analyzed as a first stage of the therapeutic effects depending on a preceding hemoglobin oxygenation degree at pathological state. The laser- magnetic irradiation causes tendency to the normalization of these process. It is proposed that the secondary reactions are initiated by reversible structural changes of erythrocytes membrane caused the strong hemoglobin absorption.

Synthesis of biodiesel from pongamia oil using heterogeneous ion-exchange resin catalyst.

PubMed

Jaya, N; Selvan, B Karpanai; Vennison, S John

2015-11-01

Biodiesel is a clean-burning renewable substitute fuel for petroleum. Biodiesel could be effectively produced by transesterification reaction of triglycerides of vegetable oils with short-chain alcohols in the presence of homogeneous or heterogeneous catalysts. Conventionally, biodiesel manufacturing processes employ strong acids or bases as catalysts. But, separation of the catalyst and the by-product glycerol from the product ester is too expensive to justify the product use as an automobile fuel. Hence heterogeneous catalysts are preferred. In this study, transesterification of pongamia oil with ethanol was performed using a solid ion-exchange resin catalyst. It is a macro porous strongly basic anion exchange resin. The process parameters affecting the ethyl ester yield were investigated. The reaction conditions were optimized for the maximum yield of fatty acid ethyl ester (FAEE) of pongamia oil. The properties of FAEE were compared with accepted standards of biodiesel. Engine performance was also studied with pongamia oil diesel blend and engine emission characteristics were observed. Copyright © 2015 Elsevier Inc. All rights reserved.

Oxidative decomposition of aromatic hydrocarbons by electron beam irradiation

NASA Astrophysics Data System (ADS)

Han, Do-Hung; Stuchinskaya, Tatiana; Won, Yang-Soo; Park, Wan-Sik; Lim, Jae-Kyong

2003-05-01

Decomposition of aromatic volatile organic compounds (VOCs) under electron beam irradiation was studied in order to examine the kinetics of the process, to characterize the reaction product distribution and to develop a process of waste gas control technology. Toluene, ethylbenzene, o-, m-, p-xylenes and chlorobenzene were used as target materials. The experiments were carried out at doses ranging from 0.5 to 10 kGy, using a flow reactor utilized under electron beam irradiation. Maximum degrees of decomposition carried out at 10 kGy in air environment were 55-65% for “non-chlorinated” aromatic VOC and 85% for chlorobenzene. It was found that a combination of aromatic pollutants with chlorobenzene would considerably increase the degradation value up to nearly 50% compared to the same compounds in the absence of chlorine groups. Based on our experimental observation, the degradation mechanism of the aromatic compounds combined with chloro-compound suggests that a chlorine radical, formed from EB irradiation, induces a chain reaction, resulting in an accelerating oxidative destruction of aromatic VOCs.

Development of an accurate and high-throughput methodology for structural comprehension of chlorophylls derivatives. (I) Phytylated derivatives.

PubMed

Chen, Kewei; Ríos, José Julián; Pérez-Gálvez, Antonio; Roca, María

2015-08-07

Phytylated chlorophyll derivatives undergo specific oxidative reactions through the natural metabolism or during food processing or storage, and consequently pyro-, 13(2)-hydroxy-, 15(1)-hydroxy-lactone chlorophylls, and pheophytins (a and b) are originated. New analytical procedures have been developed here to reproduce controlled oxidation reactions that specifically, and in reasonable amounts, produce those natural target standards. At the same time and under the same conditions, 16 natural chlorophyll derivatives have been analyzed by APCI-HPLC-hrMS(2) and most of them by the first time. The combination of the high-resolution MS mode with powerful post-processing software has allowed the identification of new fragmentation patterns, characterizing specific product ions for some particular standards. In addition, new hypotheses and reaction mechanisms for the established MS(2)-based reactions have been proposed. As a general rule, the main product ions involve the phytyl and the propionic chains but the introduction of oxygenated functional groups at the isocyclic ring produces new and specific productions and at the same time inhibits some particular fragmentations. It is noteworthy that all b derivatives, except 15(1)-hydroxy-lactone compounds, undergo specific CO losses. We propose a new reaction mechanism based in the structural configuration of a and b chlorophyll derivatives that explain the exclusive CO fragmentation in all b series except for 15(1)-hydroxy-lactone b and all a series compounds. Copyright © 2015 Elsevier B.V. All rights reserved.

Gel Point Suppression in RAFT Polymerization of Pure Acrylic Cross-Linker Derived from Soybean Oil.

PubMed

Yan, Mengguo; Huang, Yuerui; Lu, Mingjia; Lin, Fang-Yi; Hernández, Nacú B; Cochran, Eric W

2016-08-08

Here we report the reversible addition-fragmentation chain transfer (RAFT) polymerization of acrylated epoxidized soybean oil (AESO), a cross-linker molecule, to high conversion (>50%) and molecular weight (>100 kDa) without macrogelation. Surprisingly, gelation is suppressed in this system far beyond the expectations predicated both on Flory-Stockmeyer theory and multiple other studies of RAFT polymerization featuring cross-linking moieties. By varying AESO and initiator concentrations, we show how intra- versus intermolecular cross-linking compete, yielding a trade-off between the degree of intramolecular linkages and conversion at gel point. We measured polymer chain characteristics, including molecular weight, chain dimensions, polydispersity, and intrinsic viscosity, using multidetector gel permeation chromatography and NMR to track polymerization kinetics. We show that not only the time and conversion at macrogelation, but also the chain architecture, is largely affected by these reaction conditions. At maximal AESO concentration, the gel point approaches that predicted by the Flory-Stockmeyer theory, and increases in an exponential fashion as the AESO concentration decreases. In the most dilute solutions, macrogelation cannot be detected throughout the entire reaction. Instead, cyclization/intramolecular cross-linking reactions dominate, leading to microgelation. This work is important, especially in that it demonstrates that thermoplastic rubbers could be produced based on multifunctional renewable feedstocks.

Bismuth(III) trifluoromethanesulfonate catalyzed ring opening reaction of mono epoxy oleochemicals to form keto and diketo derivatives

USDA-ARS?s Scientific Manuscript database

Using a catalytic system, methyl oleate is transformed into long chain keto and diketo derivatives via an epoxide route. Methyl 9(10)-oxooctadecanoate and methyl 9,10-dioxooctadecanoate were made by a ring opening reaction of epoxidized methyl oleate using bismuth triflate catalyst. Lower reaction t...

Direct RNA detection without nucleic acid purification and PCR: Combining sandwich hybridization with signal amplification based on branched hybridization chain reaction.

PubMed

Xu, Yao; Zheng, Zhi

2016-05-15

We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.

Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

PubMed

Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

2008-03-01

Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

Future electro-optical sensors and processing in urban operations

NASA Astrophysics Data System (ADS)

Grönwall, Christina; Schwering, Piet B.; Rantakokko, Jouni; Benoist, Koen W.; Kemp, Rob A. W.; Steinvall, Ove; Letalick, Dietmar; Björkert, Stefan

2013-10-01

In the electro-optical sensors and processing in urban operations (ESUO) study we pave the way for the European Defence Agency (EDA) group of Electro-Optics experts (IAP03) for a common understanding of the optimal distribution of processing functions between the different platforms. Combinations of local, distributed and centralized processing are proposed. In this way one can match processing functionality to the required power, and available communication systems data rates, to obtain the desired reaction times. In the study, three priority scenarios were defined. For these scenarios, present-day and future sensors and signal processing technologies were studied. The priority scenarios were camp protection, patrol and house search. A method for analyzing information quality in single and multi-sensor systems has been applied. A method for estimating reaction times for transmission of data through the chain of command has been proposed and used. These methods are documented and can be used to modify scenarios, or be applied to other scenarios. Present day data processing is organized mainly locally. Very limited exchange of information with other platforms is present; this is performed mainly at a high information level. Main issues that arose from the analysis of present-day systems and methodology are the slow reaction time due to the limited field of view of present-day sensors and the lack of robust automated processing. Efficient handover schemes between wide and narrow field of view sensors may however reduce the delay times. The main effort in the study was in forecasting the signal processing of EO-sensors in the next ten to twenty years. Distributed processing is proposed between hand-held and vehicle based sensors. This can be accompanied by cloud processing on board several vehicles. Additionally, to perform sensor fusion on sensor data originating from different platforms, and making full use of UAV imagery, a combination of distributed and centralized processing is essential. There is a central role for sensor fusion of heterogeneous sensors in future processing. The changes that occur in the urban operations of the future due to the application of these new technologies will be the improved quality of information, with shorter reaction time, and with lower operator load.

Nanoparticle shape evolution and proximity effects during tip-induced electrochemical processes

DOE PAGES

Yang, Sangmo; Paranthaman, Mariappan Parans; Noh, Tae Won; ...

2016-01-08

The voltage spectroscopies in scanning probe microscopy (SPM) techniques are widely used to investigate the electrochemical processes in nanoscale volumes, which are important for current key applications, such as batteries, fuel cells, catalysts, and memristors. The spectroscopic measurements are commonly performed on a grid of multiple points to yield spatially resolved maps of reversible and irreversible electrochemical functionalities. Hence, the spacing between measurement points is an important parameter to be considered, especially for irreversible electrochemical processes. Here, we report nonlocal electrochemical dynamics in chains of Ag particles fabricated by the SPM tip on a silver ion solid electrolyte. When themore » grid spacing is small compared with the size of the formed Ag particles, anomalous chains of unequally sized particles with double periodicity evolve. This behavior is ascribed to a proximity effect during the tip-induced electrochemical process, specifically, size-dependent silver particle growth following the contact between the particles. In addition, fractal shape evolution of the formed Ag structures indicates that the growth-limiting process changes from Ag +/Ag redox reaction to Ag +-ion diffusion with the increase in the applied voltage and pulse duration. Our study shows that characteristic shapes of the electrochemical products are good indicators for determining the underlying growth-limiting process, and emergence of complex phenomena during spectroscopic mapping of electrochemical functionalities.« less

Problem-Solving Test: Pyrosequencing

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2013-01-01

Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…

A scalable moment-closure approximation for large-scale biochemical reaction networks

PubMed Central

Kazeroonian, Atefeh; Theis, Fabian J.; Hasenauer, Jan

2017-01-01

Abstract Motivation: Stochastic molecular processes are a leading cause of cell-to-cell variability. Their dynamics are often described by continuous-time discrete-state Markov chains and simulated using stochastic simulation algorithms. As these stochastic simulations are computationally demanding, ordinary differential equation models for the dynamics of the statistical moments have been developed. The number of state variables of these approximating models, however, grows at least quadratically with the number of biochemical species. This limits their application to small- and medium-sized processes. Results: In this article, we present a scalable moment-closure approximation (sMA) for the simulation of statistical moments of large-scale stochastic processes. The sMA exploits the structure of the biochemical reaction network to reduce the covariance matrix. We prove that sMA yields approximating models whose number of state variables depends predominantly on local properties, i.e. the average node degree of the reaction network, instead of the overall network size. The resulting complexity reduction is assessed by studying a range of medium- and large-scale biochemical reaction networks. To evaluate the approximation accuracy and the improvement in computational efficiency, we study models for JAK2/STAT5 signalling and NFκB signalling. Our method is applicable to generic biochemical reaction networks and we provide an implementation, including an SBML interface, which renders the sMA easily accessible. Availability and implementation: The sMA is implemented in the open-source MATLAB toolbox CERENA and is available from https://github.com/CERENADevelopers/CERENA. Contact: jan.hasenauer@helmholtz-muenchen.de or atefeh.kazeroonian@tum.de Supplementary information: Supplementary data are available at Bioinformatics online. PMID:28881983

Hydrolysis of the amorphous cellulose in cotton-based paper.

PubMed

Stephens, Catherine H; Whitmore, Paul M; Morris, Hannah R; Bier, Mark E

2008-04-01

Hydrolysis of cellulose in Whatman no. 42 cotton-based paper was studied using gel permeation chromatography (GPC), electrospray ionization-mass spectrometry (ESI-MS), and uniaxial tensile testing to understand the course and kinetics of the reaction. GPC results suggested that scission reactions passed through three stages. Additionally, the evolution of soluble oligomers in the ESI-MS data and the steady course of strength loss showed that the hydrolysis reaction occurred at a constant rate. These findings are explained with a more detailed description of the cellulose hydrolysis, which includes multiple chain scissions on amorphous segments. The breaks occur with increasing frequency near the ends of amorphous segments, where chains protrude from crystalline domains. Oligomers unattached to crystalline domains are eventually created. Late-stage reactions near the ends of amorphous segments produce a kinetic behavior that falsely suggests that hydrolysis had ceased. Monte Carlo simulations of cellulose degradation corroborated the experimental findings.

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

[The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

PubMed

D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

1993-01-01

The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

Development of a dry-reagent mix-based polymerase chain reaction as a novel tool for the identification of Acinetobacter species and its comparison with conventional polymerase chain reaction

PubMed Central

Kulkarni, Raghavendra D.; Mishra, Mukti Nath; Mohanraj, Jeevanandam; Chandrasekhar, Arun; Ajantha, G. S.; Kulkani, Sheetal; Bhat, Shama

2018-01-01

BACKGROUND: Nosocomial infections are often caused by multidrug-resistant bacteria and the incidence is increasing. Acinetobacter, a Gram-negative bacillus, is commonly associated with the use of intravascular catheterization and airway intubation. Polymerase chain reaction (PCR) for identification of Acinetobacter baumannii from samples has been standardized that use conventional wet-reagent mix. We have designed and optimized a dry-reagent mix for identification of Acinetobacter species by PCR. The dry-reagent mix can be stored at room temperature, has less chances of contamination, and thus can be used at point-of-care diagnosis. AIM AND OBJECTIVE: The present work was focused on comparing the sensitivity and specificity of dry-reagent PCR mix over conventional wet-reagent PCR mix for identification of Acinetobacter species. MATERIALS AND METHODS: Conventional wet-reagent mix based and dry-reagent mix based PCR were carried out for the DNA isolated from Acinetobacter species. The latter was also applied directly on bacterial growth without prior DNA extraction process. Equal numbers of bacterial isolates other than Acinetobacter species were also subjected to identification by the same protocols for determining the sensitivity and specificity of the test. RESULTS: The Acinetobacter species showed amplification of the target rpoB gene and the band was observed at 397 bp. The dry-reagent PCR mix results matched completely with the conventional wet-reagent PCR mix assay. All the non-Acinetobacter isolates were negative for the PCR. This indicates that the test is highly specific. The dry-reagent mix also contained an enzyme resistant to PCR inhibitors and capable of amplifying DNA directly from cells. CONCLUSION: Performance of dry-reagent PCR mix without the need for DNA extraction and preparation of a PCR mix proved to be more sensitive and reduce the handling error, minimizes the time, manual work, and skilled labor. PMID:29403209

Novel Bioconjugation Strategy Using Elevated Hydrostatic Pressure: A Case Study for the Site-Specific Attachment of Polyethylene Glycol (PEGylation) of Recombinant Human Ciliary Neurotrophic Factor.

PubMed

Wang, Qi; Zhang, Chun; Guo, Fangxia; Li, Zenglan; Liu, Yongdong; Su, Zhiguo

2017-11-15

In this paper, we reported a novel strategy for the site-specific attachment of polyethylene glycol (PEGylation) of proteins using elevated hydrostatic pressure. The process was similar to the conventional one except the reactor was under elevated hydrostatic pressure. The model protein was recombinant human ciliary neurotrophic factor (rhCNTF), and the reagent was monomethoxy-polyethylene glycol-maleimide (mPEG-MAL). PEGylation with mPEG (40 kDa)-MAL at pH 7.0 under normal pressure for 5 h achieved a less than 5% yield. In comparison, when the pressure was elevated, the PEGylation yield was increased dramatically, reaching nearly 90% at 250 MPa. Furthermore, the following phenomena were observed: (1) high-hydrostatic-pressure PEGylation (HHPP) could operate at a low reactant ratio of 1:1.2 (rhCNTF to mPEG-MAL), while the conventional process needs a much-higher ratio. (2) Short and long chains of PEG gave a similar yield of 90% in HHPP, while the conventional yield for the short chain of the PEG was higher than that of the long chain. (3) The reaction pH in the range of 7.0 to 8.0 had almost no influence upon the yield of HHPP, while the PEGylation yield was significantly increased by a factor of three from pH 7.0 to 8.0 at normal pressure. Surface accessibility analysis was performed using GRASP2 software, and we found that Cys17 of rhCNTF was located at the concave patches, which may have steric hindrance for the PEG to approach. The speculated benefit of HHPP was the facilitation of target-site exposure, reducing the steric hindrance and making the reaction much easier. Structure and activity analysis demonstrated that the HHPP product was comparable to the PEGylated rhCNTF prepared through a conventional method. Overall, this work demonstrated that HHPP, as we proposed, may have application potentials in various conjugations of biomacromolecules.

Esterification of fatty acids using nylon-immobilized lipase in n-hexane: kinetic parameters and chain-length effects.

PubMed

Zaidi, A; Gainer, J L; Carta, G; Mrani, A; Kadiri, T; Belarbi, Y; Mir, A

2002-02-28

The esterification of long-chain fatty acids in n-hexane catalyzed by nylon-immobilized lipase from Candida rugosa has been investigated. Butyl oleate (22 carbon atoms), oleyl butyrate (22 carbon atoms) and oleyl oleate (36 carbon atoms) were produced at maximum reaction rates of approximately equal to 60 mmol h(-1) g(-1) immobilized enzyme when the substrates were present in equimolar proportions at an initial concentration of 0.6 mol l(-1). The observed kinetic behavior of all the esterification reactions is found to follow a ping-pong bi-bi mechanism with competitive inhibition by both substrates. The effect of the chain-length of the fatty acids and the alcohols could be correlated to some mechanistic models, in accordance with the calculated kinetic parameters.

Substrate Trapping in Crystals of the Thiolase OleA Identifies Three Channels That Enable Long Chain Olefin Biosynthesis.

PubMed

Goblirsch, Brandon R; Jensen, Matthew R; Mohamed, Fatuma A; Wackett, Lawrence P; Wilmot, Carrie M

2016-12-23

Phylogenetically diverse microbes that produce long chain, olefinic hydrocarbons have received much attention as possible sources of renewable energy biocatalysts. One enzyme that is critical for this process is OleA, a thiolase superfamily enzyme that condenses two fatty acyl-CoA substrates to produce a β-ketoacid product and initiates the biosynthesis of long chain olefins in bacteria. Thiolases typically utilize a ping-pong mechanism centered on an active site cysteine residue. Reaction with the first substrate produces a covalent cysteine-thioester tethered acyl group that is transferred to the second substrate through formation of a carbon-carbon bond. Although the basics of thiolase chemistry are precedented, the mechanism by which OleA accommodates two substrates with extended carbon chains and a coenzyme moiety-unusual for a thiolase-are unknown. Gaining insights into this process could enable manipulation of the system for large scale olefin production with hydrocarbon chains lengths equivalent to those of fossil fuels. In this study, mutagenesis of the active site cysteine in Xanthomonas campestris OleA (Cys 143 ) enabled trapping of two catalytically relevant species in crystals. In the resulting structures, long chain alkyl groups (C 12 and C 14 ) and phosphopantetheinate define three substrate channels in a T-shaped configuration, explaining how OleA coordinates its two substrates and product. The C143A OleA co-crystal structure possesses a single bound acyl-CoA representing the Michaelis complex with the first substrate, whereas the C143S co-crystal structure contains both acyl-CoA and fatty acid, defining how a second substrate binds to the acyl-enzyme intermediate. An active site glutamate (Gluβ 117 ) is positioned to deprotonate bound acyl-CoA and initiate carbon-carbon bond formation. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Highly efficient and selective pressure-assisted photon-induced polymerization of styrene

NASA Astrophysics Data System (ADS)

Guan, Jiwen; Song, Yang

2016-06-01

The polymerization process of condensed styrene to produce polystyrene as an industrially important polymeric material was investigated using a novel approach by combining external compression with ultraviolet radiation. The reaction evolution was monitored as a function of time and the reaction products were characterized by in situ Fourier transform infrared spectroscopy. By optimizing the loading pressures, we observed highly efficient and selective production of polystyrene of different tacticities. Specifically, at relatively low loading pressures, infrared spectra suggest that styrene monomers transform to amorphous atactic polystyrene (APS) with minor crystalline isotactic polystyrene. In contrast, APS was found to be the sole product when polymerization occurs at relatively higher loading pressures. The time-dependent reaction profiles allow the examination of the polymerization kinetics by analyzing the rate constant and activation volume as a function of pressure. As a result, an optimized pressure condition, which allows a barrierless reaction to proceed, was identified and attributed to the very desirable reaction yield and kinetics. Finally, the photoinitiated reaction mechanism and the growth geometry of the polymer chains were investigated from the energy diagram of styrene and by the topology analysis of the crystal styrene. This study shows strong promise to produce functional polymeric materials in a highly efficient and controlled manner.

Metal-Organic Polyhedral Core as a Versatile Scaffold for Divergent and Convergent Star Polymer Synthesis.

PubMed

Hosono, Nobuhiko; Gochomori, Mika; Matsuda, Ryotaro; Sato, Hiroshi; Kitagawa, Susumu

2016-05-25

We herein report the divergent and convergent synthesis of coordination star polymers (CSP) by using metal-organic polyhedrons (MOPs) as a multifunctional core. For the divergent route, copper-based great rhombicuboctahedral MOPs decorated with dithiobenzoate or trithioester chain transfer groups at the periphery were designed. Subsequent reversible addition-fragmentation chain transfer (RAFT) polymerization of monomers mediated by the MOPs gave star polymers, in which 24 polymeric arms were grafted from the MOP core. On the other hand, the convergent route provided identical CSP architectures by simple mixing of a macroligand and copper ions. Isophthalic acid-terminated polymers (so-called macroligands) immediately formed the corresponding CSPs through a coordination reaction with copper(II) ions. This convergent route enabled us to obtain miktoarm CSPs with tunable chain compositions through ligand mixing alone. This powerful method allows instant access to a wide variety of multicomponent star polymers that conventionally have required highly skilled and multistep syntheses. MOP-core CSPs are a new class of star polymer that can offer a design strategy for highly processable porous soft materials by using coordination nanocages as a building component.

Study on the pyrolysis of cellulose for bio-oil with mesoporous molecular sieve catalysts.

PubMed

Yu, Feng-wen; Ji, Deng-xiang; Nie, Yong; Luo, Yao; Huang, Cheng-jie; Ji, Jian-bing

2012-09-01

Mesoporous materials possess a hexagonal array of uniform mesopores, high surface areas, and moderate acidity. They are one of the important catalysts in the field of catalytic pyrolysis. In this paper, mesoporous materials of Al-MCM-41, La-Al-MCM-41, and Ce-Al-MCM-41 were synthesized, characterized, and tested as catalysts in the cellulose catalytic pyrolysis process using a fixed bed pyrolysis reactor. The results showed that mesoporous materials exhibited a strong influence on the pyrolytic behavior of cellulose. The presence of these mesoporous molecular sieve catalysts could vary the yield of products, which was that they could decrease the yield of liquid and char and increase the yield of gas product, and could promote high-carbon chain compounds to break into low-carbon chain compounds. Mesoporous molecular sieve catalysts were benefit to the reaction of dehydrogenation and deoxidation and the breakdown of carbon chain. Further, La-Al-MCM-41 and Ce-Al-MCM-41 catalysts can produce more toluene and 2-methoxy-phenol, as compared to the non-catalytic runs.