Sample records for chain reaction profiling

  1. Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

    PubMed

    Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

    2008-03-01

    Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

  2. Identification of the people from whom engorged Aedes aegypti took blood meals in Florida, Puerto Rico, using polymerase chain reaction-based DNA profiling.

    PubMed

    De Benedictis, John; Chow-Shaffer, Esther; Costero, Adriana; Clark, Gary G; Edman, John D; Scott, Thomas W

    2003-04-01

    We used polymerase chain reaction-based DNA profiling to construct allelic profiles for residents and visitors of 22 houses in Florida, Puerto Rico, and human DNA from blood meals in Aedes aegypti that were collected in those homes. Complete profiles were obtained for < or = 2 days after blood ingestion. Eighteen percent of the meals came from two different people. There was no evidence of meals from > or = 2 people. Eighty percent of the meal sources were identified, > 70% were taken from residents of the collection house, and > 90% were from residents of the study community. Across the community, feeding was non-random with a bias towards young adults and males. Three people accounted for 56% of the meals. Our results confirm that multiple feeding on different people is an important component in the role of Ae. aegypti in dengue virus transmission and help explain the spatial distribution of dengue cases in a previous epidemic in Florida, Puerto Rico.

  3. Phenylalanine 445 within oxidosqualene-lanosterol cyclase from Saccharomyces cerevisiae influences C-Ring cyclization and deprotonation reactions.

    PubMed

    Wu, Tung-Kung; Liu, Yuan-Ting; Chiu, Feng-Hsuan; Chang, Cheng-Hsiang

    2006-10-12

    [reaction: see text] We describe the Saccharomyces cerevisiae oxidosqualene-lanosterol cyclase Phe445 site-saturated mutants that generate truncated tricyclic and altered deprotonation product profiles. Among these mutants, only polar side-chain group substitutions genetically complemented yeast viability and produced spatially related product diversity, supporting the Johnson model that cation-pi interactions between a carbocationic intermediate and an enzyme can be replaced by an electrostatic or polar side chain to stabilize the cationic intermediate, but with product differentiation.

  4. Transcriptional Changes That Characterize the Immune Reactions of Leprosy

    PubMed Central

    Dupnik, Kathryn M.; Bair, Thomas B.; Maia, Andressa O.; Amorim, Francianne M.; Costa, Marcos R.; Keesen, Tatjana S. L.; Valverde, Joanna G.; Queiroz, Maria do Carmo A. P.; Medeiros, Lúcio L.; de Lucena, Nelly L.; Wilson, Mary E.; Nobre, Mauricio L.; Johnson, Warren D.; Jeronimo, Selma M. B.

    2015-01-01

    Background. Leprosy morbidity is increased by 2 pathologic immune reactions, reversal reaction (RR) and erythema nodosum leprosum (ENL). Methods. To discover host factors related to immune reactions, global transcriptional profiles of peripheral blood mononuclear cells were compared between 11 RR, 11 ENL, and 19 matched control patients, with confirmation by quantitative polymerase chain reaction. Encoded proteins were investigated in skin biopsy specimens by means of immunohistochemistry. Results. There were 275 genes differentially expressed in RR and 517 differentially expressed in ENL on the microarray. Pathway analysis showed immunity-related pathways represented in RR and ENL transcriptional profiles, with the “complement and coagulation” pathway common to both. Interferon γ was identified as a significant upstream regulator of the expression changes for RR and ENL. Immunohistochemical staining of skin lesions showed increased C1q in both RR and ENL. Conclusions. These data suggest a previously underrecognized role for complement in the pathogenesis of both RR and ENL, and we propose new hypotheses for reaction pathogenesis. PMID:25398459

  5. Kinetic Analysis for the Multistep Profiles of Organic Reactions: Significance of the Conformational Entropy on the Rate Constants of the Claisen Rearrangement.

    PubMed

    Sumiya, Yosuke; Nagahata, Yutaka; Komatsuzaki, Tamiki; Taketsugu, Tetsuya; Maeda, Satoshi

    2015-12-03

    The significance of kinetic analysis as a tool for understanding the reactivity and selectivity of organic reactions has recently been recognized. However, conventional simulation approaches that solve rate equations numerically are not amenable to multistep reaction profiles consisting of fast and slow elementary steps. Herein, we present an efficient and robust approach for evaluating the overall rate constants of multistep reactions via the recursive contraction of the rate equations to give the overall rate constants for the products and byproducts. This new method was applied to the Claisen rearrangement of allyl vinyl ether, as well as a substituted allyl vinyl ether. Notably, the profiles of these reactions contained 23 and 84 local minima, and 66 and 278 transition states, respectively. The overall rate constant for the Claisen rearrangement of allyl vinyl ether was consistent with the experimental value. The selectivity of the Claisen rearrangement reaction has also been assessed using a substituted allyl vinyl ether. The results of this study showed that the conformational entropy in these flexible chain molecules had a substantial impact on the overall rate constants. This new method could therefore be used to estimate the overall rate constants of various other organic reactions involving flexible molecules.

  6. Checking of individuality by DNA profiling.

    PubMed

    Brdicka, R; Nürnberg, P

    1993-08-25

    A review of methods of DNA analysis used in forensic medicine for identification, paternity testing, etc. is provided. Among other techniques, DNA fingerprinting using different probes and polymerase chain reaction-based techniques such as amplified sequence polymorphisms and minisatellite variant repeat mapping are thoroughly described and both theoretical and practical aspects are discussed.

  7. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    ERIC Educational Resources Information Center

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  8. Metabolic pathway profiling of mitochondrial respiratory chain mutants in C. elegans

    PubMed Central

    MJ, Falk; Z, Zhang; Rosenjack; Nissim; E, Daikhin; Nissim; MM, Sedensky; M, Yudkoff; PG, Morgan

    2008-01-01

    C. elegans affords a model of primary mitochondrial dysfunction that provides insight into cellular adaptations which accompany mutations in nuclear gene that encode mitochondrial proteins. To this end, we characterized genome-wide expression profiles of C. elegans strains with mutations in nuclear-encoded subunits of respiratory chain complexes. Our goal was to detect concordant changes among clusters of genes that comprise defined metabolic pathways. Results indicate that respiratory chain mutants significantly upregulate a variety of basic cellular metabolic pathways involved in carbohydrate, amino acid, and fatty acid metabolism, as well as cellular defense pathways such as the metabolism of P450 and glutathione. To further confirm and extend expression analysis findings, quantitation of whole worm free amino acid levels was performed in C. elegans mitochondrial mutants for subunits of complexes I, II, and III. Significant differences were seen for 13 of 16 amino acid levels in complex I mutants compared with controls, as well as overarching similarities among profiles of complex I, II, and III mutants compared with controls. The specific pattern of amino acid alterations observed provides novel evidence to suggest that an increase in glutamate-linked transamination reactions caused by the failure of NAD+ dependent oxidation of ketoacids occurs in primary mitochondrial respiratory chain mutants. Recognition of consistent alterations among patterns of nuclear gene expression for multiple biochemical pathways and in quantitative amino acid profiles in a translational genetic model of mitochondrial dysfunction allows insight into the complex pathogenesis underlying primary mitochondrial disease. Such knowledge may enable the development of a metabolomic profiling diagnostic tool applicable to human mitochondrial disease. PMID:18178500

  9. The use of acid phosphatase test papers for DNA profiling.

    PubMed

    Reshef, A; Barash, M; Gallili, N; Michael, A; Brauner, P

    2005-01-01

    The acid phosphatase (AP) test is a routine assay used to screen casework items for the possible presence of semen. This colour test is carried out on filter paper which is retained after testing. Two-year-old AP test papers were found to contain sufficient DNA for short tandem repeat (STR) profiling. Prior to polymerase chain reaction (PCR) amplification, the DNA was preferentially separated into sperm depleted and sperm enriched cell fractions. The implication of these findings for past and present cases is discussed.

  10. Unique anthranilic acid chemistry facilitates profiling and characterization of Ser/Thr-linked sugar chains following hydrazinolysis.

    PubMed

    Anumula, Kalyan Rao

    2008-02-01

    A novel method for the analysis of Ser/Thr-linked sugar chains was made possible by the virtue of unique anthranilic acid (AA, 2-aminobenzoic acid [2AA]) chemistry for labeling carbohydrates in aqueous salt solutions (K. R. Anumula, Anal. Biochem. 350 (2006) 1-23). The protocol for profiling of Ser/Thr carbohydrates by hydrazinolysis was made simple by eliminating intermediary isolation steps involved in a sample preparation such as desalting and various chromatographic purification schemes. A 6-h hydrazinolysis was carried out at 60 degrees C for O-linked oligosaccharides and at 95 degrees C for total oligosaccharides (N-linked with some O-linked). Following evaporation of hydrazine (<10 min), the oligosaccharides were N-acetylated and derivatized with AA in the same reaction mixture containing salts. Presumably, the glycosyl-hydrazines/hydrazones present in the mixture did not interfere with AA labeling. Because AA is the most fluorescent and highly reactive tag for labeling carbohydrates, the procedures described are suitable for the analysis of a limited amount of samples ( approximately 5 microg) by the current high-resolution high-performance liquid chromatography (HPLC) methods. HPLC conditions developed for the separation of O-linked sugar chains based on size on an amide column were satisfactory for quantitative profiling and characterization. Common O-linked sugar chains found in fetuin, equine chorionic gonadotropin, and glycophorin can be analyzed in less than 50 min. In addition, these fast profiling methods were comparable to profiling by PNGase F (peptide N-glycosidase from Flavobacterium meningosepticum) digestion in terms of time, effort, and simplicity and also were highly reproducible for routine testing. The procedures for the release of sugar chains by hydrazinolysis at the microgram level, labeling with fluorescent tag AA, and profiling by HPLC should be useful in characterization of carbohydrates found in glycoproteins.

  11. An evaluation of microbial profile in halitosis with tongue coating using PCR (polymerase chain reaction)- a clinical and microbiological study.

    PubMed

    Kamaraj R, Dinesh; Bhushan, Kala S; K L, Vandana

    2014-01-01

    Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load.

  12. ETMB-RBF: discrimination of metal-binding sites in electron transporters based on RBF networks with PSSM profiles and significant amino acid pairs.

    PubMed

    Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

    2013-01-01

    Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation-reduction reactions. In these oxidation-reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins.

  13. ETMB-RBF: Discrimination of Metal-Binding Sites in Electron Transporters Based on RBF Networks with PSSM Profiles and Significant Amino Acid Pairs

    PubMed Central

    Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

    2013-01-01

    Background Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation–reduction reactions. In these oxidation–reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. Methods We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. Results We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. Conclusions We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins. PMID:23405059

  14. An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

    PubMed Central

    Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

    2014-01-01

    Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. Materials and Methods: The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. Result: The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. Conclusion: The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load. PMID:24596791

  15. Hetero-Diels-Alder reactions of novel 3-triazolyl-nitrosoalkenes as an approach to functionalized 1,2,3-triazoles with antibacterial profile.

    PubMed

    Lopes, Susana M M; Novais, Juliana S; Costa, Dora C S; Castro, Helena C; Figueiredo, Agnes Marie S; Ferreira, Vitor F; Pinho E Melo, Teresa M V D; da Silva, Fernando de Carvalho

    2018-01-01

    The generation and reactivity of 3-triazolyl-nitrosoalkenes are reported for the first time. The study showed that hetero-Diels-Alder reaction of these heterodienes is an interesting synthetic strategy to functionalized 1,2,3-triazoles, including 1,2,3-triazolyl-pyrroles, 1,2,3-triazolyl-dipyrromethanes and 1,2,3-triazolyl-indoles. The evaluation of the antibacterial profile against Gram-positive and Gram-negative strains revealed the new 5,5'-diethyldipyrromethane bearing a side chain incorporating a triazole and oxime moieties. The antibacterial profile detected was within the Clinical and Laboratory Standard Institute (CLSI) range and against important Staphylococcus species including Methicillin-resistant strain (S. aureus ATCC 25923, S. epidermidis ATCC 12228 and S. simulans ATCC 27851 and MRSA). Interestingly, this new 1,2,3-triazole presented hemocompatibility and low in silico toxicity profile similar to antibiotics current in use. It also has an usual antibiofilm activity against MRSA, which reinforced its potential as a new antibacterial prototype. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  16. Is the 'Bromine Explosion' generated from the reaction BrO HO2 alone?

    NASA Astrophysics Data System (ADS)

    Behnke, Wolfgang; Zetzsch, Cornelius

    2010-05-01

    We observed bromine explosions (a fast production of atomic Br and Cl under tropospheric conditions) in various smog chamber experiments in Teflon bags at room temperature at a relative humidity of about 80% in the presence of NaCl/NaBr-aerosol, simulated sunlight and ozone (200 - 400 ppb). Time profiles of ozone and hydrocarbons (HCs: n-butane, 2,2-dimethylbutane, tetramethylbutane and toluene, initially about 2 ppb each) were monitored to determine concentrations and source strengths of OH radicals, atomic Cl and Br and the corresponding time profiles of BrCl and Br2 as their photolytic precursors. The number and size of aerosols are measured as well as their chemical composition (Br-, Cl- and oxalic acid). Full records of raw data from the smog chamber runs are available at www.eurochamp.org for potential users. Chemical box model calculations deliver concentrations of various intermediates, such as aldehydes, HO2 and RO2 radicals and the inorganic halogen compounds ClO, BrO, HOCl and HOBr, where HOBr from O3 + Br- => BrO- + O2 in the aqueous/adsorbed phase induces the following gas-phase/ heterogeneous chain reaction Br + O3 => BrO + O2(1) BrO + HO2 => HOBr + O2(2a) HOBr + (Aerosol) => HOBrad(3) Surface-adsorbed HOBr reacts with Br- or Cl- to produce Br2 or BrCl, both of which are released and photolysed. Formation of Br2 should prevail up to Cl-/Br- -ratios of about 104 (Fickert, S., J.W. Adams, J.N. Crowley, J. Geophys. Res., D104, 23719-23727, 1999). A maximum of this ratio is reached about 30 minutes after the beginning and decreases during the next hours - probably by reaction of Br2 with oxalate and absorption of HBr, formed from the reaction of Br with aldehydes. Parallel to chain reaction (1)-(3) a chain reaction replacing Br by Cl seems possible but can not be realized, since the main sink of atomic Cl is its reaction with hydrocarbons - leading to chain termination - in contrast to atomic Br (ratio of rates: kCl[O3]/kCl[HC] ~ 0.1; kBr[O3]/kBr[toluene] ~ 100). Formation of aldehydes (R-CHO) interferes with the chain reaction (1) - (3) markedly, since kBr[O3] ≈kBr[R-CHO]. The chain reaction is limited by availability of ozone (degradation of HCs by atomic Cl stops completely with vanishing ozone), of HO2 (HCs are required to form HO2) and of aerosol. The central question is: will sufficient HO2 be formed from degradation of HCs to explain the magnitude of the formed Br2 and BrCl in our experiments? We found that the formation of HO2 should be by a factor of 2-4 larger to explain the formation of Br2 and BrCl. Which other sources for the formation of HOBr besides reaction (2a) are then available? The rate of CH3O2with BrO is 25% of that with HO2 (Enami, S.; Yamanaka, T.; Nakayama, T.; Hashimoto, S.; Kawasaki, M.; Shallcross, D.E.; Nakano, Y.; Ishiwata, T., J. Phys. Chem. A, 11, 3342 - 3348, 2007), suggesting that other RO2 radicals must contribute. In our model calculations we use this rate constant for all RO2 radicals to obtain reasonable agreement between the produced HOBr and the formed BrCl and Br2 necessary for our experimental degradation results. So reaction scheme (1) - (3) should be completed by: BrO + RO2 => HOBr + products (2b) The German Science Foundation (DFG) supported this research in unit 783 (HALOPROC).

  17. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

  18. Mode-locking in advection-reaction-diffusion systems: An invariant manifold perspective

    NASA Astrophysics Data System (ADS)

    Locke, Rory A.; Mahoney, John R.; Mitchell, Kevin A.

    2018-01-01

    Fronts propagating in two-dimensional advection-reaction-diffusion systems exhibit a rich topological structure. When the underlying fluid flow is periodic in space and time, the reaction front can lock to the driving frequency. We explain this mode-locking phenomenon using the so-called burning invariant manifolds (BIMs). In fact, the mode-locked profile is delineated by a BIM attached to a relative periodic orbit (RPO) of the front element dynamics. Changes in the type (and loss) of mode-locking can be understood in terms of local and global bifurcations of the RPOs and their BIMs. We illustrate these concepts numerically using a chain of alternating vortices in a channel geometry.

  19. Tunable, Quantitative Fenton-RAFT Polymerization via Metered Reagent Addition.

    PubMed

    Nothling, Mitchell D; McKenzie, Thomas G; Reyhani, Amin; Qiao, Greg G

    2018-05-10

    A continuous supply of radical species is a key requirement for activating chain growth and accessing quantitative monomer conversions in reversible addition-fragmentation chain transfer (RAFT) polymerization. In Fenton-RAFT, activation is provided by hydroxyl radicals, whose indiscriminate reactivity and short-lived nature poses a challenge to accessing extended polymerization times and quantitative monomer conversions. Here, an alternative Fenton-RAFT procedure is presented, whereby radical generation can be finely controlled via metered dosing of a component of the Fenton redox reaction (H 2 O 2 ) using an external pumping system. By limiting the instantaneous flux of radicals and ensuring sustained radical generation over tunable time periods, metered reagent addition reduces unwanted radical "wasting" reactions and provides access to consistent quantitative monomer conversions with high chain-end fidelity. Fine tuning of radical concentration during polymerization is achieved simply via adjustment of reagent dose rate, offering significant potential for automation. This modular strategy holds promise for extending traditional RAFT initiation toward more tightly regulated radical concentration profiles and affords excellent prospects for the automation of Fenton-RAFT polymerization. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    PubMed

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  1. Metabolome and proteome profiling of complex I deficiency induced by rotenone.

    PubMed

    Gielisch, Ina; Meierhofer, David

    2015-01-02

    Complex I (CI; NADH dehydrogenase) deficiency causes mitochondrial diseases, including Leigh syndrome. A variety of clinical symptoms of CI deficiency are known, including neurodegeneration. Here, we report an integrative study combining liquid chromatography-mass spectrometry (LC-MS)-based metabolome and proteome profiling in CI deficient HeLa cells. We report a rapid LC-MS-based method for the relative quantification of targeted metabolome profiling with an additional layer of confidence by applying multiple reaction monitoring (MRM) ion ratios for further identity confirmation and robustness. The proteome was analyzed by label-free quantification (LFQ). More than 6000 protein groups were identified. Pathway and network analyses revealed that the respiratory chain was highly deregulated, with metabolites such as FMN, FAD, NAD(+), and ADP, direct players of the OXPHOS system, and metabolites of the TCA cycle decreased up to 100-fold. Synthesis of functional iron-sulfur clusters, which are of central importance for the electron transfer chain, and degradation products like bilirubin were also significantly reduced. Glutathione metabolism on the pathway level, as well as individual metabolite components such as NADPH, glutathione (GSH), and oxidized glutathione (GSSG), was downregulated. Overall, metabolome and proteome profiles in CI deficient cells correlated well, supporting our integrated approach.

  2. Aromatic ring generation as a dust precursor in acetylene discharges

    NASA Astrophysics Data System (ADS)

    De Bleecker, Kathleen; Bogaerts, Annemie; Goedheer, Wim

    2006-04-01

    Production of aromatic hydrocarbon compounds as an intermediate step for particle formation in low-pressure acetylene discharges is investigated via a kinetic approach. The detailed chemical reaction mechanism contains 140 reactions among 55 species. The cyclic hydrocarbon chemistry is mainly based on studies of polycyclic aromatic hydrocarbon formation in cosmic environments. The model explicitly includes organic chain, cyclic molecules, radicals, and ions up to a size of 12 carbon atoms. The calculated density profiles show that the aromatic formation yields are quite significant, suggesting that aromatic compounds play a role in the underlying mechanisms of particle formation in hydrocarbon plasmas.

  3. Microarray Analysis of Differential Gene Expression Profile Between Human Fetal and Adult Heart.

    PubMed

    Geng, Zhimin; Wang, Jue; Pan, Lulu; Li, Ming; Zhang, Jitai; Cai, Xueli; Chu, Maoping

    2017-04-01

    Although many changes have been discovered during heart maturation, the genetic mechanisms involved in the changes between immature and mature myocardium have only been partially elucidated. Here, gene expression profile changed between the human fetal and adult heart was characterized. A human microarray was applied to define the gene expression signatures of the fetal (13-17 weeks of gestation, n = 4) and adult hearts (30-40 years old, n = 4). Gene ontology analyses, pathway analyses, gene set enrichment analyses, and signal transduction network were performed to predict the function of the differentially expressed genes. Ten mRNAs were confirmed by quantificational real-time polymerase chain reaction. 5547 mRNAs were found to be significantly differentially expressed. "Cell cycle" was the most enriched pathway in the down-regulated genes. EFGR, IGF1R, and ITGB1 play a central role in the regulation of heart development. EGFR, IGF1R, and FGFR2 were the core genes regulating cardiac cell proliferation. The quantificational real-time polymerase chain reaction results were concordant with the microarray data. Our data identified the transcriptional regulation of heart development in the second trimester and the potential regulators that play a prominent role in the regulation of heart development and cardiac cells proliferation.

  4. Versatile fusion source integrator AFSI for fast ion and neutron studies in fusion devices

    NASA Astrophysics Data System (ADS)

    Sirén, Paula; Varje, Jari; Äkäslompolo, Simppa; Asunta, Otto; Giroud, Carine; Kurki-Suonio, Taina; Weisen, Henri; JET Contributors, The

    2018-01-01

    ASCOT Fusion Source Integrator AFSI, an efficient tool for calculating fusion reaction rates and characterizing the fusion products, based on arbitrary reactant distributions, has been developed and is reported in this paper. Calculation of reactor-relevant D-D, D-T and D-3He fusion reactions has been implemented based on the Bosch-Hale fusion cross sections. The reactions can be calculated between arbitrary particle populations, including Maxwellian thermal particles and minority energetic particles. Reaction rate profiles, energy spectra and full 4D phase space distributions can be calculated for the non-isotropic reaction products. The code is especially suitable for integrated modelling in self-consistent plasma physics simulations as well as in the Serpent neutronics calculation chain. Validation of the model has been performed for neutron measurements at the JET tokamak and the code has been applied to predictive simulations in ITER.

  5. Simple model of inhibition of chain-branching combustion processes

    NASA Astrophysics Data System (ADS)

    Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.

    2017-11-01

    A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.

  6. Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls.

    PubMed

    Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol

    2010-03-05

    The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90%) were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8%) and the lowest in fibroblastic DNA (92.3%, P < or = 0.05). Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P < or = 0.05). The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic cells.

  7. Immunohistochemical Study of Laminin-332 γ2 Chain and MMP-9 in High Risk of Malignant Transformation Oral Lesions and OSCC.

    PubMed

    Silva, Eline Manhães Reid; Freitas, Vanessa Morais; Bautz, Willian Grassi; de Barros, Liliana Aparecida Pimenta; da Gama de Souza, Letícia Nogueira

    2018-01-01

    Oral squamous cell carcinoma is associated with alterations in basement membrane. Laminin-332 is present in basal lamina and performs multiple biologic effects by γ2 chain. Matrix metalloproteinase acts disrupting extracellular components and was related to poor prognosis in cancer. Here, molecular profile of laminin-332 γ2 chain and matrix metalloproteinase-9 was assessed in oral lesions. The expression of laminin-332 γ2 chain and matrix metalloproteinase-9 (MMP-9) was examined by immunohistochemistry in 10 patients with high risk of malignant transformation oral lesions and 26 cases of oral squamous cell carcinoma (OSCC). Associations between microscopic and clinicopathologic features were established. Immunostaining of laminin-332 γ2 chain in high risk oral lesions was most detected in basement membrane which is continuous, while the majority of OSCC cases showed a discontinuous membrane (P = 0.001). It was observed a positive reaction for γ2 chain in invasive fronts and a higher expression in epithelial compartment of smoking patients with OSCC (P < 0.0001). In epithelium, MMP-9 expression was presented in all layers with no difference between lesions. However, an elevated immunostaining in stromal cells was associated with male patients (P = 0.0054), older than 60 years (P = 0.0101) and with OSCC. Present study results support the hypothesis of changes in molecules expression in high risk oral lesions and oral squamous cell carcinoma. A relation between clinical and molecule profile was observed. Those molecules may represent a useful tool to predict oral cancer behaviour.

  8. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  9. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  10. Chain-reaction crash in traffic flow controlled by taillights

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-02-01

    We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.

  11. Presence of Legionellaceae in warm water supplies and typing of strains by polymerase chain reaction.

    PubMed Central

    Zietz, B.; Wiese, J.; Brengelmann, F.; Dunkelberg, H.

    2001-01-01

    Outbreaks of Legionnaire's disease present a public health challenge especially because fatal outcomes still remain frequent. The aim of this study was to describe the abundance and epidemiology of Legionellaceae in the human-made environment. Water was sampled from hot-water taps in private and public buildings across the area of Göttingen, Germany, including distant suburbs. Following isolation, we used polymerase chain reaction in order to generate strain specific banding profiles of legionella isolates. In total, 70 buildings were examined. Of these 18 (26%) had the bacterium in at least one water sample. Legionella pneumophila serogroups 1, 4, 5 and 6 could be identified in the water samples. Most of the buildings were colonized solely by one distinct strain, as proven by PCR. In three cases equal patterns were found in separate buildings. There were two buildings in this study where isolates with different serogroups were found at the same time. PMID:11293675

  12. ONR Far East Scientific Information Bulletin

    DTIC Science & Technology

    1990-09-01

    In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by

  13. Effect of perception irregularity on chain-reaction crash in low visibility

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-06-01

    We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.

  14. Chain-reaction crash on a highway in high visibility

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2016-05-01

    We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

  15. Role of microbiological culture and polymerase chain reaction (PCR) of actinomyces in medication-related osteonecrosis of the jaw (MRONJ).

    PubMed

    Panya, Sappasith; Fliefel, Riham; Probst, Florian; Tröltzsch, Matthias; Ehrenfeld, Michael; Schubert, Sören; Otto, Sven

    2017-03-01

    We hypothesized that local infection plays a critical role in the pathogenesis of medication-related osteonecrosis of the jaw (MRONJ). Recent developments in molecular methods have revolutionized new approaches for the rapid detection of microorganisms including those difficult to culture. The aim of our study is to identify the bacterial profiles in MRONJ by microbiological culture and polymerase chain reactions (PCR). A retrospective analysis was performed on MRONJ patients from 2008 to 2014. The bacterial profile from MRONJ bone samples was determined using microbiological culture and PCR. Ninety five patients fulfilled the inclusion criteria with mean age of 69.85 ± 8.71 years. A female predilection was detected. The mandible was more commonly affected than maxilla. Tooth extraction was the frequent triggering factor. Breast cancer was the primary cause for administration and intravenous bisphosphonates were the most commonly administrated antiresorptive drugs. The majority of patients were classified as stage 2. Posterior teeth were most commonly affected. Based on bone culture results, the most common microorganism were both actinomyces and mixed flora. PCR confirmed the presence of actinomyces in 55 patients. Our data suggest that PCR might be an innovative method for detection of microorganisms difficult to culture using traditional microbiological techniques. Copyright © 2017 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

  16. Unit and internal chain profiles of maca amylopectin.

    PubMed

    Zhang, Ling; Li, Guantian; Yao, Weirong; Zhu, Fan

    2018-03-01

    Unit chain length distributions of amylopectin and its φ, β-limit dextrins, which reflect amylopectin internal structure from three maca starches, were determined by high-performance anion-exchange chromatography with pulsed amperometric detection after debranching, and the samples were compared with maize starch. The amylopectins exhibited average chain lengths ranging from 16.72 to 17.16, with ranges of total internal chain length, external chain length, and internal chain length of the maca amylopectins at 12.49 to 13.68, 11.24 to 11.89, and 4.27 to 4.48. The average chain length, external chain length, internal chain length, and total internal chain length were comparable in three maca amylopectins. Amylopectins of the three maca genotypes studied here presented no significant differences in their unit chain length profiles, but did show significant differences in their internal chain profiles. Additional genetic variations between different maca genotypes need to be studied to provide unit- and internal chain profiles of maca amylopectin. Copyright © 2017. Published by Elsevier Ltd.

  17. Effect of vehicular size on chain-reaction crash

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-11-01

    We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

  18. Kinetic aspects of chain growth in Fischer-Tropsch synthesis.

    PubMed

    Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M

    2017-04-28

    Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.

  19. Differentiation of mixed biological traces in sexual assaults using DNA fragment analysis

    PubMed Central

    Apostolov, Аleksandar

    2014-01-01

    During the investigation of sexual abuse, it is not rare that mixed genetic material from two or more persons is detected. In such cases, successful profiling can be achieved using DNA fragment analysis, resulting in individual genetic profiles of offenders and their victims. This has led to an increase in the percentage of identified perpetrators of sexual offenses. The classic and modified genetic models used, allowed us to refine and implement appropriate extraction, polymerase chain reaction and electrophoretic procedures with individual assessment and approach to conducting research. Testing mixed biological traces using DNA fragment analysis appears to be the only opportunity for identifying perpetrators in gang rapes. PMID:26019514

  20. Transcription profile data of phorbol esters biosynthetic genes during developmental stages in Jatropha curcas.

    PubMed

    Jadid, Nurul; Mardika, Rizal Kharisma; Purwani, Kristanti Indah; Permatasari, Erlyta Vivi; Prasetyowati, Indah; Irawan, Mohammad Isa

    2018-06-01

    Jatropha curcas is currently known as an alternative source for biodiesel production. Beside its high free fatty acid content, J. curcas also contains typical diterpenoid-toxic compounds of Euphorbiaceae plant namely phorbol esters. This article present the transcription profile data of genes involved in the biosynthesis of phorbol esters at different developmental stages of leaves, fruit, and seed in Jatropha curcas . Transcriptional profiles were analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We used two genes including GGPPS (Geranylgeranyl diphospate synthase), which is responsible for the formation of common diterpenoid precursor (GGPP) and CS (Casbene Synthase), which functions in the synthesis of casbene. Meanwhile, J. curcas Actin ( ACT ) was used as internal standard. We demonstrated dynamic of GGPPS and CS expression among different stage of development of leaves, fruit and seed in Jatropha .

  1. Identification and validation of biomarkers of IgV(H) mutation status in chronic lymphocytic leukemia using microfluidics quantitative real-time polymerase chain reaction technology.

    PubMed

    Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R

    2007-09-01

    To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.

  2. Comprehensive analysis of immune, extracellular matrices and pathogens profile in lung granulomatosis of unexplained etiology.

    PubMed

    da Costa Souza, Paola; Dondo, Patrícia Suemi; Souza, Gabriela; Lopes, Deborah; Moscardi, Marcel; de Miranda Martinho, Vinicius; de Mattos Lourenço, Rodolfo Daniel; Prieto, Tabatha; Balancin, Marcelo Luiz; Assato, Aline Kawassaki; Teodoro, Walcy Rosolia; Rodrigues, Silvia; Lima, Mariana; Castellano, Maria Vera; Coletta, Ester; Parra, Edwin Roger; Capelozzi, Vera Luiza

    2018-05-01

    This study analyzed the type 1 and type 2T helper (Th1/Th2) cytokines (including interleukins), immune cellular, matrix profile, and pathogens in granulomas with unexplained etiology compared to those with infectious and noninfectious etiology. Surgical lung biopsies from 108 patients were retrospectively reviewed. Histochemistry, immunohistochemistry, immunofluorescence, morphometry and polymerase chain reaction were used, respectively, to evaluate total collagen and elastin fibers, collagen I and III, immune cells, cytokines, matrix metalloproteinase-9, myofibroblasts, and multiple usual and unusual pathogens. No relevant polymerase chain reaction expression was found in unexplained granulomas. A significant difference was found between the absolute number of eosinophils, macrophages, and lymphocytes within granulomas compared to uninvolved lung tissue. Granulomas with unexplained etiology (UEG) presented increased number of eosinophils and high expression of interleukins (ILs) IL-4/IL-5 and transforming growth factor-β. In sarcoidosis, CD4/CD8 cell number was significantly higher within and outside granulomas, respectively; the opposite was detected in hypersensitivity pneumonitis. Again, a significant difference was found between the high number of myofibroblasts and matrix metalloproteinase-9 in UEG, hypersensitivity pneumonitis, and sarcoidosis compared to granulomas of tuberculosis. Granulomas of paracoccidioisis exhibited increased type I collagen and elastic fibers. Th1 immune cellular profile was similar among granulomas with unexplained, infectious, and noninfectious etiology. In contrast, modulation of Th2 and matrix remodeling was associated with more fibroelastogenesis and scarring of lung tissue in UEG compared to infectious and noninfectious. We concluded that IL-4/IL-5 and transforming growth factor-β might be used as surrogate markers of early fibrosis, reducing the need for genotyping, and promise therapeutic target in unexplained granulomas. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Gene Expression and Metabolite Profiling of Developing Highbush Blueberry Fruit Indicates Transcriptional Regulation of Flavonoid Metabolism and Activation of Abscisic Acid Metabolism1[W][OA

    PubMed Central

    Zifkin, Michael; Jin, Alena; Ozga, Jocelyn A.; Zaharia, L. Irina; Schernthaner, Johann P.; Gesell, Andreas; Abrams, Suzanne R.; Kennedy, James A.; Constabel, C. Peter

    2012-01-01

    Highbush blueberry (Vaccinium corymbosum) fruits contain substantial quantities of flavonoids, which are implicated in a wide range of health benefits. Although the flavonoid constituents of ripe blueberries are known, the molecular genetics underlying their biosynthesis, localization, and changes that occur during development have not been investigated. Two expressed sequence tag libraries from ripening blueberry fruit were constructed as a resource for gene identification and quantitative real-time reverse transcription-polymerase chain reaction primer design. Gene expression profiling by quantitative real-time reverse transcription-polymerase chain reaction showed that flavonoid biosynthetic transcript abundance followed a tightly regulated biphasic pattern, and transcript profiles were consistent with the abundance of the three major classes of flavonoids. Proanthocyanidins (PAs) and corresponding biosynthetic transcripts encoding anthocyanidin reductase and leucoanthocyanidin reductase were most concentrated in young fruit and localized predominantly to the inner fruit tissue containing the seeds and placentae. Mean PA polymer length was seven to 8.5 subunits, linked predominantly via B-type linkages, and was relatively constant throughout development. Flavonol accumulation and localization patterns were similar to those of the PAs, and the B-ring hydroxylation pattern of both was correlated with flavonoid-3′-hydroxylase transcript abundance. By contrast, anthocyanins accumulated late in maturation, which coincided with a peak in flavonoid-3-O-glycosyltransferase and flavonoid-3′5′-hydroxylase transcripts. Transcripts of VcMYBPA1, which likely encodes an R2R3-MYB transcriptional regulator of PA synthesis, were prominent in both phases of development. Furthermore, the initiation of ripening was accompanied by a substantial rise in abscisic acid, a growth regulator that may be an important component of the ripening process and contribute to the regulation of blueberry flavonoid biosynthesis. PMID:22086422

  4. Potential Role of Gut Microbiota in ALS Pathogenesis and Possible Novel Therapeutic Strategies.

    PubMed

    Mazzini, Letizia; Mogna, Luca; De Marchi, Fabiola; Amoruso, Angela; Pane, Marco; Aloisio, Irene; Cionci, Nicole Bozzi; Gaggìa, Francesca; Lucenti, Ausiliatrice; Bersano, Enrica; Cantello, Roberto; Di Gioia, Diana; Mogna, Giovanni

    2018-05-18

    Recent preclinical studies suggest that dysfunction of gastrointestinal tract may play a role in amyotrophic lateral sclerosis (ALS) pathogenesis through a modification of the gut microbiota brain axis. Our study is the first focused on microbiota analysis in ALS patients. Our aim was to study the main human gut microbial groups and the overall microbial diversity in ALS and healthy subjects. Moreover we have examined the influence of a treatment with a specific bacteriotherapy composed of Lactobacillus strains (Lactobacillus fermentum, Lactobacillus delbrueckii, Lactobacillus plantarum, Lactobacillus salivarius) acting on the gastrointestinal barrier. We enrolled 50 ALS patients and 50 healthy controls, matched for sex, age, and origin. Fecal samples were used for total genomic DNA extraction. Enterobacteria, Bifidobacterium spp., Lactobacillus spp., Clostridium sensu stricto, Escherichia coli and yeast were quantified using quantitative polymerase chain reaction approach. Denaturing gradient gel electrophoresis analyses were performed to investigate total eubacteria and yeasts populations. Patients were randomized to double-blind treatment either with microorganisms or placebo for 6 months and monitored for clinical progression and microbiota composition. The comparison between ALS subjects and healthy group revealed a variation in the intestinal microbial composition with a higher abundance of E. coli and enterobacteria and a low abundance of total yeast in patients. Polymerase chain reaction denaturing gradient gel electrophoresis analysis showed a cluster distinction between the bacterial profiles of ALS patients and the healthy subjects. The complexity of the profiles in both cases may indicate that a real dysbiosis status is not evident in the ALS patients although differences between healthy and patients exist. The effects of the progression of the disease and of the bacteriotherapy on the bacterial and yeast populations are currently in progress. Our preliminary results confirm that there is a difference in the microbiota profile in ALS patients.

  5. Gene expression and metabolite profiling of developing highbush blueberry fruit indicates transcriptional regulation of flavonoid metabolism and activation of abscisic acid metabolism.

    PubMed

    Zifkin, Michael; Jin, Alena; Ozga, Jocelyn A; Zaharia, L Irina; Schernthaner, Johann P; Gesell, Andreas; Abrams, Suzanne R; Kennedy, James A; Constabel, C Peter

    2012-01-01

    Highbush blueberry (Vaccinium corymbosum) fruits contain substantial quantities of flavonoids, which are implicated in a wide range of health benefits. Although the flavonoid constituents of ripe blueberries are known, the molecular genetics underlying their biosynthesis, localization, and changes that occur during development have not been investigated. Two expressed sequence tag libraries from ripening blueberry fruit were constructed as a resource for gene identification and quantitative real-time reverse transcription-polymerase chain reaction primer design. Gene expression profiling by quantitative real-time reverse transcription-polymerase chain reaction showed that flavonoid biosynthetic transcript abundance followed a tightly regulated biphasic pattern, and transcript profiles were consistent with the abundance of the three major classes of flavonoids. Proanthocyanidins (PAs) and corresponding biosynthetic transcripts encoding anthocyanidin reductase and leucoanthocyanidin reductase were most concentrated in young fruit and localized predominantly to the inner fruit tissue containing the seeds and placentae. Mean PA polymer length was seven to 8.5 subunits, linked predominantly via B-type linkages, and was relatively constant throughout development. Flavonol accumulation and localization patterns were similar to those of the PAs, and the B-ring hydroxylation pattern of both was correlated with flavonoid-3'-hydroxylase transcript abundance. By contrast, anthocyanins accumulated late in maturation, which coincided with a peak in flavonoid-3-O-glycosyltransferase and flavonoid-3'5'-hydroxylase transcripts. Transcripts of VcMYBPA1, which likely encodes an R2R3-MYB transcriptional regulator of PA synthesis, were prominent in both phases of development. Furthermore, the initiation of ripening was accompanied by a substantial rise in abscisic acid, a growth regulator that may be an important component of the ripening process and contribute to the regulation of blueberry flavonoid biosynthesis.

  6. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

    PubMed

    Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

    2015-01-01

    Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

  7. Mutation for nonsyndromic mental retardation in the trans-2-enoyl-CoA reductase TER gene involved in fatty acid elongation impairs the enzyme activity and stability, leading to change in sphingolipid profile.

    PubMed

    Abe, Kensuke; Ohno, Yusuke; Sassa, Takayuki; Taguchi, Ryo; Çalışkan, Minal; Ober, Carole; Kihara, Akio

    2013-12-20

    Very long-chain fatty acids (VLCFAs, chain length >C20) exist in tissues throughout the body and are synthesized by repetition of the fatty acid (FA) elongation cycle composed of four successive enzymatic reactions. In mammals, the TER gene is the only gene encoding trans-2-enoyl-CoA reductase, which catalyzes the fourth reaction in the FA elongation cycle. The TER P182L mutation is the pathogenic mutation for nonsyndromic mental retardation. This mutation substitutes a leucine for a proline residue at amino acid 182 in the TER enzyme. Currently, the mechanism by which the TER P182L mutation causes nonsyndromic mental retardation is unknown. To understand the effect of this mutation on the TER enzyme and VLCFA synthesis, we have biochemically characterized the TER P182L mutant enzyme using yeast and mammalian cells transfected with the TER P182L mutant gene and analyzed the FA elongation cycle in the B-lymphoblastoid cell line with the homozygous TER P182L mutation (TER(P182L/P182L) B-lymphoblastoid cell line). We have found that TER P182L mutant enzyme exhibits reduced trans-2-enoyl-CoA reductase activity and protein stability, thereby impairing VLCFA synthesis and, in turn, altering the sphingolipid profile (i.e. decreased level of C24 sphingomyelin and C24 ceramide) in the TER(P182L/P182L) B-lymphoblastoid cell line. We have also found that in addition to the TER enzyme-catalyzed fourth reaction, the third reaction in the FA elongation cycle is affected by the TER P182L mutation. These findings provide new insight into the biochemical defects associated with this genetic mutation.

  8. Loop-mediated amplification of the Clavibacter michiganensis subsp. michiganensis micA gene is highly specific.

    PubMed

    Yasuhara-Bell, Jarred; Kubota, Ryo; Jenkins, Daniel M; Alvarez, Anne M

    2013-12-01

    Loop-mediated amplification (LAMP) was used to specifically identify Clavibacter michiganensis subsp. michiganensis, causal agent of bacterial canker of tomato. LAMP primers were developed to detect micA, a chromosomally stable gene that encodes a type II lantibiotic, michiganin A, which inhibits growth of other C. michiganensis subspecies. In all, 409 bacterial strains (351 C. michiganensis subsp. michiganensis and 58 non-C. michiganensis subsp. michiganensis) from a worldwide collection were tested with LAMP to determine its specificity. LAMP results were compared with genetic profiles established using polymerase chain reaction (PCR) amplification of seven genes (dnaA, ppaJ, pat-1, chpC, tomA, ppaA, and ppaC). C. michiganensis subsp. michiganensis strains produced eight distinct profiles. The LAMP reaction identified all C. michiganensis subsp. michiganensis strains and discriminated them from other C. michiganensis subspecies and non-Clavibacter bacteria. LAMP has advantages over immunodiagnostic and other molecular detection methods because of its specificity and isothermal nature, which allows for easy field application. The LAMP reaction is also not affected by as many inhibitors as PCR. This diagnostic tool has potential to provide an easy, one-step test for rapid identification of C. michiganensis subsp. michiganensis.

  9. Topology of an intracellular transduction chain (phototropism of Phycomyces): 1. Joint review of functional, temporal, and spatial aspects.

    PubMed

    Wenzler, D; Reinhardt, M; Fukshansky, L

    2001-08-21

    Two light-induced growth reactions in a unicellular cylindrical sporangiophore of Phycomyces blakesleeanus-vertical growth acceleration under symmetrical irradiation (photomecism) and directional growth under unilateral irradiation (phototropism)-share common input light perception as well as common output growth mechanism but have strongly divergent dynamics and other distinctive features. This divergence culminates in the phototropic paradoxes the main of which states that photomecism shows total adaptation, while phototropism does not adapt. The basis for this contradiction is that the phototropic transduction chain, unlike that of photomecism, faces a spatially non-uniform stimulus and processes a series of spatial patterns (light and absorption profiles, adaptation profile, etc.). The only way to resolve the paradoxes and correlate features of both responses within a single transduction chain is to assume non-local signal transduction, e.g. a cross-talk between different azimuthal locations within the cylindrical cell. On the other hand, to establish the presence of an appropriate cross-talk is equivalent of gaining insight into the topology of the transduction chain. This series of two papers contains a review reconsidering the entire field from this viewpoint (Paper 1) and a mathematical model of pattern transduction which unifies features of phototropism and resolves the paradoxes (Paper 2). At the same time, this is the first "proof of concept" for the "activity/pooling (a/p) networks"-a specific mathematical apparatus designed to analyse systemic properties and control in metabolic pathways. Copyright 2001 Academic Press.

  10. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  11. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  12. A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

    PubMed

    Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

    2016-12-01

    To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

  13. Press Releases | Argonne National Laboratory

    Science.gov Websites

    Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

  14. Proteomic identification of potential biomarkers for cervical squamous cell carcinoma and human papillomavirus infection.

    PubMed

    Qing, Song; Tulake, Wuniqiemu; Ru, Mingfang; Li, Xiaohong; Yuemaier, Reziwanguli; Lidifu, Dilare; Rouzibilali, Aierken; Hasimu, Axiangu; Yang, Yun; Rouziahong, Reziya; Upur, Halmurat; Abudula, Abulizi

    2017-04-01

    It is known that high-risk human papillomavirus infection is the main etiological factor in cervical carcinogenesis. However, human papillomavirus screening is not sufficient for early diagnosis. In this study, we aimed to identify potential biomarkers common to cervical carcinoma and human papillomavirus infection by proteomics for human papillomavirus-based early diagnosis and prognosis. To this end, we collected 76 cases of fresh cervical tissues and 116 cases of paraffin-embedded tissue slices, diagnosed as cervical squamous cell carcinoma, cervical intraepithelial neoplasia II-III, or normal cervix from ethnic Uighur and Han women. Human papillomavirus infection by eight oncogenic human papillomavirus types was detected in tissue DNA samples using a quantitative polymerase chain reaction. The protein profile of cervical specimens from human papillomavirus 16-positive squamous cell carcinoma and human papillomavirus-negative normal controls was analyzed by proteomics and bioinformatics. The expression of candidate proteins was further determined by quantitative reverse transcriptase-polymerase chain reaction and immunohistochemistry. We identified 67 proteins that were differentially expressed in human papillomavirus 16-positive squamous cell carcinoma compared to normal cervix. The quantitative reverse transcriptase-polymerase chain reaction analysis verified the upregulation of ASAH1, PCBP2, DDX5, MCM5, TAGLN2, hnRNPA1, ENO1, TYPH, CYC, and MCM4 in squamous cell carcinoma compared to normal cervix ( p < 0.05). In addition, the transcription of PCBP2, MCM5, hnRNPA1, TYPH, and CYC was also significantly increased in cervical intraepithelial neoplasia II-III compared to normal cervix. Immunohistochemistry staining further confirmed the overexpression of PCBP2, hnRNPA1, ASAH1, and DDX5 in squamous cell carcinoma and cervical intraepithelial neoplasia II-III compared to normal controls ( p < 0.05). Our data suggest that the expression of ASAH1, PCBP2, DDX5, and hnRNPA1, and possibly MCM4, MCM5, CYC, ENO1, and TYPH, is upregulated during cervical carcinogenesis and potentially associated with human papillomavirus infection. Further validation studies of the profile will contribute to establishing auxiliary diagnostic markers for human papillomavirus-based cancer prognosis.

  15. Development and accuracy of quantitative real-time polymerase chain reaction assays for detection and quantification of enterotoxigenic Escherichia coli (ETEC) heat labile and heat stable toxin genes in travelers' diarrhea samples.

    PubMed

    Youmans, Bonnie P; Ajami, Nadim J; Jiang, Zhi-Dong; Petrosino, Joseph F; DuPont, Herbert L; Highlander, Sarah K

    2014-01-01

    Enterotoxigenic Escherichia coli (ETEC), the leading bacterial pathogen of travelers' diarrhea, is routinely detected by an established DNA hybridization protocol that is neither sensitive nor quantitative. Quantitative real-time polymerase chain reaction (qPCR) assays that detect the ETEC toxin genes eltA, sta1, and sta2 in clinical stool samples were developed and tested using donor stool inoculated with known quantities of ETEC bacteria. The sensitivity of the qPCR assays is 89%, compared with 22% for the DNA hybridization assay, and the limits of detection are 10,000-fold lower than the DNA hybridization assays performed in parallel. Ninety-three clinical stool samples, previously characterized by DNA hybridization, were tested using the new ETEC qPCR assays. Discordant toxin profiles were observed for 22 samples, notably, four samples originally typed as ETEC negative were ETEC positive. The qPCR assays are unique in their sensitivity and ability to quantify the three toxin genes in clinical stool samples.

  16. Methylation pattern of IFNG in periapical granulomas and radicular cysts.

    PubMed

    Campos, Kelma; Gomes, Carolina Cavaliéri; de Fátima Correia-Silva, Jeane; Farias, Lucyana Conceição; Fonseca-Silva, Thiago; Bernardes, Vanessa Fátima; Pereira, Cláudia Maria; Gomez, Ricardo Santiago

    2013-04-01

    Interferon-γ plays an important role in the pathogenesis of periapical lesions, and the methylation of IFNG has been associated with transcriptional inactivation. The purpose of the present study was to investigate IFNG promoter methylation in association with gene transcription and protein levels in periapical granulomas and radicular cysts. Methylation-specific polymerase chain reaction was used to assess the DNA methylation pattern of the IFNG gene in 16 periapical granulomas and 13 radicular cyst samples. The transcription levels of IFNG mRNA were verified by quantitative real-time polymerase chain reaction, and protein expression was evaluated by immunohistochemistry. All the periapical lesion samples exhibited partial or total methylation of the IFNG gene. In addition, an increased methylation profile was found in radicular cysts compared with periapical granulomas. Increased IFNG mRNA expression was observed in the partially methylated periapical lesion samples relative to the samples that were completely methylated. The present study provides the first evidence of the possible impact of IFNG methylation on IFNG transcription in periapical lesions. Copyright © 2013 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  17. A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

    PubMed

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

    2011-06-01

    The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

  18. Microarray expression profiling in adhesion and normal peritoneal tissues.

    PubMed

    Ambler, Dana R; Golden, Alicia M; Gell, Jennifer S; Saed, Ghassan M; Carey, David J; Diamond, Michael P

    2012-05-01

    To identify molecular markers associated with adhesion and normal peritoneal tissue using microarray expression profiling. Comparative study. University hospital. Five premenopausal women. Adhesion and normal peritoneal tissue samples were obtained from premenopausal women. Ribonucleic acid was extracted using standard protocols and processed for hybridization to Affymetrix Whole Transcript Human Gene Expression Chips. Microarray data were obtained from five different patients, each with adhesion tissue and normal peritoneal samples. Real-time polymerase chain reaction was performed for confirmation using standard protocols. Gene expression in postoperative adhesion and normal peritoneal tissues. A total of 1,263 genes were differentially expressed between adhesion and normal tissues. One hundred seventy-three genes were found to be up-regulated and 56 genes were down-regulated in the adhesion tissues compared with normal peritoneal tissues. The genes were sorted into functional categories according to Gene Ontology annotations. Twenty-six up-regulated genes and 11 down-regulated genes were identified with functions potentially relevant to the pathophysiology of postoperative adhesions. We evaluated and confirmed expression of 12 of these specific genes via polymerase chain reaction. The pathogenesis, natural history, and optimal treatment of postoperative adhesive disease remains unanswered. Microarray analysis of adhesions identified specific genes with increased and decreased expression when compared with normal peritoneum. Knowledge of these genes and ontologic pathways with altered expression provide targets for new therapies to treat patients who have or are at risk for postoperative adhesions. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  19. Comparisons of serum miRNA expression profiles in patients with diabetic retinopathy and type 2 diabetes mellitus.

    PubMed

    Ma, Jianping; Wang, Jufang; Liu, Yanfen; Wang, Changyi; Duan, Donghui; Lu, Nanjia; Wang, Kaiyue; Zhang, Lu; Gu, Kaibo; Chen, Sihan; Zhang, Tao; You, Dingyun; Han, Liyuan

    2017-02-01

    The aim of this study was to compare the expression levels of serum miRNAs in diabetic retinopathy and type 2 diabetes mellitus. Serum miRNA expression profiles from diabetic retinopathy cases (type 2 diabetes mellitus patients with diabetic retinopathy) and type 2 diabetes mellitus controls (type 2 diabetes mellitus patients without diabetic retinopathy) were examined by miRNA-specific microarray analysis. Quantitative real-time polymerase chain reaction was used to validate the significantly differentially expressed serum miRNAs from the microarray analysis of 45 diabetic retinopathy cases and 45 age-, sex-, body mass index- and duration-of-diabetes-matched type 2 diabetes mellitus controls. The relative changes in serum miRNA expression levels were analyzed using the 2-ΔΔCt method. A total of 5 diabetic retinopathy cases and 5 type 2 diabetes mellitus controls were included in the miRNA-specific microarray analysis. The serum levels of miR-3939 and miR-1910-3p differed significantly between the two groups in the screening stage; however, quantitative real-time polymerase chain reaction did not reveal significant differences in miRNA expression for 45 diabetic retinopathy cases and their matched type 2 diabetes mellitus controls. Our findings indicate that miR-3939 and miR-1910-3p may not play important roles in the development of diabetic retinopathy; however, studies with a larger sample size are needed to confirm our findings.

  20. Introduction to Polymer Chemistry.

    ERIC Educational Resources Information Center

    Harris, Frank W.

    1981-01-01

    Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

  1. The impact of shrimp farming effluent on bacterial communities in mangrove waters, Ceará, Brazil.

    PubMed

    Sousa, O V; Macrae, A; Menezes, F G R; Gomes, N C M; Vieira, R H S F; Mendonça-Hagler, L C S

    2006-12-01

    The effects of shrimp farm effluents on bacterial communities in mangroves have been infrequently reported. Classic and molecular biology methods were used to survey bacterial communities from four mangroves systems. Water temperature, salinity, pH, total heterotrophic bacteria and maximum probable numbers of Vibrio spp. were investigated. Genetic profiles of bacterial communities were also characterized by polymerase chain reaction (PCR) amplification of eubacterial and Vibrio 16S rDNA using denaturing gradient gel electrophoresis (DGGE). Highest heterotrophic counts were registered in the mangrove not directly polluted by shrimp farming. The Enterobacteriaceae and Chryseomonas luteola dominated the heterotrophic isolates. Vibrio spp. pathogenic to humans and shrimps were identified. Eubacterial genetic profiles suggest a shared community structure independent of mangrove system. Vibrio genetic profiles were mangrove specific. Neither microbial counts nor genetic profiling revealed a significant decrease in species richness associated with shrimp farm effluent. The complex nature of mangrove ecosystems and their microbial communities is discussed.

  2. Polymerization as a Model Chain Reaction

    ERIC Educational Resources Information Center

    Morton, Maurice

    1973-01-01

    Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

  3. Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

    DOE R&D Accomplishments Database

    Weinberg, Alvin M.; Noderer, L. C.

    1951-05-15

    The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

  4. Rational steering of insulin binding specificity by intra-chain chemical crosslinking

    NASA Astrophysics Data System (ADS)

    Viková, Jitka; Collinsová, Michaela; Kletvíková, Emília; Buděšínský, Miloš; Kaplan, Vojtěch; Žáková, Lenka; Veverka, Václav; Hexnerová, Rozálie; Aviñó, Roberto J. Tarazona; Straková, Jana; Selicharová, Irena; Vaněk, Václav; Wright, Daniel W.; Watson, Christopher J.; Turkenburg, Johan P.; Brzozowski, Andrzej M.; Jiráček, Jiří

    2016-01-01

    Insulin is a key hormone of human metabolism with major therapeutic importance for both types of diabetes. New insulin analogues with more physiological profiles and better glycemic control are needed, especially analogues that preferentially bind to the metabolic B-isoform of insulin receptor (IR-B). Here, we aimed to stabilize and modulate the receptor-compatible conformation of insulin by covalent intra-chain crosslinking within its B22-B30 segment, using the CuI-catalyzed Huisgen 1,3-dipolar cycloaddition reaction of azides and alkynes. This approach resulted in 14 new, systematically crosslinked insulin analogues whose structures and functions were extensively characterized and correlated. One of the analogues, containing a B26-B29 triazole bridge, was highly active in binding to both IR isoforms, with a significant preference for IR-B. Our results demonstrate the potential of chemistry-driven modulation of insulin function, also shedding new light on the functional importance of hormone’s B-chain C-terminus for its IR-B specificity.

  5. Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins

    NASA Astrophysics Data System (ADS)

    Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John

    2017-01-01

    DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.

  6. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  7. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  8. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  9. Emilio Segrè and Spontaneous Fission

    Science.gov Websites

    fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

  10. Chain Reaction Polymerization.

    ERIC Educational Resources Information Center

    McGrath, James E.

    1981-01-01

    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  11. Characterizing Chain Processes in Visible Light Photoredox Catalysis

    PubMed Central

    Cismesia, Megan A.

    2015-01-01

    The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708

  12. Biochemical Characterization of α‐Fetoprotein and Other Serum Proteins Produced by a Uterine Endometrial Adenocarcinoma

    PubMed Central

    Taketa, Kazuhisa; Azuma, Masaki; Yamamoto, Ritsu; Fujimoto, Seiichiro; Nishi, Shinzo

    1996-01-01

    A high serum α‐fetoprotein (AFP) level was found in a patient with endometrial adenocarcinoma of the uterus, which appeared to be hepatoid on histological examination. The AFP of this unusual patient was purified hy immunoaffinity chromatography and characterized. The electrophoretic profiles on sodium dodecyl sulfate‐polyacrylamide gel electrophoresis both before and after glycopeptidase F treatment were indistinguishable from those of a hepatoma AFP. This indicates that the patient's AFP was also composed of a single polypeptide chain of Mr 67,000 and an N‐linked sugar chain of Mr 3,000. Amino acid sequence analyses of this AFP, and of AFP from hepatoma and umbilical cord serum indicated that the N‐terminal sequences were essentially the same. The sequence, Arg‐Thr‐Leu‐His‐Arg‐Asn‐Glu‐Tyr‐Gly‐Ile, was slightly different from previous reports, but matched that deduced from the cDNA sequence. AFP isoforms due to microheterogeneity of the sugar chain were analyzed by lectin affinity electrophoresis using a series of lectins. The AFP isoform profiles were distinct from those of proteins derived from cord serum, hepatoma, yolk sac tumor and gastric cancer. The reverse‐transcription of RNA from the tumor tissue followed by a polymerase chain reaction using primers with AFP‐specific sequences gave a product of the size and nucleotide sequence expected for AFP. mRNAs possessing the requisite sequences for albumin and transferrin syntheses were also detected in the tumor. The expression of these hepatocyte‐specific proteins supported the hepatoid nature of this tumor. PMID:8766525

  13. Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

    2016-09-15

    It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

  14. An inducible HSP70 gene from the midge Chironomus dilutus: Characterization and transcription profile under environmental stress

    USGS Publications Warehouse

    Karouna-Renier, N. K.; Rao, K.R.

    2009-01-01

    In the present study, we identified and characterized an inducible heat shock protein 70 (HSP70) from the midge Chironomus dilutus and investigated the transcriptional profile of the gene under baseline and environmentally stressful conditions. Using real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR), we observed increased expression of CD-HSP70-1 in response to both heat shock and copper stress. We also investigated the expression of this gene during midge development. All C. dilutus developmental stages expressed CD-HSP70-1 under normal conditions, although at extremely low levels. Phylogenetic analysis of the amino acid sequence demonstrated distinct clustering of this gene with inducible HSP70s from other insect species. ?? 2008 The Authors.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guan, Jiwen; Song, Yang, E-mail: yang.song@uwo.ca; Department of Chemistry, University of Western Ontario, London, Ontario N6A 5B7

    The polymerization process of condensed styrene to produce polystyrene as an industrially important polymeric material was investigated using a novel approach by combining external compression with ultraviolet radiation. The reaction evolution was monitored as a function of time and the reaction products were characterized by in situ Fourier transform infrared spectroscopy. By optimizing the loading pressures, we observed highly efficient and selective production of polystyrene of different tacticities. Specifically, at relatively low loading pressures, infrared spectra suggest that styrene monomers transform to amorphous atactic polystyrene (APS) with minor crystalline isotactic polystyrene. In contrast, APS was found to be the solemore » product when polymerization occurs at relatively higher loading pressures. The time-dependent reaction profiles allow the examination of the polymerization kinetics by analyzing the rate constant and activation volume as a function of pressure. As a result, an optimized pressure condition, which allows a barrierless reaction to proceed, was identified and attributed to the very desirable reaction yield and kinetics. Finally, the photoinitiated reaction mechanism and the growth geometry of the polymer chains were investigated from the energy diagram of styrene and by the topology analysis of the crystal styrene. This study shows strong promise to produce functional polymeric materials in a highly efficient and controlled manner.« less

  16. Molecular analysis and association with clinical and laboratory manifestations in children with sickle cell anemia

    PubMed Central

    Camilo-Araújo, Roberta Faria; Amancio, Olga Maria Silverio; Figueiredo, Maria Stella; Cabanãs-Pedro, Ana Carolina; Braga, Josefina Aparecida Pellegrini

    2014-01-01

    Objectives To analyze the frequency of βS-globin haplotypes and alpha-thalassemia, and their influence on clinical manifestations and the hematological profile of children with sickle cell anemia. Method The frequency of βS-globin haplotypes and alpha-thalassemia and any association with clinical and laboratorial manifestations were determined in 117 sickle cell anemia children aged 3–71 months. The confirmation of hemoglobin SS and determination of the haplotypes were achieved by polymerase chain reaction-restriction fragment length polymorphism, and alpha-thalassemia genotyping was by multiplex polymerase chain reaction (single-tube multiplex-polymerase chain reaction). Results The genotype distribution of haplotypes was 43 (36.7%) Central African Republic/Benin, 41 (35.0%) Central African Republic/Central African Republic, 20 (17.0%) Rare/atypical, and 13 (11.1%) Benin/Benin. The frequency of the α3.7 deletion was 1.71% as homozygous (−α3.7/−α3.7) and 11.9% as heterozygous (−α3.7/αα). The only significant association in respect to haplotypes was related to the mean corpuscular volume. The presence of alpha-thalassemia was significantly associated to decreases in mean corpuscular volume, mean corpuscular hemoglobin and reticulocyte count and to an increase in the red blood cell count. There were no significant associations of βS-globin haplotypes and alpha-thalassemia with clinical manifestations. Conclusions In the study population, the frequency of alpha-thalassemia was similar to published data in Brazil with the Central African Republic haplotype being the most common, followed by the Benin haplotype. βS-globin haplotypes and interaction between alpha-thalassemia and sickle cell anemia did not influence fetal hemoglobin concentrations or the number of clinical manifestations. PMID:25305165

  17. Aggregation, adsorption, and surface properties of multiply end-functionalized polystyrenes.

    PubMed

    Ansari, Imtiyaz A; Clarke, Nigel; Hutchings, Lian R; Pillay-Narrainen, Amilcar; Terry, Ann E; Thompson, Richard L; Webster, John R P

    2007-04-10

    The properties of polystyrene blends containing deuteriopolystyrene, multiply end-functionalized with C8F17 fluorocarbon groups, are strikingly analogous to those of surfactants in solution. These materials, denoted FxdPSy, where x is the number of fluorocarbon groups and y is the molecular weight of the dPS chain in kg/mol, were blended with unfunctionalized polystyrene, hPS. Nuclear reaction analysis experiments show that FxdPSy polymers adsorb spontaneously to solution and blend surfaces, resulting in a reduction in surface energy inferred from contact angle analysis. Aggregation of functionalized polymers in the bulk was found to be sensitive to FxdPSy structure and closely related to surface properties. At low concentrations, the functionalized polymers are freely dispersed in the hPS matrix, and in this range, the surface excess concentration grows sharply with increasing bulk concentration. At higher concentrations, surface excess concentrations and contact angles reach a plateau, small-angle neutron scattering data indicate small micellar aggregates of six to seven F2dPS10 polymer chains and much larger aggregates of F4dPS10. Whereas F2dPS10 aggregates are miscible with the hPS matrix, F4dPS10 forms a separate phase of multilamellar vesicles. Using neutron reflectometry (NR), we found that the extent of the adsorbed layer was approximately half the lamellar spacing of the multilamellar vesicles. NR data were fitted using an error function profile to describe the concentration profile of the adsorbed layer, and reasonable agreement was found with concentration profiles predicted by the SCFT model. The thermodynamic sticking energy of the fluorocarbon-functionalized polymer chains to the blend surface increases from 5.3kBT for x = 2 to 6.6kBT for x = 4 but appears to be somewhat dependent upon the blend concentration.

  18. Deficiency of long-chain polyunsaturated fatty acids in phenylketonuria: a cross-sectional study.

    PubMed

    Drzymała-Czyż, Sławomira; Kałużny, Łukasz; Krzyżanowska-Jankowska, Patrycja; Walkowiak, Dariusz; Mozrzymas, Renata; Walkowiak, Jarosław

    2018-01-01

    The etiology of altered blood fatty acid (FA) profile in phenylketonuria (PKU) is understood only partially. We aimed to determine whether FAs deficiency is dependent on the diet or metabolic disturbances. The study comprised 40 PKU patients (20 female, 20 male; aged 11 to 35 years; 12 children and 28 adults) and 40 healthy subjects (HS; 20 female, 20 male, aged 18 to 33 years). We assessed the profile of FAs (gas chromatography/mass spectrometry) and analyzed the 72-hour dietary recalls. The amount of C14:0, C16:0 and C16:1n-7, C18:1n-9 did not differ between the analyzed groups. The percentage of C18:0 was higher, while C20:3n-9, C18:2n-6, C20:2n-6, C20:4n-6, C22:4n-6, C22:5n-6 and C22:6n-3 was lower in PKU than in HS. However, C18:3n-6, C18:3n-3 and n-6/n-3 ratio were higher in PKU patients. The C20:4n-6/C20:3n-6 ratio (reaction catalyzed by Δ5-desaturase), the C22:5n-6/C22:4n-6 and the C22:6n-3/C22:5n-3 ratio (both reactions catalyzed by Δ6 desaturase) were significantly lower in PKU patients. Therefore, the deficiency of long-chain polyunsaturated fatty acids in PKU patients may result not only from inadequate supply but also from metabolic disturbances.

  19. Polymerase chain reaction-based denaturing gradient gel electrophoresis in the evaluation of oral microbiota.

    PubMed

    Li, Y; Saxena, D; Barnes, V M; Trivedi, H M; Ge, Y; Xu, T

    2006-10-01

    Clinical evaluation of oral microbial reduction after a standard prophylactic treatment has traditionally been based on bacterial cultivation methods. However, not all microbes in saliva or dental plaque can be cultivated. Polymerase chain reaction-based denaturing gradient gel electrophoresis (PCR-DGGE) is a cultivation-independent molecular fingerprinting technique that allows the assessment of the predominant bacterial species present in the oral cavity. This study sought to evaluate the oral microbial changes that occurred after a standard prophylactic treatment with a conventional oral care product using PCR-DGGE. Twelve healthy adults participated in the study. Pooled plaque samples were collected at baseline, 24 h after prophylaxis (T1), and 4 days after toothbrushing with fluoride toothpaste (T4). The total microbial genomic DNA of the plaque was isolated. PCR was performed with a set of universal bacterial 16S rDNA primers. The PCR-amplified 16S rDNA fragments were separated by DGGE. The effects of the treatment and of dental brushing were assessed by comparing the PCR-DGGE fingerprinting profiles. The mean numbers of detected PCR amplicons were 22.3 +/- 6.1 for the baseline group, 13.0 +/- 3.1 for the T1 group, and 13.5 +/- 4.3 for the T4 group; the differences among the three groups were statistically significant (P < 0.01). The study also found a significant difference in the mean similarities of microbial profiles between the baseline and the treatment groups (P < 0.001). PCR-based DGGE has been shown to be an excellent means of rapidly and accurately assessing oral microbial changes in this clinical study.

  20. The effects of biodegradable poly(lactic-co-glycolic acid)-based microspheres loaded with quercetin on stemness, viability and osteogenic differentiation potential of stem cell spheroids.

    PubMed

    Lee, H; Nguyen, T T; Kim, M; Jeong, J-H; Park, J-B

    2018-05-31

    Quercetin has been reported to exert many beneficial effects on the protection against various diseases, such as diabetes, cancer, and inflammation. The aim of this study is to evaluate the potential osteogenic differentiation ability of mesenchymal stem cells in the presence of quercetin. Quercetin-loaded poly(lactic-co-glycolic acid) microspheres were prepared using an electrospraying technique. Characterization of the microspheres was evaluated with a scanning electron microscope and release profile. Three-dimensional cell spheroids were fabricated using silicon elastomer-based concave microwells. Qualitative results of cellular viability were seen under a confocal microscope, and quantitative cellular viability was evaluated using the Cell Counting Kit-8 assay. The alkaline phosphatase activity and Alizarin Red S staining were performed. A quantitative real-time polymerase chain reaction and a western blot analysis were performed. Spheroids were well formed irrespective of quercetin concentration. Most of the cells in spheroids emitted green fluorescence, and the morphology was round without significant changes. The application of quercetin-loaded microspheres produced a significant increase in the alkaline phosphatase activity. The real-time polymerase chain reaction results showed a significant increase in Runx2, and western blot results showed higher expression of Runx2 protein expression. Biodegradable microspheres loaded with quercetin produced prolonged release profiles with increased mineralization. Microspheres loaded with quercetin can be used for the enhancement of osteoblastic differentiation in cell therapy. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. High fluorescence emission of carboxylic acid functionalized polystyrene/BaTiO{sub 3} nanocomposites and rare earth metal complexes: Preparation and characterization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cao, X. T.; Showkat, A. M.; Wang, Z.

    2015-03-30

    Noble fluorescence nanocomposite compound based on barium titanate nanoparticles (BTO), polystyrene (PSt), and terbium ion (Tb{sup 3+}) was synthesized by a combination of surface-initiated reversible addition-fragmentation chain transfer (RAFT) polymerization, Friedel-Crafts alkylation reaction and coordinate chemistry. Initially, a modification of surface of BTO was conducted by an exchange process with S-benzyl S’-trimethoxysilylpropyltrithiocarbonate to create macro-initiator for polymerization of styrene. Subsequently, aryl carboxylic acid functionalized polystyrene grafted barium titanate (BTO-g-PSt-COOH) was generated by substitution reaction between 4-(Chloromethyl) benzoic acid and PSt chains. The coordination of the nanohybrids with Tb{sup 3+} ions afforded fluorescent Tb{sup 3+} tagged aryl carboxylic acid functionalized polystyrenemore » grafted barium titanate (BTO-g-PSt-Tb{sup 3+}) complexes. Structure, morphology, and fluorescence properties of nanohybrid complexes were investigated by respective physical and spectral studies. FT-IR and SEM analyses confirmed the formation of BTO-g-PSt-Tb{sup 3+}nanohybrids. Furthermore, TGA profiles demonstrated the grafting of aryl carboxylic acid functionalized polystyrene on BTO surface. Optical properties of BTO-g-PSt-Tb{sup 3+} complexes were investigated by fluorescence spectroscopy.« less

  2. Development and evaluation of a species diagnostic polymerase chain reaction-restriction fragment-length polymorphism procedure for cryptic members of the Culex sitiens (Diptera: Culicidae) subgroup in Australia and the southwest Pacific.

    PubMed

    Beebe, N W; van den Hurk, A F; Chapman, H F; Frances, S P; Williams, C R; Cooper, R D

    2002-03-01

    Members of the Culex sitiens subgroup are important vectors of arboviruses, including Japanese encephalitis virus, Murray Valley encephalitis virus and Ross River virus. Of the eight described species, Cx. annulirostris Skuse, Cx. sitiens Wiedemann, and Cx. palpalis Taylor appear to be the most abundant and widespread throughout northern Australia and Papua New Guinea (PNG). Recent investigations using allozymes have shown this subgroup to contain cryptic species that possess overlapping adult morphology. We report the development of a polymerase chain reaction-restriction fragment-length polymorphism (PCR-RFLP) procedure that reliably separates these three species. This procedure utilizes the sequence variation in the ribosomal DNA ITS1 and demonstrates species-specific PCR-RFLP profiles from both colony and field collected material. Assessment of the consistency of this procedure was undertaken on mosquitoes sampled from a wide geographic area including Australia, PNG, and the Solomon Islands. Overlapping adult morphology was observed for Cx. annulirostris and Cx. palpalis in both northern Queensland and PNG and for all three species at one site in northwest Queensland.

  3. 4-Chloro-7-nitrobenzo-2-oxa-1,3-diazole as a reactivity probe for the investigation of the thiol proteinases. evidence that ficin and bromelain may lack carboxyl groups conformationally equivalent to that of aspartic acid-158 of papain.

    PubMed Central

    Shipton, M; Stuchbury, T; Brocklehurst, K

    1976-01-01

    1. 4-Chloro-7-nitrobenzo-2-oxa-1,3-diazole (Nbd chloride) was used as a reactivity probe to characterize the active centres of papin (EC 3.4.22.2), ficin (EC 3.4.22.3) and bromelain (EC 3.4.22.4). 2. In the pH range 0-8 Nbd chloride probably exists mainly as a monocation, possibly with the proton located on N-1 of the oxadiazole ring. 3. Spectroscopic evidence is presented for the intermediacy of Meisenheimer-type adducts in the reaction of Nbd chloride with nucleophiles. 4. The pH-dependence of the second-order rate constants (k) of the reactions of the three enzymes with Nbd chloride was determined at 25 degrees C, I = 0.1 mol/litre in 6.7% (v/v) ethanol in the pH range 2.5-5, where, at least for papain and ficin, the reactions occur specifically with their active-centre thiol groups. The pH-k profile for the papain reaction is bell-shaped (pKaI = 3.24, pKaII = 3.44 and k = 86M(-1)-s(-1), whereas that for ficin is sigmoidal (pKa = 3.6, k = 0.36M(-1)-s(-1), the rate increasing with increasing pH. The profile for the bromelain reaction appears to resemble that for the ficin reaction, but is complicated by amino-group labelling. 5. The bell-shaped profile of the papain reaction is considered to arise from the reaction of the thiolate ion of cysteine-25, maintained in acidic media by interaction with the side chain of histidine-159, with the Nbd chloride monocation hydrogen-bonded at its nitro group to the un-ionized form of the carboxyl group of aspartic acid-158. The lack of acid catalysis in the corresponding reactions of ficin and probably of bromelain suggests that these enzymes may lack carboxyl groups conformationally equivalent to that of aspartic acid-158 of papain. The possible consequences of this for the catalytic sites of these enzymes is discussed. PMID:11778

  4. Peroxy radical detection by chemical amplification (PERCA)

    NASA Technical Reports Server (NTRS)

    Stedman, D. H.

    1986-01-01

    Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.

  5. Step Density Profiles in Localized Chains

    NASA Astrophysics Data System (ADS)

    De Roeck, Wojciech; Dhar, Abhishek; Huveneers, François; Schütz, Marius

    2017-06-01

    We consider two types of strongly disordered one-dimensional Hamiltonian systems coupled to baths (energy or particle reservoirs) at the boundaries: strongly disordered quantum spin chains and disordered classical harmonic oscillators. These systems are believed to exhibit localization, implying in particular that the conductivity decays exponentially in the chain length L. We ask however for the profile of the (very slowly) transported quantity in the steady state. We find that this profile is a step-function, jumping in the middle of the chain from the value set by the left bath to the value set by the right bath. This is confirmed by numerics on a disordered quantum spin chain of 9 spins and on much longer chains of harmonic oscillators. From theoretical arguments, we find that the width of the step grows not faster than √{L}, and we confirm this numerically for harmonic oscillators. In this case, we also observe a drastic breakdown of local equilibrium at the step, resulting in a heavily oscillating temperature profile.

  6. Arginine Coordination in Enzymatic Phosphoryl Transfer: Evaluation of the Effect of Arg166 Mutations in Escherichia Coli Alkaline Phosphatase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    O'Brien, P.J.; Lassila, J.K.; Fenn, T.D.

    2009-05-22

    Arginine residues are commonly found in the active sites of enzymes catalyzing phosphoryl transfer reactions. Numerous site-directed mutagenesis experiments establish the importance of these residues for efficient catalysis, but their role in catalysis is not clear. To examine the role of arginine residues in the phosphoryl transfer reaction, we have measured the consequences of mutations to arginine 166 in Escherichia coli alkaline phosphatase on hydrolysis of ethyl phosphate, on individual reaction steps in the hydrolysis of the covalent enzyme-phosphoryl intermediate, and on thio substitution effects. The results show that the role of the arginine side chain extends beyond its positivemore » charge, as the Arg166Lys mutant is as compromised in activity as Arg166Ser. Through measurement of individual reaction steps, we construct a free energy profile for the hydrolysis of the enzyme-phosphate intermediate. This analysis indicates that the arginine side chain strengthens binding by {approx}3 kcal/mol and provides an additional 1-2 kcal/mol stabilization of the chemical transition state. A 2.1 {angstrom} X-ray diffraction structure of Arg166Ser AP is presented, which shows little difference in enzyme structure compared to the wild-type enzyme but shows a significant reorientation of the bound phosphate. Altogether, these results support a model in which the arginine contributes to catalysis through binding interactions and through additional transition state stabilization that may arise from complementarity of the guanidinum group to the geometry of the trigonal bipyramidal transition state.« less

  7. Tangled nonlinear driven chain reactions of all optical singularities

    NASA Astrophysics Data System (ADS)

    Vasil'ev, V. I.; Soskin, M. S.

    2012-03-01

    Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

  8. Lack of Association between Polymorphisms of Hepatic Lipase with Lipid Profile in Young Jordanian Adults

    PubMed Central

    Khabour, Omar F; Alomari, Mahmoud A; Alzoubi, Karem H; Gharaibeh, Mohammad Y; Alhashimi, Farah H

    2014-01-01

    The human hepatic lipase (LIPC) gene encodes hepatic lipase, an enzyme involved in lipoprotein metabolism and regulation. Therefore, variants in LIPC gene may influence plasma lipoprotein levels. In this study, the association of LIPC C-514T and G-250A polymorphisms with plasma lipid profiles in 348 young Jordanians was investigated. Genotyping of C-514T and G-250A was performed by polymerase chain reaction and subsequent digestion with DraI and NiaIII restriction enzymes, respectively, while Roche analyzer was used to determine plasma total cholesterol, triglycerides, low-and high-density lipoprotein. The G-250 and C-514 alleles were most abundant in Jordanians with 79 and 80% frequencies, respectively. Additionally, no difference was found in the lipid–lipoprotein profile between the different genotype groups of C-514T or G-250A polymorphisms, even when males and females were examined separately (P > 0.05). In young Jordanian adults, the examined LIPC polymorphisms seem to play a limited role in determining the lipid profile. PMID:25278769

  9. Injectable hyperbranched poly(β-amino ester) hydrogels with on-demand degradation profiles to match wound healing processes.

    PubMed

    Xu, Qian; Guo, Linru; A, Sigen; Gao, Yongsheng; Zhou, Dezhong; Greiser, Udo; Creagh-Flynn, Jack; Zhang, Hong; Dong, Yixiao; Cutlar, Lara; Wang, Fagang; Liu, Wenguang; Wang, Wei; Wang, Wenxin

    2018-02-28

    Adjusting biomaterial degradation profiles to match tissue regeneration is a challenging issue. Herein, biodegradable hyperbranched poly(β-amino ester)s (HP-PBAEs) were designed and synthesized via "A2 + B4" Michael addition polymerization, and displayed fast gelation with thiolated hyaluronic acid (HA-SH) via a "click" thiol-ene reaction. HP-PBAE/HA-SH hydrogels showed tunable degradation profiles both in vitro and in vivo using diamines with different alkyl chain lengths and poly(ethylene glycol) diacrylates with varied PEG spacers. The hydrogels with optimized degradation profiles encapsulating ADSCs were used as injectable hydrogels to treat two different types of humanized excisional wounds - acute wounds with faster healing rates and diabetic wounds with slower healing and neo-tissue formation. The fast-degrading hydrogel showed accelerated wound closure in acute wounds, while the slow-degrading hydrogel showed better wound healing for diabetic wounds. The results demonstrate that the new HP-PBAE-based hydrogel in combination with ADSCs can be used as a well-controlled biodegradable skin substitute, which demonstrates a promising approach in the treatment of various types of skin wounds.

  10. Biofilms and Antifungal Susceptibility Testing.

    PubMed

    Simitsopoulou, Maria; Chatzimoschou, Athanasios; Roilides, Emmanuel

    2016-01-01

    Yeasts and filamentous fungi both exist as single cells and hyphal forms, two morphologies used by most fungal organisms to create a complex multilayered biofilm structure. In this chapter we describe the most widely used assays for the determination of biofilm production and assessment of susceptibility of biofilms to antifungal agents or host phagocytes as various methods, the most frequent of which are staining, confocal laser scanning microscopy, quantification of extracellular DNA and protein associated with extracellular matrix and XTT metabolic reduction assay. Pathway-focused biofilm gene expression profiling is assessed by real-time reverse transcriptase polymerase chain reaction.

  11. Methylation-sensitive amplified polymorphism-based genome-wide analysis of cytosine methylation profiles in Nicotiana tabacum cultivars.

    PubMed

    Jiao, J; Wu, J; Lv, Z; Sun, C; Gao, L; Yan, X; Cui, L; Tang, Z; Yan, B; Jia, Y

    2015-11-26

    This study aimed to investigate cytosine methylation profiles in different tobacco (Nicotiana tabacum) cultivars grown in China. Methylation-sensitive amplified polymorphism was used to analyze genome-wide global methylation profiles in four tobacco cultivars (Yunyan 85, NC89, K326, and Yunyan 87). Amplicons with methylated C motifs were cloned by reamplified polymerase chain reaction, sequenced, and analyzed. The results show that geographical location had a greater effect on methylation patterns in the tobacco genome than did sampling time. Analysis of the CG dinucleotide distribution in methylation-sensitive polymorphic restriction fragments suggested that a CpG dinucleotide cluster-enriched area is a possible site of cytosine methylation in the tobacco genome. The sequence alignments of the Nia1 gene (that encodes nitrate reductase) in Yunyan 87 in different regions indicate that a C-T transition might be responsible for the tobacco phenotype. T-C nucleotide replacement might also be responsible for the tobacco phenotype and may be influenced by geographical location.

  12. The Potential of Cosmetic Applicators as a Source of DNA for Forensic Analysis.

    PubMed

    Adamowicz, Michael S; Labonte, Renáe D; Schienman, John E

    2015-07-01

    Personal products, such as toothbrushes, have been used as both known reference and evidentiary samples for forensic DNA analysis. This study examined the viability of a broad selection of cosmetic applicators for use as targets for human DNA extraction and short tandem repeat (STR) analysis using standard polymerase chain reaction (PCR) conditions. Applicator types included eyeliner smudgers, pencils and crayons, eye shadow sponges, mascara wands, concealer wands, face makeup sponges, pads and brushes, lipsticks and balms, and lip gloss wands. The quantity and quality of DNA extracted from each type of applicator were examined by assessing the number of loci successfully amplified and the peak balance of the heterozygous alleles in each full STR profile. While degraded DNA, stochastic amplification, and PCR inhibition were observed for some items, full STR profiles were developed for 14 of 76 applicators. The face makeup sponge applicators yielded the highest proportional number of full STR profiles (4/7). © 2015 American Academy of Forensic Sciences.

  13. Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

    PubMed

    Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

    2018-06-01

    Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

  14. Topological dynamics of optical singularities in speckle-fields induced by photorefractive scattering in a LiNbO{sub 3} : Fe crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vasil'ev, Vasilii I; Soskin, M S

    2013-02-28

    A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less

  15. Highly efficient and selective pressure-assisted photon-induced polymerization of styrene

    NASA Astrophysics Data System (ADS)

    Guan, Jiwen; Song, Yang

    2016-06-01

    The polymerization process of condensed styrene to produce polystyrene as an industrially important polymeric material was investigated using a novel approach by combining external compression with ultraviolet radiation. The reaction evolution was monitored as a function of time and the reaction products were characterized by in situ Fourier transform infrared spectroscopy. By optimizing the loading pressures, we observed highly efficient and selective production of polystyrene of different tacticities. Specifically, at relatively low loading pressures, infrared spectra suggest that styrene monomers transform to amorphous atactic polystyrene (APS) with minor crystalline isotactic polystyrene. In contrast, APS was found to be the sole product when polymerization occurs at relatively higher loading pressures. The time-dependent reaction profiles allow the examination of the polymerization kinetics by analyzing the rate constant and activation volume as a function of pressure. As a result, an optimized pressure condition, which allows a barrierless reaction to proceed, was identified and attributed to the very desirable reaction yield and kinetics. Finally, the photoinitiated reaction mechanism and the growth geometry of the polymer chains were investigated from the energy diagram of styrene and by the topology analysis of the crystal styrene. This study shows strong promise to produce functional polymeric materials in a highly efficient and controlled manner.

  16. Fundamental Reaction Pathway and Free Energy Profile for Butyrylcholinesterase-Catalyzed Hydrolysis of Heroin

    PubMed Central

    Qiao, Yan; Han, Keli; Zhan, Chang-Guo

    2013-01-01

    The pharmacological function of heroin requires an activation process which transforms heroin into 6-monoacetylmorphine (6-MAM) which is the most active form. The primary enzyme responsible for this activation process in human plasma is butyrylcholinesterase (BChE). The detailed reaction pathway of the activation process via BChE-catalyzed hydrolysis has been explored computationally, for the first time, in the present study by performing molecular dynamics simulation and first-principles quantum mechanical/molecular mechanical free energy calculations. It has been demonstrated that the whole reaction process includes acylation and deacylation stages. The acylation consists of two reaction steps, i.e. the nucleophilic attack on the carbonyl carbon of 3-acetyl group of heroin by the hydroxyl oxygen of Ser198 side chain and the dissociation of 6-MAM. The deacylation also consists of two reaction steps, i.e. the nucleophilic attack on the carbonyl carbon of the acyl-enzyme intermediate by a water molecule and the dissociation of the acetic acid from Ser198. The calculated free energy profile reveals that the second transition state (TS2) should be rate-determining. The structural analysis reveals that the oxyanion hole of BChE plays an important role in the stabilization of the rate-determining transition state TS2. The free energy barrier (15.9±0.2 or 16.1±0.2 kcal/mol) calculated for the rate-determining step is in good agreement with the experimentally-derived activation free energy (~16.2 kcal/mol), suggesting that the mechanistic insights obtained from the present computational study are reliable. The obtained structural and mechanistic insights could be valuable for use in future rational design of a novel therapeutic treatment of heroin abuse. PMID:23992153

  17. Acetylene chain reaction on hydrogenated boron nitride monolayers: a density functional theory study.

    PubMed

    Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru

    2017-11-28

    Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.

  18. Measurement of indicator genes using global complementary DNA (cDNA) amplification, by polyadenylic acid reverse transcriptase polymerase chain reaction (poly A RT-PCR): A feasibility study using paired samples from tissue and ductal juice in patients undergoing pancreatoduodenectomy.

    PubMed

    Sanyal, Sudip; Siriwardena, Ajith K; Byers, Richard

    2018-06-01

    The aim of this study is to compare gene expression profiles in RNA isolated from pancreatic ductal juice with the RNA expression profiles of the same genes from matched intra-operative tissue samples from pancreatic tumours. Intra-operative sampling of pancreatic juice and collection of matched tissue samples was undertaken in patients undergoing pancreatoduodenectomy for clinically suspected pancreatic cancer and a precursor lesion, main-duct intraductal papillary mucinous neoplasm. RNA was isolated and Poly A PCR was used to globally amplify the RNA. Real-time polymerase chain reaction (RT-PCR) was used to measure expression levels of 17 genes selected from microarray studies. Spearman's rank correlation test was used to examine the relationship of gene expression between pancreatic juice and tissue. The study was approved by Regional Ethics Committee. Mesothelin (MSLN) showed significant correlation (p < 0.008) in expression levels between paired pancreatic juice and tissue samples in pancreas cancer. In intraductal papillary mucinous neoplasms (IPMN), Matrix Metalloproteinase 7 (MMP7), showed significant correlation (p < 0.01) in the expression levels between paired pancreatic juice and tissue samples. This study confirms that RNA analysis of paired pancreatic juice and tissue samples and establishment of cDNA using poly A PCR is technically feasible. Application of the technique to non-invasively obtained pancreatic juice during endoscopic assessment of tumours and the use of gene arrays of cancer indicator genes are the next steps in development of this technique. Copyright © 2018 IAP and EPC. Published by Elsevier B.V. All rights reserved.

  19. Use of Artificial Intelligence and Machine Learning Algorithms with Gene Expression Profiling to Predict Recurrent Nonmuscle Invasive Urothelial Carcinoma of the Bladder.

    PubMed

    Bartsch, Georg; Mitra, Anirban P; Mitra, Sheetal A; Almal, Arpit A; Steven, Kenneth E; Skinner, Donald G; Fry, David W; Lenehan, Peter F; Worzel, William P; Cote, Richard J

    2016-02-01

    Due to the high recurrence risk of nonmuscle invasive urothelial carcinoma it is crucial to distinguish patients at high risk from those with indolent disease. In this study we used a machine learning algorithm to identify the genes in patients with nonmuscle invasive urothelial carcinoma at initial presentation that were most predictive of recurrence. We used the genes in a molecular signature to predict recurrence risk within 5 years after transurethral resection of bladder tumor. Whole genome profiling was performed on 112 frozen nonmuscle invasive urothelial carcinoma specimens obtained at first presentation on Human WG-6 BeadChips (Illumina®). A genetic programming algorithm was applied to evolve classifier mathematical models for outcome prediction. Cross-validation based resampling and gene use frequencies were used to identify the most prognostic genes, which were combined into rules used in a voting algorithm to predict the sample target class. Key genes were validated by quantitative polymerase chain reaction. The classifier set included 21 genes that predicted recurrence. Quantitative polymerase chain reaction was done for these genes in a subset of 100 patients. A 5-gene combined rule incorporating a voting algorithm yielded 77% sensitivity and 85% specificity to predict recurrence in the training set, and 69% and 62%, respectively, in the test set. A singular 3-gene rule was constructed that predicted recurrence with 80% sensitivity and 90% specificity in the training set, and 71% and 67%, respectively, in the test set. Using primary nonmuscle invasive urothelial carcinoma from initial occurrences genetic programming identified transcripts in reproducible fashion, which were predictive of recurrence. These findings could potentially impact nonmuscle invasive urothelial carcinoma management. Copyright © 2016 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  20. Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay.

    PubMed

    Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B

    2004-01-01

    Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.

  1. Regulator of calcineurin 1 controls growth plasticity of adult pancreas.

    PubMed

    Gurda, Grzegorz T; Crozier, Stephen J; Ji, Baoan; Ernst, Stephen A; Logsdon, Craig D; Rothermel, Beverly A; Williams, John A

    2010-08-01

    Growth of exocrine pancreas is regulated by gastrointestinal hormones, notably cholecystokinin (CCK). CCK-driven pancreatic growth requires calcineurin (CN), which activates Nuclear Factor of Activated T cells (NFATs), but the genetic underpinnings and feedback mechanisms that regulate this response are not known. Pancreatic growth was stimulated by protease inhibitor (PI)-containing chow, which induces secretion of endogenous CCK. Expression profiling of PI stimulation was performed on Affymetrix 430A chips, and CN was inhibited via FK506. Exocrine pancreas-specific overexpression of CN inhibitor Regulator of Calcineurin 1 (Rcan1) was achieved by breeding elastase-Cre(estrogen receptor [ER]) transgenics with "flox-on" Rcan1 mice. CN inhibitor FK506 blocked expression of 38 genes, as confirmed by quantitative polymerase chain reaction. The CN-dependent genes were linked to growth-related processes, whereas their promoters were enriched in NFAT and NFAT/AP1 sites. Multiple NFAT targets, including Rcan1, Rgs2, HB-EGF, Lif, and Gem, were validated by chromatin immunoprecipitation. One of these, a CN feedback inhibitor Rcan1, was induced >50 fold during 1-8 hours course of pancreatic growth and strongly inhibited (>99%) by FK506. To examine its role in pancreatic growth, we overexpressed Rcan1 in an inducible, acinar-specific fashion. Rcan1 overexpression inhibited CN-NFAT signaling, as shown using an NFAT-luciferase reporter and quantitative polymerase chain reaction. Most importantly, the increase in exocrine pancreas size, protein/DNA content, and acinar proliferation were all blocked in Rcan1 overexpressing mice. We profile adaptive pancreatic growth, identify Rcan1 as an important new feedback regulator, and firmly establish that CN-NFAT signaling is required for this response. Copyright (c) 2010 AGA Institute. Published by Elsevier Inc. All rights reserved.

  2. Human adipose-derived mesenchymal stromal cell pigment epithelium-derived factor cytotherapy modifies genetic and epigenetic profiles of prostate cancer cells.

    PubMed

    Zolochevska, Olga; Shearer, Joseph; Ellis, Jayne; Fokina, Valentina; Shah, Forum; Gimble, Jeffrey M; Figueiredo, Marxa L

    2014-03-01

    Adipose-derived mesenchymal stromal cells (ASCs) are promising tools for delivery of cytotherapy against cancer. However, ASCs can exert profound effects on biological behavior of tumor cells. Our study aimed to examine the influence of ASCs on gene expression and epigenetic methylation profiles of prostate cancer cells as well as the impact of expressing a therapeutic gene on modifying the interaction between ASCs and prostate cancer cells. ASCs were modified by lentiviral transduction to express either green fluorescent protein as a control or pigment epithelium-derived factor (PEDF) as a therapeutic molecule. PC3 prostate cancer cells were cultured in the presence of ASC culture-conditioned media (CCM), and effects on PC3 or DU145. Ras cells were examined by means of real-time quantitative polymerase chain reaction, EpiTect methyl prostate cancer-focused real-time quantitative polymerase chain reaction arrays, and luciferase reporter assays. ASCs transduced with lentiviral vectors were able to mediate expression of several tumor-inhibitory genes, some of which correlated with epigenetic methylation changes on cocultured PC3 prostate cancer cells. When PC3 cells were cultured with ASC-PEDF CCM, we observed a shift in the balance of gene expression toward tumor inhibition, which suggests that PEDF reduces the potential tumor-promoting activity of unmodified ASCs. These results suggest that ASC-PEDF CCM can promote reprogramming of tumor cells in a paracrine manner. An improved understanding of genetic and epigenetic events in prostate cancer growth in response to PEDF paracrine therapy would enable a more effective use of ASC-PEDF, with the goal of achieving safer yet more potent anti-tumor effects. Copyright © 2014 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  3. Development and Validation of a 3-Dimensional CFB Furnace Model

    NASA Astrophysics Data System (ADS)

    Vepsäläinen, Arl; Myöhänen, Karl; Hyppäneni, Timo; Leino, Timo; Tourunen, Antti

    At Foster Wheeler, a three-dimensional CFB furnace model is essential part of knowledge development of CFB furnace process regarding solid mixing, combustion, emission formation and heat transfer. Results of laboratory and pilot scale phenomenon research are utilized in development of sub-models. Analyses of field-test results in industrial-scale CFB boilers including furnace profile measurements are simultaneously carried out with development of 3-dimensional process modeling, which provides a chain of knowledge that is utilized as feedback for phenomenon research. Knowledge gathered by model validation studies and up-to-date parameter databases are utilized in performance prediction and design development of CFB boiler furnaces. This paper reports recent development steps related to modeling of combustion and formation of char and volatiles of various fuel types in CFB conditions. Also a new model for predicting the formation of nitrogen oxides is presented. Validation of mixing and combustion parameters for solids and gases are based on test balances at several large-scale CFB boilers combusting coal, peat and bio-fuels. Field-tests including lateral and vertical furnace profile measurements and characterization of solid materials provides a window for characterization of fuel specific mixing and combustion behavior in CFB furnace at different loads and operation conditions. Measured horizontal gas profiles are projection of balance between fuel mixing and reactions at lower part of furnace and are used together with both lateral temperature profiles at bed and upper parts of furnace for determination of solid mixing and combustion model parameters. Modeling of char and volatile based formation of NO profiles is followed by analysis of oxidizing and reducing regions formed due lower furnace design and mixing characteristics of fuel and combustion airs effecting to formation ofNO furnace profile by reduction and volatile-nitrogen reactions. This paper presents CFB process analysis focused on combustion and NO profiles in pilot and industrial scale bituminous coal combustion.

  4. Supplement to Theory of Neutron Chain Reactions

    DOE R&D Accomplishments Database

    Weinberg, Alvin M.; Noderer, L. C.

    1952-05-26

    General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

  5. Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

    PubMed

    Zhou, Yu; Pearson, John E; Auerbach, Anthony

    2005-12-01

    We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

  6. Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

    PubMed

    Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

    2017-11-01

    Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

  7. An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.

    PubMed

    Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján

    2016-02-20

    In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Transcription Analysis of the Beta-Glucosidase Precursor in Wild-Type and l-4i Mutant Bombyx mori (Lepidoptera: Bombycidae).

    PubMed

    Kang, Lequn; Huang, Fei; Wu, Fan; Zhao, Qiaoling

    2015-01-01

    Lethal fourth-instar larvae (l-4i) mutant of Bombyx mori, a recently discovered novel mutant, die from energy depletion due to genetic mutation. Beta-glucosidase is a common digestive enzyme that hydrolyzes cellulose in the diet to provide energy. In this study, the mRNA expression profiles of B. mori beta-glucosidase precursor (BmpreBG) were characterized by reverse transcription polymerase chain reaction and quantitative real-time polymerase chain reaction. The transcription level of BmpreBG varied in different tissues and developmental stages, except in the pupa and moth, which are the no-diet period. Remarkably, the mRNA expression level of BmpreBG was sharply reduced in l-4i but not in the wild type, which suggested that the digestive function of the mutant was severely damaged. This was consistent with the l-4i phenotypic traits of not eating mulberries, lack of energy, and ultimate death. 5'-rapid amplification of cDNA ends showed, for the first time, that BmpreBG has a 160-bp 5'-untranslated region. These findings suggested that B. mori β-glucosidase precursor was involved in the death process of l-4i mutant larvae. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

  9. Determination of haemolytic and non haemolytic genes profiles of Bacillus cereus strains isolated from food samples by polymerase chain reaction (pcr) technique

    NASA Astrophysics Data System (ADS)

    Jawad, Nisreen; Ahemd, Asmat; Abdullah, Aminah

    2018-04-01

    The aim of this study was to investigate the presence of Bacillus cereus and detection of enterotoxigenic genes in food samples by utilizing a Polymerase Chain Reaction technique (PCR). In this study the providence of B. cereus was carried out to food samples. The B. cereus isolates were investigated for enterotoxigenic gene. The cooked seafood, and raw milk samples were purchased from several restaurants and market in the area of (Bangi, Kajang, Serdang and UKM) Selangor, Malaysia. A total of 60 samples have been analyzed. B. cereus contamination has been formed between 1.4×105 - 3×105 cfu/mL of cooked seafood and raw milk samples. Five colonies have been detected as B. cereus using biochemical test. All B. cereus isolates named BC1 to BC27, were characterized for haemolytic enterotoxin (HBL) complex encoding genes (hblA), non-haemolytic enterotoxin encoding gene (NheA). 10 isolates have been reported to be positive towards hblA and 12 isolates were positive towards NheA. The presence of B. cereus and their enterotoxigenic genes in cooked seafood and raw milk from to food samples obtained may pose a potential risk for public health.

  10. Bacterial analysis of combined periodontal-endodontic lesions by polymerase chain reaction-denaturing gradient gel electrophoresis.

    PubMed

    Xia, Minghui; Qi, Qingguo

    2013-01-01

    We used denaturing gradient gel electrophoresis (DGGE) to compare bacterial profiles in periodontium and root canals of teeth with combined periodontal-endodontic lesions. Samples of dental plaque and necrotic pulp were collected from thirteen extracted teeth with advanced periodontitis. Genomic DNA was extracted for polymerase chain reaction (PCR) analysis using universal bacterial primers. The PCR products were then loaded onto DGGE gels to obtain fractionated bands. Characteristic DGGE bands were excised and DNA was cloned and sequenced. The number of bands, which indicates the number of bacterial species, was compared between dental plaques and necrotic pulp tissues from the same tooth. Although the difference was statistically significant (P < 0.01), there was no positive correlation; similarity (Dice coefficient) was 13.1% to 62.5%. Some bacteria species were present in both the periodontal pockets and root canals of the same tooth; however, periodontal bacteria did not always invade the root canals, and some bacteria in root canals were not present in periodontal pockets of the same tooth. In some teeth, unique bacteria in root canals had not passed from periodontal pockets. A basic local alignment search tool (BLAST) sequence search in Genbank indicated that new bacteria species were present in periodontal pockets and root canals. Their characteristics must thus be further analyzed.

  11. Regulation of Lipid Metabolism by Dicer Revealed through SILAC Mice

    PubMed Central

    Huang, Tai-Chung; Saharabuddhe, Nandini A.; Kim, Min-Sik; Getnet, Derese; Yang, Yi; Peterson, Jonathan M.; Ghosh, Bidyut; Chaerkady, Raghothama; Leach, Steven D.; Marchionni, Luigi; Wong, G. William; Pandey, Akhilesh

    2012-01-01

    Dicer is a ribonuclease whose major role is to generate mature microRNAs although additional functions have been proposed. Deletion of Dicer leads to embryonic lethality in mice. To study the role of Dicer in adults, we generated mice in which administration of tamoxifen induces deletion of Dicer. Surprisingly, disruption of Dicer in adult mice induced lipid accumulation in the small intestine. To dissect the underlying mechanisms, we carried out miRNA, mRNA and proteomic profiling of small intestine. The proteomic analysis was done using mice metabolically labeled with heavy lysine (SILAC mice) for an in vivo readout. We identified 646 proteins of which 80 were upregulated >2-fold and 75 were downregulated. Consistent with the accumulation of lipids, Dicer disruption caused a marked decrease of microsomal triglyceride transfer protein, long-chain fatty acyl-CoA ligase 5, fatty acid binding protein, and very-long-chain fatty acyl-CoA dehydrogenase, among others. We validated these results using multiple reaction monitoring (MRM) experiments by targeting proteotypic peptides. Our data reveal a previously unappreciated role of Dicer in lipid metabolism. These studies demonstrate a systems biology approach by integrating mouse models, metabolic labeling, gene expression profiling and quantitative proteomics can be a powerful tool for understanding complex biological systems. PMID:22313051

  12. Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

    PubMed

    Umamaheswari, A; Venkateswarlu, K

    2004-06-01

    Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

  13. Comparison of camelpox viruses isolated in Dubai.

    PubMed

    Pfeffer, M; Meyer, H; Wernery, U; Kaaden, O R

    1996-03-01

    Between October 1993 and March 1994, outbreaks of pox-like exanthemas were observed in several camel raising farms in Dubai. Scabs from twenty camels with either local or generalized lesions were examined, seven of them had previously been vaccinated with a modified live camelpox virus vaccine. Inspection of scabs by electron microscopy confirmed an infection with orthopox viruses (OPV) in 10 animals and with parapox virus in one camel. Investigation of the scabs by polymerase chain reaction and dot blot assay revealed the presence of OPV in 15 or 13 samples, respectively. OPV could be isolated in cell culture in 14 cases. Restriction enzyme profiles characterized all isolates as camelpox virus. Their DNA patterns were virtually identical displaying only slight variations in the terminal fragments. In contrast, the vaccine strain showed a distinct restriction enzyme profile, indicating that it was not involved in the infections.

  14. Differentially displayed expressed sequence tags in Melipona scutellaris (Hymenoptera, Apidae, Meliponini) development.

    PubMed

    Santana, Flávia A; Nunes, Francis M F; Vieira, Carlos U; Machado, Maria Alice M S; Kerr, Warwick E; Silva, Wilson A; Bonetti, Ana Maria

    2006-03-01

    We have compared gene expression, using the Differential Display Reverse Transcriptase-Polymerase Chain Reaction (DDRT-PCR) technique, by means of mRNA profile in Melipona scutellaris during ontogenetic postembryonic development, in adult worker, and in both Natural and Juvenile Hormone III-induced adult queen. Six, out of the nine ESTs described here, presented differentially expressed in the phases L1 or L2, or even in both of them, suggesting that key mechanisms to the development of Melipona scutellaris are regulated in these stages. The combination HT11G-AP05 revealed in L1 and L2 a product which matches to thioredoxin reductase protein domain in the Clostridium sporogenes, an important protein during cellular oxidoreduction processes. This study represents the first molecular evidence of differential gene expression profiles toward a description of the genetic developmental traits in the genus Melipona.

  15. Isolation, sequence identification and tissue expression profiles of 3 novel porcine genes: ASPA, NAGA, and HEXA.

    PubMed

    Shu, Xianghua; Liu, Yonggang; Yang, Liangyu; Song, Chunlian; Hou, Jiafa

    2008-01-01

    The complete coding sequences of 3 porcine genes - ASPA, NAGA, and HEXA - were amplified by the reverse transcriptase polymerase chain reaction (RT-PCR) based on the conserved sequence information of the mouse or other mammals and referenced pig ESTs. These 3 novel porcine genes were then deposited in the NCBI database and assigned GeneIDs: 100142661, 100142664 and 100142667. The phylogenetic tree analysis revealed that the porcine ASPA, NAGA, and HEXA all have closer genetic relationships with the ASPA, NAGA, and HEXA of cattle. Tissue expression profile analysis was also carried out and results revealed that swine ASPA, NAGA, and HEXA genes were differentially expressed in various organs, including skeletal muscle, the heart, liver, fat, kidney, lung, and small and large intestines. Our experiment is the first one to establish the foundation for further research on these 3 swine genes.

  16. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  17. The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

    PubMed

    Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

    2006-07-01

    We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

  18. Metabolite Profiling of Candidatus Liberibacter Infection in Hamlin Sweet Oranges.

    PubMed

    Hung, Wei-Lun; Wang, Yu

    2018-04-18

    Huanglongbing (HLB), also known as citrus greening disease, caused by Candidatus Liberibacter asiaticus (CLas), is considered the most serious citrus disease in the world. CLas infection has been shown to greatly affect metabolite profiles in citrus fruits. However, because of uneven distribution of CLas throughout the tree and a minimum bacterial titer requirement for polymerase chain reaction (PCR) detection, the infected trees may test false negative. To prevent this, metabolites of healthy Hamlin oranges (CLas-) obtained from the citrus undercover protection systems (CUPS) were investigated. Comparison of the metabolite profile of juice obtained from CLas- and CLas+ (asymptomatic and symptomatic) trees revealed significant differences in both volatile and nonvolatile metabolites. However, no consistent pattern could be observed in alcohols, esters, sesquiterpenes, sugars, flavanones, and limonoids as compared to previous studies. These results suggest that CLas may affect metabolite profiles of citrus fruits earlier than detecting infection by PCR. Citric acid, nobiletin, malic acid, and phenylalanine were identified as the metabolic biomarkers associated with the progression of HLB. Thus, the differential metabolites found in this study may serve as the biomarkers of HLB in its early stage, and the metabolite signature of CLas infection may provide useful information for developing a potential treatment strategy.

  19. Kerosene combustion at pressures up to 40 atm: Experimental study and detailed chemical kinetic modeling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dagaut, P.; Reuillon, M.; Boettner, J.C.

    1994-12-31

    The oxidation of TR0 kerosene (jet A1 aviation fuel) was studied in a jet-stirred reactor (JSR) at pressures extending from 10 to 40 atm, in the temperature range 750--1,150 K. A large number of reaction intermediates were identified, and their concentrations were followed for reaction yields ranging from low conversion to the formation of the final products. A reference hydrocarbon, n-decane, studied under the same experimental conditions gave very similar experimental concentration profiles for the main oxidation products. Because of the strong analogy between n-decane and kerosene oxidation kinetics, a detailed chemical kinetic reaction mechanisms describing the oxidation of n-decanemore » was built to reproduce the present experimental results. This mechanisms includes 573 elementary reactions, most of them being reversible, among 90 chemical species. A reasonably good prediction of the concentrations of major species was obtained by computation, covering the whole range of temperature, pressures, and equivalence ratios of the experiments. A kinetic analysis performed to identify the dominant reaction steps of the mechanism shows that, under the conditions of the present study (intermediate temperature and high pressure), HO{sub 2} radicals are important chain carriers leading to the formation of the branching agent H{sub 2}O{sub 2}.« less

  20. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  1. Inference of reaction rate parameters based on summary statistics from experiments

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khalil, Mohammad; Chowdhary, Kamaljit Singh; Safta, Cosmin

    Here, we present the results of an application of Bayesian inference and maximum entropy methods for the estimation of the joint probability density for the Arrhenius rate para meters of the rate coefficient of the H 2/O 2-mechanism chain branching reaction H + O 2 → OH + O. Available published data is in the form of summary statistics in terms of nominal values and error bars of the rate coefficient of this reaction at a number of temperature values obtained from shock-tube experiments. Our approach relies on generating data, in this case OH concentration profiles, consistent with the givenmore » summary statistics, using Approximate Bayesian Computation methods and a Markov Chain Monte Carlo procedure. The approach permits the forward propagation of parametric uncertainty through the computational model in a manner that is consistent with the published statistics. A consensus joint posterior on the parameters is obtained by pooling the posterior parameter densities given each consistent data set. To expedite this process, we construct efficient surrogates for the OH concentration using a combination of Pad'e and polynomial approximants. These surrogate models adequately represent forward model observables and their dependence on input parameters and are computationally efficient to allow their use in the Bayesian inference procedure. We also utilize Gauss-Hermite quadrature with Gaussian proposal probability density functions for moment computation resulting in orders of magnitude speedup in data likelihood evaluation. Despite the strong non-linearity in the model, the consistent data sets all res ult in nearly Gaussian conditional parameter probability density functions. The technique also accounts for nuisance parameters in the form of Arrhenius parameters of other rate coefficients with prescribed uncertainty. The resulting pooled parameter probability density function is propagated through stoichiometric hydrogen-air auto-ignition computations to illustrate the need to account for correlation among the Arrhenius rate parameters of one reaction and across rate parameters of different reactions.« less

  2. Inference of reaction rate parameters based on summary statistics from experiments

    DOE PAGES

    Khalil, Mohammad; Chowdhary, Kamaljit Singh; Safta, Cosmin; ...

    2016-10-15

    Here, we present the results of an application of Bayesian inference and maximum entropy methods for the estimation of the joint probability density for the Arrhenius rate para meters of the rate coefficient of the H 2/O 2-mechanism chain branching reaction H + O 2 → OH + O. Available published data is in the form of summary statistics in terms of nominal values and error bars of the rate coefficient of this reaction at a number of temperature values obtained from shock-tube experiments. Our approach relies on generating data, in this case OH concentration profiles, consistent with the givenmore » summary statistics, using Approximate Bayesian Computation methods and a Markov Chain Monte Carlo procedure. The approach permits the forward propagation of parametric uncertainty through the computational model in a manner that is consistent with the published statistics. A consensus joint posterior on the parameters is obtained by pooling the posterior parameter densities given each consistent data set. To expedite this process, we construct efficient surrogates for the OH concentration using a combination of Pad'e and polynomial approximants. These surrogate models adequately represent forward model observables and their dependence on input parameters and are computationally efficient to allow their use in the Bayesian inference procedure. We also utilize Gauss-Hermite quadrature with Gaussian proposal probability density functions for moment computation resulting in orders of magnitude speedup in data likelihood evaluation. Despite the strong non-linearity in the model, the consistent data sets all res ult in nearly Gaussian conditional parameter probability density functions. The technique also accounts for nuisance parameters in the form of Arrhenius parameters of other rate coefficients with prescribed uncertainty. The resulting pooled parameter probability density function is propagated through stoichiometric hydrogen-air auto-ignition computations to illustrate the need to account for correlation among the Arrhenius rate parameters of one reaction and across rate parameters of different reactions.« less

  3. Dynamics and control of DNA sequence amplification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marimuthu, Karthikeyan; Chakrabarti, Raj, E-mail: raj@pmc-group.com, E-mail: rajc@andrew.cmu.edu; Division of Fundamental Research, PMC Advanced Technology, Mount Laurel, New Jersey 08054

    2014-10-28

    DNA amplification is the process of replication of a specified DNA sequence in vitro through time-dependent manipulation of its external environment. A theoretical framework for determination of the optimal dynamic operating conditions of DNA amplification reactions, for any specified amplification objective, is presented based on first-principles biophysical modeling and control theory. Amplification of DNA is formulated as a problem in control theory with optimal solutions that can differ considerably from strategies typically used in practice. Using the Polymerase Chain Reaction as an example, sequence-dependent biophysical models for DNA amplification are cast as control systems, wherein the dynamics of the reactionmore » are controlled by a manipulated input variable. Using these control systems, we demonstrate that there exists an optimal temperature cycling strategy for geometric amplification of any DNA sequence and formulate optimal control problems that can be used to derive the optimal temperature profile. Strategies for the optimal synthesis of the DNA amplification control trajectory are proposed. Analogous methods can be used to formulate control problems for more advanced amplification objectives corresponding to the design of new types of DNA amplification reactions.« less

  4. Non-small cell lung cancer detection using microRNA expression profiling of bronchoalveolar lavage fluid and sputum.

    PubMed

    Kim, Julian O; Gazala, Sayf; Razzak, Rene; Guo, Linghong; Ghosh, Sunita; Roa, Wilson H; Bédard, Eric L R

    2015-04-01

    To assess if miRNA expression profiling of bronchoalveolar lavage (BAL) fluid and sputum could be used to detect early-stage non-small cell lung cancer (NSCLC). Hierarchical cluster analysis was performed on the expression levels of 5 miRNAs (miR-21, miR-143, miR-155, miR-210, and miR-372) which were quantified using RNA reverse transcription and quantitative real-time polymerase chain reaction in sputum and BAL samples from NSCLC cases and cancer-free controls. Cluster analysis of the miRNA expression levels in BAL samples from 21 NSCLC cases and sputum samples from 10 cancer-free controls yielded a diagnostic sensitivity of 85.7% and specificity of 100%. Cluster analysis of sputum samples from the same patients yielded a diagnostic sensitivity of 67.8% and specificity of 90%. miRNA expression profiling of sputum and BAL fluids represent a potential means to detect early-stage NSCLC. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  5. Analysis of the miRNA Profiles of Melanoma Exosomes Derived Under Normoxic and Hypoxic Culture Conditions.

    PubMed

    Wozniak, Michal; Peczek, Lukasz; Czernek, Liliana; Düchler, Markus

    2017-12-01

    MicroRNAs (miRNAs) transported in melanoma-derived exosomes function as intercellular messengers supporting tumor survival and progression. Hypoxia increases melanoma phenotypic plasticity, drug resistance, and metastasis. We determined the miRNA profiles in exosomes derived from melanoma cells grown under hypoxic and normoxic conditions by microarray analyses and reverse transcription-polymerase chain reaction (RT-PCR) in order to analyze the potential influence of vesicle-transported miRNAs on cancer-related pathways and transcriptional programs. Despite phenotypical differences of the four cell lines used, their exosomes shared the majority of miRNAs. The levels of three miRNAs were higher in normoxic exosomes, whereas 15 miRNAs were significantly more abundant under hypoxic conditions. Pathway analysis pointed at several cellular processes contributing to proliferation, drug resistance, and modification of the tumor microenvironment, including immunosuppression. The miRNA-expression profiles of exosomes from patient-derived melanoma cells are modified by oxygen concentration and reflect the phenotypic changes of melanoma cells under different growth conditions. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  6. Bulk soil and rhizosphere bacterial community PCR-DGGE profiles and beta-galactosidase activity as indicators of biological quality in soils contaminated by heavy metals and cultivated with Silene vulgaris (Moench) Garcke.

    PubMed

    Martínez-Iñigo, M J; Pérez-Sanz, A; Ortiz, I; Alonso, J; Alarcón, R; García, P; Lobo, M C

    2009-06-01

    The biological quality of two heavy metal contaminated soils (soil C: Typic Calcixerept, pH 8.3 and soil H: Typic Haploxeraf, pH 7.3) was investigated after growing the metal-tolerant plant Silene vulgaris (Moench) Garcke for two vegetative periods. The activity of the enzyme beta-galactosidase, which is sensitive to the presence of contaminants in soil, and the polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) profiles of 16S rRNA gene fragments of culturable bacteria from bulk soil and rhizosphere were determined. The microbial enzymatic activity was higher in planted soils than in bare soils at the contamination level of 600 mg of total heavy metals kg(-1) soil. After growing S. vulgaris, beta-galactosidase activity was almost recovered in the calcareous soil. In this soil new bands appeared in the PCR-DGGE profiles of the rhizosphere bacterial community as a response to the exposure to heavy metals.

  7. The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

    2013-06-28

    Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

  8. Control and reduction of peak temperature in self-curing resins.

    PubMed

    Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A

    2009-07-01

    INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.

  9. Modeling competitive substitution in a polyelectrolyte complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu

    2015-12-28

    We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less

  10. Expression profiles of antimicrobial peptides (AMPs) and their regulation by Relish

    NASA Astrophysics Data System (ADS)

    Wang, Dongdong; Li, Fuhua; Li, Shihao; Wen, Rong; Xiang, Jianhai

    2012-07-01

    Antimicrobial peptides (AMPs), as key immune effectors, play important roles in the innate immune system of invertebrates. Different types of AMPs, including Penaeidin, Crustin, ALF (antilipopolysaccharide factor) have been identified in different penaeid shrimp; however, systematic analyses on the function of different AMPs in shrimp responsive to different types of bacteria are very limited. In this study, we analyzed the expression profiles of AMPs in the Chinese shrimps, Fenneropenaeus chinensis, simultaneously by real-time RT-PCR (reverse transcription-polymerase chain reaction) when shrimp were challenged with Micrococcus lysodeikticus (Gram-positive, G+) or Vibrio anguillarium (Gram-negative, G-). Different AMPs showed different expression profiles when shrimp were injected with one type of bacterium, and one AMP also showed different expression profiles when shrimp were challenged with different bacteria. Furthermore, the expression of these AMPs showed temporal expression profiles, suggesting that different AMPs function coordinately in bacteria-infected shrimp. An RNA interference approach was used to study the function of the Relish transcription factor in regulating the transcription of different AMPs. The current study showed that Relish could regulate the transcription of different AMPs in shrimp. Differential expression profiles of AMPs in shrimp injected with different types of bacteria indicated that a complicated antimicrobial response network existed in shrimp. These data contribute to our understanding of immunity in shrimp and may provide a strategy for the control of disease in shrimp.

  11. Temperature profile and equipartition law in a Langevin harmonic chain

    NASA Astrophysics Data System (ADS)

    Kim, Sangrak

    2017-09-01

    Temperature profile in a Langevin harmonic chain is explicitly derived and the validity of the equipartition law is checked. First, we point out that the temperature profile in previous studies does not agree with the equipartition law: In thermal equilibrium, the temperature profile deviates from the same temperature distribution against the equipartition law, particularly at the ends of the chain. The matrix connecting temperatures of the heat reservoirs and the temperatures of the harmonic oscillators turns out to be a probability matrix. By explicitly calculating the power spectrum of the probability matrix, we will show that the discrepancy comes from the neglect of the power spectrum in higher frequency ω, which is in decay mode, and related with the imaginary number of wave number q.

  12. Theoretical study of the reaction mechanism and kinetics of low-molecular-weight atmospheric aldehydes (C1-C4) with NO2

    NASA Astrophysics Data System (ADS)

    Ji, Yuemeng; Gao, Yanpeng; Li, Guiying; An, Taicheng

    2012-07-01

    Accurate description of atmospheric reactions of a series of low-molecular-weight (LMW) aldehydes (C1-C4) with NO2 has been modeled using a direct dynamic approach. The profiles of the potential energy surface were constructed at the BMC-CCSD//MPWB1K/6-311G(d,p) level of theory, and two different pathways have been found: H-abstraction and NO2-addition. The modeling results found that the contribution of NO2-addition reaction pathway to the total rate constant is very small and thus this kind of pathway is insignificant in atmospheric conditions. The predicted H-abstraction products are mainly reactive acyl radical and nitrous acid (HONO) which is very mutagenic and carcinogenic pollutant as well as the precursor of acid deposition. The rate constants of both pathways were also deduced by using canonical variational transition state theory incorporating with the small curvature tunneling correction within 200-360 and 360-2000 K. Theoretical overall rate constants are in good agreement with the available experimental values, whose increase in the order of kformaldehyde < kacetaldehyde < kpropanal < kbutanal, implying that relative long-chain LMW aldehydes are more reactive toward NO2 than those short-chain LMW aldehydes in the atmospheric condition. At 298 K, the total rate constants of LMW aldehydes (C1-C4) with NO2 are obtained as 1.65 × 10-25, 1.43 × 10-24, 3.39 × 10-24 and 1.83 × 10-23 cm3 molecule-1 s-1, respectively.

  13. 5,5'-Dithiobis-(2-nitrobenzoic acid) as a probe for a non-essential cysteine residue at the medium chain acyl-coenzyme A dehydrogenase binding site of the human 'electron transferring flavoprotein' (ETF).

    PubMed

    Parker, A; Engel, P C

    1999-01-01

    Human 'electron transferring flavoprotein' (ETF) was inactivated by the thiol-specific reagent 5,5'-dithiobis-(2-nitrobenzoic acid) (DTNB). The kinetic profile showed the reaction followed pseudo-first-order kinetics during the initial phase of inactivation. Monitoring the release of 5-thio-2-nitrobenzoate (TNB) showed that modification of 1 cysteine residue was responsible for the loss of activity. The inactivation of ETF by DTNB could be reversed upon incubation with thiol-containing reagents. The loss of activity was prevented by the inclusion of medium chain acyl-CoA dehydrogenase (MCAD) and octanoyl-CoA. Cyanolysis of the DTNB modified-ETF with KCN led to the release of TNB accompanied presumably by the formation of the thio-cyano enzyme and with almost full recovery of activity. Conservation studies and the lack of 100% inactivation, however, suggested that this cysteine residue is not essential for the interaction with MCAD.

  14. Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

    PubMed

    Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

    2011-03-14

    Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

    PubMed

    Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

    2012-12-01

    Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  16. Silicon-based sleeve devices for chemical reactions

    DOEpatents

    Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

    1996-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  17. Silicon-based sleeve devices for chemical reactions

    DOEpatents

    Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

    1996-12-31

    A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

  18. Glyoxal Oxidation Mechanism: Implications for the Reactions HCO + O2 and OCHCHO + HO2.

    PubMed

    Faßheber, Nancy; Friedrichs, Gernot; Marshall, Paul; Glarborg, Peter

    2015-07-16

    A detailed mechanism for the thermal decomposition and oxidation of the flame intermediate glyoxal (OCHCHO) has been assembled from available theoretical and experimental literature data. The modeling capabilities of this extensive mechanism have been tested by simulating experimental HCO profiles measured at intermediate and high temperatures in previous glyoxal photolysis and pyrolysis studies. Additionally, new experiments on glyoxal pyrolysis and oxidation have been performed with glyoxal and glyoxal/oxygen mixtures in Ar behind shock waves at temperatures of 1285-1760 K at two different total density ranges. HCO concentration-time profiles have been detected by frequency modulation spectroscopy at a wavelength of λ = 614.752 nm. The temperature range of available direct rate constant data of the high-temperature key reaction HCO + O2 → CO + HO2 has been extended up to 1705 K and confirms a temperature dependence consistent with a dominating direct abstraction channel. Taking into account available literature data obtained at lower temperatures, the following rate constant expression is recommended over the temperature range 295 K < T < 1705 K: k1/(cm(3) mol(-1) s(-1)) = 6.92 × 10(6) × T(1.90) × exp(+5.73 kJ/mol/RT). At intermediate temperatures, the reaction OCHCHO + HO2 becomes more important. A detailed reanalysis of previous experimental data as well as more recent theoretical predictions favor the formation of a recombination product in contrast to the formerly assumed dominating and fast OH-forming channel. Modeling results of the present study support the formation of HOCH(OO)CHO and provide a 2 orders of magnitude lower rate constant estimate for the OH channel. Hence, low-temperature generation of chain carriers has to be attributed to secondary reactions of HOCH(OO)CHO.

  19. Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

    PubMed

    Chen, Y T; Mercer, G O; Chen, Y

    1993-11-01

    Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

  20. Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

    PubMed

    Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

    2016-10-01

    The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

    PubMed

    Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

    2002-07-01

    Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

  2. Organic reactions mediated by electrochemically generated ArS+.

    PubMed

    Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi

    2011-04-21

    Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.

  3. TCTEX1D4 Interactome in Human Testis: Unraveling the Function of Dynein Light Chain in Spermatozoa

    PubMed Central

    Freitas, Maria João; Korrodi-Gregório, Luís; Morais-Santos, Filipa; da Cruz e Silva, Edgar

    2014-01-01

    Abstract Studies were designed to identify the TCTEX1D4 interactome in human testis, with the purpose of unraveling putative protein complexes essential to male reproduction and thus novel TCTEX1D4 functions. TCTEX1D4 is a dynein light chain that belongs to the DYNT1/TCTEX1 family. In spermatozoa, it appears to be important to sperm motility, intraflagellar transport, and acrosome reaction. To contribute to the knowledge on TCTEX1D4 function in testis and spermatozoa, a yeast two-hybrid assay was performed in testis, which allowed the identification of 40 novel TCTEX1D4 interactors. Curiously, another dynein light chain, TCTEX1D2, was identified and its existence demonstrated for the first time in human spermatozoa. Immunofluorescence studies proved that TCTEX1D2 is an intra-acrosomal protein also present in the midpiece, suggesting a role in cargo movement in human spermatozoa. Further, an in silico profile of TCTEX1D4 revealed that most TCTEX1D4 interacting proteins were not previously characterized and the ones described present a very broad nature. This reinforces TCTEX1D4 as a dynein light chain that is capable of interacting with a variety of functionally different proteins. These observations collectively contribute to a deeper molecular understanding of the human spermatozoa function. PMID:24606217

  4. Integrating metabolomics and transcriptomics data to discover a biocatalyst that can generate the amine precursors for alkamide biosynthesis

    PubMed Central

    Rizhsky, Ludmila; Jin, Huanan; Shepard, Michael R.; Scott, Harry W.; Teitgen, Alicen M.; Perera, M. Ann; Mhaske, Vandana; Jose, Adarsh; Zheng, Xiaobin; Crispin, Matt; Wurtele, Eve S.; Jones, Dallas; Hur, Manhoi; Góngora-Castillo, Elsa; Buell, C. Robin; Minto, Robert E.; Nikolau, Basil J.

    2016-01-01

    Summary The Echinacea genus is exemplary of over 30 plant families that produce a set of bioactive amides, called alkamides. The Echinacea alkamides may be assembled from two distinct moieties, a branched-chain amine that is acylated with a novel polyunsaturated fatty acid. In this study we identified the potential enzymological source of the amine moiety as a pyridoxal phosphate dependent decarboxylating enzyme that uses branched chain amino acids as substrate. This identification was based on a correlative analysis of the transcriptomes and metabolomes of 36 different E. purpurea tissues and organs, which expressed distinct alkamide profiles. Although no correlation was found between the accumulation patterns of the alkamides and their putative metabolic precursors (i.e., fatty acids and branched chain amino acids), isotope-labeling analyses supported the transformation of valine and isoleucine to isobutylamine and 2-methylbutylamine as reactions of alkamide biosynthesis. Sequence homology identified the pyridoxal phosphate dependent decarboxylase-like proteins in the translated proteome of E. purpurea. These sequences were prioritized for direct characterization by correlating their transcript levels with alkamide accumulation patterns in different organs and tissues, and this multi-pronged approach led to the identification and characterization of a branched-chain amino acid decarboxylase, which would appear to be responsible for generating the amine moieties of naturally occurring alkamides. PMID:27497272

  5. Surfactant-controlled polymerization of semiconductor clusters to quantum dots through competing step-growth and living chain-growth mechanisms.

    PubMed

    Evans, Christopher M; Love, Alyssa M; Weiss, Emily A

    2012-10-17

    This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.

  6. Kinetics of Chemical Reactions in Flames

    NASA Technical Reports Server (NTRS)

    Zeldovich, Y.; Semenov, N.

    1946-01-01

    In part I of the paper the theory of flame propagation is developed along the lines followed by Frank-Kamenetsky and one of the writers. The development of chain processes in flames is considered. A basis is given for the application of the method of stationary concentrations to reactions in flames; reactions with branching chains are analyzed. The case of a diffusion coefficient different from the coefficient of temperature conductivity is considered.

  7. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    USDA-ARS?s Scientific Manuscript database

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  8. [Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

    PubMed

    Wang, F; Zhang, Y Q; Ding, J; Yu, L X

    2017-10-18

    To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

  9. Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

    PubMed

    Igarashi, T; Yamamoto, A; Goto, N

    1996-10-01

    Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

  10. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    PubMed

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  11. Structure–Function Studies of Hydrophobic Residues That Clamp a Basic Glutamate Side Chain during Catalysis by Triosephosphate Isomerase

    PubMed Central

    2016-01-01

    Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328

  12. Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates.

    PubMed

    Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M

    2013-03-28

    This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

  13. Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

    PubMed

    Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

    2017-05-01

    Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

  14. Microfabricated electrochemiluminescence cell for chemical reaction detection

    DOEpatents

    Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

    2003-01-01

    A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  15. The molecular genetic basis of mitochondrial malfunction in bladder tissue following outlet obstruction.

    PubMed

    Levin, Robert M; Hudson, Alan P

    2004-08-01

    Bladder dysfunction following partial outlet obstruction is a frequent consequence of benign prostatic hyperplasia and an increasingly common problem given the aging of the general population. Recent studies from this and other groups have begun to elucidate the molecular bases for the well described physiological malfunctions that characterize this clinical entity. We summarized and synthesized that information. Using modern methods of molecular genetics, including real-time polymerase chain reaction, real-time reverse transcriptase-polymerase chain reaction and others, as well as traditional experimental techniques such as electron microscopy we and others examined the transcriptional profile, morphology, etc of bladder smooth muscle mitochondria in experimental models of outlet obstruction. Data from many studies have demonstrated that aberrant gene expression in the mitochondrial and mitochondria related nuclear genetic systems underlies the loss of compliance and other attributes of bladder dysfunction following outlet obstruction. Such aberrant transcriptional characteristics engender loss of function in the electron transport and oxidative phosphorylation systems. Morphological studies of mitochondria in the animal model systems support this conclusion. In large part the loss of function in bladder smooth muscle following outlet obstruction results from the attenuation of mitochondrial energy production. In this article we reviewed and synthesized all available experimental observations relevant to this problem and we suggest future lines of inquiry that should prove fruitful in developing new strategies to treat the condition.

  16. Calcium: A novel and efficient inducer of differentiation of adipose-derived stem cells into neuron-like cells.

    PubMed

    Goudarzi, Farjam; Tayebinia, Heidar; Karimi, Jamshid; Habibitabar, Elahe; Khodadadi, Iraj

    2018-06-05

    This study comparatively investigated the effectiveness of calcium and other well-known inducers such as isobutylmethylxanthine (IBMX) and insulin in differentiating human adipose-derived stem cells (ADSCs) into neuronal-like cells. ADSCs were immunophenotyped and differentiated into neuron-like cells with different combinations of calcium, IBMX, and insulin. Calcium mobilization across the membrane was determined. Differentiated cells were characterized by cell cycle profiling, staining of Nissl bodies, detecting the gene expression level of markers such as neuronal nuclear antigen (NeuN), microtubule associated protein 2 (MAP2), neuron-specific enolase (NSE), doublecortin, synapsin I, glial fibrillary acidic protein (GFAP), and myelin basic protein (MBP) by quantitative real-time polymerase chain reaction (quantitative real-time polymerase chain reaction (qRT-PCR) and protein level by the immunofluorescence technique. Treatment with Ca + IBMX + Ins induced neuronal appearance and projection of neurite-like processes in the cells, accompanied with inhibition of proliferation and halt in the cell cycle. A significantly higher expression of MBP, GFAP, NeuN, NSE, synapsin 1, doublecortin, and MAP2 was detected in differentiated cells, confirming the advantages of Ca + IBMX + Ins to the other combinations of inducers. Here, we showed an efficient protocol for neuronal differentiation of ADSCs, and calcium fostered differentiation by augmenting the number of neuron-like cells and instantaneous increase in the expression of neuronal markers. © 2018 Wiley Periodicals, Inc.

  17. Possible etiologic heterogeneity of vulvar intraepithelial neoplasia. A correlation of pathologic characteristics with human papillomavirus detection by in situ hybridization and polymerase chain reaction.

    PubMed

    Park, J S; Jones, R W; McLean, M R; Currie, J L; Woodruff, J D; Shah, K V; Kurman, R J

    1991-03-15

    A correlated histopathologic and molecular virologic study of 30 cases of vulvar intraepithelial neoplasia Grade 3 (VIN 3) and six associated invasive vulvar carcinomas was performed. Paraffin sections were examined for human papillomavirus (HPV) types 6, 11, 16, and 18 by in situ hybridization for viral transcripts and by polymerase chain reaction (PCR) for amplification of HPV and of the beta-globin gene. Vulvar intraepithelial neoplasia Grade 3 was histologically subclassified into warty (bowenoid) (20 cases) and basaloid (undifferentiated) (ten cases) types. Warty VIN characteristically was composed of squamous cells displaying abnormal proliferation and maturation and an undulating or spiked surface creating a "condylomatous" appearance whereas basaloid VIN had a smooth surface and was composed of undifferentiated basaloid cells resembling carcinoma in situ of the cervix. Human papillomavirus-16 was the only type detected in 16 of 30 VIN 3 and in five of six invasive carcinomas. The HPV-positive women were younger than HPV-negative women (mean age at diagnosis, 49 versus 60 years), their lesions more frequently demonstrated koilocytotic atypia (94% versus 43%), and they were more likely to have warty compared with basaloid VIN lesions (65% versus 30%). These findings suggest that there are at least two different types of VIN which have differing clinical, pathologic, and viral profiles.

  18. Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions

    NASA Astrophysics Data System (ADS)

    Zlokazov, V. B.; Utyonkov, V. K.

    2017-07-01

    The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.

  19. Graded replacement of maize grain with molassed sugar beet pulp modulated ruminal microbial community and fermentation profile in vitro.

    PubMed

    Münnich, Matthias; Khol-Parisini, Annabella; Klevenhusen, Fenja; Metzler-Zebeli, Barbara U; Zebeli, Qendrim

    2018-02-01

    Molassed sugar beet pulp (Bp) is a viable alternative to grains in cattle nutrition for reducing human edible energy input. Yet little is known about the effects of high inclusion rates of Bp on rumen microbiota. This study used an in vitro approach and the quantitative polymerase chain reaction technique to establish the effects of a graded replacement of maize grain (MG) by Bp on the ruminal microbial community, fermentation profile and nutrient degradation. Six different amounts of Bp (0-400 g kg -1 ), which replaced MG in the diet, were tested using the in vitro semi-continuous rumen simulation technique. The increased inclusion of Bp resulted in greater dietary content and degradation of neutral detergent fibre (P < 0.01). Further, Bp feeding enhanced (P < 0.01) the abundance of genus Prevotella and shifted (P < 0.01) the short-chain fatty acid patterns in favour of acetate and propionate and at the expense of butyrate. A total replacement of MG with Bp resulted in an increased daily methane production (P < 0.01). Results suggest positive effects of the replacement of MG by Bp especially in terms of stimulating ruminal acetate and propionate fermentation. However, high replacement rates of Bp resulted in lowered utilization of ammonia and higher ruminal methane production. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  20. A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

    NASA Astrophysics Data System (ADS)

    Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua

    2017-08-01

    Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.

  1. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  2. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  3. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  4. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    EPA Science Inventory

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  5. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    USDA-ARS?s Scientific Manuscript database

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  6. Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

    PubMed

    Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

    2005-03-01

    We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

  7. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  8. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  9. Eliminating the Cuspidal Temperature Profile of a Non-equilibrium Chain

    NASA Astrophysics Data System (ADS)

    Cândido, Michael M.; M. Morgado, Welles A.; Duarte Queirós, Sílvio M.

    2017-06-01

    In 1967, Z. Rieder, J. L. Lebowitz, and E. Lieb (RLL) introduced a model of heat conduction on a crystal that became a milestone problem of non-equilibrium statistical mechanics. Along with its inability to reproduce Fourier's law—which subsequent generalizations have been trying to amend—the RLL model is also characterized by awkward cusps at the ends of the non-equilibrium chain, an effect that has endured all these years without a satisfactory answer. In this paper, we first show that such trait stems from the insufficiency of pinning interactions between the chain and the substrate. Assuming the possibility of pinning the chain, the analysis of the temperature profile in the space of parameters reveals that for a proper combination of the border and bulk pinning values, the temperature profile may shift twice between the RLL cuspidal behavior and the expected monotonic local temperature evolution along the system, as a function of the pinning. At those inversions, the temperature profile along the chain is characterized by perfect plateaux: at the first threshold, the cumulants of the heat flux reach their maxima and the vanishing of the two-point velocity correlation function for all sites of the chain so that the system behaves similarly to a "phonon box." On the other hand, at the second change of the temperature profile, we still have the vanishing of the two-point correlation function but only for the bulk, which explains the emergence of the temperature plateau and thwarts the reaching of the maximal values of the cumulants of the heat flux.

  10. Light Regulation of the Arabidopsis Respiratory Chain. Multiple Discrete Photoreceptor Responses Contribute to Induction of Type II NAD(P)H Dehydrogenase Genes1

    PubMed Central

    Escobar, Matthew A.; Franklin, Keara A.; Svensson, Å. Staffan; Salter, Michael G.; Whitelam, Garry C.; Rasmusson, Allan G.

    2004-01-01

    Controlled oxidation reactions catalyzed by the large, proton-pumping complexes of the respiratory chain generate an electrochemical gradient across the mitochondrial inner membrane that is harnessed for ATP production. However, several alternative respiratory pathways in plants allow the maintenance of substrate oxidation while minimizing the production of ATP. We have investigated the role of light in the regulation of these energy-dissipating pathways by transcriptional profiling of the alternative oxidase, uncoupling protein, and type II NAD(P)H dehydrogenase gene families in etiolated Arabidopsis seedlings. Expression of the nda1 and ndc1 NAD(P)H dehydrogenase genes was rapidly up-regulated by a broad range of light intensities and qualities. For both genes, light induction appears to be a direct transcriptional effect that is independent of carbon status. Mutant analyses demonstrated the involvement of two separate photoreceptor families in nda1 and ndc1 light regulation: the phytochromes (phyA and phyB) and an undetermined blue light photoreceptor. In the case of the nda1 gene, the different photoreceptor systems generate distinct kinetic induction profiles that are integrated in white light response. Primary transcriptional control of light response was localized to a 99-bp region of the nda1 promoter, which contains an I-box flanked by two GT-1 elements, an arrangement prevalent in the promoters of photosynthesis-associated genes. Light induction was specific to nda1 and ndc1. The only other substantial light effect observed was a decrease in aox2 expression. Overall, these results suggest that light directly influences the respiratory electron transport chain via photoreceptor-mediated transcriptional control, likely for supporting photosynthetic metabolism. PMID:15333756

  11. THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST

    PubMed Central

    Keil, Harry; Wasserman, David; Dawson, Charles R.

    1944-01-01

    1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415

  12. THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST.

    PubMed

    Keil, H; Wasserman, D; Dawson, C R

    1944-10-01

    1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.

  13. Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

    PubMed Central

    deWit, D; Wootton, M; Allan, B; Steyn, L

    1993-01-01

    A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

  14. Identification of specific gene expression profiles in fibroblasts derived from middle ear cholesteatoma.

    PubMed

    Yoshikawa, Mamoru; Kojima, Hiromi; Wada, Kota; Tsukidate, Toshiharu; Okada, Naoko; Saito, Hirohisa; Moriyama, Hiroshi

    2006-07-01

    To investigate the role of fibroblasts in the pathogenesis of cholesteatoma. Tissue specimens were obtained from our patients. Middle ear cholesteatoma-derived fibroblasts (MECFs) and postauricular skin-derived fibroblasts (SFs) as controls were then cultured for a few weeks. These fibroblasts were stimulated with interleukin (IL) 1alpha and/or IL-1beta before gene expression assays. We used the human genome U133A probe array (GeneChip) and real-time polymerase chain reaction to examine and compare the gene expression profiles of the MECFs and SFs. Six patients who had undergone tympanoplasty. The IL-1alpha-regulated genes were classified into 4 distinct clusters on the basis of profiles differentially regulated by SF and MECF using a hierarchical clustering analysis. The messenger RNA expressions of LARC (liver and activation-regulated chemokine), GMCSF (granulocyte-macrophage colony-stimulating factor), epiregulin, ICAM1 (intercellular adhesion molecule 1), and TGFA (transforming growth factor alpha) were more strongly up-regulated by IL-1alpha and/or IL-1beta in MECF than in SF, suggesting that these fibroblasts derived from different tissues retained their typical gene expression profiles. Fibroblasts may play a role in hyperkeratosis of middle ear cholesteatoma by releasing molecules involved in inflammation and epidermal growth. These fibroblasts may retain tissue-specific characteristics presumably controlled by epigenetic mechanisms.

  15. A metabolomics-based method for studying the effect of yfcC gene in Escherichia coli on metabolism.

    PubMed

    Wang, Xiyue; Xie, Yuping; Gao, Peng; Zhang, Sufang; Tan, Haidong; Yang, Fengxu; Lian, Rongwei; Tian, Jing; Xu, Guowang

    2014-04-15

    Metabolomics is a potent tool to assist in identifying the function of unknown genes through analysis of metabolite changes in the context of varied genetic backgrounds. However, the availability of a universal unbiased profiling analysis is still a big challenge. In this study, we report an optimized metabolic profiling method based on gas chromatography-mass spectrometry for Escherichia coli. It was found that physiological saline at -80°C could ensure satisfied metabolic quenching with less metabolite leakage. A solution of methanol/water (21:79, v/v) was proved to be efficient for intracellular metabolite extraction. This method was applied to investigate the metabolome difference among wild-type E. coli, its yfcC deletion, and overexpression mutants. Statistical and bioinformatic analysis of the metabolic profiling data indicated that the expression of yfcC potentially affected the metabolism of glyoxylate shunt. This finding was further validated by real-time quantitative polymerase chain reactions showing that expression of aceA and aceB, the key genes in glyoxylate shunt, was upregulated by yfcC. This study exemplifies the robustness of the proposed metabolic profiling analysis strategy and its potential roles in investigating unknown gene functions in view of metabolome difference. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. MicroRNA Changes in Cerebrospinal Fluid After Subarachnoid Hemorrhage.

    PubMed

    Bache, Søren; Rasmussen, Rune; Rossing, Maria; Laigaard, Finn Pedersen; Nielsen, Finn Cilius; Møller, Kirsten

    2017-09-01

    Delayed cerebral ischemia (DCI) accounts for a major part of the morbidity and mortality after aneurysmal subarachnoid hemorrhage (SAH). MicroRNAs (miRNAs) are pathophysiologically involved in acute cerebral ischemia. This study compared miRNA profiles in cerebrospinal fluid from neurologically healthy patients, as well as SAH patients with and without subsequent development of DCI. In a prospective case-control study of SAH patients treated with external ventricular drainage and neurologically healthy patients, miRNA profiles in cerebrospinal fluid were screened and validated using 2 different high-throughput real-time quantification polymerase chain reaction techniques. The occurrence of DCI was documented in patient charts and subsequently reviewed independently by 2 physicians. MiRNA profiles from 27 SAH patients and 10 neurologically healthy patients passed quality control. In the validation, 66 miRNAs showed a relative increase in cerebrospinal fluid from SAH patients compared with neurologically healthy patients ( P <0.001); 2 (miR-21 and miR-221) showed a relative increase in SAH patients with DCI compared with those without ( P <0.05) in both the screening and validation. SAH is associated with marked changes in the cerebrospinal fluid miRNA profile. These changes could be associated to the development of DCI. URL: http://www.clinicaltrials.gov. Unique identifier: NCT01791257. © 2017 The Authors.

  17. Molecular identification and cluster analysis of homofermentative thermophilic lactobacilli isolated from dairy products.

    PubMed

    Andrighetto, C; De Dea, P; Lombardi, A; Neviani, E; Rossetti, L; Giraffa, G

    1998-10-01

    Twenty-five strains of thermophilic lactobacilli isolated from yoghurt and from semi-hard and hard cheeses (in parallel with nine type or reference strains) were identified and grouped according to their genetic relatedness. Strains were identified by sugar fermentation patterns using the "API 50 CHL" galleries, by species-specific DNA probes in dot-blot hybridization experiments, by amplification and restriction analysis of the 16S rRNA gene (ARDRA) and by polymerase chain reaction (PCR) using species-specific oligonucleotide primers. Strains were classified as Lactobacillus delbrueckii subsp. lactis and subsp. bulgaricus, L. helveticus, and L. acidophilus. Strains which were atypical by sugar fermentation patterns were also identified. Most of the strains could not be grouped using carbohydrate fermentation profiles. PCR fingerprinting was used to identify DNA profiles for the 25 lactobacilli. Experimentally obtained PCR profiles enabled discrimination of all strains, which were grouped according to the similarities in their combined patterns. In general, the clustering of the strains corresponded well with species delineation obtained by molecular identification. The dendrogram of genetic relatedness enabled the unambiguous identification of most of the strains which were shown to be atypical by the sugar fermentation profile, except for a discrepancy in one L. delbrueckii subsp. lactis strain and one atypical Lactobacillus sp. strain.

  18. Quantitative PCR and disaccharide profiling to characterize the animal origin of low-molecular-weight heparins.

    PubMed

    Houiste, Céline; Auguste, Cécile; Macrez, Céline; Dereux, Stéphanie; Derouet, Angélique; Anger, Pascal

    2009-02-01

    Low-molecular-weight heparins (LMWHs) are widely used in the management of thrombosis and acute coronary syndromes. They are obtained by the enzymatic or chemical depolymerization of porcine intestinal heparin. Enoxaparin sodium, a widely used LMWH, has a unique and reproducible oligosaccharide profile which is determined by the origin of the starting material and a tightly controlled manufacturing process. Although other enoxaparin-like LMWHs do exist, specific release criteria including the origin of the crude heparin utilized for their production, have not been established. A quantitative polymerase chain reaction method has been developed to ensure the purity of the porcine origin of crude heparin, with a DNA detection limit as low as 1 ppm for bovine, or 10 ppm for ovine contaminants. This method is routinely used as the release acceptance criterion during enoxaparin sodium manufacturing. Furthermore, when the process removes DNA, other analytical techniques can be used to assess any contamination. Disaccharide profiling after exhaustive depolymerization can determine the presence of at least 10% bovine or 20% ovine material; multivariate analysis is useful to perform the data analysis. Consistent with the availability of newer technology, these methods should be required as acceptance criteria for crude heparins used in the manufacture of LMWHs to ensure their safety, quality, and immunologic profile.

  19. Injectable hyperbranched poly(β-amino ester) hydrogels with on-demand degradation profiles to match wound healing processes† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc03913a

    PubMed Central

    Xu, Qian; Guo, Linru; A, Sigen; Gao, Yongsheng; Zhou, Dezhong; Greiser, Udo; Creagh-Flynn, Jack; Zhang, Hong; Dong, Yixiao; Cutlar, Lara; Wang, Fagang; Liu, Wenguang

    2018-01-01

    Adjusting biomaterial degradation profiles to match tissue regeneration is a challenging issue. Herein, biodegradable hyperbranched poly(β-amino ester)s (HP-PBAEs) were designed and synthesized via “A2 + B4” Michael addition polymerization, and displayed fast gelation with thiolated hyaluronic acid (HA-SH) via a “click” thiol–ene reaction. HP-PBAE/HA-SH hydrogels showed tunable degradation profiles both in vitro and in vivo using diamines with different alkyl chain lengths and poly(ethylene glycol) diacrylates with varied PEG spacers. The hydrogels with optimized degradation profiles encapsulating ADSCs were used as injectable hydrogels to treat two different types of humanized excisional wounds – acute wounds with faster healing rates and diabetic wounds with slower healing and neo-tissue formation. The fast-degrading hydrogel showed accelerated wound closure in acute wounds, while the slow-degrading hydrogel showed better wound healing for diabetic wounds. The results demonstrate that the new HP-PBAE-based hydrogel in combination with ADSCs can be used as a well-controlled biodegradable skin substitute, which demonstrates a promising approach in the treatment of various types of skin wounds. PMID:29719691

  20. Microfabricated sleeve devices for chemical reactions

    DOEpatents

    Northrup, M. Allen

    2003-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  1. A Kinetic Approach to Propagation and Stability of Detonation Waves

    NASA Astrophysics Data System (ADS)

    Monaco, R.; Bianchi, M. Pandolfi; Soares, A. J.

    2008-12-01

    The problem of the steady propagation and linear stability of a detonation wave is formulated in the kinetic frame for a quaternary gas mixture in which a reversible bimolecular reaction takes place. The reactive Euler equations and related Rankine-Hugoniot conditions are deduced from the mesoscopic description of the process. The steady propagation problem is solved for a Zeldovich, von Neuman and Doering (ZND) wave, providing the detonation profiles and the wave thickness for different overdrive degrees. The one-dimensional stability of such detonation wave is then studied in terms of an initial value problem coupled with an acoustic radiation condition at the equilibrium final state. The stability equations and their initial data are deduced from the linearized reactive Euler equations and related Rankine-Hugoniot conditions through a normal mode analysis referred to the complex disturbances of the steady state variables. Some numerical simulations for an elementary reaction of the hydrogen-oxygen chain are proposed in order to describe the time and space evolution of the instabilities induced by the shock front perturbation.

  2. Enzymatic preparation of structured oils containing short-chain fatty acids.

    PubMed

    Kanda, Ayato; Namiki, Fusako; Hara, Setsuko

    2010-01-01

    Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.

  3. An ab initio molecular dynamics and density functional theory study of the formation of phosphate chains from metathiophosphates.

    PubMed

    Mosey, Nicholas J; Woo, Tom K

    2006-09-04

    The reactions that occur between metathiophosphate (MTP) molecules are identified and examined through ab initio molecular dynamics simulations and static quantum chemical calculations at the density functional level of theory. The simulations show that certain types of MTPs can react to yield phosphate chains, while others only dimerize. These differences are rationalized in terms of reaction energies and the electronic structures of these molecules. In the reaction leading to the formation of phosphate chains, the reactive center, a tri-coordinate phosphorus atom, is continually regenerated. A polymerization mechanism linking MTPs to phosphate chains is developed on the basis of these results. This information sheds light on the underlying processes that may be responsible for the formation of phosphates under high-temperature conditions and may prove useful in the development of protocols for the rational synthesis of complex phosphate structures.

  4. DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

    EPA Science Inventory

    The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

  5. 29 CFR 1910.155 - Scope, application and definitions applicable to this subpart.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... by inhibiting the chemical chain reaction of fuel and oxygen. It is also known as...F3) which is a medium for extinguishing fires by inhibiting the chemical chain reaction of fuel and..., odorless, electrically nonconductive inert gas (chemical formula CO2) that is a medium for extinguishing...

  6. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    ERIC Educational Resources Information Center

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  7. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  8. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    USDA-ARS?s Scientific Manuscript database

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  9. Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.

    PubMed

    Borkar, Santosh Ramdas; Aidhen, Indrapal Singh

    2017-04-18

    Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.

  10. Intervention of pumpkin seed oil on metabolic disease revealed by metabonomics and transcript profile.

    PubMed

    Zhao, Xiu-Ju; Chen, Yu-Lian; Fu, Bing; Zhang, Wen; Liu, Zhiguo; Zhuo, Hexian

    2017-03-01

    Understanding the metabolic and transcription basis of pumpkin seed oil (PSO) intervention on metabolic disease (MD) is essential to daily nutrition and health. This study analyzed the liver metabolic variations of Wistar rats fed normal diet (CON), high-fat diet (HFD) and high-fat plus PSO diet (PSO) to establish the relationship between the liver metabolite composition/transcript profile and the effects of PSO on MD. By using proton nuclear magnetic resonance spectroscopy together with multivariate data analysis, it was found that, compared with CON rats, HFD rats showed clear dysfunctions of choline metabolism, glucose metabolism and nucleotide and amino acid metabolism. Using quantitative real-time polymerase chain reaction (qPCR), it was found that, compared with HFD rats, PSO rats showed alleviated endoplasmic reticulum stress accompanied by lowered unfolded protein response. These findings provide useful information to understand the metabolic alterations triggered by MD and to evaluate the effects of PSO intervention. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  11. Cassava (Manihot esculenta Krantz) genome harbors KNOX genes differentially expressed during storage root development.

    PubMed

    Guo, D; Li, H L; Tang, X; Peng, S Q

    2014-12-18

    In plants, homeodomain proteins play a critical role in regulating various aspects of plant growth and development. KNOX proteins are members of the homeodomain protein family. The KNOX transcription factors have been reported from Arabidopsis, rice, and other higher plants. The recent publication of the draft genome sequence of cassava (Manihot esculenta Krantz) has allowed a genome-wide search for M. esculenta KNOX (MeKNOX) transcription factors and the comparison of these positively identified proteins with their homologs in model plants. In the present study, we identified 12 MeKNOX genes in the cassava genome and grouped them into two distinct subfamilies based on their domain composition and phylogenetic analysis. Furthermore, semi-quantitative reverse transcription polymerase chain reaction analysis was performed to elucidate the expression profiles of these genes in different tissues and during various stages of root development. The analysis of MeKNOX expression profiles of indicated that 12 MeKNOX genes display differential expressions either in their transcript abundance or expression patterns.

  12. Clinical signs and bacterial communities of deciduous necrotic root canals detected by PCR-DGGE analysis: research association.

    PubMed

    de Paula, Viviane Andrade Cancio; de Carvalho Ferreira, Dennis; Cavalcante, Fernanda Sampaio; do Carmo, Flávia Lima; Rosado, Alexandre Soares; Primo, Laura Guimarães; dos Santos, Kátia Regina Netto

    2014-08-01

    This study sought to investigate the possible association between clinical and radiographic data of the patients with the bacterial community profiles involved in cases of necrosis in primary root canals. Microbial community profiles for 25 samples from necrotic deciduous root canals were analyzed using the polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) fingerprinting approach. These results were related to the clinical and radiographic data of these patients. The analysis showed a large diversity of microbial communities in necrotic deciduous root canals. The statistical results pointed out that posterior and anterior teeth were associated with <20 bands and >20 bands in PCR-DGGE method, respectively. A relationship was verified between ages >4 years old and posterior teeth and, ages ≤4 years old and anterior teeth. The data showed a polymicrobial community and pointed out the association of age with necrosis in anterior and posterior teeth. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. Developmental Validation of Short Tandem Repeat Reagent Kit for Forensic DNA Profiling of Canine Biological Materials

    PubMed Central

    Dayton, Melody; Koskinen, Mikko T; Tom, Bradley K; Mattila, Anna-Maria; Johnston, Eric; Halverson, Joy; Fantin, Dennis; DeNise, Sue; Budowle, Bruce; Smith, David Glenn; Kanthaswamy, Sree

    2009-01-01

    Aim To develop a reagent kit that enables multiplex polymerase chain reaction (PCR) amplification of 18 short tandem repeats (STR) and the canine sex-determining Zinc Finger marker. Methods Validation studies to determine the robustness and reliability in forensic DNA typing of this multiplex assay included sensitivity testing, reproducibility studies, intra- and inter-locus color balance studies, annealing temperature and cycle number studies, peak height ratio determination, characterization of artifacts such as stutter percentages and dye blobs, mixture analyses, species-specificity, case type samples analyses and population studies. Results The kit robustly amplified domesticated dog samples and consistently generated full 19-locus profiles from as little as 125 pg of dog DNA. In addition, wolf DNA samples could be analyzed with the kit. Conclusion The kit, which produces robust, reliable, and reproducible results, will be made available for the forensic research community after modifications based on this study’s evaluation to comply with the quality standards expected for forensic casework. PMID:19480022

  14. Expression profile and distribution of Efhc1 gene transcript during rodent brain development.

    PubMed

    Conte, Fábio F; Ribeiro, Patrícia A O; Marchesini, Rafael B; Pascoal, Vinícius D B; Silva, Joelcimar M; Oliveira, Amanda R; Gilioli, Rovílson; Sbragia, Lourenço; Bittencourt, Jackson C; Lopes-Cendes, Iscia

    2009-09-01

    One of the putative causative genes for juvenile myoclonic epilepsy (JME) is EFHC1. We report here the expression profile and distribution of Efhc1 messenger RNA (mRNA) during mouse and rat brain development. Real-time polymerase chain reaction revealed that there is no difference in the expression of Efhc1 mRNA between right and left hemispheres in both species. In addition, the highest levels of Efhc1 mRNA were found at intra-uterine stages in mouse and in adulthood in rat. In common, there was a progressive decrease in Efhc1 expression from 1-day-old neonates to 14-day-old animals in both species. In situ hybridization studies showed that rat and mouse Efhc1 mRNAs are expressed in ependymal cells of ventricle walls. Our findings suggest that Efhc1 expression is more important during initial phases of brain development and that at this stage it could be involved in key developmental mechanisms underlying JME.

  15. CsGOGAT Is Important in Dynamic Changes of Theanine Content in Postharvest Tea Plant Leaves under Different Temperature and Shading Spreadings.

    PubMed

    Liu, Zhi-Wei; Li, Hui; Wang, Wen-Li; Wu, Zhi-Jun; Cui, Xin; Zhuang, Jing

    2017-11-08

    We analyzed the changes of theanine content in postharvest tea leaves under high temperature (38 °C), low temperature (4 °C), and shading spreadings by using ultrahigh-performance liquid chromatography. The differentially expressed proteins (DEPs), CsFd-GOGAT and CsNADH-GOGAT, which are involved in theanine biosynthesis pathway, were identified from the corresponding proteome data. The protein-protein interactions of CsFd-GOGAT and CsNADH-GOGAT, CsTS1, or CsNiR were verified by yeast two-hybrid technology. The expression profiles of 17 genes in theanine metabolism, including CsFd-GOGAT and CsNADH-GOGAT, were analyzed by quantitative real-time polymerase chain reaction. The correlations between the dynamic changes of theanine content and expression profiles of related genes and DEPs were analyzed. This study preliminarily proved the importance of CsGOGAT in dynamic changes of theanine content in postharvest tea leaves during spreading.

  16. Influence of nitrogen fertilization on diazotrophic communities in the rhizosphere of the Jerusalem artichoke (Helianthus tuberosus L.).

    PubMed

    Meng, Xianfa; Wang, Lin; Long, Xiaohua; Liu, Zhaopu; Zhang, Zhenhua; Zed, Rengel

    2012-06-01

    Diazotrophs in the soil may be influenced by plant factors as well as nitrogen (N) fertilization. In this study, we investigated potential diazotrophic communities in the rhizosphere of the Jerusalem artichoke (Helianthus tuberosus L.) supplied with differing amounts of N. The community structure of N(2)-fixing bacteria was profiled using the length heterogeneity polymerase chain reaction (LH-PCR) and terminal restriction fragment length polymorphism (T-RFLP) based on a variation in the nifH gene. Higher numbers of diazotrophs were detected by T-RFLP compared to LH-PCR. The lowest number of N(2)-fixing bacteria was observed in the rhizosphere soil with high N fertilization. T-RFLP was a better method than LH-PCR for profiling microbial diversity of diazotrophs using multidimensional scaling (MDS) and analysis of similarity (ANOSIM) of fingerprints as well as diversity measures. The supply of N fertilizer appeared to negatively influence the abundance of diazotrophs in the rhizophere of the Jerusalem artichoke. Copyright © 2012 Institut Pasteur. All rights reserved.

  17. Multi-scale modeling of diffusion-controlled reactions in polymers: renormalisation of reactivity parameters.

    PubMed

    Everaers, Ralf; Rosa, Angelo

    2012-01-07

    The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.

  18. miR-758-3p: a blood-based biomarker that’s influence on the expression of CERP/ABCA1 may contribute to the progression of obesity to metabolic syndrome

    PubMed Central

    O’Neill, Sadhbh; Larsen, Mette Bohl; Gregersen, Søren; Hermansen, Kjeld; O’Driscoll, Lorraine

    2018-01-01

    Due to increasing prevalence of obesity, a simple method or methods for the diagnosis of metabolic syndrome are urgently required to reduce the risk of associated cardiovascular disease, diabetes and cancer. This study aimed to identify a miRNA biomarker that may distinguish metabolic syndrome from obesity and to investigate if such a miRNA may have functional relevance for metabolic syndrome. 52 adults with clinical obesity (n=26) or metabolic syndrome (n=26) were recruited. Plasma specimens were procured from all and were randomly designated to discovery and validation cohorts. miRNA discovery profiling was performed, using array technology, on plasma RNA. Validation was performed by quantitative polymerase chain reaction. The functional effect of miR-758-3p on its predicted target, cholesterol efflux regulatory protein/ATP-binding cassette transporter, was investigated using HepG2 liver cells. Custom miRNA profiling of 25 miRNAs in the discovery cohort found miR-758-3p to be detected in the obese cohort but undetected in the metabolic syndrome cohort. miR-758-3p was subsequently validated as a potential biomarker for metabolic syndrome by quantitative polymerase chain reaction. Bioinformatics analysis identified cholesterol efflux regulatory protein/ATP-binding cassette transporter as miR-758-3p’s predicted target. Specifically, mimicking miR-758-3p in HepG2 cells suppressed cholesterol efflux regulatory protein/ATP-binding cassette transporter protein expression; conversely, inhibiting miR-758-3p increased cholesterol efflux regulatory protein/ATP-binding cassette transporter protein expression. miR-758-3p holds potential as a blood-based biomarker for distinguishing progression from obesity to metabolic syndrome and as a driver in controlling cholesterol efflux regulatory protein/ATP-binding cassette transporter expression, indicating it potential role in cholesterol control in metabolic syndrome. PMID:29507696

  19. miR-758-3p: a blood-based biomarker that's influence on the expression of CERP/ABCA1 may contribute to the progression of obesity to metabolic syndrome.

    PubMed

    O'Neill, Sadhbh; Larsen, Mette Bohl; Gregersen, Søren; Hermansen, Kjeld; O'Driscoll, Lorraine

    2018-02-06

    Due to increasing prevalence of obesity, a simple method or methods for the diagnosis of metabolic syndrome are urgently required to reduce the risk of associated cardiovascular disease, diabetes and cancer. This study aimed to identify a miRNA biomarker that may distinguish metabolic syndrome from obesity and to investigate if such a miRNA may have functional relevance for metabolic syndrome. 52 adults with clinical obesity (n=26) or metabolic syndrome (n=26) were recruited. Plasma specimens were procured from all and were randomly designated to discovery and validation cohorts. miRNA discovery profiling was performed, using array technology, on plasma RNA. Validation was performed by quantitative polymerase chain reaction. The functional effect of miR-758-3p on its predicted target, cholesterol efflux regulatory protein/ATP-binding cassette transporter, was investigated using HepG2 liver cells. Custom miRNA profiling of 25 miRNAs in the discovery cohort found miR-758-3p to be detected in the obese cohort but undetected in the metabolic syndrome cohort. miR-758-3p was subsequently validated as a potential biomarker for metabolic syndrome by quantitative polymerase chain reaction. Bioinformatics analysis identified cholesterol efflux regulatory protein/ATP-binding cassette transporter as miR-758-3p's predicted target. Specifically, mimicking miR-758-3p in HepG2 cells suppressed cholesterol efflux regulatory protein/ATP-binding cassette transporter protein expression; conversely, inhibiting miR-758-3p increased cholesterol efflux regulatory protein/ATP-binding cassette transporter protein expression. miR-758-3p holds potential as a blood-based biomarker for distinguishing progression from obesity to metabolic syndrome and as a driver in controlling cholesterol efflux regulatory protein/ATP-binding cassette transporter expression, indicating it potential role in cholesterol control in metabolic syndrome.

  20. Promoter Hypermethylation Profiling Identifies Subtypes of Head and Neck Cancer with Distinct Viral, Environmental, Genetic and Survival Characteristics

    PubMed Central

    Choudhury, Javed Hussain; Ghosh, Sankar Kumar

    2015-01-01

    Background Epigenetic and genetic alteration plays a major role to the development of head and neck squamous cell carcinoma (HNSCC). Consumption of tobacco (smoking/chewing) and human papilloma virus (HPV) are also associated with an increase the risk of HNSCC. Promoter hypermethylation of the tumor suppression genes is related with transcriptional inactivation and loss of gene expression. We investigated epigenetic alteration (promoter methylation of tumor-related genes/loci) in tumor tissues in the context of genetic alteration, viral infection, and tobacco exposure and survival status. Methodology The study included 116 tissue samples (71 tumor and 45 normal tissues) from the Northeast Indian population. Methylation specific polymerase chain reaction (MSP) was used to determine the methylation status of 10 tumor-related genes/loci (p16, DAPK, RASSF1, BRAC1, GSTP1, ECAD, MLH1, MINT1, MINT2 and MINT31). Polymorphisms of CYP1A1, GST (M1 & T1), XRCC1and XRCC2 genes were studied by using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and multiplex-PCR respectively. Principal Findings Unsupervised hierarchical clustering analysis based on methylation pattern had identified two tumor clusters, which significantly differ by CpG island methylator phenotype (CIMP), tobacco, GSTM1, CYP1A1, HPV and survival status. Analyzing methylation of genes/loci individually, we have found significant higher methylation of DAPK, RASSF1, p16 and MINT31genes (P = 0.031, 0.013, 0.031 and 0.015 respectively) in HPV (+) cases compared to HPV (-). Furthermore, a CIMP-high and Cluster-1 characteristic was also associated with poor survival. Conclusions Promoter methylation profiles reflecting a correlation with tobacco, HPV, survival status and genetic alteration and may act as a marker to determine subtypes and patient outcome in HNSCC. PMID:26098903

  1. Genetic diversity of thermotolerant Campylobacter spp. isolates from different stages of the poultry meat supply chain in Argentina.

    PubMed

    Zbrun, María V; Romero-Scharpen, Analía; Olivero, Carolina; Zimmermann, Jorge A; Rossler, Eugenia; Soto, Lorena P; Astesana, Diego M; Blajman, Jesica E; Berisvil, Ayelén; Frizzo, Laureano S; Signorini, Marcelo L

    The objective of this study was to investigate a clonal relationship among thermotolerant Campylobacter spp. isolates from different stages of the poultry meat supply chain in Argentina. A total of 128 thermotolerant Campylobacter spp. (89 C. jejuni and 39 C. coli) isolates from six poultry meat chains were examined. These isolates were from: a) hens from breeder flocks, b) chickens on the farm (at ages 1 wk and 5 wk), c) chicken carcasses in the slaughterhouse, and d) chicken carcasses in the retail market. Chickens sampled along each food chain were from the same batch. Campylobacter spp. isolates were analyzed using pulsed-field gel electrophoresis to compare different profiles according to the source. Clustering of C. jejuni isolates resulted in 17 profiles, with four predominant genotypes and many small profiles with just a few isolates or unique patterns, showing a very high degree of heterogeneity among the C. jejuni isolates. Some clusters included isolates from different stages within the same chain, which would indicate a spread of strains along the same poultry meat chain. Moreover, twenty-two strains of C. coli clustered in seven groups and the remaining 17 isolates exhibited unique profiles. Evidence for transmission of thermotolerant Campylobacter spp. through the food chain and cross contamination in the slaughterhouses were obtained. This collective evidence should be considered as the scientific basis to implement risk management measures to protect the public health. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  2. Temperature control apparatus

    DOEpatents

    Northrup, M. Allen

    2003-08-05

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  3. Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

    PubMed

    Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

    2014-01-01

    Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  4. Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

    PubMed

    Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

    2013-09-15

    We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

    PubMed Central

    Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

    2015-01-01

    Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

  6. In vitro fermentation profiles, gas production rates, and microbiota modulation as affected by certain fructans, galactooligosaccharides, and polydextrose.

    PubMed

    Hernot, David C; Boileau, Thomas W; Bauer, Laura L; Middelbos, Ingmar S; Murphy, Michael R; Swanson, Kelly S; Fahey, George C

    2009-02-25

    It is of interest to benefit from the positive intestinal health outcomes of prebiotic consumption but with minimal gas production. This study examined gas production potential, fermentation profile, and microbial modulation properties of several types of oligosaccharides. Substrates studied included short-chain, medium-chain, and long-chain fructooligosaccharides, oligofructose-enriched inulin, galactooligosaccharide, and polydextrose. Each substrate was fermented in vitro using human fecal inoculum, and fermentation characteristics were quantified at 0, 4, 8, and 12 h. Gas and short-chain fatty acid (SCFA) production data showed that short-chain oligosaccharides were more rapidly fermented and produced more SCFA and gas than substrates with greater degrees of polymerization. Lactobacilli increased similarly among substrates. Short-chain oligosaccharides fermentation resulted in the greatest increase in bifidobacteria concentrations. Mixing short- and long-chain oligosaccharides attenuated short-chain oligosaccharide fermentation rate and extent. This study provides new information on the fermentation characteristics of some oligosaccharides used in human nutrition.

  7. The effect of the amino-acid side chains on the energy profiles for ion transport in the gramicidin A channel.

    PubMed

    Etchebest, C; Pullman, A

    1985-02-01

    Computations on the energy profiles for Na+ in the gramicidin A (GA) channel have been extended by introducing the effect, previously neglected, of the amino acid side chains of GA, fixed in their most stable conformations. The calculations have been performed in two approximations: 1) with the ethanolamine tail fixed in its most stable conformation, 2) with the tail allowed to optimize its conformation upon the progression of the ion. In both approximations the overall shape of the energy profile is very similar to that obtained in the absence of the side chains. One observes, however, a general lowering of the profile upon the adjunction of the side chains. The analysis of the factors responsible for this energy lowering indicates that it is due essentially to the electrostatic and polarisation components of the interaction which interplay differently, however, in the different parts of the channel. A particular role is attributed in this respect to the tryptophan residues of GA. The role of the 4 tryptophans present, Trp 15, 13, 11 and 9, is individualized by stripping of one of them at a time. The strongest effect on the energy deepening is due to Trp 13 and is particularly prominent in the entrance zone at 14.5A from the center of the channel. The result indicates the possibility of investigating theoretically the effect on the energy profiles of the substitution of the "natural" side chain by others.

  8. An improved reaction path optimization method using a chain of conformations

    NASA Astrophysics Data System (ADS)

    Asada, Toshio; Sawada, Nozomi; Nishikawa, Takuya; Koseki, Shiro

    2018-05-01

    The efficient fast path optimization (FPO) method is proposed to optimize the reaction paths on energy surfaces by using chains of conformations. No artificial spring force is used in the FPO method to ensure the equal spacing of adjacent conformations. The FPO method is applied to optimize the reaction path on two model potential surfaces. The use of this method enabled the optimization of the reaction paths with a drastically reduced number of optimization cycles for both potentials. It was also successfully utilized to define the MEP of the isomerization of the glycine molecule in water by FPO method.

  9. Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions

    NASA Astrophysics Data System (ADS)

    Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.

    2018-05-01

    It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

  10. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

  11. Crustal structure of an intraplate thrust belt: The Iberian Chain revealed by wide-angle seismic, magnetotelluric soundings and gravity data

    NASA Astrophysics Data System (ADS)

    Seillé, Hoël; Salas, Ramon; Pous, Jaume; Guimerà, Joan; Gallart, Josep; Torne, Montserrat; Romero-Ruiz, Ivan; Diaz, Jordi; Ruiz, Mario; Carbonell, Ramon; Mas, Ramón

    2015-11-01

    The Iberian Chain is a Cenozoic intraplate thrust belt located within the Iberian plate. Unlike other belts in the Iberia Peninsula, the scarcity of geophysical studies in this area results in a number of unknowns about its crustal structure. The Iberian Chain crust was investigated by means of a NE-SW refraction/wide-angle reflection seismic transect and two magnetotelluric profiles across the chain, oriented along the same direction. The seismic profile was designed to sample the crust by means of three shots designed to obtain a reversed profile. The resulting velocity-depth model shows a moderate thickening of the crust toward the central part of the profile, where crustal thickness reaches values above 40 km, thinning toward de SW Tajo and NE Ebro foreland basins. The crustal thickening is concentrated in the upper crust. The seismic results are in overall agreement with regional trends of Bouguer gravity anomaly and the main features of the seismic model were reproduced by gravity modeling. The magnetotelluric data consist of 39 sites grouped into two profiles, with periods ranging from 0.01 s to 1000 s. Dimensionality analyses show significant 3D effects in the resistivity structure and therefore we carried out a joint 3D inversion of the full impedance tensor and magnetic transfer functions. The Mesozoic and Cenozoic basins along the Chain are well characterized by shallow high conductive zones and low velocities. Elongated conductors reaching mid-crustal depths evidence the presence of major faults dominating the crustal structure. The results from the interpretation of these complementary geophysical data sets provided the first images of the crustal structure of the Iberian Chain. They are consistent with a Cenozoic shortening responsible of the upper crust thickening as well as of the uplift of the Iberian Chain and the generation of its present day topography.

  12. Circulating Long Noncoding RNAs as Potential Biomarkers of Sepsis: A Preliminary Study.

    PubMed

    Dai, Yu; Liang, Zhixin; Li, Yulin; Li, Chunsun; Chen, Liangan

    2017-11-01

    Long noncoding RNAs (lncRNAs) are becoming promising biomarker candidates in various diseases as assessed via sequencing technologies. Sepsis is a life-threatening disease without ideal biomarkers. The aim of this study was to investigate the expression profile of lncRNAs in the peripheral blood of sepsis patients and to find potential biomarkers of sepsis. A lncRNA expression profile was performed using peripheral blood from three sepsis patients and three healthy volunteers using microarray screening. The differentially expressed lncRNAs were validated by real-time quantitative polymerase chain reaction (qRT-PCR) in a further set of 22 sepsis patients and 22 healthy volunteers. Among 1316 differentially expressed lncRNAs, 771 were downregulated and 545 were upregulated. Results of the qRT-PCR were consistent with the microarray data. lncRNA ENST00000452391.1, uc001vji.1, and uc021zxw.1 were significantly differentially expressed between sepsis patients and healthy volunteers. Moreover, lncRNA ENST00000504301.1 and ENST00000452391.1 were significantly differentially expressed between sepsis survivors and nonsurvivors. The lncRNA expression profile in the peripheral blood of sepsis patients significantly differed from that of healthy volunteers. Circulating lncRNAs may be good candidates for sepsis biomarkers.

  13. Bacterial microbiota profile in gills of modified atmosphere-packaged oysters stored at 4 °C.

    PubMed

    Chen, Huibin; Wang, Meiying; Lin, Xiangzhi; Shi, Caihua; Liu, Zhiyu

    2017-02-01

    As filter-feeding bivalves, oysters can accumulate microorganisms into their gills, causing spoilage and potential safety issues. This study aims to investigate the changes in the gill microbiota of oysters packed under air and modified atmospheres (MAs, 50% CO 2 : 50% N 2 , 70% CO 2 : 30% O 2 , and 50% CO 2 : 50% O 2 ) during storage at 4 °C. The diversity of bacterial microbiota in oyster gills was profiled through polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) analysis on the 16S rRNA gene V3 region to describe the variation during the entire storage period. The DGGE profile revealed high bacterial diversity in the air- and MA-packaged oyster gills, and the spoilage bacterial microbiota varied in the MA-packaged oyster gills. Results indicated that CO 2 :O 2 (70%:30%) was suitable for oyster MA packaging and that high bacterial loads in oyster gills need to be considered during storage. In addition, Lactobacillus and Lactococcus species were found to grow dominantly in fresh oyster gills under MA packaging, which supports the potential application of MA packaging for oyster storage. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Ufd2p synthesizes branched ubiquitin chains to promote the degradation of substrates modified with atypical chains

    PubMed Central

    Liu, Chao; Liu, Weixiao; Ye, Yihong; Li, Wei

    2017-01-01

    Ubiquitination of a subset of proteins by ubiquitin chain elongation factors (E4), represented by Ufd2p in Saccharomyces cerevisiae, is a pivotal regulator for many biological processes. However, the mechanism of Ufd2p-mediated ubiquitination is largely unclear. Here, we show that Ufd2p catalyses K48-linked multi-monoubiquitination on K29-linked ubiquitin chains assembled by the ubiquitin ligase (Ufd4p), resulting in branched ubiquitin chains. This reaction depends on the interaction of K29-linked ubiquitin chains with two N-terminal loops of Ufd2p. Only following the addition of K48-linked ubiquitin to substrates modified with K29-linked ubiquitin chains, can the substrates be escorted to the proteasome for degradation. We demonstrate that this ubiquitin chain linkage switching reaction is essential for ERAD, oleic acid and acid pH resistance in yeast. Thus, our results suggest that Ufd2p functions by switching ubiquitin chain linkages to allow the degradation of proteins modified with a ubiquitin linkage, which is normally not targeted to the proteasome. PMID:28165462

  15. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  16. Identification of Brucella spp. by using the polymerase chain reaction.

    PubMed Central

    Herman, L; De Ridder, H

    1992-01-01

    The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

  17. Detection of Listeria monocytogenes by using the polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  18. Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

    PubMed

    Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

    2012-07-09

    Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. 9 CFR 145.33 - Terminology and classification; flocks and products.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    .... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

  20. Parallel and automated library synthesis of 2-long alkyl chain benzoazoles and azole[4,5-b]pyridines under microwave irradiation.

    PubMed

    Martínez-Palou, Rafael; Zepeda, L Gerardo; Höpfl, Herbert; Montoya, Ascensión; Guzmán-Lucero, Diego J; Guzmán, Javier

    2005-01-01

    A versatile route to 40-membered library of 2-long alkyl chain substituted benzoazoles (1 and 2) and azole[4,5-b]pyridines (3 and 4) via microwave-assisted combinatorial synthesis was developed. The reactions were carried out in both monomode and multimode microwave oven. With the latter, all reactions were performed in high-throughput experimental settings consisting of an 8 x 5 combinatorial library designed to synthesize 40 compounds. Each step, from the addition of reagents to the recovery of final products, was automated. The microwave-assisted N-long chain alkylation reactions of 2-alkyl-1H-benzimidazole (1) and 2-alkyl-1H-benzimidazole[4,5-b] pyridines (3) were also studied.

  1. Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation platform: assessing its performance in formalin-fixed, paraffin-embedded samples and identifying invasion pattern-related genes in oral squamous cell carcinoma.

    PubMed

    Loudig, Olivier; Brandwein-Gensler, Margaret; Kim, Ryung S; Lin, Juan; Isayeva, Tatyana; Liu, Christina; Segall, Jeffrey E; Kenny, Paraic A; Prystowsky, Michael B

    2011-12-01

    High-throughput gene expression profiling from formalin-fixed, paraffin-embedded tissues has become a reality, and several methods are now commercially available. The Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay (Illumina, Inc) is a full-transcriptome version of the original 512-gene complementary DNA-mediated annealing, selection, extension and ligation assay, allowing high-throughput profiling of 24,526 annotated genes from degraded and formalin-fixed, paraffin-embedded RNA. This assay has the potential to allow identification of novel gene signatures associated with clinical outcome using banked archival pathology specimen resources. We tested the reproducibility of the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay and its sensitivity for detecting differentially expressed genes in RNA extracted from matched fresh and formalin-fixed, paraffin-embedded cells, after 1 and 13 months of storage, using the human breast cell lines MCF7 and MCF10A. Then, using tumor worst pattern of invasion as a classifier, 1 component of the "risk model," we selected 12 formalin-fixed, paraffin-embedded oral squamous cell carcinomas for whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay analysis. We profiled 5 tumors with nonaggressive, nondispersed pattern of invasion, and 7 tumors with aggressive dispersed pattern of invasion and satellites scattered at least 1 mm apart. To minimize variability, the formalin-fixed, paraffin-embedded specimens were prepared from snap-frozen tissues, and RNA was obtained within 24 hours of fixation. One hundred four down-regulated genes and 72 up-regulated genes in tumors with aggressive dispersed pattern of invasion were identified. We performed quantitative reverse transcriptase polymerase chain reaction validation of 4 genes using Taqman assays and in situ protein detection of 1 gene by immunohistochemistry. Functional cluster analysis of genes up-regulated in tumors with aggressive pattern of invasion suggests presence of genes involved in cellular cytoarchitecture, some of which already associated with tumor invasion. Identification of these genes provides biologic rationale for our histologic classification, with regard to tumor invasion, and demonstrates that the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay is a powerful assay for profiling degraded RNA from archived specimens when combined with quantitative reverse transcriptase polymerase chain reaction validation. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. Immediate hypersensitivity to moxifloxacin with tolerance to ciprofloxacin: report of three cases and review of the literature.

    PubMed

    Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth

    2010-04-01

    To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.

  3. No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

    PubMed

    D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

    2006-10-01

    Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

  4. Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

    PubMed

    Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

    2017-09-01

    The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species. Nevertheless, to accurately differentiate among the taxonomically related species, PCR-RFLP should be implemented.

  5. Selection of an Aptamer Antidote to the Anticoagulant Drug Bivalirudin

    PubMed Central

    Martin, Jennifer A.; Parekh, Parag; Kim, Youngmi; Morey, Timothy E.; Sefah, Kwame; Gravenstein, Nikolaus; Dennis, Donn M.; Tan, Weihong

    2013-01-01

    Adverse drug reactions, including severe patient bleeding, may occur following the administration of anticoagulant drugs. Bivalirudin is a synthetic anticoagulant drug sometimes employed as a substitute for heparin, a commonly used anticoagulant that can cause a condition called heparin-induced thrombocytopenia (HIT). Although bivalrudin has the advantage of not causing HIT, a major concern is lack of an antidote for this drug. In contrast, medical professionals can quickly reverse the effects of heparin using protamine. This report details the selection of an aptamer to bivalirudin that functions as an antidote in buffer. This was accomplished by immobilizing the drug on a monolithic column to partition binding sequences from nonbinding sequences using a low-pressure chromatography system and salt gradient elution. The elution profile of binding sequences was compared to that of a blank column (no drug), and fractions with a chromatographic difference were analyzed via real-time PCR (polymerase chain reaction) and used for further selection. Sequences were identified by 454 sequencing and demonstrated low micromolar dissociation constants through fluorescence anisotropy after only two rounds of selection. One aptamer, JPB5, displayed a dose-dependent reduction of the clotting time in buffer, with a 20 µM aptamer achieving a nearly complete antidote effect. This work is expected to result in a superior safety profile for bivalirudin, resulting in enhanced patient care. PMID:23483901

  6. High Resolution Melting Analysis Targeting hsp70 as a Fast and Efficient Method for the Discrimination of Leishmania Species.

    PubMed

    Zampieri, Ricardo Andrade; Laranjeira-Silva, Maria Fernanda; Muxel, Sandra Marcia; Stocco de Lima, Ana Carolina; Shaw, Jeffrey Jon; Floeter-Winter, Lucile Maria

    2016-02-01

    Protozoan parasites of the genus Leishmania cause a large spectrum of clinical manifestations known as Leishmaniases. These diseases are increasingly important public health problems in many countries both within and outside endemic regions. Thus, an accurate differential diagnosis is extremely relevant for understanding epidemiological profiles and for the administration of the best therapeutic protocol. Exploring the High Resolution Melting (HRM) dissociation profiles of two amplicons using real time polymerase chain reaction (real-time PCR) targeting heat-shock protein 70 coding gene (hsp70) revealed differences that allowed the discrimination of genomic DNA samples of eight Leishmania species found in the Americas, including Leishmania (Leishmania) infantum chagasi, L. (L.) amazonensis, L. (L.) mexicana, L. (Viannia) lainsoni, L. (V.) braziliensis, L. (V.) guyanensis, L. (V.) naiffi and L. (V.) shawi, and three species found in Eurasia and Africa, including L. (L.) tropica, L. (L.) donovani and L. (L.) major. In addition, we tested DNA samples obtained from standard promastigote culture, naturally infected phlebotomines, experimentally infected mice and clinical human samples to validate the proposed protocol. HRM analysis of hsp70 amplicons is a fast and robust strategy that allowed for the detection and discrimination of all Leishmania species responsible for the Leishmaniases in Brazil and Eurasia/Africa with high sensitivity and accuracy. This method could detect less than one parasite per reaction, even in the presence of host DNA.

  7. [Applications of DNA methylation markers in forensic medicine].

    PubMed

    Zhao, Gui-sen; Yang, Qing-en

    2005-02-01

    DNA methylation is a post-replication modification that is predominantly found in cytosines of the dinucleotide sequence CpG. Epigenetic information is stored in the distribution of the modified base 5-methylcytosine. DNA methylation profiles represent a more chemically and biologically stable source of molecular diagnostic information than RNA or most proteins. Recent advances attest to the great promise of DNA methylation markers as powerful future tools in the clinic. In the past decade, DNA methylation analysis has been revolutionized by two technological advances--bisulphite modification of DNA and methylation-specific polymerase chain reaction (MSP). The methylation pattern of human genome is space-time specific, sex-specific, parent-of-origin specific and disease specific, providing us an alternative way to solve forensic problems.

  8. New polymer systems: Chain extension by dianhydrides

    NASA Technical Reports Server (NTRS)

    Rhein, R. A.; Ingham, J. D.

    1972-01-01

    The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.

  9. The Effect of Isotopic Substitution on Quantum Proton Transfer Across Short Water Bridges in Biological Systems

    NASA Astrophysics Data System (ADS)

    Blazejewski, Jacob; Schultz, Chase; Mazzuca, James

    2015-03-01

    Many biological systems utilize water chains to transfer charge over long distances by means of an excess proton. This study examines how quantum effects impact these reactions in a small model system. The model consists of a water molecule situated between an imidazole donor and acceptor group, which simulate a fixed amino acid backbone. A one dimensional energy profile is evaluated using density functional theory at the 6-31G*/B3LYP level, which generates a barrier with a width of 0.6 Å and a height of 20.7 kcal/mol. Quantum transmission probability is evaluated by solving the time dependent Schrödinger equation on a grid. Isotopic effects are examined by performing calculations with both hydrogen and deuterium. The ratio of hydrogen over the deuterium shows a 130-fold increase in transmission probability at low temperatures. This indicates a substantial quantum tunneling effect. The study of higher dimensional systems as well as increasing the number of water molecules in the chain will be necessary to fully describe the proton transfer process. Alma College Provost's Office.

  10. In vitro fermentation behaviors of fucosylated chondroitin sulfate from Pearsonothuria graeffei by human gut microflora.

    PubMed

    Wei, Chao-Yang; Liao, Ning-Bo; Zhang, Yu; Ye, Xing-Qian; Li, Shan; Hu, Ya-Qin; Liu, Dong-Hong; Linhardt, Robert J; Wang, Xin; Chen, Shi-Guo

    2017-09-01

    A fucosylated chondroitin sulfate (FCS-pg) with highly repeated structure from Pearsonothuria graeffei was subjected to a in vitro fermentation model to investigate its fermentability and effects on human gut microflora. High performance liquid chromatography (HPLC) measurement found FCS-pg can be fermented to short chain fatty acids (SCFAs) by gut microflora from partial human fecal samples. 16S rRNA gene-based polymerase chain reaction-based denaturing gradient gel electrophoresis (PCR-DGGE) profiling and real-time quantitative PCR analysis showed that FCS-pg mainly increased the proportions of Clostridium cluster XI, Bacteriodes prevotella group, Bifidobacterium genus, Clostridium cluster I and Clostridium cluster XIVab, whereas the numbers of the Enterobacteriaceae and Lactobacillus decreased. These results indicated that FCS-pg was mainly fermented by Bacteroides, Bifidobacterium and Clostridium. It increased the content of probiotics bacteria in achieving health-enhancing effect, was slightly different than most sulfated polysaccharides from marine animals. The current study provides useful new information on the mechanism of absorption and functional activity on FCS-pg within the gastrointestinal tract of the human body. Copyright © 2017. Published by Elsevier B.V.

  11. Fine tuning of coenzyme specificity in family 2 aldo-keto reductases revealed by crystal structures of the Lys-274 → Arg mutant of Candida tenuis xylose reductase (AKR2B5) bound to NAD + and NADP +

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leitgeb, Stefan; Petschacher, Barbara; Wilson, David K.

    2005-01-11

    Aldo-keto reductases of family 2 employ single site replacement Lys → Arg to switch their cosubstrate preference from NADPH to NADH. X-ray crystal structures of Lys-274 → Arg mutant of Candida tenuis xylose reductase (AKR2B5) bound to NAD + and NADP + were determined at a resolution of 2.4 and 2.3 Å, respectively. Due to steric conflicts in the NADP +-bound form, the arginine side chain must rotate away from the position of the original lysine side chain, thereby disrupting a network of direct and water-mediated interactions between Glu-227, Lys-274 and the cofactor 2'-phosphate and 3'-hydroxy groups. Because anchoring contactsmore » of its Glu-227 are lost, the coenzyme-enfolding loop that becomes ordered upon binding of NAD(P) + in the wild-type remains partly disordered in the NADP +-bound mutant. The results delineate a catalytic reaction profile for the mutant in comparison to wild-type.« less

  12. Integrating uncertainty propagation in GNSS radio occultation retrieval: from excess phase to atmospheric bending angle profiles

    NASA Astrophysics Data System (ADS)

    Schwarz, Jakob; Kirchengast, Gottfried; Schwaerz, Marc

    2018-05-01

    Global Navigation Satellite System (GNSS) radio occultation (RO) observations are highly accurate, long-term stable data sets and are globally available as a continuous record from 2001. Essential climate variables for the thermodynamic state of the free atmosphere - such as pressure, temperature, and tropospheric water vapor profiles (involving background information) - can be derived from these records, which therefore have the potential to serve as climate benchmark data. However, to exploit this potential, atmospheric profile retrievals need to be very accurate and the remaining uncertainties quantified and traced throughout the retrieval chain from raw observations to essential climate variables. The new Reference Occultation Processing System (rOPS) at the Wegener Center aims to deliver such an accurate RO retrieval chain with integrated uncertainty propagation. Here we introduce and demonstrate the algorithms implemented in the rOPS for uncertainty propagation from excess phase to atmospheric bending angle profiles, for estimated systematic and random uncertainties, including vertical error correlations and resolution estimates. We estimated systematic uncertainty profiles with the same operators as used for the basic state profiles retrieval. The random uncertainty is traced through covariance propagation and validated using Monte Carlo ensemble methods. The algorithm performance is demonstrated using test day ensembles of simulated data as well as real RO event data from the satellite missions CHAllenging Minisatellite Payload (CHAMP); Constellation Observing System for Meteorology, Ionosphere, and Climate (COSMIC); and Meteorological Operational Satellite A (MetOp). The results of the Monte Carlo validation show that our covariance propagation delivers correct uncertainty quantification from excess phase to bending angle profiles. The results from the real RO event ensembles demonstrate that the new uncertainty estimation chain performs robustly. Together with the other parts of the rOPS processing chain this part is thus ready to provide integrated uncertainty propagation through the whole RO retrieval chain for the benefit of climate monitoring and other applications.

  13. Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

    PubMed

    Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

    2014-07-24

    This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

  14. Supply chain optimization: a practitioner's perspective on the next logistics breakthrough.

    PubMed

    Schlegel, G L

    2000-08-01

    The objective of this paper is to profile a practitioner's perspective on supply chain optimization and highlight the critical elements of this potential new logistics breakthrough idea. The introduction will briefly describe the existing distribution network, and business environment. This will include operational statistics, manufacturing software, and hardware configurations. The first segment will cover the critical success factors or foundations elements that are prerequisites for success. The second segment will give you a glimpse of a "working game plan" for successful migration to supply chain optimization. The final segment will briefly profile "bottom-line" benefits to be derived from the use of supply chain optimization as a strategy, tactical tool, and competitive advantage.

  15. Correcting false positive medium-chain acyl-CoA dehydrogenase deficiency results from newborn screening; synthesis, purification, and standardization of branched-chain C8 acylcarnitines for use in their selective and accurate absolute quantitation by UHPLC-MS/MS.

    PubMed

    Minkler, Paul E; Stoll, Maria S K; Ingalls, Stephen T; Hoppel, Charles L

    2017-04-01

    While selectively quantifying acylcarnitines in thousands of patient samples using UHPLC-MS/MS, we have occasionally observed unidentified branched-chain C8 acylcarnitines. Such observations are not possible using tandem MS methods, which generate pseudo-quantitative acylcarnitine "profiles". Since these "profiles" select for mass alone, they cannot distinguish authentic signal from isobaric and isomeric interferences. For example, some of the samples containing branched-chain C8 acylcarnitines were, in fact, expanded newborn screening false positive "profiles" for medium-chain acyl-CoA dehydrogenase deficiency (MCADD). Using our fast, highly selective, and quantitatively accurate UHPLC-MS/MS acylcarnitine determination method, we corrected the false positive tandem MS results and reported the sample results as normal for octanoylcarnitine (the marker for MCADD). From instances such as these, we decided to further investigate the presence of branched-chain C8 acylcarnitines in patient samples. To accomplish this, we synthesized and chromatographically characterized several branched-chain C8 acylcarnitines (in addition to valproylcarnitine): 2-methylheptanoylcarnitine, 6-methylheptanoylcarnitine, 2,2-dimethylhexanoylcarnitine, 3,3-dimethylhexanoylcarnitine, 3,5-dimethylhexanoylcarnitine, 2-ethylhexanoylcarnitine, and 2,4,4-trimethylpentanoylcarnitine. We then compared their behavior with branched-chain C8 acylcarnitines observed in patient samples and demonstrated our ability to chromographically resolve, and thus distinguish, octanoylcarnitine from branched-chain C8 acylcarnitines, correcting false positive MCADD results from expanded newborn screening. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Sleeve reaction chamber system

    DOEpatents

    Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  17. Doubly self-consistent field theory of grafted polymers under simple shear in steady state.

    PubMed

    Suo, Tongchuan; Whitmore, Mark D

    2014-03-21

    We present a generalization of the numerical self-consistent mean-field theory of polymers to the case of grafted polymers under simple shear. The general theoretical framework is presented, and then applied to three different chain models: rods, Gaussian chains, and finitely extensible nonlinear elastic (FENE) chains. The approach is self-consistent at two levels. First, for any flow field, the polymer density profile and effective potential are calculated self-consistently in a manner similar to the usual self-consistent field theory of polymers, except that the calculation is inherently two-dimensional even for a laterally homogeneous system. Second, through the use of a modified Brinkman equation, the flow field and the polymer profile are made self-consistent with respect to each other. For all chain models, we find that reasonable levels of shear cause the chains to tilt, but it has very little effect on the overall thickness of the polymer layer, causing a small decrease for rods, and an increase of no more than a few percent for the Gaussian and FENE chains. Using the FENE model, we also probe the individual bond lengths, bond correlations, and bond angles along the chains, the effects of the shear on them, and the solvent and bonded stress profiles. We find that the approximations needed within the theory for the Brinkman equation affect the bonded stress, but none of the other quantities.

  18. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    PubMed

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  19. Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

    USDA-ARS?s Scientific Manuscript database

    Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

  20. MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

    DOEpatents

    Wigner, E.P.; Weinberg, A.M.

    1961-01-24

    A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

  1. DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

    EPA Science Inventory

    This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

  2. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  3. Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

    PubMed

    Adewale, B; Mafe, M A; Oyerinde, J P O

    2005-01-01

    Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

  4. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    PubMed

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

  5. [The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

    PubMed

    Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

    2014-04-01

    The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

  6. Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

    PubMed Central

    Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

    2014-01-01

    A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

  7. Safety of medium-chain triglycerides used as an intraocular tamponading agent in an experimental vitrectomy model rabbit.

    PubMed

    Auriol, Sylvain; Mahieu, Laurence; Brousset, Pierre; Malecaze, François; Mathis, Véronique

    2013-01-01

    To evaluate safety of medium-chain triglycerides used as a possible intraocular tamponading agent. A 20-gauge pars plana vitrectomy was performed in the right eye of 28 rabbits. An ophthalmologic examination was performed every week until rabbits were killed. At days 7, 30, 60, and 90, rabbits were killed and the treated eyes were examined macroscopically and prepared for histologic examination. Principal outcome was retinal toxicity evaluated by light and electron microscopy, and secondary outcomes were the presence of medium-chain triglyceride emulsification, inflammatory reactions, and the development of cataract. Histologic examination did not reveal any retinal toxicity. Two cases of moderate emulsification were observed, but in these cases, emulsification was caused by the perioperative injection of the agent and did not increase during the postoperative period. We noted 13 cases of inflammatory reaction in vitreous cavity and no case of inflammatory reaction in anterior chamber. Two eyes developed cataract as a result of perioperative trauma to the lens with the vitreous cutter and not secondary to the presence of medium-chain triglycerides in the vitreous cavity. Medium-chain triglycerides did not induce morphologic evidence of retinal toxicity. The results suggest that medium-chain triglycerides could be a promising alternative intraocular tamponading agent for the treatment of retinal detachments.

  8. Identification and expression analysis of genes involved in early ovary development in diploid gynogenetic hybrids of red crucian carp x common carp.

    PubMed

    Liu, Dong; Liu, Shaojun; You, Cuiping; Chen, Lin; Liu, Zhen; Liu, Liangguo; Wang, Jing; Liu, Yun

    2010-04-01

    Diploid eggs of allotetraploid hybrids (red crucian carp female symbol x common carp male symbol), when activated by UV-irradiated sperm of scatter scale carp, can develop into diploid progenies without chromosome duplication treatment. Diploid progenies produce diploid eggs, which develop into diploid population by the same way. To understand the molecular mechanism underlying the production of diploid eggs by the diploid fish, we constructed a forward suppression subtractive hybridization complementary DNA (cDNA) library. The cDNAs from the ovary in proliferation phase were employed as the "tester," and those in growth phase were used as the "driver." Seventy-three cDNA clones that are specifically expressed in proliferation phase were detected by dot-blot hybridization. Sequencing analyses revealed that several of these cDNAs have high homologies to the known sequences in the NCBI database. Their encoded proteins include the protein preventing mitosis catastrophe (PMC), the signal recognition particle 9, the ATP-binding cassette transporter, the glucanase-xylanase fusion protein, and others. These genes were confirmed by reverse transcriptase-polymerase chain reaction. The expression profile of the PMC gene at different time points was analyzed by quantitative real-time polymerase chain reaction. The results indicated that the expression of this suppression subtractive hybridization-identified gene changed during the time course, corresponding with the cellular phenomenon in the ovary development. Our studies provide insights into the molecular mechanism underlying the ovary development of diploid gynogenetic fish.

  9. Selection and Validation of Reference Genes for Quantitative Real-Time Polymerase Chain Reaction Studies in Mossy Maze Polypore, Cerrena unicolor (Higher Basidiomycetes).

    PubMed

    Yang, Jie; Lin, Qi; Lin, Juan; Ye, Xiuyun

    2016-01-01

    With its ability to produce ligninolytic enzymes such as laccases, white-rot basidiomycete Cerrena unicolor, a medicinal mushroom, has great potential in biotechnology. Elucidation of the expression profiles of genes encoding ligninolytic enzymes are important for increasing their production. Quantitative real-time polymerase chain reaction (qPCR) is a powerful tool to study transcriptional regulation of genes of interest. To ensure accuracy and reliability of qPCR analysis of C. unicolor, expression levels of seven candidate reference genes were studied at different growth phases, under various induction conditions, and with a range of carbon/nitrogen ratios and carbon and nitrogen sources. The stability of the genes were analyzed with five statistical approaches, namely geNorm, NormFinder, BestKeeper, the ΔCt method, and RefFinder. Our results indicated that the selection of reference genes varied with sample sets. A combination of four reference genes (Cyt-c, ATP6, TEF1, and β-tubulin) were recommended for normalizing gene expression at different growth phases. GAPDH and Cyt-c were the appropriate reference genes under different induction conditions. ATP6 and TEF1 were most stable in fermentation media with various carbon/nitrogen ratios. In the fermentation media with various carbon or nitrogen sources, 18S rRNA and GAPDH were the references of choice. The present study represents the first validation analysis of reference genes in C. unicolor and serves as a foundation for its qPCR analysis.

  10. Diagnostic application of polymerase chain reaction for detection of Ehrlichia risticii in equine monocytic ehrlichiosis (Potomac horse fever).

    PubMed

    Biswas, B; Mukherjee, D; Mattingly-Napier, B L; Dutta, S K

    1991-10-01

    Genomic amplification by the polymerase chain reaction (PCR) was used to identify a unique genomic sequence of Ehrlichia risticii directly in DNA isolated from peripheral-blood buffy coat cells of E. risticii-infected horses (Potomac horse fever) and from infected cell cultures. A specific primer pair, selected from a cloned, species-specific, 1-kb DNA fragment of the E. risticii genome as a template, was used for the amplification of the target DNA of 247 bp. The optimal number of 40 PCR cycles, determined by analyzing an amplification profile obtained with a constant Taq polymerase concentration, was used to achieve maximum amplification of the E. risticii DNA segment. Efficient amplification of target DNA was achieved with specimens processed by either the phenol extraction or rapid lysis method. The specificity of the amplified DNA product was confirmed by the proper size (247 bp) and appropriate restriction enzyme cleavage pattern of the amplified target DNA, as well as by the specific hybridization signal obtained by using a PCR-amplified 185-bp internal DNA probe. A 10(5)- to 10(6)-fold amplification of target DNA, which allowed detection of E. risticii from as few as two to three infected cells in culture and from a very small volume of buffy coat cells from infected horses, was achieved. This PCR amplification procedure was found to be highly specific and sensitive for the detection of E. risticii for the study of Potomac horse fever.

  11. Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

    PubMed

    Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

    2012-08-15

    Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Activation of RAS family genes in urothelial carcinoma.

    PubMed

    Boulalas, I; Zaravinos, A; Karyotis, I; Delakas, D; Spandidos, D A

    2009-05-01

    Bladder cancer is the fifth most common malignancy in men in Western society. We determined RAS codon 12 and 13 point mutations and evaluated mRNA expression levels in transitional cell carcinoma cases. Samples from 30 human bladder cancers and 30 normal tissues were analyzed by polymerase chain reaction/restriction fragment length polymorphism and direct sequencing to determine the occurrence of mutations in codons 12 and 13 of RAS family genes. Moreover, we used real-time reverse transcriptase-polymerase chain reaction to evaluate the expression profile of RAS genes in bladder cancer specimens compared to that in adjacent normal tissues. Overall H-RAS mutations in codon 12 were observed in 9 tumor samples (30%). Two of the 9 patients (22%) had invasive bladder cancer and 7 (77%) had noninvasive bladder cancer. One H-RAS mutation (11%) was homozygous and the remaining 89% were heterozygous. All samples were WT for K and N-RAS oncogenes. Moreover, 23 of 30 samples (77%) showed over expression in at least 1 RAS family gene compared to adjacent normal tissue. K and N-RAS had the highest levels of over expression in bladder cancer specimens (50%), whereas 27% of transitional cell carcinomas demonstrated H-RAS over expression relative to paired normal tissues. Our results underline the importance of H-RAS activation in human bladder cancer by codon 12 mutations. Moreover, they provide evidence that increased expression of all 3 RAS genes is a common event in bladder cancer that is associated with disease development.

  13. Characterization of Gene Expression Phenotype in Amyotrophic Lateral Sclerosis Monocytes

    PubMed Central

    Zhao, Weihua; Beers, David R.; Hooten, Kristopher G.; Sieglaff, Douglas H.; Zhang, Aijun; Kalyana-Sundaram, Shanker; Traini, Christopher M.; Halsey, Wendy S.; Hughes, Ashley M.; Sathe, Ganesh M.; Livi, George P.; Fan, Guo-Huang

    2017-01-01

    Importance Amyotrophic lateral sclerosis (ALS) is a common adult-onset neurodegenerative disease characterized by selective loss of upper and lower motor neurons. Patients with ALS have persistent peripheral and central inflammatory responses including abnormally functioning T cells and activated microglia. However, much less is known about the inflammatory gene profile of circulating innate immune monocytes in these patients. Objective To characterize the transcriptomics of peripheral monocytes in patients with ALS. Design, Setting, and Participants Monocytes were isolated from peripheral blood of 43 patients with ALS and 22 healthy control individuals. Total RNA was extracted from the monocytes and subjected to deep RNA sequencing, and these results were validated by quantitative reverse transcription polymerase chain reaction. Main Outcomes and Measures The differential expressed gene signatures of these monocytes were identified using unbiased RNA sequencing strategy for gene expression profiling. Results The demographics between the patients with ALS (mean [SD] age, 58.8 [1.57] years; 55.8% were men and 44.2% were women; 90.7% were white, 4.65% were Hispanic, 2.33% were black, and 2.33% were Asian) and control individuals were similar (mean [SD] age, 57.6 [2.15] years; 50.0% were men and 50.0% were women; 90.9% were white, none were Hispanic, none were black, and 9.09% were Asian). RNA sequencing data from negative selected monocytes revealed 233 differential expressed genes in ALS monocytes compared with healthy control monocytes. Notably, ALS monocytes demonstrated a unique inflammation-related gene expression profile, the most prominent of which, including IL1B, IL8, FOSB, CXCL1, and CXCL2, were confirmed by quantitative reverse transcription polymerase chain reaction (IL8, mean [SE], 1.00 [0.18]; P = .002; FOSB, 1.00 [0.21]; P = .009; CXCL1, 1.00 [0.14]; P = .002; and CXCL2, 1.00 [0.11]; P = .01). Amyotrophic lateral sclerosis monocytes from rapidly progressing patients had more proinflammatory DEGs than monocytes from slowly progressing patients. Conclusions and Relevance Our data indicate that ALS monocytes are skewed toward a proinflammatory state in the peripheral circulation and may play a role in ALS disease progression, especially in rapidly progressing patients. This increased inflammatory response of peripheral immune cells may provide a potential target for disease-modifying therapy in patients with ALS. PMID:28437540

  14. Greenhouse gas and carbon profile of the U.S. forest products industry value chain

    Treesearch

    Linda S. Heath; Van Maltby; Reid Miner; Kenneth E. Skog; James E. Smith; Jay Unwin; Brad Upton

    2010-01-01

    A greenhouse gas and carbon accounting profile was developed for the U.S. forest products industry value chain for 1990 and 2004-2005 by examining net atmospheric fluxes of CO2 and other greenhouse gases (GHGs) using a variety of methods and data sources. Major GHG emission sources include direct and indirect (from purchased electricity...

  15. Neutron-deficient superheavy nuclei obtained in the 240Pu+48Ca reaction

    NASA Astrophysics Data System (ADS)

    Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu. Ts.; Rykaczewski, K. P.; Abdullin, F. Sh.; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu. S.; Voinov, A. A.; Subbotin, V. G.; Sukhov, A. M.; Karpov, A. V.; Popeko, A. G.; Sabel'nikov, A. V.; Svirikhin, A. I.; Vostokin, G. K.; Hamilton, J. H.; Kovrizhnykh, N. D.; Schlattauer, L.; Stoyer, M. A.; Gan, Z.; Huang, W. X.; Ma, L.

    2018-01-01

    We present new results from investigations of the 240Pu+48Ca reaction at a projectile energy of 250 MeV. Three new decay chains of 285Fl were detected with decay properties mostly consistent with those measured in earlier studies. An additional chain was observed where the nuclei may decay through energy levels different from those of the other six chains registered so far. The cross section of the 240Pu(48Ca,3 n )285Fl reaction was measured to be 0 .58-0.33+0.60pb , which is a factor of about 4-5 lower than that measured in the previous experiment at 245 MeV beam energy [V. K. Utyonkov et al., Phys. Rev. C 92, 034609 (2015)., 10.1103/PhysRevC.92.034609], consistent with expectations. The origin of an additional chain consisting of a recoil, α particle, and fission event is analyzed. The assignment of 25 short-lived SF events observed in this experiment is also discussed.

  16. Autocatalytic formation of an iron(IV)-oxo complex via scandium ion-promoted radical chain autoxidation of an iron(II) complex with dioxygen and tetraphenylborate.

    PubMed

    Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi

    2014-06-04

    A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.

  17. Unique plasma metabolomic signatures of individuals with inherited disorders of long-chain fatty acid oxidation

    USDA-ARS?s Scientific Manuscript database

    Blood and urine acylcarnitine profiles are commonly used to diagnose long-chain fatty acid oxidation disorders (FAOD: i.e., long-chain hydroxy-acyl-CoA dehydrogenase [LCHAD] and carnitine palmitoyltransferase 2 [CPT2] deficiency), but the global metabolic impact of long-chain FAOD has not been repor...

  18. 77 FR 17001 - USDA Public Stakeholder Meeting: Match Making in the Biofuels Value Chain

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-23

    ... to improve awareness and increase understanding of the biofuels supply chain links between all those.... At this meeting, federal officials will provide a short profile of each section of the supply chain... that outline their experiences in that respective supply chain sector, barriers and lessons learned...

  19. Association between Metabolite Profiles, Metabolic Syndrome and Obesity Status.

    PubMed

    Allam-Ndoul, Bénédicte; Guénard, Frédéric; Garneau, Véronique; Cormier, Hubert; Barbier, Olivier; Pérusse, Louis; Vohl, Marie-Claude

    2016-05-27

    Underlying mechanisms associated with the development of abnormal metabolic phenotypes among obese individuals are not yet clear. Our aim is to investigate differences in plasma metabolomics profiles between normal weight (NW) and overweight/obese (Ov/Ob) individuals, with or without metabolic syndrome (MetS). Mass spectrometry-based metabolite profiling was used to compare metabolite levels between each group. Three main principal components factors explaining a maximum of variance were retained. Factor 1's (long chain glycerophospholipids) metabolite profile score was higher among Ov/Ob with MetS than among Ov/Ob and NW participants without MetS. This factor was positively correlated to plasma total cholesterol (total-C) and triglyceride levels in the three groups, to high density lipoprotein -cholesterol (HDL-C) among participants without MetS. Factor 2 (amino acids and short to long chain acylcarnitine) was positively correlated to HDL-C and negatively correlated with insulin levels among NW participants. Factor 3's (medium chain acylcarnitines) metabolite profile scores were higher among NW participants than among Ov/Ob with or without MetS. Factor 3 was negatively associated with glucose levels among the Ov/Ob with MetS. Factor 1 seems to be associated with a deteriorated metabolic profile that corresponds to obesity, whereas Factors 2 and 3 seem to be rather associated with a healthy metabolic profile.

  20. Density profiles around A+B→C reaction-diffusion fronts in partially miscible systems: A general classification.

    PubMed

    Loodts, V; Trevelyan, P M J; Rongy, L; De Wit, A

    2016-10-01

    Various spatial density profiles can develop in partially miscible stratifications when a phase A dissolves with a finite solubility into a host phase containing a dissolved reactant B. We investigate theoretically the impact of an A+B→C reaction on such density profiles in the host phase and classify them in a parameter space spanned by the ratios of relative contributions to density and diffusion coefficients of the chemical species. While the density profile is either monotonically increasing or decreasing in the nonreactive case, reactions combined with differential diffusivity can create eight different types of density profiles featuring up to two extrema in density, at the reaction front or below it. We use this framework to predict various possible hydrodynamic instability scenarios inducing buoyancy-driven convection around such reaction fronts when they propagate parallel to the gravity field.

  1. Terminal alkenes as versatile chemical reporter groups for metabolic oligosaccharide engineering.

    PubMed

    Späte, Anne-Katrin; Schart, Verena F; Schöllkopf, Sophie; Niederwieser, Andrea; Wittmann, Valentin

    2014-12-08

    The Diels-Alder reaction with inverse electron demand (DAinv reaction) of 1,2,4,5-tetrazines with electron rich or strained alkenes was proven to be a bioorthogonal ligation reaction that proceeds fast and with high yields. An important application of the DAinv reaction is metabolic oligosaccharide engineering (MOE) which allows the visualization of glycoconjugates in living cells. In this approach, a sugar derivative bearing a chemical reporter group is metabolically incorporated into cellular glycoconjugates and subsequently derivatized with a probe by means of a bioorthogonal ligation reaction. Here, we investigated a series of new mannosamine and glucosamine derivatives with carbamate-linked side chains of varying length terminated by alkene groups and their suitability for labeling cell-surface glycans. Kinetic investigations showed that the reactivity of the alkenes in DAinv reactions increases with growing chain length. When applied to MOE, one of the compounds, peracetylated N-butenyloxycarbonylmannosamine, was especially well suited for labeling cell-surface glycans. Obviously, the length of its side chain represents the optimal balance between incorporation efficiency and speed of the labeling reaction. Sialidase treatment of the cells before the bioorthogonal labeling reaction showed that this sugar derivative is attached to the glycans in form of the corresponding sialic acid derivative and not epimerized to another hexosamine derivative to a considerable extent. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Factors affecting variations in the detailed fatty acid profile of Mediterranean buffalo milk determined by 2-dimensional gas chromatography.

    PubMed

    Pegolo, S; Stocco, G; Mele, M; Schiavon, S; Bittante, G; Cecchinato, A

    2017-04-01

    Buffalo milk is the world's second most widely produced milk, and increasing attention is being paid to its composition, particularly the fatty acid profile. The objectives of the present study were (1) to characterize the fatty acid composition of Mediterranean buffalo milk, and (2) to investigate potential sources of variation in the buffalo milk fatty acid profile. We determined the profile of 69 fatty acid traits in 272 individual samples of Mediterranean buffalo milk using gas chromatography. In total, 51 individual fatty acids were identified: 24 saturated fatty acids, 13 monounsaturated fatty acids, and 14 polyunsaturated fatty acids. The major individual fatty acids in buffalo milk were in the order 16:0, 18:1 cis-9, 14:0, and 18:0. Saturated fatty acids were the predominant fraction in buffalo milk fat (70.49%); monounsaturated and polyunsaturated fatty acids were at 25.95 and 3.54%, respectively. Adopting a classification based on carbon-chain length, we found that medium-chain fatty acids (11-16 carbons) represented the greater part (53.7%) of the fatty acid fraction of buffalo milk, whereas long-chain fatty acids (17-24 carbons) and short-chain fatty acids (4-10 carbons) accounted for 32.73 and 9.72%, respectively. The n-3 and n-6 fatty acids were 0.46 and 1.77%, respectively. The main conjugated linoleic acid, rumenic acid, represented 0.45% of total milk fatty acids. Herd/test date and stage of lactation were confirmed as important sources of variation in the fatty acid profile of buffalo milk. The percentages of short-chain and medium-chain fatty acids in buffalo milk increased in early lactation (+0.6 and +3.5%, respectively), whereas long-chain fatty acids decreased (-4.2%). The only exception to this pattern was butyric acid, which linearly decreased from the beginning of lactation, confirmation that its synthesis is independent of malonyl-CoA. These results seem to suggest that in early lactation the mobilization of energy reserves may have less influence on the fatty acid profile of buffalo milk than that of cow milk, probably due to a shorter and less severe period of negative energy balance. Parity affected the profiles of a few traits and had the most significant effects on branched-chain fatty acids. This work provided a detailed overview of the fatty acid profile in buffalo milk including also those fatty acids present in small concentrations, which may have beneficial effects for human health. Our results contributed also to increase the knowledge about the effects of some of the major factors affecting buffalo production traits and fatty acid concentrations in milk, and consequently its technological and nutritional properties. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  3. Phylogenetic and experimental characterization of an acyl-ACP thioesterase family reveals significant diversity in enzymatic specificity and activity.

    PubMed

    Jing, Fuyuan; Cantu, David C; Tvaruzkova, Jarmila; Chipman, Jay P; Nikolau, Basil J; Yandeau-Nelson, Marna D; Reilly, Peter J

    2011-08-10

    Acyl-acyl carrier protein thioesterases (acyl-ACP TEs) catalyze the hydrolysis of the thioester bond that links the acyl chain to the sulfhydryl group of the phosphopantetheine prosthetic group of ACP. This reaction terminates acyl chain elongation of fatty acid biosynthesis, and in plant seeds it is the biochemical determinant of the fatty acid compositions of storage lipids. To explore acyl-ACP TE diversity and to identify novel acyl ACP-TEs, 31 acyl-ACP TEs from wide-ranging phylogenetic sources were characterized to ascertain their in vivo activities and substrate specificities. These acyl-ACP TEs were chosen by two different approaches: 1) 24 TEs were selected from public databases on the basis of phylogenetic analysis and fatty acid profile knowledge of their source organisms; and 2) seven TEs were molecularly cloned from oil palm (Elaeis guineensis), coconut (Cocos nucifera) and Cuphea viscosissima, organisms that produce medium-chain and short-chain fatty acids in their seeds. The in vivo substrate specificities of the acyl-ACP TEs were determined in E. coli. Based on their specificities, these enzymes were clustered into three classes: 1) Class I acyl-ACP TEs act primarily on 14- and 16-carbon acyl-ACP substrates; 2) Class II acyl-ACP TEs have broad substrate specificities, with major activities toward 8- and 14-carbon acyl-ACP substrates; and 3) Class III acyl-ACP TEs act predominantly on 8-carbon acyl-ACPs. Several novel acyl-ACP TEs act on short-chain and unsaturated acyl-ACP or 3-ketoacyl-ACP substrates, indicating the diversity of enzymatic specificity in this enzyme family. These acyl-ACP TEs can potentially be used to diversify the fatty acid biosynthesis pathway to produce novel fatty acids.

  4. Phylogenetic and experimental characterization of an acyl-ACP thioesterase family reveals significant diversity in enzymatic specificity and activity

    PubMed Central

    2011-01-01

    Background Acyl-acyl carrier protein thioesterases (acyl-ACP TEs) catalyze the hydrolysis of the thioester bond that links the acyl chain to the sulfhydryl group of the phosphopantetheine prosthetic group of ACP. This reaction terminates acyl chain elongation of fatty acid biosynthesis, and in plant seeds it is the biochemical determinant of the fatty acid compositions of storage lipids. Results To explore acyl-ACP TE diversity and to identify novel acyl ACP-TEs, 31 acyl-ACP TEs from wide-ranging phylogenetic sources were characterized to ascertain their in vivo activities and substrate specificities. These acyl-ACP TEs were chosen by two different approaches: 1) 24 TEs were selected from public databases on the basis of phylogenetic analysis and fatty acid profile knowledge of their source organisms; and 2) seven TEs were molecularly cloned from oil palm (Elaeis guineensis), coconut (Cocos nucifera) and Cuphea viscosissima, organisms that produce medium-chain and short-chain fatty acids in their seeds. The in vivo substrate specificities of the acyl-ACP TEs were determined in E. coli. Based on their specificities, these enzymes were clustered into three classes: 1) Class I acyl-ACP TEs act primarily on 14- and 16-carbon acyl-ACP substrates; 2) Class II acyl-ACP TEs have broad substrate specificities, with major activities toward 8- and 14-carbon acyl-ACP substrates; and 3) Class III acyl-ACP TEs act predominantly on 8-carbon acyl-ACPs. Several novel acyl-ACP TEs act on short-chain and unsaturated acyl-ACP or 3-ketoacyl-ACP substrates, indicating the diversity of enzymatic specificity in this enzyme family. Conclusion These acyl-ACP TEs can potentially be used to diversify the fatty acid biosynthesis pathway to produce novel fatty acids. PMID:21831316

  5. Unit and internal chain profile of African rice (Oryza glaberrima) amylopectin.

    PubMed

    Gayin, Joseph; Abdel-Aal, El-Sayed M; Manful, John; Bertoft, Eric

    2016-02-10

    High-performance anion-exchange chromatography was used to study the unit chain profiles of amylopectins and their φ,β-limit dextrins from two African rice (Oryza glaberrima) accessions-TOG 12440 and IRGC 103759. The samples were compared with two Asian rice (Oryza sativa) samples (cv Koshihikari and cv WITA 4) and one O. sativa × O. glaberrima cross (NERICA 4). The ratio of short:long chains ranged between 12.1 and 13.8, and the ratio of A:B-chains was ∼ 1.0 in all samples. A significant difference was observed in the distribution of internal chains with regards to the proportion of short "fingerprint" B-chains (Bfp-chains), which in the φ,β-limit dextrins have a degree of polymerization (DP) 3-7. The African rice starches and NERICA 4 had higher levels of Bfp-chains, but the major group of short B-chains (DP 8-25) was similar to that of the Asian rice samples. The average chain length (CL), internal chain length (ICL), and total internal chain length (TICL) were similar in all samples. However, the external chain length (ECL) was longer in the African rice samples and NERICA 4. ECL correlated positively and significantly (p<0.05) with gelatinization transition temperatures and enthalpy suggesting differences between the two rice types in cooking properties. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Method for polymer synthesis in a reaction well

    DOEpatents

    Brennan, Thomas M.

    1998-01-01

    A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

  7. Method for polymer synthesis in a reaction well

    DOEpatents

    Brennan, T.M.

    1998-09-29

    A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

  8. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

    PubMed Central

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

  9. Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

    Treesearch

    David E. Schreiber; Karen J. Garner; James M. Slavicek

    1997-01-01

    Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

  10. The Beta-Delayed Proton and Gamma Decay of 27P for Nuclear Astrophysics

    NASA Astrophysics Data System (ADS)

    McCleskey, E.; Banu, A.; McCleskey, M.; Roeder, B.; Saastamoinen, A.; Spiridon, A.; Trache, L.; Tribble, R. E.; Davinson, T.; Doherty, D.; Lotay, G. J.; Wallace, J.; Woods, P. J.

    2013-10-01

    The main creation site of 26Al is currently under debate. The reactions for its creation or destruction are also not completely known. When 26Al is created in novae, the reaction chain is: 24Mg(p,γ)25Al(β + v)25Mg(p,γ)26Al, but this chain can be by-passed by another chain: 25Al(p,γ)26Si(p,γ)27P and it can also be destroyed directly. Another way to by-pass it is through 26mAl(p,γ)27Si* which is dominated by resonant capture. Using the Momentum Achromat Recoil Spectrometer (MARS) at the Texas A&M Cyclotron Institute and inverse kinematics, this destruction reaction was studied by the beta-delayed proton and gamma decay of 27P. Due to selection rules, states populated above the proton threshold in the compound system (27Si*) can decay to 26mAl, which are the states of interest for the capture reaction. James Madison University, VA, USA.

  11. MicroRNA Changes in Cerebrospinal Fluid After Subarachnoid Hemorrhage

    PubMed Central

    Rasmussen, Rune; Rossing, Maria; Laigaard, Finn Pedersen; Nielsen, Finn Cilius; Møller, Kirsten

    2017-01-01

    Background and Purpose— Delayed cerebral ischemia (DCI) accounts for a major part of the morbidity and mortality after aneurysmal subarachnoid hemorrhage (SAH). MicroRNAs (miRNAs) are pathophysiologically involved in acute cerebral ischemia. This study compared miRNA profiles in cerebrospinal fluid from neurologically healthy patients, as well as SAH patients with and without subsequent development of DCI. Methods— In a prospective case–control study of SAH patients treated with external ventricular drainage and neurologically healthy patients, miRNA profiles in cerebrospinal fluid were screened and validated using 2 different high-throughput real-time quantification polymerase chain reaction techniques. The occurrence of DCI was documented in patient charts and subsequently reviewed independently by 2 physicians. Results— MiRNA profiles from 27 SAH patients and 10 neurologically healthy patients passed quality control. In the validation, 66 miRNAs showed a relative increase in cerebrospinal fluid from SAH patients compared with neurologically healthy patients (P<0.001); 2 (miR-21 and miR-221) showed a relative increase in SAH patients with DCI compared with those without (P<0.05) in both the screening and validation. Conclusions— SAH is associated with marked changes in the cerebrospinal fluid miRNA profile. These changes could be associated to the development of DCI. Clinical Trial Registration— URL: http://www.clinicaltrials.gov. Unique identifier: NCT01791257. PMID:28768799

  12. Direct-to-PCR tissue preservation for DNA profiling.

    PubMed

    Sorensen, Amy; Berry, Clare; Bruce, David; Gahan, Michelle Elizabeth; Hughes-Stamm, Sheree; McNevin, Dennis

    2016-05-01

    Disaster victim identification (DVI) often occurs in remote locations with extremes of temperatures and humidities. Access to mortuary facilities and refrigeration are not always available. An effective and robust DNA sampling and preservation procedure would increase the probability of successful DNA profiling and allow faster repatriation of bodies and body parts. If the act of tissue preservation also released DNA into solution, ready for polymerase chain reaction (PCR), the DVI process could be further streamlined. In this study, we explored the possibility of obtaining DNA profiles without DNA extraction, by adding aliquots of preservative solutions surrounding fresh human muscle and decomposing human muscle and skin tissue samples directly to PCR. The preservatives consisted of two custom preparations and two proprietary solutions. The custom preparations were a salt-saturated solution of dimethyl sulfoxide (DMSO) with ethylenediaminetetraacetic (EDTA) and TENT buffer (Tris, EDTA, NaCl, Tween 20). The proprietary preservatives were DNAgard (Biomatrica(®)) and Tissue Stabilising Kit (DNA Genotek). We obtained full PowerPlex(®) 21 (Promega) and GlobalFiler(®) (Life Technologies) DNA profiles from fresh and decomposed tissue preserved at 35 °C for up to 28 days for all four preservatives. The preservative aliquots removed from the fresh muscle tissue samples had been stored at -80 °C for 4 years, indicating that long-term archival does not diminish the probability of successful DNA typing. Rather, storage at -80 °C seems to reduce PCR inhibition.

  13. An evaluation of direct PCR amplification

    PubMed Central

    Hall, Daniel E.; Roy, Reena

    2014-01-01

    Aim To generate complete DNA profiles from blood and saliva samples deposited on FTA® and non-FTA® paper substrates following a direct amplification protocol. Methods Saliva samples from living donors and blood samples from deceased individuals were deposited on ten different FTA® and non-FTA® substrates. These ten paper substrates containing body fluids were kept at room temperature for varying lengths of time ranging from one day to approximately one year. For all assays in this research, 1.2 mm punches were collected from each substrate containing one type of body fluid and amplified with reagents provided in the nine commercial polymerase chain reaction (PCR) amplification kits. The substrates were not subjected to purification reagent or extraction buffer prior to amplification. Results Success rates were calculated for all nine amplification kits and all ten substrates based on their ability to yield complete DNA profiles following a direct amplification protocol. Six out of the nine amplification kits, and four out of the ten paper substrates had the highest success rates overall. Conclusion The data show that it is possible to generate complete DNA profiles following a direct amplification protocol using both standard (non-direct) and direct PCR amplification kits. The generation of complete DNA profiles appears to depend more on the success of the amplification kit rather than the than the FTA®- or non-FTA®-based substrates. PMID:25559837

  14. Biochemical characteristics and gene expression profiles of two paralogous luciferases from the Japanese firefly Pyrocoelia atripennis (Coleoptera, Lampyridae, Lampyrinae): insight into the evolution of firefly luciferase genes.

    PubMed

    Bessho-Uehara, Manabu; Konishi, Kaori; Oba, Yuichi

    2017-08-09

    Two paralogous genes of firefly luciferase, Luc1 and Luc2, have been isolated from the species in two subfamilies, Luciolinae and Photurinae, of the family Lampyridae. The gene expression profiles have previously been examined only in the species of Luciolinae. Here we isolated Luc1 and Luc2 genes from the Japanese firefly Pyrocoelia atripennis. This is the first report of the presence of both Luc1 and Luc2 genes in the species of the subfamily Lampyrinae and of the exon-intron structure of Luc2 in the family Lampyridae. The luminescence of both gene products peaked at 547 nm under neutral buffer conditions, and the spectrum of Luc1, but not Luc2, was red-shifted under acidic conditions, as observed for Luc2 in the Luciolinae species. The semi-quantitative reverse transcription-polymerase chain reaction suggested that Luc1 was expressed in lanterns of all the stages except eggs, while Luc2 was expressed in the non-lantern bodies of eggs, prepupae, pupae, and female adults. These expression profiles are consistent with those in the Luciolinae species. Considering the distant phylogenetic relationship between Lampyrinae and Luciolinae in Lampyridae, we propose that fireflies generally possess two different luciferase genes and the biochemical properties and gene expression profiles for each paralog are conserved among lampyrid species.

  15. Early and late effects of prenatal corticosteroid treatment on the microRNA profiles of lung tissue in rats

    PubMed Central

    YU, HONG-REN; LI, SUNG-CHOU; TSENG, WAN-NING; TAIN, YOU-LIN; CHEN, CHIH-CHENG; SHEEN, JIUNN-MING; TIAO, MAO-MENG; KUO, HO-CHANG; HUANG, CHAO-CHENG; HSIEH, KAI-SHENG; HUANG, LI-TUNG

    2016-01-01

    Glucocorticoids have been administered to mothers at risk of premature delivery to induce maturation of preterm fetal lungs and prevent the development of respiratory distress syndrome. Micro (mi)RNAs serve various crucial functions in cell proliferation, differentiation and organ development; however, few studies have demonstrated an association between miRNAs and lung development. The aim of the present study was to investigate alterations in the miRNA profiles of rat lung tissue following prenatal glucocorticoid therapy for fetal lung development. The differences in miRNA expression profiles were compared between postnatal days 7 (D7) and 120 (D120) rat lung tissues, followed by validation using reverse transcription-quantitative polymerase chain reaction. The miRNA profiles of rat lung tissues following prenatal dexamethasone (DEX) therapy were also investigated. miRNAs with 2-fold changes were selected for further analysis. At D120, 6 upregulated and 6 downregulated miRNAs were detected, compared with D7. Among these differentially expressed miRNAs, miR-101-3p and miR-99b-5p were associated with the lowest and highest expressions of miRNA at D7, respectively. A limited impact on the miRNA profiles of rat lung tissues was observed following prenatal DEX treatment, which may help to further clarify the mechanisms underlying normal lung development. However, the results of the present study cannot entirely elucidate the effects of prenatal DEX treatment on the lung development of premature infants, and further studies investigating the impact of prenatal corticosteroids on fetal lung miRNA profiles are required. PMID:26997989

  16. Front dynamics and entanglement in the XXZ chain with a gradient

    NASA Astrophysics Data System (ADS)

    Eisler, Viktor; Bauernfeind, Daniel

    2017-11-01

    We consider the XXZ spin chain with a magnetic field gradient and study the profiles of the magnetization as well as the entanglement entropy. For a slowly varying field, it is shown that, by means of a local density approximation, the ground-state magnetization profile can be obtained with standard Bethe ansatz techniques. Furthermore, it is argued that the low-energy description of the theory is given by a Luttinger liquid with slowly varying parameters. This allows us to obtain a very good approximation of the entanglement profile using a recently introduced technique of conformal field theory in curved spacetime. Finally, the front dynamics is also studied after the gradient field has been switched off, following arguments of generalized hydrodynamics for integrable systems. While for the XX chain the hydrodynamic solution can be found analytically, the XXZ case appears to be more complicated and the magnetization profiles are recovered only around the edge of the front via an approximate numerical solution.

  17. Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen

    NASA Astrophysics Data System (ADS)

    Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.

    2017-12-01

    The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.

  18. Doubly self-consistent field theory of grafted polymers under simple shear in steady state

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Suo, Tongchuan; Whitmore, Mark D., E-mail: mark-whitmore@umanitoba.ca

    2014-03-21

    We present a generalization of the numerical self-consistent mean-field theory of polymers to the case of grafted polymers under simple shear. The general theoretical framework is presented, and then applied to three different chain models: rods, Gaussian chains, and finitely extensible nonlinear elastic (FENE) chains. The approach is self-consistent at two levels. First, for any flow field, the polymer density profile and effective potential are calculated self-consistently in a manner similar to the usual self-consistent field theory of polymers, except that the calculation is inherently two-dimensional even for a laterally homogeneous system. Second, through the use of a modified Brinkmanmore » equation, the flow field and the polymer profile are made self-consistent with respect to each other. For all chain models, we find that reasonable levels of shear cause the chains to tilt, but it has very little effect on the overall thickness of the polymer layer, causing a small decrease for rods, and an increase of no more than a few percent for the Gaussian and FENE chains. Using the FENE model, we also probe the individual bond lengths, bond correlations, and bond angles along the chains, the effects of the shear on them, and the solvent and bonded stress profiles. We find that the approximations needed within the theory for the Brinkman equation affect the bonded stress, but none of the other quantities.« less

  19. Additional chain-branching pathways in the low-temperature oxidation of branched alkanes

    DOE PAGES

    Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; ...

    2015-12-31

    Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C 8H 14O 4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C 8H 16O 5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C 8H 16O 5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O 2 addition, intramolecular isomerization, and OH release; C 8H 14O 4 species are proposed to result from subsequent reactions of C 8H 16O 5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less

  20. An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

    PubMed Central

    Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

    2005-01-01

    Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

  1. Blood grouping based on PCR methods and agarose gel electrophoresis.

    PubMed

    Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

    2015-01-01

    The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

  2. Excitation wavelength dependence of excited state intramolecular proton transfer reaction of 4'-N,N-diethylamino-3-hydroxyflavone in room temperature ionic liquids studied by optical Kerr gate fluorescence measurement.

    PubMed

    Suda, Kayo; Terazima, Masahide; Sato, Hirofumi; Kimura, Yoshifumi

    2013-10-17

    Excited state intramolecular proton transfer reactions (ESIPT) of 4'-N,N-diethylamino-3-hydroxyflavone (DEAHF) in ionic liquids have been studied by steady-state and time-resolved fluorescence measurements at different excitation wavelengths. Steady-state measurements show the relative yield of the tautomeric form to the normal form of DEAHF decreases as excitation wavelength is increased from 380 to 450 nm. The decrease in yield is significant in ionic liquids that have cations with long alkyl chains. The extent of the decrease is correlated with the number of carbon atoms in the alkyl chains. Time-resolved fluorescence measurements using optical Kerr gate spectroscopy show that ESIPT rate has a strong excitation wavelength dependence. There is a large difference between the spectra at a 200 ps delay from different excitation wavelengths in each ionic liquid. The difference is pronounced in ionic liquids having a long alkyl chain. The equilibrium constant in the electronic excited state obtained at a 200 ps delay and the average reaction rate are also correlated with the alkyl chain length. Considering the results of the steady-state fluorescence and time-resolved measurements, the excitation wavelength dependence of ESIPT is explained by state selective excitation due to the difference of the solvation, and the number of alkyl chain carbon atoms is found to be a good indicator of the effect of inhomogeneity for this reaction.

  3. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

    NASA Astrophysics Data System (ADS)

    Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

    2015-07-01

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

  4. A Bullet-Block Experiment that Explains the Chain Fountain

    NASA Astrophysics Data System (ADS)

    Pantaleone, J.; Smith, R.

    2018-05-01

    It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.

  5. Release of DNA from polyelectrolyte multilayers fabricated using 'charge-shifting' cationic polymers: tunable temporal control and sequential, multi-agent release.

    PubMed

    Sun, Bin; Lynn, David M

    2010-11-20

    We report an approach to the design of multilayered polyelectrolyte thin films (or 'polyelectrolyte multilayers', PEMs) that can be used to provide tunable control over the release of plasmid DNA (or multiple different DNA constructs) from film-coated surfaces. Our approach is based upon methods for the layer-by-layer assembly of DNA-containing thin films, and exploits the properties of a new class of cationic 'charge-shifting' polymers (amine functionalized polymers that undergo gradual changes in net charge upon side chain ester hydrolysis) to provide control over the rates at which these films erode and release DNA. We synthesized two 'charge-shifting' polymers (polymers 1 and 2) containing different side chain structures by ring-opening reactions of poly(2-alkenyl azlactone)s with two different tertiary amine functionalized alcohols (3-dimethylamino-1-propanol and 2-dimethylaminoethanol, respectively). Subsequent characterization revealed large changes in the rates of side chain ester hydrolysis for these two polymers; whereas the half-life for the hydrolysis of the esters in polymer 1 was ~200 days, the half-life for polymer 2 was ~6 days. We demonstrate that these large differences in side chain hydrolysis make possible the design of PEMs that erode and promote the surface-mediated release of DNA either rapidly (e.g., over ~3 days for films fabricated using polymer 2) or slowly (e.g., over ~1 month for films fabricated using polymer 1). We demonstrate further that it is possible to design films with release profiles that are intermediate to these two extremes by fabricating films using solutions containing different mixtures of these two polymers. This approach can thus expand the usefulness of these two polymers and achieve a broader range of DNA release profiles without the need to synthesize polymers with new structures or properties. Finally, we demonstrate that polymers 1 and 2 can be used to fabricate multilayered films with hierarchical structures that promote the sequential release of two different DNA constructs with separate and distinct release profiles (e.g., the release of a first construct over a period of ~3 days, followed by the sustained release of a second for a period of ~70 days). With further development, this approach could contribute to the design of functional thin films and surface coatings that provide sophisticated control over the timing and the order of the release of two or more DNA constructs (or other agents) of interest in a range of biomedical contexts. Copyright © 2010 Elsevier B.V. All rights reserved.

  6. ABC gene expression profiles have clinical importance and possibly form a new hallmark of cancer.

    PubMed

    Dvorak, Pavel; Pesta, Martin; Soucek, Pavel

    2017-05-01

    Adenosine triphosphate-binding cassette proteins constitute a large family of active transporters through extracellular and intracellular membranes. Increased drug efflux based on adenosine triphosphate-binding cassette protein activity is related to the development of cancer cell chemoresistance. Several articles have focused on adenosine triphosphate-binding cassette gene expression profiles (signatures), based on the expression of all 49 human adenosine triphosphate-binding cassette genes, in individual tumor types and reported connections to established clinicopathological features. The aim of this study was to test our theory about the existence of adenosine triphosphate-binding cassette gene expression profiles common to multiple types of tumors, which may modify tumor progression and provide clinically relevant information. Such general adenosine triphosphate-binding cassette profiles could constitute a new attribute of carcinogenesis. Our combined cohort consisted of tissues from 151 cancer patients-breast, colorectal, and pancreatic carcinomas. Standard protocols for RNA isolation and quantitative real-time polymerase chain reaction were followed. Gene expression data from individual tumor types as well as a merged tumor dataset were analyzed by bioinformatics tools. Several general adenosine triphosphate-binding cassette profiles, with differences in gene functions, were established and shown to have significant relations to clinicopathological features such as tumor size, histological grade, or clinical stage. Genes ABCC7, A3, A8, A12, and C8 prevailed among the most upregulated or downregulated ones. In conclusion, the results supported our theory about general adenosine triphosphate-binding cassette gene expression profiles and their importance for cancer on clinical as well as research levels. The presence of ABCC7 (official symbol CFTR) among the genes with key roles in the profiles supports the emerging evidence about its crucial role in various cancers. Graphical abstract.

  7. Molecular Typing and Virulence Gene Profiles of Enterotoxin Gene Cluster (egc)-Positive Staphylococcus aureus Isolates Obtained from Various Food and Clinical Specimens.

    PubMed

    Song, Minghui; Shi, Chunlei; Xu, Xuebing; Shi, Xianming

    2016-11-01

    The enterotoxin gene cluster (egc) has been proposed to contribute to the Staphylococcus aureus colonization, which highlights the need to evaluate genetic diversity and virulence gene profiles of the egc-positive population. Here, a total of 43 egc-positive isolates (16.2%) were identified from 266 S. aureus isolates that were obtained from various food and clinical specimens in Shanghai. Seven different egc profiles were found based on the polymerase chain reaction (PCR) result for egc genes. Then, these 43 egc-positive isolates were further typed by multilocus sequence typing, pulsed-field gel electrophoresis (PFGE), multiple-locus variable-number tandem-repeat analysis (MLVA), and accessory gene regulatory (agr) typing. It showed that the 43 egc-positive isolates displayed 17 sequence types, 28 PFGE patterns, 29 MLVA types, and 4 agr types, respectively. Among them, the dominant clonal lineage was CC5-agr II (48.84%). Thirty toxin and 20 adhesion-associated genes were detected by PCR in egc-positive isolates. Notably, invasive toxin genes showed a high prevalence, such as 76.7% for Panton-Valentine leukocidin encoding genes, 27.9% for sec, and 23.3% for tsst-1. Most of the examined adhesion-associated genes were found to be conserved (76.7-100%), whereas the fnbB gene was only found in 8 (18.6%) isolates. In addition, 33 toxin gene profiles and 13 adhesion gene profiles were identified, respectively. Our results imply that isolates belonging to the same clonal lineage harbored similar adhesion gene profiles but diverse toxin gene profiles. Overall, the high prevalence of invasive virulence genes increases the potential risk of egc-positive isolates in S. aureus infection.

  8. Radiolysis of N-acetyl amino acids as model compounds for radiation degradation of polypeptides

    NASA Astrophysics Data System (ADS)

    Wayne Garrett, R.; Hill, David J. T.; Ho, Sook-Ying; O'Donnell, James H.; O'Sullivan, Paul W.; Pomery, Peter J.

    Radiation chemical yields of (i) the volatile radiolysis products and (ii) the trapped free radicals from the y-radiolysis of the N-acetyl derivatives of glycine, L-valine, L-phenylalanine and L-tyrosine in the polycrystalline state have been determined at room temperature (303 K). Carbon dioxide was found to be the major molecular product for all these compounds with G(CO 2) varying from 0.36 for N-acetyl-L-tyrosine to 8 for N-acetyl-L-valine. There was evidence for some scission of the N-C α bond, indicated by the production of acetamide and the corresponding aliphatic acid, but the determination reaction was found to be of much lesser importance than the decarboxylation reaction. A protective effect of the aromatic ring in N-acetyl-L-phenylalanine and in N-acetyl-L-tyrosine was indicated by the lower yields of volatile products for these compounds. The yields of trapped free radicals were found to vary with the nature of the amino acid side chain, increasing with chain length and chain branching. The radical yields were decreased by incorporation of an aromatic moiety in the side chain, this effect being greater for the tyrosyl side chain than for the phenyl side chain. The G(R·) values showed a good correlation with G(CO 2) indicating that a common reaction may be involved in radical production and carbon dioxide formation.

  9. Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

    EPA Science Inventory

    The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

  10. Highly efficient preparation of selectively isotope cluster-labeled long chain fatty acids via two consecutive C(sp3)-C(sp3) cross-coupling reactions.

    PubMed

    Lethu, Sébastien; Matsuoka, Shigeru; Murata, Michio

    2014-02-07

    An efficient synthesis involving two copper-catalyzed alkyl-alkyl coupling reactions has been designed to easily access doubly isotope-labeled fatty acids. Such NMR- and IR-active compounds were obtained in excellent overall yields and will be further used for determining the conformation of an alkyl chain of lipidic biomolecules upon interaction with proteins.

  11. Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

    USDA-ARS?s Scientific Manuscript database

    This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

  12. Kinetic Profiling of Catalytic Organic Reactions as a Mechanistic Tool.

    PubMed

    Blackmond, Donna G

    2015-09-02

    The use of modern kinetic tools to obtain virtually continuous reaction progress data over the course of a catalytic reaction opens up a vista that provides mechanistic insights into both simple and complex catalytic networks. Reaction profiles offer a rate/concentration scan that tells the story of a batch reaction time course in a qualitative "fingerprinting" manner as well as in quantitative detail. Reaction progress experiments may be mathematically designed to elucidate catalytic rate laws from only a fraction of the number of experiments required in classical kinetic measurements. The information gained from kinetic profiles provides clues to direct further mechanistic analysis by other approaches. Examples from a variety of catalytic reactions spanning two decades of the author's work help to delineate nuances on a central mechanistic theme.

  13. A newly developed silymarin nanoformulation as a potential antidiabetic agent in experimental diabetes.

    PubMed

    El-Far, Yousra M; Zakaria, Mahmoud M; Gabr, Mahmoud M; El Gayar, Amal M; El-Sherbiny, Ibrahim M; Eissa, Laila A

    2016-10-01

    This study aimed to develop a new stable nanoformulation of silymarin (SM) with optimum enhanced oral bioavailability and to evaluate its effect as well as mechanism of action as a superior antidiabetic agent over native SM using streptozotocin-induced diabetic rats. SM-loaded pluronic nanomicelles (SMnp) were prepared and fully characterized. Biochemical parameters were performed as well as histological, confocal and reverse-transcription polymerase chain reaction studies on pancreatic target tissues. SMnp were found to improve significantly the antihyperglycemic, antioxidant and antihyperlipidemic properties as compared with native SM. In addition, SMnp was found to be a more efficient agent over SM in the management of diabetes and its associated complications due to its superior bioavailability in vivo, and the controlled release profile of SM. [Formula: see text].

  14. Polymer-based microfluidic chips for isothermal amplification of nucleic acids

    NASA Astrophysics Data System (ADS)

    Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

    2017-11-01

    Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

  15. Polymerase chain reaction with phase change as intrinsic thermal control

    NASA Astrophysics Data System (ADS)

    Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

    2013-04-01

    This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

  16. Photochemical reaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen) with basic amino acids and dipeptides.

    PubMed

    Suzuki, Tadashi; Shinoda, Mio; Osanai, Yohei; Isozaki, Tasuku

    2013-08-22

    Photoreaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen, KP) with basic amino acids (histidine, lysine, and arginine) and dipeptides (carnosine and anserine) including a histidine moiety in phosphate buffer solution (pH 7.4) has been investigated with transient absorption spectroscopy. With UV irradiation KP(-) gave rise to a carbanion through a decarboxylation reaction, and the carbanion easily abstracted a proton from the surrounding molecule to yield a 3-ethylbenzophenone ketyl biradical (EBPH). The dipeptides as well as the basic amino acids were found to accelerate the proton transfer reaction whereas alanine and glycine had no effect on the reaction, revealing that these amino acids having a protonated side chain act as a proton donor. The formation quantum yield of EBPH was estimated to be fairly large by means of an actinometrical method with benzophenone, and the bimolecular reaction rate constant for the proton transfer between the carbanion and the protonated basic amino acids or the protonated dipeptides was successfully determined. It has become apparent that the bimolecular reaction rate constant for the proton transfer depended on the acid dissociation constant for the side chain of the amino acids for the first time. This reaction mechanism was interpreted by difference of the heat of reaction for each basic amino acid based on the thermodynamical consideration. These results strongly suggest that the side chain of the basic amino acid residue in protein should play an important role for photochemistry of KP in vivo.

  17. A targeted metabolomic protocol for short-chain fatty acids and branched-chain amino acids.

    PubMed

    Zheng, Xiaojiao; Qiu, Yunping; Zhong, Wei; Baxter, Sarah; Su, Mingming; Li, Qiong; Xie, Guoxiang; Ore, Brandon M; Qiao, Shanlei; Spencer, Melanie D; Zeisel, Steven H; Zhou, Zhanxiang; Zhao, Aihua; Jia, Wei

    2013-08-01

    Research in obesity and metabolic disorders that involve intestinal microbiota demands reliable methods for the precise measurement of the short-chain fatty acids (SCFAs) and branched-chain amino acids (BCAAs) concentration. Here, we report a rapid method of simultaneously determining SCFAs and BCAAs in biological samples using propyl chloroformate (PCF) derivatization followed by gas chromatography mass spectrometry (GC-MS) analysis. A one-step derivatization using 100 µL of PCF in a reaction system of water, propanol, and pyridine (v/v/v = 8:3:2) at pH 8 provided the optimal derivatization efficiency. The best extraction efficiency of the derivatized products was achieved by a two-step extraction with hexane. The method exhibited good derivatization efficiency and recovery for a wide range of concentrations with a low limit of detection for each compound. The relative standard deviations (RSDs) of all targeted compounds showed good intra- and inter-day (within 7 days) precision (< 10%), and good stability (< 20%) within 4 days at room temperature (23-25 °C), or 7 days when stored at -20 °C. We applied our method to measure SCFA and BCAA levels in fecal samples from rats administrated with different diet. Both univariate and multivariate statistics analysis of the concentrations of these target metabolites could differentiate three groups with ethanol intervention and different oils in diet. This method was also successfully employed to determine SCFA and BCAA in the feces, plasma and urine from normal humans, providing important baseline information of the concentrations of these metabolites. This novel metabolic profile study has great potential for translational research.

  18. FACTORS AFFECTING THE CHAIN LENGTH OF GROUP A STREPTOCOCCI

    PubMed Central

    Ekstedt, Richard D.; Stollerman, Gene H.

    1960-01-01

    Group A streptococci which grew in long chains in the presence of homologous anti-M antibody were split into their original length by the addition of an excess of homologous M protein to the culture. The chain-splitting reaction showed temperature and pH optima (37°C., 7.5) and was completely inhibited at 0°C. or by heat-killing the long chains at 56°C. prior to the addition of M protein. Addition of sublethal doses of HgCl2, or of penicillin, inhibited the chain-splitting reaction. Pneumococci behaved in entirely comparable fashion to streptococci in similar experiments. Virulent strains of streptococci formed the shortest chains when broth media was enriched with serum. The chain-shortening effect of serum enrichment of the media was most apparent with encapsulated strains and under cultural conditions that favored capsule formation. Loss of capsules by mutation or by unfavorable growth conditions resulted in increase in chain length. The activity of the chain-splitting mechanism seemed to be independent of M protein, however, since encapsulated M-negative variants also formed very short chain in serum-enriched media. The physical presence of the capsule was not essential for chain shortening since enzymatic removal of the capsule with hyaluronidase during growth did not affect chain length. These results strongly suggest that chain-splitting of streptococci and pneumococci occurs by an active metabolic mechanism, presumably enzymatic, which is inhibited by the union of surface antigens with specific antibody. PMID:13726267

  19. Assessing the influence of side-chain and main-chain aromatic benzyltrimethyl ammonium on anion exchange membranes.

    PubMed

    Li, Xiuhua; Nie, Guanghui; Tao, Jinxiong; Wu, Wenjun; Wang, Liuchan; Liao, Shijun

    2014-05-28

    3,3'-Di(4″-methyl-phenyl)-4,4'-difluorodiphenyl sulfone (DMPDFPS), a new monomer with two pendent benzyl groups, was easily prepared by Suzuki coupling reaction in high yield. A series of side-chain type ionomers (PAES-Qs) containing pendant side-chain benzyltrimethylammonium groups, which linked to the backbone by alkaline resisting conjugated C-C bonds, were synthesized via polycondensation, bromination, followed by quaternization and alkalization. To assess the influence of side-chain and main-chain aromatic benzyltrimethylammonium on anion exchange membranes (AEMs), the main-chain type ionomers (MPAES-Qs) with the same backbone were synthesized following the similar procedure. GPC and (1)H NMR results indicate that the bromination shows no reaction selectivity of polymer configurations and ionizations of the side-chain type polymers display higher conversions than that of the main-chain type ones do. These two kinds of AEMs were evaluated in terms of ion exchange capacity (IEC), water uptake, swelling ratio, λ, volumetric ion exchange capacity (IECVwet), hydroxide conductivity, mechanical and thermal properties, and chemical stability, respectively. The side-chain type structure endows AEMs with lower water uptake, swelling ratio and λ, higher IECVwet, much higher hydroxide conductivity, more robust dimensional stability, mechanical and thermal properties, and higher stability in hot alkaline solution. The side-chain type cationic groups containing molecular configurations have the distinction of being practical AEMs and membrane electrode assemblies of AEMFCs.

  20. Circular RNA Expression Profile of Pancreatic Ductal Adenocarcinoma Revealed by Microarray.

    PubMed

    Li, Haimin; Hao, Xiaokun; Wang, Huimin; Liu, Zhengcai; He, Yong; Pu, Meng; Zhang, Hongtao; Yu, Hengchao; Duan, Juanli; Qu, Shibin

    2016-01-01

    Circular RNAs (circRNAs) are a special novel type of a stable, diverse and conserved noncoding RNA in mammalian cells. Particularly in cancer, circRNAs have been reported to be widely involved in the physiological/pathological process of life. However, it is unclear whether circRNAs are specifically involved in pancreatic ductal adenocarcinoma (PDAC). We investigated the expression profile of circRNAs in six PDAC cancer samples and paired adjacent normal tissues using microarray. A high-throughput circRNA microarray was used to identify dysregulated circular RNAs in six PDAC patients. Bioinformatic analyses were applied to study these differentially expressed circRNAs. Furthermore, quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed to confirm these results. We revealed and confirmed that a number of circRNAs were dysregulated, which suggests a potential role in pancreatic cancer. this study demonstrates that clusters of circRNAs are aberrantly expressed in PDAC compared with normal samples and provides new potential targets for the future treatment of PDAC and novel insights into PDAC biology. © 2016 The Author(s) Published by S. Karger AG, Basel.

  1. Expression profile of Lgi1 gene in mouse brain during development.

    PubMed

    Ribeiro, Patrícia A O; Sbragia, Lourenço; Gilioli, Rovilson; Langone, Francesco; Conte, Fábio F; Lopes-Cendes, Iscia

    2008-07-01

    Mutations in LGI1 were described in patients with autosomal dominant partial epilepsy with auditory features (ADPEAF), and recent clinical findings have implicated LGI1 in human brain development. However, the precise role of LGI1 in epileptogenesis remains largely unknown. The objective of this study was to determine the expression pattern of Lgi1 in mice brain during development and in adult animals. Real-time polymerase chain reaction (PCR) quantification and Western blot experiments showed a relative low expression during intrauterine stages, increasing until adulthood. In addition, we did not find significant differences between left and right hemispheres. The hippocampus presented higher levels of Lgi1 expression when compared to the neocortex and the cerebellum of adult animals; however, these results did not reach statistical significance. This study was the first to determine a specific profile of Lgi1 gene expression during central nervous system development, which suggests a possible inhibitory function in latter stages of development. In addition, we did not find differences in hemispheric expression that could explain the predominance of left-sided abnormalities in patients with ADPEAF.

  2. Analysis of differential gene expression by bead-based fiber-optic array in nonfunctioning pituitary adenomas.

    PubMed

    Jiang, Z; Gui, S; Zhang, Y

    2011-05-01

    Nonfunctioning pituitary adenomas (NFPAs) are relatively common, accounting for 30% of all pituitary adenomas; however, their pathogenesis remains enigmatic. To explore the possible pathogenesis of NFPAs, we used fiber-optic BeadArray to examine gene expression in 5 NFPAs compared with 3 normal pituitaries. 4 differentially expressed genes were chosen randomly for validation by reverse transcriptase-real time quantitative polymerase chain reaction (RT-qPCR). We then analyzed the differentially expressed gene profile with Kyoto Encyclopedia of Genes and Genomes (KEGG). The array analysis indentified significant increases in the expression of 1,402 genes and 383 expressed sequence tags (ESTs), and decreases in 1,697 genes and 113 ESTs in the NFPAs. Bioinformatic and pathway analysis showed that the genes HIGD1B, FAM5C, PMAIP1 and the pathway cell-cycle regulation may play an important role in tumorigenesis and progression of NFPAs. Our data suggest fiber-optic BeadArray combined with pathway analysis of differential gene expression profile appears to be a valid approach for investigating the pathogenesis of tumors. © Georg Thieme Verlag KG Stuttgart · New York.

  3. Characterization of antimicrobial resistant Escherichia coli isolated from processed bison carcasses.

    PubMed

    Li, Q; Sherwood, J S; Logue, C M

    2007-12-01

    To determine the phenotypic and genotypic antimicrobial susceptibility profiles of Escherichia coli from bison carcasses. The antimicrobial resistance of 138 E. coli isolates recovered from processed bison carcasses was determined by using the National Antimicrobial Resistance Monitoring System panels, polymerase chain reaction assays, plasmid analysis and conjugation studies. Resistance to 14 of the 16 antimicrobials was observed. Twenty-three (16.7%) isolates displayed resistance to at least one antimicrobial agent. The most prevalent resistances were to tetracycline (13.0%), sulfamethoxazole (7.9%) and streptomycin (5.8%). No resistance was observed to amikacin and ciprofloxacin. Further analysis of 23 antimicrobial-resistant E. coli isolates showed the presence of resistance genes corresponding to their phenotypic profiles. Results of conjugation studies carried out showed most isolates tested were able to transfer their resistance to recipients. This study indicated that multidrug-resistant E. coli isolates are present in bison. However, the resistance rate is lower than that reported in other meat species. The beneficial effects of antimicrobial-free feeding practice in bison may be promoting a reduction in the prevalence of antimicrobial resistance in commensal flora of bison.

  4. DNA profiling in peripheral blood, buccal swabs, hair follicles and semen from a patient following allogeneic hematopoietic stem cells transplantation

    PubMed Central

    LI, YA-TING; XIE, MING-KUN; WU, JIN

    2014-01-01

    Allogeneic peripheral blood stem cells transplantation (allo-PBSCT) or allogeneic bone marrow transplantation (allo-BMT) have been widely used to treat patients exhibiting certain severe illnesses. However, previous studies have shown that the biological materials of allo-PBSCT or allo-BMT recipients may not constitute credible materials for personal identification. In the present study, four types of commonly used samples were collected from a male individual following gender-matched allo-BMT. Autosomal short tandem repeat (STR) and Y-STR markers analysis, based on polymerase chain reaction, were used to evaluate the chimerism status. The results showed that the blood sample were all donor type, the buccal swab sample were mixed chimerism, and the sperm and hair follicle samples maintained a recipient origin of 100%. In conclusion, identical results were obtained by the two methods and it was confirmed that DNA extracted from hair follicles and sperm can be used as a reference for the pre-transplant genotype DNA profile of the recipient in the gender-match allo-BMT or -PBSCT. PMID:25279149

  5. Molecular epidemiology of SPM-1-producing Pseudomonas aeruginosa by rep-PCR in hospitals in Parana, Brazil.

    PubMed

    Kalluf, K O; Arend, L N; Wuicik, T E; Pilonetto, M; Tuon, F F

    2017-04-01

    Infections caused by multidrug resistant microorganisms are a global health problem, and Pseudomonas aeruginosa is an important nosocomial pathogen, easily disseminated in the hospital environment. The aim of this study was to determine SPM-1 in P. aeruginosa strains in 30 Brazilian hospitals and the genetic similarity of isolates. We analyzed 161 isolates of carbapenem-resistant P. aeruginosa. Imipenem/EDTA and imipenem strip were used for phenotypic detection of MBL production; and real-time polymerase chain reaction (PCR) for genetic detection. Genetic similarity was determined by rep-PCR. We obtained 136/161 (84.5%) isolates with positive phenotypic result for metallo-β-lactamase (MBL) and the bla SPM-1 gene was identified in 41 isolates. There was a predominant profile (>95% of genetic similarity) in 92.7% of isolates. This predominant profile was widely disseminated in Paraná state. SPM-1 is the main MBL identified in carbapenem-resistant P. aeruginosa in Southern Brazil. The genetic similarity among some isolates suggests a clonal expansion. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Recovery of high-quality RNA from laser capture microdissected human and rodent pancreas.

    PubMed

    Butler, Alexandra E; Matveyenko, Aleksey V; Kirakossian, David; Park, Johanna; Gurlo, Tatyana; Butler, Peter C

    Laser capture microdissection (LCM) is a powerful method to isolate specific populations of cells for subsequent analysis such as gene expression profiling, for example, microarrays or ribonucleic (RNA)-Seq. This technique has been applied to frozen as well as formalin-fixed, paraffin-embedded (FFPE) specimens with variable outcomes regarding quality and quantity of extracted RNA. The goal of the study was to develop the methods to isolate high-quality RNA from islets of Langerhans and pancreatic duct glands (PDG) isolated by LCM. We report an optimized protocol for frozen sections to minimize RNA degradation and maximize recovery of expected transcripts from the samples using quantitative real-time polymerase chain reaction (RT-PCR) by adding RNase inhibitors at multiple steps during the experiment. This technique reproducibly delivered intact RNA (RIN values 6-7). Using quantitative RT-PCR, the expected profiles of insulin, glucagon, mucin6 (Muc6), and cytokeratin-19 (CK-19) mRNA in PDGs and pancreatic islets were detected. The described experimental protocol for frozen pancreas tissue might also be useful for other tissues with moderate to high levels of intrinsic ribonuclease (RNase) activity.

  7. Identification of differentially expressed genes in cucumber (Cucumis sativus L.) root under waterlogging stress by digital gene expression profile.

    PubMed

    Qi, Xiao-Hua; Xu, Xue-Wen; Lin, Xiao-Jian; Zhang, Wen-Jie; Chen, Xue-Hao

    2012-03-01

    High-throughput tag-sequencing (Tag-seq) analysis based on the Solexa Genome Analyzer platform was applied to analyze the gene expression profiling of cucumber plant at 5 time points over a 24h period of waterlogging treatment. Approximately 5.8 million total clean sequence tags per library were obtained with 143013 distinct clean tag sequences. Approximately 23.69%-29.61% of the distinct clean tags were mapped unambiguously to the unigene database, and 53.78%-60.66% of the distinct clean tags were mapped to the cucumber genome database. Analysis of the differentially expressed genes revealed that most of the genes were down-regulated in the waterlogging stages, and the differentially expressed genes mainly linked to carbon metabolism, photosynthesis, reactive oxygen species generation/scavenging, and hormone synthesis/signaling. Finally, quantitative real-time polymerase chain reaction using nine genes independently verified the tag-mapped results. This present study reveals the comprehensive mechanisms of waterlogging-responsive transcription in cucumber. Copyright © 2011 Elsevier Inc. All rights reserved.

  8. Functional Genomics Using the Saccharomyces cerevisiae Yeast Deletion Collections.

    PubMed

    Nislow, Corey; Wong, Lai Hong; Lee, Amy Huei-Yi; Giaever, Guri

    2016-09-01

    Constructed by a consortium of 16 laboratories, the Saccharomyces genome-wide deletion collections have, for the past decade, provided a powerful, rapid, and inexpensive approach for functional profiling of the yeast genome. Loss-of-function deletion mutants were systematically created using a polymerase chain reaction (PCR)-based gene deletion strategy to generate a start-to-stop codon replacement of each open reading frame by homologous recombination. Each strain carries two molecular barcodes that serve as unique strain identifiers, enabling their growth to be analyzed in parallel and the fitness contribution of each gene to be quantitatively assessed by hybridization to high-density oligonucleotide arrays or through the use of next-generation sequencing technologies. Functional profiling of the deletion collections, using either strain-by-strain or parallel assays, provides an unbiased approach to systematically survey the yeast genome. The Saccharomyces yeast deletion collections have proved immensely powerful in contributing to the understanding of gene function, including functional relationships between genes and genetic pathways in response to diverse genetic and environmental perturbations. © 2016 Cold Spring Harbor Laboratory Press.

  9. Intact carbohydrate structures as part of the melanoidin skeleton.

    PubMed

    Cämmerer, Bettina; Jalyschko, Walentina; Kroh, Lothar W

    2002-03-27

    Model melanoidins from monomeric, oligomeric, and polymeric carbohydrates, and amino acids formed under aqueous as well as water-free reaction conditions, were submitted to acidic catalyzed hydrolysis. Their degradation products were detected qualitatively and quantitatively by HPTLC and HPLC-DAD. A considerable amount of monomer carbohydrates from hydrolysis of model melanoidins formed under water-free reaction conditions was detected. It can be seen clearly that the amount of carbohydrates released increased with increasing degree of polymerization of the carbohydrates used as starting material. In comparison, the hydrolysis of melanoidins formed in aqueous condition resulted in only a small glucose release. It seems that in the Maillard reaction under water-free conditions, a significant amount of di- and oligomer carbohydrates were incorporated into the melanoidin skeleton as complete oligomer with intact glycosidic bond, forming side chains at the melanoidin skeleton. Additional side chains could be formed by transglycosylation reactions. With increasing water content, hydrothermolytic as well as retro-aldol reactions of the starting carbonyl components became significant, and therefore the possibility of forming side chains decreased. The results are consistent with the postulated melanoidin structure being built up mainly from sugar degradation products, probably branched via amino compounds.

  10. Altered Expression of Diabetes-Related Genes in Alzheimer's Disease Brains: The Hisayama Study

    PubMed Central

    Hokama, Masaaki; Oka, Sugako; Leon, Julio; Ninomiya, Toshiharu; Honda, Hiroyuki; Sasaki, Kensuke; Iwaki, Toru; Ohara, Tomoyuki; Sasaki, Tomio; LaFerla, Frank M.; Kiyohara, Yutaka; Nakabeppu, Yusaku

    2014-01-01

    Diabetes mellitus (DM) is considered to be a risk factor for dementia including Alzheimer's disease (AD). However, the molecular mechanism underlying this risk is not well understood. We examined gene expression profiles in postmortem human brains donated for the Hisayama study. Three-way analysis of variance of microarray data from frontal cortex, temporal cortex, and hippocampus was performed with the presence/absence of AD and vascular dementia, and sex, as factors. Comparative analyses of expression changes in the brains of AD patients and a mouse model of AD were also performed. Relevant changes in gene expression identified by microarray analysis were validated by quantitative real-time reverse-transcription polymerase chain reaction and western blotting. The hippocampi of AD brains showed the most significant alteration in gene expression profile. Genes involved in noninsulin-dependent DM and obesity were significantly altered in both AD brains and the AD mouse model, as were genes related to psychiatric disorders and AD. The alterations in the expression profiles of DM-related genes in AD brains were independent of peripheral DM-related abnormalities. These results indicate that altered expression of genes related to DM in AD brains is a result of AD pathology, which may thereby be exacerbated by peripheral insulin resistance or DM. PMID:23595620

  11. Biodiesel production from triolein and short chain alcohols through biocatalysis.

    PubMed

    Salis, Andrea; Pinna, Marcella; Monduzzi, Maura; Solinas, Vincenzo

    2005-09-29

    Oleic acid alkyl esters (biodiesel) were synthesised by biocatalysis in solvent-free conditions. Different commercial immobilised lipases, namely Candida antarctica B, Rizhomucor miehei, and Pseudomonas cepacia, were tested towards the reaction between triolein and butanol to produce butyl oleate. Pseudomonas cepacia lipase resulted to be the most active enzyme reaching 100% of conversion after 6h. Different operative conditions such as reaction temperature, water activity, and reagent stoichiometric ratio were investigated and optimised. These conditions were then used to investigate the effect of linear and branched short chain alcohols. Methanol and 2-butanol were the worst alcohols: the former, probably, due to its low miscibility with the oil and the latter because secondary alcohols usually are less reactive than primary alcohols. Conversely, linear and branched primary alcohols with short alkyl chains (C(2)--C(4)) showed high reaction rate and conversion. A mixture of linear and branched short chain alcohols that mimics the residual of ethanol distillation (fusel oil) was successfully used for oleic acid ester synthesis. These compounds are important in biodiesel mixtures since they improve low temperature properties.

  12. METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM

    DOEpatents

    Fermi, E.; Leverett, M.C.

    1957-11-12

    This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.

  13. Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

    NASA Technical Reports Server (NTRS)

    Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

    1998-01-01

    Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

  14. Expression of cytokine signaling genes in morbidly obese patients with non-alcoholic steatohepatitis and hepatic fibrosis.

    PubMed

    Estep, J Michael; Baranova, Ancha; Hossain, Noreen; Elariny, Hazem; Ankrah, Kathy; Afendy, Arian; Chandhoke, Vikas; Younossi, Zobair M

    2009-05-01

    White adipose tissue (WAT) from visceral adiposity plays an important role in the pathogenesis of non-alcoholic steatohepatitis (NASH). Development of NASH and its progression to fibrosis is partially due to cytokines and adipokines produced by WAT. The aim of this study was to assess the association of hepatic fibrosis and NASH by evaluating the intrinsic differences in the inflammatory cytokine signaling in the visceral adipose tissue obtained from morbidly obese patients. We used targeted microarrays representing human genes involved in the inflammatory and fibrogenic reactions to profile visceral adipose samples of 15 well-matched NASH patients with and without fibrosis. Additionally, visceral adipose samples were subjected to real-time polymerase chain reaction profiling of 84 inflammations related genes. Eight genes (CCL2, CCL4, CCL18, CCR1, IL10RB, IL15RA, and LTB) were differentially expressed in NASH with fibrosis. Additionally, an overlapping but distinct list of the differentially expressed genes were found in NASH with type II diabetes (DM; IL8, BLR1, IL2RA, CD40LG, IL1RN, IL15RA, and CCL4) as compared to NASH without DM. Inflammatory cytokines are differentially expressed in the adipose tissue of NASH with fibrosis, as well in NASH with DM. These findings point at the interaction of adipose inflammatory cytokines, DM, hepatic fibrosis in NASH, and its progression to cirrhosis and end-stage liver disease.

  15. Alteration of the Alkaloid Profile in Genetically Modified Tobacco Reveals a Role of Methylenetetrahydrofolate Reductase in Nicotine N-Demethylation1[C][W][OA

    PubMed Central

    Hung, Chiu-Yueh; Fan, Longjiang; Kittur, Farooqahmed S.; Sun, Kehan; Qiu, Jie; Tang, She; Holliday, Bronwyn M.; Xiao, Bingguang; Burkey, Kent O.; Bush, Lowell P.; Conkling, Mark A.; Roje, Sanja; Xie, Jiahua

    2013-01-01

    Methylenetetrahydrofolate reductase (MTHFR) is a key enzyme of the tetrahydrofolate (THF)-mediated one-carbon (C1) metabolic network. This enzyme catalyzes the reduction of 5,10-methylene-THF to 5-methyl-THF. The latter donates its methyl group to homocysteine, forming methionine, which is then used for the synthesis of S-adenosyl-methionine, a universal methyl donor for numerous methylation reactions, to produce primary and secondary metabolites. Here, we demonstrate that manipulating tobacco (Nicotiana tabacum) MTHFR gene (NtMTHFR1) expression dramatically alters the alkaloid profile in transgenic tobacco plants by negatively regulating the expression of a secondary metabolic pathway nicotine N-demethylase gene, CYP82E4. Quantitative real-time polymerase chain reaction and alkaloid analyses revealed that reducing NtMTHFR expression by RNA interference dramatically induced CYP82E4 expression, resulting in higher nicotine-to-nornicotine conversion rates. Conversely, overexpressing NtMTHFR1 suppressed CYP82E4 expression, leading to lower nicotine-to-nornicotine conversion rates. However, the reduced expression of NtMTHFR did not affect the methionine and S-adenosyl-methionine levels in the knockdown lines. Our finding reveals a new regulatory role of NtMTHFR1 in nicotine N-demethylation and suggests that the negative regulation of CYP82E4 expression may serve to recruit methyl groups from nicotine into the C1 pool under C1-deficient conditions. PMID:23221678

  16. Maillard reaction versus other nonenzymatic modifications in neurodegenerative processes.

    PubMed

    Pamplona, Reinald; Ilieva, Ekaterina; Ayala, Victoria; Bellmunt, Maria Josep; Cacabelos, Daniel; Dalfo, Esther; Ferrer, Isidre; Portero-Otin, Manuel

    2008-04-01

    Nonenzymatic protein modifications are generated from direct oxidation of amino acid side chains and from reaction of the nucleophilic side chains of specific amino acids with reactive carbonyl species. These reactions give rise to specific markers that have been analyzed in different neurodegenerative diseases sharing protein aggregation, such as Alzheimer's disease, Pick's disease, Parkinson's disease, dementia with Lewy bodies, Creutzfeldt-Jakob disease, and amyotrophic lateral sclerosis. Collectively, available data demonstrate that oxidative stress homeostasis, mitochondrial function, and energy metabolism are key factors in determining the disease-specific pattern of protein molecular damage. In addition, these findings suggest the lack of a "gold marker of oxidative stress," and, consequently, they strengthen the need for a molecular dissection of the nonenzymatic reactions underlying neurodegenerative processes.

  17. Intramolecular Benzoin Reaction Catalyzed by Benzaldehyde Lyase from Pseudomonas Fluorescens Biovar I.

    PubMed

    Hernández, Karel; Parella, Teodor; Petrillo, Giovanna; Usón, Isabel; Wandtke, Claudia M; Joglar, Jesús; Bujons, Jordi; Clapés, Pere

    2017-05-02

    Intramolecular benzoin reactions catalyzed by benzaldehyde lyase from Pseudomonas fluorescens biovar I (BAL) are reported. The structure of the substrates envisaged for this reaction consists of two benzaldehyde derivatives linked by an alkyl chain. The structural requirements needed to achieve the intramolecular carbon-carbon bond reaction catalyzed by BAL were established. Thus, a linker consisting of a linear alkyl chain of three carbon atoms connected through ether-type bonds to the 2 and 2' positions of two benzaldehyde moieties, which could be substituted with either Cl, Br, or OCH 3 at either the 3 and 3' or 5 and 5' positions, were suitable substrates for BAL. Reactions with 61-84 % yields of the intramolecular product and ee values between 64 and 98 %, were achieved. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

    PubMed

    Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

    2013-08-01

    Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

    PubMed

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

    2014-03-01

    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

  20. Preemptive Isolation Precautions of Patients at High Risk for Methicillin-Resistant Staphylococcus aureus in Combination With Ultrarapid Polymerase Chain Reaction Screening as an Effective Tool for Infection Control.

    PubMed

    Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael

    2016-12-01

    This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.

  1. Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

    PubMed Central

    Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

    2006-01-01

    Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

  2. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    PubMed

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.

  3. Synthesis of Side-Chain Oxysterols and their Enantiomers through Cross-Metathesis Reactions of Δ22 Steroids

    PubMed Central

    Brownholland, David P.

    2017-01-01

    A synthetic route that utilizes a cross-metathesis reaction with Δ22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. PMID:28300584

  4. Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

    PubMed

    Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

    2018-04-25

    In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

  5. METHOD OF OPERATING NUCLEAR REACTORS

    DOEpatents

    Untermyer, S.

    1958-10-14

    A method is presented for obtaining enhanced utilization of natural uranium in heavy water moderated nuclear reactors by charging the reactor with an equal number of fuel elements formed of natural uranium and of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction. The reactor is operated until the rate of burnup of plutonium equals its rate of production, the fuel elements are processed to recover plutonium, the depleted uranium is discarded, and the remaining uranium is formed into fuel elements. These fuel elements are charged into a reactor along with an equal number of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction, and reuse of the uranium is continued as aforesaid until it wlll no longer support a chain reaction when combined with an equal quantity of natural uranium.

  6. Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

    PubMed

    Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

    1997-09-01

    In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

  7. Analysis of self-oscillating behaviors aimed at the development of a molecular robot with organic acids as fuel

    NASA Astrophysics Data System (ADS)

    Nakazumi, Tomoka; Hara, Yusuke

    2017-09-01

    We studied the transmittance self-oscillation of a polymer chain driven by an organic acid as the fuel. The self-oscillating polymer chain consists of 4-acryloylmorpholine (ACMO) and the Ru catalyst (Ru(bpy)3) of the Belousov-Zhabotinsky (BZ) reaction. The transmittance self-oscillating behavior was affected significantly by the temperature. As the amplitude of the transmittance self-oscillation, which is reflected by the aggregation state, decreased with time, the oscillation period also decreased. This trend indicates that the polymer aggregation affects the rate of the BZ reaction significantly. The activation energy of the self-oscillating value was almost the same in the normal BZ reaction, which does not include Ru(bpy)3 complexes in the polymer chains. In addition, we demonstrated the effect of one BZ substrate (sodium bromate or malonic acid) on the transmittance self-oscillation period.

  8. Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

    PubMed

    Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

    2001-03-01

    A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

  9. Initiator and Photocatalyst-Free Visible Light Induced One-Pot Reaction: Concurrent RAFT Polymerization and CuAAC Click Reaction.

    PubMed

    Wang, Jie; Wang, Xinbo; Xue, Wentao; Chen, Gaojian; Zhang, Weidong; Zhu, Xiulin

    2016-05-01

    A new, visible light-catalyzed, one-pot and one-step reaction is successfully employed to design well-controlled side-chain functionalized polymers, by the combination of ambient temperature revisible addtion-fragmentation chain transfer (RAFT) polymerization and click chemistry. Polymerizations are well controlled in a living way under the irradiation of visible light-emitting diode (LED) light without photocatalyst and initiator, using the trithiocarbonate agent as iniferter (initiator-transfer agent-terminator) agent at ambient temperature. Fourier transfer infrared spectroscopy (FT-IR), NMR, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) data confirm the successful one-pot reaction. Compared to the reported zero-valent metal-catalyzed one-pot reaction, the polymerization rate is much faster than that of the click reaction, and the visible light-catalyzed one-pot reaction can be freely and easily regulated by turning on and off the light. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

    PubMed

    Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

    2012-01-01

    Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

  11. Chain photoreduction of CCl3F in TiO2 suspensions: enhancement induced by O2.

    PubMed

    Winkelmann, Kurt; Calhoun, Robert L; Mills, German

    2006-12-28

    Trichlorofluoromethane (CFC 11) was photoreduced in aqueous suspensions of TiO2 particles containing HCO2- ions and air. Dissolved O2 inhibited the reaction during an induction period that preceded the rapid formation of chloride ions. Reaction rates were higher in systems containing O2 as compared to analogous reactions that occurred in anaerobic suspensions. High photonic efficiencies of Cl- formation (> or =15) were achieved using suspensions with pH > or = 5. As was the case for studies with air-free suspensions, reactions are best described using a photoinitiated chain mechanism that produced CHCl2F and Cl- during the propagation steps. The enhanced yields obtained in the presence of air are attributed to the removal by O2 of electrons trapped in the oxide, which are converted first into H2O2 and then into reducing radicals that participate in the chain process. Enhanced yields of Freon photoreduction were also observed during illumination of air-free suspensions containing hydrogen peroxide, which were interpreted using a similar mechanism.

  12. Tested Demonstrations.

    ERIC Educational Resources Information Center

    Gilbert, George L., Ed.

    1983-01-01

    Free radical chlorination of methane is used in organic chemistry to introduce free radical/chain reactions. In spite of its common occurrence, demonstrations of the reaction are uncommon. Therefore, such a demonstration is provided, including background information, preparation of reactants/reaction vessel, introduction of reactants, irradiation,…

  13. Efficient sampling of reversible cross-linking polymers: Self-assembly of single-chain polymeric nanoparticles

    NASA Astrophysics Data System (ADS)

    Oyarzún, Bernardo; Mognetti, Bortolo Matteo

    2018-03-01

    We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.

  14. The FAA altitude chamber training flight profile : a survey of altitude reactions, 1965-1989.

    DOT National Transportation Integrated Search

    1990-09-01

    Reactions from 1,161 trainees out of 12,759 trainees subjected to the FAA altitude chamber training flights from 1965-1989 are annotated in this survey. Although there were some mild and expected reactions, these training profiles appear to provide a...

  15. Natural Immunoreactivity of Secretory IgA to Indigenous Strains of Streptococcus mutans From Chinese Spousal Pairs

    PubMed Central

    Nie, Min; Chen, Dong; Gao, Zhenyan; Wu, Xinyu; Li, Tong

    2016-01-01

    Background Dental caries is a well-known biofilm-mediated disease initiated by Streptococcus mutans, which should infect and colonize in a milieu perfused with components of the mucosal immune system. Little is known, however, regarding the relationship between the natural secretory IgA activity and S. mutans of a variety of diverse genotypes. Objectives The current study aimed to use spousal pairs to investigate the natural immunoreactivity of salivary secretory IgA to different genotype strains of S. mutans. Patients and Methods Indigenous strains were characterized from nine spousal pairs using polymerase reaction chain (PCR) and arbitrarily primed polymerase chain reaction (AP-PCR) by genotype monitoring. Unstimulated submandibular/sublingual secretions were collected and the concentrations of secretory IgA were determined by the enzyme-linked immunosorbent assay (ELISA). Each saliva sample was examined by Western blot to analyze the immunoreactivity of naturally occurring salivary secretory IgA antibodies for his/her own indigenous strain, spouse’s strain and reference strains including S. mutans GS-5 and Ingbritt (C). Results The results showed that naturally induced salivary IgA antibodies against S. mutans were present in all subjects. Almost all subjects had the similar individual immunoblotting profiles to different genotype strains. Conclusions The current study indicated that the immunoreactivity of secretory IgA might have no direct correlation with the colonization of indigenous flora and rejection of exogenous strains in adults. The relationship of microbes, host and dental caries should be in the light of coevolved microecosystem as a whole, but not caused by one factor alone. PMID:27303613

  16. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene

    PubMed Central

    Soares, Vítor Yamashiro Rocha; da Silva, Jailthon Carlos; da Silva, Kleverton Ribeiro; Cruz, Maria do Socorro Pires e; Santos, Marcos Pérsio Dantas; Ribolla, Paulo Eduardo Martins; Alonso, Diego Peres; Coelho, Luiz Felipe Leomil; Costa, Dorcas Lamounier; Costa, Carlos Henrique Nery

    2014-01-01

    An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA. PMID:24821056

  17. Oxysterols from Free Radical Chain Oxidation of 7-Dehydrocholesterol: Product and Mechanistic Studies

    PubMed Central

    Xu, Libin; Korade, Zeljka; Porter, Ned A.

    2010-01-01

    Free radical chain oxidation of highly oxidizable 7-dehydrocholesterol (7-DHC) initiated by 2,2′-azobis(4-methoxy-2,4-dimethylvaleronitrile) was carried out at 37°C in benzene for 24 hours. Fifteen oxysterols derived from 7-DHC were isolated and characterized with 1D- and 2D-NMR spectroscopy and mass spectrometry. A mechanism that involves abstraction of hydrogen atoms at C-9 and/or C-14 is proposed to account for the formation of all of the oxysterols and the reaction progress profile. In either the H-9 or H-14 mechanism, a pentadienyl radical intermediate is formed after abstraction of H-9 or H-14 by a peroxyl radical. This step is followed by the well-precedented transformations observed in peroxidation reactions of polyunsaturated fatty acids such as oxygen addition, peroxyl radical 5-exo cyclization, and SHi carbon radical attack on the peroxide bond. The mechanism for peroxidation of 7-DHC also accounts for the formation of numerous oxysterol natural products isolated from fungal species, marine sponges, and cactaceous species. In a cell viability test, the oxysterol mixture from 7-DHC peroxidation was found to be cytotoxic to Neuro2a neuroblastoma cells in the micromolar concentration range. We propose that the high reactivity of 7-DHC and the oxysterols generated from its peroxidation may play important roles in the pathogenesis of Smith-Lemli-Opitz syndrome (SLOS), X-linked dominant chondrodysplasia punctata (CDPX2), and cerebrotendinous xanthomatosis (CTX), all of these being metabolic disorders having an elevated level of 7-DHC. PMID:20121089

  18. Expression of chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) in bladder transitional cell carcinoma.

    PubMed

    Ham, Won Sik; Lee, Joo Hyoung; Yu, Ho Song; Choi, Young Deuk

    2008-10-01

    An analysis of differentially expressed genes (DEGs) between bladder transitional cell carcinoma (TCC) and the surrounding urothelium to help identify what lies behind the mechanism of multifocal tumor development has not yet been performed. We sought to find a new DEG related to the development of bladder TCC. Thirty-nine bladder TCC tissues paired with normal-appearing urothelium tissues obtained from the same patient were used as subjects. Initially, we compared the messenger RNA (mRNA) profiles between normal-appearing urothelium and TCC tissue of 1 patient by using annealing control primer (ACP)-based GeneFishing polymerase chain reaction (PCR) and selective amplification of family members (SAFM) PCR to identify potential DEGs. To validate the results of the ACP data, reverse transcriptase-polymerase chain reaction (RT-PCR) was performed on those of all 39 patients. Among the several DEGs discovered in the ACP data, 1 DEG was chosen as the candidate for the RT-PCR, that is present or markedly upregulated in normal-appearing urothelial tissue compared with TCC tissue. Gene sequence searching revealed that this DEG is chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI). Downregulation of COUP-TFI mRNA expression in TCC tissue compared to normal-appearing urothelium tissue of the same patient, irrespective of tumor stage and grade, was confirmed by RT-PCR in 39 patients. Our results suggest that the loss of COUP-TFI may play a role in the transition from normal epithelium to TCC. Further characterization of the COUP-TFI gene is expected to give us informations about bladder TCC tumorigenesis.

  19. DNA Methylation of MMP9 Is Associated with High Levels of MMP-9 Messenger RNA in Periapical Inflammatory Lesions.

    PubMed

    Campos, Kelma; Gomes, Carolina Cavalieri; Farias, Lucyana Conceição; Silva, Renato Menezes; Letra, Ariadne; Gomez, Ricardo Santiago

    2016-01-01

    Matrix metalloproteinases (MMPs) are the major class of enzymes responsible for degradation of extracellular matrix components and participate in the pathogenesis of periapical inflammatory lesions. MMP expression may be regulated by DNA methylation. The purpose of the present investigation was to analyze the expression of MMP2 and MMP9 in periapical granulomas and radicular cysts and to test the hypothesis that, in these lesions, their transcription may be modulated by DNA methylation. Methylation-specific polymerase chain reaction was used to evaluate the DNA methylation pattern of the MMP2 gene in 13 fresh periapical granuloma samples and 10 fresh radicular cyst samples. Restriction enzyme digestion was used to assess methylation of the MMP9 gene in 12 fresh periapical granuloma samples and 10 fresh radicular cyst samples. MMP2 and MMP9 messenger RNA transcript levels were measured by quantitative real-time polymerase chain reaction. All periapical lesions and healthy mucosa samples showed partial methylation of the MMP2 gene; however, periapical granulomas showed higher MMP2 mRNA expression levels than healthy mucosa (P = .014). A higher unmethylated profile of the MMP9 gene was found in periapical granulomas and radicular cysts compared with healthy mucosa. In addition, higher MMP9 mRNA expression was observed in the periapical lesions compared with healthy tissues. The present study suggests that the unmethylated status of the MMP9 gene in periapical lesions may explain the observed up-regulation of messenger RNA transcription in these lesions. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  20. Matrix Metalloproteinases Are Differentially Regulated and Responsive to Compression Therapy in a Red Duroc Model of Hypertrophic Scar.

    PubMed

    Travis, Taryn E; Ghassemi, Pejhman; Prindeze, Nicholas J; Moffatt, Lauren T; Carney, Bonnie C; Alkhalil, Abdulnaser; Ramella-Roman, Jessica C; Shupp, Jeffrey W

    2018-01-01

    Objective: Proteins of the matrix metalloproteinases family play a vital role in extracellular matrix maintenance and basic physiological processes in tissue homeostasis. The function and activities of matrix metalloproteinases in response to compression therapies have yet to be defined. Here, a swine model of hypertrophic scar was used to profile the transcription of all known 26 matrix metalloproteinases in scars treated with a precise compression dose. Methods: Full-thickness excisional wounds were created. Wounds underwent healing and scar formation. A subset of scars underwent 2 weeks of compression therapy. Biopsy specimens were preserved, and microarrays, reverse transcription-polymerase chain reaction, Western blotting, and immunohistochemistry were performed to characterize the transcription and expression of various matrix metalloproteinase family members. Results: Microarray results showed that 13 of the known 26 matrix metalloproteinases were differentially transcribed in wounds relative to the preinjury skin. The predominant upregulation of these matrix metalloproteinases during early wound-healing stages declined gradually in later stages of wound healing. The use of compression therapy reduced this decline in 10 of the 13 differentially regulated matrix metalloproteinases. Further investigation of MMP7 using reverse transcription-polymerase chain reaction confirmed the effect of compression on transcript levels. Assessment of MMP7 at the protein level using Western blotting and immunohistochemistry was concordant. Conclusions: In a swine model of hypertrophic scar, the application of compression to hypertrophic scar attenuated a trend of decreasing levels of matrix metalloproteinases during the process of hypertrophic wound healing, including MMP7, whose enzyme regulation was confirmed at the protein level.

  1. Peptide chain dynamics in light and heavy water: zooming in on internal friction.

    PubMed

    Schulz, Julius C F; Schmidt, Lennart; Best, Robert B; Dzubiella, Joachim; Netz, Roland R

    2012-04-11

    Frictional effects due to the chain itself, rather than the solvent, may have a significant effect on protein dynamics. Experimentally, such "internal friction" has been investigated by studying folding or binding kinetics at varying solvent viscosity; however, the molecular origin of these effects is hard to pinpoint. We consider the kinetics of disordered glycine-serine and α-helix forming alanine peptides and a coarse-grained protein folding model in explicit-solvent molecular dynamics simulations. By varying the solvent mass over more than two orders of magnitude, we alter only the solvent viscosity and not the folding free energy. Folding dynamics at the near-vanishing solvent viscosities accessible by this approach suggests that solvent and internal friction effects are intrinsically entangled. This finding is rationalized by calculation of the polymer end-to-end distance dynamics from a Rouse model that includes internal friction. An analysis of the friction profile along different reaction coordinates, extracted from the simulation data, demonstrates that internal as well as solvent friction varies substantially along the folding pathways and furthermore suggests a connection between friction and the formation of hydrogen bonds upon folding. © 2012 American Chemical Society

  2. ICI 182,780-regulated gene expression in DU145 prostate cancer cells is mediated by estrogen receptor-beta/NFkappaB crosstalk.

    PubMed

    Leung, Yuet-Kin; Gao, Ying; Lau, Kin-Mang; Zhang, Xiang; Ho, Shuk-Mei

    2006-04-01

    Estrogen receptor (ER)-beta is the predominant ER subtype in prostate cancer (PCa). We previously demonstrated that ICI 182,780 (ICI), but not estrogens, exerted dose-dependent growth inhibition on DU145 PCa cells by an ER-beta-mediated pathway. Transcriptional profiling detected a greater than three-fold upregulation of seven genes after a 12-hour exposure to 1 microM ICI. Semiquantitative reverse transcriptase polymerase chain reaction confirmed the upregulation of four genes by ICI: interleukin-12alpha chain, interleukin-8, embryonic growth/differentiation factor, and RYK tyrosine kinase. Treatment with an ER-beta antisense oligonucleotide reduced cellular ER-beta mRNA and induced loss of expression of these genes. Sequence analysis revealed the presence of consensus NFkappaB sites, but not estrogen-responsive elements, in promoters of all four genes. Reporter assay and chromatin immunoprecipitation experiments demonstrated that ICI-induced gene expression could be mediated by crosstalk between ER-beta and the NFkappaB signaling pathway, denoting a novel mechanism of ER-beta-mediated ICI action. Therefore, combined therapies targeting ER-beta and NFkappaB signaling may be synergistic as treatment for PCa.

  3. ICI 182,780-Regulated Gene Expression in DU145 Prostate Cancer Cells Is Mediated by Estrogen Receptor-β/NFκB Crosstalk1

    PubMed Central

    Leung, Yuet-Kin; Gao, Ying; Lau, Kin-Mang; Zhang, Xiang; Ho, Shuk-Mei

    2006-01-01

    Abstract Estrogen receptor (ER)-β is the predominant ER subtype in prostate cancer (PCa). We previously demonstrated that ICI 182,780 (ICI), but not estrogens, exerted dose-dependent growth inhibition on DU145 PCa cells by an ER-β-mediated pathway. Transcriptional profiling detected a greater than three-fold upregulation of seven genes after a 12-hour exposure to 1 µM ICI. Semi-quantitative reverse transcriptase polymerase chain reaction confirmed the upregulation of four genes by ICI: interleukin-12α chain, interleukin-8, embryonic growth/differentiation factor, and RYK tyrosine kinase. Treatment with an ER-β antisense oligonucleotide reduced cellular ER-β mRNA and induced loss of expression of these genes. Sequence analysis revealed the presence of consensus NFκB sites, but not estrogen-responsive elements, in promoters of all four genes. Reporter assay and chromatin immunoprecipitation experiments demonstrated that ICI-induced gene expression could be mediated by crosstalk between ER-α and the NFκB signaling pathway, denoting a novel mechanism of ER-β-mediated ICI action. Therefore, combined therapies targeting ER-β and NFκB signaling may be synergistic as treatment for PCa. PMID:16756716

  4. Kinetics of reactions of the Actinomadura R39 DD-peptidase with specific substrates.

    PubMed

    Adediran, S A; Kumar, Ish; Nagarajan, Rajesh; Sauvage, Eric; Pratt, R F

    2011-01-25

    The Actinomadura R39 DD-peptidase catalyzes the hydrolysis and aminolysis of a number of small peptides and depsipeptides. Details of its substrate specificity and the nature of its in vivo substrate are not, however, well understood. This paper describes the interactions of the R39 enzyme with two peptidoglycan-mimetic substrates 3-(D-cysteinyl)propanoyl-D-alanyl-D-alanine and 3-(D-cysteinyl)propanoyl-D-alanyl-D-thiolactate. A detailed study of the reactions of the former substrate, catalyzed by the enzyme, showed DD-carboxypeptidase, DD-transpeptidase, and DD-endopeptidase activities. These results confirm the specificity of the enzyme for a free D-amino acid at the N-terminus of good substrates and indicated a preference for extended D-amino acid leaving groups. The latter was supported by determination of the structural specificity of amine nucleophiles for the acyl-enzyme generated by reaction of the enzyme with the thiolactate substrate. It was concluded that a specific substrate for this enzyme, and possibly the in vivo substrate, may consist of a partly cross-linked peptidoglycan polymer where a free side chain N-terminal un-cross-linked amino acid serves as the specific acyl group in an endopeptidase reaction. The enzyme is most likely a DD-endopeptidase in vivo. pH-rate profiles for reactions of the enzyme with peptides, the thiolactate named above, and β-lactams indicated the presence of complex proton dissociation pathways with sticky substrates and/or protons. The local structure of the active site may differ significantly for reactions of peptides and β-lactams. Solvent kinetic deuterium isotope effects indicate the presence of classical general acid/base catalysis in both acylation and deacylation; there is no evidence of the low fractionation factor active site hydrogen found previously in class A and C β-lactamases.

  5. A Gene Expression Signature Associated with Overall Survival in Patients with Hepatocellular Carcinoma Suggests a New Treatment Strategy.

    PubMed

    Gillet, Jean-Pierre; Andersen, Jesper B; Madigan, James P; Varma, Sudhir; Bagni, Rachel K; Powell, Katie; Burgan, William E; Wu, Chung-Pu; Calcagno, Anna Maria; Ambudkar, Suresh V; Thorgeirsson, Snorri S; Gottesman, Michael M

    2016-02-01

    Despite improvements in the management of liver cancer, the survival rate for patients with hepatocellular carcinoma (HCC) remains dismal. The survival benefit of systemic chemotherapy for the treatment of liver cancer is only marginal. Although the reasons for treatment failure are multifactorial, intrinsic resistance to chemotherapy plays a primary role. Here, we analyzed the expression of 377 multidrug resistance (MDR)-associated genes in two independent cohorts of patients with advanced HCC, with the aim of finding ways to improve survival in this poor-prognosis cancer. Taqman-based quantitative polymerase chain reaction revealed a 45-gene signature that predicts overall survival (OS) in patients with HCC. Using the Connectivity Map Tool, we were able to identify drugs that converted the gene expression profiles of HCC cell lines from ones matching patients with poor OS to profiles associated with good OS. We found three compounds that convert the gene expression profiles of three HCC cell lines to gene expression profiles associated with good OS. These compounds increase histone acetylation, which correlates with the synergistic sensitization of those MDR tumor cells to conventional chemotherapeutic agents, including cisplatin, sorafenib, and 5-fluorouracil. Our results indicate that it is possible to modulate gene expression profiles in HCC cell lines to those associated with better outcome. This approach also increases sensitization of HCC cells toward conventional chemotherapeutic agents. This work suggests new treatment strategies for a disease for which few therapeutic options exist. U.S. Government work not protected by U.S. copyright.

  6. Molecular genetic identification of skeletal remains from the Second World War Konfin I mass grave in Slovenia

    PubMed Central

    Gornjak Pogorelc, Barbara; Balažic, Jože

    2010-01-01

    This paper describes molecular genetic identification of one third of the skeletal remains of 88 victims of postwar (June 1945) killings found in the Konfin I mass grave in Slovenia. Living relatives were traced for 36 victims. We analyzed 84 right femurs and compared their genetic profiles to the genetic material of living relatives. We cleaned the bones, removed surface contamination, and ground the bones into powder. Prior to DNA isolation using Biorobot EZ1 (Qiagen), the powder was decalcified. The nuclear DNA of the samples was quantified using the real-time polymerase chain reaction method. We extracted 0.8 to 100 ng DNA/g of bone powder from 82 bones. Autosomal genetic profiles and Y-chromosome haplotypes were obtained from 98% of the bones, and mitochondrial DNA (mtDNA) haplotypes from 95% of the bones for the HVI region and from 98% of the bones for the HVII region. Genetic profiles of the nuclear and mtDNA were determined for reference persons. For traceability in the event of contamination, we created an elimination database including genetic profiles of the nuclear and mtDNA of all persons that had been in contact with the skeletal remains. When comparing genetic profiles, we matched 28 of the 84 bones analyzed with living relatives (brothers, sisters, sons, daughters, nephews, or cousins). The statistical analyses showed a high confidence of correct identification for all 28 victims in the Konfin I mass grave (posterior probability ranged from 99.9% to more than 99.999999%). PMID:20217112

  7. Molecular genetic identification of skeletal remains from the Second World War Konfin I mass grave in Slovenia.

    PubMed

    Zupanic Pajnic, Irena; Gornjak Pogorelc, Barbara; Balazic, Joze

    2010-07-01

    This paper describes molecular genetic identification of one third of the skeletal remains of 88 victims of postwar (June 1945) killings found in the Konfin I mass grave in Slovenia. Living relatives were traced for 36 victims. We analyzed 84 right femurs and compared their genetic profiles to the genetic material of living relatives. We cleaned the bones, removed surface contamination, and ground the bones into powder. Prior to DNA isolation using Biorobot EZ1 (Qiagen), the powder was decalcified. The nuclear DNA of the samples was quantified using the real-time polymerase chain reaction method. We extracted 0.8 to 100 ng DNA/g of bone powder from 82 bones. Autosomal genetic profiles and Y-chromosome haplotypes were obtained from 98% of the bones, and mitochondrial DNA (mtDNA) haplotypes from 95% of the bones for the HVI region and from 98% of the bones for the HVII region. Genetic profiles of the nuclear and mtDNA were determined for reference persons. For traceability in the event of contamination, we created an elimination database including genetic profiles of the nuclear and mtDNA of all persons that had been in contact with the skeletal remains. When comparing genetic profiles, we matched 28 of the 84 bones analyzed with living relatives (brothers, sisters, sons, daughters, nephews, or cousins). The statistical analyses showed a high confidence of correct identification for all 28 victims in the Konfin I mass grave (posterior probability ranged from 99.9% to more than 99.999999%).

  8. Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.

    PubMed

    Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C

    2012-09-27

    We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.

  9. Large enhancement in the heterogeneous oxidation rate of organic aerosols by hydroxyl radicals in the presence of nitric oxide

    DOE PAGES

    Richards-Henderson, Nicole K.; Goldstein, Allen H.; Wilson, Kevin R.

    2015-10-27

    In this paper we report an unexpectedly large acceleration in the effective heterogeneous OH reaction rate in the presence of NO. This 10–50 fold acceleration originates from free radical chain reactions, propagated by alkoxy radicals that form inside the aerosol by the reaction of NO with peroxy radicals, which do not appear to produce chain terminating products (e.g., alkyl nitrates), unlike gas phase mechanisms. Lastly, a kinetic model, constrained by experiments, suggests that in polluted regions heterogeneous oxidation plays a much more prominent role in the daily chemical evolution of organic aerosol than previously believed.

  10. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+{sup 11}B process

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belyaev, V. S.; Krainov, V. P., E-mail: vpkrainov@mail.ru; Zagreev, B. V.

    2015-07-15

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+{sup 11}B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from {sup 11}B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+{sup 11}B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons amongmore » fusion products. Nuclear reactions that follow the p+{sup 11}B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+{sup 11}B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.« less

  11. GRAVITY DATA OBTAINED DURING CHAIN CRUISE NO. 70.

    DTIC Science & Technology

    Profiles, tabulations, and charts are presented of principal gravity facts, free-air gravity anomalies, and simple Bouguer gravity anomalies obtained in the western North Atlantic Ocean during R/V CHAIN cruise 70. (Author)

  12. Synthesis of side-chain oxysterols and their enantiomers through cross-metathesis reactions of Δ22 steroids.

    PubMed

    Brownholland, David P; Covey, Douglas F

    2017-05-01

    A synthetic route that utilizes a cross-metathesis reaction with Δ 22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

    PubMed

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

    2014-04-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

  14. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

    PubMed Central

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

    2014-01-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

  15. Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

    PubMed

    Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

    2011-11-01

    The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  16. Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

    USDA-ARS?s Scientific Manuscript database

    The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

  17. Spark Plasma Sintering for Nanostructured Smart Materials

    DTIC Science & Technology

    2009-03-02

    polyester) with excess isocyanate to form a prepolymer , followed by the addition of a short chain diol that acts as a chain extender to link the... prepolymers together. Due to the thermodynamic imicisibility of segments of PU, phase separation into a flexible soft segment (long chain diol) and a...other reactions of the isocyanate groups with the other functional groups in the chain. [Hepburn, 1992] However, during the initial prepolymer

  18. [Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

    PubMed

    Harano, K; Harano, T; Kushida, Y; Ueda, S

    1991-08-01

    Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

  19. Density functional computational studies on the glucose and glycine Maillard reaction: Formation of the Amadori rearrangement products

    NASA Astrophysics Data System (ADS)

    Jalbout, Abraham F.; Roy, Amlan K.; Shipar, Abul Haider; Ahmed, M. Samsuddin

    Theoretical energy changes of various intermediates leading to the formation of the Amadori rearrangement products (ARPs) under different mechanistic assumptions have been calculated, by using open chain glucose (O-Glu)/closed chain glucose (A-Glu and B-Glu) and glycine (Gly) as a model for the Maillard reaction. Density functional theory (DFT) computations have been applied on the proposed mechanisms under different pH conditions. Thus, the possibility of the formation of different compounds and electronic energy changes for different steps in the proposed mechanisms has been evaluated. B-Glu has been found to be more efficient than A-Glu, and A-Glu has been found more efficient than O-Glu in the reaction. The reaction under basic condition is the most favorable for the formation of ARPs. Other reaction pathways have been computed and discussed in this work.0

  20. microRNA expression profiling in fetal single ventricle malformation identified by deep sequencing.

    PubMed

    Yu, Zhang-Bin; Han, Shu-Ping; Bai, Yun-Fei; Zhu, Chun; Pan, Ya; Guo, Xi-Rong

    2012-01-01

    microRNAs (miRNAs) have emerged as key regulators in many biological processes, particularly cardiac growth and development, although the specific miRNA expression profile associated with this process remains to be elucidated. This study aimed to characterize the cellular microRNA profile involved in the development of congenital heart malformation, through the investigation of single ventricle (SV) defects. Comprehensive miRNA profiling in human fetal SV cardiac tissue was performed by deep sequencing. Differential expression of 48 miRNAs was revealed by sequencing by oligonucleotide ligation and detection (SOLiD) analysis. Of these, 38 were down-regulated and 10 were up-regulated in differentiated SV cardiac tissue, compared to control cardiac tissue. This was confirmed by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis. Predicted target genes of the 48 differentially expressed miRNAs were analyzed by gene ontology and categorized according to cellular process, regulation of biological process and metabolic process. Pathway-Express analysis identified the WNT and mTOR signaling pathways as the most significant processes putatively affected by the differential expression of these miRNAs. The candidate genes involved in cardiac development were identified as potential targets for these differentially expressed microRNAs and the collaborative network of microRNAs and cardiac development related-mRNAs was constructed. These data provide the basis for future investigation of the mechanism of the occurrence and development of fetal SV malformations.

  1. Methanol Cannon Demonstrations Revisited.

    ERIC Educational Resources Information Center

    Dolson, David A.; And Others

    1995-01-01

    Describes two variations on the traditional methanol cannon demonstration. The first variation is a chain reaction using real metal chains. The second example involves using easily available components to produce sequential explosions that can be musical in nature. (AIM)

  2. Quasi-free Proton Knockout Reactions on the Oxygen Isotopic Chain

    NASA Astrophysics Data System (ADS)

    Atar, Leyla; Aumann, Thomas; Bertulani, Carlos; Paschalis, Stefanos; R3B Collaboration

    2017-09-01

    It is well known from electron-induced knockout data that the single-particle (SP) strength is reduced to about 60-70% for stable nuclei in comparison to the independent particle model due to the presence of short- and long-range correlations. This finding has been confirmed by nuclear knockout reactions using stable and exotic beams, however, with a strong dependency on the proton-neutron asymmetry. The observed strong reduction of SP cross sections for the deeply bound valence nucleons in asymmetric nuclei is theoretically not understood. To understand this dependency quantitatively a complementary approach, quasi-free (QF) knockout reactions in inverse kinematics, is introduced. We have performed a systematic study of spectroscopic strength of oxygen isotopes using QF (p,2p) knockout reactions in complete kinematics at the R3B/LAND setup at GSI with secondary beams containing 13-24O. The oxygen isotopic chain covers a large variation of separ ation energies, which allow a systematic study of SF with respect to isospin asymmetry. We will present results on the (p,2p) cross sections for the entire oxygen isotopic chain obtained from a single experiment. By comparison with the Eikonal reaction theory the SF and reduction factors will be presented. The work is supported by GSI-TU Darmstadt cooperation and BMBF project 05P15RDFN1.

  3. A chain reaction approach to modelling gene pathways.

    PubMed

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By applying it to microarray data, the chain reaction model computed a set of reaction rates to examine the effects of three polyphenols (EGCG, genistein, and resveratrol) on gene expression in this pathway during puberty. We first performed statistical analysis to test the time factor on the estrogen synthesis pathway. Global tests were used to evaluate an overall gene expression change during puberty for each experimental group. Then, a chain reaction model was employed to simulate the estrogen synthesis pathway. Specifically, the model computed the reaction rates in a set of ordinary differential equations to describe interactions between genes in the pathway (A reaction rate K of A to B represents gene A will induce gene B per unit at a rate of K; we give details in the "method" section). Since disparate changes of gene expression may cause numerical error problems in solving these differential equations, we used an implicit scheme to address this issue. We first applied the chain reaction model to obtain the reaction rates for the control group. A sensitivity study was conducted to evaluate how well the model fits to the control group data at Day 50. Results showed a small bias and mean square error. These observations indicated the model is robust to low random noises and has a good fit for the control group. Then the chain reaction model derived from the control group data was used to predict gene expression at Day 50 for the three polyphenol groups. If these nutrients affect the estrogen synthesis pathways during puberty, we expect discrepancy between observed and expected expressions. Results indicated some genes had large differences in the EGCG (e.g., Hsd3b and Sts) and the resveratrol (e.g., Hsd3b and Hrmt12) groups. CONCLUSIONS: In the present study, we have presented (I) experimental studies of the effect of nutrient diets on the gene expression changes in a selected estrogen synthesis pathway. This experiment is valuable because it allows us to examine how the nutrient-containing diets regulate gene expression in the estrogen synthesis pathway during puberty; (II) global tests to assess an overall association of this particular pathway with time factor by utilizing generalized linear models to analyze microarray data; and (III) a chain reaction model to simulate the pathway. This is a novel application because we are able to translate the gene pathway into the chemical reactions in which each reaction channel describes gene-gene relationship in the pathway. In the chain reaction model, the implicit scheme is employed to efficiently solve the differential equations. Data analysis results show the proposed model is capable of predicting gene expression changes and demonstrating the effect of nutrient-containing diets on gene expression changes in the pathway. One of the objectives of this study is to explore and develop a numerical approach for simulating the gene expression change so that it can be applied and calibrated when the data of more time slices are available, and thus can be used to interpolate the expression change at a desired time point without conducting expensive experiments for a large amount of time points. Hence, we are not claiming this is either essential or the most efficient way for simulating this problem, rather a mathematical/numerical approach that can model the expression change of a large set of genes of a complex pathway. In addition, we understand the limitation of this experiment and realize that it is still far from being a complete model of predicting nutrient-gene interactions. The reason is that in the present model, the reaction rates were estimated based on available data at two time points; hence, the gene expression change is dependent upon the reaction rates and a linear function of the gene expressions. More data sets containing gene expression at various time slices are needed in order to improve the present model so that a non-linear variation of gene expression changes at different time can be predicted.

  4. Prediction of FAD binding sites in electron transport proteins according to efficient radial basis function networks and significant amino acid pairs.

    PubMed

    Le, Nguyen-Quoc-Khanh; Ou, Yu-Yen

    2016-07-30

    Cellular respiration is a catabolic pathway for producing adenosine triphosphate (ATP) and is the most efficient process through which cells harvest energy from consumed food. When cells undergo cellular respiration, they require a pathway to keep and transfer electrons (i.e., the electron transport chain). Due to oxidation-reduction reactions, the electron transport chain produces a transmembrane proton electrochemical gradient. In case protons flow back through this membrane, this mechanical energy is converted into chemical energy by ATP synthase. The convert process is involved in producing ATP which provides energy in a lot of cellular processes. In the electron transport chain process, flavin adenine dinucleotide (FAD) is one of the most vital molecules for carrying and transferring electrons. Therefore, predicting FAD binding sites in the electron transport chain is vital for helping biologists understand the electron transport chain process and energy production in cells. We used an independent data set to evaluate the performance of the proposed method, which had an accuracy of 69.84 %. We compared the performance of the proposed method in analyzing two newly discovered electron transport protein sequences with that of the general FAD binding predictor presented by Mishra and Raghava and determined that the accuracy of the proposed method improved by 9-45 % and its Matthew's correlation coefficient was 0.14-0.5. Furthermore, the proposed method enabled reducing the number of false positives significantly and can provide useful information for biologists. We developed a method that is based on PSSM profiles and SAAPs for identifying FAD binding sites in newly discovered electron transport protein sequences. This approach achieved a significant improvement after we added SAAPs to PSSM features to analyze FAD binding proteins in the electron transport chain. The proposed method can serve as an effective tool for predicting FAD binding sites in electron transport proteins and can help biologists understand the functions of the electron transport chain, particularly those of FAD binding sites. We also developed a web server which identifies FAD binding sites in electron transporters available for academics.

  5. Cycle spokes and chain related injuries in children--emerging injuries in Malaysia.

    PubMed

    Nazri, M Y; Hafiz, A; Yusof, A; Khalid, K A; Aminudin, C A

    2005-07-01

    A descriptive prospective study of 16 children with injuries inflicted by bicycle spokes and chain was undertaken to identify the demographic profiles of such injuries. Aspects of preventive measures are proposed.

  6. Unraveling reaction pathways and specifying reaction kinetics for complex systems.

    PubMed

    Vinu, R; Broadbelt, Linda J

    2012-01-01

    Many natural and industrial processes involve a complex set of competing reactions that include several different species. Detailed kinetic modeling of such systems can shed light on the important pathways involved in various transformations and therefore can be used to optimize the process conditions for the desired product composition and properties. This review focuses on elucidating the various components involved in modeling the kinetics of pyrolysis and oxidation of polymers. The elementary free radical steps that constitute the chain reaction mechanism of gas-phase/nonpolar liquid-phase processes are outlined. Specification of the rate coefficients of the various reaction families, which is central to the theme of kinetics, is described. Construction of the reaction network on the basis of the types of end groups and reactive moieties in a polymer chain is discussed. Modeling frameworks based on the method of moments and kinetic Monte Carlo are evaluated using illustrations. Finally, the prospects and challenges in modeling biomass conversion are addressed.

  7. Comparison of spa Types, SCCmec Types and Antimicrobial Resistance Profiles of MRSA Isolated from Turkeys at Farm, Slaughter and from Retail Meat Indicates Transmission along the Production Chain

    PubMed Central

    Vossenkuhl, Birgit; Brandt, Jörgen; Fetsch, Alexandra; Käsbohrer, Annemarie; Kraushaar, Britta; Alt, Katja; Tenhagen, Bernd-Alois

    2014-01-01

    The prevalence of MRSA in the turkey meat production chain in Germany was estimated within the national monitoring for zoonotic agents in 2010. In total 22/112 (19.6%) dust samples from turkey farms, 235/359 (65.5%) swabs from turkey carcasses after slaughter and 147/460 (32.0%) turkey meat samples at retail were tested positive for MRSA. The specific distributions of spa types, SCCmec types and antimicrobial resistance profiles of MRSA isolated from these three different origins were compared using chi square statistics and the proportional similarity index (Czekanowski index). No significant differences between spa types, SCCmec types and antimicrobial resistance profiles of MRSA from different steps of the German turkey meat production chain were observed using Chi-Square test statistics. The Czekanowski index which can obtain values between 0 (no similarity) and 1 (perfect agreement) was consistently high (0.79–0.86) for the distribution of spa types and SCCmec types between the different processing stages indicating high degrees of similarity. The comparison of antimicrobial resistance profiles between the different process steps revealed the lowest Czekanowski index values (0.42–0.56). However, the Czekanowski index values were substantially higher than the index when isolates from the turkey meat production chain were compared to isolates from wild boar meat (0.13–0.19), an example of a separated population of MRSA used as control group. This result indicates that the proposed statistical method is valid to detect existing differences in the distribution of the tested characteristics of MRSA. The degree of similarity in the distribution of spa types, SCCmec types and antimicrobial resistance profiles between MRSA isolates from different process stages of turkey meat production may reflect MRSA transmission along the chain. PMID:24788143

  8. DNA typing in forensic medicine and in criminal investigations: a current survey.

    PubMed

    Benecke, M

    1997-05-01

    Since 1985 DNA typing of biological material has become one of the most powerful tools for personal identification in forensic medicine and in criminal investigations [1-6]. Classical DNA "fingerprinting" is increasingly being replaced by polymerase chain reaction (PCR) based technology which detects very short polymorphic stretches of DNA [7-15]. DNA loci which forensic scientists study do not code for proteins, and they are spread over the whole genome [16, 17]. These loci are neutral, and few provide any information about individuals except for their identity. Minute amounts of biological material are sufficient for DNA typing. Many European countries are beginning to establish databases to store DNA profiles of crime scenes and known offenders. A brief overview is given of past and present DNA typing and the establishment of forensic DNA databases in Europe.

  9. DNA typing in forensic medicine and in criminal investigations: a current survey

    NASA Astrophysics Data System (ADS)

    Benecke, Mark

    Since 1985 DNA typing of biological material has become one of the most powerful tools for personal identification in forensic medicine and in criminal investigations [1-6]. Classical DNA "fingerprinting" is increasingly being replaced by polymerase chain reaction (PCR) based technology which detects very short polymorphic stretches of DNA [7-15]. DNA loci which forensic scientists study do not code for proteins, and they are spread over the whole genome [16, 17]. These loci are neutral, and few provide any information about individuals except for their identity. Minute amounts of biological material are sufficient for DNA typing. Many European countries are beginning to establish databases to store DNA profiles of crime scenes and known offenders. A brief overview is given of past and present DNA typing and the establishment of forensic DNA databases in Europe.

  10. Babesia canis vogeli, Ehrlichia canis, and Anaplasma platys infection in a dog.

    PubMed

    Al Izzi, Salah; Martin, Donald S; Chan, Roxanne Y Y; Leutenegger, Christian M

    2013-12-01

    A 12-month-old male neutered mixed breed dog was presented with a history of diarrhea, lethargy, emaciation, polydypsia, and sniffling. Physical examination findings included pale mucous membranes, increased heart and respiratory rates, and normal rectal temperature (38°C). Hematologic abnormalities included anemia and thrombocytopenia. Biochemical abnormalities included hypoalbuminemia, hyperbilirubinemia, and elevated ALP and ALT activities. A SNAP 4Dx test result was positive for Ehrlichia canis. Babesia canis vogeli organisms were found in the peripheral blood films, while morulae of E canis were not seen. Real-time polymerase chain reaction testing confirmed the presence of both B c vogeli and E canis organisms, and also was positive for Anaplasma platys infection. The dog recovered following treatment with doxycycline and imidocarb dipropionate, with normal hematology and biochemical profiles. © 2013 American Society for Veterinary Clinical Pathology.

  11. Gene expression profiling in melasma in Korean women.

    PubMed

    Chung, Bo Young; Noh, Tai Kyung; Yang, Sang Hwa; Kim, Il Hwan; Lee, Mi Woo; Yoon, Tae Jin; Chang, Sung Eun

    2014-01-01

    There has been a paucity of data about the difference in gene expression between melasma lesional skin and normal adjacent one. Our aim was to identify novel genes involved in the pathogenesis of melasma. We performed a microarray analysis and confirmed the results on quantitative real-time polymerase chain reaction (qRT-PCR) in Korean women with melasma. There were 334 genes whose degree of expression showed a significant difference between melasma lesional skin and normal adjacent one. Of these, five were confirmed on qRT-PCR. In melasma lesional skin, there were down-regulation of genes involved in the PPAR signaling pathway and up-regulation of genes involved in neuronal component and the functions of stratum corneum barrier. This result suggests that the pathogenesis of melasma might be associated with novel genes involved in the above signaling pathway in Korean women.

  12. Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill.

    PubMed

    de Almeida, Márcia R; Ruedell, Carolina M; Ricachenevsky, Felipe K; Sperotto, Raul A; Pasquali, Giancarlo; Fett-Neto, Arthur G

    2010-09-20

    Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR); however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs identified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Our study showed that expression stability varied between putative reference genes tested in E. globulus. Based on the AGO1 relative expression profile obtained using the genes suggested by the algorithms, H2B and TUA were considered as the most suitable reference genes for expression studies in E. globulus adventitious rooting. UBI and 18S were unsuitable for use as controls in qPCR related to this process. These findings will enable more accurate and reliable normalization of qPCR results for gene expression studies in this economically important woody plant, particularly related to rooting and clonal propagation.

  13. Reference gene selection for quantitative reverse transcription-polymerase chain reaction normalization during in vitro adventitious rooting in Eucalyptus globulus Labill

    PubMed Central

    2010-01-01

    Background Eucalyptus globulus and its hybrids are very important for the cellulose and paper industry mainly due to their low lignin content and frost resistance. However, rooting of cuttings of this species is recalcitrant and exogenous auxin application is often necessary for good root development. To date one of the most accurate methods available for gene expression analysis is quantitative reverse transcription-polymerase chain reaction (qPCR); however, reliable use of this technique requires reference genes for normalization. There is no single reference gene that can be regarded as universal for all experiments and biological materials. Thus, the identification of reliable reference genes must be done for every species and experimental approach. The present study aimed at identifying suitable control genes for normalization of gene expression associated with adventitious rooting in E. globulus microcuttings. Results By the use of two distinct algorithms, geNorm and NormFinder, we have assessed gene expression stability of eleven candidate reference genes in E. globulus: 18S, ACT2, EF2, EUC12, H2B, IDH, SAND, TIP41, TUA, UBI and 33380. The candidate reference genes were evaluated in microccuttings rooted in vitro, in presence or absence of auxin, along six time-points spanning the process of adventitious rooting. Overall, the stability profiles of these genes determined with each one of the algorithms were very similar. Slight differences were observed in the most stable pair of genes indicated by each program: IDH and SAND for geNorm, and H2B and TUA for NormFinder. Both programs indentified UBI and 18S as the most variable genes. To validate these results and select the most suitable reference genes, the expression profile of the ARGONAUTE1 gene was evaluated in relation to the most stable candidate genes indicated by each algorithm. Conclusion Our study showed that expression stability varied between putative reference genes tested in E. globulus. Based on the AGO1 relative expression profile obtained using the genes suggested by the algorithms, H2B and TUA were considered as the most suitable reference genes for expression studies in E. globulus adventitious rooting. UBI and 18S were unsuitable for use as controls in qPCR related to this process. These findings will enable more accurate and reliable normalization of qPCR results for gene expression studies in this economically important woody plant, particularly related to rooting and clonal propagation. PMID:20854682

  14. The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

    PubMed

    Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

    2002-03-01

    Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

  15. Identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in Mexico.

    PubMed

    Ortega, Ariadna Flores; Martínez-Castañeda, José Simón; Bautista-Gómez, Linda G; Muñoz, Raúl Fajardo; Hernández, Israel Quijano

    This is the first report on circulating canine rotavirus in Mexico. Fifty samples from dogs with gastroenteritis were analyzed used polymerase chain reaction and reverse transcription polymerase chain reaction in order to identify parvovirus and rotavirus, respectively; 7% of dogs were infected with rotavirus exclusively, while 14% were co-infected with both rotavirus and parvovirus; clinical signs in co-infected dogs were more severe. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  16. Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

    PubMed

    Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

    2016-01-01

    American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

  17. Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

    PubMed

    Law, Dennis K S; Tsang, Raymond S W

    2013-05-01

    A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

  18. A computational study of pyrolysis reactions of lignin model compounds

    Treesearch

    Thomas Elder

    2010-01-01

    Enthalpies of reaction for the initial steps in the pyrolysis of lignin have been evaluated at the CBS-4m level of theory using fully substituted b-O-4 dilignols. Values for competing unimolecular decomposition reactions are consistent with results previously published for phenethyl phenyl ether models, but with lowered selectivity. Chain propagating reactions of free...

  19. Covalent bond force profile and cleavage in a single polymer chain

    NASA Astrophysics Data System (ADS)

    Garnier, Lionel; Gauthier-Manuel, Bernard; van der Vegte, Eric W.; Snijders, Jaap; Hadziioannou, Georges

    2000-08-01

    We present here the measurement of the single-polymer entropic elasticity and the single covalent bond force profile, probed with two types of atomic force microscopes (AFM) on a synthetic polymer molecule: polymethacrylic acid in water. The conventional AFM allowed us to distinguish two types of interactions present in this system when doing force spectroscopic measurements: the first interaction is associated with adsorption sites of the polymer chains onto a bare gold surface, the second interaction is directly correlated to the rupture process of a single covalent bond. All these bridging interactions allowed us to stretch the single polymer chain and to determine the various factors playing a role in the elasticity of these molecules. To obtain a closer insight into the bond rupture process, we moved to a force sensor stable in position when measuring attractive forces. By optimizing the polymer length so as to fulfill the elastic stability conditions, we were able for the first time to map out the entire force profile associated with the cleavage of a single covalent bond. Experimental data coupled with molecular quantum mechanical calculations strongly suggest that the breaking bond is located at one end of the polymer chain.

  20. Modeling the SOA Forming Potential of Substituted Dihydrofurans from Alkane + OH Reactions in the Atmosphere

    NASA Astrophysics Data System (ADS)

    Jordan, C. E.; Griffin, R. J.; Lim, Y. B.; Ziemann, P. J.; Atkinson, R.; Arey, J.

    2005-12-01

    Recent laboratory studies show that δ-hydroxycarbonyls formed in the atmosphere via OH-initiated reactions with alkanes can cyclize then dehydrate to form substituted dihydrofurans. These dihydrofurans are highly reactive, with lifetimes in the atmosphere of 1.3 h (OH), 24 s (NO3), and 7 min (O3). The ability of the δ-hydroxycarbonyls to cyclize and dehydrate has been shown to increase with increasing carbon number. Recent laboratory results show that the secondary organic aerosol (SOA) yields from alkanes also increase with carbon number reaching ~53% for C15. The reaction mechanism proposed based on the chamber results is the basis of the modeling study presented here. We have incorporated this proposed mechanism into the Caltech Atmospheric Chemistry Mechanism (CACM). For computational reasons, similar compounds are lumped together and represented by a single suitable compound. In the present case, alkanes are lumped into 3 groups: short chains (≤C6), medium chains (C7 - C12), and long chains (≥C13). SOA yields obtained in chamber studies increase dramatically from 0.5% for C8 to 25% for C12. The most dramatic increase is observed from C11 (8%) to C13 (~50%). This is attributed to the low volatility of first generation products contributing to the SOA from longer chain alkanes. Here we have studied OH reactions with the substituted dihydrofurans for medium (represented by C10) and long (represented by C16) chain alkanes using CACM along with the aerosol partitioning module MPMPO (Model to Predict the Multi-phase Partitioning of Organics). We will present the results of this modeling study, characterizing the influence of substituted dihydrofurans on the SOA forming potential of alkanes.

  1. Medium-chain triglycerides promote macrophage reverse cholesterol transport and improve atherosclerosis in ApoE-deficient mice fed a high-fat diet.

    PubMed

    Zhang, Xinsheng; Zhang, Yong; Liu, Yinghua; Wang, Jin; Xu, Qing; Yu, Xiaoming; Yang, Xueyan; Liu, Zhao; Xue, Changyong

    2016-09-01

    We previously observed that medium-chain triglycerides (MCTs) could reduce body fat mass and improve the metabolism of cholesterol. We hypothesized that MCTs can improve atherosclerosis by promoting the reverse cholesterol transport (RCT) process. Therefore, the objective of this study was to investigate the roles of MCTs in macrophage RCT and the progression of atherosclerosis. To test this hypothesis, 30 4-week-old ApoE-deficient (ApoE(-/-)) mice were randomly divided into 2 groups and fed a diet of 2% MCTs or long-chain triglycerides (LCTs) for 16 weeks. Ten age- and sex-matched C57BL/6J mice were fed a diet of 2% LCTs as the control. Macrophage-to-feces RCT was assessed in vivo by intraperitoneal injection of RAW 264.7 macrophages containing (3)H-labeled cholesterol, and atherosclerotic plaques were measured. The mRNA and protein expressions were determined by reverse transcriptase polymerase chain reaction and Western blot analyses, respectively. There was a greater decrease in body fat mass, atherosclerotic plaques, and an improvement in serum lipid profiles. In addition, the MCT mice group showed an increase in (3)H-tracer in the feces and a decrease in the liver. Significantly higher levels of mRNA and protein expression of hepatic ATP-binding cassette transporter A1, ATP-binding cassette transporter G5, cholesterol 7α-hydroxylase, and intestinal ATP-binding cassette transporter G8, as well as lower levels of expression of intestinal Niemann-Pick C1-like 1, were found in the MCT group. These results suggest that MCTs could obviously promote macrophage RCT and improve atherosclerosis in ApoE(-/-) mice, indicating that MCTs have the potential to prevent cardiovascular disease. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. A targeted metabolomic protocol for short-chain fatty acids and branched-chain amino acids

    PubMed Central

    Zheng, Xiaojiao; Qiu, Yunping; Zhong, Wei; Baxter, Sarah; Su, Mingming; Li, Qiong; Xie, Guoxiang; Ore, Brandon M.; Qiao, Shanlei; Spencer, Melanie D.; Zeisel, Steven H.; Zhou, Zhanxiang; Zhao, Aihua; Jia, Wei

    2013-01-01

    Research in obesity and metabolic disorders that involve intestinal microbiota demands reliable methods for the precise measurement of the short-chain fatty acids (SCFAs) and branched-chain amino acids (BCAAs) concentration. Here, we report a rapid method of simultaneously determining SCFAs and BCAAs in biological samples using propyl chloroformate (PCF) derivatization followed by gas chromatography mass spectrometry (GC-MS) analysis. A one-step derivatization using 100 µL of PCF in a reaction system of water, propanol, and pyridine (v/v/v = 8:3:2) at pH 8 provided the optimal derivatization efficiency. The best extraction efficiency of the derivatized products was achieved by a two-step extraction with hexane. The method exhibited good derivatization efficiency and recovery for a wide range of concentrations with a low limit of detection for each compound. The relative standard deviations (RSDs) of all targeted compounds showed good intra- and inter-day (within 7 days) precision (< 10%), and good stability (< 20%) within 4 days at room temperature (23–25 °C), or 7 days when stored at −20 °C. We applied our method to measure SCFA and BCAA levels in fecal samples from rats administrated with different diet. Both univariate and multivariate statistics analysis of the concentrations of these target metabolites could differentiate three groups with ethanol intervention and different oils in diet. This method was also successfully employed to determine SCFA and BCAA in the feces, plasma and urine from normal humans, providing important baseline information of the concentrations of these metabolites. This novel metabolic profile study has great potential for translational research. PMID:23997757

  3. OleA Glu117 is key to condensation of two fatty-acyl coenzyme A substrates in long-chain olefin biosynthesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jensen, Matthew R.; Goblirsch, Brandon R.; Christenson, James K.

    In the interest of decreasing dependence on fossil fuels, microbial hydrocarbon biosynthesis pathways are being studied for renewable, tailored production of specialty chemicals and biofuels. One candidate is long-chain olefin biosynthesis, a widespread bacterial pathway that produces waxy hydrocarbons. Found in three- and four-gene clusters, oleABCD encodes the enzymes necessary to produce cis-olefins that differ by alkyl chain length, degree of unsaturation, and alkyl chain branching. The first enzyme in the pathway, OleA, catalyzes the Claisen condensation of two fatty acyl-coenzyme A (CoA) molecules to form a β-keto acid. In this report, the mechanistic role of Xanthomonas campestris OleA Glu117more » is investigated through mutant enzymes. Crystal structures were determined for each mutant as well as their complex with the inhibitor cerulenin. Complemented by substrate modeling, these structures suggest that Glu117 aids in substrate positioning for productive carbon–carbon bond formation. Analysis of acyl-CoA substrate hydrolysis shows diminished activity in all mutants. When the active site lacks an acidic residue in the 117 position, OleA cannot form condensed product, demonstrating that Glu117 has a critical role upstream of the essential condensation reaction. Profiling of pH dependence shows that the apparent pKa for Glu117 is affected by mutagenesis. Taken together, we propose that Glu117 is the general base needed to prime condensation via deprotonation of the second, non-covalently bound substrate during turnover. This is the first example of a member of the thiolase superfamily of condensing enzymes to contain an active site base originating from the second monomer of the dimer.« less

  4. Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes

    NASA Astrophysics Data System (ADS)

    Denisov, E. T.; Shestakov, A. F.

    2018-05-01

    Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

  5. Engineering Upper Hinge Improves Stability and Effector Function of a Human IgG1

    PubMed Central

    Yan, Boxu; Boyd, Daniel; Kaschak, Timothy; Tsukuda, Joni; Shen, Amy; Lin, Yuwen; Chung, Shan; Gupta, Priyanka; Kamath, Amrita; Wong, Anne; Vernes, Jean-Michel; Meng, Gloria Y.; Totpal, Klara; Schaefer, Gabriele; Jiang, Guoying; Nogal, Bartek; Emery, Craig; Vanderlaan, Martin; Carter, Paul; Harris, Reed; Amanullah, Ashraf

    2012-01-01

    Upper hinge is vulnerable to radical attacks that result in breakage of the heavy-light chain linkage and cleavage of the hinge of an IgG1. To further explore mechanisms responsible for the radical induced hinge degradation, nine mutants were designed to determine the roles that the upper hinge Asp and His play in the radical reactions. The observation that none of these substitutions could inhibit the breakage of the heavy-light chain linkage suggests that the breakage may result from electron transfer from Cys231 directly to the heavy-light chain linkage upon radical attacks, and implies a pathway separate from His229-mediated hinge cleavage. On the other hand, the substitution of His229 with Tyr showed promising advantages over the native antibody and other substitutions in improving the stability and function of the IgG1. This substitution inhibited the hinge cleavage by 98% and suggests that the redox active nature of Tyr did not enable it to replicate the ability of His to facilitate radical induced degradation. We propose that the lower redox potential of Tyr, a residue that may be the ultimate sink for oxidizing equivalents in proteins, is responsible for the inhibition. More importantly, the substitution increased the antibody's binding to FcγRIII receptors by 2–3-fold, and improved ADCC activity by 2-fold, while maintaining a similar pharmacokinetic profile with respect to the wild type. Implications of these observations for antibody engineering and development are discussed. PMID:22203673

  6. Engineering upper hinge improves stability and effector function of a human IgG1.

    PubMed

    Yan, Boxu; Boyd, Daniel; Kaschak, Timothy; Tsukuda, Joni; Shen, Amy; Lin, Yuwen; Chung, Shan; Gupta, Priyanka; Kamath, Amrita; Wong, Anne; Vernes, Jean-Michel; Meng, Gloria Y; Totpal, Klara; Schaefer, Gabriele; Jiang, Guoying; Nogal, Bartek; Emery, Craig; Vanderlaan, Martin; Carter, Paul; Harris, Reed; Amanullah, Ashraf

    2012-02-17

    Upper hinge is vulnerable to radical attacks that result in breakage of the heavy-light chain linkage and cleavage of the hinge of an IgG1. To further explore mechanisms responsible for the radical induced hinge degradation, nine mutants were designed to determine the roles that the upper hinge Asp and His play in the radical reactions. The observation that none of these substitutions could inhibit the breakage of the heavy-light chain linkage suggests that the breakage may result from electron transfer from Cys(231) directly to the heavy-light chain linkage upon radical attacks, and implies a pathway separate from His(229)-mediated hinge cleavage. On the other hand, the substitution of His(229) with Tyr showed promising advantages over the native antibody and other substitutions in improving the stability and function of the IgG1. This substitution inhibited the hinge cleavage by 98% and suggests that the redox active nature of Tyr did not enable it to replicate the ability of His to facilitate radical induced degradation. We propose that the lower redox potential of Tyr, a residue that may be the ultimate sink for oxidizing equivalents in proteins, is responsible for the inhibition. More importantly, the substitution increased the antibody's binding to FcγRIII receptors by 2-3-fold, and improved ADCC activity by 2-fold, while maintaining a similar pharmacokinetic profile with respect to the wild type. Implications of these observations for antibody engineering and development are discussed.

  7. Chromium chains as polydentate fluoride ligands for actinides and group IV metals.

    PubMed

    Leng, Ji-Dong; Kostopoulos, Andreas K; Isherwood, Liam H; Ariciu, Ana-Maria; Tuna, Floriana; Vitórica-Yrezábal, Iñigo J; Pritchard, Robin G; Whitehead, George F S; Timco, Grigore A; Mills, David P; Winpenny, Richard E P

    2018-05-08

    The reactions of {Cr6} horseshoe chains {[nPr2NH2]3[Cr6F11(O2CtBu)10]}2, 1 and precursors of actinides and group IV metals led to a series of ring complexes [nPr2NH2][Cr7TiF6O2(O2CtBu)16], 2, [nPr2NH2][Cr6Ti2F5O3(O2CtBu)16], 3, [Cr6ThF7(O2CtBu)15 (Me2SO)], 4, [(nPr2NH2)2(Cr6Th2F12(O2CtBu)16)], 5 and [nPr2NH2][Cr6U2O2F8(O2CtBu)16(Me2SO)], 6. X-ray structure studies indicate that the {Cr6} chains maintain their structures in these complexes, acting as polydentate fluoride ligands. Their static magnetic properties were measured and fitted by isotropic exchange Hamiltonian. In accordance with 1, the magnetic exchanges between CrIII are antiferromagnetic, while the exchange interactions can be modified by the tetravalent metals. For compound 6, ferromagnetic exchanges JCr-U and JU-U are obtained. EPR spectra of compounds 2-5 were measured at Q band and were simulated. The spectrum of 2 has the same profile as {Cr7Cd} and {Cr7Zn} rings with a ground state S = 3/2. 3, 4 and 5 give similar EPR spectra with S = 0 ground states.

  8. Pressure-jump small-angle x-ray scattering detected kinetics of staphylococcal nuclease folding.

    PubMed Central

    Woenckhaus, J; Köhling, R; Thiyagarajan, P; Littrell, K C; Seifert, S; Royer, C A; Winter, R

    2001-01-01

    The kinetics of chain disruption and collapse of staphylococcal nuclease after positive or negative pressure jumps was monitored by real-time small-angle x-ray scattering under pressure. We used this method to probe the overall conformation of the protein by measuring its radius of gyration and pair-distance-distribution function p(r) which are sensitive to the spatial extent and shape of the particle. At all pressures and temperatures tested, the relaxation profiles were well described by a single exponential function. No fast collapse was observed, indicating that the rate limiting step for chain collapse is the same as that for secondary and tertiary structure formation. Whereas refolding at low pressures occurred in a few seconds, at high pressures the relaxation was quite slow, approximately 1 h, due to a large positive activation volume for the rate-limiting step for chain collapse. A large increase in the system volume upon folding implies significant dehydration of the transition state and a high degree of similarity in terms of the packing density between the native and transition states in this system. This study of the time-dependence of the tertiary structure in pressure-induced folding/unfolding reactions demonstrates that novel information about the nature of protein folding transitions and transition states can be obtained from a combination of small-angle x-ray scattering using high intensity synchrotron radiation with the high pressure perturbation technique. PMID:11222312

  9. Density functional theory for polymeric systems in 2D.

    PubMed

    Słyk, Edyta; Roth, Roland; Bryk, Paweł

    2016-06-22

    We propose density functional theory for polymeric fluids in two dimensions. The approach is based on Wertheim's first order thermodynamic perturbation theory (TPT) and closely follows density functional theory for polymers proposed by Yu and Wu (2002 J. Chem. Phys. 117 2368). As a simple application we evaluate the density profiles of tangent hard-disk polymers at hard walls. The theoretical predictions are compared against the results of the Monte Carlo simulations. We find that for short chain lengths the theoretical density profiles are in an excellent agreement with the Monte Carlo data. The agreement is less satisfactory for longer chains. The performance of the theory can be improved by recasting the approach using the self-consistent field theory formalism. When the self-avoiding chain statistics is used, the theory yields a marked improvement in the low density limit. Further improvements for long chains could be reached by going beyond the first order of TPT.

  10. Quantitative Profiling of Feruloylated Arabinoxylan Side-Chains from Graminaceous Cell Walls

    PubMed Central

    Schendel, Rachel R.; Meyer, Marleen R.; Bunzel, Mirko

    2016-01-01

    Graminaceous arabinoxylans are distinguished by decoration with feruloylated monosaccharidic and oligosaccharidic side-chains. Although it is hypothesized that structural complexity and abundance of these feruloylated arabinoxylan side-chains may contribute, among other factors, to resistance of plant cell walls to enzymatic degradation, quantitative profiling approaches for these structural units in plant cell wall materials have not been described yet. Here we report the development and application of a rapid and robust method enabling the quantitative comparison of feruloylated side-chain profiles in cell wall materials following mildly acidic hydrolysis, C18-solid phase extraction (SPE), reduction under aprotic conditions, and liquid chromatography with diode-array detection/mass spectrometry (LC-DAD/MS) separation and detection. The method was applied to the insoluble fiber/cell wall materials isolated from 12 whole grains: wild rice (Zizania aquatica L.), long-grain brown rice (Oryza sativa L.), rye (Secale cereale L.), kamut (Triticum turanicum Jakubz.), wheat (Triticum aestivum L.), spelt (Triticum spelta L.), intermediate wheatgrass (Thinopyrum intermedium), maize (Zea mays L.), popcorn (Zea mays L. var. everta), oat (Avena sativa L.) (dehulled), barley (Hordeum vulgare L.) (dehulled), and proso millet (Panicum miliaceum L.). Between 51 and 96% of the total esterified monomeric ferulates were represented in the quantified compounds captured in the feruloylated side-chain profiles, which confirms the significance of these structures to the global arabinoxylan structure in terms of quantity. The method provided new structural insights into cereal grain arabinoxylans, in particular, that the structural moiety α-l-galactopyranosyl-(1→2)-β-d-xylopyranosyl-(1→2)-5-O-trans-feruloyl-l-arabinofuranose (FAXG), which had previously only been described in maize, is ubiquitous to cereal grains. PMID:26834763

  11. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

    PubMed

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

    2009-01-01

    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  12. Cerebral Toxoplasmosis Diagnosed by Nested-polymerase Chain Reaction in a Patient with Rheumatoid Arthritis.

    PubMed

    Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki

    2018-05-15

    A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.

  13. Chemical reactions directed Peptide self-assembly.

    PubMed

    Rasale, Dnyaneshwar B; Das, Apurba K

    2015-05-13

    Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.

  14. Chemical Reactions Directed Peptide Self-Assembly

    PubMed Central

    Rasale, Dnyaneshwar B.; Das, Apurba K.

    2015-01-01

    Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly. PMID:25984603

  15. Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

    PubMed Central

    Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

    2004-01-01

    A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

  16. One-step production of long-chain hydrocarbons from waste-biomass-derived chemicals using bi-functional heterogeneous catalysts.

    PubMed

    Wen, Cun; Barrow, Elizabeth; Hattrick-Simpers, Jason; Lauterbach, Jochen

    2014-02-21

    In this study, we demonstrate the production of long-chain hydrocarbons (C8+) from 2-methylfuran (2MF) and butanal in a single step reactive process by utilizing a bi-functional catalyst with both acid and metallic sites. Our approach utilizes a solid acid for the hydroalkylation function and as a support as well as a transition metal as hydrodeoxygenation catalyst. A series of solid acids was screened, among which MCM-41 demonstrated the best combination of activity and stability. Platinum nanoparticles were then incorporated into the MCM-41. The Pt/MCM-41 catalyst showed 96% yield for C8+ hydrocarbons and the catalytic performance was stable over four reaction cycles of 20 hour each. The reaction pathways for the production of long-chain hydrocarbons is probed with a combination of infrared spectroscopy and steady-state reaction experiments. It is proposed that 2MF and butanal go through hydroalkylation first on the acid site followed by hydrodeoxygenation to produce the hydrocarbon fuels.

  17. Synthesis of surface-anchored DNA-polymer bioconjugates using reversible addition-fragmentation chain transfer polymerization.

    PubMed

    He, Peng; He, Lin

    2009-07-13

    We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.

  18. Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.

    PubMed

    Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W

    2007-04-01

    Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.

  19. Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

    PubMed

    Bridge, Julia A

    2017-01-01

    The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

  20. Reaction pathways of propene pyrolysis.

    PubMed

    Qu, Yena; Su, Kehe; Wang, Xin; Liu, Yan; Zeng, Qingfeng; Cheng, Laifei; Zhang, Litong

    2010-05-01

    The gas-phase reaction pathways in preparing pyrolytic carbon with propene pyrolysis have been investigated in detail with a total number of 110 transition states and 50 intermediates. The structure of the species was determined with density functional theory at B3PW91/6-311G(d,p) level. The transition states and their linked intermediates were confirmed with frequency and the intrinsic reaction coordinates analyses. The elementary reactions were explored in the pathways of both direct and the radical attacking decompositions. The energy barriers and the reaction energies were determined with accurate model chemistry method at G3(MP2) level after an examination of the nondynamic electronic correlations. The heat capacities and entropies were obtained with statistical thermodynamics. The Gibbs free energies at 298.15 K for all the reaction steps were reported. Those at any temperature can be developed with classical thermodynamics by using the fitted (as a function of temperature) heat capacities. It was found that the most favorable paths are mainly in the radical attacking chain reactions. The chain was proposed with 26 reaction steps including two steps of the initialization of the chain to produce H and CH(3) radicals. For a typical temperature (1200 K) adopted in the experiments, the highest energy barriers were found in the production of C(3) to be 203.4 and 193.7 kJ/mol. The highest energy barriers for the production of C(2) and C were found 174.1 and 181.4 kJ/mol, respectively. These results are comparable with the most recent experimental observation of the apparent activation energy 201.9 +/- 0.6 or 137 +/- 25 kJ/mol. Copyright 2010 Wiley Periodicals, Inc.

  1. Thermochemistry analyses for transformation of C6 glucose compound into C9, C12 and C15 alkanes using density functional theory

    NASA Astrophysics Data System (ADS)

    Verma, Anand Mohan; Kishore, Nanda

    2017-02-01

    The hydrolysis of cellulose fraction of biomass yields C6 glucose which further can be transformed into long-chain hydrocarbons by C-C coupling. In this study, C6 glucose is transformed into three chain alkanes, namely, C9, C12 and C15 using C-C coupling reactions under the gas and aqueous phase milieus. The geometry optimisation and vibrational frequency calculations are carried out at well-known hybrid-GGA functional, B3LYP with the basis set of 6-31+g(d,p) under the density functional theory framework. The single point energetics are calculated at M05-2X/6-311+g(3df,2p) level of theory. All thermochemical properties are calculated over a wide range of temperature between 300 and 900 K at an interval of 100 K. The thermochemistry suggested that the aqueous phase behaviour is suitable for the hydrolysis of sugar into long-chain alkanes compared to gas-phase environment. The hydrodeoxygenation reactions under each reaction pathway are found as most favourable reactions in both phases; however, aqueous phase dominates over gas phase in all discussed thermodynamic parameters.

  2. Structural differences among alkali-soluble arabinoxylans from maize (Zea mays), rice (Oryza sativa), and wheat (Triticum aestivum) brans influence human fecal fermentation profiles.

    PubMed

    Rose, Devin J; Patterson, John A; Hamaker, Bruce R

    2010-01-13

    Human fecal fermentation profiles of maize, rice, and wheat bran and their dietary fiber fractions released by alkaline-hydrogen peroxide treatment (principally arabinoxylan) were obtained with the aim of identifying and characterizing fractions associated with high production of short chain fatty acids and a linear fermentation profile for possible application as a slowly fermentable dietary fiber. The alkali-soluble fraction from maize bran resulted in the highest short chain fatty acid production among all samples tested, and was linear over the 24 h fermentation period. Size-exclusion chromatography and (1)H NMR suggested that higher molecular weight and uniquely substituted arabinose side chains may contribute to these properties. Monosaccharide disappearance data suggest that maize and rice bran arabinoxylans are fermented by a debranching mechanism, while wheat bran arabinoxylans likely contain large unsubstituted xylose regions that are fermented preferentially, followed by poor fermentation of the remaining, highly branched oligosaccharides.

  3. Vanadium accelerates polymerase chain reaction and expands the applicability of forensic DNA testing.

    PubMed

    Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko

    2013-05-01

    Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  4. Kinetics of the Br2-CH3CHO Photochemical Chain Reaction

    NASA Technical Reports Server (NTRS)

    Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.

    1997-01-01

    Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).

  5. ε-Poly-l-Lysine Peptide Chain Length Regulated by the Linkers Connecting the Transmembrane Domains of ε-Poly-l-Lysine Synthetase

    PubMed Central

    Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime

    2014-01-01

    ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. PMID:24907331

  6. Tracking polypeptide folds on the free energy surface: effects of the chain length and sequence.

    PubMed

    Brukhno, Andrey V; Ricchiuto, Piero; Auer, Stefan

    2012-07-26

    Characterization of the folding transition in polypeptides and assessing the thermodynamic stability of their structured folds are of primary importance for approaching the problem of protein folding. We use molecular dynamics simulations for a coarse grained polypeptide model in order to (1) obtain the equilibrium conformation diagram of homopolypeptides in a broad range of the chain lengths, N = 10, ..., 100, and temperatures, T (in a multicanonical ensemble), and (2) determine free energy profiles (FEPs) projected onto an optimal, so-called "natural", reaction coordinate that preserves the height of barriers and the diffusion coefficients on the underlying free energy hyper-surface. We then address the following fundamental questions. (i) How well does a kinetically determined free energy landscape of a single chain represent the polypeptide equilibrium (ensemble) behavior? In particular, under which conditions might the correspondence be lost, and what are the possible implications for the folding processes? (ii) How does the free energy landscape depend on the chain length (homopolypeptides) and the monomer interaction sequence (heteropolypeptides)? Our data reveal that at low T values equilibrium structures adopted by relatively short homopolypeptides (N < 60) are dominated by α-helical folds which correspond to the primary and secondary minima of the FEP. In contrast, longer homopolypeptides (N > 70), upon quasi-equilibrium cooling, fold preferentially in β-bundles with small helical portions, while the FEPs exhibit no distinct global minima. Moreover, subject to the choice of the initial configuration, at sufficiently low T, essentially metastable structures can be found and prevail far from the true thermodynamic equilibrium. We also show that, by sequence-enabling the polypeptide model, it is possible to restrict the chain to a very specific part of the configuration space, which results in substantial simplification and smoothing of the free energy landscape as compared to the case of the corresponding homopolypeptide.

  7. Whey protein supplementation does not alter plasma branched-chained amino acid profiles but results in unique metabolomics patterns in obese women enrolled in an 8-week weight loss trial

    USDA-ARS?s Scientific Manuscript database

    Background. Elevations of plasma concentrations of branched-chain amino acids (BCAA) are correlated with insulin resistance. Reduction in the activity of branched-chain ketoacid dehydrogenase complex (BCKDC) activity and impaired complete mitochondrial BCAA catabolism may contribute to this phenoty...

  8. Gene Expression Profiling of Multiple Leiomyomata Uteri and Matched Normal Tissue from a Single Patient

    PubMed Central

    Dimitrova, Irina K.; Richer, Jennifer K.; Rudolph, Michael C.; Spoelstra, Nicole S.; Reno, Elaine M.; Medina, Theresa M.; Bradford, Andrew P.

    2009-01-01

    Objective To identify differentially expressed genes between fibroid and adjacent normal myometrium in an identical hormonal and genetic background. Design Array analysis of 3 leiomyomata and matched adjacent normal myometrium in a single patient. Setting University of Colorado Hospital. Patient(s) A single female undergoing medically indicated hysterectomy for symptomatic fibroids. Interventions(s) mRNA isolation and microarray analysis, reverse-transcriptase polymerase chain reaction, western blotting and immunohistochemistry. Main Outcome Measure(s) Changes in mRNA and protein levels in leiomyomata and matched normal myometrium. Result(s) Expression of 197 genes was increased and 619 decreased, significantly by at least 2 fold, in leiomyomata relative to normal myometrium. Expression profiles between tumors were similar and normal myometrial samples showed minimal variation. Changes in, and variation of, expression of selected genes were confirmed in additional normal and leiomyoma samples from multiple patients. Conclusion(s) Analysis of multiple tumors from a single patient confirmed changes in expression of genes described in previous, apparently disparate, studies and identified novel targets. Gene expression profiles in leiomyomata are consistent with increased activation of mitogenic pathways and inhibition of apoptosis. Down-regulation of genes implicated in invasion and metastasis, of cancers, was observed in fibroids. This expression pattern may underlie the benign nature of uterine leiomyomata and may aid in the differential diagnosis of leiomyosarcoma. PMID:18672237

  9. Leishmania major: Genetic Profiles of the Parasites Isolated from Chabahar, Southeastern Iran by PPIP-PCR

    PubMed Central

    SHARIFI-RAD, Mehdi; DABIRZADEH, Mansour; SHARIFI, Iraj; BABAEI, Zahra

    2016-01-01

    Background: Leishmaniasis is important vector-borne parasitic disease worldwide, caused by the genus Leishmania. The objective of the current study was to identify genetic polymorphism in L. major, one of the species causing cutaneous leishmaniasis (CL), isolated from southeastern Iran, using Permissively Primed Intergenic Polymorphic-Polymerase Chain Reaction (PPIP-PCR) method. Methods: Overall, 340 patients with suspected CL were examined. They referred to the Central Laboratory in Chabahar, Iran during Apr 2013 to Feb 2014. Microscopic examination of Giemsa-stained slides from lesions as well as aspirates cultured in Novy- Mac Neal-Nicolle (NNN) Media was employed in order to diagnose CL in these patients. Our analyses detected 86 suspected subjects as having CL from which 35 isolates were cultured successfully. PPIP-PCR method was performed on extracted genomic DNA from selected isolates in order to determine the genetic polymorphism among L. major isolates. Results: The electrophoresis patterns demonstrated two genetic profiles including A or A1 patterns between all samples tested. Frequency of A and A1 sub-types were 33 (94.3%) and two (5.7%), respectively. Conclusion: Both host and parasite factors may contribute to the clinical profile of human leishmaniasis in the endemic foci of the disease. Here we showed that genetic variations pertaining to the Leishmania parasites might determine, in part, the clinical outcomes of human leishmaniasis. PMID:28127333

  10. Multiple-strain Trichophyton mentagrophytes infection in a silver fox (Vulpes vulpes) from a breeding farm.

    PubMed

    Gnat, Sebastian; Nowakiewicz, Aneta; Lagowski, Dominik; Troscianczyk, Aleksandra; Zieba, Przemyslaw

    2018-03-08

    Dermatophyte infections are extremely frequent worldwide, and their epidemiological features and distribution make them one of the most frequent infections all over the world. We identified and analysed multiform T. mentagrophytes strains isolated from a silver fox (Vulpes vulpes) kept on a breeding farm. Identification of dermatophyte strains was carried out traditionally by correlating both the clinical manifestations of the infection with a micro- and macroscopic examination. To confirm the species affiliation fully, molecular differentiation methods were used. DNA was isolated from the dermatophytes with the phenol-chloroform method. The reaction of chitin synthase 1 (chs1) amplification was carried out to confirm the dermatophytes. The phylogenetic analysis was based on the ITS sequences. The polymerase chain reaction melting profile (PCR-MP) procedure was used for differentiation of dermatophyte genomes. Direct analysis of the material sampled from the clinical lesions revealed the presence of arthrospores in the samples collected from all animals with skin lesions. The macromorphology of the colonies obtained from material sampled from the same individual was not homogeneous. The PCR-MP electrophoregram indicated high variability of their genomes. Although the dermatophytes were isolated from one infected fox, no two identical genomic profiles were obtained. The PCR-MP result corresponds with the phenotypic diversity of the isolates. The findings about the multiple dermatophyte infection in one individual complicate any future epidemiology work and other clinical investigation. Previously, using only morphological characteristics, it had been assumed that one fungal isolate per patient could be diagnosed. The novel findings encourage application of the newly developed molecular typing methods in the diagnosis of dermatophytosis.

  11. Recoil-α-fission and recoil-α-α-fission events observed in the reaction 48Ca + 243Am

    NASA Astrophysics Data System (ADS)

    Forsberg, U.; Rudolph, D.; Andersson, L.-L.; Di Nitto, A.; Düllmann, Ch. E.; Fahlander, C.; Gates, J. M.; Golubev, P.; Gregorich, K. E.; Gross, C. J.; Herzberg, R.-D.; Heßberger, F. P.; Khuyagbaatar, J.; Kratz, J. V.; Rykaczewski, K.; Sarmiento, L. G.; Schädel, M.; Yakushev, A.; Åberg, S.; Ackermann, D.; Block, M.; Brand, H.; Carlsson, B. G.; Cox, D.; Derkx, X.; Dobaczewski, J.; Eberhardt, K.; Even, J.; Gerl, J.; Jäger, E.; Kindler, B.; Krier, J.; Kojouharov, I.; Kurz, N.; Lommel, B.; Mistry, A.; Mokry, C.; Nazarewicz, W.; Nitsche, H.; Omtvedt, J. P.; Papadakis, P.; Ragnarsson, I.; Runke, J.; Schaffner, H.; Schausten, B.; Shi, Yue; Thörle-Pospiech, P.; Torres, T.; Traut, T.; Trautmann, N.; Türler, A.; Ward, A.; Ward, D. E.; Wiehl, N.

    2016-09-01

    Products of the fusion-evaporation reaction 48Ca + 243Am were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt, Germany. Amongst the detected thirty correlated α-decay chains associated with the production of element Z = 115, two recoil-α-fission and five recoil- α- α-fission events were observed. The latter five chains are similar to four such events reported from experiments performed at the Dubna gas-filled separator, and three such events reported from an experiment at the Berkeley gas-filled separator. The four chains observed at the Dubna gas-filled separator were assigned to start from the 2n-evaporation channel 289115 due to the fact that these recoil- α- α-fission events were observed only at low excitation energies. Contrary to this interpretation, we suggest that some of these recoil- α- α-fission decay chains, as well as some of the recoil- α- α-fission and recoil-α-fission decay chains reported from Berkeley and in this article, start from the 3n-evaporation channel 288115.

  12. Development of a 20-locus fluorescent multiplex system as a valuable tool for national DNA database.

    PubMed

    Jiang, Xianhua; Guo, Fei; Jia, Fei; Jin, Ping; Sun, Zhu

    2013-02-01

    The multiplex system allows the detection of 19 autosomal short tandem repeat (STR) loci [including all Combined DNA Index System (CODIS) STR loci as well as D2S1338, D6S1043, D12S391, D19S433, Penta D and Penta E] plus the sex-determining locus Amelogenin in a single reaction, comprising all STR loci in various commercial kits used in the China national DNA database (NDNAD). Primers are designed so that the amplicons are distributed ranging from 90 base pairs (bp) to 450 bp within a five-dye fluorescent design with the fifth dye reserved for the internal size standard. With 30 cycles, 125 pg to 2 ng DNA template showed optimal profiling result, while robust profiles could also be achieved by adjusting the cycle numbers for the DNA template beyond that optimal DNA input range. Mixture studies showed that 83% and 87% of minor alleles were detected at 9:1 and 1:9 ratios, respectively. When 4 ng of degraded DNA was digested by 2-min DNase and 1 ng undegraded DNA was added to 400 μM haematin, the complete profiles were still observed. Polymerase chain reaction (PCR)-based procedures were examined and optimized including the concentrations of primer set, magnesium and the Taq polymerase as well as volume, cycle number and annealing temperature. In addition, the system has been validated by 3000 bloodstain samples and 35 common case samples in line with the Chinese National Standards and Scientific Working Group on DNA Analysis Methods (SWGDAM) guidelines. The total probability of identity (TPI) can reach to 8×10(-24), where DNA database can be improved at the level of 10 million DNA profiles or more because the number of expected match is far from one person (4×10(-10)) and can be negligible. Further, our system also demonstrates its good performance in case samples and it will be an ideal tool for forensic DNA typing and databasing with potential application. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  13. Transcriptome profiling reveals the immune response of goose T cells under selenium stimuli.

    PubMed

    Cao, Nan; Li, Wanyan; Li, Bingxin; Tian, Yunbo; Xu, Danning

    2017-12-01

    The goose is an economically important poultry species and a principal natural host of avian viruses. This study aimed to determine the effects of selenium on the immune response of geese. Under selenium stimulation, gene expression profiling was investigated using transcriptome sequencing. The selenoproteins were promoted by selenium stimulation, while the heat shock proteins, interleukin and interferons were mainly down-regulated. After comparison, 2228 differentially expressed genes were primarily involved in immune and environmental response, and infectious disease and genetic information processing related pathways were identified. Specifically, the enzymes of the lysosomes which acted as a safeguard in preventing pathogens were mostly up-regulated and six randomly selected differentially expressed genes were validated by quantitative polymerase chain reaction. In addition, the most proportional increased transcription factor family basic helix-loop-helix (bHLH) located in the 5' flank of selenoprotein P-like protein for selenium metabolism was identified by response to the selenium stimulation in this study. These analyses show that selenium can promote immune function by activating selenoproteins, transcript factors and lysosome pathway related genes, while weakening cytokine content genes in geese. © 2017 Japanese Society of Animal Science.

  14. Identification of the full-length β-actin sequence and expression profiles in the tree shrew (Tupaia belangeri).

    PubMed

    Zheng, Yu; Yun, Chenxia; Wang, Qihui; Smith, Wanli W; Leng, Jing

    2015-02-01

    The tree shrew (Tupaia belangeri) diverges from the primate order (Primates) and is classified as a separate taxonomic group of mammals - Scandentia. It has been suggested that the tree shrew can be used as an animal model for studying human diseases; however, the genomic sequence of the tree shrew is largely unidentified. In the present study, we reported the full-length cDNA sequence of the housekeeping gene, β-actin, in the tree shrew. The amino acid sequence of β-actin in the tree shrew was compared to that of humans and other species; a simple phylogenetic relationship was discovered. Quantitative polymerase chain reaction (qPCR) and western blot analysis further demonstrated that the expression profiles of β-actin, as a general conservative housekeeping gene, in the tree shrew were similar to those in humans, although the expression levels varied among different types of tissue in the tree shrew. Our data provide evidence that the tree shrew has a close phylogenetic association with humans. These findings further enhance the potential that the tree shrew, as a species, may be used as an animal model for studying human disorders.

  15. Selection of reference genes is critical for miRNA expression analysis in human cardiac tissue. A focus on atrial fibrillation.

    PubMed

    Masè, Michela; Grasso, Margherita; Avogaro, Laura; D'Amato, Elvira; Tessarolo, Francesco; Graffigna, Angelo; Denti, Michela Alessandra; Ravelli, Flavia

    2017-01-24

    MicroRNAs (miRNAs) are emerging as key regulators of complex biological processes in several cardiovascular diseases, including atrial fibrillation (AF). Reverse transcription-quantitative polymerase chain reaction is a powerful technique to quantitatively assess miRNA expression profile, but reliable results depend on proper data normalization by suitable reference genes. Despite the increasing number of studies assessing miRNAs in cardiac disease, no consensus on the best reference genes has been reached. This work aims to assess reference genes stability in human cardiac tissue with a focus on AF investigation. We evaluated the stability of five reference genes (U6, SNORD48, SNORD44, miR-16, and 5S) in atrial tissue samples from eighteen cardiac-surgery patients in sinus rhythm and AF. Stability was quantified by combining BestKeeper, delta-C q , GeNorm, and NormFinder statistical tools. All methods assessed SNORD48 as the best and U6 as the worst reference gene. Applications of different normalization strategies significantly impacted miRNA expression profiles in the study population. Our results point out the necessity of a consensus on data normalization in AF studies to avoid the emergence of divergent biological conclusions.

  16. Gene Polymorphisms of Glutathione S-Transferase T1/M1 in Egyptian Children and Adolescents with Type 1 Diabetes Mellitus.

    PubMed

    Barseem, Naglaa; Elsamalehy, Mona

    2017-06-01

    Oxidative stress plays an important role in the pathogenesis of type 1 diabetes mellitus (T1DM). To evaluate the association of glutathione S-transferase mu 1 (GST M1) and glutathione S-transferase theta 1 (GST T1) polymorphisms with development of T1DM and disease-related risk factors. Measurement of fasting glucose, serum creatinine, lipid profile, and glycosylated hemoglobin (HbA1c), as well as evaluation of GST T1 and M1 genetic polymorphisms using polymerase chain reaction were done in 64 diabetic children and 41 controls. The diabetic group had significantly higher fasting glucose, HbA1c, and cholesterol levels. GST T1 null genotype was more frequent in the diabetic than the control group with 4.2-fold increased risk of T1DM (odds ratio=4.2; 95% confidence interval=1.6-11.5; p=0.03). Significant positive associations were found with lipid profile, HbA1c, and duration of illness but not with age, age at onset, and body mass index. Gene polymorphisms of the enzyme GST are associated with development of T1DM and disease-related risk factors.

  17. Contamination profiles of antibiotic resistance genes in the sediments at a catchment scale.

    PubMed

    Su, Hao-Chang; Pan, Chang-Gui; Ying, Guang-Guo; Zhao, Jian-Liang; Zhou, Li-Jun; Liu, You-Sheng; Tao, Ran; Zhang, Rui-Quan; He, Liang-Ying

    2014-08-15

    The aim of this study was to investigate the contamination profiles of tetracycline, sulfonamide, and macrolide resistance genes, as well as integrons in sediments of Dongjiang River basin of South China by real time quantitative polymerase chain reaction. sul2 was the most abundant resistance gene, with the average concentration of 6.97×10(8) copies/g and 1.00×10(8) copies/g in the dry and wet seasons, respectively, followed by ermF, sul3, sul1, intI1, tetA, ermB, tetX, tetM, tetQ, tetO, tetW, tetS, ermC, and tetB. The abundance of intI2 gene was the lowest in the sediment samples. Significant correlations existed between the ARGs and sediment properties as well as metals (Cu and Zn) and corresponding antibiotic classes, suggesting that the contamination of ARGs is related to chemical pollution of the sediments in the river basin. Principal component analysis showed distinct groupings of the sampling sites, reflecting that human activities are the key player in the dissemination of ARGs in the catchment environment. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Comparison of virulence factors and capsular types of Streptococcus agalactiae isolated from human and bovine infections.

    PubMed

    Emaneini, Mohammad; Khoramian, Babak; Jabalameli, Fereshteh; Abani, Samira; Dabiri, Hossein; Beigverdi, Reza

    2016-02-01

    Streptococcus agalactiae is a leading cause of human and bovine infections. A total of 194 S. agalactiae isolates, 55 isolates from bovines and 139 from humans, were analyzed for capsular types, virulence genes (scpB, hly, rib, bca and bac) and mobile genetic elements (IS1548 and GBSi1) using polymerase chain reaction (PCR) and multiplex PCR. Capsular type III was predominant (61%), followed by types V, II, Ib, and IV. The scpB, hly, bca and bac virulence genes were only found among human isolates. Twelve and 2 distinct virulence gene profiles were identified among human and bovine isolates respectively. The virulence gene profiles scpB- hly- IS1548- rib-bca (51%) and scpB- hly- IS1548- bca (19%) were only predominant among human isolates. The rib gene was the most common virulence gene in both human and bovine isolates. The study showed a high prevalence of virulence genes in S. agalactiae strains isolated from human infections, these result can support the idea that S. agalactiae isolated from humans and bovines are generally unrelated and probably belonged to separate populations. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Bacterial community structure and activity of sulfate reducing bacteria in a membrane aerated biofilm analyzed by microsensor and molecular techniques.

    PubMed

    Liu, Hong; Tan, Shuying; Sheng, Zhiya; Liu, Yang; Yu, Tong

    2014-11-01

    The activities and vertical spatial distribution of sulfate reducing bacteria (SRB) in an oxygen (O2 )-based membrane aerated biofilm (MAB) were investigated using microsensor (O2 and H2 S) measurements and molecular techniques (polymerase chain reaction-denaturing gradient gel electrophoresis [PCR-DGGE] and fluorescence in situ hybridization [FISH]). The O2 concentration profile revealed that O2 penetrated from the bottom (substratum) of the gas permeable membrane, and was gradually consumed within the biofilm until it was completely depleted near the biofilm/bulk liquid interface, indicating oxic and anoxic zone in the MAB. The H2 S concentration profile showed that H2 S production was found in the upper 285 µm of the biofilm, indicating a high activity of SRB in this region. The results from DGGE of the PCR-amplified dissimilatory sulfite reductase subunit B (dsrB) gene and FISH showed an uneven spatial distribution of SRB. The maximum SRB biomass was located in the upper biofilm. The information from the molecular analysis can be supplemented with that from microsensor measurements to better understand the microbial community and activity of SRB in the MAB. © 2014 Wiley Periodicals, Inc.

  20. Effect of Dust Storms on the Atmospheric Microbiome in the Eastern Mediterranean.

    PubMed

    Mazar, Yinon; Cytryn, Eddie; Erel, Yigal; Rudich, Yinon

    2016-04-19

    We evaluated the impact of Saharan dust storms on the local airborne microbiome in a city in the Eastern Mediterranean area. Samples of particles with diameter less than 10 μm were collected during two spring seasons on both dusty and nondusty days. DNA was extracted, and partial 16S rRNA gene amplicons were sequenced using the Illumina platform. Bioinformatic analysis showed the effect of dust events on the diversity of the atmospheric microbiome. The relative abundance of desert soil-associated bacteria increased during dust events, while the relative abundance of anthropogenic-influenced taxa decreased. Quantitative polymerase chain reaction measurements of selected clinically significant antibiotic resistance genes (ARGs) showed that their relative abundance decreased during dust events. The ARG profiles on dust-free days were similar to those in aerosol collected in a poultry house, suggesting a strong agricultural influence on the local ambient profiles. We conclude that dust storms enrich the ambient airborne microbiome with new soil-derived bacteria that disappear as the dust settles, suggesting that the bacteria are transported attached to the dust particles. Dust storms do not seem to be an important vector for transport of probed ARGs.

  1. Logical Framework of Forensic Identification: Ability to Resist Fabricated DNA.

    PubMed

    Wang, Zheng; Zhou, Di; Zhang, Suhua; Bian, Yingnan; Hu, Zhen; Zhu, Ruxin; Lu, Daru; Li, Chengtao

    2015-12-01

    Over the past 30 years, DNA analysis has revolutionized forensic science and has become the most useful single tool in the multifaceted fight against crime. Today, DNA profiling with sets of highly polymorphic autosomal short tandem repeat markers is widely employed and accepted in the courts due to its high discriminating power and reliability. However, an artificial bloodstain purposefully created using molecular biology techniques succeeded in tricking a leading forensic DNA laboratory. The disturbing possibility that a forensic DNA profile can be faked shocked the general public and the mass media, and generated serious discussion about the credibility of DNA evidence. Herein, we present two exemplary assays based on tissue-specific methylation patterns and cell-specific mRNA expression, respectively. These two assays can be integrated into the DNA analysis pipelines without consumption of additional samples. We show that the two assays can not only distinguish between artificial and genuine samples, but also provide information on tissue origin. The two assays were tested on natural and artificial bloodstains (generated by polymerase chain reaction and whole genome amplification technique) and the results illustrated that the logical framework of forensic identification is still useful for forensic identification with the high credibility.

  2. [Oxacillin-resistant coagulase-negative Staphylococci bacteremia at a teaching hospital in Santa Maria, State of Rio Grande do Sul, Brazil].

    PubMed

    Rigatti, Fabiane; Tizotti, Maísa Kraulich; Hörner, Rosmari; Domingues, Vanessa Oliveira; Martini, Rosiéli; Mayer, Letícia Eichstaedt; Khun, Fábio Teixeira; de França, Chirles Araújo; da Costa, Mateus Matiuzzi

    2010-01-01

    This study aimed to characterize the prevalence and susceptibility profile to oxacillin-resistant Coagulase-negative Staphylococci strains isolated from blood cultures in a teaching hospital, located in Santa Maria, RS. In addition, different methodologies for phenotypic characterization of mecA-mediated oxacillin resistance were compared with genotypic reference testing. After identification (MicroScan - Siemens), the isolates were tested for antimicrobial sensitivity using disk diffusion and automation (MicroScan - Siemens). The presence of mecA gene was identified by the polymerase chain reaction molecular technique. The most common species was Staphylococcus epidermidis (n=40, 67%). The mecA gene was detected in 54 (90%) strains, while analysis of the sensitivity profiles revealed a high rate of resistance to multiple classes of antimicrobial drugs. However, all isolates were uniformly sensitive to vancomycin and tigecycline. The cefoxitin disk was the phenotypic method that best correlated with the gold standard. Analysis of the clinical significance of CoNS isolated from hemocultures and the precise detection of oxacillin resistance represent decisive factors for the correct choice of antibiotic therapy. Although vancomycin constitutes the normal treatment in most Brazilian hospitals, reduction in its use is recommended.

  3. The long non coding RNAs MHRT, FENDRR and CARMEN, their expression levels in peripheral blood mononuclear cells in patients with essential hypertension and their relation to heart hypertrophy.

    PubMed

    Kontaraki, Joanna E; Marketou, Maria E; Kochiadakis, George E; Maragkoudakis, Spyros; Konstantinou, John; Vardas, Panos E; Parthenakis, Fragiskos I

    2018-06-19

    Long non-coding RNAs (lncRNAs) participate in the modulation of cardiac hypertrophy and they represent potential therapeutic targets in cardiovascular disease. We investigated the expression profiles of selected lncRNAs in peripheral blood mononuclear cells of patients with essential hypertension in relation to left ventricular hypertrophy. We assessed the expression levels of the lncRNAs MHRT, FENDRR and CARMEN using real-time reverse transcription polymerase chain reaction. Hypertensive patients showed significantly higher MHRT, FENDRR and CARMEN expression levels compared with healthy controls. In addition, we observed significant negative correlations of MHRT (r=-0.323, p=0.003) and FENDRR (r=-0.380, p=0.001) and a positive correlation of CARMEN (r=0.458, p<0.001) expression levels with left ventricular mass index. Our data reveal that the lncRNAs MHRT, FENDRR and CARMEN show distinct expression profiles in hypertensive patients and they possibly represent candidate therapeutic targets in hypertensive heart disease. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  4. Cytokinin oxidase from Phaseolus vulgaris callus tissues. Enhanced in vitro activity of the enzyme in the presence of copper-imidazole complexes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chatfield, J.M.; Armstrong, D.J.

    1987-07-01

    The effects of metal ions on cytokinin oxidase activity extracted from callus tissues of Phaseolus vulgaris L. cv Great Northern have been examined using an assay based on the oxidation of N/sup 6/-(..delta../sup 2/-isopentenyl)-adenine-2,8-/sup 3/H (i/sup 6/ Ade) to adenine (Ade). The addition of cupric ions to reaction mixtures containing imidazole buffer markedly enhanced cytokinin oxidase activity. In the presence of optimal concentrations of copper and imidazole, cytokinin oxidase activity was stimulated more than 20-fold. The effect was enzyme dependent, specific for copper, and observed only in the presence of imidazole. The substrate specificity of the copper-imidazole enhanced reaction, asmore » judged by substrate competition tests, was the same as that observed in the absence of copper and imidazole. Similarly, in tests involving DEAE-cellulose chromatography, elution profiles of cytokinin oxidase activity determined using a copper-imidazole enhanced assay were identical to those obtained using an assay without copper and imidazole. On the basis of these results, the addition of copper and imidazole to reaction mixtures used to assay for cytokinin oxidase activity is judged to provide a reliable and specific assay of greatly enhanced sensitivity for the enzyme. The mechanism by which copper and imidazole enhance cytokinin oxidase activity is not certain, but the reaction catalyzed by the enzyme was not inhibited by anaerobic conditions when these reagents were present. This observation suggests that copper-imidazole complexes are substituting for oxygen in the reaction mechanism by which cytokinin oxidase effects cleavage of the N/sup 6/-side chain of i/sup 6/ Ade.« less

  5. Kinetic Studies on Enzyme-Catalyzed Reactions: Oxidation of Glucose, Decomposition of Hydrogen Peroxide and Their Combination

    PubMed Central

    Tao, Zhimin; Raffel, Ryan A.; Souid, Abdul-Kader; Goodisman, Jerry

    2009-01-01

    The kinetics of the glucose oxidase-catalyzed reaction of glucose with O2, which produces gluconic acid and hydrogen peroxide, and the catalase-assisted breakdown of hydrogen peroxide to generate oxygen, have been measured via the rate of O2 depletion or production. The O2 concentrations in air-saturated phosphate-buffered salt solutions were monitored by measuring the decay of phosphorescence from a Pd phosphor in solution; the decay rate was obtained by fitting the tail of the phosphorescence intensity profile to an exponential. For glucose oxidation in the presence of glucose oxidase, the rate constant determined for the rate-limiting step was k = (3.0 ± 0.7) ×104 M−1s−1 at 37°C. For catalase-catalyzed H2O2 breakdown, the reaction order in [H2O2] was somewhat greater than unity at 37°C and well above unity at 25°C, suggesting different temperature dependences of the rate constants for various steps in the reaction. The two reactions were combined in a single experiment: addition of glucose oxidase to glucose-rich cell-free media caused a rapid drop in [O2], and subsequent addition of catalase caused [O2] to rise and then decrease to zero. The best fit of [O2] to a kinetic model is obtained with the rate constants for glucose oxidation and peroxide decomposition equal to 0.116 s−1 and 0.090 s−1 respectively. Cellular respiration in the presence of glucose was found to be three times as rapid as that in glucose-deprived cells. Added NaCN inhibited O2 consumption completely, confirming that oxidation occurred in the cellular mitochondrial respiratory chain. PMID:19348778

  6. IgE reactivity to alpha1 and alpha2 chains of bovine type 1 collagen in children with bovine gelatin allergy.

    PubMed

    Sakaguchi, M; Hori, H; Hattori, S; Irie, S; Imai, A; Yanagida, M; Miyazawa, H; Toda, M; Inouye, S

    1999-09-01

    Anaphylactic reactions to measles, mumps, and rubella vaccines, including gelatin as a stabilizer, have been reported. It had been found that most of these reactions to live vaccines are caused by the bovine gelatin included in these vaccines. Gelatin mainly includes denatured type I collagen, which consists of alpha1 and alpha2 chains. The current study was designed to investigate the IgE reactivity to alpha1 and alpha2 chains of bovine type I collagen in gelatin-sensitive children. Serum samples were taken from 10 children who had anaphylaxis to the vaccines and high levels of specific IgE to bovine gelatin. Bovine type I collagen was isolated from bovine skin and then separated to alpha1 and alpha2 chains by column chromatography. IgE reactivity to denatured type I collagen and its alpha1 and alpha2 chains was analyzed by immunoblotting, ELISA, and histamine release from the mast cells passive sensitized with IgE antibodies in pooled serum of the children. All children had specific IgE to bovine type I collagen. Furthermore, IgE antibodies in their sera reacted with the alpha;2 chain but not with the alpha1 chain. Similarly, the mast cells sensitized with pooled sera in the children showed alpha2 chain-specific histamine release but not alpha1 chain-specific histamine release. In gelatin allergy denatured bovine type I collagen is a major allergen and IgE-binding sites exist in the alpha2 chain of type I collagen.

  7. Potentiometric and Relaxometric Properties of a Gadolinium-based MRI Contrast Agent for Sensing Tissue pH

    PubMed Central

    Kálmán, Ferenc K.; Woods, Mark; Caravan, Peter; Jurek, Paul; Spiller, Marga; Tircsó, Gyula; Király, Róbert; Brücher, Ernő; Sherry, A. Dean

    2008-01-01

    The pH sensitive contrast agent, GdDOTA-4AmP (Gd1) has been successfully used to map tissue pH by MRI. Further studies now demonstrate that two distinct chemical forms of the complex can be prepared depending upon the pH at which Gd3+ is mixed with ligand 1. The desired pH sensitive form of this complex, referred to here as a Type II complex, is obtained as the exclusive product only when the complexation reaction is performed above pH 8. At lower pH values, a second complex is formed that, by analogy with an intermediate formed during preparation of GdDOTA, we tentatively assign this to a Type I complex where the Gd3+ is coordinated only by the appended side-chain arms of 1. The proportion of Type I complex formed is largely determined by the pH of the complexation reaction. The magnitude of pH dependent change in relaxivity of Gd1 was found to be less than earlier reported (S. Zhang, K. Wu, and A. D. Sherry, Angew. Chem., Int. Ed., 1999, 38, 3192), likely due to contamination of the earlier sample by an unknown amount of Type I complex. Examination of the NMRD and relaxivity temperature profiles, coupled with information from potentiometric titrations, shows that the amphoteric character of the phosphonate side-chains enables rapid prototropic exchange between the single bound water of the complex with those of the bulk water thereby giving Gd1 a unique pH dependent relaxivity that is quite useful for pH mapping of tissues by MRI. PMID:17539632

  8. Molecular typing of Iranian mycobacteria isolates by polymerase chain reaction-restriction fragment length polymorphism analysis of 360-bp rpoB gene

    PubMed Central

    Hadifar, Shima; Moghim, Sharareh; Fazeli, Hossein; GhasemianSafaei, Hajieh; Havaei, Seyed Asghar; Farid, Fariba; Esfahani, Bahram Nasr

    2015-01-01

    Background: Diagnosis and typing of Mycobacterium genus provides basic tools for investigating the epidemiology and pathogenesis of this group of bacteria. Polymerase chain reaction (PCR)-restriction fragment length polymorphism analysis (PRA) is an accurate method providing diagnosis and typing of species of mycobacteria. The present study is conducted by the purpose of determining restriction fragment profiles of common types of mycobacteria by PRA method of rpoB gene in this geographical region. Materials and Methods: Totally 60 clinical and environmental isolates from February to October, 2013 were collected and subcultured and identified by phenotypic methods. A 360 bp fragment of the rpoB gene amplified by PCR and products were digested by MspI and HaeIII enzymes. Results: In the present study, of all mycobacteria isolates identified by PRA method, 13 isolates (21.66%) were Mycobacterium tuberculosis, 34 isolates (56.66%) were rapidly growing Nontuberculosis Mycobacteria (NTM) that including 26 clinical isolates (43.33%) and 8 environmental isolates (13.33%), 11 isolates (18.33%) were clinical slowly growing NTM. among the clinical NTM isolates, Mycobacterium fortuitum Type I with the frequency of 57.77% was the most prevalent type isolates. Furthermore, an unrecorded of the PRA pattern of Mycobacterium conceptionense (HeaIII: 120/90/80, MspI: 120/105/80) was found. This study demonstrated that the PRA method was high discriminatory power for identification and typing of mycobacteria species and was able to identify 96.6% of all isolates. Conclusion: Based on the result of this study, rpoB gene could be a potentially useful tool for identification and investigation of molecular epidemiology of mycobacterial species. PMID:26380237

  9. Low-grade sinonasal sarcoma with neural and myogenic features: a clinicopathologic analysis of 28 cases.

    PubMed

    Lewis, Jason T; Oliveira, Andre M; Nascimento, Antonio G; Schembri-Wismayer, David; Moore, Eric A; Olsen, Kerry D; Garcia, Joaquin G; Lonzo, Melissa L; Lewis, Jean E

    2012-04-01

    Sarcomas of the sinonasal region are rare. We describe a distinct spindle cell sarcoma of the sinonasal region characterized by concomitant neural and myogenic differentiation. Consultation files and surgical cases from Mayo Clinic were reviewed. Twenty-eight cases were identified that met the inclusion criteria. Clinical data were collected from medical records, consultation letters, and referring pathologists. Reverse transcriptase-polymerase chain reaction for synovial sarcoma fusion transcripts was performed on 18 cases. Cytogenetic studies were performed on 2 cases. The 21 female and 7 male patients ranged in age from 24 to 85 years (mean, 52 y). All cases showed a characteristic histology, which included a cellular spindle cell neoplasm with uniform, elongate nuclei and an infiltrative growth pattern. All tumors demonstrated expression of S-100 with actin positivity in 96% of cases tested. Reverse transcriptase-polymerase chain reaction for synovial sarcoma fusion transcripts was negative in all cases tested. Cytogenetic studies conducted on 2 cases demonstrated the chromosomal translocation t(2;4). The nasal cavity (54%) and ethmoid sinus (57%) were the most commonly involved areas, singly or in combination. Follow-up information was available for 57% (16/28) of cases, with a mean of 8.3 years. Of these, 44% (7/16) experienced at least 1 recurrence. No patient has developed metastases or died of disease. We describe a unique tumor with a characteristic morphologic, immunophenotypic, and cytogenetic profile. On the basis of the locally aggressive nature of this lesion we believe it is best considered a low-grade sarcoma and suggest the term low-grade sinonasal sarcoma with neural and myogenic features.

  10. Molecular cloning, characterization and expression profiles of thioredoxin 1 and thioredoxin 2 genes in Mytilus galloprovincialis

    NASA Astrophysics Data System (ADS)

    Wang, Qing; Ning, Xuanxuan; Pei, Dong; Zhao, Jianmin; You, Liping; Wang, Chunyan; Wu, Huifeng

    2013-05-01

    Thioredoxin (Trx) proteins are involved in many biological processes especially the regulation of cellular redox homeostasis. In this study, two Trx cDNAs were cloned from the mussel Mytilus galloprovincialis using rapid amplifi cation of cDNA ends-polymerase chain reaction (RACE-PCR). The two cDNAs were named MgTrx1 and MgTrx2, respectively. The open reading frames of MgTrx1 and MgTrx2 were 318 and 507 base pairs (bp) and they encoded proteins of 105 and 168 amino acids with estimated molecular masses of 11.45 and 18.93 kDa, respectively. Sequence analysis revealed that both proteins possessed the conserved active site dithiol motif Cys-Gly-Pro-Cys. In addition, MgTrx2 also possessed a putative mitochondrial targeting signal suggesting that it is located in the mitochondria. Quantitative real-time polymerase chain reaction (qPCR) revealed that both MgTrx1 and MgTrx2 were constitutively expressed in all tissues examined. The MgTrx1 transcript was most abundant in hemocytes and gills, whereas the MgTrx2 transcript was most abundant in gonad, hepatopancreas, gill and hemocytes. Following Vibrio anguillarum challenge, the expression of MgTrx1 was up-regulated and reached its peak, at a value 10-fold the initial value, at 24 h. Subsequently, expression returned back to the original level. In contrast, the expression level of MgTrx2 was down-regulated following bacterial stimulation, with one fi fth of the control level evident at 12 h post challenge. These results suggest that MgTrx1 and MgTrx2 may play important roles in the response of M. galloprovincialis to bacterial challenge.

  11. CpG island methylator phenotype (CIMP) of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies.

    PubMed

    Ogino, S; Cantor, M; Kawasaki, T; Brahmandam, M; Kirkner, G J; Weisenberger, D J; Campan, M; Laird, P W; Loda, M; Fuchs, C S

    2006-07-01

    The concept of CpG island methylator phenotype (CIMP) is not universally accepted. Even if specific clinicopathological features have been associated with CIMP, investigators often failed to demonstrate a bimodal distribution of the number of methylated markers, which would suggest CIMP as a distinct subtype of colorectal cancer. Previous studies primarily used methylation specific polymerase chain reaction which might detect biologically insignificant low levels of methylation. To demonstrate a distinct genetic profile of CIMP colorectal cancer using quantitative DNA methylation analysis that can distinguish high from low levels of DNA methylation. We developed quantitative real time polymerase chain reaction (MethyLight) assays and measured DNA methylation (percentage of methylated reference) of five carefully selected loci (promoters of CACNA1G, CDKN2A (p16), CRABP1, MLH1, and NEUROG1) in 460 colorectal cancers from large prospective cohorts. There was a clear bimodal distribution of 80 microsatellite instability-high (MSI-H) tumours according to the number of methylated promoters, with no tumours showing 3/5 methylated loci. Thus we defined CIMP as having >or=4/5 methylated loci, and 17% (78) of the 460 tumours were classified as CIMP. CIMP was significantly associated with female sex, MSI, BRAF mutations, and wild-type KRAS. Both CIMP MSI-H tumours and CIMP microsatellite stable (MSS) tumours showed much higher frequencies of BRAF mutations (63% and 54%) than non-CIMP counterparts (non-CIMP MSI-H (0%, p<10(-5)) and non-CIMP MSS tumours (6.6%, p<10(-4)), respectively). CIMP is best characterised by quantitative DNA methylation analysis. CIMP is a distinct epigenotype of colorectal cancer and may be less frequent than previously reported.

  12. A two-year follow-up study of the PCV2 status of a Danish pig herd that was initially assumed to be PCV2-free.

    PubMed

    Kristensen, Charlotte S; Hjulsager, Charlotte K; Larsen, Lars E

    2015-01-01

    A longitudinal study was carried out to investigate whether a herd that had previously tested negative for porcine circovirus type 2 (PCV2) by polymerase chain reaction (PCR) was free of PCV2 or whether the negative profiles indicate that the level of PCV2 varies over time. In eight Danish herds that had initially tested negative for PCV2 by quantitative polymerase chain reaction (PCR), additional sampling was performed. Only one of the herds was still PCV2-negative in the additional sampling and was included in the study. The herd was a finishing herd, subclinically infected with PCV2, but vaccinated against PCV2 to improve performance. The herd was monitored by taking blood samples every seventh week over a period of two years and was not found to be continuously negative for PCV2 by PCR. The first time PCV2 was detected by PCR, in May 2010, PCV2 vaccination had been withdrawn from the herd, and at the same time the herd was infected with porcine reproductive and respiratory syndrome virus (PRRS). The PCV2-negative status, measured by PCR, was obtained in the first sampling after the PCV2 vaccination had been reintroduced. When PCV2 vaccination was withdrawn again in September 2011, the herd tested positive for PCV2 by PCR, and this time it continued to be PCV2-positive, even though PCV2 vaccination had been reintroduced. A Danish finishing herd that appeared to be PCV2-free from the start of a period of two years was not free of PCV2 during the entire period.

  13. T lymphocytes among HIV-infected and -uninfected infants: CD4/CD8 ratio as a potential tool in diagnosis of infection in infants under the age of 2 years.

    PubMed

    Zijenah, Lynn S; Katzenstein, David A; Nathoo, Kusum J; Rusakaniko, Simbarashe; Tobaiwa, Ocean; Gwanzura, Christine; Bikoue, Arsene; Nhembe, Margaret; Matibe, Petronella; Janossy, George

    2005-02-01

    BACKGROUND: Serologic tests for HIV infection in infants less than 18 months do not differentiate exposure and infection since maternally acquired IgG antibodies may be detected in infants. Thus, the gold standard for diagnosis of HIV-1 infection in infants under the age of 2 years is DNA or reverse transcriptase polymerase chain reaction. There is an urgent need to evaluate alternative and cost effective laboratory methods for early diagnosis of infant HIV-1 infection as well as identifying infected infants who may benefit from cotrimoxazole prophylaxis and/or initiation of highly active antiretroviral therapy. METHODS: Whole blood was collected in EDTA from 137 infants aged 0 to 18 months. DNA polymerase chain reaction was used as the reference standard for diagnosis of HIV-1 infection. T-cell subset profiles were determined by flow cytometry. RESULTS: Seventy-six infants were DNA PCR positive while 61 were negative. The median CD4 counts of PCR negative infants were significantly higher than those of the PCR positive infants, p < 0.001. The median CD4/CD8 ratio and the %CD4 of the PCR positive infants were both significantly lower than those of the negative infants, p < 0.001. The CD4/CD8 ratio had a >98% sensitivity for diagnosis of HIV-1 infection and a specificity of >98%. CONCLUSION: The CD4/CD8 ratio appears useful in identifying HIV-infected infants. The development of lower cost and more robust flow cytometric methods that provide both CD4/CD8 ratio and %CD4 may be cost-effective for HIV-1 diagnosis and identification of infants for cotrimoxazole prophylaxis and/or highly active antiretroviral therapy.

  14. T lymphocytes among HIV-infected and -uninfected infants: CD4/CD8 ratio as a potential tool in diagnosis of infection in infants under the age of 2 years

    PubMed Central

    Zijenah, Lynn S; Katzenstein, David A; Nathoo, Kusum J; Rusakaniko, Simbarashe; Tobaiwa, Ocean; Gwanzura, Christine; Bikoue, Arsene; Nhembe, Margaret; Matibe, Petronella; Janossy, George

    2005-01-01

    Background Serologic tests for HIV infection in infants less than 18 months do not differentiate exposure and infection since maternally acquired IgG antibodies may be detected in infants. Thus, the gold standard for diagnosis of HIV-1 infection in infants under the age of 2 years is DNA or reverse transcriptase polymerase chain reaction. There is an urgent need to evaluate alternative and cost effective laboratory methods for early diagnosis of infant HIV-1 infection as well as identifying infected infants who may benefit from cotrimoxazole prophylaxis and/or initiation of highly active antiretroviral therapy. Methods Whole blood was collected in EDTA from 137 infants aged 0 to 18 months. DNA polymerase chain reaction was used as the reference standard for diagnosis of HIV-1 infection. T-cell subset profiles were determined by flow cytometry. Results Seventy-six infants were DNA PCR positive while 61 were negative. The median CD4 counts of PCR negative infants were significantly higher than those of the PCR positive infants, p < 0.001. The median CD4/CD8 ratio and the %CD4 of the PCR positive infants were both significantly lower than those of the negative infants, p < 0.001. The CD4/CD8 ratio had a >98% sensitivity for diagnosis of HIV-1 infection and a specificity of >98%. Conclusion The CD4/CD8 ratio appears useful in identifying HIV-infected infants. The development of lower cost and more robust flow cytometric methods that provide both CD4/CD8 ratio and %CD4 may be cost-effective for HIV-1 diagnosis and identification of infants for cotrimoxazole prophylaxis and/or highly active antiretroviral therapy. PMID:15683549

  15. Beta-lactamic resistance profiles in Porphyromonas, Prevotella, and Parvimonas species isolated from acute endodontic infections.

    PubMed

    Montagner, Francisco; Jacinto, Rogério Castilho; Correa Signoretti, Fernanda Graziela; Scheffer de Mattos, Vanessa; Grecca, Fabiana Soares; Gomes, Brenda Paula Figueiredo de Almeida

    2014-03-01

    Susceptibility to beta-lactamic agents has changed among anaerobic isolates from acute endodontic infections. The aim of the present study was to determine the prevalence of the cfxA/cfxA2 gene in Prevotella spp., Porphyromonas spp., and Parviomonas micra strains and show its phenotypic expression. Root canal samples from teeth with acute endodontic infections were collected and Porphyromonas, Prevotella, and Parvimonas micra strains were isolated and microbiologically identified with conventional culture techniques. The susceptibility of the isolates was determined by the minimum inhibitory concentration of benzylpenicillin, amoxicillin, and amoxicillin + clavulanate using the E-test method (AB BIODISK, Solna, Sweden). The presence of the cfxA/cfxA2 gene was determined through primer-specific polymerase chain reaction. The nitrocefin test was used to determine the expression of the lactamase enzyme. Prevotella disiens, Prevotella oralis, Porphyromonas gingivalis, and P. micra strains were susceptible to benzylpenicillin, amoxicillin, and amoxicillin + clavulanate. The cfxA/cfxA2 gene was detected in 2 of 29 isolates (6.9%). Simultaneous detection of the cfxA/cfxA2 gene and lactamase production was observed for 1 Prevotella buccalis strain. The gene was in 1 P. micra strain but was not expressed. Three strains were positive for lactamase production, but the cfxA/cfxA2 gene was not detected through polymerase chain reaction. There is a low prevalence of the cfxA/cfxA2 gene and its expression in Porphyromonas spp., Prevotella spp., and P. micra strains isolated from acute endodontic infections. Genetic and phenotypic screening must be performed simultaneously to best describe additional mechanisms involved in lactamic resistance for strict anaerobes. Copyright © 2014 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  16. Utilization of a DNA enzyme immunoassay for the detection of proviral DNA of human immunodeficiency virus type 1 by polymerase chain reaction.

    PubMed

    Zella, D; Cavicchini, A; Cattaneo, E; Cimarelli, A; Bertazzoni, U

    1995-02-01

    The detection of proviral DNA by Polymerase Chain Reaction (PCR) is regarded as an important tool in the diagnosis of HIV-1 infection, specially among adults at risk of AIDS and children born to seropositive mothers. However, application of PCR in routine testing is hampered by the need to use radioactive probes. In this study, a non-radioactive test based on a microtiter plate (DNA Enzyme ImmunoAssay, DEIA) was used for the detection of proviral sequences of HIV-1 in peripheral blood cells of different patients. The results of the PCR-DEIA assay were compared to those obtained by liquid hybridization (PCR-LH), virus isolation (VI) and Western blot (WB). The study population included 92 patients belonging to three different groups: seropositive subjects with a well-defined clinical status and WB profile; adults at risk of infection with negative or indeterminate WB; children born to seropositive mothers with still unestablished HIV-1 infection. In the seropositive subjects, both PCR-LH and PCR-DEIA confirmed infection and gave the same results as WB. In adults at risk of infection, PCR with both methods anticipated the seroconversion in one patient with indeterminate WB and confirmed the absence of infection among seronegative and other indeterminate patients. In children born to seropositive mothers, both PCR systems as well as VI permitted an early diagnosis of infection, as confirmed by the clinical follow-up. This study has shown that in subjects at risk of AIDS and in children born to seropositive mothers, the non-isotopic DEIA method presents the same sensitivity and specificity for the detection of HIV-1 infection as the radioactive procedure. The DEIA method appears to be particularly useful for the detection of PCR products in routine diagnostic analyses.

  17. World Trade Center human identification project: experiences with individual body identification cases.

    PubMed

    Budimlija, Zoran M; Prinz, Mechthild K; Zelson-Mundorff, Amy; Wiersema, Jason; Bartelink, Eric; MacKinnon, Gaille; Nazzaruolo, Bianca L; Estacio, Sheila M; Hennessey, Michael J; Shaler, Robert C

    2003-06-01

    To present individual body identification efforts, as part of the World Trade Center (WTC) mass disaster identification project. More than 500 samples were tested by using polymerase chain reaction (PCR) amplification and short tandem repeat (STR) typing. The extent to which the remains were fragmented and affected by taphonomic factors complicated the identification project. Anthropologists reviewed 19,000 samples, and detected inconsistencies in 69, which were further split into 239 new cases and re-sampled by DNA specialists. The severity and nature of the disaster required an interdisciplinary effort. DNA profiling of 500 samples was successful in 75% of the cases. All discrepancies, which occurred between bone and tissue samples taken from the same body part, were resolved by re-sampling and re-testing of preferably bone tissue. Anthropologists detected inconsistencies in 69 cases, which were then split into 239 new cases. Out of 125 "split" cases, 65 were excluded from their original case. Of these 65 cases, 37 did not match any profiles in M-FISys, probably because profiles were incomplete or no exemplar for the victim was available. Out of the 60 remains not excluded from their original case, 30 were partial profiles and did not reach the statistical requirement to match their original case, because the population frequency of the DNA profile had to be

  18. Differential chemokine, chemokine receptor and cytokine expression in Epstein-Barr virus-associated lymphoproliferative diseases.

    PubMed

    Ohshima, Koichi; Karube, Kennosuke; Hamasaki, Makoto; Tutiya, Takeshi; Yamaguchi, Takahiro; Suefuji, Hiroaki; Suzuki, Keiko; Suzumiya, Junji; Ohga, Shouichi; Kikuchi, Masahiro

    2003-08-01

    T cell immunity plays an important role in the clinicopathology of Epstein-Barr virus (EBV)-associated diseases. Acute EBV-induced infectious mononucleosis (IM) is a common self-limiting disease, however, other EBV-associated diseases, including chronic active EBV infection (CAEBV), NK cell lymphoma (NKL), and Hodgkin's lymphoma (HL), exhibit distinct clinical features. Chemokines are members of a family of small-secreted proteins. The relationships between chemokines and the chemokine receptor (R) are thought to be important for selectivity of local immunity. Some chemokines, chemokine R and cytokines closely associate with the T cell subtypes, Th1 and Th2 T cells and cytotoxic cells. To clarify the role of T cell immunity in EBV-associated diseases, we conducted gene expression profiling, using chemokine, chemokine R and cytokine DNA chips. Compared to EBV negative non-specific lymphadenitis, CAEBV and NKL exhibited diffuse down- and up-regulation, respectively, of these gene profiles. IM had a predominantly Th1-type profile, whereas HL had a mixed Th1/Th2-type profile. Reduction of the Th1-type cytokine interferon gamma (IFN-gamma) in CAEBV was confirmed by Reverse transcriptase-polymerase chain reaction, whereas IFN-gamma expression was markedly enhanced in NKL, and moderately enhanced in IM. Compared to IM, CAEBV showed slight elevation of "regulated upon activation, normal T expressed and secreted" (RANTES), but almost all other genes assayed were down-regulated. NKL exhibited elevated expression of numerous genes, particularly IFN-gamma-inducible-10 (IP-10) and monokine induced by IFN-gamma (MIG). HL showed variable elevated and reduced expression of various genes, with increased expression of IL-13 receptor and MIG. Our study demonstrated the enormous potential of gene expression profiling for clarifying the pathogenesis of EBV-associated diseases.

  19. Alteration in gene expression profile and oncogenicity of esophageal squamous cell carcinoma by RIZ1 upregulation.

    PubMed

    Dong, Shang-Wen; Li, Dong; Xu, Cong; Sun, Pei; Wang, Yuan-Guo; Zhang, Peng

    2013-10-07

    To investigate the effect of retinoblastoma protein-interacting zinc finger gene 1 (RIZ1) upregulation in gene expression profile and oncogenicity of human esophageal squamous cell carcinoma (ESCC) cell line TE13. TE13 cells were transfected with pcDNA3.1(+)/RIZ1 and pcDNA3.1(+). Changes in gene expression profile were screened and the microarray results were confirmed by reverse transcription-polymerase chain reaction (RT-PCR). Nude mice were inoculated with TE13 cells to establish ESCC xenografts. After two weeks, the inoculated mice were randomly divided into three groups. Tumors were injected with normal saline, transfection reagent pcDNA3.1(+) and transfection reagent pcDNA3.1(+)/RIZ1, respectively. Tumor development was quantified, and changes in gene expression of RIZ1 transfected tumors were detected by RT-PCR and Western blotting. DNA microarray data showed that RIZ1 transfection induced widespread changes in gene expression profile of cell line TE13, with 960 genes upregulated and 1163 downregulated. Treatment of tumor xenografts with RIZ1 recombinant plasmid significantly inhibited tumor growth, decreased tumor size, and increased expression of RIZ1 mRNA compared to control groups. The changes in gene expression profile were also observed in vivo after RIZ1 transfection. Most of the differentially expressed genes were associated with cell development, supervision of viral replication, lymphocyte costimulatory and immune system development in esophageal cells. RIZ1 gene may be involved in multiple cancer pathways, such as cytokine receptor interaction and transforming growth factor beta signaling. The development and progression of esophageal cancer are related to the inactivation of RIZ1. Virus infection may also be an important factor.

  20. Detecting Service Chains and Feature Interactions in Sensor-Driven Home Network Services

    PubMed Central

    Inada, Takuya; Igaki, Hiroshi; Ikegami, Kosuke; Matsumoto, Shinsuke; Nakamura, Masahide; Kusumoto, Shinji

    2012-01-01

    Sensor-driven services often cause chain reactions, since one service may generate an environmental impact that automatically triggers another service. We first propose a framework that can formalize and detect such service chains based on ECA (event, condition, action) rules. Although the service chain can be a major source of feature interactions, not all service chains lead to harmful interactions. Therefore, we then propose a method that identifies feature interactions within the service chains. Specifically, we characterize the degree of deviation of every service chain by evaluating the gap between expected and actual service states. An experimental evaluation demonstrates that the proposed method successfully detects 11 service chains and 6 feature interactions within 7 practical sensor-driven services. PMID:23012499

  1. Molecular Mechanisms of Increased Heart Rate in Shenxianshengmai-treated Bradycardia Rabbits.

    PubMed

    Liu, Zhou-Ying; Huang, Jian; Liu, Na-Na; Zheng, Min; Zhao, Tao; Zhao, Bu-Chang; Wang, Yi-Min; Pu, Jie-Lin

    2017-01-20

    The molecular mechanisms of Shenxianshengmai (SXSM), a traditional Chinese medicine, on bradycardia have been incompletely understood. The study tried to investigate the gene expression profile and proteomics of bradycardia rabbits' hearts after SXSM treatment. Twenty-four adult rabbits were randomly assigned in four groups: sham, model, model plus SXSM treatment, and sham plus SXSM treatment groups. Heart rate was recorded in all rabbits. Then, total RNA of atria and proteins of ventricle were isolated and quantified, respectively. Gene expression profiling was conducted by gene expression chip, and quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) was performed to confirm the results of gene expression chip. We used isobaric tags for elative and absolute quantitation and Western blotting to identify altered proteins after SXSM treatment. There was a constant decrease in the mean heart rate (32%, from 238 ± 6 beats/min to 149 ± 12 beats/min) after six weeks in model compared with that in sham group. This effect was partially reversed by 4-week SXSM treatment. Complementary DNA microarray demonstrated that the increased acetylcholinesterase and reduced nicotinic receptor were take responsibility for the increased heart rate. In addition, proteins involved in calcium handling and signaling were affected by SXSM treatment. Real-time RT-PCR verified the results from gene chip. Results from proteomics demonstrated that SXSM enhanced oxidative phosphorylation and tricarboxylic acid (TCA) cycle in ventricular myocardium to improve ATP generation. Long-term SXSM stimulates sympathetic transmission by increasing the expression of acetylcholinesterase and reduces the expression of nicotinic receptor to increase heart rate. SXSM also restored the calcium handling genes and altered genes involved in signaling. In addition, SXSM improves the ATP supply of ventricular myocardium by increasing proteins involved in TCA cycle and oxidation-respiratory chain.

  2. Molecular Mechanisms of Increased Heart Rate in Shenxianshengmai-treated Bradycardia Rabbits

    PubMed Central

    Liu, Zhou-Ying; Huang, Jian; Liu, Na-Na; Zheng, Min; Zhao, Tao; Zhao, Bu-Chang; Wang, Yi-Min; Pu, Jie-Lin

    2017-01-01

    Background: The molecular mechanisms of Shenxianshengmai (SXSM), a traditional Chinese medicine, on bradycardia have been incompletely understood. The study tried to investigate the gene expression profile and proteomics of bradycardia rabbits’ hearts after SXSM treatment. Methods: Twenty-four adult rabbits were randomly assigned in four groups: sham, model, model plus SXSM treatment, and sham plus SXSM treatment groups. Heart rate was recorded in all rabbits. Then, total RNA of atria and proteins of ventricle were isolated and quantified, respectively. Gene expression profiling was conducted by gene expression chip, and quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) was performed to confirm the results of gene expression chip. We used isobaric tags for elative and absolute quantitation and Western blotting to identify altered proteins after SXSM treatment. Results: There was a constant decrease in the mean heart rate (32%, from 238 ± 6 beats/min to 149 ± 12 beats/min) after six weeks in model compared with that in sham group. This effect was partially reversed by 4-week SXSM treatment. Complementary DNA microarray demonstrated that the increased acetylcholinesterase and reduced nicotinic receptor were take responsibility for the increased heart rate. In addition, proteins involved in calcium handling and signaling were affected by SXSM treatment. Real-time RT-PCR verified the results from gene chip. Results from proteomics demonstrated that SXSM enhanced oxidative phosphorylation and tricarboxylic acid (TCA) cycle in ventricular myocardium to improve ATP generation. Conclusions: Long-term SXSM stimulates sympathetic transmission by increasing the expression of acetylcholinesterase and reduces the expression of nicotinic receptor to increase heart rate. SXSM also restored the calcium handling genes and altered genes involved in signaling. In addition, SXSM improves the ATP supply of ventricular myocardium by increasing proteins involved in TCA cycle and oxidation-respiratory chain. PMID:28091410

  3. Structural changes of gut microbiota in a rat non-alcoholic fatty liver disease model treated with a Chinese herbal formula.

    PubMed

    Yin, Xiaochen; Peng, Jinghua; Zhao, Liping; Yu, Yunpeng; Zhang, Xu; Liu, Ping; Feng, Qin; Hu, Yiyang; Pang, Xiaoyan

    2013-05-01

    Accumulating evidence indicates that disruption of the gut microbiota by a high-fat diet (HFD) may play a pivotal role in the progression of metabolic disorders such as non-alcoholic fatty liver disease (NAFLD). In this study, the structural changes of gut microbiota were analyzed in an HFD-induced NAFLD rat model during treatment with an ancient Chinese herbal formula (CHF) used in clinical practice -Qushi Huayu Fang. CHF treatment significantly reduced body weight, alleviated hepatic steatosis, and decreased the content of triglycerides and free fatty acids in the livers of the rats. Gut microbiota of treated and control rats were profiled with polymerase chain reaction-denaturing gradient gel electrophoresis and bar-coded pyrosequencing of the V3 region of 16S rRNA genes. Both analyses indicated that the CHF-treated group harbored significantly different gut microbiota from that of model rats. Partial least squares discriminant analysis and taxonomy-based analysis were further employed to identify key phylotypes responding to HFD and CHF treatment. Most notably, the genera Escherichia/Shigella, containing opportunistic pathogens, were significantly enriched in HFD-fed rats compared to controls fed normal chow (P<0.05) but they decreased to control levels after CHF treatment. Collinsella, a genus with short chain fatty acid producers, was significantly elevated in CHF-treated rats compared to HFD-fed rats (P<0.05). The results revealed that the bacterial profiles of HFD-induced rats could be modulated by the CHF. Elucidation of these differences in microbiota composition provided a basis for further understanding the pharmacological mechanism of the CHF. Copyright © 2013 Elsevier GmbH. All rights reserved.

  4. [Identification of Candida dubliniensis strains using heat tolerance tests, morphological characteristics and molecular methods].

    PubMed

    Arikan, Sevtap; Darka, Ozge; Hasçelik, Gülşen; Günalp, Ayfer

    2003-01-01

    Described in 1995, Candida dubliniensis is a novel Candida species closely related to Candida albicans due primarily to its ability to produce germ tube and chlamydospores. Given these phenotypic similarities between the two species, C. dubliniensis cannot be readily distinguished from Candida albicans by routine laboratory work-up. We explored the frequency of isolation of C. dubliniensis among 213 strains previously defined as C. albicans based on their ability to produce germ tube. The test isolates were initially examined for their morphological features on cornmeal tween 80 agar, inability to grow at 45 degrees C, and the biochemical assimilation profile (ID 32C system, bioMerieux, France). Among all, 2 (0.9%) of the isolates were identified as C. dubliniensis based on the production of numerous chlamydospores in chains on cornmeal tween 80 agar and the lack of growth at 45 degrees C. The assimilation profile of these isolates was found to be in accordance with this identification. In an effort to confirm the identification, polymerase chain reaction (PCR) studies were carried out by using the C. dubliniensis specific primer set, DUBF and DUBR. Both of the isolates yielded C. dubliniensis-specific 288 base pair amplification products, confirming the previous identification obtained with the initial screening tests. The isolates were found to be susceptible to fluconazole and itraconazole, and generated amphotericin B minimal inhibitory concentrations of 0.5-1 microgram/ml by NCCLS M27-A2 microdilution method. These data suggest that the isolation rate of C. dubliniensis among our clinical isolates is low. The morphological features on cornmeal tween 80 agar and the lack of ability to grow at 45 degrees C appear as reliable, cheap, and practical screening tests in initial identification of C. dubliniensis among germ tube-producing Candida strains.

  5. Molecular cloning, sequence identification and tissue expression profile of three novel sheep (Ovis aries) genes - BCKDHA, NAGA and HEXA.

    PubMed

    Liu, G Y; Gao, S Z

    2009-01-01

    The complete coding sequences of three sheep genes- BCKDHA, NAGA and HEXA were amplified using the reverse transcriptase polymerase chain reaction (RT-PCR), based on the conserved sequence information of the mouse or other mammals. The nucleotide sequences of these three genes revealed that the sheep BCKDHA gene encodes a protein of 313 amino acids which has high homology with the BCKDHA gene that encodes a protein of 447 amino acids that has high homology with the Branched chain keto acid dehydrogenase El, alpha polypeptide (BCKDHA) of five species chimpanzee (93%), human (96%), crab-eating macaque (93%), bovine (98%) and mouse (91%). The sheep NAGA gene encodes a protein of 411 amino acids that has high homology with the alpha-N-acetylgalactosaminidase (NAGA) of five species human (85%), bovine (94%), mouse (91%), rat (83%) and chicken (74%). The sheep HEXA gene encodes a protein of 529 amino acids that has high homology with the hexosaminidase A(HEXA) of five species bovine (98%), human (84%), Bornean orangután (84%), rat (80%) and mouse (81%). Finally these three novel sheep genes were assigned to GenelDs: 100145857, 100145858 and 100145856. The phylogenetic tree analysis revealed that the sheep BCKDHA, NAGA, and HEXA all have closer genetic relationships to the BCKDHA, NAGA, and HEXA of bovine. Tissue expression profile analysis was also carried out and results revealed that sheep BCKDHA, NAGA and HEXA genes were differentially expressed in tissues including muscle, heart, liver, fat, kidney, lung, small and large intestine. Our experiment is the first to establish the primary foundation for further research on these three sheep genes.

  6. Influence of vegetable coagulant and ripening time on the lipolytic and sensory profile of cheeses made with raw goat milk from Canary breeds.

    PubMed

    Rincón, Arturo A; Pino, Verónica; Fresno, María R; Jiménez-Abizanda, Ana I; Álvarez, Sergio; Ayala, Juan H; Afonso, Ana M

    2017-04-01

    Free fatty acids and sensory profiles were obtained for cheeses made with raw goat milk and vegetable coagulant, derived from the cardoon flower ( Cynara cardunculus), at different ripening times (7 and 20 days). A solid-liquid phase extraction method followed by solid-phase extraction and gas chromatography was used. Profiles were also obtained with cheeses made with commercial coagulant, traditional kid rennet paste, and mixture coagulant (vegetable coagulant-kid rennet). The use of vegetable coagulant and vegetable coagulant-kid rennet is common in traditional Protected Designation of Origin cheeses such as " Queso Flor de Guía" and " Queso Media Flor de Guía" (Spain). Contents of short-chain free fatty acids (7.5-22.5 mmol·kg -1 ), medium-chain free fatty acids (0.4-3.7 mmol·kg -1 ), and long-chain free fatty acids (0.2-2.1 mmol·kg -1 ) varied depending on the coagulant type and the ripening time. Vegetable coagulant cheeses present odour intensity and flavour intensity much higher than commercial coagulant cheeses in the sensory analysis for cheeses obtained with seven days of ripening, but the values decrease when increasing the ripening time. Multivariate analysis allowed us to differentiate cheese samples according to the ripening time when using lipolytic profile and according to the coagulant type using the sensory profile.

  7. Ionizing radiation-induced destruction of benzene and dienes in aqueous media.

    PubMed

    Al-Sheikhly, Mohamad; Poster, Dianne L; An, Jung-Chul; Neta, Pedatsur; Silverman, Joseph; Huie, Robert E

    2006-05-01

    Pulse radiolysis with spectrophotometric and conductometric detection was utilized to study the formation and reactions of radicals from benzene and dienes in aqueous solutions. The benzene OH adduct, *C6H6OH, reacts with O2 (k = 3 x 10(8) L mol(-1) s(-1)) in a reversible reaction. The peroxyl radical, HOC6H6O2*, undergoes O2*- elimination, bimolecular decay, and reaction with benzene to initiate a chain reaction, depending on the dose rate, benzene concentration, and pH. The occurrence of the chain reaction is demonstrated in low-dose-rate gamma radiolysis experiments where the consumption of O2 was monitored. 1,4-Cyclohexadiene, 1,4-hexadiene, and 1,4-pentadiene form OH-adducts and undergo H-abstraction by O*- radicals. The OH-adducts react with O2 to form peroxyl radicals. These peroxyl radicals, however, do not undergo unimolecular O2*- elimination but rather decay by second-order processes, which lead to subsequent steps of O2*- elimination.

  8. Benefit-Risk Summary of Crizotinib for the Treatment of Patients With ROS1 Alteration-Positive, Metastatic Non-Small Cell Lung Cancer

    PubMed Central

    Blumenthal, Gideon M.; Luo, Lola; He, Kun; Fran, Ingrid; Lemery, Steven; Pazdur, Richard

    2016-01-01

    On March 11, 2016, after an expedited 5-month review, the U.S. Food and Drug Administration expanded the crizotinib metastatic non-small cell lung cancer (mNSCLC) indication to include the treatment of patients whose tumors harbor a ROS1 rearrangement. The approval was based on a clinically meaningful, durable objective response rate (ORR) in a multicenter, single-arm clinical trial (ROS1 cohort of Trial PROFILE 1001) in patients with ROS1-positive mNSCLC. The trial enrolled 50 patients (age range: 25–77 years) whose tumors were prospectively determined to have a ROS1 gene rearrangement by break-apart fluorescence in situ hybridization (96%) or reverse transcriptase polymerase chain reaction (4%) clinical trial assays. Crizotinib demonstrated an ORR of 66% (95% confidence interval [CI]: 51%–79%) with a median duration of response of 18.3 months by independent radiology review and 72% (95% CI: 58%–84%) by investigator review. Patients received crizotinib 250 mg twice daily and had a median duration of exposure of 34.4 months. The toxicity profile in ROS1-positive patients was generally consistent with the randomized safety data in the U.S. Product Insert from two ALK-positive mNSCLC trials. The most common (≥25%) adverse reactions and laboratory test abnormalities included vision disorders, elevation of alanine transaminase and aspartate transaminase levels, nausea, hypophosphatemia, diarrhea, edema, vomiting, constipation, neutropenia, and fatigue. There were no treatment-related deaths. A favorable benefit-to-risk evaluation led to the traditional approval of crizotinib for this new supplemental indication. Implications for Practice: Given the results from the ROS1 cohort of the clinical trial PROFILE 1001, crizotinib represents a new treatment option and the first approved therapy for patients with metastatic non-small cell lung cancer whose tumors are ROS1 positive. Crizotinib demonstrated efficacy irrespective of prior treatment status. PMID:27328934

  9. Benefit-Risk Summary of Crizotinib for the Treatment of Patients With ROS1 Alteration-Positive, Metastatic Non-Small Cell Lung Cancer.

    PubMed

    Kazandjian, Dickran; Blumenthal, Gideon M; Luo, Lola; He, Kun; Fran, Ingrid; Lemery, Steven; Pazdur, Richard

    2016-08-01

    : On March 11, 2016, after an expedited 5-month review, the U.S. Food and Drug Administration expanded the crizotinib metastatic non-small cell lung cancer (mNSCLC) indication to include the treatment of patients whose tumors harbor a ROS1 rearrangement. The approval was based on a clinically meaningful, durable objective response rate (ORR) in a multicenter, single-arm clinical trial (ROS1 cohort of Trial PROFILE 1001) in patients with ROS1-positive mNSCLC. The trial enrolled 50 patients (age range: 25-77 years) whose tumors were prospectively determined to have a ROS1 gene rearrangement by break-apart fluorescence in situ hybridization (96%) or reverse transcriptase polymerase chain reaction (4%) clinical trial assays. Crizotinib demonstrated an ORR of 66% (95% confidence interval [CI]: 51%-79%) with a median duration of response of 18.3 months by independent radiology review and 72% (95% CI: 58%-84%) by investigator review. Patients received crizotinib 250 mg twice daily and had a median duration of exposure of 34.4 months. The toxicity profile in ROS1-positive patients was generally consistent with the randomized safety data in the U.S. Product Insert from two ALK-positive mNSCLC trials. The most common (≥25%) adverse reactions and laboratory test abnormalities included vision disorders, elevation of alanine transaminase and aspartate transaminase levels, nausea, hypophosphatemia, diarrhea, edema, vomiting, constipation, neutropenia, and fatigue. There were no treatment-related deaths. A favorable benefit-to-risk evaluation led to the traditional approval of crizotinib for this new supplemental indication. Given the results from the ROS1 cohort of the clinical trial PROFILE 1001, crizotinib represents a new treatment option and the first approved therapy for patients with metastatic non-small cell lung cancer whose tumors are ROS1 positive. Crizotinib demonstrated efficacy irrespective of prior treatment status. ©AlphaMed Press.

  10. Gene expression profiling of anti-GBM glomerulonephritis model: the role of NF-kappaB in immune complex kidney disease.

    PubMed

    Kim, Ju Han; Ha, Il Soo; Hwang, Chang-Il; Lee, Young-Ju; Kim, Jihoon; Yang, Seung-Hee; Kim, Yon Su; Cao, Yun Anna; Choi, Sangdun; Park, Woong-Yang

    2004-11-01

    Immune complexes may cause an irreversible onset of chronic renal disease. Most patients with chronic renal disease undergo a final common pathway, marked by glomerulosclerosis and interstitial fibrosis. We attempted to draw a molecular map of anti-glomerular basement membrane (GBM) glomerulonephritis in mice using oligonucleotide microarray technology. Kidneys were harvested at days 1, 3, 7, 11, and 16 after inducing glomerulonephritis by using anti-GBM antibody. In parallel with examining the biochemical and histologic changes, gene expression profiles were acquired against five pooled control kidneys. Gene expression levels were cross-validated by either reverse transcription-polymerase chain reaction (RT-PCR), real-time PCR, or immunohistochemistry. Pathologic changes in anti-GBM glomerulonephritis were confirmed in both BALB/c and C57BL/6 strains. Among the 13,680 spotted 65mer oligonucleotides, 1112 genes showing significant temporal patterns by permutation analysis of variance (ANOVA) with multiple testing correction [false discovery ratio (FDR) < 0.05] were chosen for cluster analysis. From the expression profile, acute inflammatory reactions characterized by the elevation of various cytokines, including interleukin (IL)-1 and IL-6, were identified within 3 days of disease onset. After 7 days, tissue remodeling response was prominent with highly induced extracellular-matrix (ECM) genes. Although cytokines related to lymphocyte activation were not detected, monocyte or mesangial cell proliferation-related genes were increased. Tumor necrosis factor-alpha (TNF-alpha) and nuclear factor-kappaB (NF-kappaB) pathway were consistently activated along the entire disease progression, inducing various target genes like complement 3, IL-1b, IL-6, Traf1, and Saa1. We made a large-scale gene expression time table for mouse anti-GBM glomerulonephritis model, providing a comprehensive overview on the mechanism governing the initiation and the progression of inflammatory renal disease.

  11. The possibility of a new resonance of three-body linear chain structure in the reaction 12C+16O at Ec.mapprox-33.5MeV

    NASA Astrophysics Data System (ADS)

    Kong, Xiangjing; P, L. Li; J, J. Kolata; A, Morsad; L, Goetting; R, A. Kryger; S, Dixit; R, Tighe; W, Chune

    1990-05-01

    There is a peak in the excitation function of total cross section of low energy α-particles in the reaction 12C+16O at Ec.m approx33.5MeV. The experimental distribution of α-particle emitted event has been obtained. The result of theoretical calculation roughly agrees with experimental data, gives an orientation where three-body resonances can be expected, and the information on internal structure of three-body linear chain molecule.

  12. DNA profiling, telomere analysis and antioxidant properties as tools for monitoring ex situ seed longevity

    PubMed Central

    Donà, M.; Balestrazzi, A.; Mondoni, A.; Rossi, G.; Ventura, L.; Buttafava, A.; Macovei, A.; Sabatini, M. E.; Valassi, A.; Carbonera, D.

    2013-01-01

    Background and Aims The germination test currently represents the most used method to assess seed viability in germplasm banks, despite the difficulties caused by the occurrence of seed dormancy. Furthermore, seed longevity can vary considerably across species and populations from different environments, and studies related to the eco-physiological processes underlying such variations are still limited in their depth. The aim of the present work was the identification of reliable molecular markers that might help in monitoring seed deterioration. Methods Dry seeds were subjected to artificial ageing and collected at different time points for molecular/biochemical analyses. DNA damage was measured using the RAPD (random amplified polymorphic DNA) approach while the seed antioxidant profile was obtained using both the DPPH (1,1-diphenyl, 2-picrylhydrazyl) assay and the Folin–Ciocalteu reagent method. Electron paramagnetic resonance (EPR) provided profiles of free radicals. Quantitative real-time polymerase chain reaction (QRT-PCR) was used to assess the expression profiles of the antioxidant genes MT2 (type 2 metallothionein) and SOD (superoxide dismutase). A modified QRT-PCR protocol was used to determine telomere length. Key Results The RAPD profiles highlighted different capacities of the two Silene species to overcome DNA damage induced by artificial ageing. The antioxidant profiles of dry and rehydrated seeds revealed that the high-altitude taxon Silene acaulis was characterized by a lower antioxidant specific activity. Significant upregulation of the MT2 and SOD genes was observed only in the rehydrated seeds of the low-altitude species. Rehydration resulted in telomere lengthening in both Silene species. Conclusions Different seed viability markers have been selected for plant species showing inherent variation of seed longevity. RAPD analysis, quantification of redox activity of non-enzymatic antioxidant compounds and gene expression profiling provide deeper insights to study seed viability during storage. Telomere lengthening is a promising tool to discriminate between short- and long-lived species. PMID:23532044

  13. High triglycerides and low high-density lipoprotein cholesterol lipid profile in rheumatoid arthritis: A potential link among inflammation, oxidative status, and dysfunctional high-density lipoprotein.

    PubMed

    Rodríguez-Carrio, Javier; Alperi-López, Mercedes; López, Patricia; López-Mejías, Raquel; Alonso-Castro, Sara; Abal, Francisco; Ballina-García, Francisco J; González-Gay, Miguel Á; Suárez, Ana

    The interactions between inflammation and lipid profile in rheumatoid arthritis (RA) are poorly understood. The lipid profile study in RA has been biased toward lipoprotein levels, whereas those of triglycerides (TGs) and lipoprotein functionality have been underestimated. Since recent findings suggest a role for TG and TG-rich lipoproteins (TRL) on inflammation, we aimed to evaluate a combined lipid profile characterized by high TG and low high-density lipoprotein cholesterol levels (TG high HDL low ) in RA. Lipid profiles were analyzed in 113 RA patients, 113 healthy controls, and 27 dyslipemic subjects. Levels of inflammatory mediators, paraoxonase-1 (PON1) activity, and total antioxidant capacity were quantified in serum. PON1-rs662 status was evaluated by real-time polymerase chain reaction. The TG high HDL low profile was detected in 29/113 RA patients. Although no differences in prevalence compared with healthy controls or dyslipemic subjects were observed, this profile was associated with increased tumor necrosis factor α (P = .004), monocyte chemotactic protein (P = .004), interferon-gamma-inducible protein-10 (P = .018), and leptin (P < .001) serum levels in RA, where decreased PON1 activity and total antioxidant capacity were found. TG high HDL low prevalence was lower among anti-TNFα-treated patients (P = .004). When RA patients were stratified by PON1-rs662 status, these associations remained in the low-activity genotype (QQ). Finally, a poor clinical response on TNFα blockade was related to an increasing prevalence of the TG high HDL low profile over treatment (P = .021) and higher TRL levels at baseline (P = .042). The TG high HDL low profile is associated with systemic inflammation, decreased PON1 activity, and poor clinical outcome on TNFα blockade in RA, suggesting a role of TRL and HDL dysfunction as the missing link between inflammation and lipid profile. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

  14. Gel Point Suppression in RAFT Polymerization of Pure Acrylic Cross-Linker Derived from Soybean Oil.

    PubMed

    Yan, Mengguo; Huang, Yuerui; Lu, Mingjia; Lin, Fang-Yi; Hernández, Nacú B; Cochran, Eric W

    2016-08-08

    Here we report the reversible addition-fragmentation chain transfer (RAFT) polymerization of acrylated epoxidized soybean oil (AESO), a cross-linker molecule, to high conversion (>50%) and molecular weight (>100 kDa) without macrogelation. Surprisingly, gelation is suppressed in this system far beyond the expectations predicated both on Flory-Stockmeyer theory and multiple other studies of RAFT polymerization featuring cross-linking moieties. By varying AESO and initiator concentrations, we show how intra- versus intermolecular cross-linking compete, yielding a trade-off between the degree of intramolecular linkages and conversion at gel point. We measured polymer chain characteristics, including molecular weight, chain dimensions, polydispersity, and intrinsic viscosity, using multidetector gel permeation chromatography and NMR to track polymerization kinetics. We show that not only the time and conversion at macrogelation, but also the chain architecture, is largely affected by these reaction conditions. At maximal AESO concentration, the gel point approaches that predicted by the Flory-Stockmeyer theory, and increases in an exponential fashion as the AESO concentration decreases. In the most dilute solutions, macrogelation cannot be detected throughout the entire reaction. Instead, cyclization/intramolecular cross-linking reactions dominate, leading to microgelation. This work is important, especially in that it demonstrates that thermoplastic rubbers could be produced based on multifunctional renewable feedstocks.

  15. Bismuth(III) trifluoromethanesulfonate catalyzed ring opening reaction of mono epoxy oleochemicals to form keto and diketo derivatives

    USDA-ARS?s Scientific Manuscript database

    Using a catalytic system, methyl oleate is transformed into long chain keto and diketo derivatives via an epoxide route. Methyl 9(10)-oxooctadecanoate and methyl 9,10-dioxooctadecanoate were made by a ring opening reaction of epoxidized methyl oleate using bismuth triflate catalyst. Lower reaction t...

  16. Direct RNA detection without nucleic acid purification and PCR: Combining sandwich hybridization with signal amplification based on branched hybridization chain reaction.

    PubMed

    Xu, Yao; Zheng, Zhi

    2016-05-15

    We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Computational study on UV curing characteristics in nanoimprint lithography: Stochastic simulation

    NASA Astrophysics Data System (ADS)

    Koyama, Masanori; Shirai, Masamitsu; Kawata, Hiroaki; Hirai, Yoshihiko; Yasuda, Masaaki

    2017-06-01

    A computational simulation model of UV curing in nanoimprint lithography based on a simplified stochastic approach is proposed. The activated unit reacts with a randomly selected monomer within a critical reaction radius. Cluster units are chained to each other. Then, another monomer is activated and the next chain reaction occurs. This process is repeated until a virgin monomer disappears within the reaction radius or until the activated monomers react with each other. The simulation model well describes the basic UV curing characteristics, such as the molecular weight distributions of the reacted monomers and the effect of the initiator concentration on the conversion ratio. The effects of film thickness on UV curing characteristics are also studied by the simulation.

  18. Massively parallel sequencing of forensic STRs and SNPs using the Illumina® ForenSeq™ DNA Signature Prep Kit on the MiSeq FGx™ Forensic Genomics System.

    PubMed

    Guo, Fei; Yu, Jiao; Zhang, Lu; Li, Jun

    2017-11-01

    The ForenSeq™ DNA Signature Prep Kit (ForenSeq Kit) is designed to detect more than 200 forensically relevant markers in a single reaction on the MiSeq FGx™ Forensic Genomics System (MiSeq FGx System), including Amelogenin, 27 autosomal short tandem repeats (A-STRs), 7 X chromosomal STRs (X-STRs), 24 Y chromosomal STRs (Y-STRs) and 94 identity-informative single nucleotide polymorphisms (iSNPs) with the option to contain 22 phenotypic-informative SNPs (pSNPs) and 56 ancestry-informative SNPs (aSNPs). In this study, we evaluated the MiSeq FGx System on three major parts: methodological optimization (DNA extraction, sample quantification, library normalization, diluted libraries concentration, and sample-to-cell arrangement), massively parallel sequencing (MPS) performance (depth of coverage, sequence coverage ratio, and allele coverage ratio), and ForenSeq Kit characteristics (repeatability and concordance, sensitivity, mixture, stability and case-type samples). Results showed that quantitative polymerase chain reaction (qPCR)-based sample quantification and library normalization and the appropriate number of pooled libraries and concentration of diluted libraries provided a greater level of MPS performance and repeatability. Repeatable and concordant genotypes were obtained by the ForenSeq Kit. Full profiles were obtained from ≥100pg input DNA for STRs and ≥200pg for SNPs. A sample with ≥5% minor contributors was considered as a mixture by imbalanced allele coverage ratio distribution, and full profiles from minor contributors were easily detected between 9:1 and 1:9 mixtures with known reference profiles. The ForenSeq Kit tolerated considerable concentrations of inhibitors like ≤200μM hematin and ≤50μg/ml humic acid, and >56% STR profiles and >88% SNP profiles were obtained from ≥200-bp degraded samples. Also, it was adapted to case-type samples. As a whole, the ForenSeq Kit is a well-performed, robust, reliable, reproducible and highly informative assay, and it can fully meet requirements for human identification. Further, sensitive QC indicator and automated sample comparison function in the ForenSeq™ Universal Analysis Software are quite helpful, so that we can concentrate on questionable genotypes and avoid tedious and time-consuming labor to maximum the time spent in data analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Forced unfolding of single-chain polymeric nanoparticles.

    PubMed

    Hosono, Nobuhiko; Kushner, Aaron M; Chung, Jaeyoon; Palmans, Anja R A; Guan, Zhibin; Meijer, E W

    2015-06-03

    Atomic force microscopy (AFM)-based single-molecule force spectroscopy (SMFS) is applied to single-chain polymeric nanoparticles (SCPNs) to acquire information about the internal folding structure of SCPNs and inherent kinetic parameters of supramolecular self-assembling motifs embedded into the SCPNs. The SCPNs used here are polyacrylate-based polymers carrying 2-ureido-4-[1H]-pyrimidinone (UPy) or benzene-1,3,5-tricarboxamide (BTA) pendants that induce an intramolecular chain collapse into nanoparticles consisting of one polymer chain only via internal supramolecular cross-linking. The SCPN is stretched by an AFM cantilever to unfold mechanically, which allows measuring of force-extension profiles of the SCPNs. Consecutive peaks observed in the force profiles are attributed to rupture events of self-assembled UPy/BTA units in the SCPNs. The force profiles have been analyzed statistically for a series of polymers with different UPy/BTA incorporation densities. The results provide insights into the internal conformation of SCPNs, where the folding structure can be changed with the incorporation density of UPy/BTA. In addition, dynamic loading rate analysis allows the determination of kinetic parameters of BTA self-assembly, which has not been accessible by any other method. This study offers a rational tool for understanding the folding structure, kinetics, and pathway of two series of SCPNs.

  20. Problem-Solving Test: Pyrosequencing

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2013-01-01

    Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…

  1. Hydrolysis of the amorphous cellulose in cotton-based paper.

    PubMed

    Stephens, Catherine H; Whitmore, Paul M; Morris, Hannah R; Bier, Mark E

    2008-04-01

    Hydrolysis of cellulose in Whatman no. 42 cotton-based paper was studied using gel permeation chromatography (GPC), electrospray ionization-mass spectrometry (ESI-MS), and uniaxial tensile testing to understand the course and kinetics of the reaction. GPC results suggested that scission reactions passed through three stages. Additionally, the evolution of soluble oligomers in the ESI-MS data and the steady course of strength loss showed that the hydrolysis reaction occurred at a constant rate. These findings are explained with a more detailed description of the cellulose hydrolysis, which includes multiple chain scissions on amorphous segments. The breaks occur with increasing frequency near the ends of amorphous segments, where chains protrude from crystalline domains. Oligomers unattached to crystalline domains are eventually created. Late-stage reactions near the ends of amorphous segments produce a kinetic behavior that falsely suggests that hydrolysis had ceased. Monte Carlo simulations of cellulose degradation corroborated the experimental findings.

  2. Dual phase multiplex polymerase chain reaction

    DOEpatents

    Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  3. [The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

    PubMed

    D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

    1993-01-01

    The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

  4. Esterification of fatty acids using nylon-immobilized lipase in n-hexane: kinetic parameters and chain-length effects.

    PubMed

    Zaidi, A; Gainer, J L; Carta, G; Mrani, A; Kadiri, T; Belarbi, Y; Mir, A

    2002-02-28

    The esterification of long-chain fatty acids in n-hexane catalyzed by nylon-immobilized lipase from Candida rugosa has been investigated. Butyl oleate (22 carbon atoms), oleyl butyrate (22 carbon atoms) and oleyl oleate (36 carbon atoms) were produced at maximum reaction rates of approximately equal to 60 mmol h(-1) g(-1) immobilized enzyme when the substrates were present in equimolar proportions at an initial concentration of 0.6 mol l(-1). The observed kinetic behavior of all the esterification reactions is found to follow a ping-pong bi-bi mechanism with competitive inhibition by both substrates. The effect of the chain-length of the fatty acids and the alcohols could be correlated to some mechanistic models, in accordance with the calculated kinetic parameters.

  5. Copolymer Synthesis and Characterization by Post-Polymerization Modification

    NASA Astrophysics Data System (ADS)

    Galvin, Casey James

    This PhD thesis examines the physical behavior of surface-grafted polymer assemblies (SGPAs) derived from post-polymerization modification (PPM) reactions in aqueous and vapor enriched environments, and offers an alternative method of creating SGPAs using a PPM approach. SGPAs comprise typically polymer chains grafted covalently to solid substrates. These assemblies show promise in a number of applications and technologies due to the stability imparted by the covalent graft and ability to modify interfacial properties and stability. SGPAs also offer a set of rich physics to explore in fundamental investigations as a result of confining macromolecules to a solid substrate. PPM reactions (also called polymer analogous reactions) apply small molecule organic chemistry reactions to the repeat units of polymer chains in order to generate new chemistries. By applying a PPM strategy to SGPAs, a wide variety of functional groups can be introduced into a small number of well-studied and well-behaved model polymer systems. This approach offers the advantage of holding constant other properties of the SGPA (e.g., molecular weight, MW, and grafting density, sigma) to isolate the effect of chemistry on physical behavior. Using a combination of PPM and fabrication methods that facilitate the formation of SPGAs with position-dependent gradual variation of sigma on flat impenetrable substrate, the influence of polymer chemistry and sigma is examined on the stability of weak polyelectrolyte brushes in aqueous environments at different pH levels. Degrafting of polymer chains in SGPAs exhibits a complex dependence on side chain chemistry, sigma, pH and the charge fraction (alpha) within the brush. Results of these experiments support a proposed mechanism of degrafting, wherein extension of the grafted chains away from the substrate generates tension along the polymer backbone, which activates the grafting chemistry for hydrolysis. The implications of these findings are important in developing technologies that use SGPAs in aqueous environments, and point to a need for potential alternative grafting chemistries. The behavior of SGPAs in vapor environments remains an underexplored phenomenon. By changing systematically the chemistry of SGPAs derived from a parent sample, the influence of side chain functional groups on the swelling of weak and strong polyelectrolyte brushes in the presence of water, methanol and ethanol vapors is explored. The extent of swelling and solvent uptake depends strongly on the chemistry in the polymer side chain and of the solvent. Despite bearing a permanent electrostatic charge in the side chain, the strong polyelectrolyte brushes exhibit no behavior typical of polyelectrolytes in water due to no dissociation of the counterion. Of particular interest is the behavior in humid environments of an SGPA bearing a zwitterionic group in its side chain, which results in exposure of electrostatic charges without counterions. Using substrates bearing the aforementioned sigma gradient of polymeric grafts, evidence of inter- and intramolecular complex formation is presented. Finally, a method of developing SGPAs by polymerizing bulk polymer chains through surface-grafted monomers (SGMs) is described. The SGMs are incorporated onto a solid substrate using the same PPM reaction employed in the degrafting and vapor swelling experiments, highlighting the versatility of PPM. The thickness of these SGPAs is correlated to the bulk polymer chains MW, suggesting this technique can be used in existing industrial bulk polymerization processes.

  6. Agaricus brasiliensis (sun mushroom) affects the expression of genes related to cholesterol homeostasis.

    PubMed

    de Miranda, Aline Mayrink; Rossoni Júnior, Joamyr Victor; Souza E Silva, Lorena; Dos Santos, Rinaldo Cardoso; Silva, Marcelo Eustáquio; Pedrosa, Maria Lúcia

    2017-06-01

    The sun mushroom (Agaricus brasiliensis) is considered a major source of bioactive compounds with potential health benefits. Mushrooms typically act as lipid-lowering agents; however, little is known about the mechanisms of action of A. brasiliensis in biological systems. This study aimed to determine the underlying mechanism involved in the cholesterol-lowering effect of A. brasiliensis through the assessment of fecal and serum lipid profiles in addition to gene expression analysis of specific transcription factors, enzymes, and transporters involved in cholesterol homeostasis. Twenty-four albino Fischer rats approximately 90 days old, with an average weight of 205 g, were divided into four groups of 6 each and fed a standard AIN-93 M diet (C), hypercholesterolemic diet (H), hypercholesterolemic diet +1 % A. brasiliensis (HAb), or hypercholesterolemic diet +0.008 % simvastatin (HS) for 6 weeks. Simvastatin was used as a positive control, as it is a typical drug prescribed for lipid disorders. Subsequently, blood, liver, and feces samples were collected for lipid profile and quantitative real-time polymerase chain reaction gene expression analyses. Diet supplementation with A. brasiliensis significantly improved serum lipid profiles, comparable to the effect observed for simvastatin. In addition, A. brasiliensis dietary supplementation markedly promoted fecal cholesterol excretion. Increased expression of 7α-hydroxylase (CYP7A1), ATP-binding cassette subfamily G-transporters (ABCG5/G8), and low-density lipoprotein receptor (LDLR) was observed following A. brasiliensis administration. Our results suggest that consumption of A. brasiliensis improves the serum lipid profile in hypercholesterolemic rats by modulating the expression of key genes involved in hepatic cholesterol metabolism.

  7. Identification of the Neuromuscular Junction Transcriptome of Extraocular Muscle by Laser Capture Microdissection

    PubMed Central

    Ketterer, Caroline; Zeiger, Ulrike; Budak, Murat T.; Rubinstein, Neal A.; Khurana, Tejvir S.

    2010-01-01

    Purpose. To examine and characterize the profile of genes expressed at the synapses or neuromuscular junctions (NMJs) of extraocular muscles (EOMs) compared with those expressed at the tibialis anterior (TA). Methods. Adult rat eyeballs with rectus EOMs attached and TAs were dissected, snap frozen, serially sectioned, and stained for acetylcholinesterase (AChE) to identify the NMJs. Approximately 6000 NMJs for rectus EOM (EOMsyn), 6000 NMJs for TA (TAsyn), equal amounts of NMJ-free fiber regions (EOMfib, TAfib), and underlying myonuclei and RNAs were captured by laser capture microdissection (LCM). RNA was processed for microarray-based expression profiling. Expression profiles and interaction lists were generated for genes differentially expressed at synaptic and nonsynaptic regions of EOM (EOMsyn versus EOMfib) and TA (TAsyn versus TAfib). Profiles were validated by using real-time quantitative polymerase chain reaction (qPCR). Results. The regional transcriptomes associated with NMJs of EOMs and TAs were identified. Two hundred seventy-five genes were preferentially expressed in EOMsyn (compared with EOMfib), 230 in TAsyn (compared with TAfib), and 288 additional transcripts expressed in both synapses. Identified genes included novel genes as well as well-known, evolutionarily conserved synaptic markers (e.g., nicotinic acetylcholine receptor (AChR) alpha (Chrna) and epsilon (Chrne) subunits and nestin (Nes). Conclusions. Transcriptome level differences exist between EOM synaptic regions and TA synaptic regions. The definition of the synaptic transcriptome provides insight into the mechanism of formation and functioning of the unique synapses of EOM and their differential involvement in diseases noted in the EOM allotype. PMID:20393109

  8. A Molecular Budget for a Peatland Based Upon 13C Solid-State Nuclear Magnetic Resonance

    NASA Astrophysics Data System (ADS)

    Moody, Catherine S.; Worrall, Fred; Clay, Gareth D.; Burt, Tim P.; Apperley, David C.; Rose, Rob

    2018-02-01

    Peatlands can accumulate organic matter into long-term carbon (C) storage within the soil profile. This study used solid-state 13C nuclear magnetic resonance (13C-NMR) to investigate the transit of organic C through a peatland ecosystem to understand the molecular budget that accompanies the long-term accumulation of C. Samples of biomass, litter, peat soil profile, particulate organic matter, and dissolved organic matter (DOM) were taken from the Moor House National Nature Reserve, a peat-covered catchment in northern England where both the dry matter and C budget for the ecosystem were known. The results showed that: The interpretation of the 13C-NMR spectra shows that polysaccharides are preferentially removed through the ecosystem, while lignin components are preferentially retained and come to dominate the organic matter accumulated at depth in the profile. The DOM is derived from the oxidation of both biomass and the degradation of lignin, while the particulate organic matter is derived from erosion of the peat profile. The DOM is differentiated by its proportion of oxidized functional groups and not by its aromatic content. The changes in functionality leading to DOM production suggest side chain oxidation resulting in C-C cleavage/depolymerisation of lignin, a common reaction within white rot fungi. The 13C-NMR budget shows that O-alkyl functional groups are disproportionately lost between primary production and accumulation in the deep peat, while C-alkyl functional groups are disproportionately preserved. The carbon lost as gases (CO2 and CH4) was estimated to be composed of 93% polysaccharide-derived carbon and 7% lignin-derived carbon.

  9. Adult and cord blood endothelial progenitor cells have different gene expression profiles and immunogenic potential.

    PubMed

    Nuzzolo, Eugenia R; Capodimonti, Sara; Martini, Maurizio; Iachininoto, Maria G; Bianchi, Maria; Cocomazzi, Alessandra; Zini, Gina; Leone, Giuseppe; Larocca, Luigi M; Teofili, Luciana

    2014-01-01

    Endothelial colony-forming cells (ECFC) are endowed with vascular regenerative ability in vivo and in vitro. In this study we compared the genotypic profile and the immunogenic potential of adult and cord blood ECFC, in order to explore the feasibility of using them as a cell therapy product. ECFC were obtained from cord blood samples not suitable for haematopoietic stem cell transplantation and from adult healthy blood donors after informed consent. Genotypes were analysed by commercially available microarray assays and results were confirmed by real-time polymerase chain reaction analysis. HLA antigen expression was evaluated by flow-cytometry. Immunogenic capacity was investigated by evaluating the activation of allogeneic lymphocytes and monocytes in co-cultures with ECFC. Microarray assays revealed that the genetic profile of cord blood and adult ECFC differed in about 20% of examined genes. We found that cord blood ECFC were characterised by lower pro-inflammatory and pro-thrombotic gene expression as compared to adult ECFC. Furthermore, whereas cord blood and adult ECFCs expressed similar amount of HLA molecules both at baseline and after incubation with γ-interferon, cord blood ECFC elicited a weaker expression of pro-inflammatory cytokine genes. Finally, we observed no differences in the amount of HLA antigens expressed among cord blood ECFC, adult ECFC and mesenchymal cells. Our observations suggest that cord blood ECFC have a lower pro-inflammatory and pro-thrombotic profile than adult ECFC. These preliminary data offer level-headed evidence to use cord blood ECFC as a cell therapy product in vascular diseases.

  10. Infrequent and low expression of cancer-testis antigens located on the X chromosome in colorectal cancer: implications for immunotherapy in South African populations.

    PubMed

    Dakshinamurthy, Amirtha Ganesh; Ramesar, Rajkumar; Goldberg, Paul; Blackburn, Jonathan M

    2008-11-01

    Cancer-testis (CT) antigens are a group of tumor antigens that are expressed in the testis and aberrantly in cancerous tissue but not in somatic tissues. The testis is an immune-privileged site because of the presence of a blood-testis barrier; as a result, CT antigens are considered to be essentially tumor specific and are attractive targets for immunotherapy. CT antigens are classified as the CT-X and the non-X CT antigens depending on the chromosomal location to which the genes are mapped. CT-X antigens are typically highly immunogenic and hence the first step towards tailored immunotherapy is to elucidate the expression profile of CT-X antigens in the respective tumors. In this study we investigated the expression profile of 16 CT-X antigen genes in 34 colorectal cancer (CRC) patients using reverse transcription-polymerase chain reaction. We observed that 12 of the 16 CT-X antigen genes studied did not show expression in any of the CRC samples analyzed. The other 4 CT-X antigen genes showed low frequency of expression and exhibited a highly variable expression profile when compared to other populations. Thus, our study forms the first report on the expression profile of CT-X antigen genes among CRC patients in the genetically diverse South African population. The results of our study suggest that genetic and ethnic variations in population might have a role in the expression of the CT-X antigen genes. Thus our results have significant implications for anti-CT antigen-based immunotherapy trials in this population.

  11. Oxidative capacity of the Mexico City atmosphere - Part 1: A radical source perspective

    NASA Astrophysics Data System (ADS)

    Volkamer, R.; Sheehy, P.; Molina, L. T.; Molina, M. J.

    2010-07-01

    A detailed analysis of OH, HO2 and RO2 radical sources is presented for the near field photochemical regime inside the Mexico City Metropolitan Area (MCMA). During spring of 2003 (MCMA-2003 field campaign) an extensive set of measurements was collected to quantify time-resolved ROx (sum of OH, HO2, RO2) radical production rates from day- and nighttime radical sources. The Master Chemical Mechanism (MCMv3.1) was constrained by measurements of (1) concentration time-profiles of photosensitive radical precursors, i.e., nitrous acid (HONO), formaldehyde (HCHO), ozone (O3), glyoxal (CHOCHO), and other oxygenated volatile organic compounds (OVOCs); (2) respective photolysis-frequencies (J-values); (3) concentration time-profiles of alkanes, alkenes, and aromatic VOCs (103 compound are treated) and oxidants, i.e., OH- and NO3 radicals, O3; and (4) NO, NO2, meteorological and other parameters. The ROx production rate was calculated directly from these observations; the MCM was used to estimate further ROx production from unconstrained sources, and express overall ROx production as OH-equivalents (i.e., taking into account the propagation efficiencies of RO2 and HO2 radicals into OH radicals). Daytime radical production is found to be about 10-25 times higher than at night; it does not track the abundance of sunlight. 12-h average daytime contributions of individual sources are: Oxygenated VOC other than HCHO about 33%; HCHO and O3 photolysis each about 20%; O3/alkene reactions and HONO photolysis each about 12%, other sources <3%. Nitryl chloride photolysis could potentially contribute ~15% additional radicals, while NO2* + water makes - if any - a very small contribution (~2%). The peak radical production of ~7.5 107 molec cm-3 s-1 is found already at 10:00 a.m., i.e., more than 2.5 h before solar noon. O3/alkene reactions are indirectly responsible for ~33% of these radicals. Our measurements and analysis comprise a database that enables testing of the representation of radical sources and radical chain reactions in photochemical models. Since the photochemical processing of pollutants in the MCMA is radical limited, our analysis identifies the drivers for ozone and SOA formation. We conclude that reductions in VOC emissions provide an efficient opportunity to reduce peak concentrations of these secondary pollutants, because (1) about 70% of radical production is linked to VOC precursors; (2) lowering the VOC/NOx ratio has the further benefit of reducing the radical re-cycling efficiency from radical chain reactions (chemical amplification of radical sources); (3) a positive feedback is identified: lowering the rate of radical production from organic precursors also reduces that from inorganic precursors, like ozone, as pollution export from the MCMA caps the amount of ozone that accumulates at a lower rate inside the MCMA. Continued VOC reductions will in the future result in decreasing peak concentrations of ozone and SOA in the MCMA.

  12. Bowman-Birk inhibitor-like protein is secreted by sprouted pea seeds in response to induced colonization by enteropathogenic Escherichia coli.

    PubMed

    Anuradha, Ravi; Raveendran, Muthuraj; Babu, Subramanian

    2013-11-01

    The interaction between the clinical isolate of enteropathogenic Escherichia coli (EPEC) SBANU8 and pea sprouts was compared with avirulent K 12. E. coli. This was carried out by repeated co-incubation with pea sprouts for 5 days, and the protein profile of the culture supernatant was analyzed by single and two-dimensional electrophoresis. Mass spectrometry analysis led to the identification of two serine protease inhibitors including a Bowman-Birk-type protein secreted by pea sprouts in response to clinical isolate. Expression of the E. coli intimin gene involved in animal host colonization and virulence was studied by reverse transcription polymerase chain reaction. Expression of this gene was high in SBANU8 when co-incubated with pea sprouts. The present study gives baseline data on the molecular level interactions of EPEC and pea sprouts, which are needed to design the outbreak control strategies.

  13. Analysis of microbial diversity in Shenqu with different fermentation times by PCR-DGGE.

    PubMed

    Liu, Tengfei; Jia, Tianzhu; Chen, Jiangning; Liu, Xiaoyu; Zhao, Minjie; Liu, Pengpeng

    Shenqu is a fermented product that is widely used in traditional Chinese medicine (TCM) to treat indigestion; however, the microbial strains in the fermentation process are still unknown. The aim of this study was to investigate microbial diversity in Shenqu using different fermentation time periods. DGGE (polymerase chain reaction-denaturing gradient gel electrophoresis) profiles indicated that a strain of Pediococcus acidilactici (band 9) is the predominant bacteria during fermentation and that the predominant fungi were uncultured Rhizopus, Aspergillus oryzae, and Rhizopus oryzae. In addition, pathogenic bacteria, such as Enterobacter cloacae, Klebsiella oxytoca, Erwinia billingiae, and Pantoea vagan were detected in Shenqu. DGGE analysis showed that bacterial and fungal diversity declined over the course of fermentation. This determination of the predominant bacterial and fungal strains responsible for fermentation may contribute to further Shenqu research, such as optimization of the fermentation process. Copyright © 2017. Published by Elsevier Editora Ltda.

  14. Tunneling in green tea: understanding the antioxidant activity of catechol-containing compounds. A variational transition-state theory study.

    PubMed

    Tejero, Ismael; Gonzalez-García, Núria; Gonzalez-Lafont, Angels; Lluch, José M

    2007-05-09

    The catechol functionality present in the catechins is responsible for the protective effects exerted by green tea against a wide range of human diseases. High-level electronic structure calculations and canonical variational transition-state theory including multidimensional tunneling corrections have allowed us to understand the key factors of the antioxidant effectiveness of the catechol group. This catechol group forms two hydrogen bonds with the two oxygen atoms of the lipid peroxyl radical, leading to a very compact reactant complex. This fact produces an extremely narrow adiabatic potential-energy profile corresponding to the hydrogen abstraction by the peroxyl radical, which makes it possible for a huge tunneling contribution to take place. So, quantum-mechanical tunneling highly increases the corresponding rate constant value, in such a way that catechins become able to trap the lipid peroxyl radicals in a dominant competition with the very damaging free-radical chain-lipid peroxidation reaction.

  15. An e.s.c.a. study of atomic oxygen interactions with phosphazene-coated polyimide films

    NASA Technical Reports Server (NTRS)

    Fewell, Larry L.; Finney, Lorie

    1991-01-01

    Metallic as well as most nonmetallic materials experience oxidation and mass loss via surface erosion in low earth orbit as shown in previous Space Shuttle flights. This study is an evaluation of select polyphosphazene polymers and their resistance to atomic oxygen attack. Electron spectroscopy for chemical analysis examinations of the surfaces of polyphosphazene coatings were monitored for microstructural changes induced during exposures to atomic oxygen. Sample exposures in oxygen plasmas and O(3P) beam were compared as to their effect on surface compositional changes in the polyphosphazene coating. High resolution line scans revealed rearrangements in the polymer backbone and scissioning reactions involving fluorocarbon units of long chain fluoroalkoxy pendant groups. Atom percents and peak areas of all species provided a detailed profile of the microstructural changes induced in phosphazene polymers as a result of exposures to atomic oxygen.

  16. A more accurate detection of codon 72 polymorphism and LOH of the TP53 gene.

    PubMed

    Baccouche, Sami; Mabrouk, Imed; Said, Salem; Mosbah, Ali; Jlidi, Rachid; Gargouri, Ali

    2003-01-10

    The polymorphism at codon 72 of the TP53 gene has been extensively studied for its involvement in cancerogenesis and loss of heterozygosity (LOH) detection. Usually, the exon 4 of the TP53 gene is amplified by polymerase chain reaction (PCR) on DNA extracted from blood and tumor tissues, then digested by AccII. In the case of heterozygosity, the comparison of AccII profile from blood and tumor DNA PCR products allowed the identification of a potential LOH in the TP53 locus. This method can be hindered by a partial AccII digestion and/or DNA contamination of non-tumor cells. To circumvent these problems, we have developed a new approach by using the AccII restriction site between exon 4 and exon 6. The PCR amplification of exon 4-6, followed by AccII digestion allowed us to detect without ambiguity any LOH case.

  17. Transcript Quantification of Genes Involved in Steviol Glycoside Biosynthesis in Stevia rebaudiana Bertoni by Real-Time Polymerase Chain Reaction (RT-PCR).

    PubMed

    Modi, Arpan; Kumar, Nitish; Narayanan, Subhash

    2016-01-01

    Stevia (Stevia rebaudiana Bertoni) is a medicinal plant having sweet, diterpenoid glycosides known as steviol glycosides which are 200-300 times sweeter than sucrose (0.4 % solution). They are synthesized mainly in the leaves via plastid localized 2-C-methyl-D-erythrose-4-phosphate pathway (MEP pathway). Fifteen genes are involved in the formation of these glycosides. In the present protocol, a method for the quantification of transcripts of these genes is shown. The work involves RNA extraction and cDNA preparation, and therefore, procedures for the confirmation of DNA-free cDNA preparation have also been illustrated. Moreover, details of plant treatments are not mentioned as this protocol may apply to relative gene expression profile in any medicinal plant with any treatment. The treatments are numbered as T0 (Control), T1, T2, T3, and T4.

  18. Molecular tools for investigating microbial community structure and function in oxygen-deficient marine waters.

    PubMed

    Hawley, Alyse K; Kheirandish, Sam; Mueller, Andreas; Leung, Hilary T C; Norbeck, Angela D; Brewer, Heather M; Pasa-Tolic, Ljiljana; Hallam, Steven J

    2013-01-01

    Water column oxygen (O2)-deficiency shapes food-web structure by progressively directing nutrients and energy away from higher trophic levels into microbial community metabolism resulting in fixed nitrogen loss and greenhouse gas production. Although respiratory O2 consumption during organic matter degradation is a natural outcome of a productive surface ocean, global-warming-induced stratification intensifies this process leading to oxygen minimum zone (OMZ) expansion. Here, we describe useful tools for detection and quantification of potential key microbial players and processes in OMZ community metabolism including quantitative polymerase chain reaction primers targeting Marine Group I Thaumarchaeota, SUP05, Arctic96BD-19, and SAR324 small-subunit ribosomal RNA genes and protein extraction methods from OMZ waters compatible with high-resolution mass spectrometry for profiling microbial community structure and functional dynamics. © 2013 Elsevier Inc. All rights reserved.

  19. Transcriptome sequencing and annotation of the halophytic microalga Dunaliella salina * #

    PubMed Central

    Hong, Ling; Liu, Jun-li; Midoun, Samira Z.; Miller, Philip C.

    2017-01-01

    The unicellular green alga Dunaliella salina is well adapted to salt stress and contains compounds (including β-carotene and vitamins) with potential commercial value. A large transcriptome database of D. salina during the adjustment, exponential and stationary growth phases was generated using a high throughput sequencing platform. We characterized the metabolic processes in D. salina with a focus on valuable metabolites, with the aim of manipulating D. salina to achieve greater economic value in large-scale production through a bioengineering strategy. Gene expression profiles under salt stress verified using quantitative polymerase chain reaction (qPCR) implied that salt can regulate the expression of key genes. This study generated a substantial fraction of D. salina transcriptional sequences for the entire growth cycle, providing a basis for the discovery of novel genes. This first full-scale transcriptome study of D. salina establishes a foundation for further comparative genomic studies. PMID:28990374

  20. Hot Topics in Perioperative Antibiotics for Cataract Surgery.

    PubMed

    Kuklo, Patrycja; Grzybowski, Andrzej; Schwartz, Stephen G; Flynn, Harry W; Pathengay, Avinash

    2017-01-01

    Acute-onset postoperative endophthalmitis is an uncommon but potentially serious complication of cataract surgery. Since there are relatively few randomized clinical trials comparing the timing and administration of prophylactic antibiotics, there are wide variations in prevention practices around the world. Literature review. Antibiotics may be used before surgery, during surgery, or after surgery in an attempt to decrease the rates of endophthalmitis. Antibiotics may be delivered by various routes, including topical, subconjunctival, in the irrigating solution, or by bolus intracameral injection. Polymerase chain reaction and other DNA identification techniques for bacterial isolates and their antibiotic sensitivity profiles will play an important role in future management strategies. There is no consensus regarding the precise use of antibiotics in the perioperative period. Because of increased multidrug-resistant bacteria, evolving strategies are needed to address these issues. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  1. Isolation of lymphocystis disease virus from sole, Solea senegalensis Kaup, and blackspot sea bream, Pagellus bogaraveo (Brunnich).

    PubMed

    Alonso, M C; Cano, I; Garcia-Rosado, E; Castro, D; Lamas, J; Barja, J L; Borrego, J J; Bergmann, S M

    2005-04-01

    Two viruses were isolated from cultured sole, Solea senegalensis, and wild blackspot sea bream, Pagellus bogaraveo, and preliminarily characterized as lymphocystis disease viruses (LCDVs). Viral isolates were characterized by morphological, biochemical and biophysical properties. In addition, the susceptibility of four fish cell lines was also tested. LCDV isolates developed cytopathic effects on the SAF-1 cell line at 5 and 6 days post-infection and reached titres of 10(6) TCID50 mL(-1). The antigenic and structural protein analysis of the two new LCDV isolates showed identical profiles to that obtained for LCDV strain Leetown NFH (ATCC VR-342), used as a reference viral strain, and for an LCDV isolate collected from gilt-head sea bream, Sparus aurata, cultured in southern Spain. Molecular confirmation was performed by polymerase chain reaction. Specific primers for LCDV produced a 270-bp DNA fragment, the expected size for LCDV.

  2. Chronic smoking and alcoholism change expression of selective genes in the human prefrontal cortex.

    PubMed

    Flatscher-Bader, Traute; Wilce, Peter A

    2006-05-01

    Alcoholism is commonly associated with chronic smoking. A number of gene expression profiles of regions within the human mesocorticolimbic system have identified potential alcohol-sensitive genes; however, the influence of smoking on these changes was not taken into account. This study addressed the impact of alcohol and smoking on the expression of 4 genes, previously identified as alcoholism-sensitive, in the human prefrontal cortex (PFC). mRNA expression of apolipoprotein D, tissue inhibitor of the metalloproteinase 3, high-affinity glial glutamate transporter and midkine, was measured in the PFC of alcoholic subjects and controls with and without smoking comorbidity using real-time polymerase chain reaction. The results show that alcohol affects transcription of some of these genes. Additionally, smoking has a marked influence on gene expression. This study emphasizes the need for careful case selection in future gene expression studies to delineate the adaptive molecular process associated with smoking and alcohol.

  3. Temperature-Dependent Kinetic Prediction for Reactions Described by Isothermal Mathematics

    DOE PAGES

    Dinh, L. N.; Sun, T. C.; McLean, W.

    2016-09-12

    Most kinetic models are expressed in isothermal mathematics. In addition, this may lead unaware scientists either to the misconception that classical isothermal kinetic models cannot be used for any chemical process in an environment with a time-dependent temperature profile or, even worse, to a misuse of them. In reality, classical isothermal models can be employed to make kinetic predictions for reactions in environments with time-dependent temperature profiles, provided that there is a continuity/conservation in the reaction extent at every temperature–time step. In this article, fundamental analyses, illustrations, guiding tables, and examples are given to help the interested readers using eithermore » conventional isothermal reacted fraction curves or rate equations to make proper kinetic predictions for chemical reactions in environments with temperature profiles that vary, even arbitrarily, with time simply by the requirement of continuity/conservation of reaction extent whenever there is an external temperature change.« less

  4. Apparatus and method for polymer synthesis using arrays

    DOEpatents

    Brennan, Thomas M.

    1995-01-01

    A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24) , and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31) , downstream from the nozzles (22) , sweeps the common chamber ( 31 ) of toxic fumes emitted by the reagents. Each reaction well (26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.

  5. Apparatus and method for polymer synthesis using arrays

    DOEpatents

    Brennan, Thomas M.

    1996-01-01

    A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24), and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31), downstream from the nozzles (22), sweeps the common chamber (31) of toxic fumes emitted by the reagents. Each reaction well ( 26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82 ) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.

  6. New polymer systems: Chain extension by dianhydrides

    NASA Technical Reports Server (NTRS)

    Rhein, R. A.; Ingham, J. D.

    1974-01-01

    Three anhydrides provide effective chain extension of hydroxy-terminated polyalkylene oxides and polybutadienes. Novel feature of these anhydride reactants is that they are difunctional as anhydrides, but they are tetrafunctional if conditions are selected that lead to total esterification or reaction of all carboxyl groups.

  7. Structure-property relationships in a series of diglycerol tetraether model lipids and their lyotropic assemblies: the effect of branching topology and chirality.

    PubMed

    Markowski, Thomas; Drescher, Simon; Meister, Annette; Blume, Alfred; Dobner, Bodo

    2014-06-14

    Three novel diglycerol tetraether lipids with one membrane-spanning chain have been synthesized. These lipids contain only two or four racemic methyl branches at selected positions of the hydrophobic chains in contrast to natural lipids from archaebacterial membranes with an isoprenoid substitution pattern. The insertion of the methyl moieties was realized starting from either (RS)-citronellyl bromide or the inexpensive methyl malonic acid ethyl ester. For chain elongation the Cu-catalysed Grignard coupling reaction was used. The preparation of diglycerol tetraethers was either performed by condensing suitable blocked monoglycerol diethers by Grubbs metathesis or by reaction of the transmembrane C32-chain with blocked glycerols followed by further alkylation steps. Finally, we could show that the resulting lipids can form closed lipid vesicles comparable to the optically pure counterparts. Therefore, these much simpler lipids compared to the natural lipids from archaebacterial membranes are also suitable for preparation of stable tailored liposomes.

  8. RICIN-inhibitor design. Final report, 15 April 1993-14 April 1996

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schramm, V.L.

    1996-05-01

    The purpose of this proposal was to provide information which will permit the design of transition state inhibitors for ricin A-chain. The original goals were to solve the transition state structure based on kinetic isotope effects. Substrates were synthesized and the conditions for assays optimized to provide catalytic rates at least 1000 fold greater than those published prior to this work. Reliable assay methods have been established to permit routine assays for ricin A-chain. Substrate analogues for N-ribohydrolase reactions have been designed to establish whether the reaction involves leaving-group activation or oxycarbonium ion formation. Based on these results, leaving groupmore » activation is a major contributor and oxycarbonium-ion formation is a secondary contribution in the mechanism of catalysis by ricin A-chain. Using this information, the first submicromolar inhibitor of ricin A-chain has been synthesized, tested and kinetically characterized. The development of powerful inhibitors will be a direct extrapolation of these results.« less

  9. ε-Poly-L-lysine peptide chain length regulated by the linkers connecting the transmembrane domains of ε-Poly-L-lysine synthetase.

    PubMed

    Hamano, Yoshimitsu; Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime

    2014-08-01

    ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  10. Polyphosphate kinase: demonstration that short chain polyphosphate serves as a primer for the enzymatic synthesis of polyphosphate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Robinson, N.A.; Wood, H.G.

    1986-05-01

    Polyphosphate (poly(P)) kinase, isolated from Propionibacterium shermanii, catalyzes the following reaction: poly(P/sub n/) + ATPin equilibriumpoly(P/sub n+1/) + ADP. The authors have purified this enzyme to 90% homogeneity and have shown it to be composed of 2-3 identical subunits of M/sub r/ 80,000. Investigation of the reaction mechanism by product analysis has revealed that the elongation phase is processive whereby successive elongation occurs without release of intermediate sizes until very long chains are formed. The initiation phase of synthesis has been investigated using (/sup 32/P) poly(P) primer of chain length 11-60. It is incorporated into long chain poly(P) and themore » /sup 32/P has been shown, by use of poly(P) glucokinase, to be localized at the end of the molecule. Calculation of average chain length based upon the incorporation of /sup 32/P, however, yields a value approx.3 fold higher than the value calculated by another method using poly(P) glucokinase. This result indicates that initiation of poly(P) synthesis occurs by at least one other route which does not involve short chain poly(P) primers. The effect of temperature and concentration of poly(P) primer upon the average chain length of poly(P) synthesized was also investigated. A general trend was observed in which the chain length of the synthesized poly(P) decreased as either temperature or concentration or primer was increased.« less

  11. Alkyl(C16, C18, C22)trimethylammonium-Based Herbicidal Ionic Liquids.

    PubMed

    Pernak, Juliusz; Giszter, Rafał; Biedziak, Agnieszka; Niemczak, Michał; Olszewski, Radosław; Marcinkowska, Katarzyna; Praczyk, Tadeusz

    2017-01-18

    In the framework of this study a synthesis methodology and characterization of long alkyl herbicidal ionic liquids (HILs) based on four commonly used herbicides (2,4-D, MCPA, MCPP, and dicamba) are presented. New HILs were obtained with high efficiency (>95%) using an acid-base reaction between herbicidal acids and hexadecyltrimethylammonium, octadecyltrimethylammonium, and behenyltrimethylammonium hydroxides in alcoholic medium. Among all synthesized salts, only three compounds comprising the MCPP anion were liquids at room temperature. Subsequently, the influence of both the alkyl chain length and the anion structure on their physicochemical properties (thermal decomposition profiles, solubility in 10 representative solvents, surface activity, density, viscosity, and refractive index) was determined. All HILs exhibited high thermal stability as well as surface activity; however, their solubility notably depended on both the length of the carbon chain and the structure of the anion. The herbicidal efficacy of the obtained salts was tested in greenhouse and field experiments. Greenhouse testing performed on common lambsquarters (Chenopodium album L.) and flixweed (Descurainia sophia L.) as test plants indicated that HILs were characterized by similar or higher efficacy compared to commercial herbicides. The results of field trials confirmed the high activity of HILs, particularly those containing phenoxyacids as anions (MCPA, 2,4-D, and MCPP).

  12. Comparative analysis of the bioenergetics of adult cardiomyocytes and nonbeating HL-1 cells: respiratory chain activities, glycolytic enzyme profiles, and metabolic fluxes.

    PubMed

    Monge, Claire; Beraud, Nathalie; Tepp, Kersti; Pelloux, Sophie; Chahboun, Siham; Kaambre, Tuuli; Kadaja, Lumme; Roosimaa, Mart; Piirsoo, Andres; Tourneur, Yves; Kuznetsov, Andrey V; Saks, Valdur; Seppet, Enn

    2009-04-01

    Comparative analysis of the bioenergetic parameters of adult rat cardiomyocytes (CM) and HL-1 cells with very different structure but similar cardiac phenotype was carried out with the aim of revealing the importance of the cell structure for regulation of its energy fluxes. Confocal microscopic analysis showed very different mitochondrial arrangement in these cells. The cytochrome content per milligram of cell protein was decreased in HL-1 cells by a factor of 7 compared with CM. In parallel, the respiratory chain complex activities were decreased by 4-8 times in the HL-1 cells. On the contrary, the activities of glycolytic enzymes, hexokinase (HK), and pyruvate kinase (PK) were increased in HL-1 cells, and these cells effectively transformed glucose into lactate. At the same time, the creatine kinase (CK) activity was significantly decreased in HL-1 cells. In conclusion, the results of this study comply with the assumption that in contrast to CM in which oxidative phosphorylation is a predominant provider of ATP and the CK system is a main carrier of energy from mitochondria to ATPases, in HL-1 cells the energy metabolism is based mostly on the glycolytic reactions coupled to oxidative phosphorylation through HK.

  13. [THE COMPARATIVE ANALYSIS OF EFFECTIVENESS OF QUICK TESTS IN DIAGNOSTIC OF INFLUENZA AND RESPIRATORY SYNCYTIAL VIRAL INFECTION IN CHILDREN].

    PubMed

    Petrova, E R; Sukhovetskaia, V P; Pisareva, M M; Maiorova, V G; Sverlova, M V; Danilenko, D M; Petrova, P A; Krivitskaia, V Z; Sominina, A A

    2015-11-01

    The analysis was implemented concerning diagnostic parameters of commercial quick tests (immune chromatographic tests BinaxNOW Influenza A&B and BinaxNow RSV Alere, Scarborough Inc., USA) under detection of antigens of influenza virus A and respiratory syncytial virus in clinical materials. The polymerase chain reaction in real-time and isolation ofviruses in cell cultures. The analysis of naso-pharyngeal smears from 116 children demonstrated that sensitivity and specifcity of detection of influenza virus A using device mariPOC in comparison with polymerase chain reaction made up to 93.8% and 99.0% correspondingly at total concordance of results of both techniques as 98.3%. At diagnosing of respiratory syncytial virus using device mariPOC parameters made up to 77.3%, 98.9% and 862% as compared with polymerase chain reaction. The sensitivity, specificity and total concordance of results of immune chromatographic tests BinaxNOW in comparison ofpolymerase chain reaction made up to 86.7%, 100% and 96.2% correspondingly at detection of influenza virus A and 80.9%, 97.4% and 91.6% correspondingly at detection of respiratory syncytial virus. In comparison with isolation technique in cell cultures sensitivity of system mariPOC and immune chromatographic tests proved to be in 1.3-1.4 times higher at detection of influenza virus A and in 1.7-2 times higher in case of isolation of respiratory syncytial virus. There is no statistically significant differences between diagnostic parameters received for mariPOC and immune chromatographic tests at diagnosing influenza virus A and respiratory syncytial viral infection.

  14. Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

    PubMed Central

    Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

    2010-01-01

    Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

  15. A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

    PubMed

    Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

    2008-09-01

    Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

  16. Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

    PubMed

    Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

    2015-07-01

    Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Psychiatric reactions to continuous traumatic stress: A Latent Profile Analysis of two Israeli samples.

    PubMed

    Itzhaky, Liat; Gelkopf, Mark; Levin, Yafit; Stein, Jacob Y; Solomon, Zahava

    2017-10-01

    Many individuals worldwide are exposed to continuous traumatic stress (CTS). However, the psychiatric sequela of CTS and the relevance of posttraumatic stress disorder (PTSD) diagnostic criteria in this situation have yet to be determined. Filling this gap, the present study assessed psychiatric reactions to CTS and the relationship between such reactions and functional impairment among two representative samples of adults exposed to ongoing shelling over 6 (n=387) and 9 years (n=468). Assessment included PTSD symptomatology (i.e., intrusion, avoidance, hyperarousal), anxiety, somatization, and depression. Profile categorization aimed to underscore variations in symptom clustering and severity, and determine whether or not a profile is dominated by PTSD symptoms. Latent Profile analyses (LPA) of sample I revealed four distinct symptoms profiles: (1) 'symptomatically resilient'; (2) 'symptomatically low-moderate'; (3) 'symptomatically moderate-high'; and (4) 'symptomatically overall high'. LPA of sample II revealed three distinct symptoms profiles: (1) 'symptomatically resilient'; (2) 'symptomatically low-moderate'; (3) "symptomatically moderate-high". Moreover, profile variation was implicated in dysfunction. Consistent with studies focusing on single trauma exposure, the findings revealed that the most prevalent profile was the symptomatically resilient, indicating that most people exposed to CTS seem to evince a scarce number of psychiatric symptoms. Moreover, reactions to CTS proved broader than the existing PTSD symptomatology. Examining symptom dominance and severity in relation to impairment and dysfunction, and clinical considerations are discussed. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. LETTER TO THE EDITOR: Single-species reactions on a random catalytic chain

    NASA Astrophysics Data System (ADS)

    Oshanin, G.; Burlatsky, S. F.

    2002-11-01

    We present an exact solution for a catalytically activated annihilation A + A → 0 reaction taking place on a one-dimensional chain in which some segments (placed at random, with mean concentration p) possess special, catalytic properties. An annihilation reaction takes place as soon as any two A particles land from the reservoir onto two vacant sites at the extremities of the catalytic segment, or when any A particle lands onto a vacant site on a catalytic segment while the site at the other extremity of this segment is already occupied by another A particle. We find that the disorder-average pressure P(quen) per site of such a chain is given by P(quen) = P(Lan) + β-1F, where P(Lan) = β-1 ln(1 + z) is the Langmuir adsorption pressure, (z being the activity and β-1 the temperature), while β-1F is the reaction-induced contribution, which can be expressed, under appropriate change of notation, as the Lyapunov exponent for the product of 2 × 2 random matrices, obtained exactly by Derrida and Hilhorst (1983 J. Phys. A: Math. Gen. 16 2641). Explicit asymptotic formulae for the particle mean density and the compressibility are also presented.

  19. Molecular Machine Powered Surface Programmatic Chain Reaction for Highly Sensitive Electrochemical Detection of Protein.

    PubMed

    Zhu, Jing; Gan, Haiying; Wu, Jie; Ju, Huangxian

    2018-04-17

    A bipedal molecular machine powered surface programmatic chain reaction was designed for electrochemical signal amplification and highly sensitive electrochemical detection of protein. The bipedal molecular machine was built through aptamer-target specific recognition for the binding of one target protein with two DNA probes, which hybridized with surface-tethered hairpin DNA 1 (H1) via proximity effect to expose the prelocked toehold domain of H1 for the hybridization of ferrocene-labeled hairpin DNA 2 (H2-Fc). The toehold-mediated strand displacement reaction brought the electrochemical signal molecule Fc close to the electrode and meanwhile released the bipedal molecular machine to traverse the sensing surface by the surface programmatic chain reaction. Eventually, a large number of duplex structures of H1-H2 with ferrocene groups facing to the electrode were formed on the sensor surface to generate an amplified electrochemical signal. Using thrombin as a model target, this method showed a linear detection range from 2 pM to 20 nM with a detection limit of 0.76 pM. The proposed detection strategy was enzyme-free and allowed highly sensitive and selective detection of a variety of protein targets by using corresponding DNA-based affinity probes, showing potential application in bioanalysis.

  20. Thermally multiplexed polymerase chain reaction.

    PubMed

    Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

    2015-07-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

Top