Sample records for chain reaction protocols

  1. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  2. Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

    PubMed

    Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

    2011-03-14

    Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  4. Sexing chick mRNA: A protocol based on quantitative real-time polymerase chain reaction.

    PubMed

    Wan, Z; Lu, Y; Rui, L; Yu, X; Li, Z

    2017-03-01

    The accurate identification of sex in birds is important for research on avian sex determination and differentiation. Polymerase chain reaction (PCR)-based methods have been widely applied for the molecular sexing of birds. However, these methods have used genomic DNA. Here, we present the first sexing protocol for chick mRNA based on real-time quantitative PCR. We demonstrate that this method can accurately determine sex using mRNA from chick gonads and other tissues, such as heart, liver, spleen, lung, and muscle. The strategy of this protocol also may be suitable for other species in which sex is determined by the inheritance of sex chromosomes (ZZ male and ZW female). © 2016 Poultry Science Association Inc.

  5. Comparison of EPA Method 1615 RT-qPCR Assays in Standard and Kit Format

    EPA Science Inventory

    EPA Method 1615 contains protocols for measuring enterovirus and norovirus by reverse transcription quantitative polymerase chain reaction. A commercial kit based upon these protocols was designed and compared to the method's standard approach. Reagent grade, secondary effluent, ...

  6. Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

    PubMed

    Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

    2016-01-01

    American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

  7. An ab initio molecular dynamics and density functional theory study of the formation of phosphate chains from metathiophosphates.

    PubMed

    Mosey, Nicholas J; Woo, Tom K

    2006-09-04

    The reactions that occur between metathiophosphate (MTP) molecules are identified and examined through ab initio molecular dynamics simulations and static quantum chemical calculations at the density functional level of theory. The simulations show that certain types of MTPs can react to yield phosphate chains, while others only dimerize. These differences are rationalized in terms of reaction energies and the electronic structures of these molecules. In the reaction leading to the formation of phosphate chains, the reactive center, a tri-coordinate phosphorus atom, is continually regenerated. A polymerization mechanism linking MTPs to phosphate chains is developed on the basis of these results. This information sheds light on the underlying processes that may be responsible for the formation of phosphates under high-temperature conditions and may prove useful in the development of protocols for the rational synthesis of complex phosphate structures.

  8. A real-time polymerase chain reaction-based protocol for low/medium-throughput Y-chromosome microdeletions analysis.

    PubMed

    Segat, Ludovica; Padovan, Lara; Doc, Darja; Petix, Vincenzo; Morgutti, Marcello; Crovella, Sergio; Ricci, Giuseppe

    2012-12-01

    We describe a real-time polymerase chain reaction (PCR) protocol based on the fluorescent molecule SYBR Green chemistry, for a low- to medium-throughput analysis of Y-chromosome microdeletions, optimized according to the European guidelines and aimed at making the protocol faster, avoiding post-PCR processing, and simplifying the results interpretation. We screened 156 men from the Assisted Reproduction Unit, Department of Obstetrics and Gynecology, Institute for Maternal and Child Health IRCCS Burlo Garofolo (Trieste, Italy), 150 not presenting Y-chromosome microdeletion, and 6 with microdeletions in different azoospermic factor (AZF) regions. For each sample, the Zinc finger Y-chromosomal protein (ZFY), sex-determining region Y (SRY), sY84, sY86, sY127, sY134, sY254, and sY255 loci were analyzed by performing one reaction for each locus. AZF microdeletions were successfully detected in six individuals, confirming the results obtained with commercial kits. Our real-time PCR protocol proved to be a rapid, safe, and relatively cheap method that was suitable for a low- to medium-throughput diagnosis of Y-chromosome microdeletion, which allows an analysis of approximately 10 samples (with the addition of positive and negative controls) in a 96-well plate format, or approximately 46 samples in a 384-well plate for all markers simultaneously, in less than 2 h without the need of post-PCR manipulation.

  9. Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

    PubMed

    Navarro, B; Daròs, J A; Flores, R

    1998-07-01

    A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

  10. Isolation of high-quality total RNA from leaves of Myrciaria dubia "CAMU CAMU".

    PubMed

    Gómez, Juan Carlos Castro; Reátegui, Alina Del Carmen Egoavil; Flores, Julián Torres; Saavedra, Roberson Ramírez; Ruiz, Marianela Cobos; Correa, Sixto Alfredo Imán

    2013-01-01

    Myrciaria dubia is a main source of vitamin C for people in the Amazon region. Molecular studies of M. dubia require high-quality total RNA from different tissues. So far, no protocols have been reported for total RNA isolation from leaves of this species. The objective of this research was to develop protocols for extracting high-quality total RNA from leaves of M. dubia. Total RNA was purified following two modified protocols developed for leaves of other species (by Zeng and Yang, and by Reid et al.) and one modified protocol developed for fruits of the studied species (by Silva). Quantity and quality of purified total RNA were assessed by spectrophotometric and electrophoretic analysis. Additionally, quality of total RNA was evaluated with reverse-transcription polymerase chain reaction (RT-PCR). With these three modified protocols we were able to isolate high-quality RNA (A260nm/A280nm >1.9 and A260nm/A230nm >2.0). Highest yield was produced with the Zeng and Yang modified protocol (384±46µg ARN/g fresh weight). Furthermore, electrophoretic analysis showed the integrity of isolated RNA and the absence of DNA. Another proof of the high quality of our purified RNA was the successful cDNA synthesis and amplification of a segment of the M. dubia actin 1 gene. We report three modified protocols for isolation total RNA from leaves of M. dubia. The modified protocols are easy, rapid, low in cost, and effective for high-quality and quantity total RNA isolation suitable for cDNA synthesis and polymerase chain reaction.

  11. The long underestimated carbonyl function of carbohydrates – an organocatalyzed shot into carbohydrate chemistry.

    PubMed

    Mahrwald, R

    2015-09-21

    The aggressive and strong development of organocatalysis provides several protocols for the convenient utilization of the carbonyl function of unprotected carbohydrates in C-C-bond formation processes. These amine-catalyzed mechanisms enable multiple cascade-protocols for the synthesis of a wide range of carbohydrate-derived compound classes. Several, only slightly different protocols, have been developed for the application of 1,3-dicarbonyl compounds in the stereoselective chain-elongation of unprotected carbohydrates and the synthesis of highly functionalized C-glycosides of defined configuration. In addition, C-glycosides can also be accessed by amine-catalyzed reactions with methyl ketones. By a one-pot cascade reaction of isocyanides with unprotected aldoses and amino acids access to defined configured glycopeptide mimetics is achieved. Depending on the reaction conditions different origins to control the installation of configuration during the bond-formation process were observed.

  12. Toxoplasma Gondii and Pre-treatment Protocols for Polymerase Chain Reaction Analysis of Milk Samples: A Field Trial in Sheep from Southern Italy.

    PubMed

    Vismarra, Alice; Barilli, Elena; Miceli, Maura; Mangia, Carlo; Bacci, Cristina; Brindani, Franco; Kramer, Laura

    2017-01-24

    Toxoplasmosis is a zoonotic disease caused by the protozoan Toxoplasma gondii. Ingestion of raw milk has been suggested as a risk for transmission to humans. Here the authors evaluated pre-treatment protocols for DNA extraction on T. gondii tachyzoite-spiked sheep milk with the aim of identifying the method that resulted in the most rapid and reliable polymerase chain reaction (PCR) positivity. This protocol was then used to analyse milk samples from sheep of three different farms in Southern Italy, including real time PCR for DNA quantification and PCR-restriction fragment length polymorphism for genotyping. The pre-treatment protocol using ethylenediaminetetraacetic acid and Tris-HCl to remove casein gave the best results in the least amount of time compared to the others on spiked milk samples. One sample of 21 collected from sheep farms was positive on one-step PCR, real time PCR and resulted in a Type I genotype at one locus (SAG3). Milk usually contains a low number of tachyzoites and this could be a limiting factor for molecular identification. Our preliminary data has evaluated a rapid, cost-effective and sensitive protocol to treat milk before DNA extraction. The results of the present study also confirm the possibility of T. gondii transmission through consumption of raw milk and its unpasteurised derivatives.

  13. A SIMPLE MULTIPLEX POLYMERASE CHAIN REACTION ASSAY FOR THE IDENTIFICATION OF FOUR ENVIRONMENTALLY RELEVANT FUNGAL CONTAMINANTS

    EPA Science Inventory

    Historically, identification of filamentous fungal (mold) species has been based on morphological characteristics, both macroscopic and microscopic. These methods have proven to be time consuming and inaccurate, necessitating the development of identification protocols that are ...

  14. Development of an Escherichia coli K12-specific quantitative polymerase chain reaction assay and DNA isolation suited to biofilms associated with iron drinking water pipe corrosion products.

    PubMed

    Lu, Jingrang; Gerke, Tammie L; Buse, Helen Y; Ashbolt, Nicholas J

    2014-12-01

    A quantitative polymerase chain reaction assay (115 bp amplicon) specific to Escherichia coli K12 with an ABI(TM) internal control was developed based on sequence data encoding the rfb gene cluster. Assay specificity was evaluated using three E. coli K12 strains (ATCC W3110, MG1655 & DH1), 24 non-K12 E. coli and 23 bacterial genera. The biofilm detection limit was 10(3) colony-forming units (CFU) E. coli K12 mL(-1), but required a modified protocol, which included a bio-blocker Pseudomonas aeruginosa with ethylenediaminetetraacetic acid buffered to pH 5 prior to cell lysis/DNA extraction. The novel protocol yielded the same sensitivity for drinking water biofilms associated with Fe3O4 (magnetite)-coated SiO2 (quartz) grains and biofilm-surface iron corrosion products from a drinking water distribution system. The novel DNA extraction protocol and specific E. coli K12 assay are sensitive and robust enough for detection and quantification within iron drinking water pipe biofilms, and are particularly well suited for studying enteric bacterial interactions within biofilms.

  15. Extraction of High Quality DNA from Seized Moroccan Cannabis Resin (Hashish)

    PubMed Central

    El Alaoui, Moulay Abdelaziz; Melloul, Marouane; Alaoui Amine, Sanaâ; Stambouli, Hamid; El Bouri, Aziz; Soulaymani, Abdelmajid; El Fahime, Elmostafa

    2013-01-01

    The extraction and purification of nucleic acids is the first step in most molecular biology analysis techniques. The objective of this work is to obtain highly purified nucleic acids derived from Cannabis sativa resin seizure in order to conduct a DNA typing method for the individualization of cannabis resin samples. To obtain highly purified nucleic acids from cannabis resin (Hashish) free from contaminants that cause inhibition of PCR reaction, we have tested two protocols: the CTAB protocol of Wagner and a CTAB protocol described by Somma (2004) adapted for difficult matrix. We obtained high quality genomic DNA from 8 cannabis resin seizures using the adapted protocol. DNA extracted by the Wagner CTAB protocol failed to give polymerase chain reaction (PCR) amplification of tetrahydrocannabinolic acid (THCA) synthase coding gene. However, the extracted DNA by the second protocol permits amplification of THCA synthase coding gene using different sets of primers as assessed by PCR. We describe here for the first time the possibility of DNA extraction from (Hashish) resin derived from Cannabis sativa. This allows the use of DNA molecular tests under special forensic circumstances. PMID:24124454

  16. Generation of human Fab antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences.

    PubMed

    Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F

    2011-09-01

    The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human Fab (fragment antigen binding) antibody libraries. In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final Fab products that are used for cloning.

  17. Evaluation of Microbial Diversity in Wetland through Polymerase Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP)

    DTIC Science & Technology

    2006-06-01

    51 Appendix C. Promega Restriction Digest Protocol ....................................................53...Rsa1 Restriction Digest Results............................................................................180 9. DNA Base Pair Comparison...particular restriction endonuclease, the length of the fragments produced will differ when the DNA is digested with a restriction enzyme (Edwards

  18. A Trio of Human Molecular Genetics PCR Assays

    ERIC Educational Resources Information Center

    Reinking, Jeffrey L.; Waldo, Jennifer T.; Dinsmore, Jannett

    2013-01-01

    This laboratory exercise demonstrates three different analytical forms of the polymerase chain reaction (PCR) that allow students to genotype themselves at four different loci. Here, we present protocols to allow students to a) genotype a non-coding polymorphic Variable Number of Tandem Repeat (VNTR) locus on human chromosome 5 using conventional…

  19. Results of the 2009 ASBVd survey of avocado accessions in the national germplasm collection in Florida

    USDA-ARS?s Scientific Manuscript database

    The presence of Avocado Sunblotch Viroid (ASBVd) infection among the avocado (Persea americana Mill.) accessions in the National Germplasm Repository at Miami (NGR-Mia) was established in previous studies. An ASBVd specific reverse transcription-polymerase chain reaction (RT-PCR) protocol was used t...

  20. A Practical Workshop for Generating Simple DNA Fingerprints of Plants

    ERIC Educational Resources Information Center

    Rouziere, A.-S.; Redman, J. E.

    2011-01-01

    Gel electrophoresis DNA fingerprints offer a graphical and visually appealing illumination of the similarities and differences between DNA sequences of different species and individuals. A polymerase chain reaction (PCR) and restriction digest protocol was designed to give high-school students the opportunity to generate simple fingerprints of…

  1. Generation of human scFv antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences.

    PubMed

    Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F

    2011-09-01

    The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human scFv (single chain antibody fragment) libraries using a short linker (GGSSRSS) or a long linker (GGSSRSSSSGGGGSGGGG). In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final scFv products that are used for cloning.

  2. Rickettsial Pathogens and Arthropod Vectors of Medical and Veterinary Significance on Kwajalein Atoll and Wake Island

    DTIC Science & Technology

    2012-01-01

    Coxiella burnetii, Ehrlichia, Hepatozoon canis, and Rickettsia spp. using real time PCR protocols described by Loftis et al (2006a) or Kledmanee...chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood. South- east Asian Journal of Tropical Medicine and

  3. Linear alkane polymerization on a gold surface.

    PubMed

    Zhong, Dingyong; Franke, Jörn-Holger; Podiyanachari, Santhosh Kumar; Blömker, Tobias; Zhang, Haiming; Kehr, Gerald; Erker, Gerhard; Fuchs, Harald; Chi, Lifeng

    2011-10-14

    In contrast to the many methods of selectively coupling olefins, few protocols catenate saturated hydrocarbons in a predictable manner. We report here the highly selective carbon-hydrogen (C-H) activation and subsequent dehydrogenative C-C coupling reaction of long-chain (>C(20)) linear alkanes on an anisotropic gold(110) surface, which undergoes an appropriate reconstruction by adsorption of the molecules and subsequent mild annealing, resulting in nanometer-sized channels (1.22 nanometers in width). Owing to the orientational constraint of the reactant molecules in these one-dimensional channels, the reaction takes place exclusively at specific sites (terminal CH(3) or penultimate CH(2) groups) in the chains at intermediate temperatures (420 to 470 kelvin) and selects for aliphatic over aromatic C-H activation.

  4. Sensitive and specific identification by polymerase chain reaction of Eimeria tenella and Eimeria maxima, important protozoan pathogens in laboratory avian facilities.

    PubMed

    Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin

    2011-09-01

    Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.

  5. Highly efficient one-pot/one-step synthesis of multiblock copolymers from three-component polymerization of carbon dioxide, epoxide and lactone.

    PubMed

    Li, Yang; Hong, Jiali; Wei, Renjian; Zhang, Yingying; Tong, Zaizai; Zhang, Xinghong; Du, Binyang; Xu, Junting; Fan, Zhiqiang

    2015-02-01

    It is a long-standing challenge to combine mixed monomers into multiblock copolymer (MBC) in a one-pot/one-step polymerization manner. We report the first example of MBC with biodegradable polycarbonate and polyester blocks that were synthesized from highly efficient one-pot/one-step polymerization of cyclohexene oxide (CHO), CO 2 and ε-caprolactone (ε-CL) in the presence of zinc-cobalt double metal cyanide complex and stannous octoate. In this protocol, two cross-chain exchange reactions (CCER) occurred at dual catalysts respectively and connected two independent chain propagation procedures ( i.e. , polycarbonate formation and polyester formation) simultaneously in a block-by-block manner, affording MBC without tapering structure. The multiblock structure of MBC was determined by the rate ratio of CCER to the two chain propagations and could be simply tuned by various kinetic factors. This protocol is also of significance due to partial utilization of renewable CO 2 and improved mechanical properties of the resultant MBC.

  6. Multiplex Droplet Digital PCR Protocols for Quantification of GM Maize Events.

    PubMed

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Štebih, Dejan; Morisset, Dany; Holst-Jensen, Arne; Žel, Jana

    2018-01-01

    The standard-curve based simplex quantitative polymerase chain reaction (qPCR) has been the gold standard for DNA target quantification for more than a decade. The large and growing number of individual analyses needed to test for genetically modified organisms (GMOs) is reducing the cost-effectiveness of qPCR. Droplet digital PCR (ddPCR) enables absolute quantification without standard curves, avoids the amplification efficiency bias observed with qPCR, allows more accurate estimations at low target copy numbers and, in combination with multiplexing, significantly improves cost efficiency. Here we describe two protocols for multiplex quantification of GM maize events: (1) nondiscriminating, with multiplex quantification of targets as a group (12 GM maize lines) and (2) discriminating, with multiplex quantification of individual targets (events). The first enables the quantification of twelve European Union authorized GM maize events as a group with only two assays, but does not permit determination of the individual events present. The second protocol enables the quantification of four individual targets (three GM events and one endogene) in a single reaction. Both protocols can be modified for quantification of any other DNA target.

  7. Detection of hepatitis C virus subtypes 6a, 6n, 6w and mixed infections using a modified multiplex real-time polymerase chain reaction protocol.

    PubMed

    Lee, Yuan-Ming; Chen, Yen-Ju; Lee, Cheng-Ming; Kuo, Lou-Hui; Wong, Wing-Wai; Chen, Yi-Ming Arthur

    2011-12-01

    In the past few years, many new subtypes in hepatitis C virus (HCV) genotype 6 have been identified. The aim of this study was to modify the multiplex real-time polymerase chain reaction (RT-PCR) protocol and use it to determine the HCV subtypes of a group of Taiwanese injection drug users (IDUs). We used 76 serum specimens collected in northern Taiwan in 2008. Multiplex RT-PCR was used for HCV subtyping among those serum samples having anti-HCV antibodies. Twenty cases were randomly selected for comparison with subtyping results from Inno-LiPa II tests and phylogenetic tree analysis using NS5B sequences. Multiplex RT-PCR assays showed that 60.5% (46/76) of IDUs had single HCV infection. Three out of 76 (3.9%) had double HCV infection (1b/6a, 2a/2b and 2b/6a). Besides this, 27.6% (21/76) had no HCV signal. One IDU had subtype 6n and two had subtype 6w infection. Inno-LiPa II tests misclassified all 6n and 6w cases as 1b subtype. Our modified multiplex RT-PCR protocol can be used to support molecular epidemiological studies and laboratory diagnoses of different HCV subtypes including genotype 6. Copyright © 2011. Published by Elsevier B.V.

  8. Slow histidine H/D exchange protocol for thermodynamic analysis of protein folding and stability using mass spectrometry.

    PubMed

    Tran, Duc T; Banerjee, Sambuddha; Alayash, Abdu I; Crumbliss, Alvin L; Fitzgerald, Michael C

    2012-02-07

    Described here is a mass spectrometry-based protocol to study the thermodynamic stability of proteins and protein-ligand complexes using the chemical denaturant dependence of the slow H/D exchange reaction of the imidazole C(2) proton in histidine side chains. The protocol is developed using several model protein systems including: ribonuclease (Rnase) A, myoglobin, bovine carbonic anhydrase (BCA) II, hemoglobin (Hb), and the hemoglobin-haptoglobin (Hb-Hp) protein complex. Folding free energies consistent with those previously determined by other more conventional techniques were obtained for the two-state folding proteins, Rnase A and myoglobin. The protocol successfully detected a previously observed partially unfolded intermediate stabilized in the BCA II folding/unfolding reaction, and it could be used to generate a K(d) value of 0.24 nM for the Hb-Hp complex. The compatibility of the protocol with conventional mass spectrometry-based proteomic sample preparation and analysis methods was also demonstrated in an experiment in which the protocol was used to detect the binding of zinc to superoxide dismutase in the yeast cell lysate sample. The yeast cell sample analyses also helped define the scope of the technique, which requires the presence of globally protected histidine residues in a protein's three-dimensional structure for successful application. © 2011 American Chemical Society

  9. Total synthesis of (+)-antroquinonol and (+)-antroquinonol D.

    PubMed

    Sulake, Rohidas S; Chen, Chinpiao

    2015-03-06

    The first total synthesis of (+)-antroquinonol and (+)-antroquinonol D, two structurally unique quinonols with a sesquiterpene side chain, is described. The route features an iridium-catalyzed olefin isomerization-Claisen rearrangement reaction (ICR), lactonization, and Grubbs olefin metathesis. The requisite α,β-unsaturation was achieved via the selenylation/oxidation protocol and elimination of β-methoxy group to provide two natural products from a common intermediate.

  10. DNA Sequences from Formalin-Fixed Nematodes: Integrating Molecular and Morphological Approaches to Taxonomy

    PubMed Central

    Thomas, W. Kelley; Vida, J. T.; Frisse, Linda M.; Mundo, Manuel; Baldwin, James G.

    1997-01-01

    To effectively integrate DNA sequence analysis and classical nematode taxonomy, we must be able to obtain DNA sequences from formalin-fixed specimens. Microdissected sections of nematodes were removed from specimens fixed in formalin, using standard protocols and without destroying morphological features. The fixed sections provided sufficient template for multiple polymerase chain reaction-based DNA sequence analyses. PMID:19274156

  11. Development of an optimized protocol for the detection of classical swine fever virus in formalin-fixed, paraffin-embedded tissues by seminested reverse transcription-polymerase chain reaction and comparison with in situ hybridization.

    PubMed

    Ha, S-K; Choi, C; Chae, C

    2004-10-01

    An optimized protocol was developed for the detection of classical swine fever virus (CSFV) in formalin-fixed, paraffin-embedded tissues obtained from experimentally and naturally infected pigs by seminested reverse transcription-polymerase chain reaction (RT-PCR). The results for seminested RT-PCR were compared with those determined by in situ hybridization. The results obtained show that the use of deparaffinization with xylene, digestion with proteinase K, extraction with Trizol LS, followed by seminested RT-PCR is a reliable detection method. An increase in sensitivity was observed as amplicon size decreased. The highest sensitivity for RT-PCR on formalin-fixed, paraffin-embedded tissues RNA was obtained with amplicon sizes less than approximately 200 base pairs. An hybridization signal for CSFV was detected in lymph nodes from 12 experimentally and 12 naturally infected pigs. The sensitivity of seminested RT-PCR compared with in situ hybridization was 100% for CSFV. When only formalin-fixed tissues are available, seminested RT-PCR and in situ hybridization would be useful diagnostic methods for the detection of CSFV nucleic acid.

  12. Total synthesis of mycobacterial arabinogalactan containing 92 monosaccharide units

    NASA Astrophysics Data System (ADS)

    Wu, Yong; Xiong, De-Cai; Chen, Si-Cong; Wang, Yong-Shi; Ye, Xin-Shan

    2017-03-01

    Carbohydrates are diverse bio-macromolecules with highly complex structures that are involved in numerous biological processes. Well-defined carbohydrates obtained by chemical synthesis are essential to the understanding of their functions. However, synthesis of carbohydrates is greatly hampered by its insufficient efficiency. So far, assembly of long carbohydrate chains remains one of the most challenging tasks for synthetic chemists. Here we describe a highly efficient assembly of a 92-mer polysaccharide by the preactivation-based one-pot glycosylation protocol. Several linear and branched oligosaccharide/polysaccharide fragments ranging from 5-mer to 31-mer in length have been rapidly constructed in one-pot manner, which enables the first total synthesis of a biologically important mycobacterial arabinogalactan through a highly convergent [31+31+30] coupling reaction. Our results show that the preactivation-based one-pot glycosylation protocol may provide access to the construction of long and complicated carbohydrate chains.

  13. A new era for homolytic aromatic substitution: replacing Bu3SnH with efficient light-induced chain reactions.

    PubMed

    Gurry, Michael; Aldabbagh, Fawaz

    2016-04-28

    Herein is a pertinent review of recent photochemical homolytic aromatic substitution (HAS) literature. Issues with using the reductant Bu3SnH in an oxidative process where the net loss of a hydrogen atom occurs is discussed. Nowadays more efficient light-induced chain reactions are used resulting in HAS becoming a synthetic mechanism of choice rivaling organometallic, transition-metal and electrophilic aromatic substitution protocols. The review includes aromatic substitution as part of a tandem or cascade reaction, Pschorr reaction, as well as HAS facilitated by ipso-substitution, and Smiles rearrangement. Recently visible-light photoredox catalysis, which is carried out at room temperature has become one of the most important means of aromatic substitution. The main photoredox catalysts used are polypyridine complexes of Ru(ii) and Ir(iii), although eosin Y is an alternative allowing metal-free HAS. Other radical initiator-free aromatic substitutions have used 9-mesityl-10-methylacridinium ion and N,N-bis(2,6-diisopropylphenyl)perylene-3,4,9,10-bis(dicarboximide) as the photoredox catalyst, UV-light, photoinduced electron-transfer, zwitterionic semiquinone radical anions, and Barton ester intermediates.

  14. High-throughput real-time quantitative reverse transcription PCR.

    PubMed

    Bookout, Angie L; Cummins, Carolyn L; Mangelsdorf, David J; Pesola, Jean M; Kramer, Martha F

    2006-02-01

    Extensive detail on the application of the real-time quantitative polymerase chain reaction (QPCR) for the analysis of gene expression is provided in this unit. The protocols are designed for high-throughput, 384-well-format instruments, such as the Applied Biosystems 7900HT, but may be modified to suit any real-time PCR instrument. QPCR primer and probe design and validation are discussed, and three relative quantitation methods are described: the standard curve method, the efficiency-corrected DeltaCt method, and the comparative cycle time, or DeltaDeltaCt method. In addition, a method is provided for absolute quantification of RNA in unknown samples. RNA standards are subjected to RT-PCR in the same manner as the experimental samples, thus accounting for the reaction efficiencies of both procedures. This protocol describes the production and quantitation of synthetic RNA molecules for real-time and non-real-time RT-PCR applications.

  15. Detection of isotype switch rearrangement in bulk culture by PCR.

    PubMed

    Max, E E; Mills, F C; Chu, C

    2001-05-01

    When a B lymphocyte changes from synthesizing IgM to synthesizing IgG, IgA, or IgE, this isotype switch is generally accompanied by a unique DNA rearrangement. The protocols in this unit describe two polymerase chain reaction (PCR)-based strategies for detecting switch rearrangements in bulk culture. The first involves direct PCR across the switch junctions, providing the opportunity for characterizing the recombination products by nucleotide sequence analysis; however, because of characteristics inherent to the PCR methodology this strategy cannot easily be used as a quantitative assay for recombination. A support protocol details the preparation of the 5' Su PCR probe for this protocol. The second basic protocol describes a method known as digestion-circularization PCR (DCPCR) that is more amenable to quantitation but yields no information on structure of the recombination products. Both techniques should be capable of detecting reciprocal deletion circles as well as functional recombination products remaining on the expressed chromosome.

  16. PCR-based identification of Erysiphe pulchra and Phyllactinia guttata from Cornus florida using ITS-specific primers

    Treesearch

    M. T. Mmbaga; N. B. Klopfenstein; M. -S. Kim; N. C. Mmbaga

    2004-01-01

    The internal transcribed spacer (ITS) regions of rDNA and the intervening 5.8S rRNA gene for the powdery mildew fungi Erysiphe (sect. Microsphaera) pulchra and Phyllactinia guttata were amplified using standard polymerase chain reaction (PCR) protocols and the universal primer pairs, ITS1 and ITS4. PCR products for ITS were analysed by electrophoresis in a 1.5% agarose...

  17. Head and Neck Squamous Cell Carcinomas Do Not Express EGFRvIII

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Melchers, Lieuwe J., E-mail: l.j.melchers@umcg.nl; Department of Pathology, University Medical Center Groningen, University of Groningen, Groningen; Clausen, Martijn J.A.M.

    2014-10-01

    Purpose: To assess the prevalence of EGFRvIII, a specific variant of EGFR (epidermal growth factor receptor), in 3 well-defined cohorts of head and neck squamous cell carcinoma (HNSCC). Methods and Materials: Immunohistochemistry for the specific detection of EGFRvIII using the L8A4 antibody was optimized on formalin-fixed, paraffin-embedded tissue using glioblastoma tissue. It was compared with EGFR and EGFRvIII RNA expression using a specific reverse transcription–polymerase chain reaction also optimized for formalin-fixed, paraffin-embedded tissue. Tissue microarrays including 531 HNSCCs of various stages with complete clinicopathologic and follow-up data were tested for the presence of EGFRvIII. Results: None of the 531 casesmore » showed EGFRvIII protein expression. Using an immunohistochemistry protocol reported by others revealed cytoplasmic staining in 8% of cases. Reverse transcription–polymerase chain reaction for the EGFRvIII transcript of the 28 highest cytoplasmic staining cases, as well as 69 negative cases, did not show expression in any of the tested cases, suggesting aspecific staining by a nonoptimal protocol. Conclusions: The EGFRvIII mutation is not present in HNSCC. Therefore, EGFRvIII does not influence treatment response in HNSCC and is not a usable clinical prognostic marker.« less

  18. Reverse transcriptase polymerase chain reaction on fine needle aspirates for rapid detection of translocations in synovial sarcoma.

    PubMed

    Nilsson, G; Wang, M; Wejde, J; Kanter, L; Karlén, J; Tani, E; Kreicbergs, A; Larsson, O

    1998-01-01

    To evaluate the utilization of fine needle aspiration (FNA) biopsy to obtain material for reverse-transcriptase polymerase chain reaction (RT-PCR) in the detection of the t(X;18)(p11.2;q11.2) translocation in synovial sarcomas. We applied RT-PCR to detection of synovial sarcoma fusion gene transcripts on fine needle aspirates. Five clinical samples were first analyzed: one was a tumor previously diagnosed as malignant hemangiopericytoma, one was a poorly defined tumor, and three were suspected synovial sarcomas. FNA material was transferred directly to the RT-PCR reaction tube without RNA extraction. The t(X;18) translocation could be detected on the limited amount of material that FNA provides. In each of the cases studied the representivity of the tumor samples was confirmed microscopically. Our protocol permits analysis directly on representative samples without extraction of RNA. The results imply that RT-PCR offers reliable detection of sarcoma fusion gene transcripts on fine needle aspirates. The procedure, apart from being applicable to outpatients, is rapid and sensitive.

  19. Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities

    Treesearch

    Fei Cheng; Lin Hou; Keith Woeste; Zhengchun Shang; Xiaobang Peng; Peng Zhao; Shuoxin Zhang

    2016-01-01

    Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high...

  20. Hybridization chain reaction: a versatile molecular tool for biosensing, bioimaging, and biomedicine.

    PubMed

    Bi, Sai; Yue, Shuzhen; Zhang, Shusheng

    2017-07-17

    Developing powerful, simple and low-cost DNA amplification techniques is of great significance to bioanalysis and biomedical research. Thus far, many signal amplification strategies have been developed, such as polymerase chain reaction (PCR), rolling circle amplification (RCA), and DNA strand displacement amplification (SDA). In particular, hybridization chain reaction (HCR), a type of toehold-mediated strand displacement (TMSD) reaction, has attracted great interest because of its enzyme-free nature, isothermal conditions, simple protocols, and excellent amplification efficiency. In a typical HCR, an analyte initiates the cross-opening of two DNA hairpins, yielding nicked double helices that are analogous to alternating copolymers. As an efficient amplification platform, HCR has been utilized for the sensitive detection of a wide variety of analytes, including nucleic acids, proteins, small molecules, and cells. In recent years, more complicated sets of monomers have been designed to develop nonlinear HCR, such as branched HCR and even dendritic systems, achieving quadratic and exponential growth mechanisms. In addition, HCR has attracted enormous attention in the fields of bioimaging and biomedicine, including applications in fluorescence in situ hybridization (FISH) imaging, live cell imaging, and targeted drug delivery. In this review, we introduce the fundamentals of HCR and examine the visualization and analysis techniques for HCR products in detail. The most recent HCR developments in biosensing, bioimaging, and biomedicine are subsequently discussed with selected examples. Finally, the review provides insight into the challenges and future perspectives of HCR.

  1. Reductive Etherification of Fatty Acids or Esters with Alcohols using Molecular Hydrogen.

    PubMed

    Erb, Benjamin; Risto, Eugen; Wendling, Timo; Gooßen, Lukas J

    2016-06-22

    In the presence of a catalyst system consisting of a ruthenium/triphos complex and the Brønsted acid trifluoromethanesulfonimide, mixtures of fatty acids and aliphatic alcohols are converted into the corresponding ethers at 70 bar H2 . The protocol allows the sustainable one-step synthesis of valuable long-chain ether fragrances, lubricants, and surfactants from renewable sources. The reaction protocol is extended to various fatty acids and esters both in pure form and as mixtures, for example, tall oil acids or rapeseed methyl ester (RME). Even the mixed triglyceride rapeseed oil was converted in one step. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Standardization of a two-step real-time polymerase chain reaction based method for species-specific detection of medically important Aspergillus species.

    PubMed

    Das, P; Pandey, P; Harishankar, A; Chandy, M; Bhattacharya, S; Chakrabarti, A

    2017-01-01

    Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.

  3. Scope and mechanism in palladium-catalyzed isomerizations of highly substituted allylic, homoallylic, and alkenyl alcohols.

    PubMed

    Larionov, Evgeny; Lin, Luqing; Guénée, Laure; Mazet, Clément

    2014-12-03

    Herein we report the palladium-catalyzed isomerization of highly substituted allylic alcohols and alkenyl alcohols by means of a single catalytic system. The operationally simple reaction protocol is applicable to a broad range of substrates and displays a wide functional group tolerance, and the products are usually isolated in high chemical yield. Experimental and computational mechanistic investigations provide complementary and converging evidence for a chain-walking process consisting of repeated migratory insertion/β-H elimination sequences. Interestingly, the catalyst does not dissociate from the substrate in the isomerization of allylic alcohols, whereas it disengages during the isomerization of alkenyl alcohols when additional substituents are present on the alkyl chain.

  4. Low-cost synthesis and physical characterization of thieno[3,4-c]pyrrole-4,6-dione-based polymers.

    PubMed

    Berrouard, Philippe; Dufresne, Stéphane; Pron, Agnieszka; Veilleux, Justine; Leclerc, Mario

    2012-09-21

    The improved synthesis of thieno[3,4-c]pyrrole-4,6-dione (TPD) monomers, including Gewald thiophene ring formation, a Sandmeyer-type reaction, and neat condensation with an amine, is presented. This protocol enables faster, cheaper, and more efficient preparation of TPD units in comparison to traditional methods. Furthermore, a series of TPD homo- and pseudohomopolymers bearing various alkyl chains was synthesized via a direct heteroarylation polymerization (DHAP) procedure. UV-visible absorption and powder X-ray diffraction measurements revealed the relationship between the ratio of branched to linear alkyl chains and the optoelectronic properties of the polymers as well as their packing in the solid state.

  5. Single cell digital polymerase chain reaction on self-priming compartmentalization chip

    PubMed Central

    Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

    2017-01-01

    Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267

  6. Micro-droplet Digital Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Technologies Provide Highly Sensitive and Accurate Detection of Zika Virus.

    PubMed

    Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei

    2018-06-01

    The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8  copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4  copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1  copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.

  7. Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

    PubMed

    Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

    2017-01-01

    Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.

  8. Multiplex polymerase chain reaction detection of black-pigmented bacteria in infections of endodontic origin.

    PubMed

    Seol, Jung-Hwan; Cho, Byung-Hoon; Chung, Chong-Pyoung; Bae, Kwang-Shik

    2006-02-01

    The purpose of this study was to detect the presence of Porphyromonas endodontalis, P. gingivalis, Prevotella intermedia, P. nigrescens, and P. tannerae from clinical samples using multiplex polymerase chain reactions (PCR). Two different multiplex PCR protocols were used (one for the two Porphyromonas species and the other for the three Prevotella species), each one using a primer pair specific for each target species. The results were compared to those of the conventional culture procedures. Microbial samples were taken aseptically from 40 infected root canals and abscesses from patients. Samples were cultured in an anaerobic condition for conventional identification using a Rapid ID 32 A kit. Multiplex PCR was processed using the DNA extracted from each sample. At least one of the five species of black-pigmented bacteria (BPB) were detected in 65% (26 of 40) of the samples using multiplex PCR, and in 15% (6 of 40) using the conventional culture procedures. Multiplex PCR was more rapid, sensitive, specific, and effective in detecting BPB than the conventional culture procedures.

  9. Polymerase Chain Reaction Pool Screening Used To Compare Prevalence of Infective Black Flies in Two Onchocerciasis Foci in Northern Sudan

    PubMed Central

    Higazi, Tarig B.; Zarroug, Isam M. A.; Mohamed, Hanan A.; Mohamed, Wigdan A.; Deran, Tong Chor M.; Aziz, Nabil; Katabarwa, Moses; Hassan, Hassan K.; Unnasch, Thomas R.; Mackenzie, Charles D.; Richards, Frank

    2011-01-01

    Onchocerciasis remains an important debilitating disease in many areas of Africa, including Sudan. The status of infection transmission in 2007 was assessed in the vectors of two disease foci in Sudan: Abu Hamed in northern Sudan, which has received at least 10 years of annual treatment and Galabat focus in eastern Sudan, where only minor, largely undocumented treatment activity has occurred. Assessment of more than 30,000 black flies for Onchocerca volvulus infectious stage L3 larvae by using an O-150 polymerase chain reaction protocol showed that black fly infectivity rates were 0.84 (95% confidence interval = 0.0497–1.88) per 10,000 flies for Abu Hamed and 6.9 (95% confidence interval = 1.1–16.4) infective flies per 10,000 for Galabat. These results provide entomologic evidence for suppressed Onchocerca volvulus transmission in the Abu Hamed focus and a moderate transmission rate of the parasite in the Galabat focus. PMID:21540385

  10. Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction.

    PubMed

    Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I

    1999-07-01

    Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

  11. Microchip Non-Aqueous Capillary Electrophoresis (MicronNACE) Method to Analyze Long-Chain Primary Amines

    NASA Technical Reports Server (NTRS)

    Willis, Peter A.; Mora, Maria; Cable, Morgan L.; Stockton, Amanda M.

    2012-01-01

    A protocol was developed as a first step in analyzing the complex organic aerosols present on Saturn's moon Titan, as well as the analogues of these aerosols (tholins) made on Earth. Labeling of primary amines using Pacific Blue succinimidyl ester is effected in ethanol with 25 mM triethylamine to maintain basic conditions. This reaction is allowed to equilibrate for at least one hour. Separation of the labeled primary amines is performed in ethanol with 1.05 M acetic acid, and 50 mM ammonium acetate in a commercial two-layer glass device with a standard crossmicrochannel measuring 50 microns wide by 20 microns deep. Injection potentials are optimized at 2 kV from the sample (negative) to the waste well (positive), with slight bias applied to the other two wells ( 0.4 and 0.8 V) to pinch the injection plug for the 30-s injection. Separation is performed at a potential of 5 kV along the channel, which has an effective separation distance of 7 cm. The use of ethanol in this method means that long-chain primary amines can be dissolved. Due to the low pH of the separation buffer, electro-osmotic flow (EOF) is minimized to allow for separation of both short-chain and longchain amines. As the freezing point of ethanol is much lower than water, this protocol can perform separations at temperatures lower than 0 C, which would not be possible in aqueous phase. This is of particular importance when considering in situ sampling of Titan aerosols, where unnecessary heating of the sample (even to room temperature) would lead to decomposition or unpredictable side reactions, which would make it difficult to characterize the sample appropriately.

  12. Two different PCR approaches for universal diagnosis of brown rot and identification of Monilinia spp. in stone fruit trees.

    PubMed

    Gell, I; Cubero, J; Melgarejo, P

    2007-12-01

    To design a protocol for the universal diagnosis of brown rot by polymerase chain reaction (PCR) in plant material and subsequently Monilinia spp. identification. Primers for discrimination of Monilinia spp. from other fungal genera by PCR were designed following a ribosomal DNA analysis. Discrimination among species of Monilinia was subsequently achieved by developing primers using SCAR (Sequence Characterised Amplified Region) markers obtained after a random amplified polymorphic DNA study. In addition, an internal control (IC) based on the utilization of a mimic plasmid was designed to be used in the diagnostic protocol of brown rot to recognize false negatives due to the inhibition of PCR. The four sets of primers designed allowed detection and discrimination of all Monilinia spp. causing brown rot in fruit trees. Addition of an IC in each PCR reaction performed increased the reliability of the diagnostic protocol. The detection protocol presented here, that combined a set of universal primers and the inclusion of the plasmid pGMON as an IC for diagnosis of all Monilinia spp., and three sets of primers to discriminate the most important species of Monilinia, could be an useful and valuable tool for epidemiological studies. The method developed could be used in programmes to avoid the spread and introduction of this serious disease in new areas.

  13. Applicability of three alternative instruments for food authenticity analysis: GMO identification.

    PubMed

    Burrell, A; Foy, C; Burns, M

    2011-03-06

    Ensuring foods are correctly labelled for ingredients derived from genetically modified organisms (GMOs) is an issue facing manufacturers, retailers, and enforcement agencies. DNA approaches for the determination of food authenticitys often use the polymerase chain reaction (PCR), and PCR products can be detected using capillary or gel electrophoresis. This study examines the fitness for purpose of the application of three laboratory electrophoresis instruments (Agilent Bioanalyzer 2100, Lab901 TapeStation, and Shimadzu MCE-202 MultiNA) for the detection of GMOs using PCR based on a previously validated protocol. Whilst minor differences in the performance characteristics of bias and precision were observed, all three instruments demonstrated their applicability in using this protocol for screening of GMO ingredients.

  14. Applicability of Three Alternative Instruments for Food Authenticity Analysis: GMO Identification

    PubMed Central

    Burrell, A.; Foy, C.; Burns, M.

    2011-01-01

    Ensuring foods are correctly labelled for ingredients derived from genetically modified organisms (GMOs) is an issue facing manufacturers, retailers, and enforcement agencies. DNA approaches for the determination of food authenticitys often use the polymerase chain reaction (PCR), and PCR products can be detected using capillary or gel electrophoresis. This study examines the fitness for purpose of the application of three laboratory electrophoresis instruments (Agilent Bioanalyzer 2100, Lab901 TapeStation, and Shimadzu MCE-202 MultiNA) for the detection of GMOs using PCR based on a previously validated protocol. Whilst minor differences in the performance characteristics of bias and precision were observed, all three instruments demonstrated their applicability in using this protocol for screening of GMO ingredients. PMID:21527985

  15. Insight into the stereospecificity of short-chain thermus thermophilus alcohol dehydrogenase showing pro-S hydride transfer and prelog enantioselectivity.

    PubMed

    Pennacchio, Angela; Giordano, Assunta; Esposito, Luciana; Langella, Emma; Rossi, Mosè; Raia, Carlo A

    2010-04-01

    The stereochemistry of the hydride transfer in reactions catalyzed by NAD(H)-dependent alcohol dehydrogenase from Thermus thermophilus HB27 was determined by means of (1)H-NMR spectroscopy. The enzyme transfers the pro-S hydrogen of [4R-(2)H]NADH and exhibits Prelog specificity. Enzyme-substrate docking calculations provided structural details about the enantioselectivity of this thermophilic enzyme. These results give additional insights into the diverse active site architectures of the largely versatile short-chain dehydrogenase superfamily enzymes. A feasible protocol for the synthesis of [4R-(2)H]NADH with high yield was also set up by enzymatic oxidation of 2-propanol-d(8) catalyzed by Bacillus stearothermophilus alcohol dehydrogenase.

  16. Standard Free Droplet Digital Polymerase Chain Reaction as a New Tool for the Quality Control of High-Capacity Adenoviral Vectors in Small-Scale Preparations

    PubMed Central

    Boehme, Philip; Stellberger, Thorsten; Solanki, Manish; Zhang, Wenli; Schulz, Eric; Bergmann, Thorsten; Liu, Jing; Doerner, Johannes; Baiker, Armin E.

    2015-01-01

    Abstract High-capacity adenoviral vectors (HCAdVs) are promising tools for gene therapy as well as for genetic engineering. However, one limitation of the HCAdV vector system is the complex, time-consuming, and labor-intensive production process and the following quality control procedure. Since HCAdVs are deleted for all viral coding sequences, a helper virus (HV) is needed in the production process to provide the sequences for all viral proteins in trans. For the purification procedure of HCAdV, cesium chloride density gradient centrifugation is usually performed followed by buffer exchange using dialysis or comparable methods. However, performing these steps is technically difficult, potentially error-prone, and not scalable. Here, we establish a new protocol for small-scale production of HCAdV based on commercially available adenovirus purification systems and a standard method for the quality control of final HCAdV preparations. For titration of final vector preparations, we established a droplet digital polymerase chain reaction (ddPCR) that uses a standard free-end-point PCR in small droplets of defined volume. By using different probes, this method is capable of detecting and quantifying HCAdV and HV in one reaction independent of reference material, rendering this method attractive for accurately comparing viral titers between different laboratories. In summary, we demonstrate that it is possible to produce HCAdV in a small scale of sufficient quality and quantity to perform experiments in cell culture, and we established a reliable protocol for vector titration based on ddPCR. Our method significantly reduces time and required equipment to perform HCAdV production. In the future the ddPCR technology could be advantageous for titration of other viral vectors commonly used in gene therapy. PMID:25640117

  17. An easy and efficient strategy for KEL genotyping in a multiethnic population.

    PubMed

    Arnoni, Carine Prisco; Muniz, Janaína Guinhem; de Paula, Tatiane Aparecida; Person, Rosangela Duarte de Medeiros; Gazito, Diana; Baleotti, Wilson; Barreto, José Augusto; Castilho, Lilian; Latini, Flavia Roche Moreira

    2013-01-01

    The Kell blood group system expresses high and low frequency antigens with the most important in relation to transfusion including the antithetic KEL1 and KEL2; KEL3 and KEL4; KEL6 and KEL7 antigens. Kell is a clinically relevant system, as it is highly immunogenic and anti-KEL antibodies are associated with hemolytic transfusion reactions and hemolytic disease of the fetus and newborn. Although required in some situations, Kell antigen phenotyping is restricted due to technical limitations. In these cases, molecular approaches maybe a solution. This study proposes three polymerase chain reaction genotyping protocols to analyze the single nucleotide polymorphisms responsible for six Kell antithetic antigens expressed in a Brazilian population. DNA was extracted from 800 blood donor samples and three polymerase chain reaction-restriction fragment length polymorphism protocols were used to genotype the KEL*1/KEL*2, KEL*3/KEL*4 and KEL*6/KEL*7 alleles. KEL*3/KEL*4 and KEL*6/KEL*7 genotyping was standardized using the NlaIII and MnlI restriction enzymes and validated using sequencing. KEL*1/KEL*2 genotyping was performed using a previously reported assay. KEL genotyping was successfully implemented in the service; the following distribution of KEL alleles was obtained for a population from southeastern Brazil: KEL*1 (2.2%), KEL*2 (97.8%), KEL*3 (0.69%), KEL*4 (99.31%), KEL*6 (2.69%) and KEL*7 (97.31%). Additionally, two individuals with rare genotypes, KEL*1/KEL*1 and KEL*3/KEL*3, were identified. KEL allele genotyping using these methods proved to be reliable and applicable to predict Kell antigen expressions in a Brazilian cohort. This easy and efficient strategy can be employed to provide safer transfusions and to help in rare donor screening.

  18. [Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

    PubMed

    Iván, Kristóf; Maráz, Anna

    2015-12-20

    Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

  19. Microarray expression profiling in adhesion and normal peritoneal tissues.

    PubMed

    Ambler, Dana R; Golden, Alicia M; Gell, Jennifer S; Saed, Ghassan M; Carey, David J; Diamond, Michael P

    2012-05-01

    To identify molecular markers associated with adhesion and normal peritoneal tissue using microarray expression profiling. Comparative study. University hospital. Five premenopausal women. Adhesion and normal peritoneal tissue samples were obtained from premenopausal women. Ribonucleic acid was extracted using standard protocols and processed for hybridization to Affymetrix Whole Transcript Human Gene Expression Chips. Microarray data were obtained from five different patients, each with adhesion tissue and normal peritoneal samples. Real-time polymerase chain reaction was performed for confirmation using standard protocols. Gene expression in postoperative adhesion and normal peritoneal tissues. A total of 1,263 genes were differentially expressed between adhesion and normal tissues. One hundred seventy-three genes were found to be up-regulated and 56 genes were down-regulated in the adhesion tissues compared with normal peritoneal tissues. The genes were sorted into functional categories according to Gene Ontology annotations. Twenty-six up-regulated genes and 11 down-regulated genes were identified with functions potentially relevant to the pathophysiology of postoperative adhesions. We evaluated and confirmed expression of 12 of these specific genes via polymerase chain reaction. The pathogenesis, natural history, and optimal treatment of postoperative adhesive disease remains unanswered. Microarray analysis of adhesions identified specific genes with increased and decreased expression when compared with normal peritoneum. Knowledge of these genes and ontologic pathways with altered expression provide targets for new therapies to treat patients who have or are at risk for postoperative adhesions. Copyright © 2012 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  20. A practical workshop for generating simple DNA fingerprints of plants.

    PubMed

    Rouzière, A-S; Redman, J E

    2011-01-01

    Gel electrophoresis DNA fingerprints offer a graphical and visually appealing illumination of the similarities and differences between DNA sequences of different species and individuals. A polymerase chain reaction (PCR) and restriction digest protocol was designed to give high-school students the opportunity to generate simple fingerprints of plants thereby illustrating concepts and techniques in genetics and molecular biology. Three combinations of primers/restriction enzyme targeting chloroplast DNA were sufficient to generate patterns that enabled visual discrimination of plant species. The protocol was tested with a range of common fruit, vegetable, and herb plants that could be easily cultivated and handled in the laboratory. Toxic or hazardous materials such as ethidium bromide and liquid nitrogen were avoided. The protocol was validated as a university outreach workshop targeted at a group of up to 10 high-school students. In a teaching laboratory, students sampled plants, setup the PCR reaction and restriction digest using microliter pipettes, and loaded the digested samples on an agarose gel. The workshop was structured as 2 × 2.5-hour sessions on separate days. The main challenges stemmed from the speed and accuracy of pipetting, especially at the gel loading stage. Feedback from students was largely positive, with the majority reporting that they had both enjoyed and learnt from the experience. Copyright © 2010 Wiley Periodicals, Inc.

  1. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

  2. Evaluating Fumonisin Gene Expression in Fusarium verticillioides.

    PubMed

    Scala, Valeria; Visentin, Ivan; Cardinale, Francesca

    2017-01-01

    Transcript levels of key genes in a biosynthetic pathway are often taken as a proxy for metabolite production. This is the case of FUM1, encoding the first dedicated enzyme in the metabolic pathway leading to the production of the mycotoxins Fumonisins by fungal species belonging to the genus Fusarium. FUM1 expression can be quantified by different methods; here, we detail a protocol based on quantitative reverse transcriptase polymerase chain reaction (RT-qPCR), by which relative or absolute transcript abundance can be estimated in Fusaria grown in vitro or in planta. As very seldom commercial kits for RNA extraction and cDNA synthesis are optimized for fungal samples, we developed a protocol tailored for these organisms, which stands alone but can be also easily integrated with specific reagents and kits commercially available.

  3. Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

    PubMed

    Nadal, Anna; Esteve, Teresa; Pla, Maria

    2009-01-01

    A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (<1.7% of false classification rate), with limit of detection values of 0.1% for each event, which were also achieved with simulated mixtures at different relative percentages of targets. The assay was further combined with a second multiplex PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary.

  4. An enzyme-free flow cytometric bead assay for the sensitive detection of microRNAs based on click nucleic acid ligation-mediated signal amplification.

    PubMed

    Qi, Yan; Qiu, Liying; Fan, Wenjiao; Liu, Chenghui; Li, Zhengping

    2017-08-07

    A versatile flow cytometric bead assay (FCBA) coupled with a completely enzyme-free signal amplification mechanism is developed for the sensitive detection of microRNAs (miRNAs). This new strategy integrates click chemistry-mediated ligation chain reaction (CLCR) with hybridization chain reaction (HCR) for enzyme-free signal amplification on magnetic beads (MBs), and a flow cytometer for the robust fluorescence readout of the MBs. Firstly, target miRNA can initiate CLCR on the surface of MBs based on the click chemical ligation between dibenzocyclooctyne (DBCO)- and azide-modified single-stranded DNA (ssDNA) probes, and the amount of ligated ssDNA sequences on the MBs will be proportional to the dosage of target miRNA. Afterward, each of the ligated ssDNA products can trigger a cascade chain reaction of hybridization events between two alternating fluorophore-tagged hairpin probes, resulting in another signal amplification pathway with an amplified accumulation of fluorophores on the MBs. Finally, the fluorophore-anchored MBs are directly and rapidly analyzed by using a flow cytometer without any separation or elution processes. Herein, the click nucleic acid ligation only occurs on the surface of MBs, so the nonspecific ligations are greatly inhibited compared with that of ligation reaction performed in homogeneous solution. Furthermore, the signal amplification by CLCR-HCR is highly efficient but totally enzyme-free, which may overcome the potential drawbacks of conventional enzyme-catalyzed signal amplification protocols and lead to a high sensitivity. The CLCR-HCR-based FCBA has pushed the detection limit of let-7a miRNA down to the femtomolar (fM) level, showing great potential in miRNA-related biological studies and disease diagnosis.

  5. Detection and signal amplification in zebrafish RNA FISH.

    PubMed

    Hauptmann, Giselbert; Lauter, Gilbert; Söll, Iris

    2016-04-01

    In situ hybridization (ISH) has become an invaluable tool for the detection of RNA in cells, tissues and organisms. Due to improvements in target and signal amplification and in probe design remarkable progress has been made concerning sensitivity, specificity and resolution of chromogenic and fluorescent ISH (FISH). These advancements allow for exquisite cellular and sub-cellular resolution and for detecting multiple RNA species at a time by multiplexing. In zebrafish (F)ISH non-enzymatic and enzymatic amplification systems have been employed to obtain enhanced signal intensities and signal-to-noise ratios. These amplification strategies include branched DNA-based RNAscope and in situ hybridization chain reaction (HCR) techniques, as well as alkaline phosphatase (AP)- and horseradish peroxidase (PO)-based immunoassays. For practical application, we provide proven multiplex FISH protocols for AP- and PO-based visualization of mRNAs at high resolution. The protocols take advantage of optimized tyramide signal amplification (TSA) conditions of the PO assay and long-lasting high signal-to-noise ratio of the AP reaction, thereby enabling detection of less abundant transcripts. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    PubMed

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  7. DCBRP: a deterministic chain-based routing protocol for wireless sensor networks.

    PubMed

    Marhoon, Haydar Abdulameer; Mahmuddin, M; Nor, Shahrudin Awang

    2016-01-01

    Wireless sensor networks (WSNs) are a promising area for both researchers and industry because of their various applications The sensor node expends the majority of its energy on communication with other nodes. Therefore, the routing protocol plays an important role in delivering network data while minimizing energy consumption as much as possible. The chain-based routing approach is superior to other approaches. However, chain-based routing protocols still expend substantial energy in the Chain Head (CH) node. In addition, these protocols also have the bottleneck issues. A novel routing protocol which is Deterministic Chain-Based Routing Protocol (DCBRP). DCBRP consists of three mechanisms: Backbone Construction Mechanism, Chain Head Selection (CHS), and the Next Hop Connection Mechanism. The CHS mechanism is presented in detail, and it is evaluated through comparison with the CCM and TSCP using an ns-3 simulator. It show that DCBRP outperforms both CCM and TSCP in terms of end-to-end delay by 19.3 and 65%, respectively, CH energy consumption by 18.3 and 23.0%, respectively, overall energy consumption by 23.7 and 31.4%, respectively, network lifetime by 22 and 38%, respectively, and the energy*delay metric by 44.85 and 77.54%, respectively. DCBRP can be used in any deterministic node deployment applications, such as smart cities or smart agriculture, to reduce energy depletion and prolong the lifetimes of WSNs.

  8. Development and accuracy of quantitative real-time polymerase chain reaction assays for detection and quantification of enterotoxigenic Escherichia coli (ETEC) heat labile and heat stable toxin genes in travelers' diarrhea samples.

    PubMed

    Youmans, Bonnie P; Ajami, Nadim J; Jiang, Zhi-Dong; Petrosino, Joseph F; DuPont, Herbert L; Highlander, Sarah K

    2014-01-01

    Enterotoxigenic Escherichia coli (ETEC), the leading bacterial pathogen of travelers' diarrhea, is routinely detected by an established DNA hybridization protocol that is neither sensitive nor quantitative. Quantitative real-time polymerase chain reaction (qPCR) assays that detect the ETEC toxin genes eltA, sta1, and sta2 in clinical stool samples were developed and tested using donor stool inoculated with known quantities of ETEC bacteria. The sensitivity of the qPCR assays is 89%, compared with 22% for the DNA hybridization assay, and the limits of detection are 10,000-fold lower than the DNA hybridization assays performed in parallel. Ninety-three clinical stool samples, previously characterized by DNA hybridization, were tested using the new ETEC qPCR assays. Discordant toxin profiles were observed for 22 samples, notably, four samples originally typed as ETEC negative were ETEC positive. The qPCR assays are unique in their sensitivity and ability to quantify the three toxin genes in clinical stool samples.

  9. Quantification of concentrated Chinese medicine granules by quantitative polymerase chain reaction.

    PubMed

    Lo, Yat-Tung; Shaw, Pang-Chui

    2017-10-25

    Determination of the amount of constituent in a multi-herb product is important for quality control. In concentrated Chinese medicine granules (CCMG), no dregs are left after dissolution of the CCMG. This study is the first to examine the feasibility of using quantitative polymerase chain reaction (qPCR) to find the amount of CCMG in solution form. DNA was extracted from Hirudo and Zaocys CCMG mixed at different ratios and amplified in qPCR using species-specific primers. The threshold cycle (C T ) obtained was compared with the respective standard curves. Results showed that reproducible quantification results could be obtained (1) for 5-50mg CCMG using a modified DNA extraction protocol, (2) amongst DNA extracted from the same batch of CCMG and (3) amongst different batches of CCMG from the same company. This study demonstrated the constitute amount of CCMG in a mixture could be determined using qPCR. This work has extended the application of DNA techniques for the quantification of herbal products and this approach may be developed for quality assurance in the CCMG industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. The design of strain-specific polymerase chain reactions for discrimination of the racoon rabies virus strain from indigenous rabies viruses of Ontario.

    PubMed

    Nadin-Davis, S A; Huang, W; Wandeler, A I

    1996-03-01

    Since its recognition as a discrete epizootic in Florida in the early 1950s, the raccoon strain of rabies virus (RV) has spread over almost the entire eastern seaboard of the US and now threatens to enter the southernmost regions of Canada. To characterise this RV strain in more detail, nucleotide sequencing of the N and G genes, encoding the nucleoprotein and glycoprotein, respectively, of representative isolates has been undertaken. This sequence information generated a conserved restriction map of the N gene, thereby permitting unequivocal identification of this strain by molecular techniques. Comparisons of the predicted nucleoprotein and glycoprotein products with those of other RV strains identified a number of amino acid sequence variations conserved only in the raccoon strain. This information was used to design strain-specific primers targeted to the N gene sequences encoding these residues. The incorporation of these primers into a multiplex polymerase chain reaction (PCR) protocol permitted easy and rapid discrimination between the raccoon RV strain and indigenous Ontario RVs.

  11. Movement of particles using sequentially activated dielectrophoretic particle trapping

    DOEpatents

    Miles, Robin R.

    2004-02-03

    Manipulation of DNA and cells/spores using dielectrophoretic (DEP) forces to perform sample preparation protocols for polymerized chain reaction (PCR) based assays for various applications. This is accomplished by movement of particles using sequentially activated dielectrophoretic particle trapping. DEP forces induce a dipole in particles, and these particles can be trapped in non-uniform fields. The particles can be trapped in the high field strength region of one set of electrodes. By switching off this field and switching on an adjacent electrodes, particles can be moved down a channel with little or no flow.

  12. The biomechanical and perceptual influence of chain resistance on the performance of the olympic clean.

    PubMed

    Berning, Joseph M; Coker, Cheryl A; Briggs, Doug

    2008-03-01

    Proponents of chain training suggest that using chains hung from the ends of barbells rather than using conventional barbells alone enhances strength, power, and neuromuscular adaptations. The purpose of this study was to determine whether a conventional barbell with chains compared to a conventional barbell without chains would affect the performance of an Olympic Clean. The subjects were also asked regarding their perception of how chains affected their lifting. Four male and 3 female competitive weightlifters who used chains as part of their training participated in the study. The testing protocol compared the subjects' lifting 80% and 85% of their 1 repetition maximum (1RM) using conventional barbells and their lifting 80% and 85% of their 1RM using chains (75% conventional barbells + 5% chains and 80% conventional barbells + 5% chains, respectively). Video analysis evaluated the bar's vertical displacement and velocity and the rate of force production. Vertical ground reaction forces for the first-pull, unweighting, and second-pull phases of the lift were evaluated by using a force plate. After testing, the subjects completed a 2-item questionnaire asking individual perception of the effects of the chains. The results showed no significant difference for condition for any of the variables examined. In contrast, all subjects perceived that the chains required a greater effort. In conclusion, the results indicated that the addition of chains provided no greater value over lifting conventional barbells alone in the performance of the Olympic Clean, although the subjects perceived the chains to have a positive effect.

  13. Charge-tagged ligands: useful tools for immobilising complexes and detecting reaction species during catalysis

    PubMed Central

    Limberger, Jones; Leal, Bárbara C.; Monteiro, Adriano L.

    2015-01-01

    In recent years, charge-tagged ligands (CTLs) have become valuable tools in organometallic catalysis. Insertion of an ionic side chain into the molecular skeleton of a known ligand has become a useful protocol for anchoring ligands, and consequently catalysts, in polar and ionic liquid phases. In addition, the insertion of a cationic moiety into a ligand is a powerful tool that can be used to detect reaction intermediates in organometallic catalysis through electrospray ionisation mass spectrometry (ESI-MS) experiments. The insertion of an ionic tag ensures the charge in the intermediates independently of the ESI-MS. For this reason, these ligands have been used as ionic probes in mechanistic studies for several catalytic reactions. Here, we summarise selected examples on the use of CTLs as immobilising agents in organometallic catalysis and as probes for studying mechanisms through ESI-MS. PMID:28553458

  14. A non-radioisotopic quantitative competitive polymerase chain reaction method: application in measurement of human herpesvirus 7 load.

    PubMed

    Kidd, I M; Clark, D A; Emery, V C

    2000-06-01

    Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed.

  15. In Vitro Characterization of Chain Depolymerization Activities of SUMO-Specific Proteases.

    PubMed

    Eckhoff, Julia; Dohmen, R Jürgen

    2016-01-01

    SUMO-specific proteases, known as Ulps in baker's yeast and SENPs in humans, have important roles in controlling the dynamics of SUMO-modified proteins. They display distinct modes of action and specificity, in that they may act on the SUMO precursor, mono-sumoylated, and/or polysumoylated proteins, and they might be specific for substrates with certain SUMO paralogs. SUMO chains may be dismantled either by endo or exo mechanisms. Biochemical characterization of a protease usually requires purification of the protein of interest. Developing a purification protocol, however, can be very difficult, and in some cases, isolation of a protease in its pure form may go along with a substantial loss of activity. To characterize the reaction mechanism of Ulps, we have developed an in vitro assay, which makes use of substrates endowed with artificial poly-SUMO chains of defined lengths, and S. cerevisiae Ulp enzymes in crude extract from E. coli. This fast and economic approach should be applicable to SUMO-specific proteases from other species as well.

  16. Comparative evaluation of total RNA extraction methods in Theobroma cacao using shoot apical meristems.

    PubMed

    Silva, D V; Branco, S M J; Holanda, I S A; Royaert, S; Motamayor, J C; Marelli, J P; Corrêa, R X

    2016-03-04

    Theobroma cacao is a species of great economic importance with its beans used for chocolate production. The tree has been a target of various molecular studies. It contains many polyphenols, which complicate the extraction of nucleic acids with the extraction protocols requiring a large amount of plant material. These issues, therefore, necessitate the optimization of the protocols. The aim of the present study was to evaluate different methods for extraction of total RNA from shoot apical meristems of T. cacao 'CCN 51' and to assess the influence of storage conditions for the meristems on the extraction. The study also aimed to identify the most efficient protocol for RNA extraction using a small amount of plant material. Four different protocols were evaluated for RNA extraction using one shoot apical meristem per sample. Among these protocols, one that was more efficient was then tested to extract RNA using four different numbers of shoot apical meristems, subjected to three different storage conditions. The best protocol was tested for cDNA amplification using reverse transcription-polymerase chain reaction; the cDNA quality was determined to be satisfactory for molecular analyses. The study revealed that with the best RNA extraction protocol, one shoot apical meristem was sufficient for extraction of high-quality total RNA. The results obtained might enable advances in genetic analyses and molecular studies using reduced amount of plant material.

  17. Inter-laboratory quality control for hormone-dependent gene expression in human breast tumors using real-time reverse transcription-polymerase chain reaction.

    PubMed

    de Cremoux, P; Bieche, I; Tran-Perennou, C; Vignaud, S; Boudou, E; Asselain, B; Lidereau, R; Magdelénat, H; Becette, V; Sigal-Zafrani, B; Spyratos, F

    2004-09-01

    Quantitative reverse transcription-polymerase chain reaction (RT-PCR) used to detect minor changes in specific mRNA concentrations may be associated with poor reproducibility. Stringent quality control is therefore essential at each step of the protocol, including the PCR procedure. We performed inter-laboratory quality control of quantitative PCR between two independent laboratories, using in-house RT-PCR assays on a series of hormone-related target genes in a retrospective consecutive series of 79 breast tumors. Total RNA was reverse transcribed in a single center. Calibration curves were performed for five target genes (estrogen receptor (ER)alpha, ERbeta, progesterone receptor (PR), CYP19 (aromatase) and Ki 67) and for two reference genes (human acidic ribosomal phosphoprotein PO (RPLPO) and TATA box-binding protein (TBP)). Amplification efficiencies of the calibrator were determined for each run and used to calculate mRNA expression. Correlation coefficients were evaluated for each target and each reference gene. A good correlation was observed for all target and reference genes in both centers using their own protocols and kits (P < 0.0001). The correlation coefficients ranged from 0.90 to 0.98 for the various target genes in the two centers. A good correlation was observed between the level of expression of the ERalpha and the PR transcripts (P < 0.001). A weak inverse correlation was observed in both centers between ERalpha and ERbeta levels, but only when TBP was the reference gene. No other correlation was observed with other parameters. Real-time PCR assays allow convenient quantification of target mRNA transcripts and quantification of target-derived nucleic acids in clinical specimens. This study addresses the importance of inter-laboratory quality controls for the use of a panel of real-time PCR assays devoted to clinical samples and protocols and to ensure their appropriate accuracy. This can also facilitate exchanges and multicenter comparison of data.

  18. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    NASA Astrophysics Data System (ADS)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  19. Novel quantitative real-time LCR for the sensitive detection of SNP frequencies in pooled DNA: method development, evaluation and application.

    PubMed

    Psifidi, Androniki; Dovas, Chrysostomos; Banos, Georgios

    2011-01-19

    Single nucleotide polymorphisms (SNP) have proven to be powerful genetic markers for genetic applications in medicine, life science and agriculture. A variety of methods exist for SNP detection but few can quantify SNP frequencies when the mutated DNA molecules correspond to a small fraction of the wild-type DNA. Furthermore, there is no generally accepted gold standard for SNP quantification, and, in general, currently applied methods give inconsistent results in selected cohorts. In the present study we sought to develop a novel method for accurate detection and quantification of SNP in DNA pooled samples. The development and evaluation of a novel Ligase Chain Reaction (LCR) protocol that uses a DNA-specific fluorescent dye to allow quantitative real-time analysis is described. Different reaction components and thermocycling parameters affecting the efficiency and specificity of LCR were examined. Several protocols, including gap-LCR modifications, were evaluated using plasmid standard and genomic DNA pools. A protocol of choice was identified and applied for the quantification of a polymorphism at codon 136 of the ovine PRNP gene that is associated with susceptibility to a transmissible spongiform encephalopathy in sheep. The real-time LCR protocol developed in the present study showed high sensitivity, accuracy, reproducibility and a wide dynamic range of SNP quantification in different DNA pools. The limits of detection and quantification of SNP frequencies were 0.085% and 0.35%, respectively. The proposed real-time LCR protocol is applicable when sensitive detection and accurate quantification of low copy number mutations in DNA pools is needed. Examples include oncogenes and tumour suppressor genes, infectious diseases, pathogenic bacteria, fungal species, viral mutants, drug resistance resulting from point mutations, and genetically modified organisms in food.

  20. Novel Quantitative Real-Time LCR for the Sensitive Detection of SNP Frequencies in Pooled DNA: Method Development, Evaluation and Application

    PubMed Central

    Psifidi, Androniki; Dovas, Chrysostomos; Banos, Georgios

    2011-01-01

    Background Single nucleotide polymorphisms (SNP) have proven to be powerful genetic markers for genetic applications in medicine, life science and agriculture. A variety of methods exist for SNP detection but few can quantify SNP frequencies when the mutated DNA molecules correspond to a small fraction of the wild-type DNA. Furthermore, there is no generally accepted gold standard for SNP quantification, and, in general, currently applied methods give inconsistent results in selected cohorts. In the present study we sought to develop a novel method for accurate detection and quantification of SNP in DNA pooled samples. Methods The development and evaluation of a novel Ligase Chain Reaction (LCR) protocol that uses a DNA-specific fluorescent dye to allow quantitative real-time analysis is described. Different reaction components and thermocycling parameters affecting the efficiency and specificity of LCR were examined. Several protocols, including gap-LCR modifications, were evaluated using plasmid standard and genomic DNA pools. A protocol of choice was identified and applied for the quantification of a polymorphism at codon 136 of the ovine PRNP gene that is associated with susceptibility to a transmissible spongiform encephalopathy in sheep. Conclusions The real-time LCR protocol developed in the present study showed high sensitivity, accuracy, reproducibility and a wide dynamic range of SNP quantification in different DNA pools. The limits of detection and quantification of SNP frequencies were 0.085% and 0.35%, respectively. Significance The proposed real-time LCR protocol is applicable when sensitive detection and accurate quantification of low copy number mutations in DNA pools is needed. Examples include oncogenes and tumour suppressor genes, infectious diseases, pathogenic bacteria, fungal species, viral mutants, drug resistance resulting from point mutations, and genetically modified organisms in food. PMID:21283808

  1. A new protocol to detect multiple foodborne pathogens with PCR dipstick DNA chromatography after a six-hour enrichment culture in a broad-range food pathogen enrichment broth.

    PubMed

    Hayashi, Masahiro; Natori, Tatsuya; Kubota-Hayashi, Sayoko; Miyata, Machiko; Ohkusu, Kiyofumi; Kawamoto, Keiko; Kurazono, Hisao; Makino, Souichi; Ezaki, Takayuki

    2013-01-01

    A quick foodborne pathogen screening method after six-hour enrichment culture with a broad-range food pathogen enrichment broth is described. Pathogenic factors of Salmonella enterica, Shigella spp., enteroinvasive Escherichia coli, and enterohemorrhagic E. coli are amplified with a cocktail primer and rapid polymerase chain reaction (PCR), which finishes amplification in 30 min. The PCR amplicon was differentiated with a dipstick DNA chromatography assay in 5-10 min. Starting from a four- to six-hour enrichment culture, this assay was finished within 45 min. Detection sensitivity of this protocol was less than 2.5 CFU/25 g for S. enterica and 3.3 CFU/25 g for enterohemorrhagic E. coli in spiked ground meat experiments.

  2. Multiplex polymerase chain reaction assay for the differential detection of trichothecene- and fumonisin-producing species of Fusarium in cornmeal.

    PubMed

    Bluhm, B H; Flaherty, J E; Cousin, M A; Woloshuk, C P

    2002-12-01

    The genus Fusarium comprises a diverse group of fungi including several species that produce mycotoxins in food commodities. In this study, a multiplex polymerase chain reaction (PCR) assay was developed for the group-specific detection of fumonisin-producing and trichothecene-producing species of Fusarium. Primers for genus-level recognition of Fusarium spp. were designed from the internal transcribed spacer regions (ITS1 and ITS2) of rDNA. Primers for group-specific detection were designed from the TRI6 gene involved in trichothecene biosynthesis and the FUM5 gene involved in fumonisin biosynthesis. Primer specificity was determined by testing for cross-reactivity against purified genomic DNA from 43 fungal species representing 14 genera, including 9 Aspergillus spp., 9 Fusarium spp., and 10 Penicillium spp. With purified genomic DNA as a template, genus-specific recognition was observed at 10 pg per reaction; group-specific recognition occurred at 100 pg of template per reaction for the trichothecene producer Fusarium graminearum and at 1 ng of template per reaction for the fumonisin producer Fusarium verticillioides. For the application of the PCR assay, a protocol was developed to isolate fungal DNA from cornmeal. The detection of F. graminearum and its differentiation from F. verticillioides were accomplished prior to visible fungal growth at <10(5) CFU/g of cornmeal. This level of detection is comparable to those of other methods such as enzyme-linked immunosorbent assay, and the assay described here can be used in the food industry's effort to monitor quality and safety.

  3. Simple model of inhibition of chain-branching combustion processes

    NASA Astrophysics Data System (ADS)

    Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.

    2017-11-01

    A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.

  4. Basic quantitative polymerase chain reaction using real-time fluorescence measurements.

    PubMed

    Ares, Manuel

    2014-10-01

    This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.

  5. Labeling proteins on live mammalian cells using click chemistry.

    PubMed

    Nikić, Ivana; Kang, Jun Hee; Girona, Gemma Estrada; Aramburu, Iker Valle; Lemke, Edward A

    2015-05-01

    We describe a protocol for the rapid labeling of cell-surface proteins in living mammalian cells using click chemistry. The labeling method is based on strain-promoted alkyne-azide cycloaddition (SPAAC) and strain-promoted inverse-electron-demand Diels-Alder cycloaddition (SPIEDAC) reactions, in which noncanonical amino acids (ncAAs) bearing ring-strained alkynes or alkenes react, respectively, with dyes containing azide or tetrazine groups. To introduce ncAAs site specifically into a protein of interest (POI), we use genetic code expansion technology. The protocol can be described as comprising two steps. In the first step, an Amber stop codon is introduced--by site-directed mutagenesis--at the desired site on the gene encoding the POI. This plasmid is then transfected into mammalian cells, along with another plasmid that encodes an aminoacyl-tRNA synthetase/tRNA (RS/tRNA) pair that is orthogonal to the host's translational machinery. In the presence of the ncAA, the orthogonal RS/tRNA pair specifically suppresses the Amber codon by incorporating the ncAA into the polypeptide chain of the POI. In the second step, the expressed POI is labeled with a suitably reactive dye derivative that is directly supplied to the growth medium. We provide a detailed protocol for using commercially available ncAAs and dyes for labeling the insulin receptor, and we discuss the optimal surface-labeling conditions and the limitations of labeling living mammalian cells. The protocol involves an initial cloning step that can take 4-7 d, followed by the described transfections and labeling reaction steps, which can take 3-4 d.

  6. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  7. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  8. Chain-reaction crash in traffic flow controlled by taillights

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-02-01

    We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.

  9. Stratospheric ozone depletion

    PubMed Central

    Rowland, F. Sherwood

    2006-01-01

    Solar ultraviolet radiation creates an ozone layer in the atmosphere which in turn completely absorbs the most energetic fraction of this radiation. This process both warms the air, creating the stratosphere between 15 and 50 km altitude, and protects the biological activities at the Earth's surface from this damaging radiation. In the last half-century, the chemical mechanisms operating within the ozone layer have been shown to include very efficient catalytic chain reactions involving the chemical species HO, HO2, NO, NO2, Cl and ClO. The NOX and ClOX chains involve the emission at Earth's surface of stable molecules in very low concentration (N2O, CCl2F2, CCl3F, etc.) which wander in the atmosphere for as long as a century before absorbing ultraviolet radiation and decomposing to create NO and Cl in the middle of the stratospheric ozone layer. The growing emissions of synthetic chlorofluorocarbon molecules cause a significant diminution in the ozone content of the stratosphere, with the result that more solar ultraviolet-B radiation (290–320 nm wavelength) reaches the surface. This ozone loss occurs in the temperate zone latitudes in all seasons, and especially drastically since the early 1980s in the south polar springtime—the ‘Antarctic ozone hole’. The chemical reactions causing this ozone depletion are primarily based on atomic Cl and ClO, the product of its reaction with ozone. The further manufacture of chlorofluorocarbons has been banned by the 1992 revisions of the 1987 Montreal Protocol of the United Nations. Atmospheric measurements have confirmed that the Protocol has been very successful in reducing further emissions of these molecules. Recovery of the stratosphere to the ozone conditions of the 1950s will occur slowly over the rest of the twenty-first century because of the long lifetime of the precursor molecules. PMID:16627294

  10. A rapid and efficient DNA extraction protocol from fresh and frozen human blood samples.

    PubMed

    Guha, Pokhraj; Das, Avishek; Dutta, Somit; Chaudhuri, Tapas Kumar

    2018-01-01

    Different methods available for extraction of human genomic DNA suffer from one or more drawbacks including low yield, compromised quality, cost, time consumption, use of toxic organic solvents, and many more. Herein, we aimed to develop a method to extract DNA from 500 μL of fresh or frozen human blood. Five hundred microliters of fresh and frozen human blood samples were used for standardization of the extraction procedure. Absorbance at 260 and 280 nm, respectively, (A 260 /A 280 ) were estimated to check the quality and quantity of the extracted DNA sample. Qualitative assessment of the extracted DNA was checked by Polymerase Chain reaction and double digestion of the DNA sample. Our protocol resulted in average yield of 22±2.97 μg and 20.5±3.97 μg from 500 μL of fresh and frozen blood, respectively, which were comparable to many reference protocols and kits. Besides yielding bulk amount of DNA, our protocol is rapid, economical, and avoids toxic organic solvents such as Phenol. Due to unaffected quality, the DNA is suitable for downstream applications. The protocol may also be useful for pursuing basic molecular researches in laboratories having limited funds. © 2017 Wiley Periodicals, Inc.

  11. Run-length encoding graphic rules, biochemically editable designs and steganographical numeric data embedment for DNA-based cryptographical coding system.

    PubMed

    Kawano, Tomonori

    2013-03-01

    There have been a wide variety of approaches for handling the pieces of DNA as the "unplugged" tools for digital information storage and processing, including a series of studies applied to the security-related area, such as DNA-based digital barcodes, water marks and cryptography. In the present article, novel designs of artificial genes as the media for storing the digitally compressed data for images are proposed for bio-computing purpose while natural genes principally encode for proteins. Furthermore, the proposed system allows cryptographical application of DNA through biochemically editable designs with capacity for steganographical numeric data embedment. As a model case of image-coding DNA technique application, numerically and biochemically combined protocols are employed for ciphering the given "passwords" and/or secret numbers using DNA sequences. The "passwords" of interest were decomposed into single letters and translated into the font image coded on the separate DNA chains with both the coding regions in which the images are encoded based on the novel run-length encoding rule, and the non-coding regions designed for biochemical editing and the remodeling processes revealing the hidden orientation of letters composing the original "passwords." The latter processes require the molecular biological tools for digestion and ligation of the fragmented DNA molecules targeting at the polymerase chain reaction-engineered termini of the chains. Lastly, additional protocols for steganographical overwriting of the numeric data of interests over the image-coding DNA are also discussed.

  12. Establishment of a rapid, inexpensive protocol for extraction of high quality RNA from small amounts of strawberry plant tissues and other recalcitrant fruit crops.

    PubMed

    Christou, Anastasis; Georgiadou, Egli C; Filippou, Panagiota; Manganaris, George A; Fotopoulos, Vasileios

    2014-03-01

    Strawberry plant tissues and particularly fruit material are rich in polysaccharides and polyphenolic compounds, thus rendering the isolation of nucleic acids a difficult task. This work describes the successful modification of a total RNA extraction protocol, which enables the isolation of high quantity and quality of total RNA from small amounts of strawberry leaf, root and fruit tissues. Reverse-transcription polymerase chain reaction (RT-PCR) amplification of GAPDH housekeeping gene from isolated RNA further supports the proposed protocol efficiency and its use for downstream molecular applications. This novel procedure was also successfully followed using other fruit tissues, such as olive and kiwifruit. In addition, optional treatment with RNase A following initial nucleic acid extraction can provide sufficient quality and quality of genomic DNA for subsequent PCR analyses, as evidenced from PCR amplification of housekeeping genes using extracted genomic DNA as template. Overall, this optimized protocol allows easy, rapid and economic isolation of high quality RNA from small amounts of an important fruit crop, such as strawberry, with extended applicability to other recalcitrant fruit crops. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Assessing Telomere Length Using Surface Enhanced Raman Scattering

    NASA Astrophysics Data System (ADS)

    Zong, Shenfei; Wang, Zhuyuan; Chen, Hui; Cui, Yiping

    2014-11-01

    Telomere length can provide valuable insight into telomeres and telomerase related diseases, including cancer. Here, we present a brand-new optical telomere length measurement protocol using surface enhanced Raman scattering (SERS). In this protocol, two single strand DNA are used as SERS probes. They are labeled with two different Raman molecules and can specifically hybridize with telomeres and centromere, respectively. First, genome DNA is extracted from cells. Then the telomere and centromere SERS probes are added into the genome DNA. After hybridization with genome DNA, excess SERS probes are removed by magnetic capturing nanoparticles. Finally, the genome DNA with SERS probes attached is dropped onto a SERS substrate and subjected to SERS measurement. Longer telomeres result in more attached telomere probes, thus a stronger SERS signal. Consequently, SERS signal can be used as an indicator of telomere length. Centromere is used as the inner control. By calibrating the SERS intensity of telomere probe with that of the centromere probe, SERS based telomere measurement is realized. This protocol does not require polymerase chain reaction (PCR) or electrophoresis procedures, which greatly simplifies the detection process. We anticipate that this easy-operation and cost-effective protocol is a fine alternative for the assessment of telomere length.

  14. Optimization of Capillary Electrophoresis With Laser Induced Fluorescent (CE-LIF) Detection for the Analysis of Double Standed DNA Polymerase Chain Reaction Products from the Telomeric Repeat Amplification Protocol

    DTIC Science & Technology

    2000-12-06

    Fluorescent Milligram (10ŗ) Milliliter (10ŗ) vm ^g Microgram (10") 1*1 Microliter (10" 6) MMA Master Mix A MMB Master Mix B NSCLC Non-Small-Cell...little effect on heat dissipation, the mixing helped to smooth out the convection gradients (see Weinberger 1993). The use of smaller i.d...clogging may occur (Heller 1998a). The gels must be covalently bound to the capillary wall to avoid extrusion from the capillary by electroosmotic flow

  15. ONR Far East Scientific Information Bulletin

    DTIC Science & Technology

    1990-09-01

    In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by

  16. High Throughput Multiplex PCR and Probe-based Detection with Luminex Beads for Seven Intestinal Parasites

    PubMed Central

    Taniuchi, Mami; Verweij, Jaco J.; Noor, Zannatun; Sobuz, Shihab U.; van Lieshout, Lisette; Petri, William A.; Haque, Rashidul; Houpt, Eric R.

    2011-01-01

    Polymerase chain reaction (PCR) assays for intestinal parasites are increasingly being used on fecal DNA samples for enhanced specificity and sensitivity of detection. Comparison of these tests against microscopy and copro-antigen detection has been favorable, and substitution of PCR-based assays for the ova and parasite stool examination is a foreseeable goal for the near future. One challenge is the diverse list of protozoan and helminth parasites. Several existing real-time PCR assays for the major intestinal parasites—Cryptosporidium spp., Giardia intestinalis, Entamoeba histolytica, Ancylostoma duodenale, Ascaris lumbricoides, Necator americanus, and Strongyloides stercoralis—were adapted into a high throughput protocol. The assay involves two multiplex PCR reactions, one with specific primers for the protozoa and one with specific primers for the helminths, after which PCR products are hybridized to beads linked to internal oligonucleotide probes and detected on a Luminex platform. When compared with the parent multiplex real-time PCR assays, this multiplex PCR-bead assay afforded between 83% and 100% sensitivity and specificity on a total of 319 clinical specimens. In conclusion, this multiplex PCR-bead protocol provides a sensitive diagnostic screen for a large panel of intestinal parasites. PMID:21292910

  17. Effect of perception irregularity on chain-reaction crash in low visibility

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-06-01

    We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.

  18. A nested multiplex polymerase chain reaction assay for the differential identification of three zooanthroponotic chlamydial strains in porcine swab samples.

    PubMed

    Li, Yingguo; Wang, Yu; Nie, Fuping; Xiao, Jinwen; Wang, Guoming; Yuan, Ling; Li, Zhengguo

    2011-07-01

    Porcine chlamydial infection is an enzootic infectious disease caused by multiple members of the family Chlamydiaceae (e.g. Chlamydophila abortus, Chlamydia suis, and Chlamydophila pneumoniae). Rapid and accurate differentiation of these pathogens is critical in the control and prevention of disease. The aim of the current study was to develop a nested multiplex polymerase chain reaction (nmPCR) assay to simultaneously detect the 3 chlamydial pathogens in clinical samples. In the first round of the nmPCR, 1 pair of family-specific primers were used to amplify the 1,100 base pair (bp) fragment of chlamydial ompA gene. In the second round of the nmPCR, 4 inner primers were designed for Ch. abortus, C. suis, and Ch. pneumoniae. Each pathogen produced a specific amplicon with a size of 340 bp, 526 bp, and 267 bp respectively. The assay was sensitive and specific for detecting target pathogens in both cell cultures and clinical specimens. The results, incorporated with the improved rapid DNA extraction protocol, suggest that the nmPCR could be a promising assay for differential identification of different chlamydial strains in pigs.

  19. Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR.

    PubMed

    Wills, Melanie K B; Kirby, Andrea M; Lloyd, Vett K

    2018-02-04

    Lyme disease is a serious vector-borne infection that is caused by the Borrelia burgdorferi sensu lato family of spirochetes, which are transmitted to humans through the bite of infected Ixodes ticks. The primary etiological agent in North America is Borrelia burgdorferi sensu stricto. As geographic risk regions expand, it is prudent to support robust surveillance programs that can measure tick infection rates, and communicate findings to clinicians, veterinarians, and the general public. The molecular technique of nested polymerase chain reaction (nPCR) has long been used for this purpose, and it remains a central, inexpensive, and robust approach in the detection of Borrelia in both ticks and wildlife. This article demonstrates the application of nPCR to tick DNA extracts to identify infected specimens. Two independent B. burgdorferi targets, genes encoding Flagellin B (FlaB) and Outer surface protein A (OspA), have been used extensively with this technique. The protocol involves tick collection, DNA extraction, and then an initial round of PCR to detect each of the two Borrelia-specific loci. Subsequent polymerase chain reaction (PCR) uses the product of the first reaction as a new template to generate smaller, internal amplification fragments. The nested approach improves upon both the specificity and sensitivity of conventional PCR. A tick is considered positive for the pathogen when inner amplicons from both Borrelia genes can be detected by agarose gel electrophoresis.

  20. Accurate, simple, and inexpensive assays to diagnose F8 gene inversion mutations in hemophilia A patients and carriers.

    PubMed

    Dutta, Debargh; Gunasekera, Devi; Ragni, Margaret V; Pratt, Kathleen P

    2016-12-27

    The most frequent mutations resulting in hemophilia A are an intron 22 or intron 1 gene inversion, which together cause ∼50% of severe hemophilia A cases. We report a simple and accurate RNA-based assay to detect these mutations in patients and heterozygous carriers. The assays do not require specialized equipment or expensive reagents; therefore, they may provide useful and economic protocols that could be standardized for central laboratory testing. RNA is purified from a blood sample, and reverse transcription nested polymerase chain reaction (RT-NPCR) reactions amplify DNA fragments with the F8 sequence spanning the exon 22 to 23 splice site (intron 22 inversion test) or the exon 1 to 2 splice site (intron 1 inversion test). These sequences will be amplified only from F8 RNA without an intron 22 or intron 1 inversion mutation, respectively. Additional RT-NPCR reactions are then carried out to amplify the inverted sequences extending from F8 exon 19 to the first in-frame stop codon within intron 22 or a chimeric transcript containing F8 exon 1 and the VBP1 gene. These latter 2 products are produced only by individuals with an intron 22 or intron 1 inversion mutation, respectively. The intron 22 inversion mutations may be further classified (eg, as type 1 or type 2, reflecting the specific homologous recombination sites) by the standard DNA-based "inverse-shifting" PCR assay if desired. Efficient Bcl I and T4 DNA ligase enzymes that cleave and ligate DNA in minutes were used, which is a substantial improvement over previous protocols that required overnight incubations. These protocols can accurately detect F8 inversion mutations via same-day testing of patient samples.

  1. A New Protocol to Detect Multiple Foodborne Pathogens with PCR Dipstick DNA Chromatography after a Six-Hour Enrichment Culture in a Broad-Range Food Pathogen Enrichment Broth

    PubMed Central

    Hayashi, Masahiro; Natori, Tatsuya; Kubota-Hayashi, Sayoko; Miyata, Machiko; Ohkusu, Kiyofumi; Kurazono, Hisao; Makino, Souichi; Ezaki, Takayuki

    2013-01-01

    A quick foodborne pathogen screening method after six-hour enrichment culture with a broad-range food pathogen enrichment broth is described. Pathogenic factors of Salmonella enterica, Shigella spp., enteroinvasive Escherichia coli, and enterohemorrhagic E. coli are amplified with a cocktail primer and rapid polymerase chain reaction (PCR), which finishes amplification in 30 min. The PCR amplicon was differentiated with a dipstick DNA chromatography assay in 5–10 min. Starting from a four- to six-hour enrichment culture, this assay was finished within 45 min. Detection sensitivity of this protocol was less than 2.5 CFU/25 g for S. enterica and 3.3 CFU/25 g for enterohemorrhagic E. coli in spiked ground meat experiments. PMID:24364031

  2. Transcript Quantification of Genes Involved in Steviol Glycoside Biosynthesis in Stevia rebaudiana Bertoni by Real-Time Polymerase Chain Reaction (RT-PCR).

    PubMed

    Modi, Arpan; Kumar, Nitish; Narayanan, Subhash

    2016-01-01

    Stevia (Stevia rebaudiana Bertoni) is a medicinal plant having sweet, diterpenoid glycosides known as steviol glycosides which are 200-300 times sweeter than sucrose (0.4 % solution). They are synthesized mainly in the leaves via plastid localized 2-C-methyl-D-erythrose-4-phosphate pathway (MEP pathway). Fifteen genes are involved in the formation of these glycosides. In the present protocol, a method for the quantification of transcripts of these genes is shown. The work involves RNA extraction and cDNA preparation, and therefore, procedures for the confirmation of DNA-free cDNA preparation have also been illustrated. Moreover, details of plant treatments are not mentioned as this protocol may apply to relative gene expression profile in any medicinal plant with any treatment. The treatments are numbered as T0 (Control), T1, T2, T3, and T4.

  3. A Novel Protocol to Analyze Short- and Long-Chain Fatty Acids Using Nonaqueous Microchip Capillary Electrophoresis

    NASA Technical Reports Server (NTRS)

    Cable, M. L.; Stockton, A. M.; Mora, Maria F; Willis, P. A.

    2013-01-01

    We propose a new protocol to identify and quantify both short- and long-chain saturated fatty acids in samples of astrobiological interest using non-aqueous microchip capillary electrophoresis (micronNACE) with laser induced fluorescence (LIF).

  4. Differentiation of human-induced pluripotent stem cells into insulin-producing clusters.

    PubMed

    Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad

    2015-02-01

    In diabetes mellitus type 1, beta cells are mostly destroyed; while in diabetes mellitus type 2, beta cells are reduced by 40% to 60%. We hope that soon, stem cells can be used in diabetes therapy via pancreatic beta cell replacement. Induced pluripotent stem cells are a kind of stem cell taken from an adult somatic cell by "stimulating" certain genes. These induced pluripotent stem cells may be a promising source of cell therapy. This study sought to produce isletlike clusters of insulin-producing cells taken from induced pluripotent stem cells. A human-induced pluripotent stem cell line was induced into isletlike clusters via a 4-step protocol, by adding insulin, transferrin, and selenium (ITS), N2, B27, fibroblast growth factor, and nicotinamide. During differentiation, expression of pancreatic β-cell genes was evaluated by reverse transcriptase-polymerase chain reaction; the morphologic changes of induced pluripotent stem cells toward isletlike clusters were observed by a light microscope. Dithizone staining was used to stain these isletlike clusters. Insulin produced by these clusters was evaluated by radio immunosorbent assay, and the secretion capacity was analyzed with a glucose challenge test. Differentiation was evaluated by analyzing the morphology, dithizone staining, real-time quantitative polymerase chain reaction, and immunocytochemistry. Gene expression of insulin, glucagon, PDX1, NGN3, PAX4, PAX6, NKX6.1, KIR6.2, and GLUT2 were documented by analyzing real-time quantitative polymerase chain reaction. Dithizone-stained cellular clusters were observed after 23 days. The isletlike clusters significantly produced insulin. The isletlike clusters could increase insulin secretion after a glucose challenge test. This work provides a model for studying the differentiation of human-induced pluripotent stem cells to insulin-producing cells.

  5. Colorimetric detection of mercury ion based on unmodified gold nanoparticles and target-triggered hybridization chain reaction amplification

    NASA Astrophysics Data System (ADS)

    Wang, Qing; Yang, Xiaohan; Yang, Xiaohai; Liu, Pei; Wang, Kemin; Huang, Jin; Liu, Jianbo; Song, Chunxia; Wang, Jingjing

    2015-02-01

    A novel unmodified gold nanoparticles (AuNPs)-based colorimetric strategy for label-free, specific and sensitive mercury ion (Hg2+) detection was demonstrated by using thymine-Hg2+-thymine (T-Hg2+-T) recognition mechanism and hybridization chain reaction (HCR) amplification strategy. In this protocol, a structure-switching probe (H0) was designed to recognize Hg2+ and then propagated a chain reaction of hybridization events between two other hairpin probes (H1 and H2). In the absence of Hg2+, all hairpin probes could stably coexist in solution, the exposed sticky ends of hairpin probes were capable of stabilizing AuNPs. As a result, salt-induced AuNPs aggregation could be effectively prevented. In the presence of Hg2+, thymine bases of H0 could specifically interact with Hg2+ to form stable T-Hg2+-T complex. Consequently, the hairpin structure of H0 probe was changed. As H1/H2 probes were added, the HCR process could be triggered and nicked double-helixes were formed. Since it was difficult for the formed nicked double-helixes to inhibit salt-induced AuNPs aggregation, a red-to-blue color change was observed in the colloid solution as the salt concentration increased. With the elegant amplification effect of HCR, a detection limit of around 30 nM was achieved (S/N = 3), which was about 1-2 orders of magnitudes lower than that of previous unmodified AuNPs-based colorimetric methods. By using the T-Hg2+-T recognition mechanism, high selectivity was also obtained. As an unmodified AuNPs-based colorimetric strategy, the system was simple in design, convenient in operation, and eliminated the requirements of separation processes, chemical modifications, and sophisticated instrumentations.

  6. Chain-reaction crash on a highway in high visibility

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2016-05-01

    We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

  7. Detection and quantitation of Kaposi's sarcoma-associated herpesvirus (KSHV) by a single competitive-quantitative polymerase chain reaction.

    PubMed

    Curreli, Francesca; Robles, Monica A; Friedman-Kien, Alvin E; Flore, Ornella

    2003-02-01

    Kaposi's sarcoma-associated herpesvirus is a novel herpesvirus linked to AIDS-related neoplasms. Currently it is difficult to evaluate the number of virions in viral preparation or in samples obtained from patients with Kaposi's sarcoma (KS), since no protocol for determining the plaque forming units of KSHV exists. We constructed a fragment of a different size than the target viral DNA to carry out a competitive-quantitative PCR. Both fragment and viral DNA were added to a single PCR reaction to compete for the same set of primers. By knowing the amount of the competitor added to the reaction, we could determine the number of viral DNA molecules. We used this assay successfully to detect and quantify KSHV genomes from KS skin biopsies and pleural effusion lymphoma, and from different viral preparations. To date, this is the most convenient and economic method that allows an accurate and fast viral detection/quantitation with a single PCR.

  8. Effect of vehicular size on chain-reaction crash

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-11-01

    We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

  9. Potential testing of reprocessing procedures by real-time polymerase chain reaction: A multicenter study of colonoscopy devices.

    PubMed

    Valeriani, Federica; Agodi, Antonella; Casini, Beatrice; Cristina, Maria Luisa; D'Errico, Marcello Mario; Gianfranceschi, Gianluca; Liguori, Giorgio; Liguori, Renato; Mucci, Nicolina; Mura, Ida; Pasquarella, Cesira; Piana, Andrea; Sotgiu, Giovanni; Privitera, Gaetano; Protano, Carmela; Quattrocchi, Annalisa; Ripabelli, Giancarlo; Rossini, Angelo; Spagnolo, Anna Maria; Tamburro, Manuela; Tardivo, Stefano; Veronesi, Licia; Vitali, Matteo; Romano Spica, Vincenzo

    2018-02-01

    Reprocessing of endoscopes is key to preventing cross-infection after colonoscopy. Culture-based methods are recommended for monitoring, but alternative and rapid approaches are needed to improve surveillance and reduce turnover times. A molecular strategy based on detection of residual traces from gut microbiota was developed and tested using a multicenter survey. A simplified sampling and DNA extraction protocol using nylon-tipped flocked swabs was optimized. A multiplex real-time polymerase chain reaction (PCR) test was developed that targeted 6 bacteria genes that were amplified in 3 mixes. The method was validated by interlaboratory tests involving 5 reference laboratories. Colonoscopy devices (n = 111) were sampled in 10 Italian hospitals. Culture-based microbiology and metagenomic tests were performed to verify PCR data. The sampling method was easily applied in all 10 endoscopy units and the optimized DNA extraction and amplification protocol was successfully performed by all of the involved laboratories. This PCR-based method allowed identification of both contaminated (n = 59) and fully reprocessed endoscopes (n = 52) with high sensibility (98%) and specificity (98%), within 3-4 hours, in contrast to the 24-72 hours needed for a classic microbiology test. Results were confirmed by next-generation sequencing and classic microbiology. A novel approach for monitoring reprocessing of colonoscopy devices was developed and successfully applied in a multicenter survey. The general principle of tracing biological fluids through microflora DNA amplification was successfully applied and may represent a promising approach for hospital hygiene. Copyright © 2018 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  10. Tools to minimize interlaboratory variability in vitellogenin gene expression monitoring programs

    USGS Publications Warehouse

    Jastrow, Aaron; Gordon, Denise A.; Auger, Kasie M.; Punska, Elizabeth C.; Arcaro, Kathleen F.; Keteles, Kristen; Winkelman, Dana L.; Lattier, David; Biales, Adam; Lazorchak, James M.

    2017-01-01

    The egg yolk precursor protein vitellogenin is widely used as a biomarker of estrogen exposure in male fish. However, standardized methodology is lacking and little is known regarding the reproducibility of results among laboratories using different equipment, reagents, protocols, and data analysis programs. To address this data gap we tested the reproducibility across laboratories to evaluate vitellogenin gene (vtg) expression and assessed the value of using a freely available software data analysis program. Samples collected from studies of male fathead minnows (Pimephales promelas) exposed to 17α-ethinylestradiol (EE2) and minnows exposed to processed wastewater effluent were evaluated for vtg expression in 4 laboratories. Our results indicate reasonable consistency among laboratories if the free software for expression analysis LinRegPCR is used, with 3 of 4 laboratories detecting vtg in fish exposed to 5 ng/L EE2 (n = 5). All 4 laboratories detected significantly increased vtg levels in 15 male fish exposed to wastewater effluent compared with 15 male fish held in a control stream. Finally, we were able to determine that the source of high interlaboratory variability from complementary deoxyribonucleic acid (cDNA) to quantitative polymerase chain reaction (qPCR) analyses was the expression analysis software unique to each real-time qPCR machine. We successfully eliminated the interlaboratory variability by reanalyzing raw fluorescence data with independent freeware, which yielded cycle thresholds and polymerase chain reaction (PCR) efficiencies that calculated results independently of proprietary software. Our results suggest that laboratories engaged in monitoring programs should validate their PCR protocols and analyze their gene expression data following the guidelines established in the present study for all gene expression biomarkers. 

  11. Two-step glutamate dehydrogenase antigen real-time polymerase chain reaction assay for detection of toxigenic Clostridium difficile.

    PubMed

    Goldenberg, S D; Cliff, P R; Smith, S; Milner, M; French, G L

    2010-01-01

    Current diagnosis of Clostridium difficile infection (CDI) relies upon detection of toxins A/B in stool by enzyme immunoassay [EIA(A/B)]. This strategy is unsatisfactory because it has a low sensitivity resulting in significant false negatives. We investigated the performance of a two-step algorithm for diagnosis of CDI using detection of glutamate dehydrogenase (GDH). GDH-positive samples were tested for C. difficile toxin B gene (tcdB) by polymerase chain reaction (PCR). The performance of the two-step protocol was compared with toxin detection by the Meridian Premier EIA kit in 500 consecutive stool samples from patients with suspected CDI. The reference standard among samples that were positive by either EIA(A/B) or GDH testing was culture cytotoxin neutralisation (culture/CTN). Thirty-six (7%) of 500 samples were identified as true positives by culture/CTN. EIA(A/B) identified 14 of the positive specimens with 22 false negatives and two false positives. The two-step protocol identified 34 of the positive samples with two false positives and two false negatives. EIA(A/B) had a sensitivity of 39%, specificity of 99%, positive predictive value of 88% and negative predictive value of 95%. The two-step algorithm performed better, with corresponding values of 94%, 99%, 94% and 99% respectively. Screening for GDH before confirmation of positives by PCR is cheaper than screening all specimens by PCR and is an effective method for routine use. Current EIA(A/B) tests for CDI are of inadequate sensitivity and should be replaced; however, this may result in apparent changes in CDI rates that would need to be explained in national surveillance statistics. Copyright 2009 The Hospital Infection Society. Published by Elsevier Ltd. All rights reserved.

  12. Kinetic aspects of chain growth in Fischer-Tropsch synthesis.

    PubMed

    Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M

    2017-04-28

    Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.

  13. An approach to natalizumab hypersensitivity: a case series of induction of tolerance.

    PubMed

    Camacho-Halili, Marie; George, Roxanne; Gottesman, Malcolm; Davis-Lorton, Mark

    2011-02-01

    Induction of tolerance protocols have been applied successfully to manage allergic reactions to many medications. Hypersensitivity reactions to natalizumab (TYSABRI®) have been recognized as a growing problem. In circumstances where a hypersensitivity reaction to a medication has occurred, but no suitable alternative exists, drug induction of tolerance protocols may be considered. Drug induction of tolerance protocols were performed in three patients with prior hypersensitivity reactions to natalizumab. All three patients tolerated the protocol without adverse reactions, allowing for the safe reintroduction of natalizumab. To conclude, this case series demonstrates success with an induction of tolerance procedure to a highly effective biological agent for multiple sclerosis, in patients with allergic reactions to natalizumab.

  14. The Compact and Biologically Relevant Structure of Inter-α-inhibitor Is Maintained by the Chondroitin Sulfate Chain and Divalent Cations.

    PubMed

    Scavenius, Carsten; Nikolajsen, Camilla Lund; Stenvang, Marcel; Thøgersen, Ida B; Wyrożemski, Łukasz; Wisniewski, Hans-Georg; Otzen, Daniel E; Sanggaard, Kristian W; Enghild, Jan J

    2016-02-26

    Inter-α-inhibitor is a proteoglycan of unique structure. The protein consists of three subunits, heavy chain 1, heavy chain 2, and bikunin covalently joined by a chondroitin sulfate chain originating at Ser-10 of bikunin. Inter-α-inhibitor interacts with an inflammation-associated protein, tumor necrosis factor-inducible gene 6 protein, in the extracellular matrix. This interaction leads to transfer of the heavy chains from the chondroitin sulfate of inter-α-inhibitor to hyaluronan and consequently to matrix stabilization. Divalent cations and heavy chain 2 are essential co-factors in this transfer reaction. In the present study, we have investigated how divalent cations in concert with the chondroitin sulfate chain influence the structure and stability of inter-α-inhibitor. The results showed that Mg(2+) or Mn(2+), but not Ca(2+), induced a conformational change in inter-α-inhibitor as evidenced by a decrease in the Stokes radius and a bikunin chondroitin sulfate-dependent increase of the thermodynamic stability. This structure was shown to be essential for the ability of inter-α-inhibitor to participate in extracellular matrix stabilization. In addition, the data revealed that bikunin was positioned adjacent to both heavy chains and that the two heavy chains also were in close proximity. The chondroitin sulfate chain interacted with all protein components and inter-α-inhibitor dissociated when it was degraded. Conventional purification protocols result in the removal of the Mg(2+) found in plasma and because divalent cations influence the conformation and affect function it is important to consider this when characterizing the biological activity of inter-α-inhibitor. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

    PubMed

    Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

    2015-01-01

    Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

  16. Run-length encoding graphic rules, biochemically editable designs and steganographical numeric data embedment for DNA-based cryptographical coding system

    PubMed Central

    Kawano, Tomonori

    2013-01-01

    There have been a wide variety of approaches for handling the pieces of DNA as the “unplugged” tools for digital information storage and processing, including a series of studies applied to the security-related area, such as DNA-based digital barcodes, water marks and cryptography. In the present article, novel designs of artificial genes as the media for storing the digitally compressed data for images are proposed for bio-computing purpose while natural genes principally encode for proteins. Furthermore, the proposed system allows cryptographical application of DNA through biochemically editable designs with capacity for steganographical numeric data embedment. As a model case of image-coding DNA technique application, numerically and biochemically combined protocols are employed for ciphering the given “passwords” and/or secret numbers using DNA sequences. The “passwords” of interest were decomposed into single letters and translated into the font image coded on the separate DNA chains with both the coding regions in which the images are encoded based on the novel run-length encoding rule, and the non-coding regions designed for biochemical editing and the remodeling processes revealing the hidden orientation of letters composing the original “passwords.” The latter processes require the molecular biological tools for digestion and ligation of the fragmented DNA molecules targeting at the polymerase chain reaction-engineered termini of the chains. Lastly, additional protocols for steganographical overwriting of the numeric data of interests over the image-coding DNA are also discussed. PMID:23750303

  17. Competitive RT-PCR Strategy for Quantitative Evaluation of the Expression of Tilapia (Oreochromis niloticus) Growth Hormone Receptor Type I

    PubMed Central

    2009-01-01

    Quantization of gene expression requires that an accurate measurement of a specific transcript is made. In this paper, a quantitative reverse transcription-polymerase chain reaction (RT-PCR) by competition for tilapia growth hormone receptor type I is designed and validated. This experimental procedure was used to determine the abundance of growth hormone receptor type I transcript in different tilapia tissues. The results obtained with this developed competitive RT-PCR were similar to real-time PCR results reported recently. This protocol provides a reliable alternative, but less expensive than real-time PCR to quantify specific genes. PMID:19495916

  18. Advances in the detection of telomerase activity using isothermal amplification

    PubMed Central

    Zhang, Xiaojin; Lou, Xiaoding; Xia, Fan

    2017-01-01

    Telomerase plays a significantly important role in keeping the telomere length of a chromosome. Telomerase overexpresses in nearly all tumor cells, suggesting that telomerase could be not only a promising biomarker but also a potential therapeutic target for cancers. Therefore, numerous efforts focusing on the detection of telomerase activity have been reported from polymerase chain reaction (PCR)-based telomeric repeat amplification protocol (TRAP) assays to PCR-free assays such as isothermal amplification in recent decade. In this review, we highlight the strategies for the detection of telomerase activity using isothermal amplification and discuss some of the challenges in designing future telomerase assays as well. PMID:28638472

  19. Identification of genus Acinetobacter: Standardization of in-house PCR and its comparison with conventional phenotypic methods.

    PubMed

    Kulkarni, Sughosh S; Madalgi, Radhika; Ajantha, Ganavalli S; Kulkarni, Raghavendra D

    2017-01-01

    Acinetobacter is grouped under nonfermenting Gram-negative bacilli. It is increasingly isolated from pathological samples. The ability of this genus to acquire drug resistance and spread in the hospital settings is posing a grave problem in healthcare. Specific treatment protocols are advocated for Acinetobacter infections. Hence, rapid identification and drug susceptibility profiling are critical in the management of these infections. To standardize an in-house polymerase chain reaction (PCR) for identification of genus Acinetobacter and to compare PCR with two protocols for its phenotypic identification. A total of 96 clinical isolates of Acinetobacter were included in the study. An in-house PCR for genus level identification of Acinetobacter was standardized. All the isolates were phenotypically identified by two protocols. The results of PCR and phenotypic identification protocols were compared. The in-house PCR standardized was highly sensitive and specific for the genus Acinetobacter . There was 100% agreement between the phenotypic and molecular identification of the genus. The preliminary identification tests routinely used in clinical laboratories were also in complete agreement with phenotypic and molecular identification. The in-house PCR for genus level identification is specific and sensitive. However, it may not be essential for routine identification as the preliminary phenotypic identification tests used in the clinical laboratory reliably identify the genus Acinetobacter .

  20. Molecular discrimination of Echinococcus granulosus and Echinococcus multilocularis by sequencing and a new PCR-RFLP method with the potential use for other Echinococcus species.

    PubMed

    Şakalar, Çağrı; Kuk, Salih; Erensoy, Ahmet; Dağli, Adile Ferda; Özercan, İbrahim Hanifi; Çetınkaya, Ülfet; Yazar, Süleyman

    2014-01-01

    To develop a novel polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) protocol using a new genomic marker sequence and a novel set of restriction enzymes in order to detect and discriminate 2 Echinococcus species, E. granulosus and E. multilocularis, found in formalin-fixed paraffin-embedded (FFPE) human tissues. DNA was isolated from 11 FFPE human tissue samples positive for cystic echinococcosis or alveolar echinococcosis. A mitochondrial genomic marker region was amplified and sequenced using a novel primer pair and a new PCR-RFLP protocol was developed for the detection and discrimination of E. granulosus and E. multilocularis using a set of restriction enzymes including AccI, MboI, MboII, and TsoI. The selected marker region was amplified using DNA isolated from FFPE human tissue samples positive for cystic echinococcosis or alveolar echinococcosis and the discrimination of E. granulosus and E. multilocularis was accomplished by use of the novel PCR-RFLP method. In this PCR-RFLP protocol, use of any single restriction enzyme is enough for the discrimination of E. granulosus and E. multilocularis. The PCR-RFLP protocol can be potentially used for the discrimination of 5 other Echinococcus species: E. oligarthus, E. shiquicus, E. ortleppi, E. canadensis, and E. vogeli.

  1. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  2. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  3. A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

    PubMed

    Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

    2016-12-01

    To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

  4. Insect Venom Immunotherapy: Analysis of the Safety and Tolerance of 3 Buildup Protocols Frequently Used in Spain.

    PubMed

    Gutiérrez Fernández, D; Moreno-Ancillo, A; Fernández Meléndez, S; Domínguez-Noche, C; Gálvez Ruiz, P; Alfaya Arias, T; Carballada González, F; Alonso Llamazares, A; Marques Amat, L; Vega Castro, A; Antolín Amérigo, D; Cruz Granados, S; Ruiz León, B; Sánchez Morillas, L; Fernández Sánchez, J; Soriano Gomis, V; Borja Segade, J; Dalmau Duch, G; Guspi Bori, R; Miranda Páez, A

    2016-01-01

    Hymenoptera venom immunotherapy (VIT) is an effective treatment but not one devoid of risk, as both local and systemic adverse reactions may occur, especially in the initial phases. We compared the tolerance to 3 VIT buildup protocols and analyzed risk factors associated with adverse reactions during this phase. We enrolled 165 patients divided into 3 groups based on the buildup protocol used (3, 4, and 9 weeks). The severity of systemic reactions was evaluated according to the World Allergy Organization model. Results were analyzed using exploratory descriptive statistics, and variables were compared using analysis of variance. Adverse reactions were recorded in 53 patients (32%) (43 local and 10 systemic). Local reactions were immediate in 27 patients (63%) and delayed in 16 (37%). The severity of the local reaction was slight/moderate in 15 patients and severe in 13. Systemic reactions were grade 1-2. No significant association was found between the treatment modality and the onset of local or systemic adverse reactions or the type of local reaction. We only found a statistically significant association between severity of the local reaction and female gender. As for the risk factors associated with systemic reactions during the buildup phase, we found no significant differences in values depending on the protocol used or the insect responsible. The buildup protocols compared proved to be safe and did not differ significantly from one another. In the population studied, patients undergoing the 9-week schedule presented no systemic reactions. Therefore, this protocol can be considered the safest approach.

  5. Press Releases | Argonne National Laboratory

    Science.gov Websites

    Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

  6. Fast equilibration protocol for million atom systems of highly entangled linear polyethylene chains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sliozberg, Yelena R.; TKC Global, Inc., Aberdeen Proving Ground, Maryland 21005; Kröger, Martin

    Equilibrated systems of entangled polymer melts cannot be produced using direct brute force equilibration due to the slow reptation dynamics exhibited by high molecular weight chains. Instead, these dense systems are produced using computational techniques such as Monte Carlo-Molecular Dynamics hybrid algorithms, though the use of soft potentials has also shown promise mainly for coarse-grained polymeric systems. Through the use of soft-potentials, the melt can be equilibrated via molecular dynamics at intermediate and long length scales prior to switching to a Lennard-Jones potential. We will outline two different equilibration protocols, which use various degrees of information to produce the startingmore » configurations. In one protocol, we use only the equilibrium bond angle, bond length, and target density during the construction of the simulation cell, where the information is obtained from available experimental data and extracted from the force field without performing any prior simulation. In the second protocol, we moreover utilize the equilibrium radial distribution function and dihedral angle distribution. This information can be obtained from experimental data or from a simulation of short unentangled chains. Both methods can be used to prepare equilibrated and highly entangled systems, but the second protocol is much more computationally efficient. These systems can be strictly monodisperse or optionally polydisperse depending on the starting chain distribution. Our protocols, which utilize a soft-core harmonic potential, will be applied for the first time to equilibrate a million particle system of polyethylene chains consisting of 1000 united atoms at various temperatures. Calculations of structural and entanglement properties demonstrate that this method can be used as an alternative towards the generation of entangled equilibrium structures.« less

  7. Breakthrough reactions of iodinated and gadolinium contrast media after oral steroid premedication protocol.

    PubMed

    Jingu, Akiko; Fukuda, Junya; Taketomi-Takahashi, Ayako; Tsushima, Yoshito

    2014-10-06

    Adverse reactions to iodinated and gadolinium contrast media are an important clinical issue. Although some guidelines have proposed oral steroid premedication protocols to prevent adverse reactions, some patients may have reactions to contrast media in spite of premedication (breakthrough reaction; BTR).The purpose of this study was to assess the frequency, type and severity of BTR when following an oral steroid premedication protocol. All iodinated and gadolinium contrast-enhanced radiologic examinations between August 2011 and February 2013 for which the premedication protocol was applied in our institution were assessed for BTRs. The protocol was applied to a total of 252 examinations (153 patients, ages 15-87 years; 63 males, 90 females). Of these, 152 were for prior acute adverse reactions to contrast media, 85 were for a history of bronchial asthma, and 15 were for other reasons. There were 198 contrast enhanced CTs and 54 contrast enhanced MRIs. There were nine BTR (4.5%) for iodinated contrast media, and only one BTR (1.9%) for gadolinium contrast media: eight were mild and one was moderate. No patient who had a mild index reaction (IR) had a severe BTR. Incidence of BTRs when following the premedication protocol was low. This study by no means proves the efficacy of premedication, but provides some support for following a premedication protocol to improve safety of contrast-enhanced examinations when prior adverse reactions are mild, or when there is a history of asthma.

  8. Breakthrough reactions of iodinated and gadolinium contrast media after oral steroid premedication protocol

    PubMed Central

    2014-01-01

    Background Adverse reactions to iodinated and gadolinium contrast media are an important clinical issue. Although some guidelines have proposed oral steroid premedication protocols to prevent adverse reactions, some patients may have reactions to contrast media in spite of premedication (breakthrough reaction; BTR). The purpose of this study was to assess the frequency, type and severity of BTR when following an oral steroid premedication protocol. Methods All iodinated and gadolinium contrast-enhanced radiologic examinations between August 2011 and February 2013 for which the premedication protocol was applied in our institution were assessed for BTRs. Results The protocol was applied to a total of 252 examinations (153 patients, ages 15–87 years; 63 males, 90 females). Of these, 152 were for prior acute adverse reactions to contrast media, 85 were for a history of bronchial asthma, and 15 were for other reasons. There were 198 contrast enhanced CTs and 54 contrast enhanced MRIs. There were nine BTR (4.5%) for iodinated contrast media, and only one BTR (1.9%) for gadolinium contrast media: eight were mild and one was moderate. No patient who had a mild index reaction (IR) had a severe BTR. Conclusion Incidence of BTRs when following the premedication protocol was low. This study by no means proves the efficacy of premedication, but provides some support for following a premedication protocol to improve safety of contrast-enhanced examinations when prior adverse reactions are mild, or when there is a history of asthma. PMID:25287952

  9. Calibration-free assays on standard real-time PCR devices

    PubMed Central

    Debski, Pawel R.; Gewartowski, Kamil; Bajer, Seweryn; Garstecki, Piotr

    2017-01-01

    Quantitative Polymerase Chain Reaction (qPCR) is one of central techniques in molecular biology and important tool in medical diagnostics. While being a golden standard qPCR techniques depend on reference measurements and are susceptible to large errors caused by even small changes of reaction efficiency or conditions that are typically not marked by decreased precision. Digital PCR (dPCR) technologies should alleviate the need for calibration by providing absolute quantitation using binary (yes/no) signals from partitions provided that the basic assumption of amplification a single target molecule into a positive signal is met. Still, the access to digital techniques is limited because they require new instruments. We show an analog-digital method that can be executed on standard (real-time) qPCR devices. It benefits from real-time readout, providing calibration-free assessment. The method combines advantages of qPCR and dPCR and bypasses their drawbacks. The protocols provide for small simplified partitioning that can be fitted within standard well plate format. We demonstrate that with the use of synergistic assay design standard qPCR devices are capable of absolute quantitation when normal qPCR protocols fail to provide accurate estimates. We list practical recipes how to design assays for required parameters, and how to analyze signals to estimate concentration. PMID:28327545

  10. Calibration-free assays on standard real-time PCR devices

    NASA Astrophysics Data System (ADS)

    Debski, Pawel R.; Gewartowski, Kamil; Bajer, Seweryn; Garstecki, Piotr

    2017-03-01

    Quantitative Polymerase Chain Reaction (qPCR) is one of central techniques in molecular biology and important tool in medical diagnostics. While being a golden standard qPCR techniques depend on reference measurements and are susceptible to large errors caused by even small changes of reaction efficiency or conditions that are typically not marked by decreased precision. Digital PCR (dPCR) technologies should alleviate the need for calibration by providing absolute quantitation using binary (yes/no) signals from partitions provided that the basic assumption of amplification a single target molecule into a positive signal is met. Still, the access to digital techniques is limited because they require new instruments. We show an analog-digital method that can be executed on standard (real-time) qPCR devices. It benefits from real-time readout, providing calibration-free assessment. The method combines advantages of qPCR and dPCR and bypasses their drawbacks. The protocols provide for small simplified partitioning that can be fitted within standard well plate format. We demonstrate that with the use of synergistic assay design standard qPCR devices are capable of absolute quantitation when normal qPCR protocols fail to provide accurate estimates. We list practical recipes how to design assays for required parameters, and how to analyze signals to estimate concentration.

  11. Duplex real-time polymerase chain reaction reveals competition between Erwinia amylovora and E. pyrifoliae on pear blossoms.

    PubMed

    Lehman, Susan M; Kim, Won-Sik; Castle, Alan J; Svircev, Antonet M

    2008-06-01

    Erwinia amylovora and E. pyrifoliae are the causative agents of fire blight and Asian pear blight, respectively. The pathogens are closely related, with overlapping host ranges. Data are unavailable on the current distribution of E. pyrifoliae and on the interaction between the two species when they are present together on the same host. In this study, a duplex real-time polymerase chain reaction (PCR) protocol was developed to monitor the population dynamics of E. amylovora and E. pyrifoliae on the surface of Bartlett pear blossoms. Bacterial cells washed from blossoms were used directly as the PCR template without DNA extraction. Primers and a probe based on the E. amylovora levansucrase gene detected all E. amylovora strains. All E. pyrifoliae strains, including the Japanese Erwinia strains previously described as E. amylovora, were detected with a primer and probe combination based on the E. pyrifoliae hrpW gene. Disease development and severity were not significantly different in blossoms inoculated with individual Erwinia species or with a mixture of the two species. However, E. amylovora grew to greater population sizes than did E. pyrifoliae in both single species inoculations and in mixtures, suggesting that E. amylovora has a greater competitive fitness on Bartlett pear blossoms than E. pyrifoliae.

  12. Introduction to Polymer Chemistry.

    ERIC Educational Resources Information Center

    Harris, Frank W.

    1981-01-01

    Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

  13. DNA assembly with error correction on a droplet digital microfluidics platform.

    PubMed

    Khilko, Yuliya; Weyman, Philip D; Glass, John I; Adams, Mark D; McNeil, Melanie A; Griffin, Peter B

    2018-06-01

    Custom synthesized DNA is in high demand for synthetic biology applications. However, current technologies to produce these sequences using assembly from DNA oligonucleotides are costly and labor-intensive. The automation and reduced sample volumes afforded by microfluidic technologies could significantly decrease materials and labor costs associated with DNA synthesis. The purpose of this study was to develop a gene assembly protocol utilizing a digital microfluidic device. Toward this goal, we adapted bench-scale oligonucleotide assembly methods followed by enzymatic error correction to the Mondrian™ digital microfluidic platform. We optimized Gibson assembly, polymerase chain reaction (PCR), and enzymatic error correction reactions in a single protocol to assemble 12 oligonucleotides into a 339-bp double- stranded DNA sequence encoding part of the human influenza virus hemagglutinin (HA) gene. The reactions were scaled down to 0.6-1.2 μL. Initial microfluidic assembly methods were successful and had an error frequency of approximately 4 errors/kb with errors originating from the original oligonucleotide synthesis. Relative to conventional benchtop procedures, PCR optimization required additional amounts of MgCl 2 , Phusion polymerase, and PEG 8000 to achieve amplification of the assembly and error correction products. After one round of error correction, error frequency was reduced to an average of 1.8 errors kb - 1 . We demonstrated that DNA assembly from oligonucleotides and error correction could be completely automated on a digital microfluidic (DMF) platform. The results demonstrate that enzymatic reactions in droplets show a strong dependence on surface interactions, and successful on-chip implementation required supplementation with surfactants, molecular crowding agents, and an excess of enzyme. Enzymatic error correction of assembled fragments improved sequence fidelity by 2-fold, which was a significant improvement but somewhat lower than expected compared to bench-top assays, suggesting an additional capacity for optimization.

  14. Non-adiabatic quantum state preparation and quantum state transport in chains of Rydberg atoms

    NASA Astrophysics Data System (ADS)

    Ostmann, Maike; Minář, Jiří; Marcuzzi, Matteo; Levi, Emanuele; Lesanovsky, Igor

    2017-12-01

    Motivated by recent progress in the experimental manipulation of cold atoms in optical lattices, we study three different protocols for non-adiabatic quantum state preparation and state transport in chains of Rydberg atoms. The protocols we discuss are based on the blockade mechanism between atoms which, when excited to a Rydberg state, interact through a van der Waals potential, and rely on single-site addressing. Specifically, we discuss protocols for efficient creation of an antiferromagnetic GHZ state, a class of matrix product states including a so-called Rydberg crystal and for the state transport of a single-qubit quantum state between two ends of a chain of atoms. We identify system parameters allowing for the operation of the protocols on timescales shorter than the lifetime of the Rydberg states while yielding high fidelity output states. We discuss the effect of positional disorder on the resulting states and comment on limitations due to other sources of noise such as radiative decay of the Rydberg states. The proposed protocols provide a testbed for benchmarking the performance of quantum information processing platforms based on Rydberg atoms.

  15. Polymerization as a Model Chain Reaction

    ERIC Educational Resources Information Center

    Morton, Maurice

    1973-01-01

    Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

  16. Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

    DOE R&D Accomplishments Database

    Weinberg, Alvin M.; Noderer, L. C.

    1951-05-15

    The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

  17. Dengue virus in bats from southeastern Mexico.

    PubMed

    Sotomayor-Bonilla, Jesús; Chaves, Andrea; Rico-Chávez, Oscar; Rostal, Melinda K; Ojeda-Flores, Rafael; Salas-Rojas, Mónica; Aguilar-Setien, Álvaro; Ibáñez-Bernal, Sergio; Barbachano-Guerrero, Arturo; Gutiérrez-Espeleta, Gustavo; Aguilar-Faisal, J Leopoldo; Aguirre, A Alonso; Daszak, Peter; Suzán, Gerardo

    2014-07-01

    To identify the relationship between landscape use and dengue virus (DENV) occurrence in bats, we investigated the presence of DENV from anthropogenically changed and unaltered landscapes in two Biosphere Reserves: Calakmul (Campeche) and Montes Azules (Chiapas) in southern Mexico. Spleen samples of 146 bats, belonging to 16 species, were tested for four DENV serotypes with standard reverse transcriptase polymerase chain reaction (RT-PCR) protocols. Six bats (4.1%) tested positive for DENV-2: four bats in Calakmul (two Glossophaga soricina, one Artibeus jamaicensis, and one A. lituratus) and two bats in Montes Azules (both A. lituratus). No effect of anthropogenic disturbance on the occurrence of DENV was detected; however, all three RT-PCR-positive bat species are considered abundant species in the Neotropics and well-adapted to disturbed habitats. To our knowledge, this study is the first study conducted in southeastern Mexico to identify DENV-2 in bats by a widely accepted RT-PCR protocol. The role that bats play on DENV's ecology remains undetermined. © The American Society of Tropical Medicine and Hygiene.

  18. Development of a real-time PCR protocol for the species origin confirmation of isolated animal particles detected by NIRM.

    PubMed

    Fumière, O; Marien, A; Fernández Pierna, J A; Baeten, V; Berben, G

    2010-08-01

    At present, European legislation prohibits totally the use of processed animal proteins in feed for all farmed animals (Commission Regulation (EC) No. 1234/2003-extended feed ban). A softening of the feed ban for non-ruminants would nevertheless be considered if alternative methods could be used to gain more information concerning the species origin of processed animal proteins than that which can be provided by classical optical microscopy. This would allow control provisions such as the ban of feeding animals with proteins from the same species or intra-species recycling (Regulation (EC) No. 1774/2002). Two promising alternative methods, near-infrared microscopy (NIRM) and real-time polymerase chain reaction (PCR), were combined to authenticate, at the species level, the presence of animal particles. The paper describes the improvements of the real-time PCR method made to the DNA extraction protocol, allowing five PCR analyses to be performed with the DNA extracted from a single particle.

  19. Agrobacterium tumefaciens-mediated transformation of Phellodendron amurense Rupr. using mature-seed explants.

    PubMed

    Yang, Jingli; Zhao, Bo; Kim, Yeon Bok; Zhou, Chenguang; Li, Chunyan; Chen, Yunlin; Zhang, Haizhen; Li, Cheng Hao

    2013-01-01

    An efficient transformation protocol was developed for Agrobacterium-mediated transformation of Phellodendron amurense Rupr. for using explants from mature seeds. The binary vector pCAMBIA1303, which contained hygromycin phosphotransferase (hptII) as a selectable marker gene and β-glucuronidase (GUS) as a reporter gene, was used for transformation studies. Different factors that affect survival of transformed buds, namely Agrobacterium infection method, bacterial strain, pre-culture duration, acetosyringone concentration, co-culture duration, and co-culture temperature were examined and optimized for transformation efficiency on the basis of GUS staining of hygromycin-resistant buds. Polymerase chain reaction (PCR), Southern blot and reverse transcription PCR confirmed the presence of the GUS gene. A transformation frequency of 13.1 % was achieved under optimized conditions for transformation (A. tumefaciens strain EHA105, 4 days co-cultivation at 4 °C, and infection of the pre-cultured mature-seed explants for 2 days). This is the first report of a successful genetic transformation protocol for P. amurense.

  20. Dengue Virus in Bats from Southeastern Mexico

    PubMed Central

    Sotomayor-Bonilla, Jesús; Chaves, Andrea; Rico-Chávez, Oscar; Rostal, Melinda K.; Ojeda-Flores, Rafael; Salas-Rojas, Mónica; Aguilar-Setien, Álvaro; Ibáñez-Bernal, Sergio; Barbachano-Guerrero, Arturo; Gutiérrez-Espeleta, Gustavo; Aguilar-Faisal, J. Leopoldo; Aguirre, A. Alonso; Daszak, Peter; Suzán, Gerardo

    2014-01-01

    To identify the relationship between landscape use and dengue virus (DENV) occurrence in bats, we investigated the presence of DENV from anthropogenically changed and unaltered landscapes in two Biosphere Reserves: Calakmul (Campeche) and Montes Azules (Chiapas) in southern Mexico. Spleen samples of 146 bats, belonging to 16 species, were tested for four DENV serotypes with standard reverse transcriptase polymerase chain reaction (RT-PCR) protocols. Six bats (4.1%) tested positive for DENV-2: four bats in Calakmul (two Glossophaga soricina, one Artibeus jamaicensis, and one A. lituratus) and two bats in Montes Azules (both A. lituratus). No effect of anthropogenic disturbance on the occurrence of DENV was detected; however, all three RT-PCR–positive bat species are considered abundant species in the Neotropics and well-adapted to disturbed habitats. To our knowledge, this study is the first study conducted in southeastern Mexico to identify DENV-2 in bats by a widely accepted RT-PCR protocol. The role that bats play on DENV's ecology remains undetermined. PMID:24752688

  1. Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins

    NASA Astrophysics Data System (ADS)

    Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John

    2017-01-01

    DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.

  2. Loop-Mediated Isothermal Amplification (LAMP): Emergence As an Alternative Technology for Herbal Medicine Identification.

    PubMed

    Li, Jing-Jian; Xiong, Chao; Liu, Yue; Liang, Jun-Song; Zhou, Xing-Wen

    2016-01-01

    Correct identification of medicinal plant ingredients is essential for their safe use and for the regulation of herbal drug supply chain. Loop-mediated isothermal amplification (LAMP) is a recently developed approach to identify herbal medicine species. This novel molecular biology technique enables timely and accurate testing, especially in settings where infrastructures to support polymerase chain reaction facilities are lacking. Studies that used this method have altered our view on the extent and complexity of herbal medicine identification. In this review, we give an introduction into LAMP analysis, covers the basic principles and important aspects in the development of LAMP analysis method. Then we presented a critical review of the application of LAMP-based methods in detecting and identifying raw medicinal plant materials and their processed products. We also provide a practical standard operating procedure (SOP) for the utilization of the LAMP protocol in herbal authentication, and consider the prospects of LAMP technology in the future developments of herbal medicine identification and the challenges associated with its application.

  3. Loop-Mediated Isothermal Amplification (LAMP): Emergence As an Alternative Technology for Herbal Medicine Identification

    PubMed Central

    Li, Jing-jian; Xiong, Chao; Liu, Yue; Liang, Jun-song; Zhou, Xing-wen

    2016-01-01

    Correct identification of medicinal plant ingredients is essential for their safe use and for the regulation of herbal drug supply chain. Loop-mediated isothermal amplification (LAMP) is a recently developed approach to identify herbal medicine species. This novel molecular biology technique enables timely and accurate testing, especially in settings where infrastructures to support polymerase chain reaction facilities are lacking. Studies that used this method have altered our view on the extent and complexity of herbal medicine identification. In this review, we give an introduction into LAMP analysis, covers the basic principles and important aspects in the development of LAMP analysis method. Then we presented a critical review of the application of LAMP-based methods in detecting and identifying raw medicinal plant materials and their processed products. We also provide a practical standard operating procedure (SOP) for the utilization of the LAMP protocol in herbal authentication, and consider the prospects of LAMP technology in the future developments of herbal medicine identification and the challenges associated with its application. PMID:28082999

  4. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  5. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  6. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  7. Emilio Segrè and Spontaneous Fission

    Science.gov Websites

    fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

  8. Constructing STR multiplex assays.

    PubMed

    Butler, John M

    2005-01-01

    Multiplex polymerase chain reaction (PCR) refers to the simultaneous amplification of multiple regions of deoxyribonucleic acid (DNA) using PCR. Commercial short tandem repeat (STR) assays that can coamplify as many as 16 different loci have become widely used in forensic DNA typing. This chapter will focus on some of the aspects of constructing robust STR multiplex assays, including careful design and quality control of PCR primers. Examples from the development of a cat STR 12plex and a human Y chromosome STR 20plex are used to illustrate the importance of various parts of the protocol. Primer design parameters and Internet-accessible resources are discussed, as are solutions to problems with residual dye artifacts that result from impure primers.

  9. Detection of Food Allergens by Taqman Real-Time PCR Methodology.

    PubMed

    García, Aina; Madrid, Raquel; García, Teresa; Martín, Rosario; González, Isabel

    2017-01-01

    Real-time PCR (polymerase chain reaction) has shown to be a very effective technology for the detection of food allergens. The protocol described herein consists on a real-time PCR assay targeting the plant ITS (Internal Transcribed Spacer) region, using species-specific primers and hydrolysis probes (Taqman) dual labeled with a reporter fluorophore at the 5' end (6-carboxyfluorescein, FAM) and a quencher fluorophore at the 3' end (Blackberry, BBQ). The species-specific real-time PCR systems (primers/probe) described in this work allowed the detection of different nuts (peanut, hazelnut, pistachio, almond, cashew, macadamia, walnut and pecan), common allergens present in commercial food products, with a detection limit of 0.1 mg/kg.

  10. Accurate multiplex polony sequencing of an evolved bacterial genome.

    PubMed

    Shendure, Jay; Porreca, Gregory J; Reppas, Nikos B; Lin, Xiaoxia; McCutcheon, John P; Rosenbaum, Abraham M; Wang, Michael D; Zhang, Kun; Mitra, Robi D; Church, George M

    2005-09-09

    We describe a DNA sequencing technology in which a commonly available, inexpensive epifluorescence microscope is converted to rapid nonelectrophoretic DNA sequencing automation. We apply this technology to resequence an evolved strain of Escherichia coli at less than one error per million consensus bases. A cell-free, mate-paired library provided single DNA molecules that were amplified in parallel to 1-micrometer beads by emulsion polymerase chain reaction. Millions of beads were immobilized in a polyacrylamide gel and subjected to automated cycles of sequencing by ligation and four-color imaging. Cost per base was roughly one-ninth as much as that of conventional sequencing. Our protocols were implemented with off-the-shelf instrumentation and reagents.

  11. Molecular screening for hemotropic mycoplasmas in captive Barbary sheep (Ammotragus lervia) in southern Brazil.

    PubMed

    Santos, Leonilda C; Vidotto, Odilon; Morikawa, Vivien M; Santos, Nelson J R; Vieira, Thállitha S W J; Barros Filho, Ivan R; Vieira, Rafael F C; Biondo, Alexander W

    2017-08-01

    This study is part of an active surveillance program for monitoring animal health status in endangered species, and was conducted to screen captive Barbary sheep ( Ammotragus lervia ) for hemoplasma infection. A total of 12 blood samples were collected, DNA extracted and further tested by a pan-hemoplasma polymerase chain reaction protocol. Animals were clinically healthy and not infested by ectoparasites. Although housekeeping gene DNA was successfully amplified, all the Barbary sheep samples tested negative for Mycoplasma sp. Notwithstanding the negative results, molecular pathogen surveys on Barbary sheep and other exotic wild mammals may provide insights regarding infection of endangered species caused by captivity stress in association with exposure to new pathogens worldwide.

  12. A Fluorescent In Vitro Assay to Investigate Paralog-Specific SUMO Conjugation.

    PubMed

    Eisenhardt, Nathalie; Chaugule, Viduth K; Pichler, Andrea

    2016-01-01

    Protein modification with the small ubiquitin-related modifier SUMO is a potent regulatory mechanism implicated in a variety of biological pathways. In vitro sumoylation reactions have emerged as a versatile tool to identify and characterize novel SUMO enzymes as well as their substrates. Here, we present detailed protocols for the purification and fluorescent labeling of mammalian SUMO paralogs for their application in sumoylation assays. These assays provide a fast readout for in vitro SUMO chain formation activity of E3 ligases in a paralog-specific manner. Finally, we critically analyze the application of fluorescent SUMO proteins to study substrate modification in vitro revealing also the drawbacks of the system.

  13. Molecular detection of Borrelia burgdorferi sensu lato – An analytical comparison of real-time PCR protocols from five different Scandinavian laboratories

    PubMed Central

    Faller, Maximilian; Wilhelmsson, Peter; Kjelland, Vivian; Andreassen, Åshild; Dargis, Rimtas; Quarsten, Hanne; Dessau, Ram; Fingerle, Volker; Margos, Gabriele; Noraas, Sølvi; Ornstein, Katharina; Petersson, Ann-Cathrine; Matussek, Andreas; Lindgren, Per-Eric; Henningsson, Anna J.

    2017-01-01

    Introduction Lyme borreliosis (LB) is the most common tick transmitted disease in Europe. The diagnosis of LB today is based on the patient´s medical history, clinical presentation and laboratory findings. The laboratory diagnostics are mainly based on antibody detection, but in certain conditions molecular detection by polymerase chain reaction (PCR) may serve as a complement. Aim The purpose of this study was to evaluate the analytical sensitivity, analytical specificity and concordance of eight different real-time PCR methods at five laboratories in Sweden, Norway and Denmark. Method Each participating laboratory was asked to analyse three different sets of samples (reference panels; all blinded) i) cDNA extracted and transcribed from water spiked with cultured Borrelia strains, ii) cerebrospinal fluid spiked with cultured Borrelia strains, and iii) DNA dilution series extracted from cultured Borrelia and relapsing fever strains. The results and the method descriptions of each laboratory were systematically evaluated. Results and conclusions The analytical sensitivities and the concordance between the eight protocols were in general high. The concordance was especially high between the protocols using 16S rRNA as the target gene, however, this concordance was mainly related to cDNA as the type of template. When comparing cDNA and DNA as the type of template the analytical sensitivity was in general higher for the protocols using DNA as template regardless of the use of target gene. The analytical specificity for all eight protocols was high. However, some protocols were not able to detect Borrelia spielmanii, Borrelia lusitaniae or Borrelia japonica. PMID:28937997

  14. Chain Reaction Polymerization.

    ERIC Educational Resources Information Center

    McGrath, James E.

    1981-01-01

    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  15. Characterizing Chain Processes in Visible Light Photoredox Catalysis

    PubMed Central

    Cismesia, Megan A.

    2015-01-01

    The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708

  16. Systemic and local reactions of bee venom immunotherapy in Iran.

    PubMed

    Bemanian, Mohammad Hassan; Farhoudi, Abolhassan; Pourpak, Zahra; Gharagozlou, Mohammad; Movahedi, Masoud; Nabavi, Mohammad; Mozafari, Habibeh; Mohammadzadeh, Iraj; Chavoshzadeh, Zahra; Shirkhoda, Zahra

    2007-12-01

    Severe allergic reactions during specific immunotherapy may occur in the treatment of hymenoptera sting allergy. The objective of the present study was to examine the characteristics of allergic reactions during specific immunotherapy in patients with allergy towards hymenoptera venom in the Iranian population. A prospective study was performed using the clinical reports of 27 patients with anaphylaxis to bee venom (Apis melifera, Geupes vespula and Geupes Polites). Ten patients treated with Cluster protocol during 2002 and 2006 After diagnosis of hymenoptera sting allergy according to history and intradermal tests, the patient were treated with Cluster protocol immunotherapy. The protocol lasted 6 weeks with an increase in the concentration of venom from 0.01 microg/ml to 100 microg/ml. None of the patient received premedication. All patients with hymenoptera venom allergy received 120 injections. Anaphylactic reactions were classified according to the Mueller-classification. The frequencies of systemic reactions during Cluster protocol were 8.33% and 5% for yellow jacket and honey bee venom respectively. No patient experienced severe systemic reaction. Cluster protocol for hymenoptera immunotherapy is a reliable method for the treatment of anaphylactic reactions to bee venom. It is safe with low cost and do not need hospitalization.

  17. Skeletal and cardiac myogenesis accompany adipogenesis in P19 embryonal stem cells.

    PubMed

    Bouchard, Frédéric; Paquin, Joanne

    2009-09-01

    P19 embryonic carcinoma cells resemble normal embryonic stem (ES) cells. They generate cardiac and skeletal myocytes in response to retinoic acid (RA) or oxytocin (OT). RA treatment followed by exposure to triiodothyronine (T3) and insulin induces ES cells differentiation into adipocytes and skeletomyocytes. On the other hand, OT (10(-7) M) was reported to inhibit 3T3 preadipocyte maturation. The present work was undertaken to determine whether P19 cells have an adipogenic potential that could be affected by OT. Cells were treated with RA (10(-6) M)/T3+insulin (adipogenic protocol) or 10(-7) M OT (cardiomyogenic protocol), and analyzed by polymerase chain reaction, immunotechniques, and cytochemistry. Oil-Red-O staining and expression of peroxisome proliferator-activated receptor-gamma (PPARgamma) and aP2 indicated the generation of adipocytes in cultures submitted to the adipogenic protocol. Contracting cells were also generated. Cells positive for sarcomeric actinin and negative for cardiac troponin inhibitor (cTpnI) indicated generation of skeletomyocytes, and cTpnI positive cells revealed generation of cardiomyocytes. Levels of cTpnI and of the skeletal marker MyoD were almost similar in both protocols, whereas no Oil-Red-O staining was associated with the cardiomyogenic protocol. Addition of 10(-7) M OT to the adipogenic protocol did not affect Oil-Red-O staining and PPARgamma expression. Interestingly, Oct3/4 pluripotency marker disappeared in the adipogenic protocol but remained expressed in the cardiomyogenic one. P19 cells thus have an adipogenic potential non affected by 10(-7) M OT. RA/T3+insulin combination generates a larger spectrum of mesodermal cell derivatives and is a more potent morphogenic treatment than OT. P19 cells could help investigating mechanisms of cell fate decision during development.

  18. Optimizing Virus Identification in Critically Ill Children Suspected of Having an Acute Severe Viral Infection.

    PubMed

    Randolph, Adrienne G; Agan, Anna A; Flanagan, Ryan F; Meece, Jennifer K; Fitzgerald, Julie C; Loftis, Laura L; Truemper, Edward J; Li, Simon; Ferdinands, Jill M

    2016-04-01

    Multiplex rapid viral tests and nasopharyngeal flocked swabs are increasingly used for viral testing in PICUs. This study aimed at evaluating how the sampling site and the type of diagnostic test influence test results in children with suspected severe viral infection. Prospective cohort study. PICUs at 21 tertiary pediatric referral centers in the United States. During the 2010-2011 and 2011-2012 influenza seasons, we enrolled children (6 mo to 17 yr old) who were suspected to have severe viral infection. We collected samples by using a standardized protocol for nasopharyngeal aspirate and nasopharyngeal flocked swabs in nonintubated patients and for endotracheal tube aspirate and nasopharyngeal flocked swabs in intubated patients. Viral testing included a single reverse transcription-polymerase chain reaction influenza test and the GenMark Respiratory Viral Panel (20 viruses). We enrolled 90 endotracheally intubated and 133 nonintubated children. We identified influenza in 45 patients with reverse transcription-polymerase chain reaction testing; the multiplex panel was falsely negative for influenza in two patients (4.4%). Six patients (13.3%) had not been diagnosed with influenza in the PICU. Non-influenza viruses were identified in 172 of 223 children (77.1%). In nonintubated children, the same virus was identified by nasopharyngeal flocked swabs and nasopharyngeal aspirate in 133 of 183 paired samples (72.7%), with +nasopharyngeal aspirate/-nasopharyngeal flocked swabs in 32 of 183 paired samples (17.4%). In intubated children, the same virus was identified by nasopharyngeal flocked swabs and endotracheal tube aspirate in 67 of 94 paired samples (71.3%), with +nasopharyngeal flocked swabs/- endotracheal tube aspirate in 22 of 94 paired samples (23.4%). Most discrepancies were either adenovirus or rhinovirus in both groups. Standardized specimen collection and sensitive diagnostic testing with a reverse transcription-polymerase chain reaction increased the identification of influenza in critically ill children. For most pathogenic viruses identified, results from nasopharyngeal flocked swabs agreed with those from nasopharyngeal or endotracheal aspirates.

  19. Development of a dry-reagent mix-based polymerase chain reaction as a novel tool for the identification of Acinetobacter species and its comparison with conventional polymerase chain reaction

    PubMed Central

    Kulkarni, Raghavendra D.; Mishra, Mukti Nath; Mohanraj, Jeevanandam; Chandrasekhar, Arun; Ajantha, G. S.; Kulkani, Sheetal; Bhat, Shama

    2018-01-01

    BACKGROUND: Nosocomial infections are often caused by multidrug-resistant bacteria and the incidence is increasing. Acinetobacter, a Gram-negative bacillus, is commonly associated with the use of intravascular catheterization and airway intubation. Polymerase chain reaction (PCR) for identification of Acinetobacter baumannii from samples has been standardized that use conventional wet-reagent mix. We have designed and optimized a dry-reagent mix for identification of Acinetobacter species by PCR. The dry-reagent mix can be stored at room temperature, has less chances of contamination, and thus can be used at point-of-care diagnosis. AIM AND OBJECTIVE: The present work was focused on comparing the sensitivity and specificity of dry-reagent PCR mix over conventional wet-reagent PCR mix for identification of Acinetobacter species. MATERIALS AND METHODS: Conventional wet-reagent mix based and dry-reagent mix based PCR were carried out for the DNA isolated from Acinetobacter species. The latter was also applied directly on bacterial growth without prior DNA extraction process. Equal numbers of bacterial isolates other than Acinetobacter species were also subjected to identification by the same protocols for determining the sensitivity and specificity of the test. RESULTS: The Acinetobacter species showed amplification of the target rpoB gene and the band was observed at 397 bp. The dry-reagent PCR mix results matched completely with the conventional wet-reagent PCR mix assay. All the non-Acinetobacter isolates were negative for the PCR. This indicates that the test is highly specific. The dry-reagent mix also contained an enzyme resistant to PCR inhibitors and capable of amplifying DNA directly from cells. CONCLUSION: Performance of dry-reagent PCR mix without the need for DNA extraction and preparation of a PCR mix proved to be more sensitive and reduce the handling error, minimizes the time, manual work, and skilled labor. PMID:29403209

  20. Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

    2016-09-15

    It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

  1. Evaluation of a Campylobacter fetus subspecies venerealis real-time quantitative polymerase chain reaction for direct analysis of bovine preputial samples

    PubMed Central

    Chaban, Bonnie; Chu, Shirley; Hendrick, Steven; Waldner, Cheryl; Hill, Janet E.

    2012-01-01

    The detection and subspeciation of Campylobacter fetus subsp. venerealis (CFV) from veterinary samples is important for both clinical and economic reasons. Campylobacter fetus subsp. venerealis is the causative agent of bovine genital campylobacteriosis, a venereal disease that can lead to serious reproductive problems in cattle, and strict international regulations require animals and animal products to be CFV-free for trade. This study evaluated methods reported in the literature for CFV detection and reports the translation of an extensively tested CFV-specific polymerase chain reaction (PCR) primer set; including the VenSF/VenSR primers and a real-time, quantitative PCR (qPCR) platform using SYBR Green chemistry. Three methods of preputial sample preparation for direct qPCR were evaluated and a heat lysis DNA extraction method was shown to allow for CFV detection at the level of approximately one cell equivalent per reaction (or 1.0 × 103 CFU/mL) from prepuce. The optimized sample preparation and qPCR protocols were then used to evaluate 3 western Canadian bull cohorts, which included 377 bulls, for CFV. The qPCR assay detected 11 positive bulls for the CFV-specific parA gene target. DNA sequence data confirmed the identity of the amplified product and revealed that positive samples were comprised of 2 sequence types; one identical to previously reported CFV parA gene sequences and one with a 9% sequence divergence. These results add valuable information towards our understanding of an important CFV subspeciation target and offer a significantly improved format for an internationally recognized PCR test. PMID:23277694

  2. Subconscious Visual Cues during Movement Execution Allow Correct Online Choice Reactions

    PubMed Central

    Leukel, Christian; Lundbye-Jensen, Jesper; Christensen, Mark Schram; Gollhofer, Albert; Nielsen, Jens Bo; Taube, Wolfgang

    2012-01-01

    Part of the sensory information is processed by our central nervous system without conscious perception. Subconscious processing has been shown to be capable of triggering motor reactions. In the present study, we asked the question whether visual information, which is not consciously perceived, could influence decision-making in a choice reaction task. Ten healthy subjects (28±5 years) executed two different experimental protocols. In the Motor reaction protocol, a visual target cue was shown on a computer screen. Depending on the displayed cue, subjects had to either complete a reaching movement (go-condition) or had to abort the movement (stop-condition). The cue was presented with different display durations (20–160 ms). In the second Verbalization protocol, subjects verbalized what they experienced on the screen. Again, the cue was presented with different display durations. This second protocol tested for conscious perception of the visual cue. The results of this study show that subjects achieved significantly more correct responses in the Motor reaction protocol than in the Verbalization protocol. This difference was only observed at the very short display durations of the visual cue. Since correct responses in the Verbalization protocol required conscious perception of the visual information, our findings imply that the subjects performed correct motor responses to visual cues, which they were not conscious about. It is therefore concluded that humans may reach decisions based on subconscious visual information in a choice reaction task. PMID:23049749

  3. HLA Class I Depleted hESC as a Source of Hypoimmunogenic Cells for Tissue Engineering Applications.

    PubMed

    Karabekian, Zaruhi; Ding, Hao; Stybayeva, Gulnaz; Ivanova, Irina; Muselimyan, Narine; Haque, Amranul; Toma, Ian; Posnack, Nikki G; Revzin, Alexander; Leitenberg, David; Laflamme, Michael A; Sarvazyan, Narine

    2015-10-01

    Rapidly improving protocols for the derivation of autologous cells from stem cell sources is a welcome development. However, there are many circumstances when off-the-shelf universally immunocompatible cells may be needed. Embryonic stem cells (ESCs) provide a unique opportunity to modify the original source of differentiated cells to minimize their rejection by nonautologous hosts. Immune rejection of nonautologous human embryonic stem cell (hESC) derivatives can be reduced by downregulating human leukocyte antigen (HLA) class I molecules, without affecting the ability of these cells to differentiate into specific lineages. Beta-2-microglobulin (B2M) expression was decreased by lentiviral transduction using human anti-HLA class I light-chain B2M short hairpin RNA. mRNA levels of B2M were decreased by 90% in a RUES2-modified hESC line, as determined by quantitative real time-polymerase chain reaction analysis. The transduced cells were selected under puromycin pressure and maintained in an undifferentiated state. The latter was confirmed by Oct4 and Nanog expression, and by the formation of characteristic round-shaped colonies. B2M downregulation led to diminished HLA-I expression on the cell surface, as determined by flow cytometry. When used as target cells in a mixed lymphocyte reaction assay, transduced hESCs and their differentiated derivatives did not stimulate allogeneic T-cell proliferation. Using a cardiac differentiation protocol, transduced hESCs formed a confluent layer of cardiac myocytes and maintained a low level of B2M expression. Transduced hESCs were also successfully differentiated into a hepatic lineage, validating their capacity to differentiate into multiple lineages. HLA-I depletion does not preclude hESC differentiation into cardiac or hepatic lineages. This methodology can be used to engineer tissue from nonautologous hESC sources with improved immunocompatibility.

  4. HLA Class I Depleted hESC as a Source of Hypoimmunogenic Cells for Tissue Engineering Applications

    PubMed Central

    Karabekian, Zaruhi; Ding, Hao; Stybayeva, Gulnaz; Ivanova, Irina; Muselimyan, Narine; Haque, Amranul; Toma, Ian; Posnack, Nikki G.; Revzin, Alexander; Leitenberg, David; Laflamme, Michael A.

    2015-01-01

    Background: Rapidly improving protocols for the derivation of autologous cells from stem cell sources is a welcome development. However, there are many circumstances when off-the-shelf universally immunocompatible cells may be needed. Embryonic stem cells (ESCs) provide a unique opportunity to modify the original source of differentiated cells to minimize their rejection by nonautologous hosts. Hypothesis: Immune rejection of nonautologous human embryonic stem cell (hESC) derivatives can be reduced by downregulating human leukocyte antigen (HLA) class I molecules, without affecting the ability of these cells to differentiate into specific lineages. Methods and Results: Beta-2-microglobulin (B2M) expression was decreased by lentiviral transduction using human anti-HLA class I light-chain B2M short hairpin RNA. mRNA levels of B2M were decreased by 90% in a RUES2-modified hESC line, as determined by quantitative real time-polymerase chain reaction analysis. The transduced cells were selected under puromycin pressure and maintained in an undifferentiated state. The latter was confirmed by Oct4 and Nanog expression, and by the formation of characteristic round-shaped colonies. B2M downregulation led to diminished HLA-I expression on the cell surface, as determined by flow cytometry. When used as target cells in a mixed lymphocyte reaction assay, transduced hESCs and their differentiated derivatives did not stimulate allogeneic T-cell proliferation. Using a cardiac differentiation protocol, transduced hESCs formed a confluent layer of cardiac myocytes and maintained a low level of B2M expression. Transduced hESCs were also successfully differentiated into a hepatic lineage, validating their capacity to differentiate into multiple lineages. Conclusions: HLA-I depletion does not preclude hESC differentiation into cardiac or hepatic lineages. This methodology can be used to engineer tissue from nonautologous hESC sources with improved immunocompatibility. PMID:26218149

  5. Infection Control in Retreatment Cases: In Vivo Antibacterial Effects of 2 Instrumentation Systems.

    PubMed

    Rodrigues, Renata C V; Antunes, Henrique S; Neves, Mônica A S; Siqueira, José F; Rôças, Isabela N

    2015-10-01

    This in vivo study compared the antibacterial effects of 2 instrumentation systems in root canal-treated teeth with apical periodontitis. Forty-eight teeth with a single root and a single canal showing post-treatment apical periodontitis were selected for this study. For retreatment, teeth were randomly divided into 2 groups according to the instrumentation system used: Self-Adjusting File (SAF; ReDent-Nova, Ra'anana, Israel) and Twisted File Adaptive (TFA; SybronEndo, Orange, CA). In both groups, 2.5% sodium hypochlorite was the irrigant. Bacteriological samples were taken before (S1) and after chemomechanical preparation (S2). In the TFA group, passive ultrasonic irrigation (PUI) was performed after instrumentation, and samples were also taken after this supplementary step (S2b). DNA was extracted from the clinical samples and subjected to quantitative real-time polymerase chain reaction to evaluate the levels of total bacteria, streptococci, and Enterococcus faecalis. Statistical analyses from quantitative real-time polymerase chain reaction data were performed within groups using the Wilcoxon matched pairs test and between groups using the Mann-Whitney U test and the Fisher exact test with the significance level set at P < .05. Bacteria were detected in S1 samples from 43 teeth, which were then included in the antibacterial experiment. Both SAF and TFA instrumentation protocols showed a highly significant intracanal bacterial reduction (P < .001). Intergroup quantitative comparisons disclosed no significant differences between TFA with or without PUI and SAF (P > .05). PUI did not result in significant improvement in disinfection (P > .05). Both instrumentation systems/treatment protocols were highly effective in significantly reducing the intracanal bacterial counts. No significant difference was observed between the 2 systems in disinfecting the canals of teeth with post-treatment apical periodontitis. Copyright © 2015 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  6. High Resolution Melting Analysis Targeting hsp70 as a Fast and Efficient Method for the Discrimination of Leishmania Species.

    PubMed

    Zampieri, Ricardo Andrade; Laranjeira-Silva, Maria Fernanda; Muxel, Sandra Marcia; Stocco de Lima, Ana Carolina; Shaw, Jeffrey Jon; Floeter-Winter, Lucile Maria

    2016-02-01

    Protozoan parasites of the genus Leishmania cause a large spectrum of clinical manifestations known as Leishmaniases. These diseases are increasingly important public health problems in many countries both within and outside endemic regions. Thus, an accurate differential diagnosis is extremely relevant for understanding epidemiological profiles and for the administration of the best therapeutic protocol. Exploring the High Resolution Melting (HRM) dissociation profiles of two amplicons using real time polymerase chain reaction (real-time PCR) targeting heat-shock protein 70 coding gene (hsp70) revealed differences that allowed the discrimination of genomic DNA samples of eight Leishmania species found in the Americas, including Leishmania (Leishmania) infantum chagasi, L. (L.) amazonensis, L. (L.) mexicana, L. (Viannia) lainsoni, L. (V.) braziliensis, L. (V.) guyanensis, L. (V.) naiffi and L. (V.) shawi, and three species found in Eurasia and Africa, including L. (L.) tropica, L. (L.) donovani and L. (L.) major. In addition, we tested DNA samples obtained from standard promastigote culture, naturally infected phlebotomines, experimentally infected mice and clinical human samples to validate the proposed protocol. HRM analysis of hsp70 amplicons is a fast and robust strategy that allowed for the detection and discrimination of all Leishmania species responsible for the Leishmaniases in Brazil and Eurasia/Africa with high sensitivity and accuracy. This method could detect less than one parasite per reaction, even in the presence of host DNA.

  7. Calcium: A novel and efficient inducer of differentiation of adipose-derived stem cells into neuron-like cells.

    PubMed

    Goudarzi, Farjam; Tayebinia, Heidar; Karimi, Jamshid; Habibitabar, Elahe; Khodadadi, Iraj

    2018-06-05

    This study comparatively investigated the effectiveness of calcium and other well-known inducers such as isobutylmethylxanthine (IBMX) and insulin in differentiating human adipose-derived stem cells (ADSCs) into neuronal-like cells. ADSCs were immunophenotyped and differentiated into neuron-like cells with different combinations of calcium, IBMX, and insulin. Calcium mobilization across the membrane was determined. Differentiated cells were characterized by cell cycle profiling, staining of Nissl bodies, detecting the gene expression level of markers such as neuronal nuclear antigen (NeuN), microtubule associated protein 2 (MAP2), neuron-specific enolase (NSE), doublecortin, synapsin I, glial fibrillary acidic protein (GFAP), and myelin basic protein (MBP) by quantitative real-time polymerase chain reaction (quantitative real-time polymerase chain reaction (qRT-PCR) and protein level by the immunofluorescence technique. Treatment with Ca + IBMX + Ins induced neuronal appearance and projection of neurite-like processes in the cells, accompanied with inhibition of proliferation and halt in the cell cycle. A significantly higher expression of MBP, GFAP, NeuN, NSE, synapsin 1, doublecortin, and MAP2 was detected in differentiated cells, confirming the advantages of Ca + IBMX + Ins to the other combinations of inducers. Here, we showed an efficient protocol for neuronal differentiation of ADSCs, and calcium fostered differentiation by augmenting the number of neuron-like cells and instantaneous increase in the expression of neuronal markers. © 2018 Wiley Periodicals, Inc.

  8. A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

    PubMed Central

    Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

    2014-01-01

    The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

  9. Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter with application of high-processivity polymerase and novel internal amplification controls for rapid and specific detection.

    PubMed

    Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S

    2012-02-01

    Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications. Published by Elsevier Inc.

  10. Clinical validation of 3 commercial real-time reverse transcriptase polymerase chain reaction assays for the detection of Middle East respiratory syndrome coronavirus from upper respiratory tract specimens.

    PubMed

    Mohamed, Deqa H; AlHetheel, AbdulKarim F; Mohamud, Hanat S; Aldosari, Kamel; Alzamil, Fahad A; Somily, Ali M

    2017-04-01

    Since discovery of Middle East respiratory syndrome coronavirus (MERS-CoV), a novel betacoronavirus first isolated and characterized in 2012, MERS-CoV real-time reverse transcriptase polymerase chain reaction (rRT-PCR) assays represent one of the most rapidly expanding commercial tests. However, in the absence of extensive evaluations of these assays on positive clinical material of different sources, evaluating their diagnostic effectiveness remains challenging. We describe the diagnostic performance evaluation of 3 common commercial MERS-CoV rRT-PCR assays on a large panel (n = 234) of upper respiratory tract specimens collected during an outbreak episode in Saudi Arabia. Assays were compared to the RealStar® MERS-CoV RT-PCR (Alton Diagnostics, Hamburg, Germany) assay as the gold standard. Results showed i) the TIB MolBiol® LightMix UpE and Orf1a assays (TIB MolBiol, Berlin, Germany) to be the most sensitive, followed by ii) the Anyplex™ Seegene MERS-CoV assay (Seegene, Seoul, Korea), and finally iii) the PrimerDesign™ Genesig® HCoV_2012 assay (PrimerDesign, England, United Kingdom). We also evaluate a modified protocol for the PrimerDesign™ Genesig® HCoV_2012 assay. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Peroxy radical detection by chemical amplification (PERCA)

    NASA Technical Reports Server (NTRS)

    Stedman, D. H.

    1986-01-01

    Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.

  12. Comparison of designed and randomly generated catalysts for simple chemical reactions.

    PubMed

    Kipnis, Yakov; Baker, David

    2012-09-01

    There has been recent success in designing enzymes for simple chemical reactions using a two-step protocol. In the first step, a geometric matching algorithm is used to identify naturally occurring protein scaffolds at which predefined idealized active sites can be realized. In the second step, the residues surrounding the transition state model are optimized to increase transition state binding affinity and to bolster the primary catalytic side chains. To improve the design methodology, we investigated how the set of solutions identified by the design calculations relate to the overall set of solutions for two different chemical reactions. Using a TIM barrel scaffold in which catalytically active Kemp eliminase and retroaldolase designs were obtained previously, we carried out activity screens of random libraries made to be compositionally similar to active designs. A small number of active catalysts were found in screens of 10³ variants for each of the two reactions, which differ from the computational designs in that they reuse charged residues already present in the native scaffold. The results suggest that computational design considerably increases the frequency of catalyst generation for active sites involving newly introduced catalytic residues, highlighting the importance of interaction cooperativity in enzyme active sites. Copyright © 2012 The Protein Society.

  13. One for all: A standardized protocol for ex vivo culture of limbal, conjunctival and oral mucosal epithelial cells into corneal lineage.

    PubMed

    Dhamodaran, Kamesh; Subramani, Murali; Matalia, Himanshu; Jayadev, Chaitra; Shetty, Rohit; Das, Debashish

    2016-04-01

    Autologous transplantation of ex vivo cultured cells the treatment of choice for patients with limbal stem cell deficiency. The most commonly used cell sources for transplantation limbal, conjunctival or oral mucosal tissue. Protocols vary for culturing each tissue type, and there are no comparative studies on transplantation outcomes using these different culture techniques. To overcome this limitation, we devised a simple protocol that can uniformly promote growth and differentiation of cells from a limbal, conjunctival or oral mucosal biopsy into the corneal lineage. Biopsies were cultured as explants on de-epithelialized human amniotic membrane in the presence of recombinant epidermal growth factor and insulin. Cultured cells were characterized using immunohistochemistry and quantitative reverse transcriptase polymerase chain reaction for stem/progenitor markers (ABCG2 and P63α) and differentiation markers (CK3, CK12, CK4, CK13, CK15 and CONNEXIN 43). Fluorescence-activated cell sorter analysis was performed for ABCG2. The results revealed that cells of all three biopsies differentiated into the corneal lineage. Positivity of CK3/12, CK4, CK12 and CONNEXIN 43 immunostaining and the relative mRNA expression of CK3, CK4, CK12, CK13, CK15 and CONNEXIN 43 could be detected in the cultured biopsies. Unlike tissue-specific protocols, our protocol can unequivocally promote differentiation of cells from a limbal, conjunctival or oral mucosal biopsy into the corneal lineage. This simple standardized protocol can be adapted for ocular surface reconstruction using stem cell transplantation. Copyright © 2016 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  14. Evaluation of cytoreductive efficacy of vincristine, cyclophosphamide, and Doxorubicin in dogs with lymphoma by measuring the number of neoplastic lymphoid cells with real-time polymerase chain reaction.

    PubMed

    Sato, M; Yamazaki, J; Goto-Koshino, Y; Takahashi, M; Fujino, Y; Ohno, K; Tsujimoto, H

    2011-01-01

    The cytoreductive efficacy of the individual components of multidrug chemotherapy for canine lymphoma is difficult to evaluate after complete remission. To compare the cytoreductive efficacy of vincristine (VCR), cyclophosphamide (CPA), and doxorubicin (DXR) in dogs that received a 6-month modified version of the University of Wisconsin-Madison chemotherapy protocol (UW-25). Twenty-nine dogs with high-grade B-cell multicentric lymphoma. Rearranged immunoglobulin heavy chain gene fragments from lymphoma cells were amplified by polymerase chain reaction (PCR) and sequenced to prepare clone-specific primers and probes for real-time PCR. The number of lymphoma cells in peripheral blood was measured from diagnosis to week 11 of UW-25. The number of lymphoma cells after the 1st administration of VCR, CPA, and DXR in weeks 1-4 was decreased in 29/29 (100%), 15/29 (51.7%), and 26/27 (96.3%) dogs, respectively. The cytoreductive efficacy of CPA was less than that of VCR and DXR. VCR, CPA, and DXR administered in weeks 6-9 were effective in 5/26 (19.2%), 5/20 (25.0%), and 14/19 (73.7%) dogs, respectively, indicating the sustained cytoreductive efficacy of DXR. CPA nonresponders were heavier and exhibited a shorter 1st remission than CPA responders. When using UW-25 for treatment of canine lymphoma, CPA was found to have less cytoreductive efficacy than VCR and DXR. Real-time PCR-based quantification of tumor cells is an objective marker of the efficacy of chemotherapeutic agents. Copyright © 2011 by the American College of Veterinary Internal Medicine.

  15. Tangled nonlinear driven chain reactions of all optical singularities

    NASA Astrophysics Data System (ADS)

    Vasil'ev, V. I.; Soskin, M. S.

    2012-03-01

    Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

  16. The importance of carbon footprint estimation boundaries.

    PubMed

    Matthews, H Scott; Hendrickson, Chris T; Weber, Christopher L

    2008-08-15

    Because of increasing concern about global climate change and carbon emissions as a causal factor, many companies and organizations are pursuing "carbon footprint" projects to estimate their own contributions to global climate change. Protocol definitions from carbon registries help organizations analyze their footprints. The scope of these protocols varies but generally suggests estimating only direct emissions and emissions from purchased energy, with less focus on supply chain emissions. In contrast approaches based on comprehensive environmental life-cycle assessment methods are available to track total emissions across the entire supply chain, and experience suggests that following narrowly defined estimation protocols will generally lead to large underestimates of carbon emissions for providing products and services. Direct emissions from an industry are, on average, only 14% of the total supply chain carbon emissions (often called Tier 1 emissions), and direct emissions plus industry energy inputs are, on average, only 26% of the total supply chain emissions (often called Tier 1 and 2 emissions). Without a full knowledge of their footprints, firms will be unable to pursue the most cost-effective carbon mitigation strategies. We suggest that firms use the screening-level analysis described here to set the bounds of their footprinting strategy to ensure that they do not ignore large sources of environmental effects across their supply chains. Such information can help firms pursue carbon and environmental emission mitigation projects not only within their own plants but also across their supply chain.

  17. From ketones to esters by a Cu-catalyzed highly selective C(CO)-C(alkyl) bond cleavage: aerobic oxidation and oxygenation with air.

    PubMed

    Huang, Xiaoqiang; Li, Xinyao; Zou, Miancheng; Song, Song; Tang, Conghui; Yuan, Yizhi; Jiao, Ning

    2014-10-22

    The Cu-catalyzed aerobic oxidative esterification of simple ketones via C-C bond cleavage has been developed. Varieties of common ketones, even inactive aryl long-chain alkyl ketones, are selectively converted into esters. The reaction tolerates a wide range of alcohols, including primary and secondary alcohols, chiral alcohols with retention of the configuration, electron-deficient phenols, as well as various natural alcohols. The usage of inexpensive copper catalyst, broad substrate scope, and neutral and open air conditions make this protocol very practical. (18)O labeling experiments reveal that oxygenation occurs during this transformation. Preliminary mechanism studies indicate that two novel pathways are mainly involved in this process.

  18. Papaya (Carica papaya L.).

    PubMed

    Zhu, Yun J; Fitch, Maureen M M; Moore, Paul H

    2006-01-01

    Transgenic papaya plants were initially obtained using particle bombardment, a method having poor efficiency in producing intact, single-copy insertion of transgenes. Single-copy gene insertion was improved using Agrobacterium tumefaciens. With progress being made in genome sequencing and gene discovery, there is a need for more efficient methods of transformation in order to study the function of these genes. We describe a protocol for Agrobacterium-mediated transformation using carborundum-wounded papaya embryogenic calli. This method should lead to high-throughput transformation, which on average produced at least one plant that was positive in polymerase chain reaction (PCR), histochemical staining, or by Southern blot hybridization from 10 to 20% of the callus clusters that had been co-cultivated with Agrobacterium. Plants regenerated from the callus clusters in 9 to 13 mo.

  19. Molecular screening for hemotropic mycoplasmas in captive Barbary sheep (Ammotragus lervia) in southern Brazil

    PubMed Central

    Santos, Leonilda C.; Vidotto, Odilon; Morikawa, Vivien M.; Santos, Nelson J. R.; Vieira, Thállitha S. W. J.; Barros Filho, Ivan R.; Vieira, Rafael F. C.; Biondo, Alexander W.

    2017-01-01

    Aim: This study is part of an active surveillance program for monitoring animal health status in endangered species, and was conducted to screen captive Barbary sheep (Ammotragus lervia) for hemoplasma infection. Materials and Methods: A total of 12 blood samples were collected, DNA extracted and further tested by a pan-hemoplasma polymerase chain reaction protocol. Results: Animals were clinically healthy and not infested by ectoparasites. Although housekeeping gene DNA was successfully amplified, all the Barbary sheep samples tested negative for Mycoplasma sp. Conclusion: Notwithstanding the negative results, molecular pathogen surveys on Barbary sheep and other exotic wild mammals may provide insights regarding infection of endangered species caused by captivity stress in association with exposure to new pathogens worldwide. PMID:28919684

  20. Droplet Microfluidic Device Fabrication and Use for Isothermal Amplification and Detection of MicroRNA.

    PubMed

    Giuffrida, Maria Chiara; D'Agata, Roberta; Spoto, Giuseppe

    2017-01-01

    Droplet microfluidics combined with the isothermal circular strand displacement polymerization (ICSDP) represents a powerful new technique to detect both single-stranded DNA and microRNA sequences. The method here described helps in overcoming some drawbacks of the lately introduced droplet polymerase chain reaction (PCR) amplification when implemented in microfluidic devices. The method also allows the detection of nanoliter droplets of nucleic acids sequences solutions, with a particular attention to microRNA sequences that are detected at the picomolar level. The integration of the ICSDP amplification protocol in droplet microfluidic devices reduces the time of analysis and the amount of sample required. In addition, there is also the possibility to design parallel analyses to be integrated in portable devices.

  1. Foamy virus–mediated gene transfer to canine repopulating cells

    PubMed Central

    Kiem, Hans-Peter; Allen, James; Trobridge, Grant; Olson, Erik; Keyser, Kirsten; Peterson, Laura; Russell, David W.

    2007-01-01

    Foamy virus (FV) vectors are particularly attractive gene-transfer vectors for stem-cell gene therapy because they form a stable transduction intermediate in quiescent cells and can efficiently transduce hematopoietic stem cells. Here, we studied the use of FV vectors to transduce long-term hematopoietic repopulating cells in the dog, a clinically relevant large animal model. Mobilized canine peripheral blood (PB) CD34+ cells were transduced with an enhanced green fluorescent protein (EGFP)–expressing FV vector in an 18-hour transduction protocol. All 3 dogs studied had rapid neutrophil engraftment to greater than 500/μL with a median of 10 days. Transgene expression was detected in all cell lineages (B cells, T cells, granulocytes, red blood cells, and platelets), indicating multilineage engraftment of transduced cells. Up to 19% of blood cells were EGFP+, and this was confirmed at the DNA level by real-time polymerase chain reaction (PCR) and Southern blot analysis. These transduction rates were higher than the best results we obtained previously with lentiviral vectors in a similar transduction protocol. Integration site analysis also demonstrated polyclonal repopulation and the transduction of multipotential hematopoietic repopulating cells. These data suggest that FV vectors should be useful for stem-cell gene therapy, particularly for applications in which short transduction protocols are critical. PMID:16968897

  2. A streamlined method for analysing genome-wide DNA methylation patterns from low amounts of FFPE DNA.

    PubMed

    Ludgate, Jackie L; Wright, James; Stockwell, Peter A; Morison, Ian M; Eccles, Michael R; Chatterjee, Aniruddha

    2017-08-31

    Formalin fixed paraffin embedded (FFPE) tumor samples are a major source of DNA from patients in cancer research. However, FFPE is a challenging material to work with due to macromolecular fragmentation and nucleic acid crosslinking. FFPE tissue particularly possesses challenges for methylation analysis and for preparing sequencing-based libraries relying on bisulfite conversion. Successful bisulfite conversion is a key requirement for sequencing-based methylation analysis. Here we describe a complete and streamlined workflow for preparing next generation sequencing libraries for methylation analysis from FFPE tissues. This includes, counting cells from FFPE blocks and extracting DNA from FFPE slides, testing bisulfite conversion efficiency with a polymerase chain reaction (PCR) based test, preparing reduced representation bisulfite sequencing libraries and massively parallel sequencing. The main features and advantages of this protocol are: An optimized method for extracting good quality DNA from FFPE tissues. An efficient bisulfite conversion and next generation sequencing library preparation protocol that uses 50 ng DNA from FFPE tissue. Incorporation of a PCR-based test to assess bisulfite conversion efficiency prior to sequencing. We provide a complete workflow and an integrated protocol for performing DNA methylation analysis at the genome-scale and we believe this will facilitate clinical epigenetic research that involves the use of FFPE tissue.

  3. An Alternative Approach to "Identification of Unknowns": Designing a Protocol to Verify the Identities of Nitrogen Fixing Bacteria.

    PubMed

    Martinez-Vaz, Betsy M; Denny, Roxanne; Young, Nevin D; Sadowsky, Michael J

    2015-12-01

    Microbiology courses often include a laboratory activity on the identification of unknown microbes. This activity consists of providing students with microbial cultures and running biochemical assays to identify the organisms. This approach lacks molecular techniques such as sequencing of genes encoding 16S rRNA, which is currently the method of choice for identification of unknown bacteria. A laboratory activity was developed to teach students how to identify microorganisms using 16S rRNA polymerase chain reaction (PCR) and validate microbial identities using biochemical techniques. We hypothesized that designing an experimental protocol to confirm the identity of a bacterium would improve students' knowledge of microbial identification techniques and the physiological characteristics of bacterial species. Nitrogen-fixing bacteria were isolated from the root nodules of Medicago truncatula and prepared for 16S rRNA PCR analysis. Once DNA sequencing revealed the identity of the organisms, the students designed experimental protocols to verify the identity of rhizobia. An assessment was conducted by analyzing pre- and posttest scores and by grading students' verification protocols and presentations. Posttest scores were higher than pretest scores at or below p = 0.001. Normalized learning gains (G) showed an improvement of students' knowledge of microbial identification methods (LO4, G = 0.46), biochemical properties of nitrogen-fixing bacteria (LO3, G = 0.45), and the events leading to the establishment of nitrogen-fixing symbioses (LO1&2, G = 0.51, G = 0.37). An evaluation of verification protocols also showed significant improvement with a p value of less than 0.001.

  4. Quantification of Short-Chain Chlorinated Paraffins by Deuterodechlorination Combined with Gas Chromatography-Mass Spectrometry.

    PubMed

    Gao, Yuan; Zhang, Haijun; Zou, Lili; Wu, Ping; Yu, Zhengkun; Lu, Xianbo; Chen, Jiping

    2016-04-05

    Analysis of short-chain chlorinated paraffins (SCCPs) is extremely difficult because of their complex compositions with thousands of isomers and homologues. A novel analytical method, deuterodechlorination combined with high resolution gas chromatography-high resolution mass spectrometry (HRGC-HRMS), was developed. A protocol is applied in the deuterodechlorination of SCCPs with LiAlD4, and the formed deuterated n-alkanes of different alkane chains can be distinguished readily from each other on the basis of their retention time and fragment mass ([M](+)) by HRGC-HRMS. An internal standard quantification of individual SCCP congeners was achieved, in which branched C10-CPs and branched C12-CPs were used as the extraction and reaction internal standards, respectively. A maximum factor of 1.26 of the target SCCP concentrations were determined by this method, and the relative standard deviations for quantification of total SCCPs were within 10%. This method was applied to determine the congener compositions of SCCPs in commercial chlorinated paraffins and environmental and biota samples after method validation. Low-chlorinated SCCP congeners (Cl1-4) were found to account for 32.4%-62.4% of the total SCCPs. The present method provides an attractive perspective for further studies on the toxicological and environmental characteristics of SCCPs.

  5. Synthesis of alkyl- and aryl-amino-substituted anthraquinone derivatives by microwave-assisted copper(0)-catalyzed Ullmann coupling reactions.

    PubMed

    Baqi, Younis; Müller, Christa E

    2010-05-01

    This protocol describes the efficient, generally applicable Ullmann coupling reaction of bromaminic acid with alkyl- or aryl-amines in phosphate buffer under microwave irradiation using elemental copper as a catalyst. The reaction leads to a number of biologically active compounds. As a prototypical example, the synthesis of a new, potent antagonist of human platelet P2Y(12) receptors, which has potential as an antithrombotic drug, is described in detail. The optimized protocol includes a description of an appropriate reaction setup, thin layer chromatography for monitoring the reaction and a procedure for the isolation, purification and characterization of the anticipated product. The reaction is performed without the use of a glove box and there is no requirement for an inert atmosphere. The reaction typically proceeds within 2-30 min, the protocol, including workup, generally takes 1-3 h to complete.

  6. Outpatient desensitization in selected patients with platinum hypersensitivity reactions.

    PubMed

    O'Malley, David M; Vetter, Monica Hagan; Cohn, David E; Khan, Ambar; Hays, John L

    2017-06-01

    Platinum-based chemotherapies are a standard treatment for both initial and recurrent gynecologic cancers. Given this widespread use, it is important to be aware of the features of platinum hypersensitivity reactions and the subsequent treatment of these reactions. There is also increasing interest in the development of desensitization protocols to allow patients with a history of platinum hypersensitivity to receive further platinum based therapy. In this review, we describe the management of platinum hypersensitivity reactions and the desensitization protocols utilized at our institution. We also describe the clinical categorizations utilized to triage patients to appropriate desensitization protocols. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Robust quantum entanglement generation and generation-plus-storage protocols with spin chains

    NASA Astrophysics Data System (ADS)

    Estarellas, Marta P.; D'Amico, Irene; Spiller, Timothy P.

    2017-04-01

    Reliable quantum communication and/or processing links between modules are a necessary building block for various quantum processing architectures. Here we consider a spin-chain system with alternating strength couplings and containing three defects, which impose three domain walls between topologically distinct regions of the chain. We show that—in addition to its useful, high-fidelity, quantum state transfer properties—an entangling protocol can be implemented in this system, with optional localization and storage of the entangled states. We demonstrate both numerically and analytically that, given a suitable initial product-state injection, the natural dynamics of the system produces a maximally entangled state at a given time. We present detailed investigations of the effects of fabrication errors, analyzing random static disorder both in the diagonal and off-diagonal terms of the system Hamiltonian. Our results show that the entangled state formation is very robust against perturbations of up to ˜10 % the weaker chain coupling, and also robust against timing injection errors. We propose a further protocol, which manipulates the chain in order to localize and store each of the entangled qubits. The engineering of a system with such characteristics would thus provide a useful device for quantum information processing tasks involving the creation and storage of entangled resources.

  8. Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

    PubMed

    Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

    2018-06-01

    Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

  9. Topological dynamics of optical singularities in speckle-fields induced by photorefractive scattering in a LiNbO{sub 3} : Fe crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vasil'ev, Vasilii I; Soskin, M S

    2013-02-28

    A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less

  10. Isolation and purification of RNA from tissues rich in polyphenols, polysaccharides, and pigments of annatto (Bixa orellana L.).

    PubMed

    Rodrigues, Simone M; Soares, Virgínia L F; de Oliveira, Tahise M; Gesteira, Abelmon S; Otoni, Wagner C; Costa, Marcio G C

    2007-11-01

    The tropical plant Bixa orellana L. (annatto) produces an array of natural products, including the pigment bixin used in the food and cosmetics industries. In order to understand the biochemical and molecular basis of the biosynthesis of these natural products, a reliable method for isolating high yields of high-quality RNA is required. Here we described a successful and reproducible method for isolation and purification of high-quantity and high-quality RNA from different tissues of annatto. This protocol overcomes the usual problems associated with large amounts of polyphenols, polysaccharides, pigments, and other secondary metabolites that are not easily removed by conventional extraction procedures. Furthermore, the proposed protocol can be easily carried out in any laboratory and it could also be extended to isolate RNA from other plant species showing similar abundance of compounds that interfere with RNA extractions. The yield and quality of the RNA were monitored by spectrophotometric analysis, separation on agarose gel, Reverse Transcription-Polymerase Chain Reaction (RT-PCR), and construction of a cDNA library.

  11. Validation of quantitative and qualitative methods for detecting allergenic ingredients in processed foods in Japan.

    PubMed

    Sakai, Shinobu; Adachi, Reiko; Akiyama, Hiroshi; Teshima, Reiko

    2013-06-19

    A labeling system for food allergenic ingredients was established in Japan in April 2002. To monitor the labeling, the Japanese government announced official methods for detecting allergens in processed foods in November 2002. The official methods consist of quantitative screening tests using enzyme-linked immunosorbent assays (ELISAs) and qualitative confirmation tests using Western blotting or polymerase chain reactions (PCR). In addition, the Japanese government designated 10 μg protein/g food (the corresponding allergenic ingredient soluble protein weight/food weight), determined by ELISA, as the labeling threshold. To standardize the official methods, the criteria for the validation protocol were described in the official guidelines. This paper, which was presented at the Advances in Food Allergen Detection Symposium, ACS National Meeting and Expo, San Diego, CA, Spring 2012, describes the validation protocol outlined in the official Japanese guidelines, the results of interlaboratory studies for the quantitative detection method (ELISA for crustacean proteins) and the qualitative detection method (PCR for shrimp and crab DNAs), and the reliability of the detection methods.

  12. An efficient protocol for tissue sampling and DNA isolation from the stem bark of Leguminosae trees.

    PubMed

    Novaes, R M L; Rodrigues, J G; Lovato, M B

    2009-02-03

    Traditionally, molecular studies of plant species have used leaves as the source of DNA. However, sampling leaves from tall tree species can be quite difficult and expensive. We developed a sequence of procedures for using stem bark as a source of DNA from Leguminosae trees of the Atlantic Forest and the Cerrado. Leguminosae is an important species-rich family in these two highly diverse and endangered biomes. A modified CTAB protocol for DNA isolation is described, and details of the procedures for sampling and storage of the bark are given. The procedures were initially developed for three species, and then their applicability for 15 other species was evaluated. DNA of satisfactory quality was obtained from the bark of all species. The amounts of DNA obtained from leaves were slightly higher than from bark samples, while its purity was the same. Storing the bark frozen or by drying in silica gel yielded similar results. Polymerase chain reaction amplification worked for both plastid and nuclear genomes. This alternative for isolating DNA from bark samples of trees facilitates field work with these tree species.

  13. An optimized high quality male DNA extraction from spermatophores in open thelycum shrimp species.

    PubMed

    Planella, Laia; Heras, Sandra; Vera, Manuel; García-Marín, José-Luis; Roldán, María Inés

    2017-09-01

    The crucial step of most of the current genetic studies is the extraction of DNA of sufficient quantity and quality. Several genomic DNA isolation methods have been described to successfully obtain male DNA from shrimp species. However, all current protocols require invasive handling methods with males for DNA isolation. Using Aristeus antennatus as a model we tested a reliable non-invasive differential DNA extraction method to male DNA isolation from spermatophores attached to female thelycum. The present protocol provides high quality and quantity DNA for polymerase chain reaction amplification and male genotyping. This new approach could be useful to experimental shrimp culture to select sires with relevant genetic patterns for selective breeding programs. More importantly, it can be applied to identify the mating pairs and male structure in wild populations of species as A. antennatus, where males are often difficult to capture. Our method could be also valuable for biological studies on other spermatophore-using species, such as myriapods, arachnids and insects. © 2016 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

  14. Preimplantation genetic diagnosis for Duchenne muscular dystrophy by multiple displacement amplification.

    PubMed

    Ren, Zi; Zeng, Hai-tao; Xu, Yan-wen; Zhuang, Guang-lun; Deng, Jie; Zhang, Cheng; Zhou, Can-quan

    2009-02-01

    To evaluate the use of multiple displacement amplification (MDA) in preimplantation genetic diagnosis (PGD) for female carriers with Duchenne muscular dystrophy (DMD). MDA was used to amplify a whole genome of single cells. Following the setup on single cells, the test was applied in two clinical cases of PGD. One mutant exon, six short tandem repeats (STR) markers within the dystrophin gene, and amelogenin were incorporated into singleplex polymerase chain reaction (PCR) assays on MDA products of single blastomeres. Center for reproductive medicine in First Affiliated Hospital, Sun Yat-sen University, China. Two female carriers with a duplication of exons 3-11 and a deletion of exons 47-50, respectively. The MDA of single cells and fluorescent PCR assays for PGD. The ability to analyze single blastomeres for DMD using MDA. The protocol setup previously allowed for the accurate diagnosis of each embryo. Two clinical cases resulted in a healthy girl, which was the first successful clinical application of MDA in PGD for DMD. We suggest that this protocol is reliable to increase the accuracy of the PGD for DMD.

  15. Modified telomeric repeat amplification protocol: a quantitative radioactive assay for telomerase without using electrophoresis.

    PubMed

    Szatmari, I; Tókés, S; Dunn, C B; Bardos, T J; Aradi, J

    2000-06-15

    A polymerase chain reaction (PCR)-based radioactive telomerase assay was developed in our laboratory which is quantitative and does not require electrophoretic evaluation (designated as TP-TRAP; it utilizes two reverse primers). The main steps of the assay include (1) extension of a 20-mer oligonucleotide substrate (MTS) by telomerase, (2) amplification of the telomerase products in the presence of [(3)H]dTTP using the substrate oligonucleotide and two reverse primers (RPC3, 38 mer; RP, 20 mer), (3) isolation of the amplified radioactive dsDNA by precipitation and filtration, (4) determination of the radioactivity of the acid-insoluble DNA. The length of the telomerase products does not increase on amplification. This valuable feature of the assay is achieved by utilization of the two reverse primers and a highly specific PCR protocol. The assay is linear, accurate, and suitable for cell-biological studies where slight quantitative differences in telomerase activity must be detected. The assay is also suitable for screening and characterization of telomerase inhibitors, as shown with a chemically modified oligonucleotide reverse transcriptase inhibitor [(s(4)dU)(35)]. Copyright 2000 Academic Press.

  16. Recovery of high-quality RNA from laser capture microdissected human and rodent pancreas.

    PubMed

    Butler, Alexandra E; Matveyenko, Aleksey V; Kirakossian, David; Park, Johanna; Gurlo, Tatyana; Butler, Peter C

    Laser capture microdissection (LCM) is a powerful method to isolate specific populations of cells for subsequent analysis such as gene expression profiling, for example, microarrays or ribonucleic (RNA)-Seq. This technique has been applied to frozen as well as formalin-fixed, paraffin-embedded (FFPE) specimens with variable outcomes regarding quality and quantity of extracted RNA. The goal of the study was to develop the methods to isolate high-quality RNA from islets of Langerhans and pancreatic duct glands (PDG) isolated by LCM. We report an optimized protocol for frozen sections to minimize RNA degradation and maximize recovery of expected transcripts from the samples using quantitative real-time polymerase chain reaction (RT-PCR) by adding RNase inhibitors at multiple steps during the experiment. This technique reproducibly delivered intact RNA (RIN values 6-7). Using quantitative RT-PCR, the expected profiles of insulin, glucagon, mucin6 (Muc6), and cytokeratin-19 (CK-19) mRNA in PDGs and pancreatic islets were detected. The described experimental protocol for frozen pancreas tissue might also be useful for other tissues with moderate to high levels of intrinsic ribonuclease (RNase) activity.

  17. Novel concept for the preparation of gas selective nanocomposite membranes

    NASA Astrophysics Data System (ADS)

    Drobek, M.; Ayral, A.; Motuzas, J.; Charmette, C.; Loubat, C.; Louradour, E.; Dhaler, D.; Julbe, A.

    2015-07-01

    In this work we report on a novel concept for the preparation of gas selective composite membranes by a simple and robust synthesis protocol involving a controlled in-situpolycondensation of functional alkoxysilanes within the pores of a mesoporous ceramic matrix. This innovative approach targets the manufacture of thin nanocomposite membranes, allowing good compromise between permeability, selectivity and thermomechanical strength. Compared to simple infiltration, the synthesis protocol allows a controlled formation of gas separation membranes from size-adjusted functional alkoxysilanes by a chemical reaction within the mesopores of a ceramic support, without any formation of a thick and continuous layer on the support top-surface. Membrane permeability can thus be effectively controlled by the thickness and pore size of the mesoporous layer, and by the oligomers chain length. The as-prepared composite membranes are expected to possess a good mechanical and thermomechanical resistance and exhibit a thermally activated transport of He and H2 up to 150 °C, resulting in enhanced separation factors for specific gas mixtures e.g. FH2/CO ˜ 10; FH2/CO2 ˜ 3; FH2/CH4 ˜ 62.

  18. Effectiveness of oxaliplatin desensitization protocols.

    PubMed

    Cortijo-Cascajares, Susana; Nacle-López, Inmaculada; García-Escobar, Ignacio; Aguilella-Vizcaíno, María José; Herreros-de-Tejada, Alberto; Cortés-Funes Castro, Hernán; Calleja-Hernández, Miguel-Ángel

    2013-03-01

    Hypersensitivity reaction (HSR) to antineoplastic drugs can force doctors to stop treatment and seek other alternatives. These alternatives may be less effective, not as well tolerated and/or more expensive. Another option is to use desensitization protocols that induce a temporary state of tolerance by gradually administering small quantities of the antineoplastic drug until the therapeutic dosage is reached. The aim of this study is to assess the effectiveness of oxaliplatin desensitization protocols. A retrospective observational study was carried out between January 2006 and May 2011. The inclusion criteria were patients undergoing chemotherapy treatment with oxaliplatin who had developed an HSR to the drug and who were candidates for continuing the treatment using a desensitization protocol. The patients' clinical records were reviewed and variables were gathered relating to the patient, the treatment, the HSR, and the desensitization protocol administered. The data were analysed using version 18.0 of the statistics program SPSS. A total of 53 desensitization protocols were administered to 21 patients. In 89 % of these cases, no new reactions occurred while the drug was being administered. New reactions of mild severity only occurred in 11 % of cases, and none of these reactions were severe enough for treatment to be stopped. All patients were able to complete the desensitization protocol. This study confirms that oxaliplatin desensitization protocols are safe and effective and allow patients to continue with the treatment that initially caused an HSR.

  19. Sodium sulphite inhibition of potato and cherry polyphenolics in nucleic acid extraction for virus detection by RT-PCR.

    PubMed

    Singh, R P; Nie, X; Singh, M; Coffin, R; Duplessis, P

    2002-01-01

    Phenolic compounds from plant tissues inhibit reverse transcription-polymerase chain reaction (RT-PCR). Multiple-step protocols using several additives to inhibit polyphenolic compounds during nucleic acid extraction are common, but time consuming and laborious. The current research highlights that the inclusion of 0.65 to 0.70% of sodium sulphite in the extraction buffer minimizes the pigmentation of nucleic acid extracts and improves the RT-PCR detection of Potato virus Y (PVY) and Potato leafroll virus (PLRV) in potato (Solanum tuberosum) tubers and Prune dwarf virus (PDV) and Prunus necrotic ringspot virus (PNRSV) in leaves and bark in the sweet cherry (Prunus avium) tree. Substituting sodium sulphite in the nucleic acid extraction buffer eliminated the use of proteinase K during extraction. Reagents phosphate buffered saline (PBS)-Tween 20 and polyvinylpyrrolidone (PVP) were also no longer required during RT or PCR phase. The resultant nucleic acid extracts were suitable for both duplex and multiplex RT-PCR. This simple and less expensive nucleic acid extraction protocol has proved very effective for potato cv. Russet Norkotah, which contains a high amount of polyphenolics. Comparing commercially available RNA extraction kits (Catrimox and RNeasy), the sodium sulphite based extraction protocol yielded two to three times higher amounts of RNA, while maintaining comparable virus detection by RT-PCR. The sodium sulphite based extraction protocol was equally effective in potato tubers, and in leaves and bark from the cherry tree.

  20. Synthesis of 1-octacosanol and GC-C-IRMS discrimination of samples from different origin.

    PubMed

    Cravotto, Giancarlo; Calcio Gaudino, Emanuela; Barge, Alessandro; Binello, Arianna; Albertino, Andrea; Aghemo, Costanza

    2010-03-01

    Lately, long-chain primary alcohols have been investigated in depth on account of their biological activities. In particular, 1-octacosanol (C(28)H(57)OH), the main component of policosanol, the hypolipidaemic fatty alcohol mixture obtained from sugar cane wax, has been the subject of a multitude of pharmacological studies. The aim of this work was to search a convenient synthetic protocol for the preparation of 1-octacosanol in a gram scale. The key step was a Wittig reaction between the octadecyltriphenylphosphonium ylide and the methyl 10-oxodecanoate. Some steps were further improved by power ultrasound and microwave irradiation, either alone or in combination. Our methodology is suitable for a rapid generation of homologues by varying the chain length in the alkyl halide. Due to the high commercial value, a series of 1-octacosanol samples, either isolated from natural sources or from synthesis (different origin and suppliers), were analysed by gas chromatography-combustion-isotopic ratio mass spectrometry (GC-C-IRMS) and according to the carbon isotopic content, classified on the basis of their origin.

  1. Application of the BAX for screening/genus Listeria polymerase chain reaction system for monitoring Listeria species in cold-smoked fish and in the smoked fish processing environment.

    PubMed

    Norton, D M; McCamey, M; Boor, K J; Wiedmann, M

    2000-03-01

    The cold-smoked fish industry was used as a model for the development of a system for monitoring Listeria spp. in foods and in the food processing environment. A total of 214 samples including raw fish, fish during the cold-smoking process, finished product, and environmental samples were collected from three processing facilities over two visits to each facility. Samples were screened for Listeria spp. using the BAX for Screening/genus Listeria polymerase chain reaction system (PCR) and by culture. Listeria spp., confirmed by the API Listeria test strip or by a PCR assay targeting the L. monocytogenes hlyA gene, were isolated from a total of 89 (41.6%) samples. Of these, 80 samples also tested positive for Listeria spp. using the BAX system. Specifically, 42 (55.3%) environmental samples (n = 76), 11 (25.6%) raw materials samples (n = 43), 20 (35.1%) samples from fish in various stages of processing (n = 57), and 7 (18.4%) finished product samples (n = 38) tested positive for Listeria spp. using the BAX system. Five (4.0%) of the 125 culture-negative samples yielded BAX system-positive results. Listeria isolates from each of nine culture-positive/BAX system-negative samples yielded a positive reaction when tested in pure culture by the BAX system, suggesting that our false-negative results were likely due to the presence of low Listeria numbers in the initial enrichment as opposed to nonreacting isolates. The employment of alternative enrichment protocols, such as the two-step enrichment recommended by the manufacturer, may increase the sensitivity of the assay.

  2. Acetylene chain reaction on hydrogenated boron nitride monolayers: a density functional theory study.

    PubMed

    Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru

    2017-11-28

    Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.

  3. Supplement to Theory of Neutron Chain Reactions

    DOE R&D Accomplishments Database

    Weinberg, Alvin M.; Noderer, L. C.

    1952-05-26

    General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

  4. A rapid, ideal, and eco-friendlier protocol for quantifying proline.

    PubMed

    Shabnam, Nisha; Tripathi, Indu; Sharmila, P; Pardha-Saradhi, P

    2016-11-01

    Proline, a stress marker, is routinely quantified by a protocol that essentially uses hazardous toluene. Negative impacts of toluene on human health prompted us to develop a reliable alternate protocol for proline quantification. Absorbance of the proline-ninhydrin condensation product formed by reaction of proline with ninhydrin at 100 °C in the reaction mixture was significantly higher than that recorded after its transfer to toluene, revealing that toluene lowers sensitivity of this assay. λ max of the proline-ninhydrin complex in the reaction mixture and toluene were 508 and 513 nm, respectively. Ninhydrin in glacial acetic acid yielded higher quantity of the proline-ninhydrin condensation product compared to ninhydrin in mixture of glacial acetic acid and H 3 PO 4 , indicating negative impact of H 3 PO 4 on proline quantification. Further, maximum yield of the proline-ninhydrin complex with ninhydrin in glacial acetic acid and ninhydrin in mixture of glacial acetic acid and H 3 PO 4 was achieved within 30 and 60 min, respectively. This revealed that H 3 PO 4 has negative impact on the reaction rate and quantity of the proline-ninhydrin complex formed. In brief, our proline quantification protocol involves reaction of a 1-ml proline sample with 2 ml of 1.25 % ninhydrin in glacial acetic acid at 100 °C for 30 min, followed by recording absorbance of the proline-ninhydrin condensation product in the reaction mixture itself at 508 nm. Amongst proline quantification protocols known till date, our protocol is the most simple, rapid, reliable, cost-effective, and eco-friendlier.

  5. Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

    PubMed

    Zhou, Yu; Pearson, John E; Auerbach, Anthony

    2005-12-01

    We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

  6. Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

    PubMed

    Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

    2017-11-01

    Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

  7. Multi-institutional evaluation of end-to-end protocol for IMRT/VMAT treatment chains utilizing conventional linacs.

    PubMed

    Loughery, Brian; Knill, Cory; Silverstein, Evan; Zakjevskii, Viatcheslav; Masi, Kathryn; Covington, Elizabeth; Snyder, Karen; Song, Kwang; Snyder, Michael

    2018-03-20

    We conducted a multi-institutional assessment of a recently developed end-to-end monthly quality assurance (QA) protocol for external beam radiation therapy treatment chains. This protocol validates the entire treatment chain against a baseline to detect the presence of complex errors not easily found in standard component-based QA methods. Participating physicists from 3 institutions ran the end-to-end protocol on treatment chains that include Imaging and Radiation Oncology Core (IROC)-credentialed linacs. Results were analyzed in the form of American Association of Physicists in Medicine (AAPM) Task Group (TG)-119 so that they may be referenced by future test participants. Optically stimulated luminescent dosimeter (OSLD), EBT3 radiochromic film, and A1SL ion chamber readings were accumulated across 10 test runs. Confidence limits were calculated to determine where 95% of measurements should fall. From calculated confidence limits, 95% of measurements should be within 5% error for OSLDs, 4% error for ionization chambers, and 4% error for (96% relative gamma pass rate) radiochromic film at 3% agreement/3 mm distance to agreement. Data were separated by institution, model of linac, and treatment protocol (intensity-modulated radiation therapy [IMRT] vs volumetric modulated arc therapy [VMAT]). A total of 97% of OSLDs, 98% of ion chambers, and 93% of films were within the confidence limits; measurements were found outside these limits by a maximum of 4%, < 1%, and < 1%, respectively. Data were consistent despite institutional differences in OSLD reading equipment and radiochromic film calibration techniques. Results from this test may be used by clinics for data comparison. Areas of improvement were identified in the end-to-end protocol that can be implemented in an updated version. The consistency of our data demonstrates the reproducibility and ease-of-use of such tests and suggests a potential role for their use in broad end-to-end QA initiatives. Copyright © 2018 American Association of Medical Dosimetrists. Published by Elsevier Inc. All rights reserved.

  8. An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.

    PubMed

    Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján

    2016-02-20

    In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Post-Outbreak Investigation of Pseudomonas aeruginosa Faucet Contamination by Quantitative Polymerase Chain Reaction and Environmental Factors Affecting Positivity.

    PubMed

    Bédard, Emilie; Laferrière, Céline; Charron, Dominique; Lalancette, Cindy; Renaud, Christian; Desmarais, Nadia; Déziel, Eric; Prévost, Michèle

    2015-11-01

    To perform a post-outbreak prospective study of the Pseudomonas aeruginosa contamination at the faucets (water, aerator and drain) by culture and quantitative polymerase chain reaction (qPCR) and to assess environmental factors influencing occurrence A 450-bed pediatric university hospital in Montreal, Canada Water, aerator swab, and drain swab samples were collected from faucets and analyzed by culture and qPCR for the post-outbreak investigation. Water microbial and physicochemical parameters were measured, and a detailed characterization of the sink environmental and design parameters was performed. The outbreak genotyping investigation identified drains and aerators as the source of infection. The implementation of corrective measures was effective, but post-outbreak sampling using qPCR revealed 50% positivity for P. aeruginosa remaining in the water compared with 7% by culture. P. aeruginosa was recovered in the water, the aerator, and the drain in 21% of sinks. Drain alignment vs the faucet and water microbial quality were significant factors associated with water positivity, whereas P. aeruginosa load in the water was an average of 2 log higher for faucets with a positive aerator. P. aeruginosa contamination in various components of sink environments was still detected several years after the resolution of an outbreak in a pediatric university hospital. Although contamination is often not detectable in water samples by culture, P. aeruginosa is present and can recover its culturability under favorable conditions. The importance of having clear maintenance protocols for water systems, including the drainage components, is highlighted.

  10. Quantitative real-time polymerase chain reaction for the verification of genomic imbalances detected by microarray-based comparative genomic hybridization.

    PubMed

    Yu, Shihui; Kielt, Matthew; Stegner, Andrew L; Kibiryeva, Nataliya; Bittel, Douglas C; Cooley, Linda D

    2009-12-01

    The American College of Medical Genetics guidelines for microarray analysis for constitutional cytogenetic abnormalities require abnormal or ambiguous results from microarray-based comparative genomic hybridization (aCGH) analysis be confirmed by an alternative method. We employed quantitative real-time polymerase chain reaction (qPCR) technology using SYBR Green I reagents for confirmation of 93 abnormal aCGH results (50 deletions and 43 duplications) and 54 parental samples. A novel qPCR protocol using DNA sequences coding for X-linked lethal diseases in males for designing reference primers was established. Of the 81 sets of test primers used for confirmation of 93 abnormal copy number variants (CNVs) in 80 patients, 71 sets worked after the initial primer design (88%), 9 sets were redesigned once, and 1 set twice because of poor amplification. Fifty-four parental samples were tested using 33 sets of test primers to follow up 34 CNVs in 30 patients. Nineteen CNVs were confirmed as inherited, 13 were negative in both parents, and 2 were inconclusive due to a negative result in a single parent. The qPCR assessment clarified aCGH results in two cases and corrected a fluorescence in situ hybridization result in one case. Our data illustrate that qPCR methodology using SYBR Green I reagents is accurate, highly sensitive, specific, rapid, and cost-effective for verification of chromosomal imbalances detected by aCGH in the clinical setting.

  11. Combinational chromosomal aneuploidies and HPV status for prediction of head and neck squamous cell carcinoma prognosis in biopsies and cytological preparations.

    PubMed

    Wemmert, Silke; Linxweiler, Maximilian; Lerner, Cornelia; Bochen, Florian; Kulas, Philipp; Linxweiler, Johannes; Smola, Sigrun; Urbschat, Steffi; Wagenpfeil, Stefan; Schick, Bernhard

    2018-06-01

    Head and neck squamous cell carcinoma (HNSCC) is one of the most common human cancer types with a very poor prognosis despite improvements in therapeutic modalities. The major known risk factors are tobacco use and alcohol consumption or infection with high-risk human papilloma viruses (HPV), especially in oropharyngeal tumors. The current management based on the assessment of a variety of clinical and pathological parameters does not sufficiently predict outcome. Chromosomal alterations detected in HNSCCs were characterized by metaphase comparative genomic hybridization (CGH) and correlated with clinical parameters as well as survival time. Candidate regions were validated by quantitative polymerase chain reaction, fluorescence-in situ-hybridization (FISH) on dapped tumor tissue and liquid-based cytological smear preparations. In addition, HPV status was determined by polymerase chain reaction and simultaneous immunocytochemical p16 INK4a -Ki67 staining. The most frequent DNA copy number gains were observed on chromosome arms 3q, 8q, 5p, 7q, 12p, and 12q. DNA copy number decreases occurred most frequently at 3p, 17p, 4q, and 5q. FISH analysis verified in part the observed alterations by CGH on dapped tissues and was especially able to detect the most frequent DNA copy changes in cytological specimens. The combination of HPV status and prognostic copy number alteration detected by FISH in biopsies or cytological specimens may be an applicable protocol for screening head and neck cancer patients prior to therapy.

  12. Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

    PubMed

    Umamaheswari, A; Venkateswarlu, K

    2004-06-01

    Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

  13. Protein structure modeling for CASP10 by multiple layers of global optimization.

    PubMed

    Joo, Keehyoung; Lee, Juyong; Sim, Sangjin; Lee, Sun Young; Lee, Kiho; Heo, Seungryong; Lee, In-Ho; Lee, Sung Jong; Lee, Jooyoung

    2014-02-01

    In the template-based modeling (TBM) category of CASP10 experiment, we introduced a new protocol called protein modeling system (PMS) to generate accurate protein structures in terms of side-chains as well as backbone trace. In the new protocol, a global optimization algorithm, called conformational space annealing (CSA), is applied to the three layers of TBM procedure: multiple sequence-structure alignment, 3D chain building, and side-chain re-modeling. For 3D chain building, we developed a new energy function which includes new distance restraint terms of Lorentzian type (derived from multiple templates), and new energy terms that combine (physical) energy terms such as dynamic fragment assembly (DFA) energy, DFIRE statistical potential energy, hydrogen bonding term, etc. These physical energy terms are expected to guide the structure modeling especially for loop regions where no template structures are available. In addition, we developed a new quality assessment method based on random forest machine learning algorithm to screen templates, multiple alignments, and final models. For TBM targets of CASP10, we find that, due to the combination of three stages of CSA global optimizations and quality assessment, the modeling accuracy of PMS improves at each additional stage of the protocol. It is especially noteworthy that the side-chains of the final PMS models are far more accurate than the models in the intermediate steps. Copyright © 2013 Wiley Periodicals, Inc.

  14. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  15. EXPERIMENTAL PROTOCOL FOR DETERMINING PROTOLYSIS REACTION RATE CONSTANTS

    EPA Science Inventory

    An experimental protocol to determine photolysis rates of chemicals which photolyze relatively rapidly in the gas phase has been developed. This procedure provides a basis for evaluating the relative importance of one atmospheric reaction pathway (i.e., photolysis) for organic su...

  16. Identification of verotoxin type 2 variant B subunit genes in Escherichia coli by the polymerase chain reaction and restriction fragment length polymorphism analysis.

    PubMed Central

    Tyler, S D; Johnson, W M; Lior, H; Wang, G; Rozee, K R

    1991-01-01

    A set of synthetic oligonucleotide primers was designed for use in a polymerase chain reaction protocol to specifically detect the B subunit genes in vtx2ha and vtx2hb, which code for the production of the VT2 (Shiga-like toxin II) variant cytotoxins VT2v-a and VT2v-b, respectively. An additional set of primers amplified a fragment common to the B subunits of the VT2 and the VT2 variant genes. Subsequent restriction endonuclease digestion of this amplicon permitted prediction of specific VT2 and variant genotypes on the basis of predetermined restriction fragment length polymorphisms. Genotypes of 21 VT2-producing strains of Escherichia coli were determined using this polymerase chain reaction-restriction fragment length polymorphism procedure. Four strains contained B subunit target sequences only for VT2 genes, 9 strains contained sequences only for VT2v-a genes, and 3 strains contained sequences only for VT2v-b. For genes in combination, one strain contained B subunit genes for both VT2 and VT2v-a and two strains contained B subunit genes for VT2 and VT2v-b. Two strains of E. coli O91:H21 contained both VT2v-a and VT2v-b B subunit genes. The VT2 reference strain of E. coli, E32511, was found to contain the targeted sequences from both VT2 and VT2v-a genes, whereas the recombinant E. coli, pEB1, possessed only that of the VT2 gene. The specific activities of extracellular VT2 determined in HeLa cells ranged from 0.3 to 41.7 TCD50 per microgram of protein in strains carrying the VT2 gene target and from 0 to 50.0 TCD50 per microgram of protein in strains carrying only the VT2 variant target (TCD50 is the tissue culture dose by which 50% of the cells were affected), suggesting that phenotypic expression does not correlate with genotype. Images PMID:1679436

  17. The use of FTA cards for preserving unfixed cytological material for high-throughput molecular analysis.

    PubMed

    Saieg, Mauro Ajaj; Geddie, William R; Boerner, Scott L; Liu, Ni; Tsao, Ming; Zhang, Tong; Kamel-Reid, Suzanne; da Cunha Santos, Gilda

    2012-06-25

    Novel high-throughput molecular technologies have made the collection and storage of cells and small tissue specimens a critical issue. The FTA card provides an alternative to cryopreservation for biobanking fresh unfixed cells. The current study compared the quality and integrity of the DNA obtained from 2 types of FTA cards (Classic and Elute) using 2 different extraction protocols ("Classic" and "Elute") and assessed the feasibility of performing multiplex mutational screening using fine-needle aspiration (FNA) biopsy samples. Residual material from 42 FNA biopsies was collected in the cards (21 Classic and 21 Elute cards). DNA was extracted using the Classic protocol for Classic cards and both protocols for Elute cards. Polymerase chain reaction for p53 (1.5 kilobase) and CARD11 (500 base pair) was performed to assess DNA integrity. Successful p53 amplification was achieved in 95.2% of the samples from the Classic cards and in 80.9% of the samples from the Elute cards using the Classic protocol and 28.5% using the Elute protocol (P = .001). All samples (both cards) could be amplified for CARD11. There was no significant difference in the DNA concentration or 260/280 purity ratio when the 2 types of cards were compared. Five samples were also successfully analyzed by multiplex MassARRAY spectrometry, with a mutation in KRAS found in 1 case. High molecular weight DNA was extracted from the cards in sufficient amounts and quality to perform high-throughput multiplex mutation assays. The results of the current study also suggest that FTA Classic cards preserve better DNA integrity for molecular applications compared with the FTA Elute cards. Copyright © 2012 American Cancer Society.

  18. Improved Detection of Norovirus and Hepatitis A Virus in Surface Water by Applying Pre-PCR Processing.

    PubMed

    Borgmästars, Emmy; Jazi, Mehrdad Mousavi; Persson, Sofia; Jansson, Linda; Rådström, Peter; Simonsson, Magnus; Hedman, Johannes; Eriksson, Ronnie

    2017-12-01

    Quantitative reverse transcriptase polymerase chain reaction (RT-qPCR) detection of waterborne RNA viruses generally requires concentration of large water volumes due to low virus levels. A common approach is to use dead-end ultrafiltration followed by precipitation with polyethylene glycol. However, this procedure often leads to the co-concentration of PCR inhibitors that impairs the limit of detection and causes false-negative results. Here, we applied the concept of pre-PCR processing to optimize RT-qPCR detection of norovirus genogroup I (GI), genogroup II (GII), and hepatitis A virus (HAV) in challenging water matrices. The RT-qPCR assay was improved by screening for an inhibitor-tolerant master mix and modifying the primers with twisted intercalating nucleic acid molecules. Additionally, a modified protocol based on chaotropic lysis buffer and magnetic silica bead nucleic acid extraction was developed for complex water matrices. A validation of the modified extraction protocol on surface and drinking waters was performed. At least a 26-fold improvement was seen in the most complex surface water studied. The modified protocol resulted in average recoveries of 33, 13, 8, and 4% for mengovirus, norovirus GI, GII, and HAV, respectively. The modified protocol also improved the limit of detection for norovirus GI and HAV. RT-qPCR inhibition with C q shifts of 1.6, 2.8, and 3.5 for norovirus GI, GII, and HAV, respectively, obtained for the standard nucleic acid extraction were completely eliminated by the modified protocol. The standard nucleic acid extraction method worked well on drinking water with no RT-qPCR inhibition observed and average recoveries of 80, 124, 89, and 32% for mengovirus, norovirus GI, GII, and HAV, respectively.

  19. Desensitization to rituximab in a multidisciplinary setting.

    PubMed

    Amorós-Reboredo, Patrícia; Sánchez-López, Jaime; Bastida-Fernández, Carla; do Pazo-Oubiña, Fernando; Borràs-Maixenchs, Núria; Giné, Eva; Valero, Antonio; Creus-Baró, Natàlia

    2015-10-01

    The need to offer first-line therapy to the increasing number of patients who have suffered an hypersensitivity reaction has stimulated the use of rapid desensitization protocols. To present our experience working as a multidisciplinary team using a rituximab rapid desensitization scheme. Patient demographics, allergic reaction, skin tests to rituximab, number of desensitizations, reactions during the desensitization protocol and actions taken, number of administered and completed cycles, were retrospectively collected in patients who received at least one desensitization to rituximab. Number of desensitizations successfully managed. Between 2012 and June 2013 five patients received a total of 19 desensitizations to rituximab using a 12 step rapid desensitization protocol. All patients received the scheduled chemotherapeutic cycles as inpatients, with no delay in administration dates. Three patients presented a hypersensitivity reaction during the first desensitization and in one patient the event occurred again during the second treatment cycle. All reactions occurred in the last step, when the infusion rate reached the maximum speed. The developed protocol for rapid desensitization was successful in five patients receiving rituximab. Patients could receive the full intended dose.

  20. Excessive training induces molecular signs of pathologic cardiac hypertrophy.

    PubMed

    da Rocha, Alisson L; Teixeira, Giovana R; Pinto, Ana P; de Morais, Gustavo P; Oliveira, Luciana da C; de Vicente, Larissa Gaioto; da Silva, Lilian E C M; Pauli, José R; Cintra, Dennys E; Ropelle, Eduardo R; de Moura, Leandro P; Mekary, Rania A; de Freitas, Ellen C; da Silva, Adelino S R

    2018-05-24

    Chronic exercise induces cardiac remodeling that promotes left ventricular hypertrophy and cardiac functional improvement, which are mediated by the mammalian or the mechanistic target of rapamycin (mTOR) as well as by the androgen and glucocorticoid receptors (GRs). However, pathological conditions (i.e., chronic heart failure, hypertension, and aortic stenosis, etc.) also induce cardiac hypertrophy, but with detrimental function, high levels of proinflammatory cytokines and myostatin, elevated fibrosis, reduced adenosine monophosphate-activated protein kinase (AMPK) activation, and fetal gene reactivation. Furthermore, recent studies have evidenced that excessive training induced an inflammatory status in the serum, muscle, hypothalamus, and liver, suggesting a pathological condition that could also be detrimental to cardiac tissue. Here, we verified the effects of three running overtraining (OT) models on the molecular parameters related to physiological and pathological cardiac hypertrophy. C57BL/6 mice performed three different OT protocols and were evaluated for molecular parameters related to physiological and pathological cardiac hypertrophy, including immunoblotting, reverse transcription polymerase chain reaction, histology, and immunohistochemistry analyses. In summary, the three OT protocols induced left ventricle (LV) hypertrophy with signs of cardiac fibrosis and negative morphological adaptations. These maladaptations were accompanied by reductions in AMPKalpha (Thr172) phosphorylation, androgen receptor, and GR expressions, as well as by an increase in interleukin-6 expression. Specifically, the downhill running-based OT model reduced the content of some proteins related to the mTOR signaling pathway and upregulated the β-isoform of myosin heavy-chain gene expression, presenting signs of LV pathological hypertrophy development. © 2018 Wiley Periodicals, Inc.

  1. The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

    PubMed

    Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

    2006-07-01

    We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

  2. Facile and Efficient Preparation of Tri-component Fluorescent Glycopolymers via RAFT-controlled Polymerization.

    PubMed

    Wang, Wei; Lester, John M; Amorosa, Anthony E; Chance, Deborah L; Mossine, Valeri V; Mawhinney, Thomas P

    2015-06-19

    Synthetic glycopolymers are instrumental and versatile tools used in various biochemical and biomedical research fields. An example of a facile and efficient synthesis of well-controlled fluorescent statistical glycopolymers using reversible addition-fragmentation chain-transfer (RAFT)-based polymerization is demonstrated. The synthesis starts with the preparation of β-galactose-containing glycomonomer 2-lactobionamidoethyl methacrylamide obtained by reaction of lactobionolactone and N-(2-aminoethyl) methacrylamide (AEMA). 2-Gluconamidoethyl methacrylamide (GAEMA) is used as a structural analog lacking a terminal β-galactoside. The following RAFT-mediated copolymerization reaction involves three different monomers: N-(2-hydroxyethyl) acrylamide as spacer, AEMA as target for further fluorescence labeling, and the glycomonomers. Tolerant of aqueous systems, the RAFT agent used in the reaction is (4-cyanopentanoic acid)-4-dithiobenzoate. Low dispersities (≤1.32), predictable copolymer compositions, and high reproducibility of the polymerizations were observed among the products. Fluorescent polymers are obtained by modifying the glycopolymers with carboxyfluorescein succinimidyl ester targeting the primary amine functional groups on AEMA. Lectin-binding specificities of the resulting glycopolymers are verified by testing with corresponding agarose beads coated with specific glycoepitope recognizing lectins. Because of the ease of the synthesis, the tight control of the product compositions and the good reproducibility of the reaction, this protocol can be translated towards preparation of other RAFT-based glycopolymers with specific structures and compositions, as desired.

  3. Safety of aspirin desensitization in patients with reported aspirin allergy and cardiovascular disease.

    PubMed

    McMullan, Kathryn L; Wedner, H James

    2013-01-01

    Aspirin (ASA) is the drug of choice in patients with coronary artery disease for primary and secondary prevention. This poses a problem for those patients reporting hypersensitivity to this drug or class of drugs. Desensitization to ASA may be carried out safely and effectively in patients with reported ASA or nonsteroidal anti-inflammatory drug (NSAID) hypersensitivity needing ASA for cardiac indications. Our 7-step protocol is one choice for a rapid desensitization protocol. A retrospective chart review was conducted evaluating ASA desensitization in patients with reported ASA or NSAID hypersensitivity and a cardiac indication for ASA. In 160 evaluations over 15 years, 89 desensitizations were performed in both the inpatient and outpatient setting with only 16 reactions (18%). Eleven of these 16 patients (68.7%) were able to take daily ASA. Twenty-six desensitization procedures were performed with our 7-step rapid desensitization protocol in 10 inpatients and 16 outpatients with 3 reactions (18.75% of reactions). Initial reaction to ASA involving angioedema and reacting to ASA within the past year increased the risk of having a reaction to desensitization. Desensitization may be safely performed in patients with reported ASA or NSAID hypersensitivity and a cardiac indication for ASA. Our 7-step rapid protocol may be used in both the inpatient and outpatient setting to desensitize these patients. Patients who had angioedema with ASA ingestion or a reaction to ASA within the past year are at higher risk for reaction during the desensitization protocol. The authors have no funding, financial relationships, or conflicts of interest to disclose. © 2012 Wiley Periodicals, Inc.

  4. Tandem Aldol-Michael Reactions in Aqueous Diethylamine Medium: A Greener and Efficient Approach to Bis-Pyrimidine Derivatives

    PubMed Central

    Al-Majid, Abdullah M.; Barakat, Assem; AL-Najjar, Hany J.; Mabkhot, Yahia N.; Ghabbour, Hazem A.; Fun, Hoong-Kun

    2013-01-01

    A simple protocol, involving the green synthesis for the construction of novel bis-pyrimidine derivatives, 3a–i and 4a–e are accomplished by the aqueous diethylamine media promoted tandem Aldol-Michael reaction between two molecules of barbituric acid derivatives 1a,b with various aldehydes. This efficient synthetic protocol using an economic and environmentally friendly reaction media with versatility and shorter reaction time provides bis-pyrimidine derivatives with high yields (88%–99%). PMID:24317435

  5. Promoting adverse drug reaction reporting: comparison of different approaches.

    PubMed

    Ribeiro-Vaz, Inês; Santos, Cristina Costa; Cruz-Correia, Ricardo

    2016-01-01

    To describe different approaches to promote adverse drug reaction reporting among health care professionals, determining their cost-effectiveness. We analyzed and compared several approaches taken by the Northern Pharmacovigilance Centre (Portugal) to promote adverse drug reaction reporting. Approaches were compared regarding the number and relevance of adverse drug reaction reports obtained and costs involved. Costs by report were estimated by adding the initial costs and the running costs of each intervention. These costs were divided by the number of reports obtained with each intervention, to assess its cost-effectiveness. All the approaches seem to have increased the number of adverse drug reaction reports. We noted the biggest increase with protocols (321 reports, costing 1.96 € each), followed by first educational approach (265 reports, 20.31 €/report) and by the hyperlink approach (136 reports, 15.59 €/report). Regarding the severity of adverse drug reactions, protocols were the most efficient approach, costing 2.29 €/report, followed by hyperlinks (30.28 €/report, having no running costs). Concerning unexpected adverse drug reactions, the best result was obtained with protocols (5.12 €/report), followed by first educational approach (38.79 €/report). We recommend implementing protocols in other pharmacovigilance centers. They seem to be the most efficient intervention, allowing receiving adverse drug reactions reports at lower costs. The increase applied not only to the total number of reports, but also to the severity, unexpectedness and high degree of causality attributed to the adverse drug reactions. Still, hyperlinks have the advantage of not involving running costs, showing the second best performance in cost per adverse drug reactions report.

  6. Easy preparation of a large-size random gene mutagenesis library in Escherichia coli.

    PubMed

    You, Chun; Percival Zhang, Y-H

    2012-09-01

    A simple and fast protocol for the preparation of a large-size mutant library for directed evolution in Escherichia coli was developed based on the DNA multimers generated by prolonged overlap extension polymerase chain reaction (POE-PCR). This protocol comprised the following: (i) a linear DNA mutant library was generated by error-prone PCR or shuffling, and a linear vector backbone was prepared by regular PCR; (ii) the DNA multimers were generated based on these two DNA templates by POE-PCR; and (iii) the one restriction enzyme-digested DNA multimers were ligated to circular plasmids, followed by transformation to E. coli. Because the ligation efficiency of one DNA fragment was several orders of magnitude higher than that of two DNA fragments for typical mutant library construction, it was very easy to generate a mutant library with a size of more than 10(7) protein mutants per 50 μl of the POE-PCR product. Via this method, four new fluorescent protein mutants were obtained based on monomeric cherry fluorescent protein. This new protocol was simple and fast because it did not require labor-intensive optimizations in restriction enzyme digestion and ligation, did not involve special plasmid design, and enabled constructing a large-size mutant library for directed enzyme evolution within 1 day. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. An evaluation of direct PCR amplification

    PubMed Central

    Hall, Daniel E.; Roy, Reena

    2014-01-01

    Aim To generate complete DNA profiles from blood and saliva samples deposited on FTA® and non-FTA® paper substrates following a direct amplification protocol. Methods Saliva samples from living donors and blood samples from deceased individuals were deposited on ten different FTA® and non-FTA® substrates. These ten paper substrates containing body fluids were kept at room temperature for varying lengths of time ranging from one day to approximately one year. For all assays in this research, 1.2 mm punches were collected from each substrate containing one type of body fluid and amplified with reagents provided in the nine commercial polymerase chain reaction (PCR) amplification kits. The substrates were not subjected to purification reagent or extraction buffer prior to amplification. Results Success rates were calculated for all nine amplification kits and all ten substrates based on their ability to yield complete DNA profiles following a direct amplification protocol. Six out of the nine amplification kits, and four out of the ten paper substrates had the highest success rates overall. Conclusion The data show that it is possible to generate complete DNA profiles following a direct amplification protocol using both standard (non-direct) and direct PCR amplification kits. The generation of complete DNA profiles appears to depend more on the success of the amplification kit rather than the than the FTA®- or non-FTA®-based substrates. PMID:25559837

  8. A powerless on-the-spot detection protocol for transgenic crops within 30 min, from leaf sampling up to results.

    PubMed

    Wang, Liu; Wang, Rui; Yu, Yonghua; Zhang, Fang; Wang, Xiaofu; Ying, Yibin; Wu, Jian; Xu, Junfeng

    2016-01-01

    The requirement of power-dependent instruments or excessive operation time usually restricts current nucleic acid amplification methods from being used for detection of transgenic crops in the field. In this paper, an easy and rapid detection method which requires no electricity supply has been developed. The time-consuming process of nucleic acid purification is omitted in this method. DNA solution obtained from leaves with 0.5 M sodium hydroxide (NaOH) can be used for loop-mediated isothermal amplification (LAMP) only after simple dilution. Traditional instruments like a polymerase chain reaction (PCR) amplifier and water bath used for DNA amplification are abandoned. Three kinds of dewar flasks were tested and it turned out that the common dewar flask was the best. Combined with visual detection of LAMP amplicons by phosphate (Pi)-induced coloration reaction, the whole process of detection of transgenic crops via genetically pure material (leaf material of one plant) could be accomplished within 30 min. The feasibility of this method was also verified by analysis of practical samples.

  9. Isothermal Amplification Methods for the Detection of Nucleic Acids in Microfluidic Devices

    PubMed Central

    Zanoli, Laura Maria; Spoto, Giuseppe

    2012-01-01

    Diagnostic tools for biomolecular detection need to fulfill specific requirements in terms of sensitivity, selectivity and high-throughput in order to widen their applicability and to minimize the cost of the assay. The nucleic acid amplification is a key step in DNA detection assays. It contributes to improving the assay sensitivity by enabling the detection of a limited number of target molecules. The use of microfluidic devices to miniaturize amplification protocols reduces the required sample volume and the analysis times and offers new possibilities for the process automation and integration in one single device. The vast majority of miniaturized systems for nucleic acid analysis exploit the polymerase chain reaction (PCR) amplification method, which requires repeated cycles of three or two temperature-dependent steps during the amplification of the nucleic acid target sequence. In contrast, low temperature isothermal amplification methods have no need for thermal cycling thus requiring simplified microfluidic device features. Here, the use of miniaturized analysis systems using isothermal amplification reactions for the nucleic acid amplification will be discussed. PMID:25587397

  10. Energetics and kinetics of primary charge separation in bacterial photosynthesis.

    PubMed

    LeBard, David N; Kapko, Vitaliy; Matyushov, Dmitry V

    2008-08-21

    We report the results of molecular dynamics (MD) simulations and formal modeling of the free-energy surfaces and reaction rates of primary charge separation in the reaction center of Rhodobacter sphaeroides. Two simulation protocols were used to produce MD trajectories. Standard force-field potentials were employed in the first protocol. In the second protocol, the special pair was made polarizable to reproduce a high polarizability of its photoexcited state observed by Stark spectroscopy. The charge distribution between covalent and charge-transfer states of the special pair was dynamically adjusted during the simulation run. We found from both protocols that the breadth of electrostatic fluctuations of the protein/water environment far exceeds previous estimates, resulting in about 1.6 eV reorganization energy of electron transfer in the first protocol and 2.5 eV in the second protocol. Most of these electrostatic fluctuations become dynamically frozen on the time scale of primary charge separation, resulting in much smaller solvation contributions to the activation barrier. While water dominates solvation thermodynamics on long observation times, protein emerges as the major thermal bath coupled to electron transfer on the picosecond time of the reaction. Marcus parabolas were obtained for the free-energy surfaces of electron transfer by using the first protocol, while a highly asymmetric surface was obtained in the second protocol. A nonergodic formulation of the diffusion-reaction electron-transfer kinetics has allowed us to reproduce the experimental results for both the temperature dependence of the rate and the nonexponential decay of the population of the photoexcited special pair.

  11. The In Situ Enzymatic Screening (ISES) Approach to Reaction Discovery and Catalyst Identification.

    PubMed

    Swyka, Robert A; Berkowitz, David B

    2017-12-14

    The importance of discovering new chemical transformations and/or optimizing catalytic combinations has led to a flurry of activity in reaction screening. The in situ enzymatic screening (ISES) approach described here utilizes biological tools (enzymes/cofactors) to advance chemistry. The protocol interfaces an organic reaction layer with an adjacent aqueous layer containing reporting enzymes that act upon the organic reaction product, giving rise to a spectroscopic signal. ISES allows the experimentalist to rapidly glean information on the relative rates of a set of parallel organic/organometallic reactions under investigation, without the need to quench the reactions or draw aliquots. In certain cases, the real-time enzymatic readout also provides information on sense and magnitude of enantioselectivity and substrate specificity. This article contains protocols for single-well (relative rate) and double-well (relative rate/enantiomeric excess) ISES, in addition to a colorimetric ISES protocol and a miniaturized double-well procedure. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  12. New approach to real-time nucleic acids detection: folding polymerase chain reaction amplicons into a secondary structure to improve cleavage of Förster resonance energy transfer probes in 5′-nuclease assays

    PubMed Central

    Kutyavin, Igor V.

    2010-01-01

    The article describes a new technology for real-time polymerase chain reaction (PCR) detection of nucleic acids. Similar to Taqman, this new method, named Snake, utilizes the 5′-nuclease activity of Thermus aquaticus (Taq) DNA polymerase that cleaves dual-labeled Förster resonance energy transfer (FRET) probes and generates a fluorescent signal during PCR. However, the mechanism of the probe cleavage in Snake is different. In this assay, PCR amplicons fold into stem–loop secondary structures. Hybridization of FRET probes to one of these structures leads to the formation of optimal substrates for the 5′-nuclease activity of Taq. The stem–loop structures in the Snake amplicons are introduced by the unique design of one of the PCR primers, which carries a special 5′-flap sequence. It was found that at a certain length of these 5′-flap sequences the folded Snake amplicons have very little, if any, effect on PCR yield but benefit many aspects of the detection process, particularly the signal productivity. Unlike Taqman, the Snake system favors the use of short FRET probes with improved fluorescence background. The head-to-head comparison study of Snake and Taqman revealed that these two technologies have more differences than similarities with respect to their responses to changes in PCR protocol, e.g. the variations in primer concentration, annealing time, PCR asymmetry. The optimal PCR protocol for Snake has been identified. The technology’s real-time performance was compared to a number of conventional assays including Taqman, 3′-MGB-Taqman, Molecular Beacon and Scorpion primers. The test trial showed that Snake supersedes the conventional assays in the signal productivity and detection of sequence variations as small as single nucleotide polymorphisms. Due to the assay’s cost-effectiveness and simplicity of design, the technology is anticipated to quickly replace all known conventional methods currently used for real-time nucleic acid detection. PMID:19969535

  13. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  14. Short Communication An efficient method for simultaneous extraction of high-quality RNA and DNA from various plant tissues.

    PubMed

    Oliveira, R R; Viana, A J C; Reátegui, A C E; Vincentz, M G A

    2015-12-29

    Determination of gene expression is an important tool to study biological processes and relies on the quality of the extracted RNA. Changes in gene expression profiles may be directly related to mutations in regulatory DNA sequences or alterations in DNA cytosine methylation, which is an epigenetic mark. Correlation of gene expression with DNA sequence or epigenetic mark polymorphism is often desirable; for this, a robust protocol to isolate high-quality RNA and DNA simultaneously from the same sample is required. Although commercial kits and protocols are available, they are mainly optimized for animal tissues and, in general, restricted to RNA or DNA extraction, not both. In the present study, we describe an efficient and accessible method to extract both RNA and DNA simultaneously from the same sample of various plant tissues, using small amounts of starting material. The protocol was efficient in the extraction of high-quality nucleic acids from several Arabidopsis thaliana tissues (e.g., leaf, inflorescence stem, flower, fruit, cotyledon, seedlings, root, and embryo) and from other tissues of non-model plants, such as Avicennia schaueriana (Acanthaceae), Theobroma cacao (Malvaceae), Paspalum notatum (Poaceae), and Sorghum bicolor (Poaceae). The obtained nucleic acids were used as templates for downstream analyses, such as mRNA sequencing, quantitative real time-polymerase chain reaction, bisulfite treatment, and others; the results were comparable to those obtained with commercial kits. We believe that this protocol could be applied to a broad range of plant species, help avoid technical and sampling biases, and facilitate several RNA- and DNA-dependent analyses.

  15. Stereocontrolled Alkylative Construction of Quaternary Carbon Centers

    PubMed Central

    Kummer, David A.; Chain, William J.; Morales, Marvin R.; Quiroga, Olga; Myers, Andrew G.

    2009-01-01

    Protocols for the stereodefined formation of α,α-disubstituted enolates of pseudoephedrine amides are presented followed by the implementation of these in diastereoselective alkylation reactions. Direct alkylation of α,α-disubstituted pseudoephedrine amide substrates is demonstrated to be both efficient and diastereoselective across a range of substrates, as exemplified by alkylation of the diastereomeric pseudoephedrine α-methylbutyramides, where both substrates are found to undergo stereospecific replacement of the α-C-H bond with α-C-alkyl, with retention of stereochemistry. This is shown to arise by sequential stereospecific enolization and alkylation reactions, with the alkyl halide attacking a common π-face of the E- and Z-enolates, proposed to be that opposite the pseudoephedrine alkoxide side-chain. Pseudoephedrine α-phenylbutyramides are found to undergo highly stereoselective but not stereospecific α-alkylation reactions, which evidence suggests is due to facile enolate isomerization. Also, we show that α, α-disubstituted pseudoephedrine amide enolates can be generated in a highly stereocontrolled fashion by conjugate addition of an alkyllithium reagent to the s-cis-conformer of an α-alkyl-α,β-unsaturated pseudoephedrine amide, providing α,α-disubstituted enolate substrates that undergo alkylation in the same sense as those formed by direct deprotonation. Methods are presented to transform the α-quaternary pseudoephedrine amide products into optically active carboxylic acids, ketones, primary alcohols, and aldehydes. PMID:18788739

  16. Facile chemical synthesis and equilibrium unfolding properties of CopG

    PubMed Central

    Wales, Thomas E.; Richardson, Jane S.; Fitzgerald, Michael C.

    2004-01-01

    The 45-amino acid polypeptide chain of the homodimeric transcriptional repressor, CopG, was chemically synthesized by stepwise solid phase peptide synthesis (SPPS) using a protocol based on Boc-chemistry. The product obtained from the synthesis was readily purified by reversed-phase HPLC to give a good overall yield (21% by weight). Moreover, the synthetic CopG constructs prepared in this work folded into three-dimensional structures similar to the wild-type protein prepared using conventional recombinant methods as judged by far UV-CD spectroscopy. A fluorescent CopG analog, (Y39W)CopG, was also designed and chemically synthesized to facilitate biophysical studies of CopG’s protein folding and assembly reaction. The guanidinium chloride-induced equilibrium unfolding properties of the wild-type CopG and (Y39W)CopG constructs in this work were characterized and used to develop a model for CopG’s equilibrium unfolding reaction. Our results indicate that CopG’s folding and assembly reaction is well modeled by a two-state process involving folded dimer and unfolded monomer. Using this model, ΔGf and m-values of −13.42 ± 0.04 kcal/mole dimer and 1.92 ± 0.01 kcal/(mole M) were calculated for CopG. PMID:15169951

  17. The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

    2013-06-28

    Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

  18. Control and reduction of peak temperature in self-curing resins.

    PubMed

    Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A

    2009-07-01

    INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.

  19. A prospective observational study of a novel 2-phase infusion protocol for the administration of acetylcysteine in paracetamol poisoning.

    PubMed

    Isbister, Geoffrey K; Downes, Michael A; Mcnamara, Kylie; Berling, Ingrid; Whyte, Ian M; Page, Colin B

    2016-01-01

    The current 3-phase acetylcysteine infusion for paracetamol poisoning delivers half the dose over 15-60 min and frequently results in adverse reactions. We aimed to determine adverse reaction frequency with a modified 2-phase infusion protocol with a longer initial infusion. A prospective observational study of a modified 2-phase acetylcysteine protocol was undertaken at two hospitals. Acetylcysteine was commenced on admission and ceased if paracetamol concentrations were low-risk (below the nomogram line). The first infusion was 200 mg/kg over 4-9 h based on ingestion time or 4 h for staggered/chronic ingestions. The second infusion was 100 mg/kg over 16 h. Pre-defined outcomes were frequency of adverse reactions (systemic hypersensitivity reactions or gastrointestinal); proportion with alanine transaminase (ALT) > 1000 U/L or abnormal ALT. 654 paracetamol poisonings were treated with the new protocol; median age 29 y (15-98 y); 453 females; 576 acute and 78 staggered/chronic ingestions. In 420 (64%) acetylcysteine was stopped for low-risk paracetamol concentrations. An adverse reaction occurred in 229/654 admissions (35%; 95% CI: 31-39%): 173 (26.5%; 95% CI: 23-30%) only gastrointestinal, 50 (8%; 95% CI: 6-10%) skin only systemic hypersensitivity reactions; and three severe anaphylaxis (0.5%; 95% CI: 0.1-1.5%; all hypotension). Adverse reactions occurred in 111/231 (48%) receiving full treatment compared to 116/420 (28%) in whom the infusion was stopped early (absolute difference 20%; 95% CI: 13-28%; p < 0.0001). In 200 overdoses < 10 g, one had toxic paracetamol concentrations, but 53 developed reactions. Sixteen patients had an ALT > 1000 U/L and 24 an abnormal ALT attributable to paracetamol; all but one had treatment commenced >12 h post-ingestion. A 2-phase acetylcysteine infusion protocol results in a fewer reactions in patients with toxic paracetamol concentrations, but is not justified in patients with low-risk paracetamol concentrations.

  20. Perspectives for laboratory implementation of the Duan-Lukin-Cirac-Zoller protocol for quantum repeaters

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mendes, Milrian S.; Felinto, Daniel

    2011-12-15

    We analyze the efficiency and scalability of the Duan-Lukin-Cirac-Zoller (DLCZ) protocol for quantum repeaters focusing on the behavior of the experimentally accessible measures of entanglement for the system, taking into account crucial imperfections of the stored entangled states. We calculate then the degradation of the final state of the quantum-repeater linear chain for increasing sizes of the chain, and characterize it by a lower bound on its concurrence and the ability to violate the Clausner-Horne-Shimony-Holt inequality. The states are calculated up to an arbitrary number of stored excitations, as this number is not fundamentally bound for experiments involving large atomicmore » ensembles. The measurement by avalanche photodetectors is modeled by ''ON/OFF'' positive operator-valued measure operators. As a result, we are able to consistently test the approximation of the real fields by fields with a finite number of excitations, determining the minimum number of excitations required to achieve a desired precision in the prediction of the various measured quantities. This analysis finally determines the minimum purity of the initial state that is required to succeed in the protocol as the size of the chain increases. We also provide a more accurate estimate for the average time required to succeed in each step of the protocol. The minimum purity analysis and the new time estimates are then combined to trace the perspectives for implementation of the DLCZ protocol in present-day laboratory setups.« less

  1. Perspectives for laboratory implementation of the Duan-Lukin-Cirac-Zoller protocol for quantum repeaters

    NASA Astrophysics Data System (ADS)

    Mendes, Milrian S.; Felinto, Daniel

    2011-12-01

    We analyze the efficiency and scalability of the Duan-Lukin-Cirac-Zoller (DLCZ) protocol for quantum repeaters focusing on the behavior of the experimentally accessible measures of entanglement for the system, taking into account crucial imperfections of the stored entangled states. We calculate then the degradation of the final state of the quantum-repeater linear chain for increasing sizes of the chain, and characterize it by a lower bound on its concurrence and the ability to violate the Clausner-Horne-Shimony-Holt inequality. The states are calculated up to an arbitrary number of stored excitations, as this number is not fundamentally bound for experiments involving large atomic ensembles. The measurement by avalanche photodetectors is modeled by “ON/OFF” positive operator-valued measure operators. As a result, we are able to consistently test the approximation of the real fields by fields with a finite number of excitations, determining the minimum number of excitations required to achieve a desired precision in the prediction of the various measured quantities. This analysis finally determines the minimum purity of the initial state that is required to succeed in the protocol as the size of the chain increases. We also provide a more accurate estimate for the average time required to succeed in each step of the protocol. The minimum purity analysis and the new time estimates are then combined to trace the perspectives for implementation of the DLCZ protocol in present-day laboratory setups.

  2. Modeling competitive substitution in a polyelectrolyte complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu

    2015-12-28

    We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less

  3. A targeted metabolomic protocol for short-chain fatty acids and branched-chain amino acids.

    PubMed

    Zheng, Xiaojiao; Qiu, Yunping; Zhong, Wei; Baxter, Sarah; Su, Mingming; Li, Qiong; Xie, Guoxiang; Ore, Brandon M; Qiao, Shanlei; Spencer, Melanie D; Zeisel, Steven H; Zhou, Zhanxiang; Zhao, Aihua; Jia, Wei

    2013-08-01

    Research in obesity and metabolic disorders that involve intestinal microbiota demands reliable methods for the precise measurement of the short-chain fatty acids (SCFAs) and branched-chain amino acids (BCAAs) concentration. Here, we report a rapid method of simultaneously determining SCFAs and BCAAs in biological samples using propyl chloroformate (PCF) derivatization followed by gas chromatography mass spectrometry (GC-MS) analysis. A one-step derivatization using 100 µL of PCF in a reaction system of water, propanol, and pyridine (v/v/v = 8:3:2) at pH 8 provided the optimal derivatization efficiency. The best extraction efficiency of the derivatized products was achieved by a two-step extraction with hexane. The method exhibited good derivatization efficiency and recovery for a wide range of concentrations with a low limit of detection for each compound. The relative standard deviations (RSDs) of all targeted compounds showed good intra- and inter-day (within 7 days) precision (< 10%), and good stability (< 20%) within 4 days at room temperature (23-25 °C), or 7 days when stored at -20 °C. We applied our method to measure SCFA and BCAA levels in fecal samples from rats administrated with different diet. Both univariate and multivariate statistics analysis of the concentrations of these target metabolites could differentiate three groups with ethanol intervention and different oils in diet. This method was also successfully employed to determine SCFA and BCAA in the feces, plasma and urine from normal humans, providing important baseline information of the concentrations of these metabolites. This novel metabolic profile study has great potential for translational research.

  4. Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

    PubMed

    Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

    2012-12-01

    Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  5. A reliable protocol for the isolation of viable, chondrogenically differentiated human mesenchymal stem cells from high-density pellet cultures.

    PubMed

    Ullah, Mujib; Hamouda, Houda; Stich, Stefan; Sittinger, Michael; Ringe, Jochen

    2012-12-01

    Administration of chondrogenically differentiated mesenchymal stem cells (MSC) is discussed as a promising approach for the regenerative treatment of injured or diseased cartilage. The high-density pellet culture is the standard culture for chondrogenic differentiation, but cells in pellets secrete extracellular matrix (ECM) that they become entrapped in. Protocols for cell isolation from pellets often result in cell damage and dedifferentiation towards less differentiated MSC. Therefore, our aim was to develop a reliable protocol for the isolation of viable, chondrogenically differentiated MSC from high-density pellet cultures. Human bone marrow MSC were chondrogenically stimulated with transforming growth factor-β3, and the cartilaginous structure of the pellets was verified by alcian blue staining of cartilage proteoglycans, antibody staining of cartilage collagen type II, and quantitative real-time reverse-transcription polymerase chain reaction of the marker genes COL2A1 and SOX9. Trypsin and collagenases II and P were tested alone or in combination, and for different concentrations and times, to find a protocol for optimized pellet digestion. Whereas trypsin was not able to release viable cells, 90-min digestion with 300 U of collagenase II, 20 U of collagenase P, and 2 mM CaCl2 worked quite well and resulted in about 2.5×10(5) cells/pellet. The protocol was further optimized for the separation of released cells and ECM from each other. Cells were alcian blue and collagen type II positive and expressed COL2A1 and SOX9, verifying a chondrogenic character. However, they had different morphological shapes. The ECM was also uniformly alcian blue and collagen type II positive but showed different organizational and structural forms. To conclude, our protocol allows the reliable isolation of a defined number of viable, chondrogenically differentiated MSC from high-density pellet cultures. Such cells, as well as the ECM components, are of interest as research tools and for cartilage tissue engineering.

  6. Promoting adverse drug reaction reporting: comparison of different approaches

    PubMed Central

    Ribeiro-Vaz, Inês; Santos, Cristina Costa; Cruz-Correia, Ricardo

    2016-01-01

    ABSTRACT OBJECTIVE To describe different approaches to promote adverse drug reaction reporting among health care professionals, determining their cost-effectiveness. METHODS We analyzed and compared several approaches taken by the Northern Pharmacovigilance Centre (Portugal) to promote adverse drug reaction reporting. Approaches were compared regarding the number and relevance of adverse drug reaction reports obtained and costs involved. Costs by report were estimated by adding the initial costs and the running costs of each intervention. These costs were divided by the number of reports obtained with each intervention, to assess its cost-effectiveness. RESULTS All the approaches seem to have increased the number of adverse drug reaction reports. We noted the biggest increase with protocols (321 reports, costing 1.96 € each), followed by first educational approach (265 reports, 20.31 €/report) and by the hyperlink approach (136 reports, 15.59 €/report). Regarding the severity of adverse drug reactions, protocols were the most efficient approach, costing 2.29 €/report, followed by hyperlinks (30.28 €/report, having no running costs). Concerning unexpected adverse drug reactions, the best result was obtained with protocols (5.12 €/report), followed by first educational approach (38.79 €/report). CONCLUSIONS We recommend implementing protocols in other pharmacovigilance centers. They seem to be the most efficient intervention, allowing receiving adverse drug reactions reports at lower costs. The increase applied not only to the total number of reports, but also to the severity, unexpectedness and high degree of causality attributed to the adverse drug reactions. Still, hyperlinks have the advantage of not involving running costs, showing the second best performance in cost per adverse drug reactions report. PMID:27143614

  7. Silicon-based sleeve devices for chemical reactions

    DOEpatents

    Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

    1996-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  8. Silicon-based sleeve devices for chemical reactions

    DOEpatents

    Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

    1996-12-31

    A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

  9. Unbiased Strain-Typing of Arbovirus Directly from Mosquitoes Using Nanopore Sequencing: A Field-forward Biosurveillance Protocol.

    PubMed

    Russell, Joseph A; Campos, Brittany; Stone, Jennifer; Blosser, Erik M; Burkett-Cadena, Nathan; Jacobs, Jonathan L

    2018-04-03

    The future of infectious disease surveillance and outbreak response is trending towards smaller hand-held solutions for point-of-need pathogen detection. Here, samples of Culex cedecei mosquitoes collected in Southern Florida, USA were tested for Venezuelan Equine Encephalitis Virus (VEEV), a previously-weaponized arthropod-borne RNA-virus capable of causing acute and fatal encephalitis in animal and human hosts. A single 20-mosquito pool tested positive for VEEV by quantitative reverse transcription polymerase chain reaction (RT-qPCR) on the Biomeme two3. The virus-positive sample was subjected to unbiased metatranscriptome sequencing on the Oxford Nanopore MinION and shown to contain Everglades Virus (EVEV), an alphavirus in the VEEV serocomplex. Our results demonstrate, for the first time, the use of unbiased sequence-based detection and subtyping of a high-consequence biothreat pathogen directly from an environmental sample using field-forward protocols. The development and validation of methods designed for field-based diagnostic metagenomics and pathogen discovery, such as those suitable for use in mobile "pocket laboratories", will address a growing demand for public health teams to carry out their mission where it is most urgent: at the point-of-need.

  10. A Modified Protocol with Improved Detection Rate for Mis-Matched Donor HLA from Low Quantities of DNA in Urine Samples from Kidney Graft Recipients.

    PubMed

    Kwok, Janette; Choi, Leo C W; Ho, Jenny C Y; Chan, Gavin S W; Mok, Maggie M Y; Lam, Man-Fei; Chak, Wai-Leung; Cheuk, Au; Chau, Ka-Foon; Tong, Matthew; Chan, Kwok-Wah; Chan, Tak-Mao

    2016-01-01

    Urine from kidney transplant recipient has proven to be a viable source for donor DNA. However, an optimized protocol would be required to determine mis-matched donor HLA specificities in view of the scarcity of DNA obtained in some cases. In this study, fresh early morning urine specimens were obtained from 155 kidney transplant recipients with known donor HLA phenotype. DNA was extracted and typing of HLA-A, B and DRB1 loci by polymerase chain reaction-specific sequence primers was performed using tailor-made condition according to the concentration of extracted DNA. HLA typing of DNA extracted from urine revealed both recipient and donor HLA phenotypes, allowing the deduction of the unknown donor HLA and hence the degree of HLA mis-match. By adopting the modified procedures, mis-matched donor HLA phenotypes were successfully deduced in all of 35 tested urine samples at DNA quantities spanning the range of 620-24,000 ng. This urine-based method offers a promising and reliable non-invasive means for the identification of mis-matched donor HLA antigens in kidney transplant recipients with unknown donor HLA phenotype or otherwise inadequate donor information.

  11. Rapid microfluidic analysis of a Y-STR multiplex for screening of forensic samples.

    PubMed

    Gibson-Daw, Georgiana; Albani, Patricia; Gassmann, Marcus; McCord, Bruce

    2017-02-01

    In this paper, we demonstrate a rapid analysis procedure for use with a small set of rapidly mutating Y chromosomal short tandem repeat (Y-STR) loci that combines both rapid polymerase chain reaction (PCR) and microfluidic separation elements. The procedure involves a high-speed polymerase and a rapid cycling protocol to permit PCR amplification in 16 min. The resultant amplified sample is next analysed using a short 1.8-cm microfluidic electrophoresis system that permits a four-locus Y-STR genotype to be produced in 80 s. The entire procedure takes less than 25 min from sample collection to result. This paper describes the rapid amplification protocol as well as studies of the reproducibility and sensitivity of the procedure and its optimisation. The amplification process utilises a small high-speed thermocycler, microfluidic device and compact laptop, making it portable and potentially useful for rapid, inexpensive on-site genotyping. The four loci used for the multiplex were selected due to their rapid mutation rates and should proved useful in preliminary screening of samples and suspects. Overall, this technique provides a method for rapid sample screening of suspect and crime scene samples in forensic casework. Graphical abstract ᅟ.

  12. A linear concatenation strategy to construct 5'-enriched amplified cDNA libraries using multiple displacement amplification.

    PubMed

    Gadkar, Vijay J; Filion, Martin

    2013-06-01

    In various experimental systems, limiting available amounts of RNA may prevent a researcher from performing large-scale analyses of gene transcripts. One way to circumvent this is to 'pre-amplify' the starting RNA/cDNA, so that sufficient amounts are available for any downstream analysis. In the present study, we report the development of a novel protocol for constructing amplified cDNA libraries using the Phi29 DNA polymerase based multiple displacement amplification (MDA) system. Using as little as 200 ng of total RNA, we developed a linear concatenation strategy to make the single-stranded cDNA template amenable for MDA. The concatenation, made possible by the template switching property of the reverse transcriptase enzyme, resulted in the amplified cDNA library with intact 5' ends. MDA generated micrograms of template, allowing large-scale polymerase chain reaction analyses or other large-scale downstream applications. As the amplified cDNA library contains intact 5' ends, it is also compatible with 5' RACE analyses of specific gene transcripts. Empirical validation of this protocol is demonstrated on a highly characterized (tomato) and an uncharacterized (corn gromwell) experimental system.

  13. PCR synthesis of double stranded DNA labeled with 5-bromouridine. A step towards finding a bromonucleoside for clinical trials.

    PubMed

    Michalska, Barbara; Sobolewski, Ireneusz; Polska, Katarzyna; Zielonka, Justyna; Zylicz-Stachula, Agnieszka; Skowron, Piotr; Rak, Janusz

    2011-12-05

    Incorporation of 5-bromouridine (5BrdU) into DNA makes it sensitive to UV and ionizing radiation, which opens up a prospective route for the clinical usage of 5-bromouridine and other halonucleosides. In the present work the polymerase chain reaction (PCR) protocol, which enables a long DNA fragment (resembling DNA synthesized in the cell in the presence of halonucleosides) to be completely substituted with 5BrdU, was optimized. Using HPLC coupled to enzymatic digestion, it was demonstrated that the actual amounts of native nucleosides and 5BrdU correspond very well to those calculated from the sequence of PCR products. The synthesized DNA is photosensitive to photons of 300nm. HPLC analysis demonstrated that the photolysis of labeled PCR products leads to a significant decrease in the 5BrdU signal and the simultaneous occurrence of a uridine peak. Agarose and polyacrylamide gel electrophoresis suggest that single strand breaks and cross-links are formed as a result of UV irradiation. The PCR protocol described in the current paper may be employed for labeling DNA not only with BrdU but also with other halonucleosides. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Highly efficient oxidation of amines to imines by singlet oxygen and its application in Ugi-type reactions.

    PubMed

    Jiang, Gaoxi; Chen, Jian; Huang, Jie-Sheng; Che, Chi-Ming

    2009-10-15

    A variety of secondary benzylic amines were oxidized to imines in 90% to >99% yields by singlet oxygen generated from oxygen and a porphyrin photosensitizer. On the basis of these reactions, a protocol was developed for oxidative Ugi-type reactions with singlet oxygen as the oxidant. This protocol has been used to synthesize C1- and N-functionalized benzylic amines in up to 96% yields.

  15. Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

    PubMed

    Chen, Y T; Mercer, G O; Chen, Y

    1993-11-01

    Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

  16. Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

    PubMed

    Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

    2016-10-01

    The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

    PubMed

    Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

    2002-07-01

    Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

  18. Organic reactions mediated by electrochemically generated ArS+.

    PubMed

    Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi

    2011-04-21

    Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.

  19. Paper-based archiving of biological samples from fish for detecting betanodavirus.

    PubMed

    Navaneeth Krishnan, A; Bhuvaneswari, T; Ezhil Praveena, P; Jithendran, K P

    2016-07-01

    This study was carried out to evaluate the efficiency of the Flinders Technology Associates (FTA(®)) card (Whatman(®)) as a sampling device and storage platform for RNA from betanodavirus-infected biological samples (viz., larvae, broodstock, cell culture supernatants and rearing seawater spiked with infected materials). The study showed that FTA cards can be used to detect betanodaviruses by reverse transcription-polymerase chain reaction (RT-PCR). The diagnostic efficiency of RT-PCR from all sample types on FTA cards decreased after 21 days of storage at 4 °C, although the virus could be detected up to 28 days by nested RT-PCR. The FTA card protocol thus provides a supplementary method for quick and easy collection of samples, preservation of RNA on a dry storage basis, and detection of betanodavirus-infected fish.

  20. Development of a highly sensitive screen for influenza A in guano and its application in the search for ancient RNA preserved under Antarctic Adelie penguin colonies.

    PubMed

    Briggs, L C; Ashton, R M; Metcalf, P

    2003-01-01

    We have developed a reverse transcriptase polymerase chain reaction (RT-PCR)-based assay to detect influenza A in guano samples as part of our program to investigate ancient viral RNA from under Antarctic Adelie penguin (Pygoscelis adeliae) colonies. Of five extraction protocols tested (RNeasy, GTC TRIZOL, GTC Silica, Rnaid, and AGPC), AGPC proved to be the most consistent and sensitive to low concentrations of influenza, but further purification with commercial viral nucleic acid spin filter system was still required to remove remaining PCR inhibitors. RT-PCR was then performed on the eluent and 650 bases of the M1 gene were amplified. The assay was found to be able to detect as little as 100 microl of 0.1 hemagglutination units (HU)/ml influenza.

  1. Successful off-label use of the Cepheid Xpert GBS in a late-onset neonatal meningitis by Streptococcus agalactiae.

    PubMed

    Savini, Vincenzo; Marrollo, Roberta; Coclite, Eleonora; Fusilli, Paola; D'Incecco, Carmine; Fazii, Paolo

    2014-01-01

    We report the case of a late-onset neonatal meningitis by Streptococcus agalactiae (group B Streptococcus - GBS) that was diagnosed with a latex agglutination assay (on cerebrospinal fluid, CSF), as well as by using, for the first time, Xpert GBS (Cepheid, US) on CSF. Due to empirical antibiotics given before sampling, both CSF and blood culture were negative, so the abovementioned diagnostics was crucial. Moreover, the Xpert GBS assay, performed according to an off-label, modified protocol (the system is designed for GBS-carriage intrapartum screening, based on a completely automated real time-Polymerase Chain Reaction) quickly detected the organism's genome target. Although further investigation on this test's performace on CSF is required, then, we trust it may be a promising, quick and precise diagnostic method for infections in newborns.

  2. Nursing Care of Patients Undergoing Chemotherapy Desensitization: Part I.

    PubMed

    Jakel, Patricia; Carsten, Cynthia; Braskett, Melinda; Carino, Arvie

    2016-02-01

    Hypersensitivity reactions to chemotherapeutic agents can cause the discontinuation of first-line therapies. Chemotherapy desensitization is a safe, but labor-intensive, process to administer these important medications. A desensitization protocol can enable a patient to receive the entire target dose of a medication, even if the patient has a history of severe infusion reactions. In this article, the authors explain the pathophysiology of hypersensitivity reactions and describe the recent development of desensitization protocols in oncology. In part II of this article, which will appear in the April 2016 issue of the Clinical Journal of Oncology Nursing, the authors will give a detailed account of how a desensitization protocol is performed at an academic medical center.
.

  3. Surfactant-controlled polymerization of semiconductor clusters to quantum dots through competing step-growth and living chain-growth mechanisms.

    PubMed

    Evans, Christopher M; Love, Alyssa M; Weiss, Emily A

    2012-10-17

    This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.

  4. Kinetics of Chemical Reactions in Flames

    NASA Technical Reports Server (NTRS)

    Zeldovich, Y.; Semenov, N.

    1946-01-01

    In part I of the paper the theory of flame propagation is developed along the lines followed by Frank-Kamenetsky and one of the writers. The development of chain processes in flames is considered. A basis is given for the application of the method of stationary concentrations to reactions in flames; reactions with branching chains are analyzed. The case of a diffusion coefficient different from the coefficient of temperature conductivity is considered.

  5. Single-Point Mutation with a Rotamer Library Toolkit: Toward Protein Engineering.

    PubMed

    Pottel, Joshua; Moitessier, Nicolas

    2015-12-28

    Protein engineers have long been hard at work to harness biocatalysts as a natural source of regio-, stereo-, and chemoselectivity in order to carry out chemistry (reactions and/or substrates) not previously achieved with these enzymes. The extreme labor demands and exponential number of mutation combinations have induced computational advances in this domain. The first step in our virtual approach is to predict the correct conformations upon mutation of residues (i.e., rebuilding side chains). For this purpose, we opted for a combination of molecular mechanics and statistical data. In this work, we have developed automated computational tools to extract protein structural information and created conformational libraries for each amino acid dependent on a variable number of parameters (e.g., resolution, flexibility, secondary structure). We have also developed the necessary tool to apply the mutation and optimize the conformation accordingly. For side-chain conformation prediction, we obtained overall average root-mean-square deviations (RMSDs) of 0.91 and 1.01 Å for the 18 flexible natural amino acids within two distinct sets of over 3000 and 1500 side-chain residues, respectively. The commonly used dihedral angle differences were also evaluated and performed worse than the state of the art. These two metrics are also compared. Furthermore, we generated a family-specific library for kinases that produced an average 2% lower RMSD upon side-chain reconstruction and a residue-specific library that yielded a 17% improvement. Ultimately, since our protein engineering outlook involves using our docking software, Fitted/Impacts, we applied our mutation protocol to a benchmarked data set for self- and cross-docking. Our side-chain reconstruction does not hinder our docking software, demonstrating differences in pose prediction accuracy of approximately 2% (RMSD cutoff metric) for a set of over 200 protein/ligand structures. Similarly, when docking to a set of over 100 kinases, side-chain reconstruction (using both general and biased conformation libraries) had minimal detriment to the docking accuracy.

  6. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    USDA-ARS?s Scientific Manuscript database

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  7. [Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

    PubMed

    Wang, F; Zhang, Y Q; Ding, J; Yu, L X

    2017-10-18

    To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

  8. Dissipative Quantum Control of a Spin Chain

    NASA Astrophysics Data System (ADS)

    Morigi, Giovanna; Eschner, Jürgen; Cormick, Cecilia; Lin, Yiheng; Leibfried, Dietrich; Wineland, David J.

    2015-11-01

    A protocol is discussed for preparing a spin chain in a generic many-body state in the asymptotic limit of tailored nonunitary dynamics. The dynamics require the spectral resolution of the target state, optimized coherent pulses, engineered dissipation, and feedback. As an example, we discuss the preparation of an entangled antiferromagnetic state, and argue that the procedure can be applied to chains of trapped ions or Rydberg atoms.

  9. Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

    PubMed

    Igarashi, T; Yamamoto, A; Goto, N

    1996-10-01

    Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

  10. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    PubMed

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  11. Structure–Function Studies of Hydrophobic Residues That Clamp a Basic Glutamate Side Chain during Catalysis by Triosephosphate Isomerase

    PubMed Central

    2016-01-01

    Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328

  12. Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates.

    PubMed

    Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M

    2013-03-28

    This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

  13. Desensitization to clopidogrel: a tailor-made protocol.

    PubMed

    Barreira, P; Cadinha, S; Malheiro, D; Moreira da Silva, J P

    2014-01-01

    Clopidogrel is an antiplatelet drug widely used for treatment and prevention of a variety of cardiovascular diseases. We report a successful desensitization to clopidogrel in a 70-year-old Caucasian man with delayed hypersensitivity (HS) reaction. He developed lip, hand and foot swelling, erythematous papular non-pruritic lesions and arthralgias 2 weeks after starting treatment with clopidogrel 75 mg/d. A 3-hour desensitization protocol was started, achieving a cumulative dose of 154 mg without any reaction, and a daily dose of 75 mg was recommended. On the 4th day, the patient developed skin lesions similar to the previously described. He was treated with topical steroids and oral antihistamines, and the daily dose of clopidogrel was reduced to 20 mg. A new desensitization protocol was established, with a slow dose increment, according to the patient's response. It was only possible to achieve the dose of 75 mg/d after 2 months. Although well tolerated by most patients, HS reactions with clopidogrel may occur and desensitization is rising as a safe alternative in those patients. In delayed reactions with cutaneous lesions, a slower desensitization protocol may be necessary, as in this case.

  14. Postinduction minimal residual disease monitoring by polymerase chain reaction in children with acute lymphoblastic leukemia.

    PubMed

    Paganin, Maddalena; Fabbri, Giulia; Conter, Valentino; Barisone, Elena; Polato, Katia; Cazzaniga, Giovanni; Giraldi, Eugenia; Fagioli, Franca; Aricò, Maurizio; Valsecchi, Maria Grazia; Basso, Giuseppe

    2014-11-01

    Acute lymphoblastic leukemia (ALL) is the most common pediatric cancer. Monitoring minimal residual disease (MRD) by using real-time quantitative polymerase chain reaction (RQ-PCR) provides information for patient stratification and individual risk-directed treatment. Cooperative studies have documented that measurement of blast clearance from the bone marrow during and after induction therapy identifies patient populations with different risk of relapse. We explored the possible contribution of measurements of MRD during the course of treatment. We used RQ-PCR to detect MRD in 110 unselected patients treated in Italy in the International Collaborative Treatment Protocol for Children and Adolescents With Acute Lymphoblastic Leukemia (AIEOP-BFM ALL 2000). The trial took place in AIEOP centers during postinduction chemotherapy. Results were categorized as negative, low positive (below the quantitative range [< 5 × 10(-4)]), or high positive (≥ 5 × 10(-4)). Patients with at least one low-positive or high-positive result were assigned to the corresponding subgroup. Patients who tested high positive, low positive, or negative had significantly different cumulative incidences of leukemia relapse: 83.3%, 34.8%, and 8.6%, respectively (P < .001). Two thirds of positive cases were identified within 4 months after induction-consolidation therapy, suggesting that this time frame may be most suitable for cost-effective MRD monitoring, particularly in patients who did not clear their disease at the end of consolidation. These findings provide further insights into the dynamic of MRD and the ongoing effort to define molecular relapse in childhood ALL. © 2014 by American Society of Clinical Oncology.

  15. Three-dimensional printing surgical instruments: are we there yet?

    PubMed

    Rankin, Timothy M; Giovinco, Nicholas A; Cucher, Daniel J; Watts, George; Hurwitz, Bonnie; Armstrong, David G

    2014-06-15

    The applications for rapid prototyping have expanded dramatically over the last 20 y. In recent years, additive manufacturing has been intensely investigated for surgical implants, tissue scaffolds, and organs. There is, however, scant literature to date that has investigated the viability of three-dimensional (3D) printing of surgical instruments. Using a fused deposition modeling printer, an Army/Navy surgical retractor was replicated from polylactic acid (PLA) filament. The retractor was sterilized using standard Food and Drug Administration approved glutaraldehyde protocols, tested for bacteria by polymerase chain reaction, and stressed until fracture to determine if the printed instrument could tolerate force beyond the demands of an operating room (OR). Printing required roughly 90 min. The instrument tolerated 13.6 kg of tangential force before failure, both before and after exposure to the sterilant. Freshly extruded PLA from the printer was sterile and produced no polymerase chain reaction product. Each instrument weighed 16 g and required only $0.46 of PLA. Our estimates place the cost per unit of a 3D-printed retractor to be roughly 1/10th the cost of a stainless steel instrument. The PLA Army/Navy retractor is strong enough for the demands of the OR. Freshly extruded PLA in a clean environment, such as an OR, would produce a sterile ready-to-use instrument. Because of the unprecedented accessibility of 3D printing technology world wide and the cost efficiency of these instruments, there are far reaching implications for surgery in some underserved and less developed parts of the world. Copyright © 2014 Elsevier Inc. All rights reserved.

  16. Microfabricated electrochemiluminescence cell for chemical reaction detection

    DOEpatents

    Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

    2003-01-01

    A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  17. Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions

    NASA Astrophysics Data System (ADS)

    Zlokazov, V. B.; Utyonkov, V. K.

    2017-07-01

    The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.

  18. A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

    NASA Astrophysics Data System (ADS)

    Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua

    2017-08-01

    Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.

  19. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  20. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  1. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  2. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    EPA Science Inventory

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  3. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    USDA-ARS?s Scientific Manuscript database

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  4. Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

    PubMed

    Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

    2005-03-01

    We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

  5. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  6. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  7. Template based protein structure modeling by global optimization in CASP11.

    PubMed

    Joo, Keehyoung; Joung, InSuk; Lee, Sun Young; Kim, Jong Yun; Cheng, Qianyi; Manavalan, Balachandran; Joung, Jong Young; Heo, Seungryong; Lee, Juyong; Nam, Mikyung; Lee, In-Ho; Lee, Sung Jong; Lee, Jooyoung

    2016-09-01

    For the template-based modeling (TBM) of CASP11 targets, we have developed three new protein modeling protocols (nns for server prediction and LEE and LEER for human prediction) by improving upon our previous CASP protocols (CASP7 through CASP10). We applied the powerful global optimization method of conformational space annealing to three stages of optimization, including multiple sequence-structure alignment, three-dimensional (3D) chain building, and side-chain remodeling. For more successful fold recognition, a new alignment method called CRFalign was developed. It can incorporate sensitive positional and environmental dependence in alignment scores as well as strong nonlinear correlations among various features. Modifications and adjustments were made to the form of the energy function and weight parameters pertaining to the chain building procedure. For the side-chain remodeling step, residue-type dependence was introduced to the cutoff value that determines the entry of a rotamer to the side-chain modeling library. The improved performance of the nns server method is attributed to successful fold recognition achieved by combining several methods including CRFalign and to the current modeling formulation that can incorporate native-like structural aspects present in multiple templates. The LEE protocol is identical to the nns one except that CASP11-released server models are used as templates. The success of LEE in utilizing CASP11 server models indicates that proper template screening and template clustering assisted by appropriate cluster ranking promises a new direction to enhance protein 3D modeling. Proteins 2016; 84(Suppl 1):221-232. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  8. Carboplatin Hypersensitivity Reactions in Pediatric Low Grade Glioma Are Protocol Specific and Desensitization Shows Poor Efficacy.

    PubMed

    Dodgshun, Andrew J; Hansford, Jordan R; Cole, Theresa; Choo, Sharon; Sullivan, Michael J

    2016-01-01

    The use of carboplatin for the treatment of pediatric low grade gliomas (PLGG) is often limited by the development of carboplatin hypersensitivity. Reported rates of carboplatin hypersensitivity reactions vary between 6% and 32% in these patients. Here we report the frequency of carboplatin hypersensitivity reactions depending on the treatment regimen used, and outcomes of carboplatin desensitization. The records of all patients in a single institution who were treated with carboplatin for PLGG were accessed and all patients receiving more than one dose of carboplatin are reported. Thirty four patients with PLGG were treated with carboplatin according to one of the two different regimens. Carboplatin hypersensitivity was documented in 47% of patients, but the frequency differed by treatment protocol. Those patients treated with 4-weekly single agent carboplatin had carboplatin allergy in 8% of cases whereas 68% of those treated with combined carboplatin and vincristine (every three weeks, according to the SIOP 2004 low grade glioma protocol) had carboplatin reactions (OR 23.6, P < 0.01). Desensitization was only successful in two out of 10 patients in whom it was attempted. Hypersensitivity reactions to carboplatin are more common in this cohort than previously reported and rates are protocol-dependent. Desensitization showed limited effectiveness in this cohort. © 2015 Wiley Periodicals, Inc.

  9. THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST

    PubMed Central

    Keil, Harry; Wasserman, David; Dawson, Charles R.

    1944-01-01

    1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415

  10. THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST.

    PubMed

    Keil, H; Wasserman, D; Dawson, C R

    1944-10-01

    1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.

  11. Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

    PubMed Central

    deWit, D; Wootton, M; Allan, B; Steyn, L

    1993-01-01

    A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

  12. Early diagnosis of HIV in children below 18 months using DNA PCR test--assessment of the effectiveness of PMTCT interventions and challenges in early initiation of ART in a resource-limited setting.

    PubMed

    Gupta, Anil; Singh, Girraj; Kaushik, Pratap; Joshi, Bipin; Kalra, Kamlesh; Chakraborty, Sabyasachi

    2013-04-01

    This study was conducted to assess efficacy of the current Indian Prevention of Mother-to-Child Transmission (PMTCT) protocol in 217 HIV-exposed infants, and to assess challenges in the early initiation of antiretroviral treatment (ART) in 18 (8.3%) infants with HIV, as determined by the HIV-1 DNA polymerase chain reaction (PCR) test at ≥ 6 weeks to <18 months of age. The mother-to-child transmission (MTCT) rate in 154 mother-baby pairs fully compliant with the PMTCT protocol was 5.2%. However, if 25 pairs who were positive using dried blood spot (DBS) DNA PCR and who did not undergo whole blood testing are included in the analysis, then the overall MTCT rate would be 19.8%. The current protocol is 50% effective considering an MTCT rate of 35-40% without any intervention. ART was initiated in 10 (55.6%) HIV-infected children at a mean ± standard deviation (SD) age of 10.45 ± 4.9 (range: 4-17.5) months; delay resulted in opportunistic infections in one-third of the children. A single-dose nevirapine PMTCT regimen should be replaced by a triple antiretroviral regimen; DBS DNA PCR-positive infants may be given ART, and simultaneously a whole blood specimen should be taken to determine whether ART should be continued.

  13. Development of a direct in-matrix extraction (DIME) protocol for MALDI-TOF-MS detection of glycated phospholipids in heat-treated food samples.

    PubMed

    Calvano, Cosima D; De Ceglie, Cristina; Zambonin, Carlo G

    2014-09-01

    In foodstuffs, one of the main factors inducing modifications in phospholipids (PLs) structure is the heat treatment. Among PLs, only phosphatidylethanolamines and phosphatidylserines, due to their free amino group, can be involved in Maillard reaction and can form adducts with reducing sugars, besides other by-products called advanced glycation end-products. To date, glycated lipid products are less characterized in comparison to proteins. The aim of this work was to develop a novel, rapid and sensitive extraction protocol for the detection and characterization of modified PLs (glycated and oxidized) by means of matrix-assisted laser desorption/ionization-mass spectrometry (MALDI-MS). At first, to investigate the formation of glycated and/or short chain by-products in different classes of PLs, representative standards were heated with or without sugar (lactose or glucose) and subjected to traditional lipid extraction methods as Bligh and Dyer and to the novel direct in matrix extraction (DIME) using 1,8-bis(dimethylamino)naphthalene as preconcentrating matrix. MALDI-MS analysis in negative ion mode allowed detecting glycation and oxidation products both on fatty acid and glucose moieties. Then, the procedure was successfully applied to different heat-treated and powdered samples (milk powders, pasteurized milk, ultra-high-temperature milk and soy flour) for the detection of modified PLs in complex foods. The currently developed DIME protocol could be a powerful tool for understanding lipid glycation also in biological samples. Copyright © 2014 John Wiley & Sons, Ltd.

  14. Microfabricated sleeve devices for chemical reactions

    DOEpatents

    Northrup, M. Allen

    2003-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  15. Aneuploidy screening of embryonic stem cell clones by metaphase karyotyping and droplet digital polymerase chain reaction.

    PubMed

    Codner, Gemma F; Lindner, Loic; Caulder, Adam; Wattenhofer-Donzé, Marie; Radage, Adam; Mertz, Annelyse; Eisenmann, Benjamin; Mianné, Joffrey; Evans, Edward P; Beechey, Colin V; Fray, Martin D; Birling, Marie-Christine; Hérault, Yann; Pavlovic, Guillaume; Teboul, Lydia

    2016-08-05

    Karyotypic integrity is essential for the successful germline transmission of alleles mutated in embryonic stem (ES) cells. Classical methods for the identification of aneuploidy involve cytological analyses that are both time consuming and require rare expertise to identify mouse chromosomes. As part of the International Mouse Phenotyping Consortium, we gathered data from over 1,500 ES cell clones and found that the germline transmission (GLT) efficiency of clones is compromised when over 50 % of cells harbour chromosome number abnormalities. In JM8 cells, chromosomes 1, 8, 11 or Y displayed copy number variation most frequently, whilst the remainder generally remain unchanged. We developed protocols employing droplet digital polymerase chain reaction (ddPCR) to accurately quantify the copy number of these four chromosomes, allowing efficient triage of ES clones prior to microinjection. We verified that assessments of aneuploidy, and thus decisions regarding the suitability of clones for microinjection, were concordant between classical cytological and ddPCR-based methods. Finally, we improved the method to include assay multiplexing so that two unstable chromosomes are counted simultaneously (and independently) in one reaction, to enhance throughput and further reduce the cost. We validated a PCR-based method as an alternative to classical karyotype analysis. This technique enables laboratories that are non-specialist, or work with large numbers of clones, to precisely screen ES cells for the most common aneuploidies prior to microinjection to ensure the highest level of germline transmission potential. The application of this method allows early exclusion of aneuploid ES cell clones in the ES cell to mouse conversion process, thus improving the chances of obtaining germline transmission and reducing the number of animals used in failed microinjection attempts. This method can be applied to any other experiments that require accurate analysis of the genome for copy number variation (CNV).

  16. TECHNICAL ADVANCES: Effects of genotyping protocols on success and errors in identifying individual river otters (Lontra canadensis) from their faeces.

    PubMed

    Hansen, Heidi; Ben-David, Merav; McDonald, David B

    2008-03-01

    In noninvasive genetic sampling, when genotyping error rates are high and recapture rates are low, misidentification of individuals can lead to overestimation of population size. Thus, estimating genotyping errors is imperative. Nonetheless, conducting multiple polymerase chain reactions (PCRs) at multiple loci is time-consuming and costly. To address the controversy regarding the minimum number of PCRs required for obtaining a consensus genotype, we compared consumer-style the performance of two genotyping protocols (multiple-tubes and 'comparative method') in respect to genotyping success and error rates. Our results from 48 faecal samples of river otters (Lontra canadensis) collected in Wyoming in 2003, and from blood samples of five captive river otters amplified with four different primers, suggest that use of the comparative genotyping protocol can minimize the number of PCRs per locus. For all but five samples at one locus, the same consensus genotypes were reached with fewer PCRs and with reduced error rates with this protocol compared to the multiple-tubes method. This finding is reassuring because genotyping errors can occur at relatively high rates even in tissues such as blood and hair. In addition, we found that loci that amplify readily and yield consensus genotypes, may still exhibit high error rates (7-32%) and that amplification with different primers resulted in different types and rates of error. Thus, assigning a genotype based on a single PCR for several loci could result in misidentification of individuals. We recommend that programs designed to statistically assign consensus genotypes should be modified to allow the different treatment of heterozygotes and homozygotes intrinsic to the comparative method. © 2007 The Authors.

  17. Two aircraft carriers’ perspectives: a comparative of control measures in shipboard H1N1 outbreaks.

    PubMed

    Harwood, Jared L; LaVan, Joseph T; Brand, George J

    2013-02-01

    The USS George Washington (GW) and the USS Ronald Reagan (RR), 2 US Navy aircraft carriers, experienced almost simultaneous outbreaks of novel H1N1 influenza A in the summer of 2009. We compared the respective epidemic control measures taken and subsequent lessons learned. Data were collated from both outbreaks to assess various elements including attack rate, isolation/quarantine protocols, and treatment methods. The respective duration of each outbreak was compared with survival curve analysis. The number of personnel affected in each outbreak was compared using χ2 analysis. Differences were found in the protocols used on the 2 ships. The GW treated about two-thirds of the patients with oseltamivir through day 14 and quarantined all patients meeting case definition throughout the outbreak. Face masks were used throughout. The RR used oseltamivir and quarantined many fewer patients (through days 5 and 3, respectively). No face masks were used after day 5. The outbreaks were similar in duration (GW = 25 days, RR = 27 days, P = .38), but the RR had significantly more cases (n = 253 vs 142, P < .0001). A portion of each group had samples that were confirmed H1N1 by polymerase chain reaction. GW's protocol, including aggressive oseltamivir treatment of two-thirds of the cases and quarantine throughout the duration decreased the overall number of personnel affected, likely reducing the overall control reproduction number. Both outbreaks were similar in duration. Even though the GW expended significantly more resources than the RR, if the 2009 pandemic H1N1 strain had been as clinically severe as the 1918 pandemic, a more stringent treatment protocol may have been the only way to prevent significant operational impact.

  18. Evaluating minimalist mimics by exploring key orientations on secondary structures (EKOS)☟

    PubMed Central

    Xin, Dongyue; Ko, Eunhwa; Perez, Lisa M.; Ioerger, Thomas R.; Burgess, Kevin

    2013-01-01

    Peptide mimics that display amino acid side-chains on semi-rigid scaffolds (not peptide polyamides) can be referred to as minimalist mimics. Accessible conformations of these scaffolds may overlay with secondary structures giving, for example, “minimalist helical mimics”. It is difficult for researchers who want to apply minimalist mimics to decide which one to use because there is no widely accepted protocol for calibrating how closely these compounds mimic secondary structures. Moreover, it is also difficult for potential practitioners to evaluate which ideal minimalist helical mimics are preferred for a particular set of side-chains. For instance, what mimic presents i, i+4, i+7 side-chains in orientations that best resemble an ideal α-helix, and is a different mimic required for a i, i+3, i+7 helical combination? This article describes a protocol for fitting each member of an array of accessible scaffold conformations on secondary structures. The protocol involves: (i) use quenched molecular dynamics (QMD) to generate an ensemble consisting of hundreds of accessible, low energy conformers of the mimics; (ii) representation of each of these as a set of Cα and Cβ coordinates corresponding to three amino acid side-chains displayed by the scaffolds;(iii) similar representation of each combination of three side-chains in each ideal secondary structure as a set of Cα and Cβ coordinates corresponding to three amino acid side-chains displayed by the scaffolds; and, (iv) overlay Cα and Cβ coordinates of all the conformers on all the sets of side-chain “triads” in the ideal secondary structures and express the goodness of fit in terms of root mean squared deviation (RMSD, Å) for each overlay. We refer to this process as Exploring Key Orientations on Secondary structures (EKOS). Application of this procedure reveals the relative bias of a scaffold to overlay on different secondary structures, the “side-chain correspondences” (eg i, i+4, i+7 or i, i+3, i+4) of those overlays, and the energy of this state relative to the minimum located. This protocol was tested on some of the most widely cited minimalist α-helical mimics (1 – 8 in the text). The data obtained indicates several of these compounds preferentially exist in conformations that resemble other secondary structures as well as α-helices, and many of the α-helical conformations have unexpected side-chain correspondences. These observations imply the featured minimalist mimics have more scope for disrupting PPI interfaces than previously anticipated. Finally, the same simulation method was used to match preferred conformations of minimalist mimics with actual protein/peptide structures at interfaces providing quantitative comparisons of predicted fits of the test mimics at protein-protein interaction sites. PMID:24121516

  19. Evaluating minimalist mimics by exploring key orientations on secondary structures (EKOS).

    PubMed

    Xin, Dongyue; Ko, Eunhwa; Perez, Lisa M; Ioerger, Thomas R; Burgess, Kevin

    2013-11-28

    Peptide mimics that display amino acid side-chains on semi-rigid scaffolds (not peptide polyamides) can be referred to as minimalist mimics. Accessible conformations of these scaffolds may overlay with secondary structures giving, for example, "minimalist helical mimics". It is difficult for researchers who want to apply minimalist mimics to decide which one to use because there is no widely accepted protocol for calibrating how closely these compounds mimic secondary structures. Moreover, it is also difficult for potential practitioners to evaluate which ideal minimalist helical mimics are preferred for a particular set of side-chains. For instance, what mimic presents i, i + 4, i + 7 side-chains in orientations that best resemble an ideal α-helix, and is a different mimic required for a i, i + 3, i + 7 helical combination? This article describes a protocol for fitting each member of an array of accessible scaffold conformations on secondary structures. The protocol involves: (i) use quenched molecular dynamics (QMD) to generate an ensemble consisting of hundreds of accessible, low energy conformers of the mimics; (ii) representation of each of these as a set of Cα and Cβ coordinates corresponding to three amino acid side-chains displayed by the scaffolds; (iii) similar representation of each combination of three side-chains in each ideal secondary structure as a set of Cα and Cβ coordinates corresponding to three amino acid side-chains displayed by the scaffolds; and, (iv) overlay Cα and Cβ coordinates of all the conformers on all the sets of side-chain "triads" in the ideal secondary structures and express the goodness of fit in terms of root mean squared deviation (RMSD, Å) for each overlay. We refer to this process as Exploring Key Orientations on Secondary structures (EKOS). Application of this procedure reveals the relative bias of a scaffold to overlay on different secondary structures, the "side-chain correspondences" (e.g. i, i + 4, i + 7 or i, i + 3, i + 4) of those overlays, and the energy of this state relative to the minimum located. This protocol was tested on some of the most widely cited minimalist α-helical mimics (1-8 in the text). The data obtained indicates several of these compounds preferentially exist in conformations that resemble other secondary structures as well as α-helices, and many of the α-helical conformations have unexpected side-chain correspondences. These observations imply the featured minimalist mimics have more scope for disrupting PPI interfaces than previously anticipated. Finally, the same simulation method was used to match preferred conformations of minimalist mimics with actual protein/peptide structures at interfaces providing quantitative comparisons of predicted fits of the test mimics at protein-protein interaction sites.

  20. Enzymatic preparation of structured oils containing short-chain fatty acids.

    PubMed

    Kanda, Ayato; Namiki, Fusako; Hara, Setsuko

    2010-01-01

    Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.

  1. DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

    EPA Science Inventory

    The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

  2. 29 CFR 1910.155 - Scope, application and definitions applicable to this subpart.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... by inhibiting the chemical chain reaction of fuel and oxygen. It is also known as...F3) which is a medium for extinguishing fires by inhibiting the chemical chain reaction of fuel and..., odorless, electrically nonconductive inert gas (chemical formula CO2) that is a medium for extinguishing...

  3. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    ERIC Educational Resources Information Center

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  4. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    USDA-ARS?s Scientific Manuscript database

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  5. Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.

    PubMed

    Borkar, Santosh Ramdas; Aidhen, Indrapal Singh

    2017-04-18

    Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.

  6. Multi-scale modeling of diffusion-controlled reactions in polymers: renormalisation of reactivity parameters.

    PubMed

    Everaers, Ralf; Rosa, Angelo

    2012-01-07

    The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.

  7. Temperature control apparatus

    DOEpatents

    Northrup, M. Allen

    2003-08-05

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  8. Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

    PubMed

    Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

    2014-01-01

    Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  9. Hymenoptera Venom Immunotherapy: Tolerance and Efficacy of an Ultrarush Protocol versus a Rush and a Slow Conventional Protocol

    PubMed Central

    Patella, Vincenzo; Florio, Giovanni; Giuliano, Ada; Oricchio, Carmine; Spadaro, Giuseppe; Marone, Gianni; Genovese, Arturo

    2012-01-01

    Background and Objective. Various venom immunotherapy (VIT) protocols are available for Hymenoptera allergy. Although adverse reactions (ADRs) to VIT are widely reported, controlled trials are still needed. We conducted a randomized prospective study to evaluate ADRs and the efficacy of three VIT regimens. Methods. 76 patients with Hymenoptera allergy, aged 16–76 years, were randomized to receive an ultrarush protocol (group A: 27 patients), a rush protocol (group B: 25), or a slow protocol (group C: 24). Aqueous venom extract was used in incremental phase and an adsorbed depot in maintenance phase. ADRs and accidental Hymenoptera stings during VIT were used to evaluate efficacy. Results. During incremental treatment, ADRs occurred in 1.99%, 3.7%, and 3.9% of patients in groups A, B, and C, and in 0.99%, 1.46%, and 2.7%, respectively, during maintenance. ADRs were significantly fewer in group A (incremental + maintenance phase) than in group C (1.29% versus 3.2%; P = 0.013). Reactions to accidental Hymenoptera stings did not differ among groups (1.1%, 1.2%, and 1.1%). Conclusion. Ultrarush was as effective as the rush and slow protocols and was associated with a low incidence of reactions to stings. This study indicates that ultrarush VIT is a valid therapeutic option for Hymenoptera allergy. PMID:22693521

  10. An Identity Based Key Exchange Protocol in Cloud Computing

    NASA Astrophysics Data System (ADS)

    Molli, Venkateswara Rao; Tiwary, Omkar Nath

    2012-10-01

    Workflow systems often use delegation to enhance the flexibility of authorization; delegation transfers privileges among users across different administrative domains and facilitates information sharing. We present an independently verifiable delegation mechanism, where a delegation credential can be verified without the participation of domain administrators. This protocol, called role-based cascaded delegation (RBCD), supports simple and efficient cross-domain delegation of authority. RBCD enables a role member to create delegations based on the dynamic needs of collaboration; in the meantime, a delegation chain canbe verified by anyone without the participation of role administrators. We also propose the Measurable Risk Adaptive decentralized Role-based Delegation framework to address this problem. Describe an efficient realization of RBCD by using aggregate signatures, where the authentication information for an arbitrarily long role-based delegation chain is captured by one short signature of constant size. RBCD enables a role member to create delegations based on the need of collaboration; in the meantime anyone can verify a delegation chain without the participation of role administrators. The protocol is general and can be realized by any signature scheme. We have described a specific realization with a hierarchical certificate-based encryption scheme that gives delegation compact credentials.

  11. Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

    PubMed

    Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

    2013-09-15

    We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

    PubMed Central

    Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

    2015-01-01

    Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

  13. A targeted metabolomic protocol for short-chain fatty acids and branched-chain amino acids

    PubMed Central

    Zheng, Xiaojiao; Qiu, Yunping; Zhong, Wei; Baxter, Sarah; Su, Mingming; Li, Qiong; Xie, Guoxiang; Ore, Brandon M.; Qiao, Shanlei; Spencer, Melanie D.; Zeisel, Steven H.; Zhou, Zhanxiang; Zhao, Aihua; Jia, Wei

    2013-01-01

    Research in obesity and metabolic disorders that involve intestinal microbiota demands reliable methods for the precise measurement of the short-chain fatty acids (SCFAs) and branched-chain amino acids (BCAAs) concentration. Here, we report a rapid method of simultaneously determining SCFAs and BCAAs in biological samples using propyl chloroformate (PCF) derivatization followed by gas chromatography mass spectrometry (GC-MS) analysis. A one-step derivatization using 100 µL of PCF in a reaction system of water, propanol, and pyridine (v/v/v = 8:3:2) at pH 8 provided the optimal derivatization efficiency. The best extraction efficiency of the derivatized products was achieved by a two-step extraction with hexane. The method exhibited good derivatization efficiency and recovery for a wide range of concentrations with a low limit of detection for each compound. The relative standard deviations (RSDs) of all targeted compounds showed good intra- and inter-day (within 7 days) precision (< 10%), and good stability (< 20%) within 4 days at room temperature (23–25 °C), or 7 days when stored at −20 °C. We applied our method to measure SCFA and BCAA levels in fecal samples from rats administrated with different diet. Both univariate and multivariate statistics analysis of the concentrations of these target metabolites could differentiate three groups with ethanol intervention and different oils in diet. This method was also successfully employed to determine SCFA and BCAA in the feces, plasma and urine from normal humans, providing important baseline information of the concentrations of these metabolites. This novel metabolic profile study has great potential for translational research. PMID:23997757

  14. A practical and successful desensitization protocol for immediate hypersensitivity reactions to iron salts.

    PubMed

    Demir, Semra; Olgac, Muge; Unal, Derya; Gelincik, Asli; Colakoglu, Bahauddin; Buyukozturk, Suna

    2014-01-01

    Orally administered iron salts (OAS) are widely used in the management of iron deficiency anemia and hypersensitivity reactions to OAS are not common. If an offending drug is the sole option or is significantly more effective than its alternatives, it can be readministered by desensitization. The oral desensitization protocols for iron published so far concern either desensitization that was completed only over a long period or did not attain the recommended therapeutic dose. We aimed to develop a more effective protocol. We report here on 2 patients who experienced hypersensitivity reactions to OAS. After confirming the diagnosis, both patients were desensitized to oral ferrous (II) glycine sulfate complex according to a 2-day desensitization protocol. A commercial suspension of oral ferrous glycine sulfate, which contains 4 mg of elemental iron in 1 ml, was preferred. We started with a dose as low as 0.1 ml from a 1/100 dilution (0.004 mg elemental iron) of the original suspension and reached the maximum effective dose in 2 days. Both patients were successfully desensitized and they went on to complete the 6-month iron treatment without any adverse effects. Although hypersensitvity reactions to iron are not common, there is no alternative for iron administration. Therefore, desensitization has to be the choice. This easy desensitization protocol seems to be a promising option. © 2014 S. Karger AG, Basel.

  15. An improved reaction path optimization method using a chain of conformations

    NASA Astrophysics Data System (ADS)

    Asada, Toshio; Sawada, Nozomi; Nishikawa, Takuya; Koseki, Shiro

    2018-05-01

    The efficient fast path optimization (FPO) method is proposed to optimize the reaction paths on energy surfaces by using chains of conformations. No artificial spring force is used in the FPO method to ensure the equal spacing of adjacent conformations. The FPO method is applied to optimize the reaction path on two model potential surfaces. The use of this method enabled the optimization of the reaction paths with a drastically reduced number of optimization cycles for both potentials. It was also successfully utilized to define the MEP of the isomerization of the glycine molecule in water by FPO method.

  16. Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions

    NASA Astrophysics Data System (ADS)

    Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.

    2018-05-01

    It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

  17. Genotype identification of Math1/LacZ knockout mice based on real-time PCR with SYBR Green I dye.

    PubMed

    Krizhanovsky, Valery; Golenser, Esther; Ben-Arie, Nissim

    2004-07-30

    Knockout mice are widely used in all fields of biomedical research. Determining the genotype of every newborn mouse is a tedious task, usually performed by Southern blot hybridization or Polymerase Chain Reaction (PCR). We describe here a quick and simple genotype identification assay based on real-time PCR and SYBR Green I dye, without using fluorescent primers. The discrimination between the wild type and targeted alleles is based on a PCR design that leads to a different melting temperature for each product. The identification of the genotype is obvious immediately after amplification, and no post-PCR manipulations are needed, reducing cost and time. Therefore, while the real-time PCR amplification increases the sensitivity, the fact that the reactions tubes are never opened after amplification, reduces the risk of contamination and eliminates errors, which are common during the repeated handling of dozens of samples from the same mouse line. The protocol we provide was tested on Math1 knockout mice, but is general, and may be utilized for any knockout line and real-time thermocycler, without any further modification, accessories or special reagents. Copyright 2004 Elsevier B.V.

  18. Bank robberies: A psychological protocol of intervention in financial institutions and principal effects.

    PubMed

    Tabanelli, Maria Carla; Bonfiglioli, Roberta; Violante, Francesco S

    2013-03-26

    BACKGROUND: Robbery in workplaces represents a potentially traumatic experience for workers. OBJECTIVES: This article describes the set up and evaluation of a comprehensive psychological intervention designed to help to reduce the adverse consequences of bank robberies. PARTICIPANTS: The study population was selected among the employees of two Italian banks.METHODS: The psychological protocol was designed according to the results of a comprehensive non-systematic review of the scientific literature and it was evaluated at work site. RESULTS: The protocol consists of a "pre-event" formative intervention and "post-event" psychological support. The qualitative data collected allowed us to understand that the reactions after a robbery can differ depending on the phase during which the workers were exposed to the robbery. We noted that the main consequences can be classified in emotional/sentimental reactions, behavioral reactions, physiological reactions and experiences during the event; emotions/feelings following the robbery and psycho/physical state and emotions/feelings in the following days.CONCLUSIONS: In a working environment, the chance to take advantage of a specific protocol for the traumatic event of a bank robbery offers both the company and the workers important tools for well-being, including post-robbery psychological support and classroom instructions.

  19. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

  20. Single-step azide introduction in proteins via an aqueous diazo transfer.

    PubMed

    van Dongen, Stijn F M; Teeuwen, Rosalie L M; Nallani, Madhavan; van Berkel, Sander S; Cornelissen, Jeroen J L M; Nolte, Roeland J M; van Hest, Jan C M

    2009-01-01

    The controlled introduction of azides in proteins provides targetable handles for selective protein manipulation. We present here an efficient diazo transfer protocol that can be applied in an aqueous solution, leading to the facile introduction of azides in the side chains of lysine residues and at the N-terminus of enzymes, e.g. horseradish peroxidase (HRP) and the red fluorescent protein DsRed. The effective introduction of azides was verified by mass spectrometry, after which the azido-proteins were used in Cu(I)-catalyzed [3 + 2] cycloaddition reactions. Azido-HRP retained its catalytic activity after conjugation of a small molecule. This modified protein could also be successfully immobilized on the surface of an acetylene-covered polymersome. Azido-DsRed was coupled to an acetylene-bearing protein allowing it to act as a fluorescent label, demonstrating the wide applicability of the diazo transfer procedure.

  1. High-Throughput RT-PCR for small-molecule screening assays

    PubMed Central

    Bittker, Joshua A.

    2012-01-01

    Quantitative measurement of the levels of mRNA expression using real-time reverse transcription polymerase chain reaction (RT-PCR) has long been used for analyzing expression differences in tissue or cell lines of interest. This method has been used somewhat less frequently to measure the changes in gene expression due to perturbagens such as small molecules or siRNA. The availability of new instrumentation for liquid handling and real-time PCR analysis as well as the commercial availability of start-to-finish kits for RT-PCR has enabled the use of this method for high-throughput small-molecule screening on a scale comparable to traditional high-throughput screening (HTS) assays. This protocol focuses on the special considerations necessary for using quantitative RT-PCR as a primary small-molecule screening assay, including the different methods available for mRNA isolation and analysis. PMID:23487248

  2. Characterization of an Avipoxvirus From a Bald Eagle ( Haliaeetus leucocephalus ) Using Novel Consensus PCR Protocols for the rpo147 and DNA-Dependent DNA Polymerase Genes.

    PubMed

    Stephen, Alexa A; Leone, Angelique M; Toplon, David E; Archer, Linda L; Wellehan, James F X

    2016-12-01

    A juvenile female bald eagle ( Haliaeetus leucocephalus ) was presented with emaciation and proliferative periocular lesions. The eagle did not respond to supportive therapy and was euthanatized. Histopathologic examination of the skin lesions revealed plaques of marked epidermal hyperplasia parakeratosis, marked acanthosis and spongiosis, and eosinophilic intracytoplasmic inclusion bodies. Novel polymerase chain reaction (PCR) assays were done to amplify and sequence DNA polymerase and rpo147 genes. The 4b gene was also analyzed by a previously developed assay. Bayesian and maximum likelihood phylogenetic analyses of the obtained sequences found it to be poxvirus of the genus Avipoxvirus and clustered with other raptor isolates. Better phylogenetic resolution was found in rpo147 rather than the commonly used DNA polymerase. The novel consensus rpo147 PCR assay will create more accurate phylogenic trees and allow better insight into poxvirus history.

  3. Jatropha (Jatropha curcas L.).

    PubMed

    Maravi, Devendra Kumar; Mazumdar, Purabi; Alam, Shamsher; Goud, Vaibhav V; Sahoo, Lingaraj

    2015-01-01

    The seed oil of Jatropha (Jatropha curcas L.) as a source of biodiesel fuel is gaining worldwide importance. Commercial-scale exploration of Jatropha has not succeeded due to low and unstable seed yield in semiarid lands unsuitable for the food production and infestation to diseases. Genetic engineering is promising to improve various agronomic traits in Jatropha and to understand the molecular functions of key Jatropha genes for molecular breeding. We describe a protocol routinely followed in our laboratory for stable and efficient Agrobacterium tumefaciens-mediated transformation of Jatropha using cotyledonary leaf as explants. The 4-day-old explants are infected with Agrobacterium tumefaciens strain EHA105 harboring pBI121 plant binary vector, which contains nptII as plant selectable marker and gus as reporter. The putative transformed plants are selected on kanamycin, and stable integration of transgene(s) is confirmed by histochemical GUS assay, polymerase chain reaction, and Southern hybridization.

  4. A Novel mRNA Level Subtraction Method for Quick Identification of Target-Orientated Uniquely Expressed Genes Between Peanut Immature Pod and Leaf

    PubMed Central

    2010-01-01

    Subtraction technique has been broadly applied for target gene discovery. However, most current protocols apply relative differential subtraction and result in great amount clone mixtures of unique and differentially expressed genes. This makes it more difficult to identify unique or target-orientated expressed genes. In this study, we developed a novel method for subtraction at mRNA level by integrating magnetic particle technology into driver preparation and tester–driver hybridization to facilitate uniquely expressed gene discovery between peanut immature pod and leaf through a single round subtraction. The resulting target clones were further validated through polymerase chain reaction screening using peanut immature pod and leaf cDNA libraries as templates. This study has resulted in identifying several genes expressed uniquely in immature peanut pod. These target genes can be used for future peanut functional genome and genetic engineering research. PMID:21406066

  5. DNA detection rates of host mtDNA in bloodmeals of human body lice (Pediculus humanus L., 1758).

    PubMed

    Davey, J S; Casey, C S; Burgess, I F; Cable, J

    2007-09-01

    Using polymerase chain reaction, we investigated the extent to which digestion affects the potential to amplify 12S mitochondrial DNA sequences from bloodmeals of individual human body lice (Pediculus humanus L.) (Phthiraptera, Pediculidae) up to 72 h after feeding on a surrogate rabbit host (Oryctolagus cuniculus L.) (Lagomorpha, Leporidae). Two rabbit-specific primer pairs were developed to produce amplicons of 199 bp and 283 bp, the smaller of which was found to have a significantly slower decay rate. Median detection periods (T50) for the amplicons were 20 h and 12 h, with maximum detection periods of 24 h and 12 h, respectively, suggesting an inversely proportional linear relationship between amplicon size and digestion time. The data provide an indication of timeframes essential for the design of forensic sampling protocols and a basis for investigating the feeding frequency of human lice.

  6. The synthesis of amphipathic prodrugs of 1,2-diol drugs with saccharide conjugates by high regioselective enzymatic protocol.

    PubMed

    Quan, Jing; Chen, Zhichun; Han, Chengyou; Lin, Xianfu

    2007-02-15

    A facile, high regioselective enzymatic synthesis approach for the preparation of amphipathic prodrugs with saccharides of mephenesin and chlorphenesin was developed. Firstly, transesterification of two drugs with divinyl dicarboxylates with different carbon chain length was performed under the catalysis of Candida antarctica lipase acrylic resin and Lipozyme in anhydrous acetone at 50 degrees C, respectively. A series of lipophilic derivatives with vinyl groups of mephenesin and chlorphenesin were prepared. The influences of different organic solvents, enzyme sources, reaction time, and the acylation reagents on the synthesis of vinyl esters were investigated. And then, protease-catalyzed high regioselective acylation of D-glucose and D-mannose with vinyl esters of mephenesin and chlorphenesin gave drug-saccharide derivatives in good yields. The studies of lipophilicity and hydrolysis in vitro of prodrugs verified that drug-saccharide derivatives had amphipathic properties, and both lipophilic and amphipathic drug derivatives had obvious controlled release characteristics.

  7. Ufd2p synthesizes branched ubiquitin chains to promote the degradation of substrates modified with atypical chains

    PubMed Central

    Liu, Chao; Liu, Weixiao; Ye, Yihong; Li, Wei

    2017-01-01

    Ubiquitination of a subset of proteins by ubiquitin chain elongation factors (E4), represented by Ufd2p in Saccharomyces cerevisiae, is a pivotal regulator for many biological processes. However, the mechanism of Ufd2p-mediated ubiquitination is largely unclear. Here, we show that Ufd2p catalyses K48-linked multi-monoubiquitination on K29-linked ubiquitin chains assembled by the ubiquitin ligase (Ufd4p), resulting in branched ubiquitin chains. This reaction depends on the interaction of K29-linked ubiquitin chains with two N-terminal loops of Ufd2p. Only following the addition of K48-linked ubiquitin to substrates modified with K29-linked ubiquitin chains, can the substrates be escorted to the proteasome for degradation. We demonstrate that this ubiquitin chain linkage switching reaction is essential for ERAD, oleic acid and acid pH resistance in yeast. Thus, our results suggest that Ufd2p functions by switching ubiquitin chain linkages to allow the degradation of proteins modified with a ubiquitin linkage, which is normally not targeted to the proteasome. PMID:28165462

  8. Multicast Delayed Authentication For Streaming Synchrophasor Data in the Smart Grid

    PubMed Central

    Câmara, Sérgio; Anand, Dhananjay; Pillitteri, Victoria; Carmo, Luiz

    2017-01-01

    Multicast authentication of synchrophasor data is challenging due to the design requirements of Smart Grid monitoring systems such as low security overhead, tolerance of lossy networks, time-criticality and high data rates. In this work, we propose inf -TESLA, Infinite Timed Efficient Stream Loss-tolerant Authentication, a multicast delayed authentication protocol for communication links used to stream synchrophasor data for wide area control of electric power networks. Our approach is based on the authentication protocol TESLA but is augmented to accommodate high frequency transmissions of unbounded length. inf TESLA protocol utilizes the Dual Offset Key Chains mechanism to reduce authentication delay and computational cost associated with key chain commitment. We provide a description of the mechanism using two different modes for disclosing keys and demonstrate its security against a man-in-the-middle attack attempt. We compare our approach against the TESLA protocol in a 2-day simulation scenario, showing a reduction of 15.82% and 47.29% in computational cost, sender and receiver respectively, and a cumulative reduction in the communication overhead. PMID:28736582

  9. Multicast Delayed Authentication For Streaming Synchrophasor Data in the Smart Grid.

    PubMed

    Câmara, Sérgio; Anand, Dhananjay; Pillitteri, Victoria; Carmo, Luiz

    2016-01-01

    Multicast authentication of synchrophasor data is challenging due to the design requirements of Smart Grid monitoring systems such as low security overhead, tolerance of lossy networks, time-criticality and high data rates. In this work, we propose inf -TESLA, Infinite Timed Efficient Stream Loss-tolerant Authentication, a multicast delayed authentication protocol for communication links used to stream synchrophasor data for wide area control of electric power networks. Our approach is based on the authentication protocol TESLA but is augmented to accommodate high frequency transmissions of unbounded length. inf TESLA protocol utilizes the Dual Offset Key Chains mechanism to reduce authentication delay and computational cost associated with key chain commitment. We provide a description of the mechanism using two different modes for disclosing keys and demonstrate its security against a man-in-the-middle attack attempt. We compare our approach against the TESLA protocol in a 2-day simulation scenario, showing a reduction of 15.82% and 47.29% in computational cost, sender and receiver respectively, and a cumulative reduction in the communication overhead.

  10. [Accelerated desensitization for hymenoptera venom allergy in 30 hours: efficacy and safety in 150 cases].

    PubMed

    van der Brempt, X; Ledent, C; Mairesse, M

    1997-06-01

    In this study, we performed 150 desensitizations in 139 Hymenoptera venom allergic patients (109 Yellow jacket allergic patients, 19 Honey bee allergic patients and 11 patients sensitized to both insects, who received a dual desensitization). We used a rush protocol, allowing injection of a total cumulated dose of 125,1 (Honey bee) to 175,1 (Yellow jacket) microgram of venom in 30 hours. Patients were hospitalized, with all emergency precautions for treating systemic reactions. The protocol was well tolerated in 147/150 cases; 3 patients had a benign systemic reaction. Patients received monthly maintenance doses of 100 micrograms venom. 39 patients experienced a field sting during immunotherapy; 2 of them (5%) had a benign systemic reaction. Thus, our rush desensitization protocol seems to be safe and effective.

  11. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  12. Identification of Brucella spp. by using the polymerase chain reaction.

    PubMed Central

    Herman, L; De Ridder, H

    1992-01-01

    The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

  13. Detection of Listeria monocytogenes by using the polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  14. Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

    PubMed

    Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

    2012-07-09

    Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. 9 CFR 145.33 - Terminology and classification; flocks and products.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    .... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

  16. Parallel and automated library synthesis of 2-long alkyl chain benzoazoles and azole[4,5-b]pyridines under microwave irradiation.

    PubMed

    Martínez-Palou, Rafael; Zepeda, L Gerardo; Höpfl, Herbert; Montoya, Ascensión; Guzmán-Lucero, Diego J; Guzmán, Javier

    2005-01-01

    A versatile route to 40-membered library of 2-long alkyl chain substituted benzoazoles (1 and 2) and azole[4,5-b]pyridines (3 and 4) via microwave-assisted combinatorial synthesis was developed. The reactions were carried out in both monomode and multimode microwave oven. With the latter, all reactions were performed in high-throughput experimental settings consisting of an 8 x 5 combinatorial library designed to synthesize 40 compounds. Each step, from the addition of reagents to the recovery of final products, was automated. The microwave-assisted N-long chain alkylation reactions of 2-alkyl-1H-benzimidazole (1) and 2-alkyl-1H-benzimidazole[4,5-b] pyridines (3) were also studied.

  17. Linezolid desensitization for a patient with multiple medication hypersensitivity reactions.

    PubMed

    Bagwell, Autumn D; Stollings, Joanna L; White, Katie D; Fadugba, Olajumoke O; Choi, Jane J

    2013-01-01

    To describe a case in which a linezolid desensitization protocol was successfully used for a polymicrobial surgical wound infection in a patient with multiple drug hypersensitivity reactions. A 24-year-old woman with vocal cord dysfunction requiring tracheostomy was admitted for a surgical wound infection following a tracheostomy fistula closure procedure. The patient reported multiple antibiotic allergies including penicillins (rash), sulfonamides (rash), vancomycin (anaphylaxis), azithromycin (rash), cephalosporins (anaphylaxis), levofloxacin (unspecified), clindamycin (unspecified), and carbapenems (unspecified). Gram stain of the purulent wound drainage demonstrated mixed gram-negative and gram-positive flora, and bacterial cultures were overgrown with Proteus mirabilis, which precluded identification of other pathogens. Following failed test doses of linezolid, tigecycline, and daptomycin, all of which resulted in hypersensitivity reactions, a 16-step linezolid desensitization protocol was developed and successfully implemented without adverse reactions. The patient completed a 2-week course of antibiotic therapy that included linezolid upon finishing the desensitization protocol. Linezolid is useful in treating complicated and uncomplicated skin and soft tissue infections caused by gram-positive bacteria. With precautions, including premedication, a monitored nursing unit, and immediate availability of an emergency anaphylaxis kit, drug desensitization allows patients the ability to safely use medications to which they may have an immediate hypersensitivity reaction. Minimal data exist on linezolid desensitization protocols. Linezolid desensitization can be a viable option in patients requiring antimicrobial therapy for complicated gram-positive skin infections.

  18. Identification and characterization of TCRgamma and TCRdelta chains in channel catfish, Ictalurus punctatus

    USDA-ARS?s Scientific Manuscript database

    Channel catfish, Ictalurus punctatus, T cell receptors (TCR) gamma and delta were identified by mining of expressed sequence tag databases and full length sequences were obtained by 5'-RACE and RT-PCR protocols. cDNAs for each of these TCR chains encode typical variable (V), (diversity; D), joining ...

  19. Analysis of Novel Prostate Cancer Biomarkers and their Predictive Utility in an Active Surveillance Protocol

    DTIC Science & Technology

    2014-05-01

    Shock Protein, Annexin A3, Sorbitol Dehydrogenase, Fibrinogen Beta Chain Precursor, Creatine Kinase B-Type, Annexin A1, Cystatin B, and AZI. We have...Shock Protein, Annexin A3, Sorbitol Dehydrogenase, Fibrinogen Beta Chain Precursor, and Creatine Kinase B-Type. After testing these candidates with

  20. Synthesis of a new class of Betti bases by the Mannich-type reaction: efficient, facile, solvent-free and one-pot protocol.

    PubMed

    Shahrisa, Aziz; Teimuri-Mofrad, Reza; Gholamhosseini-Nazari, Mahdi

    2015-02-01

    A variety of organocatalysts has been screened for the synthesis of arylaminonaphthols. It has been shown that (N,N-dimethylethanolamine) is a highly efficient organocatalyst for the direct synthesis of a novel class of arylaminonaphthols via three-component condensation of 2-naphthol, aldehydes, and arylamines under solvent-free conditions. Mild, one-pot, and green reaction conditions, relatively short reaction times and good yields make this protocol highly significant. 25 new compounds have been synthesized by this method.

  1. Titanium isopropoxide as efficient catalyst for the aza-Baylis-Hillman reaction. Selective formation of alpha-methylene-beta-amino acid derivatives.

    PubMed

    Balan, Daniela; Adolfsson, Hans

    2002-04-05

    The direct formation of alpha-methylene-beta-amino acid derivatives is achieved using the aza version of the Baylis-Hillman protocol. The products are readily formed in a three-component one-pot reaction between arylaldehydes, sulfonamides, and alpha,beta-unsaturated carbonyl compounds. The reaction is efficiently catalyzed by titanium isopropoxide and 2-hydroxyquinuclidine in the presence of molecular sieves. The protocol allows for structural variation of the substrates, tolerating electron-poor and electron-rich arylaldehydes and various Michael acceptors.

  2. A Protocol for Safe Lithiation Reactions Using Organolithium Reagents

    PubMed Central

    Gau, Michael R.; Zdilla, Michael J.

    2016-01-01

    Organolithium reagents are powerful tools in the synthetic chemist's toolbox. However, the extreme pyrophoric nature of the most reactive reagents warrants proper technique, thorough training, and proper personal protective equipment. To aid in the training of researchers using organolithium reagents, a thorough, step-by-step protocol for the safe and effective use of tert-butyllithium on an inert gas line or within a glovebox is described. As a model reaction, preparation of lithium tert-butyl amide by the reaction of tert-butyl amine with one equivalent of tert-butyl lithium is presented. PMID:27911386

  3. Immediate hypersensitivity to moxifloxacin with tolerance to ciprofloxacin: report of three cases and review of the literature.

    PubMed

    Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth

    2010-04-01

    To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.

  4. No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

    PubMed

    D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

    2006-10-01

    Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

  5. Development of a real-time microchip PCR system for portable plant disease diagnosis.

    PubMed

    Koo, Chiwan; Malapi-Wight, Martha; Kim, Hyun Soo; Cifci, Osman S; Vaughn-Diaz, Vanessa L; Ma, Bo; Kim, Sungman; Abdel-Raziq, Haron; Ong, Kevin; Jo, Young-Ki; Gross, Dennis C; Shim, Won-Bo; Han, Arum

    2013-01-01

    Rapid and accurate detection of plant pathogens in the field is crucial to prevent the proliferation of infected crops. Polymerase chain reaction (PCR) process is the most reliable and accepted method for plant pathogen diagnosis, however current conventional PCR machines are not portable and require additional post-processing steps to detect the amplified DNA (amplicon) of pathogens. Real-time PCR can directly quantify the amplicon during the DNA amplification without the need for post processing, thus more suitable for field operations, however still takes time and require large instruments that are costly and not portable. Microchip PCR systems have emerged in the past decade to miniaturize conventional PCR systems and to reduce operation time and cost. Real-time microchip PCR systems have also emerged, but unfortunately all reported portable real-time microchip PCR systems require various auxiliary instruments. Here we present a stand-alone real-time microchip PCR system composed of a PCR reaction chamber microchip with integrated thin-film heater, a compact fluorescence detector to detect amplified DNA, a microcontroller to control the entire thermocycling operation with data acquisition capability, and a battery. The entire system is 25 × 16 × 8 cm(3) in size and 843 g in weight. The disposable microchip requires only 8-µl sample volume and a single PCR run consumes 110 mAh of power. A DNA extraction protocol, notably without the use of liquid nitrogen, chemicals, and other large lab equipment, was developed for field operations. The developed real-time microchip PCR system and the DNA extraction protocol were used to successfully detect six different fungal and bacterial plant pathogens with 100% success rate to a detection limit of 5 ng/8 µl sample.

  6. Development of a Real-Time Microchip PCR System for Portable Plant Disease Diagnosis

    PubMed Central

    Kim, Hyun Soo; Cifci, Osman S.; Vaughn-Diaz, Vanessa L.; Ma, Bo; Kim, Sungman; Abdel-Raziq, Haron; Ong, Kevin; Jo, Young-Ki; Gross, Dennis C.; Shim, Won-Bo; Han, Arum

    2013-01-01

    Rapid and accurate detection of plant pathogens in the field is crucial to prevent the proliferation of infected crops. Polymerase chain reaction (PCR) process is the most reliable and accepted method for plant pathogen diagnosis, however current conventional PCR machines are not portable and require additional post-processing steps to detect the amplified DNA (amplicon) of pathogens. Real-time PCR can directly quantify the amplicon during the DNA amplification without the need for post processing, thus more suitable for field operations, however still takes time and require large instruments that are costly and not portable. Microchip PCR systems have emerged in the past decade to miniaturize conventional PCR systems and to reduce operation time and cost. Real-time microchip PCR systems have also emerged, but unfortunately all reported portable real-time microchip PCR systems require various auxiliary instruments. Here we present a stand-alone real-time microchip PCR system composed of a PCR reaction chamber microchip with integrated thin-film heater, a compact fluorescence detector to detect amplified DNA, a microcontroller to control the entire thermocycling operation with data acquisition capability, and a battery. The entire system is 25×16×8 cm3 in size and 843 g in weight. The disposable microchip requires only 8-µl sample volume and a single PCR run consumes 110 mAh of power. A DNA extraction protocol, notably without the use of liquid nitrogen, chemicals, and other large lab equipment, was developed for field operations. The developed real-time microchip PCR system and the DNA extraction protocol were used to successfully detect six different fungal and bacterial plant pathogens with 100% success rate to a detection limit of 5 ng/8 µl sample. PMID:24349341

  7. New polymer systems: Chain extension by dianhydrides

    NASA Technical Reports Server (NTRS)

    Rhein, R. A.; Ingham, J. D.

    1972-01-01

    The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.

  8. Unique anthranilic acid chemistry facilitates profiling and characterization of Ser/Thr-linked sugar chains following hydrazinolysis.

    PubMed

    Anumula, Kalyan Rao

    2008-02-01

    A novel method for the analysis of Ser/Thr-linked sugar chains was made possible by the virtue of unique anthranilic acid (AA, 2-aminobenzoic acid [2AA]) chemistry for labeling carbohydrates in aqueous salt solutions (K. R. Anumula, Anal. Biochem. 350 (2006) 1-23). The protocol for profiling of Ser/Thr carbohydrates by hydrazinolysis was made simple by eliminating intermediary isolation steps involved in a sample preparation such as desalting and various chromatographic purification schemes. A 6-h hydrazinolysis was carried out at 60 degrees C for O-linked oligosaccharides and at 95 degrees C for total oligosaccharides (N-linked with some O-linked). Following evaporation of hydrazine (<10 min), the oligosaccharides were N-acetylated and derivatized with AA in the same reaction mixture containing salts. Presumably, the glycosyl-hydrazines/hydrazones present in the mixture did not interfere with AA labeling. Because AA is the most fluorescent and highly reactive tag for labeling carbohydrates, the procedures described are suitable for the analysis of a limited amount of samples ( approximately 5 microg) by the current high-resolution high-performance liquid chromatography (HPLC) methods. HPLC conditions developed for the separation of O-linked sugar chains based on size on an amide column were satisfactory for quantitative profiling and characterization. Common O-linked sugar chains found in fetuin, equine chorionic gonadotropin, and glycophorin can be analyzed in less than 50 min. In addition, these fast profiling methods were comparable to profiling by PNGase F (peptide N-glycosidase from Flavobacterium meningosepticum) digestion in terms of time, effort, and simplicity and also were highly reproducible for routine testing. The procedures for the release of sugar chains by hydrazinolysis at the microgram level, labeling with fluorescent tag AA, and profiling by HPLC should be useful in characterization of carbohydrates found in glycoproteins.

  9. In vitro propagation of Rauwolfia serpentina using liquid medium, assessment of genetic fidelity of micropropagated plants, and simultaneous quantitation of reserpine, ajmaline, and ajmalicine.

    PubMed

    Goel, M K; Mehrotra, S; Kukreja, A K; Shanker, K; Khanuja, S P S

    2009-01-01

    Rauwolfia serpentina holds an important position in the pharmaceutical world because of its immense anti-hypertensive properties resulting from the presence of reserpine in the oleoresin fraction of the roots. Poor seed viability, low seed germination rate, and enormous genetic variability are the major constraints for the commercial cultivation of R. serpentina through conventional mode. The present optimized protocol offers an impeccable end to end method from the establishment of aseptic cultures to in-vitro plantlet production employing semisolid as well liquid nutrient culture medium and assessment of their genetic fidelity using polymerase chain reaction based rapid amplification of polymorphic DNA analysis. In vitro shoots multiplied on Murashige and Skoog basal liquid nutrients supplemented with benzo[a]pyrene (1.0 mg/L) and NAA (0.1 mg/L) and in-vitro rhizogenesis was observed in modified MS basal nutrient containing NAA (1.0 mg/L) and 2% sucrose. In-vitro raised plants exhibited 90-95% survival under glass house/field condition and 85% similarity in the plants regenerated through this protocol. Field established plants were harvested and extraction of indole alkaloid particularly reserpine, ajmaline and ajmalicine and their simultaneous quantitation was performed using monolithic reverse phase high-performance liquid chromatography (HPLC).

  10. Solution Hybrid Selection Capture for the Recovery of Functional Full-Length Eukaryotic cDNAs From Complex Environmental Samples

    PubMed Central

    Bragalini, Claudia; Ribière, Céline; Parisot, Nicolas; Vallon, Laurent; Prudent, Elsa; Peyretaillade, Eric; Girlanda, Mariangela; Peyret, Pierre; Marmeisse, Roland; Luis, Patricia

    2014-01-01

    Eukaryotic microbial communities play key functional roles in soil biology and potentially represent a rich source of natural products including biocatalysts. Culture-independent molecular methods are powerful tools to isolate functional genes from uncultured microorganisms. However, none of the methods used in environmental genomics allow for a rapid isolation of numerous functional genes from eukaryotic microbial communities. We developed an original adaptation of the solution hybrid selection (SHS) for an efficient recovery of functional complementary DNAs (cDNAs) synthesized from soil-extracted polyadenylated mRNAs. This protocol was tested on the Glycoside Hydrolase 11 gene family encoding endo-xylanases for which we designed 35 explorative 31-mers capture probes. SHS was implemented on four soil eukaryotic cDNA pools. After two successive rounds of capture, >90% of the resulting cDNAs were GH11 sequences, of which 70% (38 among 53 sequenced genes) were full length. Between 1.5 and 25% of the cloned captured sequences were expressed in Saccharomyces cerevisiae. Sequencing of polymerase chain reaction-amplified GH11 gene fragments from the captured sequences highlighted hundreds of phylogenetically diverse sequences that were not yet described, in public databases. This protocol offers the possibility of performing exhaustive exploration of eukaryotic gene families within microbial communities thriving in any type of environment. PMID:25281543

  11. Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens

    PubMed Central

    Barkway, Christopher P.; Pocock, Rebecca L.; Vrba, Vladimir; Blake, Damer P.

    2015-01-01

    Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm’s anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable. PMID:25741643

  12. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens.

    PubMed

    Barkway, Christopher P; Pocock, Rebecca L; Vrba, Vladimir; Blake, Damer P

    2015-02-20

    Eimeria species parasites, protozoa which cause the enteric disease coccidiosis, pose a serious threat to the production and welfare of chickens. In the absence of effective control clinical coccidiosis can be devastating. Resistance to the chemoprophylactics frequently used to control Eimeria is common and sub-clinical infection is widespread, influencing feed conversion ratios and susceptibility to other pathogens such as Clostridium perfringens. Despite the availability of polymerase chain reaction (PCR)-based tools, diagnosis of Eimeria infection still relies almost entirely on traditional approaches such as lesion scoring and oocyst morphology, but neither is straightforward. Limitations of the existing molecular tools include the requirement for specialist equipment and difficulties accessing DNA as template. In response a simple field DNA preparation protocol and a panel of species-specific loop-mediated isothermal amplification (LAMP) assays have been developed for the seven Eimeria recognised to infect the chicken. We now provide a detailed protocol describing the preparation of genomic DNA from intestinal tissue collected post-mortem, followed by setup and readout of the LAMP assays. Eimeria species-specific LAMP can be used to monitor parasite occurrence, assessing the efficacy of a farm's anticoccidial strategy, and to diagnose sub-clinical infection or clinical disease with particular value when expert surveillance is unavailable.

  13. A molecular genetic lab to generate inclusive and exclusive forensic evidence: two suspects, a victim, and a bloodstained T-shirt.

    PubMed

    Smit, Julie; Heath, Daniel D; Walter, Ryan P

    2014-01-01

    Molecular genetic laboratory exercises can be ineffective due the student's lack of connection to the complex and sequential protocols. In this inquiry-based molecular genetic laboratory exercise, we harness students' fascination with human forensics and provide a real-life scenario using biomolecular techniques to identify "whose blood is on the t-shirt." We use fish blood to create realistic blood stains on clothing and challenge the students to use DNA analyses to clear or implicate suspects. Safety concerns are minimized through the use of fish blood, while maximizing both realism and the likelihood of student success due to fishes' nucleated red blood cells. The goal in designing this laboratory exercise was to create a feasible protocol for large (over 300 students) second year university courses. During two 3 hour laboratory sessions, students learn and apply clean/sterile technique, DNA extraction, polymerase chain reaction, restriction fragment length polymorphisms, and agarose gel electrophoresis. The students also learn to interpret the resulting gel bands in terms of inclusive or exclusive evidence. Students have consistently ranked this lab as their favorite of five taken as part of a second year Genetics course. Copyright © 2013 by The International Union of Biochemistry and Molecular Biology.

  14. Relationship between subclinical rejection and genotype, renal messenger RNA, and plasma protein transforming growth factor-beta1 levels.

    PubMed

    Hueso, Miguel; Navarro, Estanis; Moreso, Francesc; Beltrán-Sastre, Violeta; Ventura, Francesc; Grinyó, Josep M; Serón, Daniel

    2006-05-27

    Transforming growth factor (TGF)-beta(1) is increased in allograft rejection and its production is associated with single nucleotide polymorphisms (SNPs). The contribution of SNPs at codons 10 and 25 of the TGF-beta(1) gene to renal allograft damage was assessed in 6-month protocol biopsies and their association with TGF-beta(1) production. TGF-beta(1) genotypes were evaluated by polymerase chain reaction (PCR)/restriction fragment length polymorphism. Intragraft TGF-beta(1) messenger RNA (mRNA) was measured by real-time PCR and TGF-beta(1) plasma levels were assessed by enzyme-linked immunosorbent assay. Eighty consecutive patients were included. Allele T at codon 10 (risk ratio, 6.7; P = 0.02) and an episode of acute rejection before protocol biopsy (risk ratio, 6.2; P = 0.01) were independent predictors of subclinical rejection (SCR). TGF-beta(1) plasma levels, but not those of TGF-beta(1) mRNA, were increased in patients with SCR (2.59 ng/mL +/- 0.91 [n = 22] vs. 2.05 ng/mL +/- 0.76 [n = 43]; P = 0.01). There was no association between allele T and TGF-beta(1) plasma or intragraft levels. Allele T at codon 10 of the TGF-beta(1) gene is associated with a higher incidence of SCR.

  15. Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

    PubMed

    Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

    2014-07-24

    This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

  16. Sleeve reaction chamber system

    DOEpatents

    Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  17. Agrobacterium-mediated genetic transformation of yam (Dioscorea rotundata): an important tool for functional study of genes and crop improvement

    PubMed Central

    Nyaboga, Evans; Tripathi, Jaindra N.; Manoharan, Rajesh; Tripathi, Leena

    2014-01-01

    Although genetic transformation of clonally propagated crops has been widely studied as a tool for crop improvement and as a vital part of the development of functional genomics resources, there has been no report of any existing Agrobacterium-mediated transformation of yam (Dioscorea spp.) with evidence of stable integration of T-DNA. Yam is an important crop in the tropics and subtropics providing food security and income to over 300 million people. However, yam production remains constrained by increasing levels of field and storage pests and diseases. A major constraint to the development of biotechnological approaches for yam improvement has been the lack of an efficient and robust transformation and regeneration system. In this study, we developed an Agrobacterium-mediated transformation of Dioscorea rotundata using axillary buds as explants. Two cultivars of D. rotundata were transformed using Agrobacterium tumefaciens harboring the binary vectors containing selectable marker and reporter genes. After selection with appropriate concentrations of antibiotic, shoots were developed on shoot induction and elongation medium. The elongated antibiotic-resistant shoots were subsequently rooted on medium supplemented with selection agent. Successful transformation was confirmed by polymerase chain reaction, Southern blot analysis, and reporter genes assay. Expression of gusA gene in transgenic plants was also verified by reverse transcription polymerase chain reaction analysis. Transformation efficiency varied from 9.4 to 18.2% depending on the cultivars, selectable marker genes, and the Agrobacterium strain used for transformation. It took 3–4 months from Agro-infection to regeneration of complete transgenic plant. Here we report an efficient, fast and reproducible protocol for Agrobacterium-mediated transformation of D. rotundata using axillary buds as explants, which provides a useful platform for future genetic engineering studies in this economically important crop. PMID:25309562

  18. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST)

    PubMed Central

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

    2014-01-01

    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase–polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains. PMID:25424931

  19. Aspirin inhibits human telomerase activation in unstable carotid plaques

    PubMed Central

    LI, FANGMING; GUO, YI; JIANG, XIN; ZHONG, JIANXIN; LI, GUANDONG; SUN, SHENGGANG

    2013-01-01

    The activation of telomerase in unstable plaques is an important factor in atherosclerosis, and may be predictive of the risk of cerebrovascular diseases. Human telomerase reverse transcriptase (hTERT) is a subunit of telomerase that is essential for telomerase activation. The aim of the present study was to investigate whether aspirin inhibits the activation of telomerase and hTERT in unstable carotid plaques. Polymorphonuclear neutrophils (PMNs) derived from carotid plaques were isolated from the washing medium of angioplasty balloons, while circulating PMNs, isolated from arterial blood, served as the controls. A polymerase chain reaction-based telomeric repeat amplification protocol (TRAP) enzyme-linked immunosorbent assay (ELISA) was used to measure the telomerase activity in the cells following treatment with aspirin. The mRNA and protein expression of hTERT were detected by a reverse transcription-polymerase chain reaction (RT-PCR) and western blot analysis, respectively. The results revealed that the atherosclerotic plaques were positive for telomerase activity, and that aspirin inhibited the telomerase activity of the PMNs derived from the plaques. In addition, aspirin was demonstrated to inhibit the mRNA and protein expression of hTERT through the suppression of hTERT transcriptional activity; however, it had no inhibitory effect on the telomerase activity of the circulating PMNs. Thus, the activation of telomerase in resident PMNs is critical in the instability of carotid plaques. The upregulation of telomerase and hTERT during the progression of atherosclerosis may indicate a role for telomerase in the vascular remodeling that occurs during atherogenesis. Aspirin was demonstrated to inhibit the activation of telomerase via an hTERT-dependent manner in the PMN cells of unstable carotid plaques, and thus hTERT may be considered as a target in the treatment of cerebrovascular diseases. PMID:23935747

  20. A Pilot Study of the Noninvasive Assessment of the Lung Microbiota as a Potential Tool for the Early Diagnosis of Ventilator-Associated Pneumonia

    PubMed Central

    Brady, Jacob S.; Romano-Keeler, Joann; Drake, Wonder P.; Norris, Patrick R.; Jenkins, Judith M.; Isaacs, Richard J.; Boczko, Erik M.

    2015-01-01

    BACKGROUND: Ventilator-associated pneumonia (VAP) remains a common complication in critically ill surgical patients, and its diagnosis remains problematic. Exhaled breath contains aerosolized droplets that reflect the lung microbiota. We hypothesized that exhaled breath condensate fluid (EBCF) in hygroscopic condenser humidifier/heat and moisture exchanger (HCH/HME) filters would contain bacterial DNA that qualitatively and quantitatively correlate with pathogens isolated from quantitative BAL samples obtained for clinical suspicion of pneumonia. METHODS: Forty-eight adult patients who were mechanically ventilated and undergoing quantitative BAL (n = 51) for suspected pneumonia in the surgical ICU were enrolled. Per protocol, patients fulfilling VAP clinical criteria undergo quantitative BAL bacterial culture. Immediately prior to BAL, time-matched HCH/HME filters were collected for study of EBCF by real-time polymerase chain reaction. Additionally, convenience samples of serially collected filters in patients with BAL-diagnosed VAP were analyzed. RESULTS: Forty-nine of 51 time-matched EBCF/BAL fluid samples were fully concordant (concordance > 95% by κ statistic) relative to identified pathogens and strongly correlated with clinical cultures. Regression analysis of quantitative bacterial DNA in paired samples revealed a statistically significant positive correlation (r = 0.85). In a convenience sample, qualitative and quantitative polymerase chain reaction analysis of serial HCH/HME samples for bacterial DNA demonstrated an increase in load that preceded the suspicion of pneumonia. CONCLUSIONS: Bacterial DNA within EBCF demonstrates a high correlation with BAL fluid and clinical cultures. Bacterial DNA within EBCF increases prior to the suspicion of pneumonia. Further study of this novel approach may allow development of a noninvasive tool for the early diagnosis of VAP. PMID:25474571

  1. Isolation of Streptococcus pyogenes from children with pharyngitis and emm type analysis.

    PubMed

    Khosravi, Azar D; Ebrahimifard, Nasim; Shamsizadeh, Ahmad; Shoja, Saeed

    2016-05-01

    The group A streptococcus (GAS) M protein, encoded by the emm gene, acts as a major virulence factor. Emm-typing is the GAS gold standard molecular typing and is based on the DNA sequence of the nucleotides of the emm gene. The aim of the present study was to isolate GAS from patients and to detect the emm types of the isolates using emm typing. A total of 1000 throat samples were collected from patients with pharyngitis referred to Aboozar Children's Hospital in Ahvaz, Iran. We performed antimicrobial susceptibility testing on all isolates using the Kirby-Bauer disk diffusion method. Additionally, amplification of the emm gene was performed using polymerase chain reaction using the standard primers and described protocol. From all throat samples screened, 25 isolates (2.5%) were identified as GAS. Antibiotic susceptibility testing revealed that all the GAS isolates were susceptible to penicillin and erythromycin, but 44% showed resistance to vancomycin. Based on polymerase chain reaction for the emm gene, the obtained emm types were: emm-3, observed in 20 isolates (80%); emm-1 observed in four isolates (16%); and emm-75 observed in one isolate (4%). The result of the present study showed that penicillin and erythromycin are still the most effective antibiotics against the organism. The emm typing revealed that emm type-3 was detected in most of the isolates from patients with purulent pharyngitis. On the basis of the findings of this study, we may conclude that emm typing provides new insights on the genetic diversity of the M proteins, and is of demonstrable value for molecular studies of GAS. Copyright © 2016. Published by Elsevier Taiwan LLC.

  2. Detection and management of minimal residual disease in acute lymphoblastic leukemia.

    PubMed

    Schrappe, Martin

    2014-12-05

    The detection of minimal residual disease (MRD) has become part of the state-of-the-art diagnostics to guide treatment both in pediatric and adult acute lymphoblastic leukemia (ALL). This applies to the treatment of de novo and recurrent ALL. In high-risk ALL, MRD detection is considered an important tool to adjust therapy before and after hematopoietic stem cell transplantation. Precise quantification and quality control is instrumental to avoid false treatment assignment. A new methodological approach to analyzing MRD has become available and is based on next-generation sequencing. In principle, this technique will be able to detect a large number of leukemic subclones at a much higher speed than before. Carefully designed prospective studies need to demonstrate concordance or even superiority compared with those techniques in use right now: detection of aberrant expression of leukemia-specific antigens by flow cytometry of blood or bone marrow, or detection of specific rearrangements of the T-cell receptor or immunoglobulin genes by real-time quantitative polymerase chain reaction using DNA of leukemic cells. In some cases with known fusion genes, such as BCR/ABL, reverse transcriptase-polymerase chain reaction has been used as additional method to identify leukemic cells by analyzing RNA in patient samples. MRD detection may be used to modulate treatment intensity once it has been demonstrated at well-defined informative checkpoints that certain levels of MRD can reliably predict the risk of relapse. In addition, MRD is used as end point to determine the activity of a given agent or treatment protocol. If activity translates into antileukemic efficacy, MRD may be considered a surrogate clinical end point. © 2014 by The American Society of Hematology. All rights reserved.

  3. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST).

    PubMed

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

    2014-01-01

    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.

  4. An Hourly Dose-Escalation Desensitization Protocol for Aspirin-Exacerbated Respiratory Disease.

    PubMed

    Chen, Justin R; Buchmiller, Brett L; Khan, David A

    2015-01-01

    Aspirin desensitization followed by maintenance therapy effectively improves symptom control in patients with aspirin exacerbated respiratory disease (AERD). The majority of current desensitization protocols use 3-hour dosing intervals and often require 2 to 3 days to complete. We evaluated hourly dose escalations in a subset of patients with chronic rhinosinusitis, nasal polyps, and asthma who historically reacted to aspirin within 1 hour or were avoiding aspirin with the goal of developing a safe and efficient desensitization protocol. Fifty-seven aspirin desensitizations were performed under the hourly protocol. All patients had refractory nasal polyposis as an indication for aspirin desensitization. The clinical characteristics of each subject were analyzed in relation to aspects of his or her reactions during the procedure. Ninety-eight percent of study patients were successfully treated under the hourly protocol, including those with a history of severe reactions and intubation. None required further medication than is available in an outpatient allergy clinic. A total of 96% of reactors recorded a bronchial or naso-ocular reaction within 1 hour of the preceding dose. Of the total patients on this protocol, 40% were able to complete the procedure in a single day, and 60% within 2 days. Patients with AERD who have a history of symptoms less than 1 hour after aspirin exposure can be safely desensitized with a 1-hour dose-escalation protocol that can often be completed in a single day. Copyright © 2015 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  5. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    PubMed

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  6. Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

    USDA-ARS?s Scientific Manuscript database

    Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

  7. MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

    DOEpatents

    Wigner, E.P.; Weinberg, A.M.

    1961-01-24

    A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

  8. DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

    EPA Science Inventory

    This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

  9. Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

    PubMed

    Adewale, B; Mafe, M A; Oyerinde, J P O

    2005-01-01

    Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

  10. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    PubMed

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

  11. [The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

    PubMed

    Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

    2014-04-01

    The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

  12. Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

    PubMed Central

    Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

    2014-01-01

    A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

  13. Developing daisy chain receivers for light-emitting diode illumination adopting the digital multiplex-512 protocol.

    PubMed

    Um, Keehong; Yoo, Sooyeup

    2013-10-01

    Protocol for digital multiplex with 512 pieces of information is increasingly adopted in the design of illumination systems. In conventional light-emitting diode systems, the receivers are connected in parallel and each of the receiving units receives all the data from the master dimmer console, but each receiving unit operates by recognizing as its own data that which corresponds to the assigned number of the receiver. Because the serial numbers of illumination devices are transmitted in binary code, synchronization is too complicated to be used properly. In order to improve the protocol of illumination control systems, we propose an algorithm of protocol reception to install and manage the system in a simpler and more convenient way. We propose the systems for controlling the light-emitting diode illumination of simplified receiver slaves adopting the digital multiplex-512 protocol where master console and multiple receiver slaves are connected in a daisy chain fashion. The digital multiplex-512 data packet is received according to the sequence order of their locations from the console, without assigning the sequence number of each channel at the receiving device. The purpose of this paper is to design a simple and small-sized controller for the control systems of lamps and lighting adopting the digital multiplex-512 network.

  14. Safety of medium-chain triglycerides used as an intraocular tamponading agent in an experimental vitrectomy model rabbit.

    PubMed

    Auriol, Sylvain; Mahieu, Laurence; Brousset, Pierre; Malecaze, François; Mathis, Véronique

    2013-01-01

    To evaluate safety of medium-chain triglycerides used as a possible intraocular tamponading agent. A 20-gauge pars plana vitrectomy was performed in the right eye of 28 rabbits. An ophthalmologic examination was performed every week until rabbits were killed. At days 7, 30, 60, and 90, rabbits were killed and the treated eyes were examined macroscopically and prepared for histologic examination. Principal outcome was retinal toxicity evaluated by light and electron microscopy, and secondary outcomes were the presence of medium-chain triglyceride emulsification, inflammatory reactions, and the development of cataract. Histologic examination did not reveal any retinal toxicity. Two cases of moderate emulsification were observed, but in these cases, emulsification was caused by the perioperative injection of the agent and did not increase during the postoperative period. We noted 13 cases of inflammatory reaction in vitreous cavity and no case of inflammatory reaction in anterior chamber. Two eyes developed cataract as a result of perioperative trauma to the lens with the vitreous cutter and not secondary to the presence of medium-chain triglycerides in the vitreous cavity. Medium-chain triglycerides did not induce morphologic evidence of retinal toxicity. The results suggest that medium-chain triglycerides could be a promising alternative intraocular tamponading agent for the treatment of retinal detachments.

  15. Neutron-deficient superheavy nuclei obtained in the 240Pu+48Ca reaction

    NASA Astrophysics Data System (ADS)

    Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu. Ts.; Rykaczewski, K. P.; Abdullin, F. Sh.; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu. S.; Voinov, A. A.; Subbotin, V. G.; Sukhov, A. M.; Karpov, A. V.; Popeko, A. G.; Sabel'nikov, A. V.; Svirikhin, A. I.; Vostokin, G. K.; Hamilton, J. H.; Kovrizhnykh, N. D.; Schlattauer, L.; Stoyer, M. A.; Gan, Z.; Huang, W. X.; Ma, L.

    2018-01-01

    We present new results from investigations of the 240Pu+48Ca reaction at a projectile energy of 250 MeV. Three new decay chains of 285Fl were detected with decay properties mostly consistent with those measured in earlier studies. An additional chain was observed where the nuclei may decay through energy levels different from those of the other six chains registered so far. The cross section of the 240Pu(48Ca,3 n )285Fl reaction was measured to be 0 .58-0.33+0.60pb , which is a factor of about 4-5 lower than that measured in the previous experiment at 245 MeV beam energy [V. K. Utyonkov et al., Phys. Rev. C 92, 034609 (2015)., 10.1103/PhysRevC.92.034609], consistent with expectations. The origin of an additional chain consisting of a recoil, α particle, and fission event is analyzed. The assignment of 25 short-lived SF events observed in this experiment is also discussed.

  16. Autocatalytic formation of an iron(IV)-oxo complex via scandium ion-promoted radical chain autoxidation of an iron(II) complex with dioxygen and tetraphenylborate.

    PubMed

    Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi

    2014-06-04

    A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.

  17. Rapid Hymenoptera venom immunotherapy: comparative safety of three protocols.

    PubMed

    Birnbaum, J; Charpin, D; Vervloet, D

    1993-03-01

    We compared 284 sting-allergic patients treated with either a 4 day (group 1), 6 hr (group 2) or 210 min (group 3) rapid venom immunotherapy (RVIT) protocol using honey bee (HB) or yellow jacket (YJ) venom at cumulative doses of 527.6 micrograms, 226.6 micrograms and 101.1 micrograms respectively. The 4 day protocol involved four times as many injections as the 210 min protocol and twice as many as the 6 hr protocol. Desensitization was conducted in a hospital providing full emergency resuscitation facilities. In group 1, 1 x 100 micrograms boosters were given on days 7, 10, 15 and 45 and, in groups 2 and 3, 2 x 50 micrograms boosters were given on day 15 and 1 x 100 micrograms on day 45. The patients in the three groups were comparable with regard to clinical characteristics and immunological reactivity determined by skin tests. All patients had large local reactions. Systemic reactions (SR) occurred in 28.2% of patients in group 1, 28.6% in group 2 and 6.9% in group 3. The mean total cumulative venom dose (s.e.m.) for occurrence of SR was 123.75 (+/- 24.2) in group 1, 183.27 (+/- 28.5) in group 2, and 36.43 (+/- 9.3) in group 3. HB led to more systemic reactions than YJ venom. The rate of SR decreased when the cumulative venom dose was reduced during RVIT. The median dose was 137.6 micrograms in group 1, 226.6 micrograms in group 2, and 21.1 micrograms in group 3. No systemic reactions were observed after the booster injections. The results of this study suggest that short RVIT protocols with low cumulative doses carry a lesser risk of SR.

  18. Terminal alkenes as versatile chemical reporter groups for metabolic oligosaccharide engineering.

    PubMed

    Späte, Anne-Katrin; Schart, Verena F; Schöllkopf, Sophie; Niederwieser, Andrea; Wittmann, Valentin

    2014-12-08

    The Diels-Alder reaction with inverse electron demand (DAinv reaction) of 1,2,4,5-tetrazines with electron rich or strained alkenes was proven to be a bioorthogonal ligation reaction that proceeds fast and with high yields. An important application of the DAinv reaction is metabolic oligosaccharide engineering (MOE) which allows the visualization of glycoconjugates in living cells. In this approach, a sugar derivative bearing a chemical reporter group is metabolically incorporated into cellular glycoconjugates and subsequently derivatized with a probe by means of a bioorthogonal ligation reaction. Here, we investigated a series of new mannosamine and glucosamine derivatives with carbamate-linked side chains of varying length terminated by alkene groups and their suitability for labeling cell-surface glycans. Kinetic investigations showed that the reactivity of the alkenes in DAinv reactions increases with growing chain length. When applied to MOE, one of the compounds, peracetylated N-butenyloxycarbonylmannosamine, was especially well suited for labeling cell-surface glycans. Obviously, the length of its side chain represents the optimal balance between incorporation efficiency and speed of the labeling reaction. Sialidase treatment of the cells before the bioorthogonal labeling reaction showed that this sugar derivative is attached to the glycans in form of the corresponding sialic acid derivative and not epimerized to another hexosamine derivative to a considerable extent. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Efficient quantum state transfer in an engineered chain of quantum bits

    NASA Astrophysics Data System (ADS)

    Sandberg, Martin; Knill, Emanuel; Kapit, Eliot; Vissers, Michael R.; Pappas, David P.

    2016-03-01

    We present a method of performing quantum state transfer in a chain of superconducting quantum bits. Our protocol is based on engineering the energy levels of the qubits in the chain and tuning them all simultaneously with an external flux bias. The system is designed to allow sequential adiabatic state transfers, resulting in on-demand quantum state transfer from one end of the chain to the other. Numerical simulations of the master equation using realistic parameters for capacitive nearest-neighbor coupling, energy relaxation, and dephasing show that fast, high-fidelity state transfer should be feasible using this method.

  20. Synthesis and Crystallization Behavior of Surfactants with Hexamolybdate as the Polar Headgroup

    DOE PAGES

    Zhu, Li; Chen, Kun; Hao, Jian; ...

    2015-06-12

    For this paper, alkyl chains with different lengths were covalently grafted onto the surface of hexamolybdate through the postfunctionalization protocol of polyoxometalates. The obtained compounds represent typical structures of the so-called giant surfactants. Unexpectedly, those surfactants with hexamolybdates as polar headgroups are able to crystallize, while single-crystal X-ray diffraction reveals that the crystallization behavior of the surfactants is highly dependent on the length of the alkyl chains. For surfactants with comparatively short alkyl chains (C6 and C10), the alkyl chains prefer to interact with tetrabutylammonium, the countercation of hexamolybdate. However, the alkyl chains tend to pack with each other tomore » form a domain of alkyl chains in the surfactant with a longer alkyl chain (C18). Finally, the possible mechanism is that a long alkyl chain cannot be fully compatible with the short chain (C4) of tetrabutylammonium.« less

  1. Multicomponent, flow diazotization/Mizoroki-Heck coupling protocol: dispelling myths about working with diazonium salts.

    PubMed

    Nalivela, Kumara S; Tilley, Michael; McGuire, Michael A; Organ, Michael G

    2014-05-26

    A single pass flow diazotization/Mizoroki-Heck protocol has been developed for the production of cinnimoyl and styryl products. The factors that govern aryl diazonium salt stability have been examined in detail leading to the development of a MeOH/DMF co-solvent system in which the diazonium salts can be generated in the presence of all other reaction components and then coupled selectively to give the desired products. Finally the key role of the reaction quench for flow reactions has been demonstrated. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Method for polymer synthesis in a reaction well

    DOEpatents

    Brennan, Thomas M.

    1998-01-01

    A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

  3. Method for polymer synthesis in a reaction well

    DOEpatents

    Brennan, T.M.

    1998-09-29

    A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

  4. MICROWAVE-ACCELERATED MULTICOMPONENT REACTIONS UNDER SOLVENT-FREE CONDITIONS

    EPA Science Inventory

    The application of microwave-accelerated solventless synthetic protocols in multicomponent (MCC) reactions will be exemplified by several condensation and cyclization reactions including the rapid one-pot assembly of valuable heterocyclic compounds from in situ generated intermed...

  5. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

    PubMed Central

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

  6. Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

    Treesearch

    David E. Schreiber; Karen J. Garner; James M. Slavicek

    1997-01-01

    Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

  7. Palladium/N-heterocyclic carbene catalysed regio and diastereoselective reaction of ketones with allyl reagents via inner-sphere mechanism

    PubMed Central

    Bai, Da-Chang; Yu, Fei-Le; Wang, Wan-Ying; Chen, Di; Li, Hao; Liu, Qing-Rong; Ding, Chang-Hua; Chen, Bo; Hou, Xue-Long

    2016-01-01

    The palladium-catalysed allylic substitution reaction is one of the most important reactions in transition-metal catalysis and has been well-studied in the past decades. Most of the reactions proceed through an outer-sphere mechanism, affording linear products when monosubstituted allyl reagents are used. Here, we report an efficient Palladium-catalysed protocol for reactions of β-substituted ketones with monosubstituted allyl substrates, simply by using N-heterocyclic carbene as ligand, leading to branched products with up to three contiguous stereocentres in a (syn, anti)-mode with excellent regio and diastereoselectivities. The scope of the protocol in organic synthesis has been examined preliminarily. Mechanistic studies by both experiments and density functional theory (DFT) calculations reveal that the reaction proceeds via an inner-sphere mechanism—nucleophilic attack of enolate oxygen on Palladium followed by C–C bond-forming [3,3']-reductive elimination. PMID:27283477

  8. Palladium/N-heterocyclic carbene catalysed regio and diastereoselective reaction of ketones with allyl reagents via inner-sphere mechanism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bai, Da -Chang; Yu, Fei -Le; Wang, Wan -Ying

    The palladium-catalysed allylic substitution reaction is one of the most important reactions in transition-metal catalysis and has been well-studied in the past decades. Most of the reactions proceed through an outer-sphere mechanism, affording linear products when monosubstituted allyl reagents are used. Here, we report an efficient Palladium-catalysed protocol for reactions of beta-substituted ketones with monosubstituted allyl substrates, simply by using N-heterocyclic carbene as ligand, leading to branched products with up to three contiguous stereocentres in a ( syn, anti)-mode with excellent regio and diastereoselectivities. The scope of the protocol in organic synthesis has been examined preliminarily. As a result, mechanisticmore » studies by both experiments and density functional theory ( DFT) calculations reveal that the reaction proceeds via an inner-sphere mechanism-nucleophilic attack of enolate oxygen on Palladium followed by C-C bond-forming [3,3']-reductive elimination.« less

  9. Palladium/N-heterocyclic carbene catalysed regio and diastereoselective reaction of ketones with allyl reagents via inner-sphere mechanism

    DOE PAGES

    Bai, Da -Chang; Yu, Fei -Le; Wang, Wan -Ying; ...

    2016-06-10

    The palladium-catalysed allylic substitution reaction is one of the most important reactions in transition-metal catalysis and has been well-studied in the past decades. Most of the reactions proceed through an outer-sphere mechanism, affording linear products when monosubstituted allyl reagents are used. Here, we report an efficient Palladium-catalysed protocol for reactions of beta-substituted ketones with monosubstituted allyl substrates, simply by using N-heterocyclic carbene as ligand, leading to branched products with up to three contiguous stereocentres in a ( syn, anti)-mode with excellent regio and diastereoselectivities. The scope of the protocol in organic synthesis has been examined preliminarily. As a result, mechanisticmore » studies by both experiments and density functional theory ( DFT) calculations reveal that the reaction proceeds via an inner-sphere mechanism-nucleophilic attack of enolate oxygen on Palladium followed by C-C bond-forming [3,3']-reductive elimination.« less

  10. A Study of Shared-Memory Mutual Exclusion Protocols Using CADP

    NASA Astrophysics Data System (ADS)

    Mateescu, Radu; Serwe, Wendelin

    Mutual exclusion protocols are an essential building block of concurrent systems: indeed, such a protocol is required whenever a shared resource has to be protected against concurrent non-atomic accesses. Hence, many variants of mutual exclusion protocols exist in the shared-memory setting, such as Peterson's or Dekker's well-known protocols. Although the functional correctness of these protocols has been studied extensively, relatively little attention has been paid to their non-functional aspects, such as their performance in the long run. In this paper, we report on experiments with the performance evaluation of mutual exclusion protocols using Interactive Markov Chains. Steady-state analysis provides an additional criterion for comparing protocols, which complements the verification of their functional properties. We also carefully re-examined the functional properties, whose accurate formulation as temporal logic formulas in the action-based setting turns out to be quite involved.

  11. Safety profile and protocol prevention of adverse reactions to uroangiographic contrast media in diagnostic imaging.

    PubMed

    Rossi, C; Reginelli, A; D'Amora, M; Di Grezia, G; Mandato, Y; D'Andrea, A; Brunese, L; Grassi, R; Rotondi, A

    2014-01-01

    The purpose of the study is to examine the incidence of adverse reactions caused by non-ionic contrast media in selected patients after desensitization treatment and to evaluate the safety profile of organ iodine contrast media (i.c.m.) in a multistep prevention protocol. In a population of 2000 patients that had received a CT scan, 100 patients with moderate/high risk for adverse reactions against iodinated contrast agents followed a premedication protocol and all adverse reactions are reported and classified as mild, moderate or severe. 1.7 percent of the pre-treated patients reported a mild, immediate type reaction to iodine contrast; of these five patients with allergy 0.71 percent had received iomeprol, 0.35 percent received ioversol and 0.71 percent received iopromide. The incidence of adverse reactions was reported to be higher (4 out of 5 patients) among those that referred a history of hypersensitivity against iodinated i.c.m. Although intravenous contrast materials have greatly improved, especially in terms of their safety profile, they should not be administered if there isn't a clear or justified indication. In conclusion, even if we know that the majority of these reactions are idiosyncratic and unpredictable we propose, with the aim of improving our knowledge on this subject, a multicenter study, based on skin allergy tests (prick test, patch test, intradermal reaction) in selected patients that have had previous experiences of hypersensitivity against parenteral organ iodine contrast media.

  12. The Beta-Delayed Proton and Gamma Decay of 27P for Nuclear Astrophysics

    NASA Astrophysics Data System (ADS)

    McCleskey, E.; Banu, A.; McCleskey, M.; Roeder, B.; Saastamoinen, A.; Spiridon, A.; Trache, L.; Tribble, R. E.; Davinson, T.; Doherty, D.; Lotay, G. J.; Wallace, J.; Woods, P. J.

    2013-10-01

    The main creation site of 26Al is currently under debate. The reactions for its creation or destruction are also not completely known. When 26Al is created in novae, the reaction chain is: 24Mg(p,γ)25Al(β + v)25Mg(p,γ)26Al, but this chain can be by-passed by another chain: 25Al(p,γ)26Si(p,γ)27P and it can also be destroyed directly. Another way to by-pass it is through 26mAl(p,γ)27Si* which is dominated by resonant capture. Using the Momentum Achromat Recoil Spectrometer (MARS) at the Texas A&M Cyclotron Institute and inverse kinematics, this destruction reaction was studied by the beta-delayed proton and gamma decay of 27P. Due to selection rules, states populated above the proton threshold in the compound system (27Si*) can decay to 26mAl, which are the states of interest for the capture reaction. James Madison University, VA, USA.

  13. Rate-loss analysis of an efficient quantum repeater architecture

    NASA Astrophysics Data System (ADS)

    Guha, Saikat; Krovi, Hari; Fuchs, Christopher A.; Dutton, Zachary; Slater, Joshua A.; Simon, Christoph; Tittel, Wolfgang

    2015-08-01

    We analyze an entanglement-based quantum key distribution (QKD) architecture that uses a linear chain of quantum repeaters employing photon-pair sources, spectral-multiplexing, linear-optic Bell-state measurements, multimode quantum memories, and classical-only error correction. Assuming perfect sources, we find an exact expression for the secret-key rate, and an analytical description of how errors propagate through the repeater chain, as a function of various loss-and-noise parameters of the devices. We show via an explicit analytical calculation, which separately addresses the effects of the principle nonidealities, that this scheme achieves a secret-key rate that surpasses the Takeoka-Guha-Wilde bound—a recently found fundamental limit to the rate-vs-loss scaling achievable by any QKD protocol over a direct optical link—thereby providing one of the first rigorous proofs of the efficacy of a repeater protocol. We explicitly calculate the end-to-end shared noisy quantum state generated by the repeater chain, which could be useful for analyzing the performance of other non-QKD quantum protocols that require establishing long-distance entanglement. We evaluate that shared state's fidelity and the achievable entanglement-distillation rate, as a function of the number of repeater nodes, total range, and various loss-and-noise parameters of the system. We extend our theoretical analysis to encompass sources with nonzero two-pair-emission probability, using an efficient exact numerical evaluation of the quantum state propagation and measurements. We expect our results to spur formal rate-loss analysis of other repeater protocols and also to provide useful abstractions to seed analyses of quantum networks of complex topologies.

  14. Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen

    NASA Astrophysics Data System (ADS)

    Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.

    2017-12-01

    The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.

  15. A Facile CD Protocol for Rapid Determination of Enantiomeric Excess and Concentration of Chiral Primary Amines

    PubMed Central

    Nieto, Sonia; Dragna, Justin M.; Anslyn, Eric V.

    2010-01-01

    A protocol for the rapid determination of the absolute configuration and enantiomeric excess of α-chiral primary amines with potential applications in asymmetric reaction discovery has been developed. The protocol requires derivatization of α-chiral primary amines via condensation with pyridine carboxaldehyde to quantitatively yield the corresponding imine. The Cu(I) complex with 2,2'-bis (diphenylphosphino)-1,1'-dinaphthyl (BINAP -CuI) with the imine yields a metal-to-ligand-charge-transfer band (MLCT) in the visible region of the circular dichroism spectrum upon binding. Diastereomeric host-guest complexes give CD signals of the same signs, but different amplitudes, allowing for differentiation of enantiomers. Processing the primary optical data from the CD spectrum with linear discriminant analysis (LDA) allows for the determination of absolute configuration and identification of the amines, and processing with a supervised multi-layer perceptron artifical neural network (MLP-ANN) allows for the simultaneous determination of ee and concentration. The primary optical data necessary to determine the ee of unknown samples is obtained in 2 minutes per sample. To demonstrate the utility of the protocol in asymmetric reaction discovery, the ee's and concentrations for an asymmetric metal catalyzed reaction are determined. The potential of the protocol's application in high-throughput screening (HTS) of ee is discussed. PMID:19946914

  16. Metal- and additive-free photoinduced borylation of haloarenes.

    PubMed

    Mfuh, Adelphe M; Schneider, Brett D; Cruces, Westley; Larionov, Oleg V

    2017-03-01

    Boronic acids and esters have critical roles in the areas of synthetic organic chemistry, molecular sensors, materials science, drug discovery, and catalysis. Many of the current applications of boronic acids and esters require materials with very low levels of transition metal contamination. Most of the current methods for the synthesis of boronic acids, however, require transition metal catalysts and ligands that must be removed via additional purification procedures. This protocol describes a simple, metal- and additive-free method of conversion of haloarenes directly to boronic acids and esters. This photoinduced borylation protocol does not require expensive and toxic metal catalysts or ligands, and it produces innocuous and easy-to-remove by-products. Furthermore, the reaction can be carried out on multigram scales in common-grade solvents without the need for reaction mixtures to be deoxygenated. The setup and purification steps are typically accomplished within 1-3 h. The reactions can be run overnight, and the protocol can be completed within 13-16 h. Two representative procedures that are described in this protocol provide details for preparation of a boronic acid (3-cyanopheylboronic acid) and a boronic ester (1,4-benzenediboronic acid bis(pinacol)ester). We also discuss additional details of the method that will be helpful in the application of the protocol to other haloarene substrates.

  17. Share2Quit: Web-Based Peer-Driven Referrals for Smoking Cessation

    PubMed Central

    2013-01-01

    Background Smoking is the number one preventable cause of death in the United States. Effective Web-assisted tobacco interventions are often underutilized and require new and innovative engagement approaches. Web-based peer-driven chain referrals successfully used outside health care have the potential for increasing the reach of Internet interventions. Objective The objective of our study was to describe the protocol for the development and testing of proactive Web-based chain-referral tools for increasing the access to Decide2Quit.org, a Web-assisted tobacco intervention system. Methods We will build and refine proactive chain-referral tools, including email and Facebook referrals. In addition, we will implement respondent-driven sampling (RDS), a controlled chain-referral sampling technique designed to remove inherent biases in chain referrals and obtain a representative sample. We will begin our chain referrals with an initial recruitment of former and current smokers as seeds (initial participants) who will be trained to refer current smokers from their social network using the developed tools. In turn, these newly referred smokers will also be provided the tools to refer other smokers from their social networks. We will model predictors of referral success using sample weights from the RDS to estimate the success of the system in the targeted population. Results This protocol describes the evaluation of proactive Web-based chain-referral tools, which can be used in tobacco interventions to increase the access to hard-to-reach populations, for promoting smoking cessation. Conclusions Share2Quit represents an innovative advancement by capitalizing on naturally occurring technology trends to recruit smokers to Web-assisted tobacco interventions. PMID:24067329

  18. Novel multi-day sputum transport reagent works with routine tuberculosis tests and eliminates need for cold chain: Preliminary study of compatibility with the Xpert® MTB/RIF assay.

    PubMed

    Kelly-Cirino, Cassandra D; Curry, Patricia S; Marola, Jamie L; Helstrom, Niels K; Salfinger, Max

    2016-11-01

    OMNIgene®•SPUTUM (OM-S) is a sputum transport reagent designed to work with all tuberculosis diagnostics and eliminate the need for cold chain. The aim of this preliminary study was to assess the compatibility of OM-S-treated sputum with the Xpert® MTB/RIF assay. Fifty-five characterized sputa from the FIND TB Specimen Bank were used. Compatibility of OM-S was assessed for both Xpert sample preparation methods: H.1 protocol (sediment, n=25) and H.2 protocol (direct expectorate, n=30). All controls were prepared using the H.2 protocol. Results revealed 100% concordance of MTB/RIF results for all except the low-positive group in the H.1 study arm (n=10; 88% concordance). OM-S-treated sputa were successful in both protocols; if the Xpert buffer is not added during the H.2 procedure, sample viscosity may require repeat testing. Using OM-S could offer users flexibility in clinical testing algorithms. Larger compatibility studies are warranted, particularly with respect to MTB/RIF results for low-positive samples. Copyright © 2016 Elsevier Inc. All rights reserved.

  19. Automated muscle fiber type population analysis with ImageJ of whole rat muscles using rapid myosin heavy chain immunohistochemistry.

    PubMed

    Bergmeister, Konstantin D; Gröger, Marion; Aman, Martin; Willensdorfer, Anna; Manzano-Szalai, Krisztina; Salminger, Stefan; Aszmann, Oskar C

    2016-08-01

    Skeletal muscle consists of different fiber types which adapt to exercise, aging, disease, or trauma. Here we present a protocol for fast staining, automatic acquisition, and quantification of fiber populations with ImageJ. Biceps and lumbrical muscles were harvested from Sprague-Dawley rats. Quadruple immunohistochemical staining was performed on single sections using antibodies against myosin heavy chains and secondary fluorescent antibodies. Slides were scanned automatically with a slide scanner. Manual and automatic analyses were performed and compared statistically. The protocol provided rapid and reliable staining for automated image acquisition. Analyses between manual and automatic data indicated Pearson correlation coefficients for biceps of 0.645-0.841 and 0.564-0.673 for lumbrical muscles. Relative fiber populations were accurate to a degree of ± 4%. This protocol provides a reliable tool for quantification of muscle fiber populations. Using freely available software, it decreases the required time to analyze whole muscle sections. Muscle Nerve 54: 292-299, 2016. © 2016 Wiley Periodicals, Inc.

  20. MICROWAVE-FACILITATED MULTICOMPONENT REACTIONS UNDER SOLVENT-FREE CONDITIONS

    EPA Science Inventory

    The application of microwave-expedited solvent-free synthetic protocols in multi-component (MCC) reactions will be exemplified by several condensation and cyclization reactions including the rapid one-pot assembly of heterocyclic compounds from in situ generated intermediates. R...

  1. Nursing Care of Patients Undergoing Chemotherapy Desensitization: Part II.

    PubMed

    Jakel, Patricia; Carsten, Cynthia; Carino, Arvie; Braskett, Melinda

    2016-04-01

    Chemotherapy desensitization protocols are safe, but labor-intensive, processes that allow patients with cancer to receive medications even if they initially experienced severe hypersensitivity reactions. Part I of this column discussed the pathophysiology of hypersensitivity reactions and described the development of desensitization protocols in oncology settings. Part II incorporates the experiences of an academic medical center and provides a practical guide for the nursing care of patients undergoing chemotherapy desensitization.
.

  2. Additional chain-branching pathways in the low-temperature oxidation of branched alkanes

    DOE PAGES

    Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; ...

    2015-12-31

    Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C 8H 14O 4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C 8H 16O 5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C 8H 16O 5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O 2 addition, intramolecular isomerization, and OH release; C 8H 14O 4 species are proposed to result from subsequent reactions of C 8H 16O 5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less

  3. An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

    PubMed Central

    Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

    2005-01-01

    Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

  4. Blood grouping based on PCR methods and agarose gel electrophoresis.

    PubMed

    Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

    2015-01-01

    The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

  5. Excitation wavelength dependence of excited state intramolecular proton transfer reaction of 4'-N,N-diethylamino-3-hydroxyflavone in room temperature ionic liquids studied by optical Kerr gate fluorescence measurement.

    PubMed

    Suda, Kayo; Terazima, Masahide; Sato, Hirofumi; Kimura, Yoshifumi

    2013-10-17

    Excited state intramolecular proton transfer reactions (ESIPT) of 4'-N,N-diethylamino-3-hydroxyflavone (DEAHF) in ionic liquids have been studied by steady-state and time-resolved fluorescence measurements at different excitation wavelengths. Steady-state measurements show the relative yield of the tautomeric form to the normal form of DEAHF decreases as excitation wavelength is increased from 380 to 450 nm. The decrease in yield is significant in ionic liquids that have cations with long alkyl chains. The extent of the decrease is correlated with the number of carbon atoms in the alkyl chains. Time-resolved fluorescence measurements using optical Kerr gate spectroscopy show that ESIPT rate has a strong excitation wavelength dependence. There is a large difference between the spectra at a 200 ps delay from different excitation wavelengths in each ionic liquid. The difference is pronounced in ionic liquids having a long alkyl chain. The equilibrium constant in the electronic excited state obtained at a 200 ps delay and the average reaction rate are also correlated with the alkyl chain length. Considering the results of the steady-state fluorescence and time-resolved measurements, the excitation wavelength dependence of ESIPT is explained by state selective excitation due to the difference of the solvation, and the number of alkyl chain carbon atoms is found to be a good indicator of the effect of inhomogeneity for this reaction.

  6. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

    NASA Astrophysics Data System (ADS)

    Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

    2015-07-01

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

  7. A Bullet-Block Experiment that Explains the Chain Fountain

    NASA Astrophysics Data System (ADS)

    Pantaleone, J.; Smith, R.

    2018-05-01

    It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.

  8. Radiolysis of N-acetyl amino acids as model compounds for radiation degradation of polypeptides

    NASA Astrophysics Data System (ADS)

    Wayne Garrett, R.; Hill, David J. T.; Ho, Sook-Ying; O'Donnell, James H.; O'Sullivan, Paul W.; Pomery, Peter J.

    Radiation chemical yields of (i) the volatile radiolysis products and (ii) the trapped free radicals from the y-radiolysis of the N-acetyl derivatives of glycine, L-valine, L-phenylalanine and L-tyrosine in the polycrystalline state have been determined at room temperature (303 K). Carbon dioxide was found to be the major molecular product for all these compounds with G(CO 2) varying from 0.36 for N-acetyl-L-tyrosine to 8 for N-acetyl-L-valine. There was evidence for some scission of the N-C α bond, indicated by the production of acetamide and the corresponding aliphatic acid, but the determination reaction was found to be of much lesser importance than the decarboxylation reaction. A protective effect of the aromatic ring in N-acetyl-L-phenylalanine and in N-acetyl-L-tyrosine was indicated by the lower yields of volatile products for these compounds. The yields of trapped free radicals were found to vary with the nature of the amino acid side chain, increasing with chain length and chain branching. The radical yields were decreased by incorporation of an aromatic moiety in the side chain, this effect being greater for the tyrosyl side chain than for the phenyl side chain. The G(R·) values showed a good correlation with G(CO 2) indicating that a common reaction may be involved in radical production and carbon dioxide formation.

  9. Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

    EPA Science Inventory

    The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

  10. Highly efficient preparation of selectively isotope cluster-labeled long chain fatty acids via two consecutive C(sp3)-C(sp3) cross-coupling reactions.

    PubMed

    Lethu, Sébastien; Matsuoka, Shigeru; Murata, Michio

    2014-02-07

    An efficient synthesis involving two copper-catalyzed alkyl-alkyl coupling reactions has been designed to easily access doubly isotope-labeled fatty acids. Such NMR- and IR-active compounds were obtained in excellent overall yields and will be further used for determining the conformation of an alkyl chain of lipidic biomolecules upon interaction with proteins.

  11. Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

    USDA-ARS?s Scientific Manuscript database

    This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

  12. Development of a two-step protocol for culture expansion of human annulus fibrosus cells with TGF-β1 and FGF-2.

    PubMed

    Chou, Po-Hsin; Wang, Shih-Tien; Ma, Hsiao-Li; Liu, Chien-Lin; Chang, Ming-Chau; Lee, Oscar Kuang-Sheng

    2016-07-12

    Different biologic approaches to treat disc regeneration, including growth factors (GFs) application, are currently under investigation. Human annulus fibrosus (hAF) repair or regeneration is one of the key elements for maintenance and restoration of nucleus pulposus function. However, so far there is no effective treatment for this purpose. The aim of the present study was to investigate the response of hAF cells to different combinations of GFs, and develop a protocol for efficient culture expansion. hAF cells were harvested from degenerated disc tissues during surgical intervertebral disc removal, and hAF cells were expanded in a monolayer. The experiments were categorized based on different protocols with transforming growth factor (TGF-β1) and fibroblast growth factor (FGF-2) culture for 14 days: group 1 had no GFs (control group); group 2 received TGF-β1; group 3 received FGF-2; group 4 received both GFs; and group 5 (two-step) received both GFs for the first 10 days and TGF-β1 only for the next 4 days. Cell proliferation, collagen, and noncollagen extracellular matrix (ECM) production and genes expression were compared among these groups. At days 3, 7 and 10 of cultivation, groups 4 and 5 had significantly more cell numbers and faster cell proliferation rates than groups 1, 2, and 3. At 14 days of cultivation, significantly more cell numbers were observed in groups 3 and 4 than in group 5. The group 4 had the most cell numbers and the fastest proliferation rate at 14 days of cultivation. After normalization for cell numbers, group 5 (two-step) produced the most collagen and noncollagen ECM at 10 and 14 days of cultivation among the five groups. In group 5, ECM gene expression was significantly upregulated. High expression of matrix metalloproteinase-1 was upregulated with FGF-2 on the different days as compared to the other groups. Annulus fibrosus cell phenotypes were only marginally retained under the different protocols based on quantitative polymerase chain reaction results. Taken together, the two-step protocol was the most efficient among these different protocols with the most abundant ECM production after normalization for cell numbers for culture expansion of hAF cells. The protocol may be useful in further cell therapy and tissue engineering approaches for disc regeneration.

  13. Using Green Star Metrics to Optimize the Greenness of Literature Protocols for Syntheses

    ERIC Educational Resources Information Center

    Duarte, Rita C. C.; Ribeiro, M. Gabriela T. C.; Machado, Adélio A. S. C.

    2015-01-01

    A procedure to improve the greenness of a synthesis, without performing laboratory work, using alternative protocols available in the literature is presented. The greenness evaluation involves the separate assessment of the different steps described in the available protocols--reaction, isolation, and purification--as well as the global process,…

  14. Polymer-based microfluidic chips for isothermal amplification of nucleic acids

    NASA Astrophysics Data System (ADS)

    Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

    2017-11-01

    Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

  15. Polymerase chain reaction with phase change as intrinsic thermal control

    NASA Astrophysics Data System (ADS)

    Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

    2013-04-01

    This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

  16. Photochemical reaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen) with basic amino acids and dipeptides.

    PubMed

    Suzuki, Tadashi; Shinoda, Mio; Osanai, Yohei; Isozaki, Tasuku

    2013-08-22

    Photoreaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen, KP) with basic amino acids (histidine, lysine, and arginine) and dipeptides (carnosine and anserine) including a histidine moiety in phosphate buffer solution (pH 7.4) has been investigated with transient absorption spectroscopy. With UV irradiation KP(-) gave rise to a carbanion through a decarboxylation reaction, and the carbanion easily abstracted a proton from the surrounding molecule to yield a 3-ethylbenzophenone ketyl biradical (EBPH). The dipeptides as well as the basic amino acids were found to accelerate the proton transfer reaction whereas alanine and glycine had no effect on the reaction, revealing that these amino acids having a protonated side chain act as a proton donor. The formation quantum yield of EBPH was estimated to be fairly large by means of an actinometrical method with benzophenone, and the bimolecular reaction rate constant for the proton transfer between the carbanion and the protonated basic amino acids or the protonated dipeptides was successfully determined. It has become apparent that the bimolecular reaction rate constant for the proton transfer depended on the acid dissociation constant for the side chain of the amino acids for the first time. This reaction mechanism was interpreted by difference of the heat of reaction for each basic amino acid based on the thermodynamical consideration. These results strongly suggest that the side chain of the basic amino acid residue in protein should play an important role for photochemistry of KP in vivo.

  17. FACTORS AFFECTING THE CHAIN LENGTH OF GROUP A STREPTOCOCCI

    PubMed Central

    Ekstedt, Richard D.; Stollerman, Gene H.

    1960-01-01

    Group A streptococci which grew in long chains in the presence of homologous anti-M antibody were split into their original length by the addition of an excess of homologous M protein to the culture. The chain-splitting reaction showed temperature and pH optima (37°C., 7.5) and was completely inhibited at 0°C. or by heat-killing the long chains at 56°C. prior to the addition of M protein. Addition of sublethal doses of HgCl2, or of penicillin, inhibited the chain-splitting reaction. Pneumococci behaved in entirely comparable fashion to streptococci in similar experiments. Virulent strains of streptococci formed the shortest chains when broth media was enriched with serum. The chain-shortening effect of serum enrichment of the media was most apparent with encapsulated strains and under cultural conditions that favored capsule formation. Loss of capsules by mutation or by unfavorable growth conditions resulted in increase in chain length. The activity of the chain-splitting mechanism seemed to be independent of M protein, however, since encapsulated M-negative variants also formed very short chain in serum-enriched media. The physical presence of the capsule was not essential for chain shortening since enzymatic removal of the capsule with hyaluronidase during growth did not affect chain length. These results strongly suggest that chain-splitting of streptococci and pneumococci occurs by an active metabolic mechanism, presumably enzymatic, which is inhibited by the union of surface antigens with specific antibody. PMID:13726267

  18. Assessing the influence of side-chain and main-chain aromatic benzyltrimethyl ammonium on anion exchange membranes.

    PubMed

    Li, Xiuhua; Nie, Guanghui; Tao, Jinxiong; Wu, Wenjun; Wang, Liuchan; Liao, Shijun

    2014-05-28

    3,3'-Di(4″-methyl-phenyl)-4,4'-difluorodiphenyl sulfone (DMPDFPS), a new monomer with two pendent benzyl groups, was easily prepared by Suzuki coupling reaction in high yield. A series of side-chain type ionomers (PAES-Qs) containing pendant side-chain benzyltrimethylammonium groups, which linked to the backbone by alkaline resisting conjugated C-C bonds, were synthesized via polycondensation, bromination, followed by quaternization and alkalization. To assess the influence of side-chain and main-chain aromatic benzyltrimethylammonium on anion exchange membranes (AEMs), the main-chain type ionomers (MPAES-Qs) with the same backbone were synthesized following the similar procedure. GPC and (1)H NMR results indicate that the bromination shows no reaction selectivity of polymer configurations and ionizations of the side-chain type polymers display higher conversions than that of the main-chain type ones do. These two kinds of AEMs were evaluated in terms of ion exchange capacity (IEC), water uptake, swelling ratio, λ, volumetric ion exchange capacity (IECVwet), hydroxide conductivity, mechanical and thermal properties, and chemical stability, respectively. The side-chain type structure endows AEMs with lower water uptake, swelling ratio and λ, higher IECVwet, much higher hydroxide conductivity, more robust dimensional stability, mechanical and thermal properties, and higher stability in hot alkaline solution. The side-chain type cationic groups containing molecular configurations have the distinction of being practical AEMs and membrane electrode assemblies of AEMFCs.

  19. Rapid Waterborne Pathogen Detection with Mobile Electronics.

    PubMed

    Wu, Tsung-Feng; Chen, Yu-Chen; Wang, Wei-Chung; Kucknoor, Ashwini S; Lin, Che-Jen; Lo, Yu-Hwa; Yao, Chun-Wei; Lian, Ian

    2017-06-09

    Pathogen detection in water samples, without complex and time consuming procedures such as fluorescent-labeling or culture-based incubation, is essential to public safety. We propose an immunoagglutination-based protocol together with the microfluidic device to quantify pathogen levels directly from water samples. Utilizing ubiquitous complementary metal-oxide-semiconductor (CMOS) imagers from mobile electronics, a low-cost and one-step reaction detection protocol is developed to enable field detection for waterborne pathogens. 10 mL of pathogen-containing water samples was processed using the developed protocol including filtration enrichment, immune-reaction detection and imaging processing. The limit of detection of 10 E. coli O157:H7 cells/10 mL has been demonstrated within 10 min of turnaround time. The protocol can readily be integrated into a mobile electronics such as smartphones for rapid and reproducible field detection of waterborne pathogens.

  20. Intact carbohydrate structures as part of the melanoidin skeleton.

    PubMed

    Cämmerer, Bettina; Jalyschko, Walentina; Kroh, Lothar W

    2002-03-27

    Model melanoidins from monomeric, oligomeric, and polymeric carbohydrates, and amino acids formed under aqueous as well as water-free reaction conditions, were submitted to acidic catalyzed hydrolysis. Their degradation products were detected qualitatively and quantitatively by HPTLC and HPLC-DAD. A considerable amount of monomer carbohydrates from hydrolysis of model melanoidins formed under water-free reaction conditions was detected. It can be seen clearly that the amount of carbohydrates released increased with increasing degree of polymerization of the carbohydrates used as starting material. In comparison, the hydrolysis of melanoidins formed in aqueous condition resulted in only a small glucose release. It seems that in the Maillard reaction under water-free conditions, a significant amount of di- and oligomer carbohydrates were incorporated into the melanoidin skeleton as complete oligomer with intact glycosidic bond, forming side chains at the melanoidin skeleton. Additional side chains could be formed by transglycosylation reactions. With increasing water content, hydrothermolytic as well as retro-aldol reactions of the starting carbonyl components became significant, and therefore the possibility of forming side chains decreased. The results are consistent with the postulated melanoidin structure being built up mainly from sugar degradation products, probably branched via amino compounds.

  1. Biodiesel production from triolein and short chain alcohols through biocatalysis.

    PubMed

    Salis, Andrea; Pinna, Marcella; Monduzzi, Maura; Solinas, Vincenzo

    2005-09-29

    Oleic acid alkyl esters (biodiesel) were synthesised by biocatalysis in solvent-free conditions. Different commercial immobilised lipases, namely Candida antarctica B, Rizhomucor miehei, and Pseudomonas cepacia, were tested towards the reaction between triolein and butanol to produce butyl oleate. Pseudomonas cepacia lipase resulted to be the most active enzyme reaching 100% of conversion after 6h. Different operative conditions such as reaction temperature, water activity, and reagent stoichiometric ratio were investigated and optimised. These conditions were then used to investigate the effect of linear and branched short chain alcohols. Methanol and 2-butanol were the worst alcohols: the former, probably, due to its low miscibility with the oil and the latter because secondary alcohols usually are less reactive than primary alcohols. Conversely, linear and branched primary alcohols with short alkyl chains (C(2)--C(4)) showed high reaction rate and conversion. A mixture of linear and branched short chain alcohols that mimics the residual of ethanol distillation (fusel oil) was successfully used for oleic acid ester synthesis. These compounds are important in biodiesel mixtures since they improve low temperature properties.

  2. A SAFE PROTOCOL FOR RAPID DESENSITIZATION IN PATIENTS WITH CYSTIC FIBROSIS AND ANTIBIOTIC HYPERSENSITIVITY

    PubMed Central

    Legere, Henry J.; Palis, Ross I.; Bouza, Tito Rodriguez; Uluer, Ahmet Z.; Castells, Mariana C.

    2009-01-01

    Background CF patients often demonstrate hypersensitivity to one or multiple antibiotics due to frequent and repeated exposures. Attempts at antibiotic desensitization in this population are historically complicated by higher reaction rates, failure to complete the procedure and consequent withholding of first-line therapy. This study evaluates the outcomes of a rapid desensitization protocol developed at our institution. Methods We retrospectively reviewed the medical records of 15 patients undergoing 52 rapid antibiotic desensitizations at Brigham and Women’s Hospital and Children’s Hospital Boston utilizing our protocol. Results Mean FEV1 % predicted was 44.1 (SD 16.5), with two patients at <30% and one patient desensitized during bilateral lung transplantation. Adverse reactions during desensitization occurred in 13.4%, and most were mild. 100% of patients completed the protocol and ultimately tolerated subsequent full-strength antibiotic courses. Conclusions CF patients with antibiotic hypersensitivity can safely receive first-line antibiotics via our rapid desensitization protocol, including those with severe obstructive lung disease. PMID:19740711

  3. An Eco-Friendly Improved Protocol for the Synthesis of Bis(3-indolyl)methanes Using Poly(4-vinylpyridinium)hydrogen Sulfate as Efficient, Heterogeneous, and Recyclable Solid Acid Catalyst

    PubMed Central

    Banothu, Janardhan; Gali, Rajitha; Velpula, Ravibabu; Bavantula, Rajitha; Crooks, Peter A.

    2013-01-01

    Highly efficient and eco-friendly protocol for the synthesis of bis(3-indolyl)methanes by the electrophilic substitution reaction of indole with aldehydes catalyzed by poly(4-vinylpyridinium)hydrogen sulfate was described. Excellent yields, shorter reaction times, simple work-up procedure, avoiding hazardous organic solvents, and reusability of the catalyst are the most obvious advantages of this method. PMID:24052864

  4. Reaction-to-Fire of Wood Products and Other Building Materials: Part 1, Room/Corner Test Performance

    Treesearch

    Ondrej Grexa; Mark A. Dietenberger; Robert H. White

    2012-01-01

    This project researched the assessment of reaction-to-fire of common materials using the full-scale room/corner test (ISO 9705) protocol and the predictions of time to flashover using results from the bench-scale cone calorimeter test (ISO 5660-1). Using a burner protocol of 100 kW for 10 min, followed by 300 kW for 10 min and the test materials on the walls only, we...

  5. 391 Description of Drug Allergy Study Conducted in a Teaching Hospital between October 2007 and March 2011

    PubMed Central

    Rodríguez Martínez, Consuelo Fernanda; Rubio, Alicia Sciaraffia

    2012-01-01

    Background The World Allergy Organization (WAO) in 2003 defined ‘drug allergy’ as an immunologically mediated drug hypersensitivity reaction. The mechanism of drug allergy may be either IgE or non-IgE mediated. The true incidence of drug allergy is not known. There are only few studies/datasets using standardized clinical questionnaires and validated in vivo or in vitro tests to confirm the diagnosis of drug allergy. Here we have analyzed the obtained results of in vivo test in suspected drug allergy patients. Methods Data from the Centre of Allergies of the Clinical Hospital of the Universidad de Chile between the months of October 2007 and March 2011 was obtained. The information of the protocols of drug executed, by defining as Protocol the study of a probable allergy by 2 or more procedures, which can be: Prick Test, intradermal reaction, specific IgE and/or Test Patch. Results For a total of 126 drug protocols, 25% of them were trivírica vaccine, 24% β-lactams, 21% local anaesthetics and 10% to general anesthesia (inductors, muscle relaxants and Latex). Of the total of patients undergoing protocols the most of them were women, there is no clear difference between the number of children and adults. The temporal distribution of protocols was stable between the months of October 2007 and March 2009 (15 protocols/semester), to then become variable, reaching values between 10 and 29 every 6 months. Of total protocols, 30.1% were positive; only one patient presented a mild adverse reaction (local welt). The β-lactams being most often the positive drugs. Protocols involving pethidine 100% was positive, diclofenac 33%, dipyrone, ketoprofen and hydrocortisone each one 25%. The most accomplished protocol was trivírica vaccine, resulting in 100% negative. Of all negative protocols 58% went to provocation, resulting in a 8% positive, including one provocation to the trívirica vaccine. Conclusions Methodologicall study is very important for a possible drug allergy, because history is not enough to certify the diagnosis. To do a provocation test to a negative protocol is crucial.

  6. METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM

    DOEpatents

    Fermi, E.; Leverett, M.C.

    1957-11-12

    This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.

  7. Computational analysis of stochastic heterogeneity in PCR amplification efficiency revealed by single molecule barcoding

    PubMed Central

    Best, Katharine; Oakes, Theres; Heather, James M.; Shawe-Taylor, John; Chain, Benny

    2015-01-01

    The polymerase chain reaction (PCR) is one of the most widely used techniques in molecular biology. In combination with High Throughput Sequencing (HTS), PCR is widely used to quantify transcript abundance for RNA-seq, and in the context of analysis of T and B cell receptor repertoires. In this study, we combine DNA barcoding with HTS to quantify PCR output from individual target molecules. We develop computational tools that simulate both the PCR branching process itself, and the subsequent subsampling which typically occurs during HTS sequencing. We explore the influence of different types of heterogeneity on sequencing output, and compare them to experimental results where the efficiency of amplification is measured by barcodes uniquely identifying each molecule of starting template. Our results demonstrate that the PCR process introduces substantial amplification heterogeneity, independent of primer sequence and bulk experimental conditions. This heterogeneity can be attributed both to inherited differences between different template DNA molecules, and the inherent stochasticity of the PCR process. The results demonstrate that PCR heterogeneity arises even when reaction and substrate conditions are kept as constant as possible, and therefore single molecule barcoding is essential in order to derive reproducible quantitative results from any protocol combining PCR with HTS. PMID:26459131

  8. Enzymatic monoesterification of symmetric diols: restriction of molecular conformations influences selectivity.

    PubMed

    Tomer, Sanjiv O; Soni, Hemant P

    2017-10-31

    We have experimentally demonstrated that by 'locking' the molecular conformation through the introduction of a double or triple bond in the center of a symmetric diol, enzymatic monoesterification can be achieved selectively. The enzyme Candida antarctica lipase B, generally used for the transesterification of diols, can be effectively used for the monoesterification of symmetrical diols in an unbuffered system also. By varying the chain length of a carboxylic acid moiety, we have established that optimum selectivity and efficiency can be achieved in the range of 4.8 to 5.0 pK a values. Selectivity can be improved up to 98.75% for a monoester in an overall 73% yield (mixture of a monoester and a diester) when but-2-yne-1,4-diol reacted with hexanoic acid. Water, a by-product, provides an interfacial environment for the enzyme to work in the organic reaction medium. The uniqueness of the reported monoesterification protocol is that it involves only the mechanical stirring of the reaction mixture at room temperature in the presence of the enzyme for 24 h. High percentage yield with selectivity for a monoester, easier product isolation and overall, environmental sustainability are added advantages. The synthesized monoesters are characterized by using HNMR and high resolution mass spectrometry (HRMS).

  9. Development of crossbreeding high-yield-potential strains for commercial cultivation in the medicinal mushroom Wolfiporia cocos (Higher Basidiomycetes).

    PubMed

    Xiang, Xiaozhao; Wang, Xiaoxia; Bian, Yinbing; Xu, Zhangyi

    2016-07-01

    Wolfiporia cocos is a well-known medicinal mushroom, and its dried sclerotia has been widely used as a traditional medicine in China, Japan, and other Asian countries for centuries. However, long-term asexual reproduction of the breeding system in W. cocos results in a current universal degeneration of cultivated strains. To develop a W. cocos breeding program that will benefit commercial cultivation, we previously developed an optimum method for indoor induction of W. cocos fruiting bodies and clarified the nature of preponderant binuclear sexual basidiospores. In this paper, we first show that the majority of W. cocos single-spore isolates cannot form sclerotium in field cultivation. We then investigated the possibility of breeding new strains by crossbreeding. Three types of mating reactions were observed in both intra-strain pairings and inter-strain pairings, and a total of fifty-five hybrids were selected by antagonistic testing and allele-specific polymerase chain reaction (PCR). Field cultivation of hybrids demonstrated that some hybrids can form sclerotium via two cultivated methods. Two new high-yield strains were identified. This report will stimulate new thinking on W. cocos and promote further extensive studies on crossbreeding in W. cocos, a new topic related to the development of more efficient protocols for the discrimination of hybrids in W. cocos.

  10. Rapid detection and quantification of Ebola Zaire virus by one-step real-time quantitative reverse transcription-polymerase chain reaction.

    PubMed

    Ro, Young-Tae; Ticer, Anysha; Carrion, Ricardo; Patterson, Jean L

    2017-04-01

    Given that Ebola virus causes severe hemorrhagic fever in humans with mortality rates as high as 90%, rapid and accurate detection of this virus is essential both for controlling infection and preventing further transmission. Here, a one-step qRT-PCR assay for rapid and quantitative detection of an Ebola Zaire strain using GP, VP24 or VP40 genes as a target is introduced. Routine assay conditions for hydrolysis probe detection were established from the manufacturer's protocol used in the assays. The analytical specificity and sensitivity of each assay was evaluated using in vitro synthesized viral RNA transcripts. The assays were highly specific for the RNA transcripts, no cross-reactivity being observed among them. The limits of detection of the assays ranged from 10 2 to 10 3 copies per reaction. The assays were also evaluated using viral RNAs extracted from cell culture-propagated viruses (Ebola Zaire, Sudan and Reston strains), confirming that they are gene- and strain-specific. The RT-PCR assays detected viral RNAs in blood samples from virus-infected animal, suggesting that they can be also a useful method for identifying Ebola virus in clinical samples. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  11. Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

    NASA Technical Reports Server (NTRS)

    Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

    1998-01-01

    Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

  12. Maillard reaction versus other nonenzymatic modifications in neurodegenerative processes.

    PubMed

    Pamplona, Reinald; Ilieva, Ekaterina; Ayala, Victoria; Bellmunt, Maria Josep; Cacabelos, Daniel; Dalfo, Esther; Ferrer, Isidre; Portero-Otin, Manuel

    2008-04-01

    Nonenzymatic protein modifications are generated from direct oxidation of amino acid side chains and from reaction of the nucleophilic side chains of specific amino acids with reactive carbonyl species. These reactions give rise to specific markers that have been analyzed in different neurodegenerative diseases sharing protein aggregation, such as Alzheimer's disease, Pick's disease, Parkinson's disease, dementia with Lewy bodies, Creutzfeldt-Jakob disease, and amyotrophic lateral sclerosis. Collectively, available data demonstrate that oxidative stress homeostasis, mitochondrial function, and energy metabolism are key factors in determining the disease-specific pattern of protein molecular damage. In addition, these findings suggest the lack of a "gold marker of oxidative stress," and, consequently, they strengthen the need for a molecular dissection of the nonenzymatic reactions underlying neurodegenerative processes.

  13. Intramolecular Benzoin Reaction Catalyzed by Benzaldehyde Lyase from Pseudomonas Fluorescens Biovar I.

    PubMed

    Hernández, Karel; Parella, Teodor; Petrillo, Giovanna; Usón, Isabel; Wandtke, Claudia M; Joglar, Jesús; Bujons, Jordi; Clapés, Pere

    2017-05-02

    Intramolecular benzoin reactions catalyzed by benzaldehyde lyase from Pseudomonas fluorescens biovar I (BAL) are reported. The structure of the substrates envisaged for this reaction consists of two benzaldehyde derivatives linked by an alkyl chain. The structural requirements needed to achieve the intramolecular carbon-carbon bond reaction catalyzed by BAL were established. Thus, a linker consisting of a linear alkyl chain of three carbon atoms connected through ether-type bonds to the 2 and 2' positions of two benzaldehyde moieties, which could be substituted with either Cl, Br, or OCH 3 at either the 3 and 3' or 5 and 5' positions, were suitable substrates for BAL. Reactions with 61-84 % yields of the intramolecular product and ee values between 64 and 98 %, were achieved. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

    PubMed

    Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

    2013-08-01

    Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

    PubMed

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

    2014-03-01

    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

  16. Preemptive Isolation Precautions of Patients at High Risk for Methicillin-Resistant Staphylococcus aureus in Combination With Ultrarapid Polymerase Chain Reaction Screening as an Effective Tool for Infection Control.

    PubMed

    Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael

    2016-12-01

    This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.

  17. Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

    PubMed Central

    Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

    2006-01-01

    Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

  18. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    PubMed

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.

  19. Synthesis of Side-Chain Oxysterols and their Enantiomers through Cross-Metathesis Reactions of Δ22 Steroids

    PubMed Central

    Brownholland, David P.

    2017-01-01

    A synthetic route that utilizes a cross-metathesis reaction with Δ22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. PMID:28300584

  20. Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

    PubMed

    Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

    2018-04-25

    In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

  1. METHOD OF OPERATING NUCLEAR REACTORS

    DOEpatents

    Untermyer, S.

    1958-10-14

    A method is presented for obtaining enhanced utilization of natural uranium in heavy water moderated nuclear reactors by charging the reactor with an equal number of fuel elements formed of natural uranium and of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction. The reactor is operated until the rate of burnup of plutonium equals its rate of production, the fuel elements are processed to recover plutonium, the depleted uranium is discarded, and the remaining uranium is formed into fuel elements. These fuel elements are charged into a reactor along with an equal number of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction, and reuse of the uranium is continued as aforesaid until it wlll no longer support a chain reaction when combined with an equal quantity of natural uranium.

  2. Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

    PubMed

    Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

    1997-09-01

    In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

  3. Analysis of self-oscillating behaviors aimed at the development of a molecular robot with organic acids as fuel

    NASA Astrophysics Data System (ADS)

    Nakazumi, Tomoka; Hara, Yusuke

    2017-09-01

    We studied the transmittance self-oscillation of a polymer chain driven by an organic acid as the fuel. The self-oscillating polymer chain consists of 4-acryloylmorpholine (ACMO) and the Ru catalyst (Ru(bpy)3) of the Belousov-Zhabotinsky (BZ) reaction. The transmittance self-oscillating behavior was affected significantly by the temperature. As the amplitude of the transmittance self-oscillation, which is reflected by the aggregation state, decreased with time, the oscillation period also decreased. This trend indicates that the polymer aggregation affects the rate of the BZ reaction significantly. The activation energy of the self-oscillating value was almost the same in the normal BZ reaction, which does not include Ru(bpy)3 complexes in the polymer chains. In addition, we demonstrated the effect of one BZ substrate (sodium bromate or malonic acid) on the transmittance self-oscillation period.

  4. Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

    PubMed

    Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

    2001-03-01

    A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

  5. Initiator and Photocatalyst-Free Visible Light Induced One-Pot Reaction: Concurrent RAFT Polymerization and CuAAC Click Reaction.

    PubMed

    Wang, Jie; Wang, Xinbo; Xue, Wentao; Chen, Gaojian; Zhang, Weidong; Zhu, Xiulin

    2016-05-01

    A new, visible light-catalyzed, one-pot and one-step reaction is successfully employed to design well-controlled side-chain functionalized polymers, by the combination of ambient temperature revisible addtion-fragmentation chain transfer (RAFT) polymerization and click chemistry. Polymerizations are well controlled in a living way under the irradiation of visible light-emitting diode (LED) light without photocatalyst and initiator, using the trithiocarbonate agent as iniferter (initiator-transfer agent-terminator) agent at ambient temperature. Fourier transfer infrared spectroscopy (FT-IR), NMR, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) data confirm the successful one-pot reaction. Compared to the reported zero-valent metal-catalyzed one-pot reaction, the polymerization rate is much faster than that of the click reaction, and the visible light-catalyzed one-pot reaction can be freely and easily regulated by turning on and off the light. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Frequency and severity of reactions to a 325-mg aspirin dose during desensitization.

    PubMed

    Schuler, Charles F; Baldwin, James L; Baptist, Alan P

    2017-03-01

    The frequency with which patients with aspirin-exacerbated respiratory disease (AERD) react to 325 mg of aspirin during aspirin desensitization, or fail to react at all, is not fully known. To determine the rate and type of reaction at 325 mg of aspirin during desensitization. A retrospective study of 104 patients who underwent aspirin desensitization from 2010 to 2016 was performed. A standard desensitization protocol (starting at 20-40 mg, progressing through 325 mg, and extinguishing reactions by dose repetition) was used. Reactions were defined by upper respiratory tract symptoms, lower respiratory tract symptoms, and/or forced expiratory volume in 1 second decrease of 15% or greater. Patients who did and did not react were compared by logistic regression. Eighty-four patients reacted (81%) and 20 did not (19%). Seventy-seven patients who had a provoking reaction at 162 mg of aspirin or less subsequently extinguished their reactions before they reached a dose of 325 mg and had no problems at that dose; one subsequent 325-mg reaction occurred during a protocol violation. One initial provoking reaction to 325 mg occurred. Both 325-mg reactions were mild, and neither met the forced expiratory volume in 1 second criterion for a clinically meaningful change. The remaining 5 patients could not complete the protocol because of persistent reactions or social reasons. Reactors were more likely to have had asthma for more than 10 years than nonreactors (odds ratio, 3.2; 95% confidence interval, 1.0-10.3; P = .05). During aspirin desensitization for AERD, provoking reactions at the 325-mg dose are rare (1%) and mild. Patients who react at 162 mg or less and extinguish their reactions may be able to administer the 325-mg dose at home. Copyright © 2016 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  7. Transport of spin qubits with donor chains under realistic experimental conditions

    NASA Astrophysics Data System (ADS)

    Mohiyaddin, Fahd A.; Kalra, Rachpon; Laucht, Arne; Rahman, Rajib; Klimeck, Gerhard; Morello, Andrea

    2016-07-01

    The ability to transport quantum information across some distance can facilitate the design and operation of a quantum processor. One-dimensional spin chains provide a compact platform to realize scalable spin transport for a solid-state quantum computer. Here, we model odd-sized donor chains in silicon under a range of experimental nonidealities, including variability of donor position within the chain. We show that the tolerance against donor placement inaccuracies is greatly improved by operating the spin chain in a mode where the electrons are confined at the Si-SiO2 interface. We then estimate the required time scales and exchange couplings, and the level of noise that can be tolerated to achieve high-fidelity transport. We also propose a protocol to calibrate and initialize the chain, thereby providing a complete guideline for realizing a functional donor chain and utilizing it for spin transport.

  8. Transport of spin qubits with donor chains under realistic experimental conditions

    DOE PAGES

    Mohiyaddin, Fahd A.; Kalra, Rachpon; Laucht, Arne; ...

    2016-07-25

    The ability to transport quantum information across some distance can facilitate the design and operation of a quantum processor. One-dimensional spin chains provide a compact platform to realize scalable spin transport for a solid-state quantum computer. Here, we model odd-sized donor chains in silicon under a range of experimental nonidealities, including variability of donor position within the chain. We show that the tolerance against donor placement inaccuracies is greatly improved by operating the spin chain in a mode where the electrons are confined at the Si-SiO 2 interface. We then estimate the required time scales and exchange couplings, and themore » level of noise that can be tolerated to achieve high-fidelity transport. As a result, we also propose a protocol to calibrate and initialize the chain, thereby providing a complete guideline for realizing a functional donor chain and utilizing it for spin transport.« less

  9. Copper(I)/TEMPO Catalyzed Aerobic Oxidation of Primary Alcohols to Aldehydes with Ambient Air

    PubMed Central

    Hoover, Jessica M.; Steves, Janelle E.; Stahl, Shannon S.

    2012-01-01

    This protocol describes a practical laboratory-scale method for aerobic oxidation of primary alcohols to aldehydes, using a chemoselective CuI/TEMPO catalyst system. The catalyst is prepared in situ from commercially available reagents, and the reactions are performed in a common organic solvent (acetonitrile) with ambient air as the oxidant. Three different reaction conditions and three procedures for the isolation and purification of the aldehyde product are presented. The oxidations of eight different alcohols, described here, include representative examples of each reaction condition and purification method. Reaction times vary from 20 min to 24 h, depending on the alcohol, while the purification methods each take about 2 h. The total time necessary for the complete protocol ranges from 3 – 26 h. PMID:22635108

  10. Storing self-contained gel capillary cassettes for POC medical diagnostics.

    PubMed

    Manage, Dammika P; Lauzon, Jana; Zahariadis, George; Pilarski, Linda M

    2013-10-21

    For effective clinical uptake of the lab on a chip/point of care technology (LOC-POC), in addition to cost advantages LOC-POC devices should offer multiple patient screening panels for related diseases as well as cold-chain transportation and storage abilities. We recently described a device that performs polymerase chain reaction (PCR) to simultaneously screen raw clinical samples from up to 16 patients for multiple infectious agents (Manage et al., Lab Chip, 2013, 13, 2576-2584). This cassette contains glass capillaries with desiccated semi-solid acrylamide gels that include all the reagents except for the sample, with integrated quality control. Here we report the development of protocols to store assembled PCR cassettes at room temperature, 4 °C or -20 °C as well as at +40 °C. We show that our cassettes are stable, with no loss of activity for at least 3 months at RT and at least 7 months at 4 °C and -20 °C. However, the activity of desiccated cassettes degrades when stored for more than 2 weeks at 40 °C, insufficient time for post-manufacture delivery and use of cassette PCR. To address this, we have evaluated two stage storage protocols. PCR cassettes can initially be stored at 4 °C and -20 °C for prolonged periods of time and removed for shorter term storage at RT, retaining activity for at least a month, which would facilitate transport to remote areas for testing. Effective use of cassette PCR in high temperature regions of the world, for experimental purposes defined here as 40 °C, appears to be feasible only after a first stage storage in the cold, followed by no more than 1 week at 40 °C. This should allow sufficient time for delivery by the manufacturer to a central area well served by power and refrigeration, for later ambient temperature transport and use in under-resourced areas that lack refrigeration.

  11. Comparison of test protocols for standard room/corner tests

    Treesearch

    R. H. White; M. A. Dietenberger; H. Tran; O. Grexa; L. Richardson; K. Sumathipala; M. Janssens

    1998-01-01

    As part of international efforts to evaluate alternative reaction-to-fire tests, several series of room/comer tests have been conducted. This paper reviews the overall results of related projects in which different test protocols for standard room/corner tests were used. Differences in the test protocols involved two options for the ignition burner scenario and whether...

  12. T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

    PubMed

    Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

    2012-01-01

    Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

  13. Chain photoreduction of CCl3F in TiO2 suspensions: enhancement induced by O2.

    PubMed

    Winkelmann, Kurt; Calhoun, Robert L; Mills, German

    2006-12-28

    Trichlorofluoromethane (CFC 11) was photoreduced in aqueous suspensions of TiO2 particles containing HCO2- ions and air. Dissolved O2 inhibited the reaction during an induction period that preceded the rapid formation of chloride ions. Reaction rates were higher in systems containing O2 as compared to analogous reactions that occurred in anaerobic suspensions. High photonic efficiencies of Cl- formation (> or =15) were achieved using suspensions with pH > or = 5. As was the case for studies with air-free suspensions, reactions are best described using a photoinitiated chain mechanism that produced CHCl2F and Cl- during the propagation steps. The enhanced yields obtained in the presence of air are attributed to the removal by O2 of electrons trapped in the oxide, which are converted first into H2O2 and then into reducing radicals that participate in the chain process. Enhanced yields of Freon photoreduction were also observed during illumination of air-free suspensions containing hydrogen peroxide, which were interpreted using a similar mechanism.

  14. Tested Demonstrations.

    ERIC Educational Resources Information Center

    Gilbert, George L., Ed.

    1983-01-01

    Free radical chlorination of methane is used in organic chemistry to introduce free radical/chain reactions. In spite of its common occurrence, demonstrations of the reaction are uncommon. Therefore, such a demonstration is provided, including background information, preparation of reactants/reaction vessel, introduction of reactants, irradiation,…

  15. Efficient sampling of reversible cross-linking polymers: Self-assembly of single-chain polymeric nanoparticles

    NASA Astrophysics Data System (ADS)

    Oyarzún, Bernardo; Mognetti, Bortolo Matteo

    2018-03-01

    We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.

  16. Allergic reactions to iodinated contrast media: premedication considerations for patients at risk.

    PubMed

    Schopp, Jennifer G; Iyer, Ramesh S; Wang, Carolyn L; Petscavage, Jonelle M; Paladin, Angelisa M; Bush, William H; Dighe, Manjiri K

    2013-08-01

    The objectives of this article are to review allergy-type reactions to iodinated contrast media and the protocols utilized to prevent or reduce the occurrence of these adverse reactions in high-risk patients. We will begin by discussing the types or classifications of the adverse reactions to iodinated contrast media. We will then discuss reaction mechanisms, identify the patients at highest risk for adverse reactions, and clarify common misperceptions about the risk. Finally, we will discuss the actions of the medications used to help reduce or prevent allergy-type reactions to iodinated contrast media, the protocols used to help reduce or prevent contrast reactions in high-risk patients, and the potential side effects of these medications. We will also discuss the high-risk patient who has received premedication due to a prior index reaction and discuss the risk of having a subsequent reaction, termed "breakthrough reaction." Identifying patient at high risk for an "allergy-type" reaction to contrast media is an essential task of the radiologist. Prevention of or reduction of the risk of an adverse reaction is critical to patient safety. If an examination can be performed without contrast in a patient at high risk for an allergy-type reaction, it may be appropriate to avoid contrast. However, there are situations where contrast media is necessary, and the radiologist plays a vital role in preventing or mitigating an allergy-type reaction.

  17. Template-free modeling by LEE and LEER in CASP11.

    PubMed

    Joung, InSuk; Lee, Sun Young; Cheng, Qianyi; Kim, Jong Yun; Joo, Keehyoung; Lee, Sung Jong; Lee, Jooyoung

    2016-09-01

    For the template-free modeling of human targets of CASP11, we utilized two of our modeling protocols, LEE and LEER. The LEE protocol took CASP11-released server models as the input and used some of them as templates for 3D (three-dimensional) modeling. The template selection procedure was based on the clustering of the server models aided by a community detection method of a server-model network. Restraining energy terms generated from the selected templates together with physical and statistical energy terms were used to build 3D models. Side-chains of the 3D models were rebuilt using target-specific consensus side-chain library along with the SCWRL4 rotamer library, which completed the LEE protocol. The first success factor of the LEE protocol was due to efficient server model screening. The average backbone accuracy of selected server models was similar to that of top 30% server models. The second factor was that a proper energy function along with our optimization method guided us, so that we successfully generated better quality models than the input template models. In 10 out of 24 cases, better backbone structures than the best of input template structures were generated. LEE models were further refined by performing restrained molecular dynamics simulations to generate LEER models. CASP11 results indicate that LEE models were better than the average template models in terms of both backbone structures and side-chain orientations. LEER models were of improved physical realism and stereo-chemistry compared to LEE models, and they were comparable to LEE models in the backbone accuracy. Proteins 2016; 84(Suppl 1):118-130. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  18. Tetrabutylammonium Iodide-Promoted Thiolation of Oxindoles Using Sulfonyl Chlorides as Sulfenylation Reagents.

    PubMed

    Zhao, Xia; Wei, Aoqi; Lu, Xiaoyu; Lu, Kui

    2017-08-01

    3-Sulfanyloxindoles were synthesised by triphenylphosphine-mediated transition-metal-free thiolation of oxindoles using sulfonyl chlorides as sulfenylation reagents. The above reaction was promoted by iodide anions, which was ascribed to the in situ conversion of sulfenyl chlorides into the more reactive sulfenyl iodides. Moreover, the thiolation of 3-aryloxindoles was facilitated by bases. The use of a transition-metal-free protocol, readily available reagents, and mild reaction conditions make this protocol more practical for preparing 3-sulfanyloxindoles than traditional methods.

  19. Separation of endogenous viral elements from infectious Penaeus stylirostris densovirus using recombinase polymerase amplification.

    PubMed

    Jaroenram, Wansadaj; Owens, Leigh

    2014-01-01

    Non-infectious Penaeus stylirostris densovirus (PstDV)-related sequences in the shrimp genome cause false positive results with current PCR protocols. Here, we examined and mapped PstDV insertion profile in the genome of Australian Penaeus monodon. A DNA sequence which is likely to represent infectious PstDV was also identified and used as a target sequence for recombinase polymerase amplification (RPA)-based approach, developed for specifically detecting PstDV. The RPA protocol at 37 °C for 30 min showed no cross-reaction with other shrimp viruses, and was 10 times more sensitive than the 309F/R PCR protocol currently recommended by the World Organization for Animal Health (OIE) for PstDV diagnosis. These features, together with the simplicity of the protocol, requiring only a heating block for the reaction, offer opportunities for rapid and efficient detection of PstDV. Copyright © 2014 Elsevier Ltd. All rights reserved.

  20. Blood cell mRNAs and microRNAs: optimized protocols for extraction and preservation.

    PubMed

    Eikmans, Michael; Rekers, Niels V; Anholts, Jacqueline D H; Heidt, Sebastiaan; Claas, Frans H J

    2013-03-14

    Assessing messenger RNA (mRNA) and microRNA levels in peripheral blood cells may complement conventional parameters in clinical practice. Working with small, precious samples requires optimal RNA yields and minimal RNA degradation. Several procedures for RNA extraction and complementary DNA (cDNA) synthesis were compared for their efficiency. The effect on RNA quality of freeze-thawing peripheral blood cells and storage in preserving reagents was investigated. In terms of RNA yield and convenience, quality quantitative polymerase chain reaction signals per nanogram of total RNA and using NucleoSpin and mirVana columns is preferable. The SuperScript III protocol results in the highest cDNA yields. During conventional procedures of storing peripheral blood cells at -180°C and thawing them thereafter, RNA integrity is maintained. TRIzol preserves RNA in cells stored at -20°C. Detection of mRNA levels significantly decreases in degraded RNA samples, whereas microRNA molecules remain relatively stable. When standardized to reference targets, mRNA transcripts and microRNAs can be reliably quantified in moderately degraded (quality index 4-7) and severely degraded (quality index <4) RNA samples, respectively. We describe a strategy for obtaining high-quality and quantity RNA from fresh and stored cells from blood. The results serve as a guideline for sensitive mRNA and microRNA expression assessment in clinical material.

  1. Clones identification of Sequoia sempervirens (D. Don) Endl. in Chile by using PCR-RAPDs technique.

    PubMed

    Toral Ibañez, Manuel; Caru, Margarita; Herrera, Miguel A; Gonzalez, Luis; Martin, Luis M; Miranda, Jorge; Navarro-Cerrillo, Rafael M

    2009-02-01

    A protocol of polymerase chain reaction-random amplified polymorphic DNAs (PCR-RAPDs) was established to analyse the gene diversity and genotype identification for clones of Sequoia sempervirens (D. Don) Endl. in Chile. Ten (out of 34) clones from introduction trial located in Voipir-Villarrica, Chile, were studied. The PCR-RAPDs technique and a modified hexadecyltrimethylammonium bromide (CTAB) protocol were used for genomic DNA extraction. The PCR tests were carried out employing 10-mer random primers. The amplification products were detected by electrophoresis in agarose gels. Forty nine polymorphic bands were obtained with the selected primers (BG04, BF07, BF12, BF13, and BF14) and were ordered according to their molecular size. The genetic similarity between samples was calculated by the Jaccard index and a dendrogram was constructed using a cluster analysis of unweighted pair group method using arithmetic averages (UPGMA). Of the primers tested, 5 (out of 60) RAPD primers were selected for their reproducibility and high polymorphism. A total of 49 polymorphic RAPD bands were detected out of 252 bands. The genetic similarity analysis demonstrates an extensive genetic variability between the tested clones and the dendrogram depicts the genetic relationships among the clones, suggesting a geographic relationship. The results indicate that the RAPD markers permitted the identification of the assayed clones, although they are derived from the same geographic origin.

  2. Clones identification of Sequoia sempervirens (D. Don) Endl. in Chile by using PCR-RAPDs technique*

    PubMed Central

    Toral Ibañez, Manuel; Caru, Margarita; Herrera, Miguel A.; Gonzalez, Luis; Martin, Luis M.; Miranda, Jorge; Navarro-Cerrillo, Rafael M.

    2009-01-01

    A protocol of polymerase chain reaction-random amplified polymorphic DNAs (PCR-RAPDs) was established to analyse the gene diversity and genotype identification for clones of Sequoia sempervirens (D. Don) Endl. in Chile. Ten (out of 34) clones from introduction trial located in Voipir-Villarrica, Chile, were studied. The PCR-RAPDs technique and a modified hexadecyltrimethylammonium bromide (CTAB) protocol were used for genomic DNA extraction. The PCR tests were carried out employing 10-mer random primers. The amplification products were detected by electrophoresis in agarose gels. Forty nine polymorphic bands were obtained with the selected primers (BG04, BF07, BF12, BF13, and BF14) and were ordered according to their molecular size. The genetic similarity between samples was calculated by the Jaccard index and a dendrogram was constructed using a cluster analysis of unweighted pair group method using arithmetic averages (UPGMA). Of the primers tested, 5 (out of 60) RAPD primers were selected for their reproducibility and high polymorphism. A total of 49 polymorphic RAPD bands were detected out of 252 bands. The genetic similarity analysis demonstrates an extensive genetic variability between the tested clones and the dendrogram depicts the genetic relationships among the clones, suggesting a geographic relationship. The results indicate that the RAPD markers permitted the identification of the assayed clones, although they are derived from the same geographic origin. PMID:19235269

  3. Methods for the extraction and RNA profiling of exosomes

    PubMed Central

    Zeringer, Emily; Li, Mu; Barta, Tim; Schageman, Jeoffrey; Pedersen, Ketil Winther; Neurauter, Axl; Magdaleno, Susan; Setterquist, Robert; Vlassov, Alexander V

    2013-01-01

    AIM: To develop protocols for isolation of exosomes and characterization of their RNA content. METHODS: Exosomes were extracted from HeLa cell culture media and human blood serum using the Total exosome isolation (from cell culture media) reagent, and Total exosome isolation (from serum) reagent respectively. Identity and purity of the exosomes was confirmed by Nanosight® analysis, electron microscopy, and Western blots for CD63 marker. Exosomal RNA cargo was recovered with the Total exosome RNA and protein isolation kit. Finally, RNA was profiled using Bioanalyzer and quantitative reverse transcription-polymerase chain reaction (qRT-PCR) methodology. RESULTS: Here we describe a novel approach for robust and scalable isolation of exosomes from cell culture media and serum, with subsequent isolation and analysis of RNA residing within these vesicles. The isolation procedure is completed in a fraction of the time, compared to the current standard protocols utilizing ultracentrifugation, and allows to recover fully intact exosomes in higher yields. Exosomes were found to contain a very diverse RNA cargo, primarily short sequences 20-200 nt (such as miRNA and fragments of mRNA), however longer RNA species were detected as well, including full-length 18S and 28S rRNA. CONCLUSION: We have successfully developed a set of reagents and a workflow allowing fast and efficient extraction of exosomes, followed by isolation of RNA and its analysis by qRT-PCR and other techniques. PMID:25237619

  4. Development of real-time PCR methods to quantify patulin-producing molds in food products.

    PubMed

    Rodríguez, Alicia; Luque, M Isabel; Andrade, María J; Rodríguez, Mar; Asensio, Miguel A; Córdoba, Juan J

    2011-09-01

    Patulin is a mycotoxin produced by different Penicillium and Aspergillus strains isolated from food products. To improve food safety, the presence of patulin-producing molds in foods should be quantified. In the present work, two real-time (RTi) PCR protocols based on SYBR Green and TaqMan were developed. Thirty four patulin producers and 28 non-producers strains belonging to different species usually reported in food products were used. The patulin production was tested by mycellar electrokinetic capillary electrophoresis (MECE) and high-pressure liquid chromatography-mass spectrometry (HPLC-MS). A primer pair F-idhtrb/R-idhtrb and the probe IDHprobe were designed from the isoepoxydon dehydrogenase (idh) gene, involved in patulin biosynthesis. The functionality of the developed method was demonstrated by the high linear relationship of the standard curves constructed with the idh gene copy number and Ct values for the different patulin producers tested. The ability to quantify patulin producers of the developed SYBR Green and TaqMan assays in artificially inoculated food samples was successful, with a minimum threshold of 10 conidia g(-1) per reaction. The developed methods quantified with high efficiency fungal load in foods. These RTi-PCR protocols, are proposed to be used to quantify patulin-producing molds in food products and to prevent patulin from entering the food chain. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. A site-directed mutagenesis method particularly useful for creating otherwise difficult-to-make mutants and alanine scanning.

    PubMed

    Wan, Haisu; Li, Yongwen; Fan, Yu; Meng, Fanrong; Chen, Chen; Zhou, Qinghua

    2012-01-15

    Site-directed mutagenesis has become routine in molecular biology. However, many mutants can still be very difficult to create. Complicated chimerical mutations, tandem repeats, inverted sequences, GC-rich regions, and/or heavy secondary structures can cause inefficient or incorrect binding of the mutagenic primer to the target sequence and affect the subsequent amplification. In theory, these problems can be avoided by introducing the mutations into the target sequence using mutagenic fragments and so removing the need for primer-template annealing. The cassette mutagenesis uses the mutagenic fragment in its protocol; however, in most cases it needs to perform two rounds of mutagenic primer-based mutagenesis to introduce suitable restriction enzyme sites into templates and is not suitable for routine mutagenesis. Here we describe a highly efficient method in which the template except the region to be mutated is amplified by polymerase chain reaction (PCR) and the type IIs restriction enzyme-digested PCR product is directly ligated with the mutagenic fragment. Our method requires no assistance of mutagenic primers. We have used this method to create various types of difficult-to-make mutants with mutagenic frequencies of nearly 100%. Our protocol has many advantages over the prevalent QuikChange method and is a valuable tool for studies on gene structure and function. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. A Novel In Vivo Protocol for Molecular Study of Radiation-Induced Fibrosis in Head and Neck Cancer Patients.

    PubMed

    Krisciunas, Gintas P; Platt, Michael; Trojanowska, Maria; Grillone, Gregory A; Haines, Paul C; Langmore, Susan E

    2016-03-01

    Radiation-induced fibrosis is a common complication for patients following head and neck cancer treatment. This study presents a novel minimally invasive protocol for molecular study of fibrosis in the stromal tissues. Subjects with radiation-induced fibrosis in the head and neck who were at least 6 months post treatment received submental core needle biopsies, followed by molecular processing and quantification of gene expression for 14 select pro-inflammatory and pro-fibrotic genes. Control biopsies from the upper arm were obtained from the same subjects. Patients were followed up at 1 and 2 weeks to monitor for safety and adverse outcomes. Six subjects were enrolled and completed the study. No subjects experienced adverse outcomes or complication. An 18 gauge core biopsy needle with a 10 mm notch inserted for up to 60 seconds was needed. Subcutaneous tissue yielded 3 ng of RNA, amplified to 6 µg of cDNA, allowing for adequately sensitive quantitative polymerase chain reaction (qPCR) analysis of approximately 28 genes. This study demonstrates the safety and utility of a novel technique for the molecular study of fibrosis in head and neck cancer patients. Longitudinal studies of patients undergoing radiation therapy will allow for identification of molecular targets that contribute to the process of fibrosis in the head and neck. © The Author(s) 2015.

  7. Protocol Improvements for Low Concentration DNA-Based Bioaerosol Sampling and Analysis

    PubMed Central

    Ng, Chun Kiat; Miller, Dana; Cao, Bin

    2015-01-01

    Introduction As bioaerosol research attracts increasing attention, there is a need for additional efforts that focus on method development to deal with different environmental samples. Bioaerosol environmental samples typically have very low biomass concentrations in the air, which often leaves researchers with limited options in choosing the downstream analysis steps, especially when culture-independent methods are intended. Objectives This study investigates the impacts of three important factors that can influence the performance of culture-independent DNA-based analysis in dealing with bioaerosol environmental samples engaged in this study. The factors are: 1) enhanced high temperature sonication during DNA extraction; 2) effect of sampling duration on DNA recoverability; and 3) an alternative method for concentrating composite samples. In this study, DNA extracted from samples was analysed using the Qubit fluorometer (for direct total DNA measurement) and quantitative polymerase chain reaction (qPCR). Results and Findings The findings suggest that additional lysis from high temperature sonication is crucial: DNA yields from both high and low biomass samples increased up to 600% when the protocol included 30-min sonication at 65°C. Long air sampling duration on a filter media was shown to have a negative impact on DNA recoverability with up to 98% of DNA lost over a 20-h sampling period. Pooling DNA from separate samples during extraction was proven to be feasible with margins of error below 30%. PMID:26619279

  8. Development of molecular techniques for detection of lymphocystis disease virus in different marine fish species.

    PubMed

    Cano, I; Ferro, P; Alonso, M C; Bergmann, S M; Römer-Oberdörfer, A; Garcia-Rosado, E; Castro, D; Borrego, J J

    2007-01-01

    The development and evaluation of a protocol based on polymerase chain reaction (PCR) and nucleic acid hybridization techniques for the specific detection of lymphocystis disease virus (LCDV) in several marine fish species. The pair of primers for PCR, OBL3 and OBL4, was designed based on published nucleotide sequence (LCDV-1) and amplifies a fragment within the major capsid protein. The sensitivity was evaluated using DNA from purified viral particles, as well as from cells inoculated with several viral concentrations. The PCR combined with slot blot was the most sensitive methodology, detecting 2.5 ng of viral DNA. Using this methodology LCDV was detected at 5 days postinoculation from SAF-1 cells initially inoculated with 10(-5) TCID(50) ml(-1). The combination of PCR with membrane hybridization has also been proved to be adequate to detect LCDV from apparently healthy carriers by means of caudal fin sample analysis. This asymptomatic infection was also demonstrated by classical virological methods (cell culture and immunoblot). The protocol described in this study allows the specific detection of LCDV, both in cell cultures and in fin homogenates from asymptomatic fish. The detection of asymptomatic carriers by a rapid molecular method using caudal fin sampling, which does not imply animal killing, could be an important tool to control epizootics caused by LCDV, as fish could be analysed before their introduction and/or mobilization in farm facilities.

  9. One-step multiplex quantitative RT-PCR for the simultaneous detection of viroids and phytoplasmas of pome fruit trees.

    PubMed

    Malandraki, Ioanna; Varveri, Christina; Olmos, Antonio; Vassilakos, Nikon

    2015-03-01

    A one-step multiplex real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) based on TaqMan chemistry was developed for the simultaneous detection of Pear blister canker viroid and Apple scar skin viroid along with universal detection of phytoplasmas, in pome trees. Total nucleic acids (TNAs) extraction was performed according to a modified CTAB protocol. Primers and TaqMan MGB probes for specific detection of the two viroids were designed in this study, whereas for phytoplasma detection published universal primers and probe were used, with the difference that the later was modified to carry a MGB quencher. The pathogens were detected simultaneously in 10-fold serial dilutions of TNAs from infected plant material into TNAs of healthy plant up to dilutions 10(-5) for viroids and 10(-4) for phytoplasmas. The multiplex real-time assay was at least 10 times more sensitive than conventional protocols for viroid and phytoplasma detection. Simultaneous detection of the three targets was achieved in composite samples at least up to a ratio of 1:100 triple-infected to healthy tissue, demonstrating that the developed assay has the potential to be used for rapid and massive screening of viroids and phytoplasmas of pome fruit trees in the frame of certification schemes and surveys. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. iSAFT Protocol Validation Platform for On-Board Data Networks

    NASA Astrophysics Data System (ADS)

    Tavoularis, Antonis; Kollias, Vangelis; Marinis, Kostas

    2014-08-01

    iSAFT is an integrated powerful HW/SW environmentfor the simulation, validation & monitoring of satellite/spacecraft on-board data networks supporting simultaneously a wide range of protocols (RMAP, PTP, CCSDS Space Packet, TM/TC, CANopen, etc.) and network interfaces (SpaceWire, ECSS MIL-STD-1553, ECSS CAN). It is based on over 20 years of TELETEL's experience in the area of protocol validation in the telecommunications and aeronautical sectors, and it has been fully re-engineered in cooperation of TELETEL with ESA & space Primes, to comply with space on-board industrial validation requirements (ECSS, EGSE, AIT, AIV, etc.). iSAFT is highly modular and expandable to support new network interfaces & protocols and it is based on the powerful iSAFT graphical tool chain (Protocol Analyser / Recorder, TestRunner, Device Simulator, Traffic Generator, etc.).

  11. Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.

    PubMed

    Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C

    2012-09-27

    We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.

  12. Large enhancement in the heterogeneous oxidation rate of organic aerosols by hydroxyl radicals in the presence of nitric oxide

    DOE PAGES

    Richards-Henderson, Nicole K.; Goldstein, Allen H.; Wilson, Kevin R.

    2015-10-27

    In this paper we report an unexpectedly large acceleration in the effective heterogeneous OH reaction rate in the presence of NO. This 10–50 fold acceleration originates from free radical chain reactions, propagated by alkoxy radicals that form inside the aerosol by the reaction of NO with peroxy radicals, which do not appear to produce chain terminating products (e.g., alkyl nitrates), unlike gas phase mechanisms. Lastly, a kinetic model, constrained by experiments, suggests that in polluted regions heterogeneous oxidation plays a much more prominent role in the daily chemical evolution of organic aerosol than previously believed.

  13. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+{sup 11}B process

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belyaev, V. S.; Krainov, V. P., E-mail: vpkrainov@mail.ru; Zagreev, B. V.

    2015-07-15

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+{sup 11}B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from {sup 11}B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+{sup 11}B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons amongmore » fusion products. Nuclear reactions that follow the p+{sup 11}B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+{sup 11}B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.« less

  14. Gene Polymorphism Studies in a Teaching Laboratory

    NASA Astrophysics Data System (ADS)

    Shultz, Jeffry

    2009-02-01

    I present a laboratory procedure for illustrating transcription, post-transcriptional modification, gene conservation, and comparative genetics for use in undergraduate biology education. Students are individually assigned genes in a targeted biochemical pathway, for which they design and test polymerase chain reaction (PCR) primers. In this example, students used genes annotated for the steroid biosynthesis pathway in soybean. The authoritative Kyoto encyclopedia of genes and genomes (KEGG) interactive database and other online resources were used to design primers based first on soybean expressed sequence tags (ESTs), then on ESTs from an alternate organism if soybean sequence was unavailable. Students designed a total of 50 gene-based primer pairs (37 soybean, 13 alternative) and tested these for polymorphism state and similarity between two soybean and two pea lines. Student assessment was based on acquisition of laboratory skills and successful project completion. This simple procedure illustrates conservation of genes and is not limited to soybean or pea. Cost per student estimates are included, along with a detailed protocol and flow diagram of the procedure.

  15. Identification of the razor clam species Ensis arcuatus, E. siliqua, E. directus, E. macha, and Solen marginatus using PCR-RFLP analysis of the 5S rDNA region.

    PubMed

    Fernandez-Tajes, Juan; Méndez, Josefina

    2007-09-05

    Polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis of the 5S ribosomal DNA region has been applied to the establishment of DNA-based molecular markers for the identification of five razor clam species: Ensis arcuatus, E. siliqua, E. directus, E. macha, and Solen marginatus. PCR amplifications were carried out using a pair of universal primers from the coding region of 5S rDNA. S. marginatus was simply distinguished by the different size of the amplicons obtained. Species-specific restriction endonuclease patterns were found with the enzymes Hae III for E. arcuatus, E. siliqua, and E. directus, and Acs I for E. macha, and when two enzymes were combined, the four species were also identified. Thus, this work provides a simple, reliable, and rapid protocol for the accurate identification of Ensis and Solen species in fresh and canned products, which is very useful for traceability and to enforce labeling regulations.

  16. First report of phlebotomine sand flies (Diptera: Psychodidae) in Kansas and Missouri, and a PCR method to distinguish Lutzomyia shannoni from Lutzomyia vexator.

    PubMed

    Weng, Ju-Lin; Young, Samantha L; Gordon, David M; Claborn, David; Petersen, Christine; Ramalho-Ortigao, Marcelo

    2012-11-01

    Sand flies Lutzomyia (Psathyromyia) shannoni (Dyar) and Lu. (Helcocyrtomyia) vexator (Coquillet) were collected for the first time in southwest Missouri and southeast Kansas, expanding the known range of these species in North America. Altogether, 680 sand flies (356 males and 324 females) were collected during trapping from May through October 2011 and identified using morphological characters. Of the total sand flies collected, 315 were identified as Lu. shannoni, with 181 individuals (or 26.6% of all sand flies) trapped in Missouri and 134 individuals (or 19.7%) trapped in Kansas. Whereas 358 Lu. vexator were identified from southwest Missouri, only a single specimen was trapped in southeast Kansas. One male Lu. vexator with asymmetric gonostyli was trapped in Missouri. We also developed a polymerase chain reaction protocol to consistently and accurately distinguish Lu. shannoni from Lu. vexator based on presence or absence of a 416 bp fragment from the cytochrome oxidase c subunit 1 gene.

  17. Birth of two healthy females after preimplantation genetic diagnosis for familial amyloid polyneuropathy.

    PubMed

    Almeida, V M; Costa, P M; Moreira, P; Gonçalves, J; Braga, J

    2005-05-01

    Familial amyloid polyneuropathy (FAP), Portuguese type, is a late onset, high penetrance, autosomal dominant Mendelian disorder caused by a V30M substitution in the transthyretin (TTR) protein. A genetic diagnosis was developed using fluorescent single cell polymerase chain reaction (PCR) on lymphocytes from patients and controls. Ovarian stimulation and oocyte retrieval were carried out using conventional protocols in a couple in whom the female was heterozygous for the mutation TTR V30M. Blastomere biopsy was performed on day 3 after intracytoplasmic sperm injection. PCR was then performed for a segment of the TTR gene encompassing the V30M mutation. The transfer of three embryos at day 4 resulted in a twin pregnancy, confirmed as healthy females by amniocentesis at 16 weeks of gestation; the birth took place at 37 weeks of gestation. With this report, FAP, TTR related, joins the lengthening list of genetic conditions for which preimplantation genetic diagnosis has been successfully carried out.

  18. Study of the diversity of microbial communities in a sequencing batch reactor oxic-settling-anaerobic process and its modified process.

    PubMed

    Sun, Lianpeng; Chen, Jianfan; Wei, Xiange; Guo, Wuzhen; Lin, Meishan; Yu, Xiaoyu

    2016-05-01

    To further reveal the mechanism of sludge reduction in the oxic-settling-anaerobic (OSA) process, the polymerase chain reaction - denaturing gradient gel electrophoresis protocol was used to study the possible difference in the microbial communities between a sequencing batch reactor (SBR)-OSA process and its modified process, by analyzing the change in the diversity of the microbial communities in each reactor of both systems. The results indicated that the structure of the microbial communities in aerobic reactors of the 2 processes was very different, but the predominant microbial populations in anaerobic reactors were similar. The predominant microbial population in the aerobic reactor of the SBR-OSA belonged to Burkholderia cepacia, class Betaproteobacteria, while those of the modified process belonged to the classes Alphaproteobacteria, Betaproteobacteria, and Gammaproteobacteria. These 3 types of microbes had a cryptic growth characteristic, which was the main cause of a greater sludge reduction efficiency achieved by the modified process.

  19. 'Mitominis': multiplex PCR analysis of reduced size amplicons for compound sequence analysis of the entire mtDNA control region in highly degraded samples.

    PubMed

    Eichmann, Cordula; Parson, Walther

    2008-09-01

    The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.

  20. STR-typing of ancient skeletal remains: which multiplex-PCR kit is the best?

    PubMed Central

    Harder, Melanie; Renneberg, Rebecca; Meyer, Patrick; Krause-Kyora, Ben; von Wurmb-Schwark, Nicole

    2012-01-01

    Aim To comparatively test nine commercially available short tandem repeat (STR)-multiplex kits (PowerPlex 16, 16HS, ES, ESI17, ESX17, S5 [all Promega]; AmpFiSTR Identifiler, NGM and SEfiler [all Applied Biosystems]) for their efficiency and applicability to analyze ancient and thus highly degraded DNA samples. Methods Fifteen human skeletal remains from the late medieval age were obtained and analyzed using the nine polymerase chain reaction assays with slightly modified protocols. Data were systematically compared to find the most meaningful and sensitive assay. Results The ESI, ESX, and NGM kits showed the best overall results regarding amplification success, detection rate, identification of heterozygous alleles, sex determination, and reproducibility of the obtained data. Conclusion Since application of these three kits enables the employment of different primer sequences for all the investigated amplicons, a combined application is recommended for best possible and – most importantly – reliable genetic analysis of ancient skeletal material or otherwise highly degraded samples, eg, from forensic cases. PMID:23100203

  1. Low-intensity red and infrared lasers on XPA and XPC gene expression

    NASA Astrophysics Data System (ADS)

    Fonseca, A. S.; Magalhães, L. A. G.; Mencalha, A. L.; Ferreira-Machado, S. C.; Geller, M.; Paoli, F.

    2014-09-01

    Laser devices emit monochromatic, coherent, and highly collimated intense beams of light that are useful for a number of biomedical applications. However, for low-intensity lasers, possible adverse effects of laser light on DNA are still controversial. In this work, the expression of XPA and XPC genes in skin and muscle tissue exposed to low-intensity red and infrared lasers was evaluated. Skin and muscle tissue of Wistar rats were exposed to low-intensity red and infrared lasers at different fluences in continuous mode emission. Skin and muscle tissue samples were withdrawn for total RNA extraction, cDNA synthesis, and evaluation of actin gene expression by quantitative polymerase chain reaction. Data obtained show that laser radiation alters the expression of XPA and XPC mRNA differently in skin and muscle tissue of Wistar rats, depending on physical (fluence and wavelength) and biological (tissue) parameters. Laser light could modify expression of genes related to the nucleotide excision repair pathway at fluences and wavelengths used in clinical protocols.

  2. On-Site Molecular Detection of Soil-Borne Phytopathogens Using a Portable Real-Time PCR System

    PubMed Central

    DeShields, Joseph B.; Bomberger, Rachel A.; Woodhall, James W.; Wheeler, David L.; Moroz, Natalia; Johnson, Dennis A.; Tanaka, Kiwamu

    2018-01-01

    On-site diagnosis of plant diseases can be a useful tool for growers for timely decisions enabling the earlier implementation of disease management strategies that reduce the impact of the disease. Presently in many diagnostic laboratories, the polymerase chain reaction (PCR), particularly real-time PCR, is considered the most sensitive and accurate method for plant pathogen detection. However, laboratory-based PCRs typically require expensive laboratory equipment and skilled personnel. In this study, soil-borne pathogens of potato are used to demonstrate the potential for on-site molecular detection. This was achieved using a rapid and simple protocol comprising of magnetic bead-based nucleic acid extraction, portable real-time PCR (fluorogenic probe-based assay). The portable real-time PCR approach compared favorably with a laboratory-based system, detecting as few as 100 copies of DNA from Spongospora subterranea. The portable real-time PCR method developed here can serve as an alternative to laboratory-based approaches and a useful on-site tool for pathogen diagnosis. PMID:29553557

  3. Effect of the glass transition temperature on alpha-amylase activity in a starch matrix.

    PubMed

    Chaudhary, Vinita; Panyoyai, Naksit; Small, Darryl M; Shanks, Robert A; Kasapis, Stefan

    2017-02-10

    This study optimises a protocol for the estimation of α-amylase activity in a condensed starch matrix in the vicinity of the glass transition region. Enzymatic activity on the vitrified starch system was compared with that of a reference substrate, maltodextrin. The activity was assayed as the rate of release of reducing sugar using a dinitrosalicylic acid procedure. The condensed carbohydrate matrices served the dual purpose of acting as a substrate as well as producing a pronounced effect on the ability to enzymatic hydrolysis. Activation energies were estimated throughout the glass transition region of condensed carbohydrate preparations based on the concept of the spectroscopic shift factor. Results were used to demonstrate a considerable moderation by the mechanical glass transition temperature, beyond the expected linear effect of the temperature dependence, on the reaction rate of starch hydrolysis by α-amylase in comparison with the low-molecular weight chain of maltodextrin. Copyright © 2016. Published by Elsevier Ltd.

  4. Molecular – genetic variance of RH blood group system within human population of Bosnia and Herzegovina

    PubMed Central

    Lasić, Lejla; Lojo-Kadrić, Naida; Silajdžić, Elma; Pojskić, Lejla; Hadžiselimović, Rifat; Pojskić, Naris

    2013-01-01

    There are two major theories for inheritance of Rh blood group system: Fisher – Race theory and Wiener theory. Aim of this study was identifying frequency of RHDCE alleles in Bosnian – Herzegovinian population and introduction of this method in screening for Rh phenotype in B&H since this type of analysis was not used for blood typing in B&H before. Rh blood group was typed by Polymerase Chain Reaction, using the protocols and primers previously established by other authors, then carrying out electrophoresis in 2-3% agarose gel. Percentage of Rh positive individuals in our sample is 84.48%, while the percentage of Rh negative individuals is 15.52%. Inter-rater agreement statistic showed perfect agreement (K=1) between the results of Rh blood system detection based on serological and molecular-genetics methods. In conclusion, molecular – genetic methods are suitable for prenatal genotyping and specific cases while standard serological method is suitable for high-throughput of samples. PMID:23448604

  5. Diagnosis and successful treatment of a lung abscess associated with Brucella species infection in a bottlenose dolphin (Tursiops truncatus).

    PubMed

    Cassle, Stephen E; Jensen, Eric D; Smith, Cynthia R; Meegan, Jennifer M; Johnson, Shawn P; Lutmerding, Betsy; Ridgway, Sam H; Francis-Floyd, Ruth

    2013-06-01

    This brief communication describes the clinical presentation, antemortem diagnosis, and successful treatment of a pulmonary abscess associated with a Brucella sp. in a 27-yr-old female bottlenose dolphin (Tursiops truncatus). Ultrasound revealed a 3-cm diameter hypoechoic mass deep to the pleural lining in the left lung field. Multiple ultrasound-guided fine-needle aspirates were performed and tested for bacterial and fungal etiology. All cultures were negative, but the infectious agent was identified by MicroSEQ analysis in two samples and confirmed with real-time polymerase chain reaction (PCR) amplification using known Brucella sp. primers. Amikacin was infused into the abscess and was followed by an oral doxycycline and rifampin protocol. Follow-up diagnostic imaging, including radiographs and computed tomography, revealed a resolved lesion with minimal mineralization within the affected lung fields. Brucellosis should be considered for pulmonary disease in dolphins, and personnel who interact with marine animals should use caution to prevent zoonotic brucellosis.

  6. Polymorphism at the merozoite surface protein-3alpha locus of Plasmodium vivax: global and local diversity.

    PubMed

    Bruce, M C; Galinski, M R; Barnwell, J W; Snounou, G; Day, K P

    1999-10-01

    Allelic diversity at the Plasmodium vivax merozoite surface protein-3alpha (PvMsp-3alpha) locus was investigated using a combined polymerase chain reaction/restriction fragment length polymorphism (PCR/RFLP) protocol. Symptomatic patient isolates from global geographic origins showed a high level of polymorphism at the nucleotide level. These samples were used to validate the sensitivity, specificity, and reproducibility of the PCR/RFLP method. It was then used to investigate PvMsp3alpha diversity in field samples from children living in a single village in a malaria-endemic region of Papua New Guinea, with the aim of assessing the usefulness of this locus as an epidemiologic marker of P. vivax infections. Eleven PvMsp-3alpha alleles were distinguishable in 16 samples with single infections, revealing extensive parasite polymorphism within this restricted area. Multiple infections were easily detected and accounted for 5 (23%) of 22 positive samples. Pairs of samples from individual children provided preliminary evidence for high turnover of P. vivax populations.

  7. Genotyping of Listeria monocytogenes isolates from poultry carcasses using high resolution melting (HRM) analysis.

    PubMed

    Sakaridis, Ioannis; Ganopoulos, Ioannis; Madesis, Panagiotis; Tsaftaris, Athanasios; Argiriou, Anagnostis

    2014-01-02

    An outbreak situation of human listeriosis requires a fast and accurate protocol for typing Listeria monocytogenes . Existing techniques are either characterized by low discriminatory power or are laborious and require several days to give a final result. Polymerase chain reaction (PCR) coupled with high resolution melting (HRM) analysis was investigated in this study as an alternative tool for a rapid and precise genotyping of L. monocytogenes isolates. Fifty-five isolates of L. monocytogenes isolated from poultry carcasses and the environment of four slaughterhouses were typed by HRM analysis using two specific markers, internalin B and ssrA genes. The analysis of genotype confidence percentage of L. monocytogenes isolates produced by HRM analysis generated dendrograms with two major groups and several subgroups. Furthermore, the analysis of the HRM curves revealed that all L. monocytogenes isolates could easily be distinguished. In conclusion, HRM was proven to be a fast and powerful tool for genotyping isolates of L. monocytogenes .

  8. Isolation of total RNA from yeast cell cultures.

    PubMed

    Ares, Manuel

    2012-10-01

    This article describes two procedures for isolating total RNA from yeast cell cultures. The first allows the convenient isolation of total RNA from early log-phase cultures (vegetative cells). RNA isolated in this way is intact and sufficiently pure for use in microarray experiments, primer extension, and RNase protection mapping. With additional treatment to remove contaminating genomic DNA, the preparation is suitable for reverse transcription-polymerase chain reaction (RT-PCR), quantitative PCR (qPCR), cDNA library construction, high-throughput sequencing of RNA, or other manipulations. However, compared to vegetative cells, the isolation of RNA from cells late in meiosis (asci and ascospores) requires additional effort. This is because a tough cell wall composed of heavily cross-linked polysaccharides and proteins is built around the four spores during meiosis and ascospore development. Therefore, an alternative protocol is presented for extracting RNA from cells late in meiosis. This alternative may also be preferable for cells from stationary cultures or from yeast strains and other fungal species isolated from the environment.

  9. Using comparative genomics to develop a molecular diagnostic for the identification of an emerging pest Drosophila suzukii.

    PubMed

    Murphy, K A; Unruh, T R; Zhou, L M; Zalom, F G; Shearer, P W; Beers, E H; Walton, V M; Miller, B; Chiu, J C

    2015-06-01

    Drosophila suzukii (Spotted Wing Drosophila) has recently become a serious invasive pest of fruit crops in the USA, Canada, and Europe, leading to substantial economic losses. D. suzukii is a direct pest, ovipositing directly into ripe or ripening fruits; in contrast, other Drosophilids utilize decaying or blemished fruits and are nuisance pests at worst. Immature stages of D. suzukii are difficult to differentiate from other Drosophilids, posing problems for research and for meeting quarantine restrictions designed to prevent the spread of this pest in fruit exports. Here we used a combined phylogenetic and bioinformatic approach to discover genetic markers suitable for a species diagnostic protocol of this agricultural pest. We describe a molecular diagnostic for rapid identification of single D. suzukii larva using multiplex polymerase chain reaction. Our molecular diagnostic was validated using nine different species of Drosophila for specificity and 19 populations of D. suzukii from different geographical regions to ensure utility within species.

  10. Synthesis of side-chain oxysterols and their enantiomers through cross-metathesis reactions of Δ22 steroids.

    PubMed

    Brownholland, David P; Covey, Douglas F

    2017-05-01

    A synthetic route that utilizes a cross-metathesis reaction with Δ 22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

    PubMed

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

    2014-04-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

  12. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

    PubMed Central

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

    2014-01-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

  13. Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

    PubMed

    Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

    2011-11-01

    The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  14. Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

    USDA-ARS?s Scientific Manuscript database

    The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

  15. Free Radical Scavenging Fingerprints of Selected Aromatic and Medicinal Tunisian Plants Assessed by Means of TLC-DPPH(•) Test and Image Processing.

    PubMed

    El Euch, Salma Kammoun; Cieśla, Łukasz; Bouzouita, Nabiha

    2014-01-01

    Aqueous-methanol extracts prepared from 10 Tunisian plant species were analyzed for the presence of potent direct antioxidants. The analyzed species included: Anacyclus clavatus Desf., Erica multiflora L., Cistus salvifolius L., Centaurium erythraea Rafn., Marrubium vulgare L., Lavandula stoechas L., Artemisia campestris L., Origanum majorana L., Salvia officinalis L., and Pistacia lentiscus L. All the extracts were chromatographed on the RP18 W plates with methanol-water-acetic acid (48 + 47 + 5, v/v/v) mobile phase. Upon completion of the chromatographic development and the drying step, the plates were stained with a chloroform solution of 2, 2-diphenyl-1-picrylhydrazyl radical (DPPH(•)). An image processing protocol, with use of Sorbfil TLC Videodensitometer, was applied to quantitatively measure the activity of polyphenols and to screen complex samples for the presence of free radical scavengers. The activity of the individual compounds was compared with that of rutin, used as a standard. The TLC-DPPH(•) test showed that C. salvifolius had the most potent antioxidant activity, as it possessed the highest activity coefficient (calculated as the sum of the areas under the peaks of all active compounds/area under peak of rutin). The proposed procedure may be used to differentiate potent chain-breaking antioxidants and compounds propagating radical chain reactions.

  16. Spark Plasma Sintering for Nanostructured Smart Materials

    DTIC Science & Technology

    2009-03-02

    polyester) with excess isocyanate to form a prepolymer , followed by the addition of a short chain diol that acts as a chain extender to link the... prepolymers together. Due to the thermodynamic imicisibility of segments of PU, phase separation into a flexible soft segment (long chain diol) and a...other reactions of the isocyanate groups with the other functional groups in the chain. [Hepburn, 1992] However, during the initial prepolymer

  17. Mandibular molar uprighting using mini-implants: different approaches for different clinical cases--two case reports.

    PubMed

    Derton, Nicola; Perini, Alessandro; Mutinelli, Sabrina; Gracco, Antonio

    2012-01-01

    To detail two different clinical protocols and case studies using mini-implant anchorage developed to respond to certain clinical conditions. Two clinical protocols are described to upright mesially tilted mandibular molars. In the first protocol, a single mini-implant is inserted distally to the molar to be uprighted, and an elastic traction chain is applied to the tooth. In the second clinical approach, two mini-implants are inserted mesially. A screw-suspended TMA sectional archwire is applied (Derton-Perini technique). Two cases, descriptive of the two different treatment protocols, are described. In the first case, the mandibular right second premolar was missing and the adjacent first molar needed to be uprighted. A single screw was inserted distally to the first molar, and an elastic chain was applied. In the second case, the mandibular left second molar was missing and the third molar needed to be uprighted. Two mini-implants were inserted mesially and a fully screw-supported sectional archwire was used to upright and bodily mesialize the third molar. Both uprighting approaches uprighted the molar axis without loss of anchorage. The two approaches to mandibular molar uprighting, developed as rational responses to different clinical cases, were both found to be effective.

  18. Ground-state-entanglement bound for quantum energy teleportation of general spin-chain models

    NASA Astrophysics Data System (ADS)

    Hotta, Masahiro

    2013-03-01

    Many-body quantum systems in the ground states have zero-point energy due to the uncertainty relation. In many cases, the system in the ground state accompanies spatially entangled energy density fluctuation via the noncommutativity of the energy density operators, though the total energy takes a fixed value, i.e., the lowest eigenvalue of the Hamiltonian. Quantum energy teleportation (QET) is a protocol for the extraction of the zero-point energy out of one subsystem using information of a remote measurement of another subsystem. From an operational viewpoint of protocol users, QET can be regarded as an effective rapid energy transportation without breaking all physical laws, including causality and local energy conservation. In the protocol, the ground-state entanglement plays a crucial role. In this paper, we show analytically for a general class of spin-chain systems that the entanglement entropy is lower bounded by a positive quadratic function of the teleported energy between the regions of a QET protocol. This supports a general conjecture that ground-state entanglement is an evident physical resource for energy transportation in the context of QET. The result may also deepen our understanding of the energy density fluctuation in condensed-matter systems from a perspective of quantum information theory.

  19. [Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

    PubMed

    Harano, K; Harano, T; Kushida, Y; Ueda, S

    1991-08-01

    Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

  20. Endoglycosidase and glycoamidase release of N-linked oligosaccharides.

    PubMed

    Freeze, H H

    2001-05-01

    Carbohydrate chain modifications are often used to monitor glycoprotein movement through the secretory pathway. This is because stepwise sugar-chain processing is unidirectional and generally corresponds to the forward or anterograde movement of proteins. This unit offers a group of techniques that will help analyze the general structure of carbohydrate chains on a protein and, therefore, oligosaccharide processing mileposts. The sugar chains themselves are not analyzed, but their presence and structure are inferred from gel mobility differences after one or more enzymatic digestions. This approach is most often used in combination with [35S]Met pulse-chase metabolic labeling protocols, but they can be applied to any suitably labeled protein (e.g., biotinylated or 125I-labeled).

Top