Sample records for chain reaction quantification

  1. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    PubMed

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  2. The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

    2013-06-28

    Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

  3. Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

    PubMed

    Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

    2008-07-23

    A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

  4. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

    PubMed

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2013-01-01

    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  5. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

    PubMed

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

    2015-04-01

    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  6. Multiplex Droplet Digital PCR Protocols for Quantification of GM Maize Events.

    PubMed

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Štebih, Dejan; Morisset, Dany; Holst-Jensen, Arne; Žel, Jana

    2018-01-01

    The standard-curve based simplex quantitative polymerase chain reaction (qPCR) has been the gold standard for DNA target quantification for more than a decade. The large and growing number of individual analyses needed to test for genetically modified organisms (GMOs) is reducing the cost-effectiveness of qPCR. Droplet digital PCR (ddPCR) enables absolute quantification without standard curves, avoids the amplification efficiency bias observed with qPCR, allows more accurate estimations at low target copy numbers and, in combination with multiplexing, significantly improves cost efficiency. Here we describe two protocols for multiplex quantification of GM maize events: (1) nondiscriminating, with multiplex quantification of targets as a group (12 GM maize lines) and (2) discriminating, with multiplex quantification of individual targets (events). The first enables the quantification of twelve European Union authorized GM maize events as a group with only two assays, but does not permit determination of the individual events present. The second protocol enables the quantification of four individual targets (three GM events and one endogene) in a single reaction. Both protocols can be modified for quantification of any other DNA target.

  7. Quantification of concentrated Chinese medicine granules by quantitative polymerase chain reaction.

    PubMed

    Lo, Yat-Tung; Shaw, Pang-Chui

    2017-10-25

    Determination of the amount of constituent in a multi-herb product is important for quality control. In concentrated Chinese medicine granules (CCMG), no dregs are left after dissolution of the CCMG. This study is the first to examine the feasibility of using quantitative polymerase chain reaction (qPCR) to find the amount of CCMG in solution form. DNA was extracted from Hirudo and Zaocys CCMG mixed at different ratios and amplified in qPCR using species-specific primers. The threshold cycle (C T ) obtained was compared with the respective standard curves. Results showed that reproducible quantification results could be obtained (1) for 5-50mg CCMG using a modified DNA extraction protocol, (2) amongst DNA extracted from the same batch of CCMG and (3) amongst different batches of CCMG from the same company. This study demonstrated the constitute amount of CCMG in a mixture could be determined using qPCR. This work has extended the application of DNA techniques for the quantification of herbal products and this approach may be developed for quality assurance in the CCMG industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Quantification of free fatty acids in human stratum corneum using tandem mass spectrometry and surrogate analyte approach.

    PubMed

    Dapic, Irena; Kobetic, Renata; Brkljacic, Lidija; Kezic, Sanja; Jakasa, Ivone

    2018-02-01

    The free fatty acids (FFAs) are one of the major components of the lipids in the stratum corneum (SC), the uppermost layer of the skin. Relative composition of FFAs has been proposed as a biomarker of the skin barrier status in patients with atopic dermatitis (AD). Here, we developed an LC-ESI-MS/MS method for simultaneous quantification of a range of FFAs with long and very long chain length in the SC collected by adhesive tape (D-Squame). The method, based on derivatization with 2-bromo-1-methylpyridinium iodide and 3-carbinol-1-methylpyridinium iodide, allowed highly sensitive detection and quantification of FFAs using multiple reaction monitoring. For the quantification, we applied a surrogate analyte approach and internal standardization using isotope labeled derivatives of FFAs. Adhesive tapes showed the presence of several FFAs, which are also present in the SC, a problem encountered in previous studies. Therefore, the levels of FFAs in the SC were corrected using C12:0, which was present on the adhesive tape, but not detected in the SC. The method was applied to SC samples from patients with atopic dermatitis and healthy subjects. Quantification using multiple reaction monitoring allowed sufficient sensitivity to analyze FFAs of chain lengths C16-C28 in the SC collected on only one tape strip. Copyright © 2017 John Wiley & Sons, Ltd.

  9. Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR

    PubMed Central

    Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao

    2012-01-01

    AIM: To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. METHODS: Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. RESULTS: cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. CONCLUSION: The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well. PMID:22294830

  10. Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR.

    PubMed

    Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao

    2012-01-21

    To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well.

  11. International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method.

    PubMed

    Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

    2015-05-27

    This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method.

  12. Multiplex quantification of 12 European Union authorized genetically modified maize lines with droplet digital polymerase chain reaction.

    PubMed

    Dobnik, David; Spilsberg, Bjørn; Bogožalec Košir, Alexandra; Holst-Jensen, Arne; Žel, Jana

    2015-08-18

    Presence of genetically modified organisms (GMO) in food and feed products is regulated in many countries. The European Union (EU) has implemented a threshold for labeling of products containing more than 0.9% of authorized GMOs per ingredient. As the number of GMOs has increased over time, standard-curve based simplex quantitative polymerase chain reaction (qPCR) analyses are no longer sufficiently cost-effective, despite widespread use of initial PCR based screenings. Newly developed GMO detection methods, also multiplex methods, are mostly focused on screening and detection but not quantification. On the basis of droplet digital PCR (ddPCR) technology, multiplex assays for quantification of all 12 EU authorized GM maize lines (per April first 2015) were developed. Because of high sequence similarity of some of the 12 GM targets, two separate multiplex assays were needed. In both assays (4-plex and 10-plex), the transgenes were labeled with one fluorescence reporter and the endogene with another (GMO concentration = transgene/endogene ratio). It was shown that both multiplex assays produce specific results and that performance parameters such as limit of quantification, repeatability, and trueness comply with international recommendations for GMO quantification methods. Moreover, for samples containing GMOs, the throughput and cost-effectiveness is significantly improved compared to qPCR. Thus, it was concluded that the multiplex ddPCR assays could be applied for routine quantification of 12 EU authorized GM maize lines. In case of new authorizations, the events can easily be added to the existing multiplex assays. The presented principle of quantitative multiplexing can be applied to any other domain.

  13. Development of real-time PCR method for the detection and the quantification of a new endogenous reference gene in sugar beet "Beta vulgaris L.": GMO application.

    PubMed

    Chaouachi, Maher; Alaya, Akram; Ali, Imen Ben Haj; Hafsa, Ahmed Ben; Nabi, Nesrine; Bérard, Aurélie; Romaniuk, Marcel; Skhiri, Fethia; Saïd, Khaled

    2013-01-01

    KEY MESSAGE : Here, we describe a new developed quantitative real-time PCR method for the detection and quantification of a new specific endogenous reference gene used in GMO analysis. The key requirement of this study was the identification of a new reference gene used for the differentiation of the four genomic sections of the sugar beet (Beta vulgaris L.) (Beta, Corrollinae, Nanae and Procumbentes) suitable for quantification of genetically modified sugar beet. A specific qualitative polymerase chain reaction (PCR) assay was designed to detect the sugar beet amplifying a region of the adenylate transporter (ant) gene only from the species of the genomic section I of the genus Beta (cultivated and wild relatives) and showing negative PCR results for 7 species of the 3 other sections, 8 related species and 20 non-sugar beet plants. The sensitivity of the assay was 15 haploid genome copies (HGC). A quantitative real-time polymerase chain reaction (QRT-PCR) assay was also performed, having high linearity (R (2) > 0.994) over sugar beet standard concentrations ranging from 20,000 to 10 HGC of the sugar beet DNA per PCR. The QRT-PCR assay described in this study was specific and more sensitive for sugar beet quantification compared to the validated test previously reported in the European Reference Laboratory. This assay is suitable for GMO quantification in routine analysis from a wide variety of matrices.

  14. Quantification of Parvovirus B19 DNA Using COBAS AmpliPrep Automated Sample Preparation and LightCycler Real-Time PCR

    PubMed Central

    Schorling, Stefan; Schalasta, Gunnar; Enders, Gisela; Zauke, Michael

    2004-01-01

    The COBAS AmpliPrep instrument (Roche Diagnostics GmbH, D-68305 Mannheim, Germany) automates the entire sample preparation process of nucleic acid isolation from serum or plasma for polymerase chain reaction analysis. We report the analytical performance of the LightCycler Parvovirus B19 Quantification Kit (Roche Diagnostics) using nucleic acids isolated with the COBAS AmpliPrep instrument. Nucleic acids were extracted using the Total Nucleic Acid Isolation Kit (Roche Diagnostics) and amplified with the LightCycler Parvovirus B19 Quantification Kit. The kit combination processes 72 samples per 8-hour shift. The lower detection limit is 234 IU/ml at a 95% hit-rate, linear range approximately 104-1010 IU/ml, and overall precision 16 to 40%. Relative sensitivity and specificity in routine samples from pregnant women are 100% and 93%, respectively. Identification of a persistent parvovirus B19-infected individual by the polymerase chain reaction among 51 anti-parvovirus B19 IgM-negative samples underlines the importance of additional nucleic acid testing in pregnancy and its superiority to serology in identifying the risk of parvovirus B19 transmission via blood or blood products. Combination of the Total Nucleic Acid Isolation Kit on the COBAS AmpliPrep instrument with the LightCycler Parvovirus B19 Quantification Kit provides a reliable and time-saving tool for sensitive and accurate detection of parvovirus B19 DNA. PMID:14736825

  15. Advanced Quantification of Plutonium Ionization Potential to Support Nuclear Forensic Evaluations by Resonance Ionization Mass Spectrometry

    DTIC Science & Technology

    2015-06-01

    Research Committee nm Nanometer Np Neptunium NPT Treaty of Non-proliferation of Nuclear Weapons ns Nanosecond ps Picosecond Pu Plutonium RIMS...discovery—credited also to Fritz Strassman— scientists realized these reactions also emitted secondary neutrons . These secondary neutrons could in...destructive capabilities of nuclear fission and atomic weapons . Figure 1. Uranium-235 Fission chain reaction, from [1

  16. Development and characterization of a synthetic DNA, NUversa, to be used as a standard in quantitative polymerase chain reactions for molecular pneumococcal serotyping.

    PubMed

    Sakai, Fuminori; Sonaty, Griffin; Watson, David; Klugman, Keith P; Vidal, Jorge E

    2017-09-15

    Identification of Streptococcus pneumoniae and its more than 90 serotypes is routinely conducted by culture and Quellung reactions. Quantitative polymerase chain reactions (qPCRs) have been developed for molecular detection, including a pan-pneumococcus lytA assay, and assays targeting 79 serotypes. Reactions require genomic DNA from every target to prepare standards, which can be time consuming. In this study, we have developed a synthetic DNA molecule as a surrogate for genomic DNA and present new single-plex qPCR reactions to increase molecular detection to 94 pneumococcal serotypes. Specificity of these new reactions was confirmed with a limit of detection between 2 and 20 genome equivalents/reaction. A synthetic DNA (NUversa, ∼8.2 kb) was then engineered to contain all available qPCR targets for serotyping and lytA. NUversa was cloned into pUC57-Amp-modified to generate pNUversa (∼10.2 kb). Standards prepared from pNUversa and NUversa were compared against standards made out of genomic DNA. Linearity [NUversa (R2 > 0.982); pNUversa (R2 > 0.991)] and efficiency of qPCR reactions were similar to those utilizing chromosomal DNA (R2 > 0.981). Quantification with plasmid pNUversa was affected, however, whereas quantification with synthetic NUversa was comparable to that of genomic DNA. Therefore, NUversa may be utilized as DNA standard in single-plex assays of the currently known 94 pneumococcal serotypes. © FEMS 2017.

  17. Implications of Measurement Assay Type in Design of HIV Experiments.

    PubMed

    Cannon, LaMont; Jagarapu, Aditya; Vargas-Garcia, Cesar A; Piovoso, Michael J; Zurakowski, Ryan

    2017-12-01

    Time series measurements of circular viral episome (2-LTR) concentrations enable indirect quantification of persistent low-level Human Immunodeficiency Virus (HIV) replication in patients on Integrase-Inhibitor intensified Combined Antiretroviral Therapy (cART). In order to determine the magnitude of these low level infection events, blood has to be drawn from a patients at a frequency and volume that is strictly regulated by the Institutional Review Board (IRB). Once the blood is drawn, the 2-LTR concentration is determined by quantifying the amount of HIV DNA present in the sample via a PCR (Polymerase Chain Reaction) assay. Real time quantitative Polymerase Chain Reaction (qPCR) is a widely used method of performing PCR; however, a newer droplet digital Polymerase Chain Reaction (ddPCR) method has been shown to provide more accurate quantification of DNA. Using a validated model of HIV viral replication, this paper demonstrates the importance of considering DNA quantification assay type when optimizing experiment design conditions. Experiments are optimized using a Genetic Algorithm (GA) to locate a family of suboptimal sample schedules which yield the highest fitness. Fitness is defined as the expected information gained in the experiment, measured by the Kullback-Leibler Divergence (KLD) between the prior and posterior distributions of the model parameters. We compare the information content of the optimized schedules to uniform schedules as well as two clinical schedules implemented by researchers at UCSF and the University of Melbourne. This work shows that there is a significantly greater gain information in experiments using a ddPCR assay vs. a qPCR assay and that certain experiment design considerations should be taken when using either assay.

  18. Novel approach to quantitative polymerase chain reaction using real-time detection: application to the detection of gene amplification in breast cancer.

    PubMed

    Bièche, I; Olivi, M; Champème, M H; Vidaud, D; Lidereau, R; Vidaud, M

    1998-11-23

    Gene amplification is a common event in the progression of human cancers, and amplified oncogenes have been shown to have diagnostic, prognostic and therapeutic relevance. A kinetic quantitative polymerase-chain-reaction (PCR) method, based on fluorescent TaqMan methodology and a new instrument (ABI Prism 7700 Sequence Detection System) capable of measuring fluorescence in real-time, was used to quantify gene amplification in tumor DNA. Reactions are characterized by the point during cycling when PCR amplification is still in the exponential phase, rather than the amount of PCR product accumulated after a fixed number of cycles. None of the reaction components is limited during the exponential phase, meaning that values are highly reproducible in reactions starting with the same copy number. This greatly improves the precision of DNA quantification. Moreover, real-time PCR does not require post-PCR sample handling, thereby preventing potential PCR-product carry-over contamination; it possesses a wide dynamic range of quantification and results in much faster and higher sample throughput. The real-time PCR method, was used to develop and validate a simple and rapid assay for the detection and quantification of the 3 most frequently amplified genes (myc, ccndl and erbB2) in breast tumors. Extra copies of myc, ccndl and erbB2 were observed in 10, 23 and 15%, respectively, of 108 breast-tumor DNA; the largest observed numbers of gene copies were 4.6, 18.6 and 15.1, respectively. These results correlated well with those of Southern blotting. The use of this new semi-automated technique will make molecular analysis of human cancers simpler and more reliable, and should find broad applications in clinical and research settings.

  19. QUANTIFICATION OF TRANSGENIC PLANT MARKER GENE PERSISTENCE IN THE FIELD

    EPA Science Inventory

    Methods were developed to monitor persistence of genomic DNA in decaying plants in the field. As a model, we used recombinant neomycin phosphotransferase II (rNPT-II) marker genes present in genetically engineered plants. Polymerase chain reaction (PCR) primers were designed, com...

  20. SIMULTANEOUS ONE-TUBE QUANTIFICATION OF HOST AND PATHOGEN DNA WITH REAL-TIME POLYMERASE CHAIN REACTION

    EPA Science Inventory

    Phaeocryptopus gaeumannii is a widespread foliar parasite of Douglas-fir. Although normally innocuous, the fungus also causes the defoliating disease Swiss needle cast in heavily infected needles. The extent of P. gaeumannii colonization in Douglas-fir foliage was estimated wit...

  1. Detection and quantification limits of the EPA Enterococcus qPCR method

    EPA Science Inventory

    The U.S. EPA will be recommending a quantitative polymerase chain reaction (qPCR) method targeting Enterococcus spp. as an option for monitoring recreational beach water quality in 2013 and has published preliminary proposed water quality criteria guidelines for the method. An im...

  2. [Detection of recombinant-DNA in foods from stacked genetically modified plants].

    PubMed

    Sorokina, E Iu; Chernyshova, O N

    2012-01-01

    A quantitative real-time multiplex polymerase chain reaction method was applied to the detection and quantification of MON863 and MON810 in stacked genetically modified maize MON 810xMON 863. The limit of detection was approximately 0,1%. The accuracy of the quantification, measured as bias from the accepted value and the relative repeatability standard deviation, which measures the intra-laboratory variability, were within 25% at each GM-level. A method verification has demonstrated that the MON 863 and the MON810 methods can be equally applied in quantification of the respective events in stacked MON810xMON 863.

  3. Genomic DNA-based absolute quantification of gene expression in Vitis

    USDA-ARS?s Scientific Manuscript database

    Many studies in which gene expression is quantified by polymerase chain reaction represent the expression of a gene of interest (GOI) relative to that of a reference gene (RG). Relative expression is founded on the assumptions that RG expression is stable across samples, treatments, organs, etc., an...

  4. REAL TIME PCR ANALYSIS OF INDOOR MOLDS: PRINCIPLES, PROCEDURES AND APPLICATIONS

    EPA Science Inventory

    This presentation will endeavor to present an overview of the real time polymerase chain reaction method developed for indoor mold detection and quantification by the EPA. It will begin with a brief discussion of the PCR technology that provides the basis for this method and how ...

  5. QUANTIFICATION AND ASSOCIATED VARIABILITY OF INDUCED VITELLOGENIN GENE TRANSCRIPTS IN FATHEAD MINNOW (PIMEPHALES PROMELAS) BY QUANTITATIVE REAL-TIME POLYMERASE CHAIN REACTION ASSAY

    EPA Science Inventory

    Ecological risk assessors have a growing need for sensitive and rapid indicators of environmental exposure in aquatic ecosystems resulting from natural and synthetic estrogen-like compounds. Investigators developing subcellular exposure markers in traditional sentinel organisms m...

  6. Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods

    EPA Science Inventory

    Quantitative polymerase chain reaction (qPCR) is increasingly being used for the quantitative detection of fecal indicator bacteria in beach water. QPCR allows for same-day health warnings, and its application is being considered as an optionn for recreational water quality testi...

  7. DETECTION OF STACHYBOTRYS CHARTARUM USING rRNA, tri5, AND Β-TUBULIN PRIMERS AND DETERMINING THEIR RELATIVE COPY NUMBER BY REAL TIME PCR

    EPA Science Inventory

    This research utilizes the quantitative polymerase chain reaction (qPCR) to determine ribosomal copy number of fungal organisms found in unhealthy indoor environments. Knowing specific copy numbers will allow for greater accuracy in quantification when utilizing current pQCR tec...

  8. Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze)

    USDA-ARS?s Scientific Manuscript database

    Quantitative real-time polymerase chain reaction (qRT-PCR) is a commonly used technique for measuring gene expression levels due to its simplicity, specificity, and sensitivity. Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a...

  9. Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis.

    PubMed

    Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao

    2013-11-27

    The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.

  10. Quantification of Wilms' tumor 1 mRNA by digital polymerase chain reaction.

    PubMed

    Koizumi, Yuki; Furuya, Daisuke; Endo, Teruo; Asanuma, Kouichi; Yanagihara, Nozomi; Takahashi, Satoshi

    2018-02-01

    Wilms' tumor 1 (WT1) is overexpressed in various hematopoietic tumors and widely used as a marker of minimal residual disease. WT1 mRNA has been analyzed using quantitative real-time polymerase chain reaction (real-time PCR). In the present study, we analyzed 40 peripheral blood and bone marrow samples obtained from cases of acute myeloid leukemia, acute lymphoblastic leukemia, and myelodysplastic syndrome at Sapporo Medical University Hospital from April 2012 to January 2015. We performed quantification of WT1 was performed using QuantStudio 3D Digital PCR System (Thermo Fisher Scientific‎) and compared the results between digital PCR and real-time PCR technology. The correlation between digital PCR and real-time PCR was very strong (R = 0.99), and the detection limits of the two methods were equivalent. Digital PCR was able to accurately detect lower WT levels compared with real-time PCR. Digital PCR technology can thus be utilized to predict WT1/ABL1 expression level accurately and should thus be useful for diagnosis or the evaluation of drug efficiency in patients with leukemia.

  11. Quantitative competitive (QC) PCR for quantification of porcine DNA.

    PubMed

    Wolf, C; Lüthy, J

    2001-02-01

    Many meat products nowadays may contain several species in different proportions. To protect consumers from fraud and misdeclarations, not only a qualitative but also a quantitative monitoring of ingredients of complex food products is necessary. DNA based techniques like the polymerase chain reaction (PCR) are widely used for identification of species but no answer to the proportional amount of a certain species could be given using current techniques. In this study we report the development and evaluation of a quantitative competitive polymerase chain reaction (QC-PCR) for detection and quantification of porcine DNA using a new porcine specific PCR system based on the growth hormone gene of sus scrofa. A DNA competitor differing by 30 bp in length from the porcine target sequence was constructed and used for PCR together with the target DNA. Specificity of the new primers was evaluated with DNA from cattle, sheep, chicken and turkey. The competitor concentration was adjusted to porcine DNA contents of 2 or 20% by coamplification of mixtures containing porcine and corresponding amounts of bovine DNA in defined ratios.

  12. In situ DNA hybridized chain reaction (FISH-HCR) as a better method for quantification of bacteria and archaea within marine sediment

    NASA Astrophysics Data System (ADS)

    Buongiorno, J.; Lloyd, K. G.; Shumaker, A.; Schippers, A.; Webster, G.; Weightman, A.; Turner, S.

    2015-12-01

    Nearly 75% of the Earth's surface is covered by marine sediment that is home to an estimated 2.9 x 1029 microbial cells. A substantial impediment to understanding the abundance and distribution of cells within marine sediment is the lack of a consistent and reliable method for their taxon-specific quantification. Catalyzed reporter fluorescent in situ hybridization (CARD-FISH) provides taxon-specific enumeration, but this process requires passing a large enzyme through cell membranes, decreasing its precision relative to general cell counts using a small DNA stain. In 2015, Yamaguchi et al. developed FISH hybridization chain reaction (FISH-HCR) as an in situ whole cell detection method for environmental microorganisms. FISH-HCR amplifies the fluorescent signal, as does CARD-FISH, but it allows for milder cell permeation methods that might prevent yield loss. To compare FISH-HCR to CARD-FISH, we examined bacteria and archaea cell counts within two sediment cores, Lille Belt (~78 meters deep) and Landsort Deep (90 meters deep), which were retrieved from the Baltic Sea Basin during IODP Expedition 347. Preliminary analysis shows that CARD-FISH counts are below the quantification limit for most depths across both cores. By contrast, quantification of cells was possible with FISH-HCR in all examined depths. When quantification with CARD-FISH was above the limit of detection, counts with FISH-HCR were up to 11 fold higher for Bacteria and 3 fold higher for Archaea from the same sediment sample. Further, FISH-HCR counts follow the trends of on board counts nicely, indicating that FISH-HCR may better reflect the cellular abundance within marine sediment than other quantification methods, including qPCR. Using FISH-HCR, we found that archaeal cell counts were on average greater than bacterial cell counts, but within the same order of magnitude.

  13. Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR

    USDA-ARS?s Scientific Manuscript database

    Droplet digital Polymerase chain reaction (ddPCR) is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. It is a promising DNA quantification technology for medical diagnostics but there are only a few reports of its use for plant pat...

  14. Evaluation and selection of internal reference genes from two- and six-row U.S. malting barley varieties throughout micromalting for use in RT-qPCR

    USDA-ARS?s Scientific Manuscript database

    Reverse Transcription quantitative Polymerase Chain Reaction (qRT-PCR) is a popular method for measuring transcript abundance. The most commonly used method of interpretation is relative quantification and thus necessitates the use of normalization controls (i.e. reference genes) to standardize tran...

  15. Optimisation of techniques for quantification of Botrytis cinerea in grape berries and receptacles by quantitative polymerase chain reaction

    USDA-ARS?s Scientific Manuscript database

    Quantitative PCR (qPCR) can be used to detect and monitor pathogen colonization, but early attempts to apply the technology to Botrytis cinerea infection of grape berries have identified limitations to current techniques. In this study, four DNA extraction methods, two grinding methods, two grape or...

  16. Influences of sample interference and interference controls on quantification of enterococci fecal indicator bacteria in surface water samples by the qPCR method

    EPA Science Inventory

    A quantitative polymerase chain reaction (qPCR) method for the detection of entercocci fecal indicator bacteria has been shown to be generally applicable for the analysis of temperate fresh (Great Lakes) and marine coastal waters and for providing risk-based determinations of wat...

  17. Quantification of Short-Chain Chlorinated Paraffins by Deuterodechlorination Combined with Gas Chromatography-Mass Spectrometry.

    PubMed

    Gao, Yuan; Zhang, Haijun; Zou, Lili; Wu, Ping; Yu, Zhengkun; Lu, Xianbo; Chen, Jiping

    2016-04-05

    Analysis of short-chain chlorinated paraffins (SCCPs) is extremely difficult because of their complex compositions with thousands of isomers and homologues. A novel analytical method, deuterodechlorination combined with high resolution gas chromatography-high resolution mass spectrometry (HRGC-HRMS), was developed. A protocol is applied in the deuterodechlorination of SCCPs with LiAlD4, and the formed deuterated n-alkanes of different alkane chains can be distinguished readily from each other on the basis of their retention time and fragment mass ([M](+)) by HRGC-HRMS. An internal standard quantification of individual SCCP congeners was achieved, in which branched C10-CPs and branched C12-CPs were used as the extraction and reaction internal standards, respectively. A maximum factor of 1.26 of the target SCCP concentrations were determined by this method, and the relative standard deviations for quantification of total SCCPs were within 10%. This method was applied to determine the congener compositions of SCCPs in commercial chlorinated paraffins and environmental and biota samples after method validation. Low-chlorinated SCCP congeners (Cl1-4) were found to account for 32.4%-62.4% of the total SCCPs. The present method provides an attractive perspective for further studies on the toxicological and environmental characteristics of SCCPs.

  18. Methods for detection of GMOs in food and feed.

    PubMed

    Marmiroli, Nelson; Maestri, Elena; Gullì, Mariolina; Malcevschi, Alessio; Peano, Clelia; Bordoni, Roberta; De Bellis, Gianluca

    2008-10-01

    This paper reviews aspects relevant to detection and quantification of genetically modified (GM) material within the feed/food chain. The GM crop regulatory framework at the international level is evaluated with reference to traceability and labelling. Current analytical methods for the detection, identification, and quantification of transgenic DNA in food and feed are reviewed. These methods include quantitative real-time PCR, multiplex PCR, and multiplex real-time PCR. Particular attention is paid to methods able to identify multiple GM events in a single reaction and to the development of microdevices and microsensors, though they have not been fully validated for application.

  19. Label-Free Fluorescent DNA Dendrimers for microRNA Detection Based On Nonlinear Hybridization Chain Reaction-Mediated Multiple G-Quadruplex with Low Background Signal.

    PubMed

    Xue, Qingwang; Liu, Chunxue; Li, Xia; Dai, Li; Wang, Huaisheng

    2018-04-18

    Various fluorescent sensing systems for miRNA detection have been developed, but they mostly contain enzymatic amplification reactions and label procedures. The strict reaction conditions of tool enzymes and the high cost of labeling limit their potential applications, especially in complex biological matrices. Here, we have addressed the difficult problems and report a strategy for label-free fluorescent DNA dendrimers based on enzyme-free nonlinear hybridization chain reaction (HCR)-mediated multiple G-quadruplex for simple, sensitive, and selective detection of miRNAs with low-background signal. In the strategy, a split G-quadruplex (3:1) sequence is ingeniously designed at both ends of two double-stranded DNAs, which is exploited as building blocks for nonlinear HCR assembly, thereby acquiring a low background signal. A hairpin switch probe (HSP) was employed as recognition and transduction element. Upon sensing the target miRNA, the nonlinear HCR assembly of two blocks (blocks-A and blocks-B) was initiated with the help of two single-stranded DNA assistants, resulting in chain-branching growth of DNA dendrimers with multiple G-quadruplex incorporation. With the zinc(II)-protoporphyrin IX (ZnPPIX) selectively intercalated into the multiple G-quadruplexes, fluorescent DNA dendrimers were obtained, leading to an exponential fluorescence intensity increase. Benefiting from excellent performances of nonlinear HCR and low background signal, this strategy possesses the characteristics of a simplified reaction operation process, as well as high sensitivity. Moreover, the proposed fluorescent sensing strategy also shows preferable selectivity, and can be implemented without modified DNA blocks. Importantly, the strategy has also been tested for miRNA quantification with high confidence in breast cancer cells. Thus, this proposed strategy for label-free fluorescent DNA dendrimers based on a nonlinear HCR-mediated multiple G-quadruplex will be turned into an alternative approach for simple, sensitive, and selective miRNA quantification.

  20. Microbial quantification in activated sludge: the hits and misses.

    PubMed

    Hall, S J; Keller, J; Blackall, L L

    2003-01-01

    Since the implementation of the activated sludge process for treating wastewater, there has been a reliance on chemical and physical parameters to monitor the system. However, in biological nutrient removal (BNR) processes, the microorganisms responsible for some of the transformations should be used to monitor the processes with the overall goal to achieve better treatment performance. The development of in situ identification and rapid quantification techniques for key microorganisms involved in BNR are required to achieve this goal. This study explored the quantification of Nitrospira, a key organism in the oxidation of nitrite to nitrate in BNR. Two molecular genetic microbial quantification techniques were evaluated: real-time polymerase chain reaction (PCR) and fluorescence in situ hybridisation (FISH) followed by digital image analysis. A correlation between the Nitrospira quantitative data and the nitrate production rate, determined in batch tests, was attempted. The disadvantages and advantages of both methods will be discussed.

  1. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei

    2008-12-01

    We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection ofmore » target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.« less

  2. Detection and Quantification of Viable and Nonviable Trypanosoma cruzi Parasites by a Propidium Monoazide Real-Time Polymerase Chain Reaction Assay

    PubMed Central

    Cancino-Faure, Beatriz; Fisa, Roser; Alcover, M. Magdalena; Jimenez-Marco, Teresa; Riera, Cristina

    2016-01-01

    Molecular techniques based on real-time polymerase chain reaction (qPCR) allow the detection and quantification of DNA but are unable to distinguish between signals from dead or live cells. Because of the lack of simple techniques to differentiate between viable and nonviable cells, the aim of this study was to optimize and evaluate a straightforward test based on propidium monoazide (PMA) dye action combined with a qPCR assay (PMA-qPCR) for the selective quantification of viable/nonviable epimastigotes of Trypanosoma cruzi. PMA has the ability to penetrate the plasma membrane of dead cells and covalently cross-link to the DNA during exposure to bright visible light, thereby inhibiting PCR amplification. Different concentrations of PMA (50–200 μM) and epimastigotes of the Maracay strain of T. cruzi (1 × 105–10 parasites/mL) were assayed; viable and nonviable parasites were tested and quantified by qPCR with a TaqMan probe specific for T. cruzi. In the PMA-qPCR assay optimized at 100 μM PMA, a significant qPCR signal reduction was observed in the nonviable versus viable epimastigotes treated with PMA, with a mean signal reduction of 2.5 logarithm units and a percentage of signal reduction > 98%, in all concentrations of parasites assayed. This signal reduction was also observed when PMA-qPCR was applied to a mixture of live/dead parasites, which allowed the detection of live cells, except when the concentration of live parasites was low (10 parasites/mL). The PMA-qPCR developed allows differentiation between viable and nonviable epimastigotes of T. cruzi and could thus be a potential method of parasite viability assessment and quantification. PMID:27139452

  3. The Next-Generation PCR-Based Quantification Method for Ambient Waters: Digital PCR.

    PubMed

    Cao, Yiping; Griffith, John F; Weisberg, Stephen B

    2016-01-01

    Real-time quantitative PCR (qPCR) is increasingly being used for ambient water monitoring, but development of digital polymerase chain reaction (digital PCR) has the potential to further advance the use of molecular techniques in such applications. Digital PCR refines qPCR by partitioning the sample into thousands to millions of miniature reactions that are examined individually for binary endpoint results, with DNA density calculated from the fraction of positives using Poisson statistics. This direct quantification removes the need for standard curves, eliminating the labor and materials associated with creating and running standards with each batch, and removing biases associated with standard variability and mismatching amplification efficiency between standards and samples. Confining reactions and binary endpoint measurements to small partitions also leads to other performance advantages, including reduced susceptibility to inhibition, increased repeatability and reproducibility, and increased capacity to measure multiple targets in one analysis. As such, digital PCR is well suited for ambient water monitoring applications and is particularly advantageous as molecular methods move toward autonomous field application.

  4. Multipurpose assessment for the quantification of Vibrio spp. and total bacteria in fish and seawater using multiplex real-time polymerase chain reaction.

    PubMed

    Kim, Ji Yeun; Lee, Jung-Lim

    2014-10-01

    This study describes the first multiplex real-time polymerase chain reaction assay developed, as a multipurpose assessment, for the simultaneous quantification of total bacteria and three Vibrio spp. (V. parahaemolyticus, V. vulnificus and V. anguillarum) in fish and seawater. The consumption of raw finfish as sushi or sashimi has been increasing the chance of Vibrio outbreaks in consumers. Freshness and quality of fishery products also depend on the total bacterial populations present. The detection sensitivity of the specific targets for the multiplex assay was 1 CFU mL⁻¹ in pure culture and seawater, and 10 CFU g⁻¹ in fish. While total bacterial counts by the multiplex assay were similar to those obtained by cultural methods, the levels of Vibrio detected by the multiplex assay were generally higher than by cultural methods of the same populations. Among the natural samples without Vibrio spp. inoculation, eight out of 10 seawater and three out of 20 fish samples were determined to contain Vibrio spp. Our data demonstrate that this multiplex assay could be useful for the rapid detection and quantification of Vibrio spp. and total bacteria as a multipurpose tool for surveillance of fish and water quality as well as diagnostic method. © 2014 The Authors. Journal of the Science of Food and Agriculture published by JohnWiley & Sons Ltd on behalf of Society of Chemical Industry.

  5. Multipurpose assessment for the quantification of Vibrio spp. and total bacteria in fish and seawater using multiplex real-time polymerase chain reaction

    PubMed Central

    Kim, Ji Yeun; Lee, Jung-Lim

    2014-01-01

    Background This study describes the first multiplex real-time polymerase chain reaction assay developed, as a multipurpose assessment, for the simultaneous quantification of total bacteria and three Vibrio spp. (V. parahaemolyticus, V. vulnificus and V. anguillarum) in fish and seawater. The consumption of raw finfish as sushi or sashimi has been increasing the chance of Vibrio outbreaks in consumers. Freshness and quality of fishery products also depend on the total bacterial populations present. Results The detection sensitivity of the specific targets for the multiplex assay was 1 CFU mL−1 in pure culture and seawater, and 10 CFU g−1 in fish. While total bacterial counts by the multiplex assay were similar to those obtained by cultural methods, the levels of Vibrio detected by the multiplex assay were generally higher than by cultural methods of the same populations. Among the natural samples without Vibrio spp. inoculation, eight out of 10 seawater and three out of 20 fish samples were determined to contain Vibrio spp. Conclusion Our data demonstrate that this multiplex assay could be useful for the rapid detection and quantification of Vibrio spp. and total bacteria as a multipurpose tool for surveillance of fish and water quality as well as diagnostic method. © 2014 The Authors. Journal of the Science of Food and Agriculture published by JohnWiley & Sons Ltd on behalf of Society of Chemical Industry. PMID:24752974

  6. Chromophore absorbance change quantification in tissue during low-level light therapy

    NASA Astrophysics Data System (ADS)

    Huynh, Daniel; Chung, Christine; Qian, Li; Lilge, Lothar

    2012-03-01

    Low Level Light Therapy (LLLT) has been implicated to stimulate tissue, promoting healing and reducing pain. One of the potential pathways stimulated by LLLT relates to the electron transport chain, where photon quantum energy can induce a change in the biochemical reactions within the cell. The aim of this study is to assess the feasibility to exploit light additionally as a diagnostic tool to determine tissue physiological states, particularly in quantifying the changes in redox states of Cytochrome C as a result of induced LLLT biochemical reactions.

  7. ddpcr: an R package and web application for analysis of droplet digital PCR data.

    PubMed

    Attali, Dean; Bidshahri, Roza; Haynes, Charles; Bryan, Jennifer

    2016-01-01

    Droplet digital polymerase chain reaction (ddPCR) is a novel platform for exact quantification of DNA which holds great promise in clinical diagnostics. It is increasingly popular due to its digital nature, which provides more accurate quantification and higher sensitivity than traditional real-time PCR. However, clinical adoption has been slowed in part by the lack of software tools available for analyzing ddPCR data. Here, we present ddpcr - a new R package for ddPCR visualization and analysis. In addition, ddpcr includes a web application (powered by the Shiny R package) that allows users to analyze ddPCR data using an interactive graphical interface.

  8. A TaqMan-based real-time PCR assay for porcine parvovirus 4 detection and quantification in reproductive tissues of sows

    USDA-ARS?s Scientific Manuscript database

    Porcine parvovirus 4 (PPV4) is a DNA virus, and a member of the Parvoviridae family within the Bocavirus genera. It was recently detected in swine, but its epidemiology and pathology remain unclear. A TaqMan-based real-time polymerase chain reaction (qPCR) assay targeting a conserved region of the O...

  9. Four human Plasmodium species quantification using droplet digital PCR.

    PubMed

    Srisutham, Suttipat; Saralamba, Naowarat; Malleret, Benoit; Rénia, Laurent; Dondorp, Arjen M; Imwong, Mallika

    2017-01-01

    Droplet digital polymerase chain reaction (ddPCR) is a partial PCR based on water-oil emulsion droplet technology. It is a highly sensitive method for detecting and delineating minor alleles from complex backgrounds and provides absolute quantification of DNA targets. The ddPCR technology has been applied for detection of many pathogens. Here the sensitive assay utilizing ddPCR for detection and quantification of Plasmodium species was investigated. The assay was developed for two levels of detection, genus specific for all Plasmodium species and for specific Plasmodium species detection. The ddPCR assay was developed based on primers and probes specific to the Plasmodium genus 18S rRNA gene. Using ddPCR for ultra-sensitive P. falciparum assessment, the lower level of detection from concentrated DNA obtained from a high volume (1 mL) blood sample was 11 parasites/mL. For species identification, in particular for samples with mixed infections, a duplex reaction was developed for detection and quantification P. falciparum/ P. vivax and P. malariae/ P. ovale. Amplification of each Plasmodium species in the duplex reaction showed equal sensitivity to singleplex single species detection. The duplex ddPCR assay had higher sensitivity to identify minor species in 32 subpatent parasitaemia samples from Cambodia, and performed better than real-time PCR. The ddPCR assay shows high sensitivity to assess very low parasitaemia of all human Plasmodium species. This provides a useful research tool for studying the role of the asymptomatic parasite reservoir for transmission in regions aiming for malaria elimination.

  10. Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

    PubMed

    Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

    2017-05-17

    Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

  11. Detection of epsilon class switching and IgE synthesis in human B cells.

    PubMed

    Pène, Jérôme; Guilhot, Florence; Cognet, Isabelle; Guglielmi, Paul; Guay-Giroux, Angélique; Bonnefoy, Jean-Yves; Elson, Greg C; Yssel, Hans; Gauchat, Jean-François

    2006-01-01

    We observed that mast cells, as other cells expressing the CD40 ligand CD154, can trigger IgE synthesis in B cells in the presence of interleukin (IL)-4. Numerous complementary techniques can be used to follow the succession of molecular events leading to IgE synthesis. This chapter will illustrate how human B cells (naïve or memory) can be purified, stored, and cultivated in medium that is permissive for IgE synthesis and stimulated with IL-4 or IL-13 and CD40 activation, the latter being induced by soluble CD154, anti-CD40 antibodies, or CD154-expressing cells. All these molecules are expressed by mast cells. The quantification of the epsilon-sterile transcript synthesis by polymerase chain reaction or Northern blot, the epsilon excision circles produced during immunoglobulin heavy chain locus rearrangement by polymerase chain reaction, and the IgE production by enzyme-linked immunosorbent assay will be described.

  12. Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

    PubMed

    Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

    2008-12-01

    One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

  13. Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications.

    PubMed

    Cao, Lei; Cui, Xingye; Hu, Jie; Li, Zedong; Choi, Jane Ru; Yang, Qingzhen; Lin, Min; Ying Hui, Li; Xu, Feng

    2017-04-15

    Since the invention of polymerase chain reaction (PCR) in 1985, PCR has played a significant role in molecular diagnostics for genetic diseases, pathogens, oncogenes and forensic identification. In the past three decades, PCR has evolved from end-point PCR, through real-time PCR, to its current version, which is the absolute quantitive digital PCR (dPCR). In this review, we first discuss the principles of all key steps of dPCR, i.e., sample dispersion, amplification, and quantification, covering commercialized apparatuses and other devices still under lab development. We highlight the advantages and disadvantages of different technologies based on these steps, and discuss the emerging biomedical applications of dPCR. Finally, we provide a glimpse of the existing challenges and future perspectives for dPCR. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Real-Time Reverse-Transcription Quantitative Polymerase Chain Reaction Assay Is a Feasible Method for the Relative Quantification of Heregulin Expression in Non-Small Cell Lung Cancer Tissue.

    PubMed

    Kristof, Jessica; Sakrison, Kellen; Jin, Xiaoping; Nakamaru, Kenji; Schneider, Matthias; Beckman, Robert A; Freeman, Daniel; Spittle, Cindy; Feng, Wenqin

    2017-01-01

    In preclinical studies, heregulin ( HRG ) expression was shown to be the most relevant predictive biomarker for response to patritumab, a fully human anti-epidermal growth factor receptor 3 monoclonal antibody. In support of a phase 2 study of erlotinib ± patritumab in non-small cell lung cancer (NSCLC), a reverse-transcription quantitative polymerase chain reaction (RT-qPCR) assay for relative quantification of HRG expression from formalin-fixed paraffin-embedded (FFPE) NSCLC tissue samples was developed and validated and described herein. Test specimens included matched FFPE normal lung and NSCLC and frozen NSCLC tissue, and HRG -positive and HRG -negative cell lines. Formalin-fixed paraffin-embedded tissue was examined for functional performance. Heregulin distribution was also analyzed across 200 NSCLC commercial samples. Applied Biosystems TaqMan Gene Expression Assays were run on the Bio-Rad CFX96 real-time PCR platform. Heregulin RT-qPCR assay specificity, PCR efficiency, PCR linearity, and reproducibility were demonstrated. The final assay parameters included the Qiagen FFPE RNA Extraction Kit for RNA extraction from FFPE NSCLC tissue, 50 ng of RNA input, and 3 reference (housekeeping) genes ( HMBS, IPO8 , and EIF2B1 ), which had expression levels similar to HRG expression levels and were stable among FFPE NSCLC samples. Using the validated assay, unimodal HRG distribution was confirmed across 185 evaluable FFPE NSCLC commercial samples. Feasibility of an RT-qPCR assay for the quantification of HRG expression in FFPE NSCLC specimens was demonstrated.

  15. Impacts of Sampling and Handling Procedures on DNA- and RNA-based Microbial Characterization and Quantification of Groundwater and Saturated Soil

    DTIC Science & Technology

    2012-07-01

    use of molecular biological techniques (MBTs) has allowed microbial ecologists and environmental engineers to determine microbial community...metabolic genes). The most common approaches used in bioremediation research are those based on the polymerase chain reaction (PCR) amplification of... bioremediation . Because of its sensitivity compared to direct hybridization/probing, PCR is increasingly used to analyze groundwater samples and soil samples

  16. Microarray Analysis of Differential Gene Expression Profile Between Human Fetal and Adult Heart.

    PubMed

    Geng, Zhimin; Wang, Jue; Pan, Lulu; Li, Ming; Zhang, Jitai; Cai, Xueli; Chu, Maoping

    2017-04-01

    Although many changes have been discovered during heart maturation, the genetic mechanisms involved in the changes between immature and mature myocardium have only been partially elucidated. Here, gene expression profile changed between the human fetal and adult heart was characterized. A human microarray was applied to define the gene expression signatures of the fetal (13-17 weeks of gestation, n = 4) and adult hearts (30-40 years old, n = 4). Gene ontology analyses, pathway analyses, gene set enrichment analyses, and signal transduction network were performed to predict the function of the differentially expressed genes. Ten mRNAs were confirmed by quantificational real-time polymerase chain reaction. 5547 mRNAs were found to be significantly differentially expressed. "Cell cycle" was the most enriched pathway in the down-regulated genes. EFGR, IGF1R, and ITGB1 play a central role in the regulation of heart development. EGFR, IGF1R, and FGFR2 were the core genes regulating cardiac cell proliferation. The quantificational real-time polymerase chain reaction results were concordant with the microarray data. Our data identified the transcriptional regulation of heart development in the second trimester and the potential regulators that play a prominent role in the regulation of heart development and cardiac cells proliferation.

  17. Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

    PubMed

    Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

    2009-11-25

    Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

  18. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means ofmore » rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.« less

  19. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

    USGS Publications Warehouse

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.

    2006-01-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  20. Optimized methods for total nucleic acid extraction and quantification of the bat white-nose syndrome fungus, Pseudogymnoascus destructans, from swab and environmental samples.

    PubMed

    Verant, Michelle L; Bohuski, Elizabeth A; Lorch, Jeffery M; Blehert, David S

    2016-03-01

    The continued spread of white-nose syndrome and its impacts on hibernating bat populations across North America has prompted nationwide surveillance efforts and the need for high-throughput, noninvasive diagnostic tools. Quantitative real-time polymerase chain reaction (qPCR) analysis has been increasingly used for detection of the causative fungus, Pseudogymnoascus destructans, in both bat- and environment-associated samples and provides a tool for quantification of fungal DNA useful for research and monitoring purposes. However, precise quantification of nucleic acid from P. destructans is dependent on effective and standardized methods for extracting nucleic acid from various relevant sample types. We describe optimized methodologies for extracting fungal nucleic acids from sediment, guano, and swab-based samples using commercial kits together with a combination of chemical, enzymatic, and mechanical modifications. Additionally, we define modifications to a previously published intergenic spacer-based qPCR test for P. destructans to refine quantification capabilities of this assay. © 2016 The Author(s).

  1. Optimized methods for total nucleic acid extraction and quantification of the bat white-nose syndrome fungus, Pseudogymnoascus destructans, from swab and environmental samples

    USGS Publications Warehouse

    Verant, Michelle; Bohuski, Elizabeth A.; Lorch, Jeffrey M.; Blehert, David

    2016-01-01

    The continued spread of white-nose syndrome and its impacts on hibernating bat populations across North America has prompted nationwide surveillance efforts and the need for high-throughput, noninvasive diagnostic tools. Quantitative real-time polymerase chain reaction (qPCR) analysis has been increasingly used for detection of the causative fungus, Pseudogymnoascus destructans, in both bat- and environment-associated samples and provides a tool for quantification of fungal DNA useful for research and monitoring purposes. However, precise quantification of nucleic acid fromP. destructans is dependent on effective and standardized methods for extracting nucleic acid from various relevant sample types. We describe optimized methodologies for extracting fungal nucleic acids from sediment, guano, and swab-based samples using commercial kits together with a combination of chemical, enzymatic, and mechanical modifications. Additionally, we define modifications to a previously published intergenic spacer–based qPCR test for P. destructans to refine quantification capabilities of this assay.

  2. Real-time polymerase chain reaction-based approach for quantification of the pat gene in the T25 Zea mays event.

    PubMed

    Weighardt, Florian; Barbati, Cristina; Paoletti, Claudia; Querci, Maddalena; Kay, Simon; De Beuckeleer, Marc; Van den Eede, Guy

    2004-01-01

    In Europe, a growing interest for reliable techniques for the quantification of genetically modified component(s) of food matrixes is arising from the need to comply with the European legislative framework on novel food products. Real-time polymerase chain reaction (PCR) is currently the most powerful technique for the quantification of specific nucleic acid sequences. Several real-time PCR methodologies based on different molecular principles have been developed for this purpose. The most frequently used approach in the field of genetically modified organism (GMO) quantification in food or feed samples is based on the 5'-3'-exonuclease activity of Taq DNA polymerase on specific degradation probes (TaqMan principle). A novel approach was developed for the establishment of a TaqMan quantification system assessing GMO contents around the 1% threshold stipulated under European Union (EU) legislation for the labeling of food products. The Zea mays T25 elite event was chosen as a model for the development of the novel GMO quantification approach. The most innovative aspect of the system is represented by the use of sequences cloned in plasmids as reference standards. In the field of GMO quantification, plasmids are an easy to use, cheap, and reliable alternative to Certified Reference Materials (CRMs), which are only available for a few of the GMOs authorized in Europe, have a relatively high production cost, and require further processing to be suitable for analysis. Strengths and weaknesses of the use of novel plasmid-based standards are addressed in detail. In addition, the quantification system was designed to avoid the use of a reference gene (e.g., a single copy, species-specific gene) as normalizer, i.e., to perform a GMO quantification based on an absolute instead of a relative measurement. In fact, experimental evidences show that the use of reference genes adds variability to the measurement system because a second independent real-time PCR-based measurement must be performed. Moreover, for some reference genes no sufficient information on copy number in and among genomes of different lines is available, making adequate quantification difficult. Once developed, the method was subsequently validated according to IUPAC and ISO 5725 guidelines. Thirteen laboratories from 8 EU countries participated in the trial. Eleven laboratories provided results complying with the predefined study requirements. Repeatability (RSDr) values ranged from 8.7 to 15.9%, with a mean value of 12%. Reproducibility (RSDR) values ranged from 16.3 to 25.5%, with a mean value of 21%. Following Codex Alimentarius Committee guidelines, both the limits of detection and quantitation were determined to be <0.1%.

  3. GMO detection using a bioluminescent real time reporter (BART) of loop mediated isothermal amplification (LAMP) suitable for field use.

    PubMed

    Kiddle, Guy; Hardinge, Patrick; Buttigieg, Neil; Gandelman, Olga; Pereira, Clint; McElgunn, Cathal J; Rizzoli, Manuela; Jackson, Rebecca; Appleton, Nigel; Moore, Cathy; Tisi, Laurence C; Murray, James A H

    2012-04-30

    There is an increasing need for quantitative technologies suitable for molecular detection in a variety of settings for applications including food traceability and monitoring of genetically modified (GM) crops and their products through the food processing chain. Conventional molecular diagnostics utilising real-time polymerase chain reaction (RT-PCR) and fluorescence-based determination of amplification require temperature cycling and relatively complex optics. In contrast, isothermal amplification coupled to a bioluminescent output produced in real-time (BART) occurs at a constant temperature and only requires a simple light detection and integration device. Loop mediated isothermal amplification (LAMP) shows robustness to sample-derived inhibitors. Here we show the applicability of coupled LAMP and BART reactions (LAMP-BART) for determination of genetically modified (GM) maize target DNA at low levels of contamination (0.1-5.0% GM) using certified reference material, and compare this to RT-PCR. Results show that conventional DNA extraction methods developed for PCR may not be optimal for LAMP-BART quantification. Additionally, we demonstrate that LAMP is more tolerant to plant sample-derived inhibitors, and show this can be exploited to develop rapid extraction techniques suitable for simple field-based qualitative tests for GM status determination. We also assess the effect of total DNA assay load on LAMP-BART quantitation. LAMP-BART is an effective and sensitive technique for GM detection with significant potential for quantification even at low levels of contamination and in samples derived from crops such as maize with a large genome size. The resilience of LAMP-BART to acidic polysaccharides makes it well suited to rapid sample preparation techniques and hence to both high throughput laboratory settings and to portable GM detection applications. The impact of the plant sample matrix and genome loading within a reaction must be controlled to ensure quantification at low target concentrations.

  4. Detection and quantification of serum or plasma HCV RNA: mini review of commercially available assays.

    PubMed

    Le Guillou-Guillemette, Helene; Lunel-Fabiani, Francoise

    2009-01-01

    The treatment schedule (combination of compounds, doses, and duration) and the virological follow-up for management of antiviral treatment in patients chronically infected by HCV is now well standardized, but to ensure good monitoring of the treated patients, physicians need rapid, reproducible, and sensitive molecular virological tools with a wide range of detection and quantification of HCV RNA in blood samples. Several assays for detection and/or quantification of HCV RNA are currently commercially available. Here, all these assays are detailed, and a brief description of each step of the assay is provided. They are divided into two categories by method: those based on signal amplification and those based on target amplification. These two categories are then divided into qualitative, quantitative, and quantitative detection assays. The real-time reverse-transcription polymerase chain reaction (RT-PCR)-based assays are the most promising strategy in the HCV virological area.

  5. Detection and quantification of Leptographium wageneri, the cause of black-stain root disease, from bark beetles (Coleoptera: Scolytidae) in North California using regular and real-time PCR

    Treesearch

    Wolfgang Schweigkofler; William J. Otrosina; Sheri L. Smith; Daniel R. Cluck; Kevin Maeda; Kabir G. Peay; Matteo Garbelotto

    2005-01-01

    Black-stain root disease is a threat to conifer forests in western North America. The disease is caused by the ophiostomatoid fungus Leptographium wageneri (W.B. Kendr.) M.J. Wingf., which is associated with a number of bark beetle (Coleoptera: Scolytidae) and weevil species (Coleoptera: Curculionidae). We developed a polymerase chain reaction test...

  6. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji

    2011-01-01

    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  7. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

    PubMed

    Ririe, K M; Rasmussen, R P; Wittwer, C T

    1997-02-15

    A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

  8. Novel quantitative real-time LCR for the sensitive detection of SNP frequencies in pooled DNA: method development, evaluation and application.

    PubMed

    Psifidi, Androniki; Dovas, Chrysostomos; Banos, Georgios

    2011-01-19

    Single nucleotide polymorphisms (SNP) have proven to be powerful genetic markers for genetic applications in medicine, life science and agriculture. A variety of methods exist for SNP detection but few can quantify SNP frequencies when the mutated DNA molecules correspond to a small fraction of the wild-type DNA. Furthermore, there is no generally accepted gold standard for SNP quantification, and, in general, currently applied methods give inconsistent results in selected cohorts. In the present study we sought to develop a novel method for accurate detection and quantification of SNP in DNA pooled samples. The development and evaluation of a novel Ligase Chain Reaction (LCR) protocol that uses a DNA-specific fluorescent dye to allow quantitative real-time analysis is described. Different reaction components and thermocycling parameters affecting the efficiency and specificity of LCR were examined. Several protocols, including gap-LCR modifications, were evaluated using plasmid standard and genomic DNA pools. A protocol of choice was identified and applied for the quantification of a polymorphism at codon 136 of the ovine PRNP gene that is associated with susceptibility to a transmissible spongiform encephalopathy in sheep. The real-time LCR protocol developed in the present study showed high sensitivity, accuracy, reproducibility and a wide dynamic range of SNP quantification in different DNA pools. The limits of detection and quantification of SNP frequencies were 0.085% and 0.35%, respectively. The proposed real-time LCR protocol is applicable when sensitive detection and accurate quantification of low copy number mutations in DNA pools is needed. Examples include oncogenes and tumour suppressor genes, infectious diseases, pathogenic bacteria, fungal species, viral mutants, drug resistance resulting from point mutations, and genetically modified organisms in food.

  9. Novel Quantitative Real-Time LCR for the Sensitive Detection of SNP Frequencies in Pooled DNA: Method Development, Evaluation and Application

    PubMed Central

    Psifidi, Androniki; Dovas, Chrysostomos; Banos, Georgios

    2011-01-01

    Background Single nucleotide polymorphisms (SNP) have proven to be powerful genetic markers for genetic applications in medicine, life science and agriculture. A variety of methods exist for SNP detection but few can quantify SNP frequencies when the mutated DNA molecules correspond to a small fraction of the wild-type DNA. Furthermore, there is no generally accepted gold standard for SNP quantification, and, in general, currently applied methods give inconsistent results in selected cohorts. In the present study we sought to develop a novel method for accurate detection and quantification of SNP in DNA pooled samples. Methods The development and evaluation of a novel Ligase Chain Reaction (LCR) protocol that uses a DNA-specific fluorescent dye to allow quantitative real-time analysis is described. Different reaction components and thermocycling parameters affecting the efficiency and specificity of LCR were examined. Several protocols, including gap-LCR modifications, were evaluated using plasmid standard and genomic DNA pools. A protocol of choice was identified and applied for the quantification of a polymorphism at codon 136 of the ovine PRNP gene that is associated with susceptibility to a transmissible spongiform encephalopathy in sheep. Conclusions The real-time LCR protocol developed in the present study showed high sensitivity, accuracy, reproducibility and a wide dynamic range of SNP quantification in different DNA pools. The limits of detection and quantification of SNP frequencies were 0.085% and 0.35%, respectively. Significance The proposed real-time LCR protocol is applicable when sensitive detection and accurate quantification of low copy number mutations in DNA pools is needed. Examples include oncogenes and tumour suppressor genes, infectious diseases, pathogenic bacteria, fungal species, viral mutants, drug resistance resulting from point mutations, and genetically modified organisms in food. PMID:21283808

  10. Detection and quantification of periodontal pathogens in smokers and never-smokers with chronic periodontitis by real-time polymerase chain reaction.

    PubMed

    Guglielmetti, Mariana R; Rosa, Ecinele F; Lourenção, Daniele S; Inoue, Gislene; Gomes, Elaine F; De Micheli, Giorgio; Mendes, Fausto Medeiros; Hirata, Rosário D C; Hirata, Mario H; Pannuti, Claudio M

    2014-10-01

    The purpose of the present investigation is to compare the presence and number of periodontal pathogens in the subgingival microbiota of smokers versus never-smokers with chronic periodontitis and matched probing depths (PDs) using real-time polymerase chain reaction (RT-PCR). Forty current smokers and 40 never-smokers, matched for age, sex, and mean PD of sampling site, were included in this investigation. A full-mouth periodontal examination was performed, and a pooled subgingival plaque sample was collected from the deepest site in each quadrant of each participant. To confirm smoking status, expired carbon monoxide (CO) concentrations were measured with a CO monitor. The presence and quantification of Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Tannerella forsythia, and Treponema denticola were determined using RT-PCR. Smokers had greater overall mean PD (P = 0.001) and attachment loss (P = 0.006) and fewer bleeding on probing sites (P = 0.001). An association was observed between smoking status and the presence of A. actinomycetemcomitans (P <0.001). The counts of A. actinomycetemcomitans (P <0.001), P. gingivalis (P = 0.042), and T. forsythia (P <0.001) were significantly higher in smokers. Smokers showed significantly greater amounts of P. gingivalis, A. actinomycetemcomitans, and T. forsythia than never-smokers. There was a significant association between smoking and the presence of A. actinomycetemcomitans.

  11. A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

    PubMed

    Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

    2008-09-01

    Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

  12. Digital isothermal quantification of nucleic acids via simultaneous chemical initiation of recombinase polymerase amplification reactions on SlipChip.

    PubMed

    Shen, Feng; Davydova, Elena K; Du, Wenbin; Kreutz, Jason E; Piepenburg, Olaf; Ismagilov, Rustem F

    2011-05-01

    In this paper, digital quantitative detection of nucleic acids was achieved at the single-molecule level by chemical initiation of over one thousand sequence-specific, nanoliter isothermal amplification reactions in parallel. Digital polymerase chain reaction (digital PCR), a method used for quantification of nucleic acids, counts the presence or absence of amplification of individual molecules. However, it still requires temperature cycling, which is undesirable under resource-limited conditions. This makes isothermal methods for nucleic acid amplification, such as recombinase polymerase amplification (RPA), more attractive. A microfluidic digital RPA SlipChip is described here for simultaneous initiation of over one thousand nL-scale RPA reactions by adding a chemical initiator to each reaction compartment with a simple slipping step after instrument-free pipet loading. Two designs of the SlipChip, two-step slipping and one-step slipping, were validated using digital RPA. By using the digital RPA SlipChip, false-positive results from preinitiation of the RPA amplification reaction before incubation were eliminated. End point fluorescence readout was used for "yes or no" digital quantification. The performance of digital RPA in a SlipChip was validated by amplifying and counting single molecules of the target nucleic acid, methicillin-resistant Staphylococcus aureus (MRSA) genomic DNA. The digital RPA on SlipChip was also tolerant to fluctuations of the incubation temperature (37-42 °C), and its performance was comparable to digital PCR on the same SlipChip design. The digital RPA SlipChip provides a simple method to quantify nucleic acids without requiring thermal cycling or kinetic measurements, with potential applications in diagnostics and environmental monitoring under resource-limited settings. The ability to initiate thousands of chemical reactions in parallel on the nanoliter scale using solvent-resistant glass devices is likely to be useful for a broader range of applications.

  13. Digital Isothermal Quantification of Nucleic Acids via Simultaneous Chemical Initiation of Recombinase Polymerase Amplification Reactions on SlipChip

    PubMed Central

    Shen, Feng; Davydova, Elena K.; Du, Wenbin; Kreutz, Jason E.; Piepenburg, Olaf; Ismagilov, Rustem F.

    2011-01-01

    In this paper, digital quantitative detection of nucleic acids was achieved at the single-molecule level by chemical initiation of over one thousand sequence-specific, nanoliter, isothermal amplification reactions in parallel. Digital polymerase chain reaction (digital PCR), a method used for quantification of nucleic acids, counts the presence or absence of amplification of individual molecules. However it still requires temperature cycling, which is undesirable under resource-limited conditions. This makes isothermal methods for nucleic acid amplification, such as recombinase polymerase amplification (RPA), more attractive. A microfluidic digital RPA SlipChip is described here for simultaneous initiation of over one thousand nL-scale RPA reactions by adding a chemical initiator to each reaction compartment with a simple slipping step after instrument-free pipette loading. Two designs of the SlipChip, two-step slipping and one-step slipping, were validated using digital RPA. By using the digital RPA SlipChip, false positive results from pre-initiation of the RPA amplification reaction before incubation were eliminated. End-point fluorescence readout was used for “yes or no” digital quantification. The performance of digital RPA in a SlipChip was validated by amplifying and counting single molecules of the target nucleic acid, Methicillin-resistant Staphylococcus aureus (MRSA) genomic DNA. The digital RPA on SlipChip was also tolerant to fluctuations of the incubation temperature (37–42 °C), and its performance was comparable to digital PCR on the same SlipChip design. The digital RPA SlipChip provides a simple method to quantify nucleic acids without requiring thermal cycling or kinetic measurements, with potential applications in diagnostics and environmental monitoring under resource-limited settings. The ability to initiate thousands of chemical reactions in parallel on the nanoliter scale using solvent-resistant glass devices is likely to be useful for a broader range of applications. PMID:21476587

  14. GMO quantification: valuable experience and insights for the future.

    PubMed

    Milavec, Mojca; Dobnik, David; Yang, Litao; Zhang, Dabing; Gruden, Kristina; Zel, Jana

    2014-10-01

    Cultivation and marketing of genetically modified organisms (GMOs) have been unevenly adopted worldwide. To facilitate international trade and to provide information to consumers, labelling requirements have been set up in many countries. Quantitative real-time polymerase chain reaction (qPCR) is currently the method of choice for detection, identification and quantification of GMOs. This has been critically assessed and the requirements for the method performance have been set. Nevertheless, there are challenges that should still be highlighted, such as measuring the quantity and quality of DNA, and determining the qPCR efficiency, possible sequence mismatches, characteristics of taxon-specific genes and appropriate units of measurement, as these remain potential sources of measurement uncertainty. To overcome these problems and to cope with the continuous increase in the number and variety of GMOs, new approaches are needed. Statistical strategies of quantification have already been proposed and expanded with the development of digital PCR. The first attempts have been made to use new generation sequencing also for quantitative purposes, although accurate quantification of the contents of GMOs using this technology is still a challenge for the future, and especially for mixed samples. New approaches are needed also for the quantification of stacks, and for potential quantification of organisms produced by new plant breeding techniques.

  15. Wheat-specific gene, ribosomal protein l21, used as the endogenous reference gene for qualitative and real-time quantitative polymerase chain reaction detection of transgenes.

    PubMed

    Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai

    2014-10-29

    Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.

  16. Data on synthesis and thermo-mechanical properties of stimuli-responsive rubber materials bearing pendant anthracene groups.

    PubMed

    Manhart, Jakob; Ayalur-Karunakaran, Santhosh; Radl, Simone; Oesterreicher, Andreas; Moser, Andreas; Ganser, Christian; Teichert, Christian; Pinter, Gerald; Kern, Wolfgang; Griesser, Thomas; Schlögl, Sandra

    2016-12-01

    The photo-reversible [4πs+4πs] cycloaddition reaction of pendant anthracene moieties represents a convenient strategy to impart wavelength dependent properties into hydrogenated carboxylated nitrile butadiene rubber (HXNBR) networks. The present article provides the 1 H NMR data on the reaction kinetics of the side chain functionalization of HXNBR. 2-(Anthracene-9-yl)oxirane with reactive epoxy groups is covalently attached to the polymer side chain of HXNBR via ring opening reaction between the epoxy and the carboxylic groups. Along with the identification, 1 H NMR data on the quantification of the attached functional groups are shown in dependence on reaction time and concentration of 2-(anthracene-9-yl)oxirane. Changes in the modification yield are reflected in the mechanical properties and DMA data of photo-responsive elastomers are illustrated in dependence on the number of attached anthracene groups. DMA curves over repeated cycles of UV induced crosslinking ( λ >300 nm) and UV induced cleavage ( λ =254 nm) are further depicted, demonstrating the photo-reversibility of the thermo-mechanical properties. Interpretation and discussion of the data are provided in "Design and application of photo-reversible elastomer networks by using the [4πs+4πs] cycloaddition reaction of pendant anthracene groups" (Manhart et al., 2016) [1].

  17. Vascular endothelial growth factor and platelet-derived growth factor are potential angiogenic and metastatic factors in human breast cancer.

    PubMed

    Anan, K; Morisaki, T; Katano, M; Ikubo, A; Kitsuki, H; Uchiyama, A; Kuroki, S; Tanaka, M; Torisu, M

    1996-03-01

    Angiogenesis is a prerequisite for tumor growth and metastasis. Tumor angiogenesis may be mediated by several angiogenic factors such as vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), transforming growth factor-alpha, and basic fibroblast growth factor. Differential mRNA expressions of VEGF, PDGF (A chain), transforming growth factor-alpha and basic fibroblast growth factor in 32 primary invasive breast tumors were examined by reverse transcriptase-polymerase chain reaction. We analyzed relationships between mRNA expressions of these angiogenic factors and the degree of angiogenesis, tumor size, and metastasis. Quantification of angiogenesis was achieved by the immunohistochemical staining of endothelial cells with antibody to CD31. VEGF and PDGF-A mRNAs were expressed more frequently in breast tumors than in nontumor breast tissues, whereas no difference was found in expression frequency of either transforming growth factor-alpha or basic fibroblast growth factor mRNA. Vascular counts in tumors correlated with each expression frequency of VEGF and PDGF-A mRNA. PDGF-A mRNA was expressed more frequently in tumors with lymph node metastasis than in those without metastasis. Expression of VEGF and PDGF mRNAs detected by reverse transcriptase-polymerase chain reaction in breast tumors correlates with tumor-related characteristics of angiogenesis and metastatic potential. Analysis of these mRNAs by reverse transcriptase-polymerase chain reaction may be useful for assessing the biologic behavior of a breast tumor before surgical treatment.

  18. Real-time PCR machine system modeling and a systematic approach for the robust design of a real-time PCR-on-a-chip system.

    PubMed

    Lee, Da-Sheng

    2010-01-01

    Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR) machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DNA quantification and achieve a robust design for a real-time PCR-on-a-chip system. Accelerated lift testing was adopted to evaluate the reliability of the chip prototype. According to the life test plan, this proposed real-time PCR-on-a-chip system was simulated to work continuously for over three years with similar reproducibility in DNA quantification. This not only shows the robustness of the lab-on-a-chip system, but also verifies the effectiveness of our systematic method for achieving a robust design.

  19. A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

    PubMed Central

    Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

    2008-01-01

    Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880

  20. Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo

    PubMed Central

    Yang, Jin-Long; Cheng, An-Chun; Wang, Ming-Shu; Pan, Kang-Cheng; Li, Min; Guo, Yu-Fei; Li, Chuan-Feng; Zhu, De-Kang; Chen, Xiao-Yue

    2009-01-01

    Background Goose parvovirus (GPV) is a Dependovirus associated with latent infection and mortality in geese. Currently, it severely affects geese production worldwide. The objective of this study was to develop a fluorescent quantitative real-time polymerase chain reaction (PCR) (FQ-PCR) assay for fast and accurate quantification of GPV DNA in infected goslings, which can aid in the understanding of the regular distribution pattern and the nosogenesis of GPV in vivo. Results The detection limit of the assay was 2.8 × 101 standard DNA copies, with a sensitivity of 3 logs higher than that of the conventional gel-based PCR assay targeting the same gene. The real-time PCR was reproducible, as shown by satisfactory low intraassay and interassay coefficients of variation. Conclusion The high sensitivity, specificity, simplicity, and reproducibility of the GPV fluorogenic PCR assay, combined with a high throughput, make this method suitable for a broad spectrum of GPV etiology-related applications. PMID:19754946

  1. Inkjet Printing Based Droplet Generation for Integrated Online Digital Polymerase Chain Reaction.

    PubMed

    Zhang, Weifei; Li, Nan; Koga, Daisuke; Zhang, Yong; Zeng, Hulie; Nakajima, Hizuru; Lin, Jin-Ming; Uchiyama, Katsumi

    2018-04-17

    We report on the development of a novel and flexible online digital polymerase chain reaction (dPCR) system. The system was composed of three parts: an inkjet for generating the droplets, a coiled fused-silica capillary for thermal cycling, and a laser-induced fluorescence detector (LIFD) for positive droplet counting. Upon inkjet printing, monodisperse droplets were continuously generated in the oil phase and then introduced into the capillary in the form of a stable dispersion. The droplets containing one or zero molecules of target DNA passed through the helical capillary that was attached to a cylindrical thermal cycler for PCR amplification, resulting in the generation of fluorescence for the DNA-positive droplet. After 36 PCR cycles, the fluorescence signal intensity was detected by laser-induced fluorescence located at the downstream of the capillary, followed by a positive/negative counting. The present system was successfully applied to the absolute quantification of the HPV sequence in Caski cells with dynamic ranges spanning 4 orders of magnitude.

  2. How to Make Data a Blessing to Parametric Uncertainty Quantification and Reduction?

    NASA Astrophysics Data System (ADS)

    Ye, M.; Shi, X.; Curtis, G. P.; Kohler, M.; Wu, J.

    2013-12-01

    In a Bayesian point of view, probability of model parameters and predictions are conditioned on data used for parameter inference and prediction analysis. It is critical to use appropriate data for quantifying parametric uncertainty and its propagation to model predictions. However, data are always limited and imperfect. When a dataset cannot properly constrain model parameters, it may lead to inaccurate uncertainty quantification. While in this case data appears to be a curse to uncertainty quantification, a comprehensive modeling analysis may help understand the cause and characteristics of parametric uncertainty and thus turns data into a blessing. In this study, we illustrate impacts of data on uncertainty quantification and reduction using an example of surface complexation model (SCM) developed to simulate uranyl (U(VI)) adsorption. The model includes two adsorption sites, referred to as strong and weak sites. The amount of uranium adsorption on these sites determines both the mean arrival time and the long tail of the breakthrough curves. There is one reaction on the weak site but two reactions on the strong site. The unknown parameters include fractions of the total surface site density of the two sites and surface complex formation constants of the three reactions. A total of seven experiments were conducted with different geochemical conditions to estimate these parameters. The experiments with low initial concentration of U(VI) result in a large amount of parametric uncertainty. A modeling analysis shows that it is because the experiments cannot distinguish the relative adsorption affinity of the strong and weak sites on uranium adsorption. Therefore, the experiments with high initial concentration of U(VI) are needed, because in the experiments the strong site is nearly saturated and the weak site can be determined. The experiments with high initial concentration of U(VI) are a blessing to uncertainty quantification, and the experiments with low initial concentration help modelers turn a curse into a blessing. The data impacts on uncertainty quantification and reduction are quantified using probability density functions of model parameters obtained from Markov Chain Monte Carlo simulation using the DREAM algorithm. This study provides insights to model calibration, uncertainty quantification, experiment design, and data collection in groundwater reactive transport modeling and other environmental modeling.

  3. Molecular identification and quantification of bacteria from endodontic infections using real-time polymerase chain reaction.

    PubMed

    Blome, B; Braun, A; Sobarzo, V; Jepsen, S

    2008-10-01

    It was the aim of the present study to evaluate root canal samples for the presence and numbers of specific species as well as for total bacterial load in teeth with chronic apical periodontitis using quantitative real-time polymerase chain reaction (PCR). Forty adult patients with one radiographically documented periapical lesion were included. Twenty teeth presented with primary infections and 20 with secondary infections, requiring retreatment. After removal of necrotic pulp tissue or root canal filling, a first bacterial sample was obtained. Following chemo-mechanical root canal preparation a second sample was taken and a third sample was obtained after 14 days of intracanal dressing with calcium hydroxide. Analysis by real-time PCR enabled the quantification of total bacterial counts and of nine selected species. Root canals with primary infections harbored significantly more bacteria (by total bacterial count) than teeth with secondary infections (P < 0.05). Mean total bacterial count in the retreatment group was 2.1 x 10(6) and was significantly reduced following root canal preparation (3.6 x 10(4)) and intracanal dressing (1.4 x 10(5)). Corresponding values for primary infections were: 4.6 x 10(7), 3.6 x 10(4), and 6.9 x 10(4). The numbers of the selected bacteria and their detection frequency were also significantly reduced. Root canals with primary infections contained a higher bacterial load. Chemo-mechanical root canal preparation reduced bacterial counts by at least 95%.

  4. Rapid and accurate identification by real-time PCR of biotoxin-producing dinoflagellates from the family gymnodiniaceae.

    PubMed

    Smith, Kirsty F; de Salas, Miguel; Adamson, Janet; Rhodes, Lesley L

    2014-03-07

    The identification of toxin-producing dinoflagellates for monitoring programmes and bio-compound discovery requires considerable taxonomic expertise. It can also be difficult to morphologically differentiate toxic and non-toxic species or strains. Various molecular methods have been used for dinoflagellate identification and detection, and this study describes the development of eight real-time polymerase chain reaction (PCR) assays targeting the large subunit ribosomal RNA (LSU rRNA) gene of species from the genera Gymnodinium, Karenia, Karlodinium, and Takayama. Assays proved to be highly specific and sensitive, and the assay for G. catenatum was further developed for quantification in response to a bloom in Manukau Harbour, New Zealand. The assay estimated cell densities from environmental samples as low as 0.07 cells per PCR reaction, which equated to three cells per litre. This assay not only enabled conclusive species identification but also detected the presence of cells below the limit of detection for light microscopy. This study demonstrates the usefulness of real-time PCR as a sensitive and rapid molecular technique for the detection and quantification of micro-algae from environmental samples.

  5. Single cell digital polymerase chain reaction on self-priming compartmentalization chip

    PubMed Central

    Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

    2017-01-01

    Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267

  6. Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

    PubMed

    Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

    2017-01-01

    Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.

  7. Evaluation of the performance of quantitative detection of the Listeria monocytogenes prfA locus with droplet digital PCR.

    PubMed

    Witte, Anna Kristina; Fister, Susanne; Mester, Patrick; Schoder, Dagmar; Rossmanith, Peter

    2016-11-01

    Fast and reliable pathogen detection is an important issue for human health. Since conventional microbiological methods are rather slow, there is growing interest in detection and quantification using molecular methods. The droplet digital polymerase chain reaction (ddPCR) is a relatively new PCR method for absolute and accurate quantification without external standards. Using the Listeria monocytogenes specific prfA assay, we focused on the questions of whether the assay was directly transferable to ddPCR and whether ddPCR was suitable for samples derived from heterogeneous matrices, such as foodstuffs that often included inhibitors and a non-target bacterial background flora. Although the prfA assay showed suboptimal cluster formation, use of ddPCR for quantification of L. monocytogenes from pure bacterial cultures, artificially contaminated cheese, and naturally contaminated foodstuff was satisfactory over a relatively broad dynamic range. Moreover, results demonstrated the outstanding detection limit of one copy. However, while poorer DNA quality, such as resulting from longer storage, can impair ddPCR, internal amplification control (IAC) of prfA by ddPCR, that is integrated in the genome of L. monocytogenes ΔprfA, showed even slightly better quantification over a broader dynamic range. Graphical Abstract Evaluating the absolute quantification potential of ddPCR targeting Listeria monocytogenes prfA.

  8. Enhanced analysis of real-time PCR data by using a variable efficiency model: FPK-PCR

    PubMed Central

    Lievens, Antoon; Van Aelst, S.; Van den Bulcke, M.; Goetghebeur, E.

    2012-01-01

    Current methodology in real-time Polymerase chain reaction (PCR) analysis performs well provided PCR efficiency remains constant over reactions. Yet, small changes in efficiency can lead to large quantification errors. Particularly in biological samples, the possible presence of inhibitors forms a challenge. We present a new approach to single reaction efficiency calculation, called Full Process Kinetics-PCR (FPK-PCR). It combines a kinetically more realistic model with flexible adaptation to the full range of data. By reconstructing the entire chain of cycle efficiencies, rather than restricting the focus on a ‘window of application’, one extracts additional information and loses a level of arbitrariness. The maximal efficiency estimates returned by the model are comparable in accuracy and precision to both the golden standard of serial dilution and other single reaction efficiency methods. The cycle-to-cycle changes in efficiency, as described by the FPK-PCR procedure, stay considerably closer to the data than those from other S-shaped models. The assessment of individual cycle efficiencies returns more information than other single efficiency methods. It allows in-depth interpretation of real-time PCR data and reconstruction of the fluorescence data, providing quality control. Finally, by implementing a global efficiency model, reproducibility is improved as the selection of a window of application is avoided. PMID:22102586

  9. dPCR: A Technology Review

    PubMed Central

    Quan, Phenix-Lan; Sauzade, Martin

    2018-01-01

    Digital Polymerase Chain Reaction (dPCR) is a novel method for the absolute quantification of target nucleic acids. Quantification by dPCR hinges on the fact that the random distribution of molecules in many partitions follows a Poisson distribution. Each partition acts as an individual PCR microreactor and partitions containing amplified target sequences are detected by fluorescence. The proportion of PCR-positive partitions suffices to determine the concentration of the target sequence without a need for calibration. Advances in microfluidics enabled the current revolution of digital quantification by providing efficient partitioning methods. In this review, we compare the fundamental concepts behind the quantification of nucleic acids by dPCR and quantitative real-time PCR (qPCR). We detail the underlying statistics of dPCR and explain how it defines its precision and performance metrics. We review the different microfluidic digital PCR formats, present their underlying physical principles, and analyze the technological evolution of dPCR platforms. We present the novel multiplexing strategies enabled by dPCR and examine how isothermal amplification could be an alternative to PCR in digital assays. Finally, we determine whether the theoretical advantages of dPCR over qPCR hold true by perusing studies that directly compare assays implemented with both methods. PMID:29677144

  10. Antiadhesion activity of juniper (Juniperus communis L.) preparations against Campylobacter jejuni evaluated with PCR-based methods.

    PubMed

    Klančnik, Anja; Zorko, Špela; Toplak, Nataša; Kovač, Minka; Bucar, Franz; Jeršek, Barbara; Smole Možina, Sonja

    2018-03-01

    The food-borne pathogen Campylobacter jejuni can cause bacterial gastrointestinal infections. Biofilm formation amplifies the risk of human infection by improving survival and persistence of C. jejuni in food processing environments and its transmission through the food chain. We aimed to control C. jejuni using an alternative strategy of low doses of Juniperus communis fruit preparations to target bacterial adhesion properties in the first step of biofilm formation. First, we defined the anti-Campylobacter activity of a juniper fruit crude extract and its fractionated biflavonoids, flavone glycosides, and purified amentoflavone, of juniper fruit essential oil and of juniper fruit postdistillation waste material extract. For accurate quantification of adherent C. jejuni, we optimised digital Polymerase Chain Reaction (PCR) and quantitative real-time PCR for construction of standard curves and quantification. We show for the first time that juniper fruit formulations can effectively inhibit adhesion of C. jejuni to polystyrene. Furthermore, ≥94% of the antiadhesion activity of juniper fruit crude extract and juniper fruit essential oil remained under food-related conditions: modified culture medium with glucose, or a stainless steel surface, or mixed co-cultures of C. jejuni and Listeria monocytogenes. This study indicates that addition of juniper fruit formulations can control growth and adhesion of C. jejuni and thus limit food chain transmission of campylobacters. Copyright © 2017 John Wiley & Sons, Ltd.

  11. Quantification of short chain amines in aqueous matrices using liquid chromatography electrospray ionization tandem mass spectrometry.

    PubMed

    Viidanoja, Jyrki

    2017-01-13

    A new liquid chromatography-electrospray ionization-tandem Mass Spectrometry (LC-ESI-MS/MS) method was developed for the determination of more than 20 C 1 -C 6 alkyl and alkanolamines in aqueous matrices. The method employs Hydrophilic Interaction Liquid Chromatography Multiple Reaction Monitoring (HILIC-MRM) with a ZIC-pHILIC column and four stable isotope labeled amines as internal standards for signal normalization and quantification of the amines. The method was validated using a refinery process water sample that was obtained from a cooling cycle of crude oil distillation. The averaged within run precision, between run precision and accuracy were generally within 2-10%, 1-9% and 80-120%, respectively, depending on the analyte and concentration level. Selected aqueous process samples were analyzed with the method. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Quantitative Detection of Low-Abundance Transcripts at Single-Cell Level in Human Epidermal Keratinocytes by Digital Droplet Reverse Transcription-Polymerase Chain Reaction.

    PubMed

    Auvré, Frédéric; Coutier, Julien; Martin, Michèle T; Fortunel, Nicolas O

    2018-05-08

    Genetic and epigenetic characterization of the large cellular diversity observed within tissues is essential to understanding the molecular networks that ensure the regulation of homeostasis, repair, and regeneration, but also pathophysiological processes. Skin is composed of multiple cell lineages and is therefore fully concerned by this complexity. Even within one particular lineage, such as epidermal keratinocytes, different immaturity statuses or differentiation stages are represented, which are still incompletely characterized. Accordingly, there is presently great demand for methods and technologies enabling molecular investigation at single-cell level. Also, most current methods used to analyze gene expression at RNA level, such as RT-qPCR, do not directly provide quantitative data, but rather comparative ratios between two conditions. A second important need in skin biology is thus to determine the number of RNA molecules in a given cell sample. Here, we describe a workflow that we have set up to meet these specific needs, by means of transcript quantification in cellular micro-samples using flow cytometry sorting and reverse transcription-digital droplet polymerase chain reaction. As a proof-of-principle, the workflow was tested for the detection of transcription factor transcripts expressed at low levels in keratinocyte precursor cells. A linear correlation was found between quantification values and keratinocyte input numbers in a low quantity range from 40 cells to 1 cell. Interpretable signals were repeatedly obtained from single-cell samples corresponding to estimated expression levels as low as 10-20 transcript copies per keratinocyte or less. The present workflow may have broad applications for the detection and quantification of low-abundance nucleic acid species in single cells, opening up perspectives for the study of cell-to-cell genetic and molecular heterogeneity. Interestingly, the process described here does not require internal references such as house-keeping gene expression, as it is initiated with defined cell numbers, precisely sorted by flow cytometry.

  13. Establishment and application of event-specific polymerase chain reaction methods for two genetically modified soybean events, A2704-12 and A5547-127.

    PubMed

    Li, Xiang; Pan, Liangwen; Li, Junyi; Zhang, Qigang; Zhang, Shuya; Lv, Rong; Yang, Litao

    2011-12-28

    For implementation of the issued regulations and labeling policies for genetically modified organism (GMO) supervision, the polymerase chain reaction (PCR) method has been widely used due to its high specificity and sensitivity. In particular, use of the event-specific PCR method based on the flanking sequence of transgenes has become the primary trend. In this study, both qualitative and quantitative PCR methods were established on the basis of the 5' flanking sequence of transgenic soybean A2704-12 and the 3' flanking sequence of transgenic soybean A5547-127, respectively. In qualitative PCR assays, the limits of detection (LODs) were 10 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127. In quantitative real-time PCR assays, the LODs were 5 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127, and the limits of quantification (LOQs) were 10 copies for both. Low bias and acceptable SD and RSD values were also achieved in quantification of four blind samples using the developed real-time PCR assays. In addition, the developed PCR assays for the two transgenic soybean events were used for routine analysis of soybean samples imported to Shanghai in a 6 month period from October 2010 to March 2011. A total of 27 lots of soybean from the United States and Argentina were analyzed: 8 lots from the Unites States were found to have the GM soybean A2704-12 event, and the GM contents were <1.5% in all eight analyzed lots. On the contrary, no GM soybean A5547-127 content was found in any of the eight lots. These results demonstrated that the established event-specific qualitative and quantitative PCR methods could be used effectively in routine identification and quantification of GM soybeans A2704-12 and A5547-127 and their derived products.

  14. Metabolome and proteome profiling of complex I deficiency induced by rotenone.

    PubMed

    Gielisch, Ina; Meierhofer, David

    2015-01-02

    Complex I (CI; NADH dehydrogenase) deficiency causes mitochondrial diseases, including Leigh syndrome. A variety of clinical symptoms of CI deficiency are known, including neurodegeneration. Here, we report an integrative study combining liquid chromatography-mass spectrometry (LC-MS)-based metabolome and proteome profiling in CI deficient HeLa cells. We report a rapid LC-MS-based method for the relative quantification of targeted metabolome profiling with an additional layer of confidence by applying multiple reaction monitoring (MRM) ion ratios for further identity confirmation and robustness. The proteome was analyzed by label-free quantification (LFQ). More than 6000 protein groups were identified. Pathway and network analyses revealed that the respiratory chain was highly deregulated, with metabolites such as FMN, FAD, NAD(+), and ADP, direct players of the OXPHOS system, and metabolites of the TCA cycle decreased up to 100-fold. Synthesis of functional iron-sulfur clusters, which are of central importance for the electron transfer chain, and degradation products like bilirubin were also significantly reduced. Glutathione metabolism on the pathway level, as well as individual metabolite components such as NADPH, glutathione (GSH), and oxidized glutathione (GSSG), was downregulated. Overall, metabolome and proteome profiles in CI deficient cells correlated well, supporting our integrated approach.

  15. Predominant Lactobacillus species types of vaginal microbiota in pregnant Korean women: quantification of the five Lactobacillus species and two anaerobes.

    PubMed

    Kim, Jeong Hyun; Yoo, Seung Min; Sohn, Yong Hak; Jin, Chan Hee; Yang, Yun Suk; Hwang, In Taek; Oh, Kwan Young

    2017-10-01

    To investigate the predominant Lactobacillus species types (LSTs) of vaginal microbiota in pregnant Korean women by quantifying five Lactobacillus species and two anaerobes. In all, 168 pregnant Korean women under antenatal care at Eulji University Hospital and local clinics were enrolled in the prospective cohort study during pregnancy (10-14 weeks). Vaginal samples were collected with Eswab for Quantitative polymerase chain reaction (qPCR) and stored in a -80 °C freezer. qPCR was performed for five Lactobacillus species and two anaerobes. To identify the predominant LSTs, quantifications were analyzed by the Cluster and Tree View programs of Eisen Lab. Also the quantifications were compared among classified groups. L. crispatus and L. iners were most commonly found in pregnant Korean women, followed by L. gasseri and L. jensenii; L. vaginalis was nearly absent. Five types (four predominant LSTs and one predominant anaerobe type without predominant Lactobacillus species) were classified. Five predominant LSTs were identified in vaginal microbiota of pregnant Korean women. L. crispatus and L. iners predominant types comprised a large proportion.

  16. Quantitative and Functional Requirements for Bioluminescent Cancer Models.

    PubMed

    Feys, Lynn; Descamps, Benedicte; Vanhove, Christian; Vermeulen, Stefan; Vandesompele, J O; Vanderheyden, Katrien; Messens, Kathy; Bracke, Marc; De Wever, Olivier

    2016-01-01

    Bioluminescent cancer models are widely used but detailed quantification of the luciferase signal and functional comparison with a non-transfected control cell line are generally lacking. In the present study, we provide quantitative and functional tests for luciferase-transfected cells. We quantified the luciferase expression in BLM and HCT8/E11 transfected cancer cells, and examined the effect of long-term luciferin exposure. The present study also investigated functional differences between parental and transfected cancer cells. Our results showed that quantification of different single-cell-derived populations are superior with droplet digital polymerase chain reaction. Quantification of luciferase protein level and luciferase bioluminescent activity is only useful when there is a significant difference in copy number. Continuous exposure of cell cultures to luciferin leads to inhibitory effects on mitochondrial activity, cell growth and bioluminescence. These inhibitory effects correlate with luciferase copy number. Cell culture and mouse xenograft assays showed no significant functional differences between luciferase-transfected and parental cells. Luciferase-transfected cells should be validated by quantitative and functional assays before starting large-scale experiments. Copyright © 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  17. Matrix-normalised quantification of species by threshold-calibrated competitive real-time PCR: allergenic peanut in food as one example.

    PubMed

    Holzhauser, Thomas; Kleiner, Kornelia; Janise, Annabella; Röder, Martin

    2014-11-15

    A novel method to quantify species or DNA on the basis of a competitive quantitative real-time polymerase chain reaction (cqPCR) was developed. Potentially allergenic peanut in food served as one example. Based on an internal competitive DNA sequence for normalisation of DNA extraction and amplification, the cqPCR was threshold-calibrated against 100mg/kg incurred peanut in milk chocolate. No external standards were necessary. The competitive molecule successfully served as calibrator for quantification, matrix normalisation, and inhibition control. Although designed for verification of a virtual threshold of 100mg/kg, the method allowed quantification of 10-1,000 mg/kg peanut incurred in various food matrices and without further matrix adaption: On the basis of four PCR replicates per sample, mean recovery of 10-1,000 mg/kg peanut in chocolate, vanilla ice cream, cookie dough, cookie, and muesli was 87% (range: 39-147%) in comparison to 199% (range: 114-237%) by three commercial ELISA kits. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. Real-time PCR Machine System Modeling and a Systematic Approach for the Robust Design of a Real-time PCR-on-a-Chip System

    PubMed Central

    Lee, Da-Sheng

    2010-01-01

    Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR) machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DNA quantification and achieve a robust design for a real-time PCR-on-a-chip system. Accelerated lift testing was adopted to evaluate the reliability of the chip prototype. According to the life test plan, this proposed real-time PCR-on-a-chip system was simulated to work continuously for over three years with similar reproducibility in DNA quantification. This not only shows the robustness of the lab-on-a-chip system, but also verifies the effectiveness of our systematic method for achieving a robust design. PMID:22315563

  19. Fingerprinting and quantification of GMOs in the agro-food sector.

    PubMed

    Taverniers, I; Van Bockstaele, E; De Loose, M

    2003-01-01

    Most strategies for analyzing GMOs in plants and derived food and feed products, are based on the polymerase chain reaction (PCR) technique. In conventional PCR methods, a 'known' sequence between two specific primers is amplified. To the contrary, with the 'anchor PCR' technique, unknown sequences adjacent to a known sequence, can be amplified. Because T-DNA/plant border sequences are being amplified, anchor PCR is the perfect tool for unique identification of transgenes, including non-authorized GMOs. In this work, anchor PCR was applied to characterize the 'transgene locus' and to clarify the complete molecular structure of at least six different commercial transgenic plants. Based on sequences of T-DNA/plant border junctions, obtained by anchor PCR, event specific primers were developed. The junction fragments, together with endogeneous reference gene targets, were cloned in plasmids. The latter were then used as event specific calibrators in real-time PCR, a new technique for the accurate relative quantification of GMOs. We demonstrate here the importance of anchor PCR for identification and the usefulness of plasmid DNA calibrators in quantification strategies for GMOs, throughout the agro-food sector.

  20. Identification and quantification of genetically modified Moonshade carnation lines using conventional and TaqMan real-time polymerase chain reaction methods.

    PubMed

    Li, Peng; Jia, Junwei; Bai, Lan; Pan, Aihu; Tang, Xueming

    2013-07-01

    Genetically modified carnation (Dianthus caryophyllus L.) Moonshade was approved for planting and commercialization in several countries from 2004. Developing methods for analyzing Moonshade is necessary for implementing genetically modified organism labeling regulations. In this study, the 5'-transgene integration sequence was isolated using thermal asymmetric interlaced (TAIL)-PCR. Based upon the 5'-transgene integration sequence, conventional and TaqMan real-time PCR assays were established. The relative limit of detection for the conventional PCR assay was 0.05 % for Moonshade using 100 ng total carnation genomic DNA, corresponding to approximately 79 copies of the carnation haploid genome, and the limits of detection and quantification of the TaqMan real-time PCR assay were estimated to be 51 and 254 copies of haploid carnation genomic DNA, respectively. These results are useful for identifying and quantifying Moonshade and its derivatives.

  1. Transcript Quantification of Genes Involved in Steviol Glycoside Biosynthesis in Stevia rebaudiana Bertoni by Real-Time Polymerase Chain Reaction (RT-PCR).

    PubMed

    Modi, Arpan; Kumar, Nitish; Narayanan, Subhash

    2016-01-01

    Stevia (Stevia rebaudiana Bertoni) is a medicinal plant having sweet, diterpenoid glycosides known as steviol glycosides which are 200-300 times sweeter than sucrose (0.4 % solution). They are synthesized mainly in the leaves via plastid localized 2-C-methyl-D-erythrose-4-phosphate pathway (MEP pathway). Fifteen genes are involved in the formation of these glycosides. In the present protocol, a method for the quantification of transcripts of these genes is shown. The work involves RNA extraction and cDNA preparation, and therefore, procedures for the confirmation of DNA-free cDNA preparation have also been illustrated. Moreover, details of plant treatments are not mentioned as this protocol may apply to relative gene expression profile in any medicinal plant with any treatment. The treatments are numbered as T0 (Control), T1, T2, T3, and T4.

  2. Development and accuracy of quantitative real-time polymerase chain reaction assays for detection and quantification of enterotoxigenic Escherichia coli (ETEC) heat labile and heat stable toxin genes in travelers' diarrhea samples.

    PubMed

    Youmans, Bonnie P; Ajami, Nadim J; Jiang, Zhi-Dong; Petrosino, Joseph F; DuPont, Herbert L; Highlander, Sarah K

    2014-01-01

    Enterotoxigenic Escherichia coli (ETEC), the leading bacterial pathogen of travelers' diarrhea, is routinely detected by an established DNA hybridization protocol that is neither sensitive nor quantitative. Quantitative real-time polymerase chain reaction (qPCR) assays that detect the ETEC toxin genes eltA, sta1, and sta2 in clinical stool samples were developed and tested using donor stool inoculated with known quantities of ETEC bacteria. The sensitivity of the qPCR assays is 89%, compared with 22% for the DNA hybridization assay, and the limits of detection are 10,000-fold lower than the DNA hybridization assays performed in parallel. Ninety-three clinical stool samples, previously characterized by DNA hybridization, were tested using the new ETEC qPCR assays. Discordant toxin profiles were observed for 22 samples, notably, four samples originally typed as ETEC negative were ETEC positive. The qPCR assays are unique in their sensitivity and ability to quantify the three toxin genes in clinical stool samples.

  3. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.

  4. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics.

    PubMed

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-20

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  5. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    NASA Astrophysics Data System (ADS)

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  6. Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR.

    PubMed

    Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V

    2016-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies.

  7. Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR

    PubMed Central

    Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.

    2016-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

  8. TaqMan probe real-time polymerase chain reaction assay for the quantification of canine DNA in chicken nugget.

    PubMed

    Rahman, Md Mahfujur; Hamid, Sharifah Bee Abd; Basirun, Wan Jefrey; Bhassu, Subha; Rashid, Nur Raifana Abdul; Mustafa, Shuhaimi; Mohd Desa, Mohd Nasir; Ali, Md Eaqub

    2016-01-01

    This paper describes a short-amplicon-based TaqMan probe quantitative real-time PCR (qPCR) assay for the quantitative detection of canine meat in chicken nuggets, which are very popular across the world, including Malaysia. The assay targeted a 100-bp fragment of canine cytb gene using a canine-specific primer and TaqMan probe. Specificity against 10 different animals and plants species demonstrated threshold cycles (Ct) of 16.13 ± 0.12 to 16.25 ± 0.23 for canine DNA and negative results for the others in a 40-cycle reaction. The assay was tested for the quantification of up to 0.01% canine meat in deliberately spiked chicken nuggets with 99.7% PCR efficiency and 0.995 correlation coefficient. The analysis of the actual and qPCR predicted values showed a high recovery rate (from 87% ± 28% to 112% ± 19%) with a linear regression close to unity (R(2) = 0.999). Finally, samples of three halal-branded commercial chicken nuggets collected from different Malaysian outlets were screened for canine meat, but no contamination was demonstrated.

  9. Picoliter Well Array Chip-Based Digital Recombinase Polymerase Amplification for Absolute Quantification of Nucleic Acids.

    PubMed

    Li, Zhao; Liu, Yong; Wei, Qingquan; Liu, Yuanjie; Liu, Wenwen; Zhang, Xuelian; Yu, Yude

    2016-01-01

    Absolute, precise quantification methods expand the scope of nucleic acids research and have many practical applications. Digital polymerase chain reaction (dPCR) is a powerful method for nucleic acid detection and absolute quantification. However, it requires thermal cycling and accurate temperature control, which are difficult in resource-limited conditions. Accordingly, isothermal methods, such as recombinase polymerase amplification (RPA), are more attractive. We developed a picoliter well array (PWA) chip with 27,000 consistently sized picoliter reactions (314 pL) for isothermal DNA quantification using digital RPA (dRPA) at 39°C. Sample loading using a scraping liquid blade was simple, fast, and required small reagent volumes (i.e., <20 μL). Passivating the chip surface using a methoxy-PEG-silane agent effectively eliminated cross-contamination during dRPA. Our creative optical design enabled wide-field fluorescence imaging in situ and both end-point and real-time analyses of picoliter wells in a 6-cm(2) area. It was not necessary to use scan shooting and stitch serial small images together. Using this method, we quantified serial dilutions of a Listeria monocytogenes gDNA stock solution from 9 × 10(-1) to 4 × 10(-3) copies per well with an average error of less than 11% (N = 15). Overall dRPA-on-chip processing required less than 30 min, which was a 4-fold decrease compared to dPCR, requiring approximately 2 h. dRPA on the PWA chip provides a simple and highly sensitive method to quantify nucleic acids without thermal cycling or precise micropump/microvalve control. It has applications in fast field analysis and critical clinical diagnostics under resource-limited settings.

  10. Picoliter Well Array Chip-Based Digital Recombinase Polymerase Amplification for Absolute Quantification of Nucleic Acids

    PubMed Central

    Li, Zhao; Liu, Yong; Wei, Qingquan; Liu, Yuanjie; Liu, Wenwen; Zhang, Xuelian; Yu, Yude

    2016-01-01

    Absolute, precise quantification methods expand the scope of nucleic acids research and have many practical applications. Digital polymerase chain reaction (dPCR) is a powerful method for nucleic acid detection and absolute quantification. However, it requires thermal cycling and accurate temperature control, which are difficult in resource-limited conditions. Accordingly, isothermal methods, such as recombinase polymerase amplification (RPA), are more attractive. We developed a picoliter well array (PWA) chip with 27,000 consistently sized picoliter reactions (314 pL) for isothermal DNA quantification using digital RPA (dRPA) at 39°C. Sample loading using a scraping liquid blade was simple, fast, and required small reagent volumes (i.e., <20 μL). Passivating the chip surface using a methoxy-PEG-silane agent effectively eliminated cross-contamination during dRPA. Our creative optical design enabled wide-field fluorescence imaging in situ and both end-point and real-time analyses of picoliter wells in a 6-cm2 area. It was not necessary to use scan shooting and stitch serial small images together. Using this method, we quantified serial dilutions of a Listeria monocytogenes gDNA stock solution from 9 × 10-1 to 4 × 10-3 copies per well with an average error of less than 11% (N = 15). Overall dRPA-on-chip processing required less than 30 min, which was a 4-fold decrease compared to dPCR, requiring approximately 2 h. dRPA on the PWA chip provides a simple and highly sensitive method to quantify nucleic acids without thermal cycling or precise micropump/microvalve control. It has applications in fast field analysis and critical clinical diagnostics under resource-limited settings. PMID:27074005

  11. Labeling milk along its production chain with DNA encapsulated in silica.

    PubMed

    Bloch, Madeleine S; Paunescu, Daniela; Stoessel, Philipp R; Mora, Carlos A; Stark, Wendelin J; Grass, Robert N

    2014-10-29

    The capability of tracing a food product along its production chain is important to ensure food safety and product authenticity. For this purpose and as an application example, recently developed Silica Particles with Encapsulated DNA (SPED) were added to milk at concentrations ranging from 0.1 to 100 ppb (μg per kg milk). Thereby the milk, as well as the milk-derived products yoghurt and cheese, could be uniquely labeled with a DNA tag. Procedures for the extraction of the DNA tags from the food matrixes were elaborated and allowed identification and quantification of previously marked products by quantitative polymerase chain reaction (qPCR) with detection limits below 1 ppb of added particles. The applicability of synthetic as well as naturally occurring DNA sequences was shown. The usage of approved food additives as DNA carrier (silica = E551) and the low cost of the technology (<0.1 USD per ton of milk labeled with 10 ppb of SPED) display the technical applicability of this food labeling technology.

  12. Development and in-house validation of the event-specific qualitative and quantitative PCR detection methods for genetically modified cotton MON15985.

    PubMed

    Jiang, Lingxi; Yang, Litao; Rao, Jun; Guo, Jinchao; Wang, Shu; Liu, Jia; Lee, Seonghun; Zhang, Dabing

    2010-02-01

    To implement genetically modified organism (GMO) labeling regulations, an event-specific analysis method based on the junction sequence between exogenous integration and host genomic DNA has become the preferential approach for GMO identification and quantification. In this study, specific primers and TaqMan probes based on the revealed 5'-end junction sequence of GM cotton MON15985 were designed, and qualitative and quantitative polymerase chain reaction (PCR) assays were established employing the designed primers and probes. In the qualitative PCR assay, the limit of detection (LOD) was 0.5 g kg(-1) in 100 ng total cotton genomic DNA, corresponding to about 17 copies of haploid cotton genomic DNA, and the LOD and limit of quantification (LOQ) for quantitative PCR assay were 10 and 17 copies of haploid cotton genomic DNA, respectively. Furthermore, the developed quantitative PCR assays were validated in-house by five different researchers. Also, five practical samples with known GM contents were quantified using the developed PCR assay in in-house validation, and the bias between the true and quantification values ranged from 2.06% to 12.59%. This study shows that the developed qualitative and quantitative PCR methods are applicable for the identification and quantification of GM cotton MON15985 and its derivates.

  13. Detection and quantification of genetically modified organisms using very short, locked nucleic acid TaqMan probes.

    PubMed

    Salvi, Sergio; D'Orso, Fabio; Morelli, Giorgio

    2008-06-25

    Many countries have introduced mandatory labeling requirements on foods derived from genetically modified organisms (GMOs). Real-time quantitative polymerase chain reaction (PCR) based upon the TaqMan probe chemistry has become the method mostly used to support these regulations; moreover, event-specific PCR is the preferred method in GMO detection because of its high specificity based on the flanking sequence of the exogenous integrant. The aim of this study was to evaluate the use of very short (eight-nucleotide long), locked nucleic acid (LNA) TaqMan probes in 5'-nuclease PCR assays for the detection and quantification of GMOs. Classic TaqMan and LNA TaqMan probes were compared for the analysis of the maize MON810 transgene. The performance of the two types of probes was tested on the maize endogenous reference gene hmga, the CaMV 35S promoter, and the hsp70/cryIA(b) construct as well as for the event-specific 5'-integration junction of MON810, using plasmids as standard reference molecules. The results of our study demonstrate that the LNA 5'-nuclease PCR assays represent a valid and reliable analytical system for the detection and quantification of transgenes. Application of very short LNA TaqMan probes to GMO quantification can simplify the design of 5'-nuclease assays.

  14. Quantitation of Human Papillomavirus DNA in Plasma of Oropharyngeal Carcinoma Patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cao Hongbin; Banh, Alice; Kwok, Shirley

    Purpose: To determine whether human papillomavirus (HPV) DNA can be detected in the plasma of patients with HPV-positive oropharyngeal carcinoma (OPC) and to monitor its temporal change during radiotherapy. Methods and Materials: We used polymerase chain reaction to detect HPV DNA in the culture media of HPV-positive SCC90 and VU147T cells and the plasma of SCC90 and HeLa tumor-bearing mice, non-tumor-bearing controls, and those with HPV-negative tumors. We used real-time quantitative polymerase chain reaction to quantify the plasma HPV DNA in 40 HPV-positive OPC, 24 HPV-negative head-and-neck cancer patients and 10 non-cancer volunteers. The tumor HPV status was confirmed bymore » p16{sup INK4a} staining and HPV16/18 polymerase chain reaction or HPV in situ hybridization. A total of 14 patients had serial plasma samples for HPV DNA quantification during radiotherapy. Results: HPV DNA was detectable in the plasma samples of SCC90- and HeLa-bearing mice but not in the controls. It was detected in 65% of the pretreatment plasma samples from HPV-positive OPC patients using E6/7 quantitative polymerase chain reaction. None of the HPV-negative head-and-neck cancer patients or non-cancer controls had detectable HPV DNA. The pretreatment plasma HPV DNA copy number correlated significantly with the nodal metabolic tumor volume (assessed using {sup 18}F-deoxyglucose positron emission tomography). The serial measurements in 14 patients showed a rapid decline in HPV DNA that had become undetectable at radiotherapy completion. In 3 patients, the HPV DNA level had increased to a discernable level at metastasis. Conclusions: Xenograft studies indicated that plasma HPV DNA is released from HPV-positive tumors. Circulating HPV DNA was detectable in most HPV-positive OPC patients. Thus, plasma HPV DNA might be a valuable tool for identifying relapse.« less

  15. Droplet digital PCR technology promises new applications and research areas.

    PubMed

    Manoj, P

    2016-01-01

    Digital Polymerase Chain Reaction (dPCR) is used to quantify nucleic acids and its applications are in the detection and precise quantification of low-level pathogens, rare genetic sequences, quantification of copy number variants, rare mutations and in relative gene expressions. Here the PCR is performed in large number of reaction chambers or partitions and the reaction is carried out in each partition individually. This separation allows a more reliable collection and sensitive measurement of nucleic acid. Results are calculated by counting amplified target sequence (positive droplets) and the number of partitions in which there is no amplification (negative droplets). The mean number of target sequences was calculated by Poisson Algorithm. Poisson correction compensates the presence of more than one copy of target gene in any droplets. The method provides information with accuracy and precision which is highly reproducible and less susceptible to inhibitors than qPCR. It has been demonstrated in studying variations in gene sequences, such as copy number variants and point mutations, distinguishing differences between expression of nearly identical alleles, assessment of clinically relevant genetic variations and it is routinely used for clonal amplification of samples for NGS methods. dPCR enables more reliable predictors of tumor status and patient prognosis by absolute quantitation using reference normalizations. Rare mitochondrial DNA deletions associated with a range of diseases and disorders as well as aging can be accurately detected with droplet digital PCR.

  16. Quantification of Peptides from Immunoglobulin Constant and Variable Regions by Liquid Chromatography-Multiple Reaction Monitoring Mass Spectrometry for Assessment of Multiple Myeloma Patients

    PubMed Central

    Remily-Wood, Elizabeth R.; Benson, Kaaron; Baz, Rachid C.; Chen, Y. Ann; Hussein, Mohamad; Hartley-Brown, Monique A.; Sprung, Robert W.; Perez, Brianna; Liu, Richard Z.; Yoder, Sean; Teer, Jamie; Eschrich, Steven A.; Koomen, John M.

    2014-01-01

    Purpose Quantitative mass spectrometry assays for immunoglobulins (Igs) are compared with existing clinical methods in samples from patients with plasma cell dyscrasias, e.g. multiple myeloma. Experimental design Using LC-MS/MS data, Ig constant region peptides and transitions were selected for liquid chromatography-multiple reaction monitoring mass spectrometry (LC-MRM). Quantitative assays were used to assess Igs in serum from 83 patients. Results LC-MRM assays quantify serum levels of Igs and their isoforms (IgG1–4, IgA1–2, IgM, IgD, and IgE, as well as kappa(κ) and lambda(λ) light chains). LC-MRM quantification has been applied to single samples from a patient cohort and a longitudinal study of an IgE patient undergoing treatment, to enable comparison with existing clinical methods. Proof-of-concept data for defining and monitoring variable region peptides are provided using the H929 multiple myeloma cell line and two MM patients. Conclusions and Clinical Relevance LC-MRM assays targeting constant region peptides determine the type and isoform of the involved immunoglobulin and quantify its expression; the LC-MRM approach has improved sensitivity compared with the current clinical method, but slightly higher interassay variability. Detection of variable region peptides is a promising way to improve Ig quantification, which could produce a dramatic increase in sensitivity over existing methods, and could further complement current clinical techniques. PMID:24723328

  17. Identification and quantification of three genetically modified insect resistant cotton lines using conventional and TaqMan real-time polymerase chain reaction methods.

    PubMed

    Yang, Litao; Pan, Aihu; Zhang, Kewei; Guo, Jinchao; Yin, Changsong; Chen, Jianxiu; Huang, Cheng; Zhang, Dabing

    2005-08-10

    As the genetically modified organisms (GMOs) labeling policies are issued in many countries, qualitative and quantitative polymerase chain reaction (PCR) techniques are increasingly used for the detection of genetically modified (GM) crops in foods. Qualitative PCR and TaqMan real-time quantitative PCR methods to detect and identify three varieties of insect resistant cotton, i.e., Mon531 cotton (Monsanto Co.) and GK19 and SGK321 cottons (Chinese Academy of Agricultural Sciences), which were approved for commercialization in China, were developed in this paper. Primer pairs specific to inserted DNAs, such as Cowpea trypsin inhibitor (CpTI) gene of SGK321 cotton and the specific junction DNA sequences containing partial Cry1A(c) gene and NOS terminator of Mon531, GK19, and SGK321 cotton varieties were designed to conduct the identified PCR assays. In conventional specific identified PCR assays, the limit of detection (LOD) was 0.05% for Mon531, GK19, or SGK321 in 100 ng of cotton genomic DNA for one reaction. Also, the multiplex PCR method for screening the three GM cottons was also established, which could save time and cost in practical detection. Furthermore, a real-time quantitative PCR assay based on TaqMan chemistry for detection of insect resistant gene, Cry1A(c), was developed. This assay also featured the use of a standard plasmid as a reference molecule, which contained both a specific region of the transgene Cry1A(c) and an endogenous stearoyl-acyl carrier protein desaturase (Sad1) gene of the cotton. In quantitative PCR assay, the quantification range was from 0.01 to 100% in 100 ng of the genome DNA template, and in the detection of 1.0, 3.0, and 5.0% levels of three insect resistant cotton lines, respectively, all of the relative standard deviations (RSDs) were less than 8.2% except for the GM cotton samples with 1.0% Mon531 or GK19, which meant that our real-time PCR assays involving the use of reference molecule were reliable and practical for GM insect resistant cottons quantification. All of these results indicated that our established conventional and TaqMan real-time PCR assays were applicable to detect the three insect resistant cottons qualitatively and quantitatively.

  18. Site-specific quantitative analysis of cardiac mitochondrial protein phosphorylation.

    PubMed

    Lam, Maggie P Y; Lau, Edward; Scruggs, Sarah B; Wang, Ding; Kim, Tae-Young; Liem, David A; Zhang, Jun; Ryan, Christopher M; Faull, Kym F; Ping, Peipei

    2013-04-09

    We report the development of a multiple-reaction monitoring (MRM) strategy specifically tailored to the detection and quantification of mitochondrial protein phosphorylation. We recently derived 68 MRM transitions specific to protein modifications in the respiratory chain, voltage-dependent anion channel, and adenine nucleotide translocase. Here, we have now expanded the total number of MRM transitions to 176 to cover proteins from the tricarboxylic acid cycle, pyruvate dehydrogenase complex, and branched-chain alpha-keto acid dehydrogenase complex. We utilized the transition set to analyze endogenous protein phosphorylation in human heart, mouse heart, and mouse liver. The data demonstrate the potential utility of the MRM workflow for studying the functional details of mitochondrial phosphorylation signaling. This article is part of a Special Issue entitled: From protein structures to clinical applications. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. A method for quantitative analysis of standard and high-throughput qPCR expression data based on input sample quantity.

    PubMed

    Adamski, Mateusz G; Gumann, Patryk; Baird, Alison E

    2014-01-01

    Over the past decade rapid advances have occurred in the understanding of RNA expression and its regulation. Quantitative polymerase chain reactions (qPCR) have become the gold standard for quantifying gene expression. Microfluidic next generation, high throughput qPCR now permits the detection of transcript copy number in thousands of reactions simultaneously, dramatically increasing the sensitivity over standard qPCR. Here we present a gene expression analysis method applicable to both standard polymerase chain reactions (qPCR) and high throughput qPCR. This technique is adjusted to the input sample quantity (e.g., the number of cells) and is independent of control gene expression. It is efficiency-corrected and with the use of a universal reference sample (commercial complementary DNA (cDNA)) permits the normalization of results between different batches and between different instruments--regardless of potential differences in transcript amplification efficiency. Modifications of the input quantity method include (1) the achievement of absolute quantification and (2) a non-efficiency corrected analysis. When compared to other commonly used algorithms the input quantity method proved to be valid. This method is of particular value for clinical studies of whole blood and circulating leukocytes where cell counts are readily available.

  20. Biofilms and Antifungal Susceptibility Testing.

    PubMed

    Simitsopoulou, Maria; Chatzimoschou, Athanasios; Roilides, Emmanuel

    2016-01-01

    Yeasts and filamentous fungi both exist as single cells and hyphal forms, two morphologies used by most fungal organisms to create a complex multilayered biofilm structure. In this chapter we describe the most widely used assays for the determination of biofilm production and assessment of susceptibility of biofilms to antifungal agents or host phagocytes as various methods, the most frequent of which are staining, confocal laser scanning microscopy, quantification of extracellular DNA and protein associated with extracellular matrix and XTT metabolic reduction assay. Pathway-focused biofilm gene expression profiling is assessed by real-time reverse transcriptase polymerase chain reaction.

  1. Label-free measurement of the yeast short chain TAG lipase activity by ESI-MS after one-step esterification.

    PubMed

    Ham, Hye Jin; Seo, Jongcheol; Yoon, Hye-Joo; Shin, Seung Koo

    2017-03-01

    Triacylglycerol (TAG) lipases hydrolyze ester bonds in TAG and release diacylglycerol (DAG), monoacylglycerol (MAG), and FA. We present a one-step chemical derivatization method for label-free quantification of a mixture of TAG, DAG, and MAG following lipase assay by ESI-MS. Because the ionization efficiencies of TAG, DAG, and MAG are not identical, lipase reaction products, DAG and MAG, are derivatized to TAG species by esterifying their hydroxyl groups using acyl chloride, whose acyl chain contains one less (or one more) -CH 2 group than that of substrate TAG. This resulted in three TAG species that were separated by 14 Da from one another and exhibited similar ion responses representing their molar amounts in the mass spectra. A good linear correlation was observed between peak intensity ratios and molar ratios in calibration curve. This method enables simultaneous quantification of TAG, DAG, and MAG in lipase assay and, in turn, allows stoichiometric determination of the concentrations of FAs released from TAG and DAG separately. By applying this strategy to measure both TAG and DAG lipolytic activities of the yeast Tgl2 lipase, we demonstrated its usefulness in studying enzymatic catalysis, as lipase enzymes often show dissimilar activities toward these lipids. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.

  2. Self-digitization microfluidic chip for absolute quantification of mRNA in single cells.

    PubMed

    Thompson, Alison M; Gansen, Alexander; Paguirigan, Amy L; Kreutz, Jason E; Radich, Jerald P; Chiu, Daniel T

    2014-12-16

    Quantification of mRNA in single cells provides direct insight into how intercellular heterogeneity plays a role in disease progression and outcomes. Quantitative polymerase chain reaction (qPCR), the current gold standard for evaluating gene expression, is insufficient for providing absolute measurement of single-cell mRNA transcript abundance. Challenges include difficulties in handling small sample volumes and the high variability in measurements. Microfluidic digital PCR provides far better sensitivity for minute quantities of genetic material, but the typical format of this assay does not allow for counting of the absolute number of mRNA transcripts samples taken from single cells. Furthermore, a large fraction of the sample is often lost during sample handling in microfluidic digital PCR. Here, we report the absolute quantification of single-cell mRNA transcripts by digital, one-step reverse transcription PCR in a simple microfluidic array device called the self-digitization (SD) chip. By performing the reverse transcription step in digitized volumes, we find that the assay exhibits a linear signal across a wide range of total RNA concentrations and agrees well with standard curve qPCR. The SD chip is found to digitize a high percentage (86.7%) of the sample for single-cell experiments. Moreover, quantification of transferrin receptor mRNA in single cells agrees well with single-molecule fluorescence in situ hybridization experiments. The SD platform for absolute quantification of single-cell mRNA can be optimized for other genes and may be useful as an independent control method for the validation of mRNA quantification techniques.

  3. Ultrasensitive Single Fluorescence-Labeled Probe-Mediated Single Universal Primer-Multiplex-Droplet Digital Polymerase Chain Reaction for High-Throughput Genetically Modified Organism Screening.

    PubMed

    Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

    2018-05-01

    As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

  4. Interlaboratory comparison of three microbial source tracking quantitative polymerase chain reaction (qPCR) assays from fecal-source and environmental samples

    USGS Publications Warehouse

    Stelzer, Erin A.; Strickler, Kriston M.; Schill, William B.

    2012-01-01

    During summer and early fall 2010, 15 river samples and 6 fecal-source samples were collected in West Virginia. These samples were analyzed by three laboratories for three microbial source tracking (MST) markers: AllBac, a general fecal indicator; BacHum, a human-associated fecal indicator; and BoBac, a ruminant-associated fecal indicator. MST markers were analyzed by means of the quantitative polymerase chain reaction (qPCR) method. The aim was to assess interlaboratory precision when the three laboratories used the same MST marker and shared deoxyribonucleic acid (DNA) extracts of the samples, but different equipment, reagents, and analyst experience levels. The term assay refers to both the markers and the procedure differences listed above. Interlaboratory precision was best for all three MST assays when using the geometric mean absolute relative percent difference (ARPD) and Friedman's statistical test as a measure of interlaboratory precision. Adjustment factors (one for each MST assay) were calculated using results from fecal-source samples analyzed by all three laboratories and applied retrospectively to sample concentrations to account for differences in qPCR results among labs using different standards and procedures. Following the application of adjustment factors to qPCR results, ARPDs were lower; however, statistically significant differences between labs were still observed for the BacHum and BoBac assays. This was a small study and two of the MST assays had 52 percent of samples with concentrations at or below the limit of accurate quantification; hence, more testing could be done to determine if the adjustment factors would work better if the majority of sample concentrations were above the quantification limit.

  5. A Study of Mercury Methylation Genetics: Qualitative and Quantitative Analysis of hgcAB in Pure Culture

    NASA Astrophysics Data System (ADS)

    Christensen, G. A.; Wymore, A. M.; King, A. J.; Podar, M.; Hurt, R. A., Jr.; Santillan, E. F. U.; Gilmour, C. C.; Brandt, C. C.; Brown, S. D.; Palumbo, A. V.; Elias, D. A.

    2015-12-01

    Two proteins (HgcA and HgcB) have been determined to be essential for mercury (Hg)-methylation and either one alone is not sufficient for this process. Detection and quantification of these genes to determine at risk environments is critical. Universal degenerate polymerase chain reaction (PCR) primers spanning hgcAB were developed to ascertain organismal diversity and validate that both genes were present as an established prerequisite for Hg-methylation. To confirm this approach, an extensive set of pure cultures with published genomes (including methylators and non-methylators: 13 Deltaproteobacteria, 9 Firmicutes, and 10 methanogenic Archaea) were assayed with the newly designed universal hgcAB primer set. A single band within an agarose gel was observed for the majority of the cultures with known hgcAB and confirmed via Sanger sequencing. For environmental applications, once the potential for Hg-methylation is established from PCR amplification with the universal hgcAB primer set, quantification of clade-specific hgcAB gene abundance is desirable. We developed quantitative polymerase chain reaction (qPCR) degenerate primers targeting hgcA from each of the three dominate clades (Deltaproteobacteria, Firmicutes and methanogenic Archaea) known to be associated with anaerobic Hg-methylation. The qPCR primers amplify virtually all hgcA positive cultures overall and are specific for their designed clade. Finally, to ensure the procedure is robust and sensitive in complex environmental matrices, cells from all clades were mixed in different combinations and ratios to assess qPCR primer specificity. The development and validation of these high fidelity quantitative molecular tools now allows for rapid and accurate risk management assessment in any environment.

  6. Identification and quantification of ricin in biomedical samples by magnetic immunocapture enrichment and liquid chromatography electrospray ionization tandem mass spectrometry.

    PubMed

    Ma, Xiaoxi; Tang, Jijun; Li, Chunzheng; Liu, Qin; Chen, Jia; Li, Hua; Guo, Lei; Xie, Jianwei

    2014-08-01

    Ricin is a toxic protein derived from castor beans and composed of a cytotoxic A chain and a galactose-binding B chain linked by a disulfide bond, which can inhibit protein synthesis and cause cell death. Owing to its high toxicity, ease of preparation, and lack of medical countermeasures, ricin has been listed as both chemical and biological warfare agents. For homeland security or public safety, the unambiguous, sensitive, and rapid methods for identification and quantification of ricin in complicated matrices are of urgent need. Mass spectrometric analysis, which provides specific and sensitive characterization of protein, can be applied to confirm and quantify ricin. Here, we report a liquid chromatography-electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS) method in which ricin was extracted and enriched from serum by immunocapture using anti-ricin monoclonal antibody 3D74 linked to magnetic beads, then digested by trypsin, and analyzed by LC-ESI-MS/MS. Among 19 distinct peptides observed in LC-quadrupole/time of flight-MS (LC-QTOF-MS), two specific and sensitive peptides, T7A ((49)VGLPINQR(56)) and T14B ((188)DNCLTSDSNIR(198)), were chosen, and a highly sensitive determination of ricin was established in LC-triple quadrupole-MS (LC-QqQ-MS) operating in multiple reaction monitoring mode. These specific peptides can definitely distinguish ricin from the homologous protein Ricinus communis agglutinin (RCA120), even though the amino acid sequence homology of the A-chain of ricin and RCA120 is up to ca. 93% and that of B-chain is ca. 85%. Furthermore, peptide T7A was preferred in the quantification of ricin because its sensitivity was at least one order of magnitude higher than that of the peptide T14B. Combined with immunocapture enrichment, this method provided a limit of detection of ca. 2.5 ng/mL and the limit of quantification was ca. 5 ng/mL of ricin in serum, respectively. Both precision and accuracy of this method were determined and the RSD was less than 15%. This established method was then applied to measure ricin in serum samples collected from rats exposed to ricin at the dosage of 50 μg/kg in an intravenous injection manner. The results showed that ca. 10 ng/mL of the residual ricin in poisoned rats serum could be detected even at 12 h after exposure.

  7. Legionella detection by culture and qPCR: Comparing apples and oranges.

    PubMed

    Whiley, Harriet; Taylor, Michael

    2016-01-01

    Legionella spp. are the causative agent of Legionnaire's disease and an opportunistic pathogen of significant public health concern. Identification and quantification from environmental sources is crucial for identifying outbreak origins and providing sufficient information for risk assessment and disease prevention. Currently there are a range of methods for Legionella spp. quantification from environmental sources, but the two most widely used and accepted are culture and real-time polymerase chain reaction (qPCR). This paper provides a review of these two methods and outlines their advantages and limitations. Studies from the last 10 years which have concurrently used culture and qPCR to quantify Legionella spp. from environmental sources have been compiled. 26/28 studies detected Legionella at a higher rate using qPCR compared to culture, whilst only one study detected equivalent levels of Legionella spp. using both qPCR and culture. Aggregating the environmental samples from all 28 studies, 2856/3967 (72%) tested positive for the presence of Legionella spp. using qPCR and 1331/3967 (34%) using culture. The lack of correlation between methods highlights the need to develop an acceptable standardized method for quantification that is sufficient for risk assessment and management of this human pathogen.

  8. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    PubMed

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  9. Usefulness of quantitative polymerase chain reaction in amniotic fluid as early prognostic marker of fetal infection with Toxoplasma gondii.

    PubMed

    Romand, Stéphane; Chosson, Muriel; Franck, Jacqueline; Wallon, Martine; Kieffer, François; Kaiser, Karine; Dumon, Henri; Peyron, François; Thulliez, Philippe; Picot, Stéphane

    2004-03-01

    Our purpose was to evaluate Toxoplasma gondii concentration in amniotic fluid (AF) samples as a prognostic marker of congenital toxoplasmosis. A retrospective study was carried out in 88 consecutive AF samples from 86 pregnant women, which were found positive by prospective polymerase chain reaction (PCR) testing. Parasite AF concentrations were estimated by real-time quantitative PCR and analyzed in relation to the clinical outcome of infected fetuses during pregnancy and at birth, taking into account the gestational age at maternal infection. A significant negative linear regression was observed between gestational age at maternal infection and T gondii DNA loads in AF. After adjusting for time at maternal seroconversion by multivariate analysis, higher parasite concentrations were significantly associated with a severe outcome of congenital infection (odds ratio [OR]=15.38/log (parasites/mL AF) [95% CI=2.45-97.7]). PCR quantification of T gondii in AF can be highly contributive for early prognosis of congenital toxoplasmosis. Maternal infections acquired before 20 weeks with a parasite load greater than 100/mL of AF have the highest risk of severe fetal outcome.

  10. Development of an Escherichia coli K12-specific quantitative polymerase chain reaction assay and DNA isolation suited to biofilms associated with iron drinking water pipe corrosion products.

    PubMed

    Lu, Jingrang; Gerke, Tammie L; Buse, Helen Y; Ashbolt, Nicholas J

    2014-12-01

    A quantitative polymerase chain reaction assay (115 bp amplicon) specific to Escherichia coli K12 with an ABI(TM) internal control was developed based on sequence data encoding the rfb gene cluster. Assay specificity was evaluated using three E. coli K12 strains (ATCC W3110, MG1655 & DH1), 24 non-K12 E. coli and 23 bacterial genera. The biofilm detection limit was 10(3) colony-forming units (CFU) E. coli K12 mL(-1), but required a modified protocol, which included a bio-blocker Pseudomonas aeruginosa with ethylenediaminetetraacetic acid buffered to pH 5 prior to cell lysis/DNA extraction. The novel protocol yielded the same sensitivity for drinking water biofilms associated with Fe3O4 (magnetite)-coated SiO2 (quartz) grains and biofilm-surface iron corrosion products from a drinking water distribution system. The novel DNA extraction protocol and specific E. coli K12 assay are sensitive and robust enough for detection and quantification within iron drinking water pipe biofilms, and are particularly well suited for studying enteric bacterial interactions within biofilms.

  11. Delayed vaccine virus replication in chickens vaccinated subcutaneously with an immune complex infectious bursal disease vaccine: Quantification of vaccine virus by real-time polymerase chain reaction

    PubMed Central

    2005-01-01

    Abstract The distribution of the immune complex vaccine virus for infectious bursal disease (IBD) in tissue was examined and the viral loads of the organs were quantitatively compared. One-day-old specific pathogen free (SPF) and maternally immune broiler chickens were injected subcutaneously with the vaccine. Lymphoid and non-lymphoid tissues were collected at various time intervals during the experiment to test for infectious bursal disease virus (IBDV)-RNA by using reverse transcriptase-polymerase chain reaction (RT-PCR). Only the bursa of Fabricius was found to be positive with unusually long viral persistence in the broiler group. The positive bursa samples were further investigated by using real-time PCR coupled with a TaqMan probe. The highest amounts of the virus were detected at its first appearance in the bursa: on day 14 post vaccination (PV) in the SPF chickens and on day 17 and day 21 PV in the maternally immune broiler group. The virus then gradually cleared, most likely due to the parallel appearance of the active immune response indicated by seroconversion. PMID:15971678

  12. Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction.

    PubMed

    Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong

    2015-01-01

    The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.

  13. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    PubMed Central

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-01-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas. PMID:24553130

  14. Rapid Quantification of Low-Viscosity Acetyl-Triacylglycerols Using Electrospray Ionization Mass Spectrometry.

    PubMed

    Bansal, Sunil; Durrett, Timothy P

    2016-09-01

    Acetyl-triacylglycerols (acetyl-TAG) possess an sn-3 acetate group, which confers useful chemical and physical properties to these unusual triacylglycerols (TAG). Current methods for quantification of acetyl-TAG are time consuming and do not provide any information on the molecular species profile. Electrospray ionization mass spectrometry (ESI-MS)-based methods can overcome these drawbacks. However, the ESI-MS signal intensity for TAG depends on the aliphatic chain length and unsaturation index of the molecule. Therefore response factors for different molecular species need to be determined before any quantification. The effects of the chain length and the number of double-bonds of the sn-1/2 acyl groups on the signal intensity for the neutral loss of short chain length sn-3 groups were quantified using a series of synthesized sn-3 specific structured TAG. The signal intensity for the neutral loss of the sn-3 acyl group was found to negatively correlated with the aliphatic chain length and unsaturation index of the sn-1/2 acyl groups. The signal intensity of the neutral loss of the sn-3 acyl group was also negatively correlated with the size of that chain. Further, the position of the group undergoing neutral loss was also important, with the signal from an sn-2 acyl group much lower than that from one located at sn-3. Response factors obtained from these analyses were used to develop a method for the absolute quantification of acetyl-TAG. The increased sensitivity of this ESI-MS-based approach allowed successful quantification of acetyl-TAG in various biological settings, including the products of in vitro enzyme activity assays.

  15. Quantification of Diesel Fuel Intermediate-Volatile Organic Compounds by Proton Transfer Reaction Mass Spectrometer

    NASA Astrophysics Data System (ADS)

    Erickson, M. H.; Jobson, B. T.

    2010-12-01

    To understand secondary organic aerosol formation it is important to observe the precursors. The large hydrocarbon species found in diesel exhaust is thought to be a major contributor to SOA formation in urban environments. A new method was developed utilizing a proton transfer reaction mass spectrometer (PTR-MS) to measure long chain alkanes (C12 and above). There are two issues involved in directly measuring these alkanes. Diesel exhaust is present in relatively low concentrations, which often close or below the limits of detection. A preconcentration system was built to collect a large sample to increase our signal to noise. Lab tests show that all the alkanes fragment to a common set of m/z values. Interferences from other species occur at these m/z values. To overcome this obstacle, the preconcentration system was operated to discriminate between VOCs and IVOCs. This will allow for minimal interference and better quantification of the alkanes. The PTR-MS was outfitted with a new sample system that contains two inlets to allow for the measurement of VOCs while the IVOCs are being collected, which means a wide range of SOA precursors can be measured. Results from the Carbonaceous Aerosol and Radiative Effects Study in Sacramento, CA will be presented.

  16. Epstein-Barr viral load assessment in immunocompetent patients with fulminant infectious mononucleosis.

    PubMed

    van Laar, Jan A M; Buysse, Corinne M P; Vossen, Ann C T M; Hjálmarsson, Björn; van Den Berg, Bart; van Lom, Kirsten; Deinum, Jaap

    2002-04-08

    We describe 2 immunocompetent adolescents with fulminant infectious mononucleosis and virus-associated hemophagocytosis. A new quantitative polymerase chain reaction revealed high serum Epstein-Barr virus DNA levels in these patients. One patient died with an increasing viral load not responding to corticosteroids followed by antiviral and intensified immunomodulatory treatment. The other patient received corticosteroids and acyclovir at diagnosis; her rapid recovery was heralded by a steep decline of viral load. We propose monitoring the clinical course of fulminant infectious mononucleosis in immunocompetent patients by Epstein-Barr virus DNA quantification and prompt corticosteroid and antiviral therapy when viral load is high.

  17. Molecular characteristics, biofilm-forming abilities, and quorum sensing molecules in Vibrio parahaemolyticus strains isolated from marine and clinical environments in Korea.

    PubMed

    Mizan, Md Furkanur Rahaman; Bang, Hyeon-Jo; Sadekuzzaman, Mohammad; Lee, Nari; Kim, Tae-Jo; Ha, Sang-Do

    2017-05-01

    Vibrio parahaemolyticus is an inhabitant of marine and estuarine environments and causes seafood-borne gastroenteritis in humans. In this study, an UltraFast LabChip Real-Time PCR assay was evaluated for rapid detection and quantification of pathogenic V. parahaemolyticus isolates. Escherichia coli and Vibrio harveyi were used as negative controls. Twenty-six tdh-positive, biofilm-producing V. parahaemolyticus isolates were analyzed by repetitive extragenic palindromic-polymerase chain reaction (REP-PCR). REP-PCR analysis showed that the majority of the V. parahaemolyticus isolates originated from seafood and that clinical specimens formed two major clusters at 92.8% and 32% similarity levels. The presence and quantification of Autoinducer-2 was carried out using high-performance liquid chromatography with fluorescence detection (HPLC-FLD) after derivatization of Autoinducer-2 with 2, 3-diaminonaphthalene. The presence of tdh-positive V. parahaemolyticus in marine samples highlights the need for constant environmental monitoring to protect public health.

  18. Quantitative analysis of glycosaminoglycans, chondroitin/dermatan sulfate, hyaluronic acid, heparan sulfate, and keratan sulfate by liquid chromatography-electrospray ionization-tandem mass spectrometry.

    PubMed

    Osago, Harumi; Shibata, Tomoko; Hara, Nobumasa; Kuwata, Suguru; Kono, Michihaya; Uchio, Yuji; Tsuchiya, Mikako

    2014-12-15

    We developed a method using liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS/MS) with a selected reaction monitoring (SRM) mode for simultaneous quantitative analysis of glycosaminoglycans (GAGs). Using one-shot analysis with our MS/MS method, we demonstrated the simultaneous quantification of a total of 23 variously sulfated disaccharides of four GAG classes (8 chondroitin/dermatan sulfates, 1 hyaluronic acid, 12 heparan sulfates, and 2 keratan sulfates) with a sensitivity of less than 0.5 pmol within 20 min. We showed the differences in the composition of GAG classes and the sulfation patterns between porcine articular cartilage and yellow ligament. In addition to the internal disaccharides described above, some saccharides derived from the nonreducing terminal were detected simultaneously. The simultaneous quantification of both internal and nonreducing terminal saccharides could be useful to estimate the chain length of GAGs. This method would help to establish comprehensive "GAGomic" analysis of biological tissues. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Quantification of lithium at ppm level in geological samples using nuclear reaction analysis.

    PubMed

    De La Rosa, Nathaly; Kristiansson, Per; Nilsson, E J Charlotta; Ros, Linus; Pallon, Jan; Skogby, Henrik

    2018-01-01

    Proton-induced reaction (p,α) is one type of nuclear reaction analysis (NRA) suitable especially for light element quantification. In the case of lithium quantification presented in this work, accelerated protons with an energy about of 850 keV were used to induce the 7 Li(p,α) 4 He reaction in standard reference and geological samples such as tourmaline and other Li-minerals. It is shown that this technique for lithium quantification allowed for measurement of concentrations down below one ppm. The possibility to relate the lithium content with the boron content in a single analysis was also demonstrated using tourmaline samples, both in absolute concentration and in lateral distribution. In addition, Particle induced X-ray emission (PIXE) was utilized as a complementary IBA technique for simultaneous mapping of elements heavier than sodium.

  20. Quantification and characterization of enzymatically produced hyaluronan with fluorophore-assisted carbohydrate electrophoresis.

    PubMed

    Kooy, Floor K; Ma, Muyuan; Beeftink, Hendrik H; Eggink, Gerrit; Tramper, Johannes; Boeriu, Carmen G

    2009-01-15

    Hyaluronan (HA) is a polysaccharide with high-potential medical applications, depending on the chain length and the chain length distribution. Special interest goes to homogeneous HA oligosaccharides, which can be enzymatically produced using Pasteurella multocida hyaluronan synthase (PmHAS). We have developed a sensitive, simple, and fast method, based on fluorophore-assisted carbohydrate electrophoresis (FACE), for characterization and quantification of polymerization products. A chromatographic pure fluorescent template was synthesized from HA tetrasaccharide (HA4) and 2-aminobenzoic acid. HA4-fluor and HA4 were used as template for PmHAS-mediated polymerization of nucleotide sugars. All products, fluorescent and nonfluorescent, were analyzed with gel electrophoresis and quantified using lane densitometry. Comparison of HA4- and HA4-fluor-derived polymers showed that the fluorophore did not negatively influence the PmHAS-mediated polymerization. Only even-numbered oligosaccharide products were observed using HA4-fluor or HA4 as template. The fluorophore intensity was linearly related to its concentration, and the limit of detection was determined to be 7.4pmol per product band. With this assay, we can now differentiate oligosaccharides of size range DP2 (degree of polymerization 2) to approximately DP400, monitor the progress of polymerization reactions, and measure subtle differences in polymerization rate. Quantifying polymerization products enables us to study the influence of experimental conditions on HA synthesis.

  1. Quantification of Vibrio species in oysters from the Gulf of Mexico with two procedures based on MPN and PCR.

    PubMed

    Barrera-Escorcia, Guadalupe; Wong-Chang, Irma; Fernández-Rendón, Carlos Leopoldo; Botello, Alfonso Vázquez; Gómez-Gil, Bruno; Lizárraga-Partida, Marcial Leonardo

    2016-11-01

    Oysters can accumulate potentially pathogenic water bacteria. The objective of this study was to compare two procedures to quantify Vibrio species present in oysters to determine the most sensitive method. We analyzed oyster samples from the Gulf of Mexico, commercialized in Mexico City. The samples were inoculated in tubes with alkaline peptone water (APW), based on three tubes and four dilutions (10 -1 to 10 -4 ). From these tubes, the first quantification of Vibrio species was performed (most probable number (MPN) from tubes) and bacteria were inoculated by streaking on thiosulfate-citrate-bile salts-sucrose (TCBS) petri dishes. Colonies were isolated for a second quantification (MPN from dishes). Polymerase chain reaction (PCR) was used to determine species with specific primers: ompW for Vibrio cholerae, tlh for Vibrio parahaemolyticus, and VvhA for Vibrio vulnificus. Simultaneously, the sanitary quality of oysters was determined. The quantification of V. parahaemolyticus was significantly higher in APW tubes than in TCBS dishes. Regarding V. vulnificus counts, the differences among both approaches were not significant. In contrast, the MPNs of V. cholerae obtained from dishes were higher than from tubes. The quantification of MPNs through PCR of V. parahaemolyticus and V. vulnificus obtained from APW was sensitive and recommendable for the detection of both species. In contrast, to quantify V. cholerae, it was necessary to isolate colonies on TCBS prior PCR. Culturing in APW at 42 °C could be an alternative to avoid colony isolation. The MPNs of V. cholerae from dishes was associated with the bad sanitary quality of the samples.

  2. Enzyme- and label-free electrochemical aptasensor for kanamycin detection based on double stir bar-assisted toehold-mediated strand displacement reaction for dual-signal amplification.

    PubMed

    Hong, Feng; Chen, Xixue; Cao, Yuting; Dong, Youren; Wu, Dazhen; Hu, Futao; Gan, Ning

    2018-07-30

    It is critically important to detect antibiotic residues for monitoring food safety. In this study, an enzyme- and label-free electrochemical aptasensor for antibiotics, with kanamycin (Kana) as a typical analyte, was developed based on a double stir bar-assisted toehold-mediated strand displacement reaction (dSB-TMSDR) for dual-signal amplification. First, we modified two gold electrodes (E-1 and E-2) with different DNA probes (S1/S2 hybrid probe in E-1 and DNA fuel strand S3 in E-2). In the presence of Kana, an S1/S2 probe can be disassembled from E-1 to form an S2/Kana complex in supernatant. The S2/Kana could react with S3 on E-2 to form S2/S3 hybrid and release Kana through TMSDR. After then, the target recycling was triggered. Subsequently, the formed S2/S3 hybrid can also trigger a hybridization chain reaction (HCR). Consequently, the dual-signal amplification strategy was established, which resulted in many long dsDNA chains on E-2. The chains can associate with methylene blue (MB) as redox probes to produce a current response for the quantification of Kana. The assay exhibited high sensitivity and specificity with a detection limit at 16 fM Kana due to the dual-signal amplification. The double stir bars system can both increase phase separation and prevent leakage of DNA fuel to reduce background interference. Moreover, it allows flexible sequence design of the TMSDR probes. The assay was successfully employed to detect Kana residues in food and showed potential application value in food safety detection. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. High-throughput real-time quantitative reverse transcription PCR.

    PubMed

    Bookout, Angie L; Cummins, Carolyn L; Mangelsdorf, David J; Pesola, Jean M; Kramer, Martha F

    2006-02-01

    Extensive detail on the application of the real-time quantitative polymerase chain reaction (QPCR) for the analysis of gene expression is provided in this unit. The protocols are designed for high-throughput, 384-well-format instruments, such as the Applied Biosystems 7900HT, but may be modified to suit any real-time PCR instrument. QPCR primer and probe design and validation are discussed, and three relative quantitation methods are described: the standard curve method, the efficiency-corrected DeltaCt method, and the comparative cycle time, or DeltaDeltaCt method. In addition, a method is provided for absolute quantification of RNA in unknown samples. RNA standards are subjected to RT-PCR in the same manner as the experimental samples, thus accounting for the reaction efficiencies of both procedures. This protocol describes the production and quantitation of synthetic RNA molecules for real-time and non-real-time RT-PCR applications.

  4. Quantification of the Influence of Extracellular Laccase and Intracellular Reactions on the Isomer-Specific Biotransformation of the Xenoestrogen Technical Nonylphenol by the Aquatic Hyphomycete Clavariopsis aquatica▿

    PubMed Central

    Martin, Claudia; Corvini, Philippe F. X.; Vinken, Ralph; Junghanns, Charles; Krauss, Gudrun; Schlosser, Dietmar

    2009-01-01

    The aquatic hyphomycete Clavariopsis aquatica was used to quantify the effects of extracellular laccase and intracellular reactions on the isomer-specific biotransformation of technical nonylphenol (t-NP). In laccase-producing cultures, maximal removal rates of t-NP and the isomer 4-(1-ethyl-1,4-dimethylpentyl)phenol (NP112) were about 1.6- and 2.4-fold higher, respectively, than in laccase-lacking cultures. The selective suppression of either laccase or intracellular reactions resulted in essentially comparable maximal removal rates for both compounds. Evidence for an unspecific oxidation of t-NP isomers was consistently obtained from laccase-expressing fungal cultures when intracellular biotransformation was suppressed and from reaction mixtures containing isolated laccase. This observation contrasts with the selective degradation of t-NP isomers by bacteria and should prevent the enrichment of highly estrogenic isomers in remaining t-NP. In contrast with laccase reactions, intracellular fungal biotransformation caused a significant shift in the isomeric composition of remaining t-NP. As a result, certain t-NP constituents related to more estrogenic isomers were less efficiently degraded than others. In contrast to bacterial degradation via ipso-hydroxylation, the substitution pattern of the quaternary α-carbon of t-NP isomers does not seem to be very important for intracellular transformation in C. aquatica. As-yet-unknown intracellular enzymes are obviously induced by nonylphenols. Mass spectral data of the metabolites resulting from the intracellular oxidation of t-NP, NP112, and 4-(1-ethyl-1,3-dimethylpentyl)phenol indicate nonyl chain hydroxylation, further oxidation into keto or aldehyde compounds, and the subsequent formation of carboxylic acid derivatives. Further metabolites suggest nonyl chain desaturation and methylation of carboxylic acids. The phenolic moieties of the nonylphenols remained unchanged. PMID:19429559

  5. Development and inter-laboratory assessment of droplet digital PCR assays for multiplex quantification of 15 genetically modified soybean lines.

    PubMed

    Košir, Alexandra Bogožalec; Spilsberg, Bjørn; Holst-Jensen, Arne; Žel, Jana; Dobnik, David

    2017-08-17

    Quantification of genetically modified organisms (GMOs) in food and feed products is often required for their labelling or for tolerance thresholds. Standard-curve-based simplex quantitative polymerase chain reaction (qPCR) is the prevailing technology, which is often combined with screening analysis. With the rapidly growing number of GMOs on the world market, qPCR analysis becomes laborious and expensive. Innovative cost-effective approaches are therefore urgently needed. Here, we report the development and inter-laboratory assessment of multiplex assays to quantify GMO soybean using droplet digital PCR (ddPCR). The assays were developed to facilitate testing of foods and feed for compliance with current GMO regulations in the European Union (EU). Within the EU, the threshold for labelling is 0.9% for authorised GMOs per ingredient. Furthermore, the EU has set a technical zero tolerance limit of 0.1% for certain unauthorised GMOs. The novel multiplex ddPCR assays developed target 11 GMO soybean lines that are currently authorised, and four that are tolerated, pending authorisation in the EU. Potential significant improvements in cost efficiency are demonstrated. Performance was assessed for the critical parameters, including limits of detection and quantification, and trueness, repeatability, and robustness. Inter-laboratory performance was also determined on a number of proficiency programme and real-life samples.

  6. Optimization and Verification of Droplet Digital PCR Even-Specific Methods for the Quantification of GM Maize DAS1507 and NK603.

    PubMed

    Grelewska-Nowotko, Katarzyna; Żurawska-Zajfert, Magdalena; Żmijewska, Ewelina; Sowa, Sławomir

    2018-05-01

    In recent years, digital polymerase chain reaction (dPCR), a new molecular biology technique, has been gaining in popularity. Among many other applications, this technique can also be used for the detection and quantification of genetically modified organisms (GMOs) in food and feed. It might replace the currently widely used real-time PCR method (qPCR), by overcoming problems related to the PCR inhibition and the requirement of certified reference materials to be used as a calibrant. In theory, validated qPCR methods can be easily transferred to the dPCR platform. However, optimization of the PCR conditions might be necessary. In this study, we report the transfer of two validated qPCR methods for quantification of maize DAS1507 and NK603 events to the droplet dPCR (ddPCR) platform. After some optimization, both methods have been verified according to the guidance of the European Network of GMO Laboratories (ENGL) on analytical method verification (ENGL working group on "Method Verification." (2011) Verification of Analytical Methods for GMO Testing When Implementing Interlaboratory Validated Methods). Digital PCR methods performed equally or better than the qPCR methods. Optimized ddPCR methods confirm their suitability for GMO determination in food and feed.

  7. Quantitative PCR assay to determine prevalence and intensity of MSX (Haplosporidium nelsoni) in North Carolina and Rhode Island oysters Crassostrea virginica.

    PubMed

    Wilbur, Ami E; Ford, Susan E; Gauthier, Julie D; Gomez-Chiarri, Marta

    2012-12-27

    The continuing challenges to the management of both wild and cultured eastern oyster Crassostrea virginica populations resulting from protozoan parasites has stimulated interest in the development of molecular assays for their detection and quantification. For Haplosporidium nelsoni, the causative agent of multinucleated sphere unknown (MSX) disease, diagnostic evaluations depend extensively on traditional but laborious histological approaches and more recently on rapid and sensitive (but not quantitative) end-point polymerase chain reaction (PCR) assays. Here, we describe the development and application of a quantitative PCR (qPCR) assay for H. nelsoni using an Applied Biosystems TaqMan® assay designed with minor groove binder (MGB) probes. The assay was highly sensitive, detecting as few as 20 copies of cloned target DNA. Histologically evaluated parasite density was significantly correlated with the quantification cycle (Cq), regardless of whether quantification was categorical (r2 = 0.696, p < 0.0001) or quantitative (r2 = 0.797, p < 0.0001). Application in field studies conducted in North Carolina, USA (7 locations), revealed widespread occurrence of the parasite with moderate to high intensities noted in some locations. In Rhode Island, USA, application of the assay on oysters from 2 locations resulted in no positives.

  8. Molecular Approaches for High Throughput Detection and Quantification of Genetically Modified Crops: A Review

    PubMed Central

    Salisu, Ibrahim B.; Shahid, Ahmad A.; Yaqoob, Amina; Ali, Qurban; Bajwa, Kamran S.; Rao, Abdul Q.; Husnain, Tayyab

    2017-01-01

    As long as the genetically modified crops are gaining attention globally, their proper approval and commercialization need accurate and reliable diagnostic methods for the transgenic content. These diagnostic techniques are mainly divided into two major groups, i.e., identification of transgenic (1) DNA and (2) proteins from GMOs and their products. Conventional methods such as PCR (polymerase chain reaction) and enzyme-linked immunosorbent assay (ELISA) were routinely employed for DNA and protein based quantification respectively. Although, these Techniques (PCR and ELISA) are considered as significantly convenient and productive, but there is need for more advance technologies that allow for high throughput detection and the quantification of GM event as the production of more complex GMO is increasing day by day. Therefore, recent approaches like microarray, capillary gel electrophoresis, digital PCR and next generation sequencing are more promising due to their accuracy and precise detection of transgenic contents. The present article is a brief comparative study of all such detection techniques on the basis of their advent, feasibility, accuracy, and cost effectiveness. However, these emerging technologies have a lot to do with detection of a specific event, contamination of different events and determination of fusion as well as stacked gene protein are the critical issues to be addressed in future. PMID:29085378

  9. Rapid quantification of plant-powdery mildew interactions by qPCR and conidiospore counts.

    PubMed

    Weßling, Ralf; Panstruga, Ralph

    2012-08-31

    The powdery mildew disease represents a valuable patho-system to study the interaction between plant hosts and obligate biotrophic fungal pathogens. Numerous discoveries have been made on the basis of the quantitative evaluation of plant-powdery mildew interactions, especially in the context of hyper-susceptible and/or resistant plant mutants. However, the presently available methods to score the pathogenic success of powdery mildew fungi are laborious and thus not well suited for medium- to high-throughput analysis. Here we present two new protocols that allow the rapid quantitative assessment of powdery mildew disease development. One procedure depends on quantitative polymerase chain reaction (qPCR)-based evaluation of fungal biomass, while the other relies on the quantification of fungal conidiospores. We validated both techniques using the powdery mildew pathogen Golovinomyces orontii on a set of hyper-susceptible and resistant Arabidopsis thaliana mutants and found that both cover a wide dynamic range of one to two (qPCR) and four to five (quantification of conidia) orders of magnitude, respectively. The two approaches yield reproducible results and are easy to perform without specialized equipment. The qPCR and spore count assays rapidly and reproducibly quantify powdery mildew pathogenesis. Our methods are performed at later stages of infection and discern mutant phenotypes accurately. The assays therefore complement currently used procedures of powdery mildew quantification and can overcome some of their limitations. In addition, they can easily be adapted to other plant-powdery mildew patho-systems.

  10. Quantitative Analysis of Food and Feed Samples with Droplet Digital PCR

    PubMed Central

    Morisset, Dany; Štebih, Dejan; Milavec, Mojca; Gruden, Kristina; Žel, Jana

    2013-01-01

    In this study, the applicability of droplet digital PCR (ddPCR) for routine analysis in food and feed samples was demonstrated with the quantification of genetically modified organisms (GMOs). Real-time quantitative polymerase chain reaction (qPCR) is currently used for quantitative molecular analysis of the presence of GMOs in products. However, its use is limited for detecting and quantifying very small numbers of DNA targets, as in some complex food and feed matrices. Using ddPCR duplex assay, we have measured the absolute numbers of MON810 transgene and hmg maize reference gene copies in DNA samples. Key performance parameters of the assay were determined. The ddPCR system is shown to offer precise absolute and relative quantification of targets, without the need for calibration curves. The sensitivity (five target DNA copies) of the ddPCR assay compares well with those of individual qPCR assays and of the chamber digital PCR (cdPCR) approach. It offers a dynamic range over four orders of magnitude, greater than that of cdPCR. Moreover, when compared to qPCR, the ddPCR assay showed better repeatability at low target concentrations and a greater tolerance to inhibitors. Finally, ddPCR throughput and cost are advantageous relative to those of qPCR for routine GMO quantification. It is thus concluded that ddPCR technology can be applied for routine quantification of GMOs, or any other domain where quantitative analysis of food and feed samples is needed. PMID:23658750

  11. Assessment of DNA degradation induced by thermal and UV radiation processing: implications for quantification of genetically modified organisms.

    PubMed

    Ballari, Rajashekhar V; Martin, Asha

    2013-12-01

    DNA quality is an important parameter for the detection and quantification of genetically modified organisms (GMO's) using the polymerase chain reaction (PCR). Food processing leads to degradation of DNA, which may impair GMO detection and quantification. This study evaluated the effect of various processing treatments such as heating, baking, microwaving, autoclaving and ultraviolet (UV) irradiation on the relative transgenic content of MON 810 maize using pRSETMON-02, a dual target plasmid as a model system. Amongst all the processing treatments examined, autoclaving and UV irradiation resulted in the least recovery of the transgenic (CaMV 35S promoter) and taxon-specific (zein) target DNA sequences. Although a profound impact on DNA degradation was seen during the processing, DNA could still be reliably quantified by Real-time PCR. The measured mean DNA copy number ratios of the processed samples were in agreement with the expected values. Our study confirms the premise that the final analytical value assigned to a particular sample is independent of the degree of DNA degradation since the transgenic and the taxon-specific target sequences possessing approximately similar lengths degrade in parallel. The results of our study demonstrate that food processing does not alter the relative quantification of the transgenic content provided the quantitative assays target shorter amplicons and the difference in the amplicon size between the transgenic and taxon-specific genes is minimal. Copyright © 2013 Elsevier Ltd. All rights reserved.

  12. Quantification of therapeutic miRNA mimics in whole blood from nonhuman primates.

    PubMed

    Kelnar, Kevin; Peltier, Heidi J; Leatherbury, Neil; Stoudemire, Jay; Bader, Andreas G

    2014-02-04

    MRX34, a microRNA (miRNA)-based therapy for cancer, has recently entered clinical trials as the first clinical candidate in its class. It is a liposomal nanoparticle loaded with a synthetic mimic of the tumor suppressor miRNA miR-34a as the active pharmaceutical ingredient. To understand the pharmacokinetic properties of the drug and to rationalize an optimal dosing regimen in the clinic, a method is needed to quantitatively detect the miRNA mimic. Here, we report the development and qualification of a quantitative reverse transcription-polymerase chain reaction (qRT-PCR) assay in support of pharmacokinetic and toxicokinetic assessments in the nonhuman primate. Detection and quantification were performed on total ribonucleic acid (RNA) isolated from whole blood. The qualified range of the standard curve spans 6 orders of magnitude from 2.5 × 10(-7) to 2.5 × 10(-1) ng per reverse transcription (RT) reaction, corresponding to an estimated blood concentration from 6.2 × 10(-5) to 6.2 × 10(1) ng/mL. Our results demonstrate that endogenous as well as the exogenous miR-34a can be accurately and precisely quantified. The assay was used to establish the pharmacokinetic profile of MRX34, showing a favorable residence time and exposure of the miRNA mimic in whole blood from nonhuman primates.

  13. Centrifugal step emulsification applied for absolute quantification of nucleic acids by digital droplet RPA.

    PubMed

    Schuler, Friedrich; Schwemmer, Frank; Trotter, Martin; Wadle, Simon; Zengerle, Roland; von Stetten, Felix; Paust, Nils

    2015-07-07

    Aqueous microdroplets provide miniaturized reaction compartments for numerous chemical, biochemical or pharmaceutical applications. We introduce centrifugal step emulsification for the fast and easy production of monodisperse droplets. Homogenous droplets with pre-selectable diameters in a range from 120 μm to 170 μm were generated with coefficients of variation of 2-4% and zero run-in time or dead volume. The droplet diameter depends on the nozzle geometry (depth, width, and step size) and interfacial tensions only. Droplet size is demonstrated to be independent of the dispersed phase flow rate between 0.01 and 1 μl s(-1), proving the robustness of the centrifugal approach. Centrifugal step emulsification can easily be combined with existing centrifugal microfluidic unit operations, is compatible to scalable manufacturing technologies such as thermoforming or injection moulding and enables fast emulsification (>500 droplets per second and nozzle) with minimal handling effort (2-3 pipetting steps). The centrifugal microfluidic droplet generation was used to perform the first digital droplet recombinase polymerase amplification (ddRPA). It was used for absolute quantification of Listeria monocytogenes DNA concentration standards with a total analysis time below 30 min. Compared to digital droplet polymerase chain reaction (ddPCR), with processing times of about 2 hours, the overall processing time of digital analysis was reduced by more than a factor of 4.

  14. Comprehensive Panel of Real-Time TaqMan™ Polymerase Chain Reaction Assays for Detection and Absolute Quantification of Filoviruses, Arenaviruses, and New World Hantaviruses

    PubMed Central

    Trombley, Adrienne R.; Wachter, Leslie; Garrison, Jeffrey; Buckley-Beason, Valerie A.; Jahrling, Jordan; Hensley, Lisa E.; Schoepp, Randal J.; Norwood, David A.; Goba, Augustine; Fair, Joseph N.; Kulesh, David A.

    2010-01-01

    Viral hemorrhagic fever is caused by a diverse group of single-stranded, negative-sense or positive-sense RNA viruses belonging to the families Filoviridae (Ebola and Marburg), Arenaviridae (Lassa, Junin, Machupo, Sabia, and Guanarito), and Bunyaviridae (hantavirus). Disease characteristics in these families mark each with the potential to be used as a biological threat agent. Because other diseases have similar clinical symptoms, specific laboratory diagnostic tests are necessary to provide the differential diagnosis during outbreaks and for instituting acceptable quarantine procedures. We designed 48 TaqMan™-based polymerase chain reaction (PCR) assays for specific and absolute quantitative detection of multiple hemorrhagic fever viruses. Forty-six assays were determined to be virus-specific, and two were designated as pan assays for Marburg virus. The limit of detection for the assays ranged from 10 to 0.001 plaque-forming units (PFU)/PCR. Although these real-time hemorrhagic fever virus assays are qualitative (presence of target), they are also quantitative (measure a single DNA/RNA target sequence in an unknown sample and express the final results as an absolute value (e.g., viral load, PFUs, or copies/mL) on the basis of concentration of standard samples and can be used in viral load, vaccine, and antiviral drug studies. PMID:20439981

  15. Habitat associations of two entomopathogenic nematodes: a quantitative study using real-time quantitative polymerase chain reactions.

    PubMed

    Torr, Peter; Spiridonov, Sergei E; Heritage, Stuart; Wilson, Michael J

    2007-03-01

    1. Despite nematodes being the most abundant animals on earth, very few animal ecologists study them, probably because of the difficulties of identifying them to species by morphological methods. 2. A group of nematodes that are important both ecologically and economically is the entomopathogenic nematodes, which play a key role in regulating soil food webs and are sold throughout the world as biological insecticides, yet for which very little is known of their population ecology. 3. A novel detection and quantification method was developed for soil nematodes using real-time polymerase chain reaction (PCR), and the technique was used to estimate numbers of two closely related species of entomopathogenic nematodes, Steinernema kraussei and S. affine in 50 soil samples from 10 sites in Scotland representing two distinct habitats (woodland and grassland). 4. There was a high degree of correlation between our molecular and traditional morphological estimates of population size and our data clearly showed that Steinernema affine occurred only in grassland areas, whereas S. kraussei was found in grassland and woodland samples to a similar degree. 5. Real-time PCR offers a rapid and accurate method of detecting individual nematode species from soil samples without the need for a specialist taxonomist, and has much potential for use in studies of nematode population ecology.

  16. Comparison of quantitative real-time polymerase chain reaction with NanoString® methodology using adipose and liver tissues from rats fed seaweed.

    PubMed

    Bentley-Hewitt, Kerry L; Hedderley, Duncan I; Monro, John; Martell, Sheridan; Smith, Hannah; Mishra, Suman

    2016-05-25

    Experimental methods are constantly being improved by new technology. Recently a new technology, NanoString®, has been introduced to the market for the analysis of gene expression. Our experiments used adipose and liver samples collected from a rat feeding trial to explore gene expression changes resulting from a diet of 7.5% seaweed. Both quantitative real-time polymerase chain reaction (qPCR) and NanoString methods were employed to look at expression of genes related to fat and glucose metabolism and this paper compares results from both methods. We conclude that NanoString offers a valuable alternative to qPCR and our data suggest that results are more accurate because of the reduced sample handling and direct quantification of gene copy number without the need for enzymatic amplification. However, we have highlighted a potential challenge for both methods, which needs to be addressed when designing primers or probes. We suggest a literature search for known splice variants of a particular gene to be completed so that primers or probes can be designed that do not span exons which may be affected by alternative gene sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

    PubMed

    Amendola, R

    1994-11-01

    The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

  18. Quantification of Xylella fastidiosa from Citrus Trees by Real-Time Polymerase Chain Reaction Assay.

    PubMed

    Oliveira, Antonio C; Vallim, Marcelo A; Semighini, Camile P; Araújo, Welington L; Goldman, Gustavo H; Machado, Marcos A

    2002-10-01

    ABSTRACT Xylella fastidiosa is the causal agent of citrus variegated chlorosis (CVC), a destructive disease of sweet orange cultivars in Brazil. Polymerase chain reaction (PCR)-based assays constitute the principal diagnostic method for detection of these bacteria. In this work, we established a real-time quantitative PCR (QPCR) assay to quantify X. fastidiosa in naturally and artificially infected citrus. The X. fastidiosa cell number detected in the leaves increased according to the age of the leaf, and bacteria were not detected in the upper midrib section in young leaves, indicating temporal and spatial distribution patterns of bacteria, respectively. In addition, the X. fastidiosa cell number quantified in leaves of 'Pera' orange and 'Murcott' tangor reflected the susceptible and resistant status of these citrus cultivars. None of the 12 endophytic citrus bacteria or the four strains of X. fastidiosa nonpathogenic to citrus that were tested showed an increase in the fluorescence signal during QPCR. In contrast, all 10 CVC-causing strains exhibited an increase in fluorescence signal, thus indicating the specificity of this QPCR assay. Our QPCR provides a powerful tool for studies of different aspects of the Xylella-citrus interactions, and can be incorporated into breeding programs in order to select CVC-resistant plants more quickly.

  19. A critical assessment of transmethylation procedures for n-3 long-chain polyunsaturated fatty acid quantification of lipid classes.

    PubMed

    Sehl, Anthony; Couëdelo, Leslie; Fonseca, Laurence; Vaysse, Carole; Cansell, Maud

    2018-06-15

    Lipid transmethylation methods described in the literature are not always evaluated with care so to insure that the methods are effective, especially on food matrix or biological samples containing polyunsaturated fatty acid (PUFA). The aim of the present study was to select a method suitable for all lipid species rich in long chain n-3 PUFA. Three published methods were adapted and applied on individual lipid classes. Lipid (trans)methylation efficiency was characterized in terms of reaction yield and gas chromatography (GC) analysis. The acid-catalyzed method was unable to convert triglycerides and sterol esters, while the method using an incubation at a moderate temperature was ineffective on phospholipids and sterol esters. On the whole only the method using sodium methoxide and sulfuric acid was effective on lipid classes taken individually or in a complex medium. This study highlighted the use of an appropriate (trans)methylation method for insuring an accurate fatty acid composition. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

  1. Investigation of UF/sub 6/ behavior in a fire

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Williams, W.R.

    Reactions between UF/sub 6/ and combustible gases and the potential for UF/sub 6/-filled cylinders to rupture when exposed to fire are addressed. Although the absence of kinetic data prevents specific identification and quantification of the chemical species formed, potential reaction products resulting from the release of UF/sub 6/ into a fire include UF/sub 4/, UO/sub 2/F/sub 2/, HF, C, CF/sub 4/,COF/sub 2/, and short chain, fluorinated or partially fluorinated hydrocarbons. Such a release adds energy to a fire relative to normal combustion reactions. Time intervals to an assumed point of rupture for UF/sub 6/-filled cylinders exposed to fire are estimatedmore » conservatively. Several related studies are also summarized, including a test series in which small UF/sub 6/-filled cylinders were immersed in fire resulting in valve failures and explosive ruptures. It is concluded that all sizes of UF/sub 6/ cylinders currently in use may rupture within 30 minutes when totally immersed in a fire. For cylinders adjacent to fires, rupture of the larger cylinders appears much less likely.« less

  2. Electrochemical branched-DNA assay for polymerase chain reaction-free detection and quantification of oncogenes in messenger RNA.

    PubMed

    Lee, Ai-Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe

    2008-12-15

    We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcripts in the population of messenger ribonucleic acid (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify the target signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-naphthyl phosphate. The voltammetric characteristics of substrate and enzymatic product as well as the parameters of SWV analysis were systematically optimized. A detection limit of 1 fM (1 x 10(-19) mol of target transcripts in 100 microL) and a 3-order-wide dynamic range of target concentration were achieved by the electrochemical bDNA assay. Such limit corresponded to approximately 17 fg of the p185 BCR-ABL fusion transcripts. The specificity and sensitivity of assay enabled direct detection of target transcripts in as little as 4.6 ng of mRNA population without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcripts in mRNA population. A mean transcript copy number of 62,900/ng of mRNA was determined, which was at least 50-fold higher than that of real-time quantitative PCR (qPCR). The finding was consistent with the underestimation of targets by qPCR reported earlier. In addition, the unique design based on bDNA technology increases the assay specificity as only the p185 BCR-ABL fusion transcripts will respond to the detection. The approach thus provides a simple, sensitive, accurate, and quantitative tool alternative to the qPCR for early disease diagnosis.

  3. Effect of a lotion containing the heat-treated probiotic strain Lactobacillus johnsonii NCC 533 on Staphylococcus aureus colonization in atopic dermatitis.

    PubMed

    Blanchet-Réthoré, Sandrine; Bourdès, Valérie; Mercenier, Annick; Haddar, Cyrille H; Verhoeven, Paul O; Andres, Philippe

    2017-01-01

    Staphylococcus aureus dominates the skin microbiota in patients with atopic dermatitis (AD), with bacterial loads correlating with disease severity. The aim of this exploratory study was to investigate the effect of a cosmetic lotion containing heat-treated Lactobacillus johnsonii NCC 533 (HT La1) on S. aureus colonization in AD patients. This open-label, multicenter study was performed in AD patients in Germany. First, detection of S. aureus was performed in all patients using the swab or scrub-wash method of sampling, followed by quantitative culture or quantitative polymerase chain reaction. Repeatability and reproducibility of all method combinations were evaluated to select the best combination of sampling and quantification. Second, a lotion containing HT La1 was applied to lesional skin twice daily for 3 weeks. Scoring using local objective SCORing Atopic Dermatitis (SCORAD), measurement of S. aureus load, and lesional microbiome analysis were performed before and after the 3-week treatment period. Thirty-one patients with AD were included in the study. All sampling and quantification methods were found to be robust, reproducible, and repeatable for assessing S. aureus load. For simplicity, a combination of swab and quantitative polymerase chain reaction was chosen to assess the efficacy of HT La1. Following application of a lotion containing HT La1 to AD lesions for 3 weeks, a reduction in S. aureus load was observed in patients, which correlated with a decrease in local objective SCORAD. Interestingly, high baseline skin concentrations of S. aureus were associated with good responses to the lotion. This study demonstrated that the application of a lotion containing HT La1 to the lesional skin of patients with AD for 3 weeks controlled S. aureus colonization and was associated with local clinical improvement (SCORAD). These findings support further development of topical treatments containing heat-treated nonreplicating beneficial bacteria for patients with AD.

  4. Inter-laboratory quality control for hormone-dependent gene expression in human breast tumors using real-time reverse transcription-polymerase chain reaction.

    PubMed

    de Cremoux, P; Bieche, I; Tran-Perennou, C; Vignaud, S; Boudou, E; Asselain, B; Lidereau, R; Magdelénat, H; Becette, V; Sigal-Zafrani, B; Spyratos, F

    2004-09-01

    Quantitative reverse transcription-polymerase chain reaction (RT-PCR) used to detect minor changes in specific mRNA concentrations may be associated with poor reproducibility. Stringent quality control is therefore essential at each step of the protocol, including the PCR procedure. We performed inter-laboratory quality control of quantitative PCR between two independent laboratories, using in-house RT-PCR assays on a series of hormone-related target genes in a retrospective consecutive series of 79 breast tumors. Total RNA was reverse transcribed in a single center. Calibration curves were performed for five target genes (estrogen receptor (ER)alpha, ERbeta, progesterone receptor (PR), CYP19 (aromatase) and Ki 67) and for two reference genes (human acidic ribosomal phosphoprotein PO (RPLPO) and TATA box-binding protein (TBP)). Amplification efficiencies of the calibrator were determined for each run and used to calculate mRNA expression. Correlation coefficients were evaluated for each target and each reference gene. A good correlation was observed for all target and reference genes in both centers using their own protocols and kits (P < 0.0001). The correlation coefficients ranged from 0.90 to 0.98 for the various target genes in the two centers. A good correlation was observed between the level of expression of the ERalpha and the PR transcripts (P < 0.001). A weak inverse correlation was observed in both centers between ERalpha and ERbeta levels, but only when TBP was the reference gene. No other correlation was observed with other parameters. Real-time PCR assays allow convenient quantification of target mRNA transcripts and quantification of target-derived nucleic acids in clinical specimens. This study addresses the importance of inter-laboratory quality controls for the use of a panel of real-time PCR assays devoted to clinical samples and protocols and to ensure their appropriate accuracy. This can also facilitate exchanges and multicenter comparison of data.

  5. Evaluating the influence of wastewater composition on the growth of Microthrix parvicella by GCxGC/qMS and real-time PCR.

    PubMed

    Dunkel, Thiemo; de León Gallegos, Erika Lizette; Schönsee, Carina D; Hesse, Tobias; Jochmann, Maik; Wingender, Jost; Denecke, Martin

    2016-01-01

    This study underlines the significance of long chain fatty acid (LCFA) content in wastewater influents as an influencing factor promoting the growth of Candidatus 'Microthrix parvicella' (M. parvicella), the most common filamentous bacteria causing foam in activated sludge systems worldwide. Quantification of M. parvicella by real-time polymerase chain reaction (real-time PCR) and analysis of LCFAs by means of two-dimensional gas chromatography coupled with mass spectrometry (GCxGC/qMS), involving solid phase micro-extraction (SPME) to enhance sensitivity, were combined for the first time as a monitoring tool. The results indicate a highly significant correlation between the abundance of M. parvicella and the total LCFA loading (r = 0.96) and linolenic acid C18:3 (r = 0.98) in particular. Additionally, comparison of slope values for the direct correlations of all significant LCFAs found in the analyses showed that the influence of LCFAs on M. parvicella growth increases with an increasing degree of unsaturation of carbon chains. These findings suggest that by removing lipid compounds from the incoming waters, substrate availability would be limited for M. parvicella. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Fast quantification of short chain fatty acids and ketone bodies by liquid chromatography-tandem mass spectrometry after facile derivatization coupled with liquid-liquid extraction.

    PubMed

    Zeng, Mingfei; Cao, Huachuan

    2018-04-15

    Short chain fatty acids (SCFA) and ketone bodies recently emerged as important physiological relevant metabolites because of their association with microbiota, immunology, obesity and other metabolic states. They were commonly analyzed by GC-MS with long run time and laborious sample preparation. In this study we developed a novel LC-MS/MS method using fast derivatization coupled with liquid-liquid extraction to detect SCFA and ketone bodies in plasma and feces. Several different derivatization reagents were evaluated to compare the efficiency, the sensitivity and chromatographic separation of structural isomers. O‑benzylhydroxylamine was selected for its superior overall performance in reaction time and isomeric separation that allowed the measurement of each SCFAs and ketone bodies free from interferences. The derivatization procedure is facile and reproducible in aqueous-organic medium, which abolished the evaporation procedure hampering the analysis of volatile short chain acids. Enhancement in sensitivity remarkably improved the detection limit of SCFA and ketone bodies to sub-fmol level. This novel method was applied to quantify these metabolites in fecal and plasma samples from lean and DIO mouse. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    PubMed

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  8. Evaluation of RNA extraction methods and identification of putative reference genes for real-time quantitative polymerase chain reaction expression studies on olive (Olea europaea L.) fruits.

    PubMed

    Nonis, Alberto; Vezzaro, Alice; Ruperti, Benedetto

    2012-07-11

    Genome wide transcriptomic surveys together with targeted molecular studies are uncovering an ever increasing number of differentially expressed genes in relation to agriculturally relevant processes in olive (Olea europaea L). These data need to be supported by quantitative approaches enabling the precise estimation of transcript abundance. qPCR being the most widely adopted technique for mRNA quantification, preliminary work needs to be done to set up robust methods for extraction of fully functional RNA and for the identification of the best reference genes to obtain reliable quantification of transcripts. In this work, we have assessed different methods for their suitability for RNA extraction from olive fruits and leaves and we have evaluated thirteen potential candidate reference genes on 21 RNA samples belonging to fruit developmental/ripening series and to leaves subjected to wounding. By using two different algorithms, GAPDH2 and PP2A1 were identified as the best reference genes for olive fruit development and ripening, and their effectiveness for normalization of expression of two ripening marker genes was demonstrated.

  9. Direct Quantification of Methane Emissions Across the Supply Chain: Identification of Mitigation Targets

    NASA Astrophysics Data System (ADS)

    Darzi, M.; Johnson, D.; Heltzel, R.; Clark, N.

    2017-12-01

    Researchers at West Virginia University's Center for Alternative Fuels, Engines, and Emissions have recently participated in a variety of studies targeted at direction quantification of methane emissions from across the natural gas supply chain. These studies included assessing methane emissions from heavy-duty vehicles and their fuel stations, active unconventional well sites - during both development and production, natural gas compression and storage facilities, natural gas engines - both large and small, two- and four-stroke, and low-throughput equipment associated with coal bed methane wells. Engine emissions were sampled using conventional instruments such as Fourier transform infrared spectrometers and heated flame ionization detection analyzers. However, to accurately quantify a wide range of other sources beyond the tailpipe (both leaks and losses), a full flow sampling system was developed, which included an integrated cavity-enhanced absorption spectrometer. Through these direct quantification efforts and analysis major sources of methane emissions were identified. Technological solutions and best practices exist or could be developed to reduce methane emissions by focusing on the "lowest-hanging fruit." For example, engine crankcases from across the supply chain should employ vent mitigation systems to reduce methane and other emissions. An overview of the direct quantification system and various campaign measurements results will be presented along with the identification of other targets for additional mitigation.

  10. Parallel Reaction Monitoring: A Targeted Experiment Performed Using High Resolution and High Mass Accuracy Mass Spectrometry

    PubMed Central

    Rauniyar, Navin

    2015-01-01

    The parallel reaction monitoring (PRM) assay has emerged as an alternative method of targeted quantification. The PRM assay is performed in a high resolution and high mass accuracy mode on a mass spectrometer. This review presents the features that make PRM a highly specific and selective method for targeted quantification using quadrupole-Orbitrap hybrid instruments. In addition, this review discusses the label-based and label-free methods of quantification that can be performed with the targeted approach. PMID:26633379

  11. Overcoming Heparin-Associated RT-qPCR Inhibition and Normalization Issues for microRNA Quantification in Patients with Acute Myocardial Infarction.

    PubMed

    Coelho-Lima, Jose; Mohammed, Ashfaq; Cormack, Suzanne; Jones, Samuel; Das, Rajiv; Egred, Mohaned; Panahi, Pedram; Ali, Simi; Spyridopoulos, Ioakim

    2018-06-11

     Cardiac-enriched micro ribonucleic acids (miRNAs) are released into the circulation following ST-elevation myocardial infarction (STEMI). Lack of standardized approaches for reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) data normalization and presence of RT-qPCR inhibitors (e.g. heparin) in patient blood samples have prevented reproducible miRNA quantification in this cohort and subsequent translation of these biomarkers to clinical practice.  Using a RT-qPCR miRNA screening platform, we identified and validated an endogenous circulating miRNA as a normalization control. In addition, we assessed the effects of in vivo and in vitro anticoagulant drugs administration (heparin and bivalirudin) on three RT-qPCR normalization strategies (global miRNA mean, exogenous spike-in control [cel-miR-39] and endogenous miRNA control). Finally, we evaluated the effect of heparin and its in vitro inhibition with heparinase on the quantification of cardiac-enriched miRNAs in STEMI patients.  miR-425-5p was validated as an endogenous miRNA control. Heparin administration in vitro and in vivo inhibited all RT-qPCR normalization strategies. In contrast, bivalirudin had no effects on cel-miR-39 or miR-425-5p quantification. In vitro RNA sample treatment with 0.3 U of heparinase overcame heparin-induced over-estimation of cardiac-enriched miRNA levels and improved their correlation with high-sensitivity troponin T.  miRNA quantification in STEMI patients receiving heparin is jeopardized by its effect on all RT-qPCR normalization approaches. Use of samples from bivalirudin-treated patients or in vitro treatment of heparin-contaminated samples with heparinase are suitable alternatives for miRNA quantification in this cohort. Finally, we reinforce the evidence that cardiac-enriched miRNAs early after myocardial reperfusion reflect the severity of cardiac injury. Schattauer GmbH Stuttgart.

  12. Clarity™ digital PCR system: a novel platform for absolute quantification of nucleic acids.

    PubMed

    Low, Huiyu; Chan, Shun-Jie; Soo, Guo-Hao; Ling, Belinda; Tan, Eng-Lee

    2017-03-01

    In recent years, digital polymerase chain reaction (dPCR) has gained recognition in biomedical research as it provides a platform for precise and accurate quantification of nucleic acids without the need for a standard curve. However, this technology has not yet been widely adopted as compared to real-time quantitative PCR due to its more cumbersome workflow arising from the need to sub-divide a PCR sample into a large number of smaller partitions prior to thermal cycling to achieve zero or at least one copy of the target RNA/DNA per partition. A recently launched platform, the Clarity™ system from JN Medsys, simplifies dPCR workflow through the use of a novel chip-in-a-tube technology for sample partitioning. In this study, the performance of Clarity™ was evaluated through quantification of the single-copy human RNase P gene. The system demonstrated high precision and accuracy and also excellent linearity across a range of over 4 orders of magnitude for the absolute quantification of the target gene. Moreover, consistent DNA copy measurements were also attained using a panel of different probe- and dye-based master mixes, demonstrating the system's compatibility with commercial master mixes. The Clarity™ was then compared to the QX100™ droplet dPCR system from Bio-Rad using a set of DNA reference materials, and the copy number concentrations derived from both systems were found to be closely associated. Collectively, the results showed that Clarity™ is a reliable, robust and flexible platform for next-generation genetic analysis.

  13. Development of a real-time PCR assay for Penicillium expansum quantification and patulin estimation in apples.

    PubMed

    Tannous, Joanna; Atoui, Ali; El Khoury, André; Kantar, Sally; Chdid, Nader; Oswald, Isabelle P; Puel, Olivier; Lteif, Roger

    2015-09-01

    Due to the occurrence and spread of the fungal contaminants in food and the difficulties to remove their resulting mycotoxins, rapid and accurate methods are needed for early detection of these mycotoxigenic fungi. The polymerase chain reaction and the real time PCR have been widely used for this purpose. Apples are suitable substrates for fungal colonization mostly caused by Penicillium expansum, which produces the mycotoxin patulin during fruit infection. This study describes the development of a real-time PCR assay incorporating an internal amplification control (IAC) to specifically detect and quantify P. expansum. A specific primer pair was designed from the patF gene, involved in patulin biosynthesis. The selected primer set showed a high specificity for P. expansum and was successfully employed in a standardized real-time PCR for the direct quantification of this fungus in apples. Using the developed system, twenty eight apples were analyzed for their DNA content. Apples were also analyzed for patulin content by HPLC. Interestingly, a positive correlation (R(2) = 0.701) was found between P. expansum DNA content and patulin concentration. This work offers an alternative to conventional methods of patulin quantification and mycological detection of P. expansum and could be very useful for the screening of patulin in fruits through the application of industrial quality control. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Application of loop-mediated isothermal amplification with propidium monoazide treatment to detect live Salmonella in chicken carcasses.

    PubMed

    Youn, S Y; Jeong, O M; Choi, B K; Jung, S C; Kang, M S

    2017-02-01

    Raw chicken products are major causes of human foodborne salmonellosis worldwide. In particular, there is a significant risk of human exposure to Salmonella originating from the chicken slaughtering process. Controlling the contamination of chicken carcasses by Salmonella has been a considerable challenge in chicken-slaughtering facilities and involves routine microbiological monitoring using reliable detection methods. Simple and rapid detection methods, particularly those capable of determining cell viability, will significantly facilitate routine monitoring of Salmonella Here, we report an invA-based loop-mediated isothermal amplification method coupled with a simple propidium monoazide treatment (PMA-LAMP) for simple and rapid detection and quantification of viable Salmonella in rinse water of chicken carcasses. In this study, PMA-LAMP consistently gave negative results for isopropanol-killed Salmonella with concentrations up to 8.0 × 10 6 CFU/reaction. The detection limit of PMA-LAMP was 8.0 × 10 1 CFU/reaction with viable Salmonella in both pure culture and rinse water of chicken carcasses, and 10-fold lower than a conventional polymerase chain reaction coupled with PMA (PMA-PCR) targeting invA There was a high correlation (R 2 = 0.99 to 0.976) between LAMP time threshold (T T ) values and viable Salmonella with a quantification range of 1.0 × 10 3 to 1.0 × 10 8 CFU/mL in pure culture and rinse water of chicken carcasses. The PMA-LAMP assay took less than 2 h to detect Salmonella contaminated in test samples. Therefore, this simple and rapid method will be a very useful tool to detect live Salmonella contamination of chicken carcasses without pre-enrichment at the slaughterhouse where sanitizing treatments are commonly used. © 2016 Poultry Science Association Inc.

  15. Fundamentals of multiplexing with digital PCR.

    PubMed

    Whale, Alexandra S; Huggett, Jim F; Tzonev, Svilen

    2016-12-01

    Over the past decade numerous publications have demonstrated how digital PCR (dPCR) enables precise and sensitive quantification of nucleic acids in a wide range of applications in both healthcare and environmental analysis. This has occurred in parallel with the advances in partitioning fluidics that enable a reaction to be subdivided into an increasing number of partitions. As the majority of dPCR systems are based on detection in two discrete optical channels, most research to date has focused on quantification of one or two targets within a single reaction. Here we describe 'higher order multiplexing' that is the unique ability of dPCR to precisely measure more than two targets in the same reaction. Using examples, we describe the different types of duplex and multiplex reactions that can be achieved. We also describe essential experimental considerations to ensure accurate quantification of multiple targets.

  16. High-throughput microfluidic single-cell digital polymerase chain reaction.

    PubMed

    White, A K; Heyries, K A; Doolin, C; Vaninsberghe, M; Hansen, C L

    2013-08-06

    Here we present an integrated microfluidic device for the high-throughput digital polymerase chain reaction (dPCR) analysis of single cells. This device allows for the parallel processing of single cells and executes all steps of analysis, including cell capture, washing, lysis, reverse transcription, and dPCR analysis. The cDNA from each single cell is distributed into a dedicated dPCR array consisting of 1020 chambers, each having a volume of 25 pL, using surface-tension-based sample partitioning. The high density of this dPCR format (118,900 chambers/cm(2)) allows the analysis of 200 single cells per run, for a total of 204,000 PCR reactions using a device footprint of 10 cm(2). Experiments using RNA dilutions show this device achieves shot-noise-limited performance in quantifying single molecules, with a dynamic range of 10(4). We performed over 1200 single-cell measurements, demonstrating the use of this platform in the absolute quantification of both high- and low-abundance mRNA transcripts, as well as micro-RNAs that are not easily measured using alternative hybridization methods. We further apply the specificity and sensitivity of single-cell dPCR to performing measurements of RNA editing events in single cells. High-throughput dPCR provides a new tool in the arsenal of single-cell analysis methods, with a unique combination of speed, precision, sensitivity, and specificity. We anticipate this approach will enable new studies where high-performance single-cell measurements are essential, including the analysis of transcriptional noise, allelic imbalance, and RNA processing.

  17. Development of Multiplex Reverse Transcription-Polymerase Chain Reaction for Simultaneous Detection of Influenza A, B and Adenoviruses

    PubMed Central

    Nakhaie, Mohsen; Soleimanjahi, Hoorieh; Mollaie, Hamid Reza; Arabzadeh, Seyed Mohamad Ali

    2018-01-01

    Background and objective: Millions of people in developing countries lose their lives due to acute respiratory infections, such as Influenza A & B and Adeno viruses. Given the importance of rapid identification of the virus, in this study the researchers attempted to design a method that enables detection of influenza A, B, and adenoviruses, quickly and simultaneously. The Multiplex RT PCR method was the preferred method for the detection of influenza A, B, and adenoviruses in clinical specimens because it is rapid, sensitive, specific, and more cost-effective than alternative methods Methods: After collecting samples from patients with respiratory disease, virus genome was extracted, then Monoplex PCR was used on positive samples and Multiplex RT-PCR on clinical specimens. Finally, by comparing the bands of these samples, the type of virus in the clinical samples was determined. Results: Performing Multiplex RT-PCR on 50 samples of respiratory tract led to following results; flu A: 12.5%, fluB: 50%, adeno: 27.5%, negative: 7.5%, and 2.5% contamination. Conclusion: Reverse transcription-multiplex Polymerase Chain Reaction (PCR) technique, a rapid diagnostic tool, has potential for high-throughput testing. This method has a significant advantage, which provides simultaneous amplification of numerous viruses in a single reaction. This study concentrates on multiplex molecular technologies and their clinical application for the detection and quantification of respiratory pathogens. The improvement in diagnostic testing for viral respiratory pathogens effects patient management, and leads to more cost-effective delivery of care. It limits unnecessary antibiotic use and improves clinical management by use of suitable treatment. PMID:29731796

  18. A robust method for determining water-extractable alkylphenol polyethoxylates in textile products by reaction-based headspace gas chromatography.

    PubMed

    Zhang, Shu-Xin; Chai, Xin-Sheng; Huang, Bo-Xi; Mai, Xiao-Xia

    2015-08-07

    Alkylphenol polyethoxylates (APEO), surfactants used in the production of textiles, have the potential to move from the fabric to the skin of the person wearing the clothes, posing an inherent risk of adverse health consequences. Therefore, the textile industry needs a fast, robust method for determining aqueous extractable APEO in fabrics. The currently-favored HPLC methods are limited by the presence of a mixture of analytes (due to the molecular weight distribution) and a lack of analytical standards for quantifying results. As a result, it has not been possible to reach consensus on a standard method for the determination of APEO in textiles. This paper addresses these limitations through the use of reaction-based head space-gas chromatography (HS-GC). Specifically, water is used to simulate body sweat and extract APEO. HI is then used to react the ethoxylate chains to depolymerize the chains into iodoethane that is quantified through HS-GC, providing an estimate of the average amount of APEO in the clothing. Data are presented to justify the optimal operating conditions; i.e., water extraction at 60°C for 1h and reaction with a specified amount of HI in the headspace vial at 135°C for 4h. The results show that the HS-GC method has good precision (RSD<10%) and good accuracy (recoveries from 95 to 106%) for the quantification of APEO content in textile and related materials. As such, the method should be a strong candidate to become a standard method for such determinations. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Simple model of inhibition of chain-branching combustion processes

    NASA Astrophysics Data System (ADS)

    Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.

    2017-11-01

    A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.

  20. Nasopharyngeal bacterial load as a marker for rapid and easy diagnosis of invasive pneumococcal disease in children from Mozambique

    PubMed Central

    Lanaspa, Miguel; Henares, Desiree; Perez-Arguello, Amaresh; Madrid, Lola; Balcells, Reyes; Acacio, Sozinho; Andres-Franch, Maria; Marcos, Maria Angeles; Valero-Rello, Ana

    2017-01-01

    Background Current diagnostic methods for detection of Streptococcus pneumoniae in children with suspected invasive pneumococcal disease have limitations of accuracy, timeliness, and patient convenience. This study aimed to determine the performance of pneumococcal load quantified with a real-time polymerase-chain reaction in nasopharyngeal samples to diagnose invasive pneumococcal disease in children. Methods Matched case-control study of patients <5 years of age with invasive pneumococcal disease admitted to the Manhiça District Hospital (Mozambique) and asymptomatic controls recruited in different periods between 2006 and 2014. Cases were confirmed by a positive bacterial culture for S. pneumoniae in blood or cerebrospinal fluid. Nasopharyngeal aspirates were collected from cases and controls and pneumococcal density was quantified by lytA real-time polymerase-chain reaction. Results Thirty cases (median age 12.8 months) and sixty controls (median age 11.7 months) were enrolled and 70% of them were male. Nasopharyngeal pneumococcal carriage was high in both groups: 28/30 (93.3%) for cases vs. 53/60 (88.3%) for controls (p = 0.71). Mean nasopharyngeal pneumococcal load was identified as a marker for invasive pneumococcal disease (7.0 log10 copies/mL in cases vs. 5.8 log10 copies/mL in controls, p<0.001) and showed good discriminatory power (AUC-ROC: 82.1%, 95% CI 72.5%-91.8%). A colonization density of 6.5 log10 copies/mL was determined as the optimal cut-off value to distinguish cases from controls (sensitivity 75.0%, specificity 73.6%). Conclusion Use of non-invasive nasopharyngeal aspirates coupled with rapid and accurate quantification of pneumococcal load by real-time polymerase chain reaction has the potential to become a useful surrogate marker for early diagnosis of invasive pneumococcal disease in children. PMID:28910402

  1. Quantification of diesel exhaust gas phase organics by a thermal desorption proton transfer reaction mass spectrometer

    NASA Astrophysics Data System (ADS)

    Erickson, M. H.; Wallace, H. W.; Jobson, B. T.

    2012-02-01

    A new approach was developed to measure the total abundance of long chain alkanes (C12 and above) in urban air using thermal desorption with a proton transfer reaction mass spectrometer (PTR-MS). These species are emitted in diesel exhaust and may be important precursors to secondary organic aerosol production in urban areas. Long chain alkanes undergo dissociative proton transfer reactions forming a series of fragment ions with formula CnH2n+1. The yield of the fragment ions is a function of drift conditions. At a drift field strength of 80 Townsends, the most abundant ion fragments from C10 to C16 n-alkanes were m/z 57, 71 and 85. The PTR-MS is insensitive to n-alkanes less than C8 but displays an increasing sensitivity for larger alkanes. Higher drift field strengths yield greater normalized sensitivity implying that the proton affinity of the long chain n-alkanes is less than H2O. Analysis of diesel fuel shows the mass spectrum was dominated by alkanes (CnH2n+1), monocyclic aromatics, and an ion group with formula CnH2n-1 (m/z 97, 111, 125, 139). The PTR-MS was deployed in Sacramento, CA during the Carbonaceous Aerosols and Radiative Effects Study field experiment in June 2010. The ratio of the m/z 97 to 85 ion intensities in ambient air matched that found in diesel fuel. Total diesel exhaust alkane concentrations calculated from the measured abundance of m/z 85 ranged from the method detection limit of ~1 μg m-3 to 100 μg m-3 in several air pollution episodes. The total diesel exhaust alkane concentration determined by this method was on average a factor of 10 greater than the sum of alkylbenzenes associated with spark ignition vehicle exhaust.

  2. Toxoplasma Gondii and Pre-treatment Protocols for Polymerase Chain Reaction Analysis of Milk Samples: A Field Trial in Sheep from Southern Italy.

    PubMed

    Vismarra, Alice; Barilli, Elena; Miceli, Maura; Mangia, Carlo; Bacci, Cristina; Brindani, Franco; Kramer, Laura

    2017-01-24

    Toxoplasmosis is a zoonotic disease caused by the protozoan Toxoplasma gondii. Ingestion of raw milk has been suggested as a risk for transmission to humans. Here the authors evaluated pre-treatment protocols for DNA extraction on T. gondii tachyzoite-spiked sheep milk with the aim of identifying the method that resulted in the most rapid and reliable polymerase chain reaction (PCR) positivity. This protocol was then used to analyse milk samples from sheep of three different farms in Southern Italy, including real time PCR for DNA quantification and PCR-restriction fragment length polymorphism for genotyping. The pre-treatment protocol using ethylenediaminetetraacetic acid and Tris-HCl to remove casein gave the best results in the least amount of time compared to the others on spiked milk samples. One sample of 21 collected from sheep farms was positive on one-step PCR, real time PCR and resulted in a Type I genotype at one locus (SAG3). Milk usually contains a low number of tachyzoites and this could be a limiting factor for molecular identification. Our preliminary data has evaluated a rapid, cost-effective and sensitive protocol to treat milk before DNA extraction. The results of the present study also confirm the possibility of T. gondii transmission through consumption of raw milk and its unpasteurised derivatives.

  3. Ultrasensitive electrochemical detection of DNA based on Zn²⁺ assistant DNA recycling followed with hybridization chain reaction dual amplification.

    PubMed

    Qian, Yong; Wang, Chunyan; Gao, Fenglei

    2015-01-15

    A new strategy to combine Zn(2+) assistant DNA recycling followed with hybridization chain reaction dual amplification was designed for highly sensitive electrochemical detection of target DNA. A gold electrode was used to immobilize molecular beacon (MB) as the recognition probe and perform the amplification procedure. In the presence of the target DNA, the hairpin probe 1 was opened, and the DNAzyme was liberated from the caged structure. The activated DNAzyme hybridized with the MB and catalyzed its cleavage in the presence of Zn(2+) cofactor and resulting in a free DNAzyme strand. Finally, each target-induced activated DNAzyme underwent many cycles triggering the cleavage of MB, thus forming numerous MB fragments. The MB fragments triggered the HCR and formed a long double-helix DNA structure. Because both H1 and H2 were labeled by biotin, a lot of SA-ALP was captured on the electrode surface, thus catalyzing a silver deposition process for electrochemical stripping analysis. This novel cascade signal amplification strategy can detect target DNA down to the attomolar level with a dynamic range spanning 6 orders of magnitude. This highly sensitive and specific assay has a great potential to become a promising DNA quantification method in biomedical research and clinical diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Use of Blood Smears and Dried Blood Spots for Polymerase Chain Reaction-Based Detection and Quantification of Bacterial Infection and Plasmodium falciparum in Severely Ill Febrile African Children.

    PubMed

    Wihokhoen, Benchawan; Dondorp, Arjen M; Turner, Paul; Woodrow, Charles J; Imwong, Mallika

    2016-02-01

    Molecular approaches offer a means of testing archived samples stored as dried blood spots in settings where standard blood cultures are not possible. Peripheral blood films are one suggested source of material, although the sensitivity of this approach has not been well defined. Thin blood smears and dried blood spots from a severe pediatric malaria study were assessed using specific polymerase chain reaction (PCR) primers to detect non-typhoidal Salmonella (NTS; MisL gene), Streptococcus pneumoniae (lytA), and Plasmodium falciparum (18S rRNA). Of 16 cases of NTS and S. pneumoniae confirmed on blood culture, none were positive by PCR using DNA extracts from blood films or dried blood spots. In contrast, four of 36 dried blood spots and two of 178 plasma samples were PCR positive for S. pneumoniae, despite negative bacterial blood cultures, suggesting false positives. Quantitative assessment revealed that the effective concentration of P. falciparum DNA in blood films was three log orders of magnitude lower than for dried blood spots. The P. falciparum kelch13 gene could not be amplified from blood films. These findings question the value of blood PCR-based approaches for detection of NTS and S. pneumoniae, and show that stored blood films are an inefficient method of studying P. falciparum. © The American Society of Tropical Medicine and Hygiene.

  5. Validation of Roche LightCycler Epstein-Barr virus quantification reagents in a clinical laboratory setting.

    PubMed

    Gulley, Margaret L; Fan, Hongxin; Elmore, Sandra H

    2006-11-01

    Epstein-Barr virus (EBV) is associated with a wide range of benign and malignant diseases, including infectious mononucleosis, lymphoma, posttransplant lymphoproliferative disorder, and nasopharyngeal carcinoma. Measurement of EBV viral load in plasma is increasingly used for rapid assessment of disease status. We evaluated the performance characteristics of an EBV polymerase chain reaction assay that uses commercial reagents and instruments from Roche Diagnostics (Indianapolis, IN). DNA was extracted from plasma using a MagNaPure instrument, and viral load was measured by real-time polymerase chain reaction on a LightCycler. Analyte-specific reagents included primers and hybridization probes targeting the EBV LMP2 gene and a spiked control sequence. Accuracy and reproducibility were established using DNA from three cell lines. The assay was sensitive to approximately 750 copies of EBV DNA per milliliter of plasma and was linear across at least four orders of magnitude. The assay detected EBV DNA in three of five samples from nasopharyngeal carcinoma patients, seven of nine infectious mononucleosis samples, and 34/34 samples from immunosuppressed patients with clinically significant EBV-related disease, whereas EBV DNA was undetectable in plasma from 21 individuals without EBV-related disease. In conclusion, this LightCycler EBV assay is rapid, sensitive, and linear for quantifying EBV viral load. The assay appears to be useful for measuring clinically significant EBV levels in immunodeficient patients.

  6. Bayesian forecasting and uncertainty quantifying of stream flows using Metropolis-Hastings Markov Chain Monte Carlo algorithm

    NASA Astrophysics Data System (ADS)

    Wang, Hongrui; Wang, Cheng; Wang, Ying; Gao, Xiong; Yu, Chen

    2017-06-01

    This paper presents a Bayesian approach using Metropolis-Hastings Markov Chain Monte Carlo algorithm and applies this method for daily river flow rate forecast and uncertainty quantification for Zhujiachuan River using data collected from Qiaotoubao Gage Station and other 13 gage stations in Zhujiachuan watershed in China. The proposed method is also compared with the conventional maximum likelihood estimation (MLE) for parameter estimation and quantification of associated uncertainties. While the Bayesian method performs similarly in estimating the mean value of daily flow rate, it performs over the conventional MLE method on uncertainty quantification, providing relatively narrower reliable interval than the MLE confidence interval and thus more precise estimation by using the related information from regional gage stations. The Bayesian MCMC method might be more favorable in the uncertainty analysis and risk management.

  7. Fast and high-efficiency magnetic surface imprinting based on microwave-accelerated reversible addition fragmentation chain transfer polymerization for the selective extraction of estrogen residues in milk.

    PubMed

    Chen, Fangfang; Wang, Jiayu; Lu, Ruicong; Chen, Huiru; Xie, Xiaoyu

    2018-08-10

    A novel microwave-accelerated reversible addition fragmentation chain transfer (RAFT) polymerization strategy has been introduced to shorten reaction time and improved polymerization efficiency of the conventional molecularly imprinting technology based on RAFT. Magnetic molecular imprinted polymers (MMIPs) were successfully synthesized much more efficiently using 17β-estradiol (E2) as a template for the determination of estrogen residues. The resultant MMIPs had well-defined thin imprinted film, favoring the fast mass transfer. Moreover, the reaction time, which was just 1/24 of the time taken by conventional heating, was significantly decreased, improving the reaction efficiency and reducing the probability of side reactions. Meanwhile, the obtained polymers have good capacity of 6.67 mg g -1 and satisfactory selectivity to template molecule with the imprinting factor of 5.11. As a result, a method combination of the resultant MMIPs as solid phase extraction sorbents and high-performance liquid chromatography was successfully set up to determinate three estrogen residues in milk samples. For E2, estrone, and estriol, the limit of detections were calculated to be 0.03, 0.08, and 0.06 ng mL -1 , respectively, and the limit of quantifications were 0.11, 0.27, and 0.21 ng mL -1 , respectively. At the spiked level of 1, 5, and 10 ng mL -1 , the recoveries of the three estrogens were ranged from 69.1% to 91.9% and the intra-day relative standard deviation (RSD) was less than 5.7%. In addition, the resultant MMIPs exhibited good reproducibility and reusability with the inter-batch RSD of 5.3% and the intra-batch RSD of 6.2%, respectively. Overall, the realization of this strategy facilitates the preparation of MMIPs with good architecture and high reaction efficiencies for the analysis of complicated real samples. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  9. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  10. Chain-reaction crash in traffic flow controlled by taillights

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-02-01

    We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.

  11. Immobilized Metal Affinity Chromatography Coupled to Multiple Reaction Monitoring Enables Reproducible Quantification of Phospho-signaling*

    PubMed Central

    Kennedy, Jacob J.; Yan, Ping; Zhao, Lei; Ivey, Richard G.; Voytovich, Uliana J.; Moore, Heather D.; Lin, Chenwei; Pogosova-Agadjanyan, Era L.; Stirewalt, Derek L.; Reding, Kerryn W.; Whiteaker, Jeffrey R.; Paulovich, Amanda G.

    2016-01-01

    A major goal in cell signaling research is the quantification of phosphorylation pharmacodynamics following perturbations. Traditional methods of studying cellular phospho-signaling measure one analyte at a time with poor standardization, rendering them inadequate for interrogating network biology and contributing to the irreproducibility of preclinical research. In this study, we test the feasibility of circumventing these issues by coupling immobilized metal affinity chromatography (IMAC)-based enrichment of phosphopeptides with targeted, multiple reaction monitoring (MRM) mass spectrometry to achieve precise, specific, standardized, multiplex quantification of phospho-signaling responses. A multiplex immobilized metal affinity chromatography- multiple reaction monitoring assay targeting phospho-analytes responsive to DNA damage was configured, analytically characterized, and deployed to generate phospho-pharmacodynamic curves from primary and immortalized human cells experiencing genotoxic stress. The multiplexed assays demonstrated linear ranges of ≥3 orders of magnitude, median lower limit of quantification of 0.64 fmol on column, median intra-assay variability of 9.3%, median inter-assay variability of 12.7%, and median total CV of 16.0%. The multiplex immobilized metal affinity chromatography- multiple reaction monitoring assay enabled robust quantification of 107 DNA damage-responsive phosphosites from human cells following DNA damage. The assays have been made publicly available as a resource to the community. The approach is generally applicable, enabling wide interrogation of signaling networks. PMID:26621847

  12. Cutaneous T-cell lymphoma (CTCL): Current practices in blood assessment and the utility of T-cell receptor (TCR)-Vβ chain restriction.

    PubMed

    Gibson, Juliet F; Huang, Jing; Liu, Kristina J; Carlson, Kacie R; Foss, Francine; Choi, Jaehyuk; Edelson, Richard; Hussong, Jerry W; Mohl, Ramsey; Hill, Sally; Girardi, Michael

    2016-05-01

    Accurate quantification of malignant cells in the peripheral blood of patients with cutaneous T-cell lymphoma is important for early detection, prognosis, and monitoring disease burden. We sought to determine the spectrum of current clinical practices; critically evaluate elements of current International Society for Cutaneous Lymphomas (ISCL) B1 and B2 staging criteria; and assess the potential role of T-cell receptor-Vβ analysis by flow cytometry. We assessed current clinical practices by survey, and performed a retrospective analysis of 161 patients evaluated at Yale (2011-2014) to compare the sensitivity, specificity, positive predictive value, and negative predictive value of parameters for ISCL B2 staging. There was heterogeneity in clinical practices among institutions. ISCL B1 criteria did not capture 5 Yale cohort cases with immunophenotypic abnormalities that later progressed. T-cell receptor-Vβ testing was more specific than polymerase chain reaction and aided diagnosis in detecting clonality, but was of limited benefit in quantification of tumor burden. Because of limited follow-up involving a single center, further investigation will be necessary to conclude whether our proposed diagnostic algorithm is of general clinical benefit. We propose further study of modified B1 criteria: CD4/CD8 ratio 5 or greater, %CD4(+) CD26(-) 20% or greater, or %CD4(+) CD7(-) 20% or greater, with evidence of clonality. T-cell receptor-Vβ testing should be considered in future diagnostic and staging algorithms. Copyright © 2015 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

  13. ONR Far East Scientific Information Bulletin

    DTIC Science & Technology

    1990-09-01

    In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by

  14. Mechanistic Studies of Hafnium-Pyridyl Amido-Catalyzed 1-Octene Polymerization and Chain Transfer Using Quench-Labeling Methods.

    PubMed

    Cueny, Eric S; Johnson, Heather C; Anding, Bernie J; Landis, Clark R

    2017-08-30

    Chromophore quench-labeling applied to 1-octene polymerization as catalyzed by hafnium-pyridyl amido precursors enables quantification of the amount of active catalyst and observation of the molecular weight distribution (MWD) of Hf-bound polymers via UV-GPC analysis. Comparison of the UV-detected MWD with the MWD of the "bulk" (all polymers, from RI-GPC analysis) provides important mechanistic information. The time evolution of the dual-detection GPC data, concentration of active catalyst, and monomer consumption suggests optimal activation conditions for the Hf pre-catalyst in the presence of the activator [Ph 3 C][B(C 6 F 5 ) 4 ]. The chromophore quench-labeling agents do not react with the chain-transfer agent ZnEt 2 under the reaction conditions. Thus, Hf-bound polymeryls are selectively labeled in the presence of zinc-polymeryls. Quench-labeling studies in the presence of ZnEt 2 reveal that ZnEt 2 does not influence the rate of propagation at the Hf center, and chain transfer of Hf-bound polymers to ZnEt 2 is fast and quasi-irreversible. The quench-label techniques represent a means to study commercial polymerization catalysts that operate with high efficiency at low catalyst concentrations without the need for specialized equipment.

  15. Effect of perception irregularity on chain-reaction crash in low visibility

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-06-01

    We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.

  16. A newly developed real-time PCR assay for detection and quantification of Fusarium oxysporum and its use in compatible and incompatible interactions with grafted melon genotypes.

    PubMed

    Haegi, Anita; Catalano, Valentina; Luongo, Laura; Vitale, Salvatore; Scotton, Michele; Ficcadenti, Nadia; Belisario, Alessandra

    2013-08-01

    A reliable and species-specific real-time quantitative polymerase chain reaction (qPCR) assay was developed for detection of the complex soilborne anamorphic fungus Fusarium oxysporum. The new primer pair, designed on the translation elongation factor 1-α gene with an amplicon of 142 bp, was highly specific to F. oxysporum without cross reactions with other Fusarium spp. The protocol was applied to grafted melon plants for the detection and quantification of F. oxysporum f. sp. melonis, a devastating pathogen of this cucurbit. Grafting technologies are widely used in melon to confer resistance against new virulent races of F. oxysporum f. sp. melonis, while maintaining the properties of valuable commercial varieties. However, the effects on the vascular pathogen colonization have not been fully investigated. Analyses were performed on 'Charentais-T' (susceptible) and 'Nad-1' (resistant) melon cultivars, both used either as rootstock and scion, and inoculated with F. oxysporum f. sp. melonis race 1 and race 1,2. Pathogen development was compared using qPCR and isolations from stem tissues. Early asymptomatic melon infections were detected with a quantification limit of 1 pg of fungal DNA. The qPCR protocol clearly showed that fungal development was highly affected by host-pathogen interaction (compatible or incompatible) and time (days postinoculation). The principal significant effect (P ≤ 0.01) on fungal development was due to the melon genotype used as rootstock, and this effect had a significant interaction with time and F. oxysporum f. sp. melonis race. In particular, the amount of race 1,2 DNA was significantly higher compared with that estimated for race 1 in the incompatible interaction at 18 days postinoculation. The two fungal races were always present in both the rootstock and scion of grafted plants in either the compatible or incompatible interaction.

  17. Evaluation of cytoreductive efficacy of vincristine, cyclophosphamide, and Doxorubicin in dogs with lymphoma by measuring the number of neoplastic lymphoid cells with real-time polymerase chain reaction.

    PubMed

    Sato, M; Yamazaki, J; Goto-Koshino, Y; Takahashi, M; Fujino, Y; Ohno, K; Tsujimoto, H

    2011-01-01

    The cytoreductive efficacy of the individual components of multidrug chemotherapy for canine lymphoma is difficult to evaluate after complete remission. To compare the cytoreductive efficacy of vincristine (VCR), cyclophosphamide (CPA), and doxorubicin (DXR) in dogs that received a 6-month modified version of the University of Wisconsin-Madison chemotherapy protocol (UW-25). Twenty-nine dogs with high-grade B-cell multicentric lymphoma. Rearranged immunoglobulin heavy chain gene fragments from lymphoma cells were amplified by polymerase chain reaction (PCR) and sequenced to prepare clone-specific primers and probes for real-time PCR. The number of lymphoma cells in peripheral blood was measured from diagnosis to week 11 of UW-25. The number of lymphoma cells after the 1st administration of VCR, CPA, and DXR in weeks 1-4 was decreased in 29/29 (100%), 15/29 (51.7%), and 26/27 (96.3%) dogs, respectively. The cytoreductive efficacy of CPA was less than that of VCR and DXR. VCR, CPA, and DXR administered in weeks 6-9 were effective in 5/26 (19.2%), 5/20 (25.0%), and 14/19 (73.7%) dogs, respectively, indicating the sustained cytoreductive efficacy of DXR. CPA nonresponders were heavier and exhibited a shorter 1st remission than CPA responders. When using UW-25 for treatment of canine lymphoma, CPA was found to have less cytoreductive efficacy than VCR and DXR. Real-time PCR-based quantification of tumor cells is an objective marker of the efficacy of chemotherapeutic agents. Copyright © 2011 by the American College of Veterinary Internal Medicine.

  18. Bayesian forecasting and uncertainty quantifying of stream flows using Metropolis–Hastings Markov Chain Monte Carlo algorithm

    DOE PAGES

    Wang, Hongrui; Wang, Cheng; Wang, Ying; ...

    2017-04-05

    This paper presents a Bayesian approach using Metropolis-Hastings Markov Chain Monte Carlo algorithm and applies this method for daily river flow rate forecast and uncertainty quantification for Zhujiachuan River using data collected from Qiaotoubao Gage Station and other 13 gage stations in Zhujiachuan watershed in China. The proposed method is also compared with the conventional maximum likelihood estimation (MLE) for parameter estimation and quantification of associated uncertainties. While the Bayesian method performs similarly in estimating the mean value of daily flow rate, it performs over the conventional MLE method on uncertainty quantification, providing relatively narrower reliable interval than the MLEmore » confidence interval and thus more precise estimation by using the related information from regional gage stations. As a result, the Bayesian MCMC method might be more favorable in the uncertainty analysis and risk management.« less

  19. Quantification of cardiolipin by liquid chromatography-electrospray ionization mass spectrometry.

    PubMed

    Garrett, Teresa A; Kordestani, Reza; Raetz, Christian R H

    2007-01-01

    Cardiolipin (CL), a tetra-acylated glycerophospholipid composed of two phosphatidyl moieties linked by a bridging glycerol, plays an important role in mitochondrial function in eukaryotic cells. Alterations to the content and acylation state of CL cause mitochondrial dysfunction and may be associated with pathologies such as ischemia, hypothyrodism, aging, and heart failure. The structure of CL is very complex because of microheterogeneity among its four acyl chains. Here we have developed a method for the quantification of CL molecular species by liquid chromatography-electrospray ionization mass spectrometry. We quantify the [M-2H](2-) ion of a CL of a given molecular formula and identify the CLs by their total number of carbons and unsaturations in the acyl chains. This method, developed using mouse macrophage RAW 264.7 tumor cells, is broadly applicable to other cell lines, tissues, bacteria and yeast. Furthermore, this method could be used for the quantification of lyso-CLs and bis-lyso-CLs.

  20. Chain-reaction crash on a highway in high visibility

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2016-05-01

    We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

  1. Quantification of intestinal bacterial populations by real-time PCR with a universal primer set and minor groove binder probes: a global approach to the enteric flora.

    PubMed

    Ott, Stephan J; Musfeldt, Meike; Ullmann, Uwe; Hampe, Jochen; Schreiber, Stefan

    2004-06-01

    The composition of the human intestinal flora is important for the health status of the host. The global composition and the presence of specific pathogens are relevant to the effects of the flora. Therefore, accurate quantification of all major bacterial populations of the enteric flora is needed. A TaqMan real-time PCR-based method for the quantification of 20 dominant bacterial species and groups of the intestinal flora has been established on the basis of 16S ribosomal DNA taxonomy. A PCR with conserved primers was used for all reactions. In each real-time PCR, a universal probe for quantification of total bacteria and a specific probe for the species in question were included. PCR with conserved primers and the universal probe for total bacteria allowed relative and absolute quantification. Minor groove binder probes increased the sensitivity of the assays 10- to 100-fold. The method was evaluated by cross-reaction experiments and quantification of bacteria in complex clinical samples from healthy patients. A sensitivity of 10(1) to 10(3) bacterial cells per sample was achieved. No significant cross-reaction was observed. The real-time PCR assays presented may facilitate understanding of the intestinal bacterial flora through a normalized global estimation of the major contributing species.

  2. Competitive Reporter Monitored Amplification (CMA) - Quantification of Molecular Targets by Real Time Monitoring of Competitive Reporter Hybridization

    PubMed Central

    Ullrich, Thomas; Ermantraut, Eugen; Schulz, Torsten; Steinmetzer, Katrin

    2012-01-01

    Background State of the art molecular diagnostic tests are based on the sensitive detection and quantification of nucleic acids. However, currently established diagnostic tests are characterized by elaborate and expensive technical solutions hindering the development of simple, affordable and compact point-of-care molecular tests. Methodology and Principal Findings The described competitive reporter monitored amplification allows the simultaneous amplification and quantification of multiple nucleic acid targets by polymerase chain reaction. Target quantification is accomplished by real-time detection of amplified nucleic acids utilizing a capture probe array and specific reporter probes. The reporter probes are fluorescently labeled oligonucleotides that are complementary to the respective capture probes on the array and to the respective sites of the target nucleic acids in solution. Capture probes and amplified target compete for reporter probes. Increasing amplicon concentration leads to decreased fluorescence signal at the respective capture probe position on the array which is measured after each cycle of amplification. In order to observe reporter probe hybridization in real-time without any additional washing steps, we have developed a mechanical fluorescence background displacement technique. Conclusions and Significance The system presented in this paper enables simultaneous detection and quantification of multiple targets. Moreover, the presented fluorescence background displacement technique provides a generic solution for real time monitoring of binding events of fluorescently labelled ligands to surface immobilized probes. With the model assay for the detection of human immunodeficiency virus type 1 and 2 (HIV 1/2), we have been able to observe the amplification kinetics of five targets simultaneously and accommodate two additional hybridization controls with a simple instrument set-up. The ability to accommodate multiple controls and targets into a single assay and to perform the assay on simple and robust instrumentation is a prerequisite for the development of novel molecular point of care tests. PMID:22539973

  3. Effect of vehicular size on chain-reaction crash

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-11-01

    We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

  4. Kinetic aspects of chain growth in Fischer-Tropsch synthesis.

    PubMed

    Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M

    2017-04-28

    Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.

  5. Quantification of Plasma miRNAs by Digital PCR for Cancer Diagnosis

    PubMed Central

    Ma, Jie; Li, Ning; Guarnera, Maria; Jiang, Feng

    2013-01-01

    Analysis of plasma microRNAs (miRNAs) by quantitative polymerase chain reaction (qPCR) provides a potential approach for cancer diagnosis. However, absolutely quantifying low abundant plasma miRNAs is challenging with qPCR. Digital PCR offers a unique means for assessment of nucleic acids presenting at low levels in plasma. This study aimed to evaluate the efficacy of digital PCR for quantification of plasma miRNAs and the potential utility of this technique for cancer diagnosis. We used digital PCR to quantify the copy number of plasma microRNA-21-5p (miR-21–5p) and microRNA-335–3p (miR-335–3p) in 36 lung cancer patients and 38 controls. Digital PCR showed a high degree of linearity and quantitative correlation with miRNAs in a dynamic range from 1 to 10,000 copies/μL of input, with high reproducibility. qPCR exhibited a dynamic range from 100 to 1×107 copies/μL of input. Digital PCR had a higher sensitivity to detect copy number of the miRNAs compared with qPCR. In plasma, digital PCR could detect copy number of both miR-21–5p and miR-335–3p, whereas qPCR was only able to assess miR-21–5p. Quantification of the plasma miRNAs by digital PCR provided 71.8% sensitivity and 80.6% specificity in distinguishing lung cancer patients from cancer-free subjects. PMID:24277982

  6. A sensitive and accurate quantification method for the detection of hepatitis B virus covalently closed circular DNA by the application of a droplet digital polymerase chain reaction amplification system.

    PubMed

    Mu, Di; Yan, Liang; Tang, Hui; Liao, Yong

    2015-10-01

    To develop a sensitive and accurate assay system for the quantification of covalently closed circular HBV DNA (cccDNA) for future clinical monitoring of cccDNA fluctuation during antiviral therapy in the liver of infected patients. A droplet digital PCR (ddPCR)-based assay system detected template DNA input at the single copy level (or ~10(-5) pg of plasmid HBV DNA) by using serially diluted plasmid HBV DNA samples. Compared with the conventional quantitative PCR assay in the detection of cccDNA, which required at least 50 ng of template DNA input, a parallel experiment applying a ddPCR system demonstrates that the lowest detection limit of cccDNA from HepG2.215 cellular DNA samples is around 1 ng, which is equivalent to 0.54 ± 0.94 copies of cccDNA. In addition, we demonstrated that the addition of cccDNA-safe exonuclease and utilization of cccDNA-specific primers in the ddPCR assay system significantly improved the detection accuracy of HBV cccDNA from HepG2.215 cellular DNA samples. The ddPCR-based cccDNA detection system is a sensitive and accurate assay for the quantification of cccDNA in HBV-transfected HepG2.215 cellular DNA samples and may represent an important method for future application in monitoring cccDNA fluctuation during antiviral therapy.

  7. Quantification of viable bacterial starter cultures of Virgibacillus sp. and Tetragenococcus halophilus in fish sauce fermentation by real-time quantitative PCR.

    PubMed

    Udomsil, Natteewan; Chen, Shu; Rodtong, Sureelak; Yongsawatdigul, Jirawat

    2016-08-01

    Real-time quantitative polymerase chain reaction (qPCR) methods were developed for the quantification of Virgibacillus sp. SK37 and Tetragenococcus halophilus MS33, which were added as starter cultures in fish sauce fermentation. The PCR assays were coupled with propidium monoazide (PMA) treatment of samples to selectively quantify viable cells and integrated with exogenous recombinant Escherichia coli cells to control variabilities in analysis procedures. The qPCR methods showed species-specificity for both Virgibacillus halodenitrificans and T. halophilus as evaluated using 6 reference strains and 28 strains of bacteria isolated from fish sauce fermentation. The qPCR efficiencies were 101.1% for V. halodenitrificans and 90.2% for T. halophilus. The quantification limits of the assays were 10(3) CFU/mL and 10(2) CFU/mL in fish sauce samples with linear correlations over 4 Logs for V. halodenitrificans and T. halophilus, respectively. The matrix effect was not observed when evaluated using fish sauce samples fermented for 1-6 months. The developed PMA-qPCR methods were successfully applied to monitor changes of Virgibacillus sp. SK37 and T. halophilus MS33 in a mackerel fish sauce fermentation model where culture-dependent techniques failed to quantify the starter cultures. The results demonstrated the usability of the methods as practical tools for monitoring the starter cultures in fish sauce fermentation. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Quantitative detection method for Roundup Ready soybean in food using duplex real-time PCR MGB chemistry.

    PubMed

    Samson, Maria Cristina; Gullì, Mariolina; Marmiroli, Nelson

    2010-07-01

    Methodologies that enable the detection of genetically modified organisms (GMOs) (authorized and non-authorized) in food and feed strongly influence the potential for adequate updating and implementation of legislation together with labeling requirements. Quantitative polymerase chain reaction (qPCR) systems were designed to boost the sensitivity and specificity on the identification of GMOs in highly degraded DNA samples; however, such testing will become economically difficult to cope with due to increasing numbers of approved genetically modified (GM) lines. Multiplexing approaches are therefore in development to provide cost-efficient solution. Construct-specific primers and probe were developed for quantitative analysis of Roundup Ready soybean (RRS) event glyphosate-tolerant soybean (GTS) 40-3-2. The lectin gene (Le1) was used as a reference gene, and its specificity was verified. RRS- and Le1-specific quantitative real-time PCR (qRTPCR) were optimized in a duplex platform that has been validated with respect to limit of detection (LOD) and limit of quantification (LOQ), as well as accuracy. The analysis of model processed food samples showed that the degradation of DNA has no adverse or little effects on the performance of quantification assay. In this study, a duplex qRTPCR using TaqMan minor groove binder-non-fluorescent quencher (MGB-NFQ) chemistry was developed for specific detection and quantification of RRS event GTS 40-3-2 that can be used for practical monitoring in processed food products.

  9. Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.

    PubMed

    Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing

    2005-11-30

    Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.

  10. Oligonucleotide microarray chip for the quantification of MS2, ΦX174, and adenoviruses on the multiplex analysis platform MCR 3.

    PubMed

    Lengger, Sandra; Otto, Johannes; Elsässer, Dennis; Schneider, Oliver; Tiehm, Andreas; Fleischer, Jens; Niessner, Reinhard; Seidel, Michael

    2014-05-01

    Pathogenic viruses are emerging contaminants in water which should be analyzed for water safety to preserve public health. A strategy was developed to quantify RNA and DNA viruses in parallel on chemiluminescence flow-through oligonucleotide microarrays. In order to show the proof of principle, bacteriophage MS2, ΦX174, and the human pathogenic adenovirus type 2 (hAdV2) were analyzed in spiked tap water samples on the analysis platform MCR 3. The chemiluminescence microarray imaging unit was equipped with a Peltier heater for a controlled heating of the flow cell. The efficiency and selectivity of DNA hybridization could be increased resulting in higher signal intensities and lower cross-reactivities of polymerase chain reaction (PCR) products from other viruses. The total analysis time for DNA/RNA extraction, cDNA synthesis for RNA viruses, polymerase chain reaction, single-strand separation, and oligonucleotide microarray analysis was performed in 4-4.5 h. The parallel quantification was possible in a concentration range of 9.6 × 10(5)-1.4 × 10(10) genomic units (GU)/mL for bacteriophage MS2, 1.4 × 10(5)-3.7 × 10(8) GU/mL for bacteriophage ΦX174, and 6.5 × 10(3)-1.2 × 10(5) for hAdV2, respectively, by using a measuring temperature of 40 °C. Detection limits could be calculated to 6.6 × 10(5) GU/mL for MS2, 5.3 × 10(3) GU/mL for ΦX174, and 1.5 × 10(2) GU/mL for hAdV2, respectively. Real samples of surface water and treated wastewater were tested. Generally, found concentrations of hAdV2, bacteriophage MS2, and ΦX174 were at the detection limit. Nevertheless, bacteriophages could be identified with similar results by means of quantitative PCR and oligonucleotide microarray analysis on the MCR 3.

  11. Short-Chain Polysaccharide Analysis in Ethanol-Water Solutions.

    PubMed

    Yan, Xun

    2017-07-01

    This study demonstrates that short-chain polysaccharides, or oligosaccharides, could be sufficiently separated with hydrophilic interaction LC (HILIC) conditions and quantified by evaporative light-scattering detection (ELSD). The multianalyte calibration approach improved the efficiency of calibrating the nonlinear detector response. The method allowed easy quantification of short-chain carbohydrates. Using the HILIC method, the oligosaccharide solubility and its profile in water/alcohol solutions at room temperature were able to be quantified. The results showed that the polysaccharide solubility in ethanol-water solutions decreased as ethanol content increased. The results also showed oligosaccharides to have minimal solubility in pure ethanol. In a saturated maltodextrin ethanol (80%) solution, oligosaccharide components with a degree of polymerization >12 were practically insoluble and contributed less than 0.2% to the total solute dry weight. The HILIC-ELSD method allows for the identification and quantification of low-MW carbohydrates individually and served as an alternative method to current gel permeation chromatography procedures.

  12. Quantification of Nε-(2-Furoylmethyl)-L-lysine (furosine), Nε-(Carboxymethyl)-L-lysine (CML), Nε-(Carboxyethyl)-L-lysine (CEL) and total lysine through stable isotope dilution assay and tandem mass spectrometry.

    PubMed

    Troise, Antonio Dario; Fiore, Alberto; Wiltafsky, Markus; Fogliano, Vincenzo

    2015-12-01

    The control of Maillard reaction (MR) is a key point to ensure processed foods quality. Due to the presence of a primary amino group on its side chain, lysine is particularly prone to chemical modifications with the formation of Amadori products (AP), Nε-(Carboxymethyl)-L-lysine (CML), Nε-(Carboxyethyl)-L-lysine (CEL). A new analytical strategy was proposed which allowed to simultaneously quantify lysine, CML, CEL and the Nε-(2-Furoylmethyl)-L-lysine (furosine), the indirect marker of AP. The procedure is based on stable isotope dilution assay followed by liquid chromatography tandem mass spectrometry. It showed high sensitivity and good reproducibility and repeatability in different foods. The limit of detection and the RSD% were lower than 5 ppb and below 8%, respectively. Results obtained with the new procedure not only improved the knowledge about the reliability of thermal treatment markers, but also defined new insights in the relationship between Maillard reaction products and their precursors. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. A rapid, ideal, and eco-friendlier protocol for quantifying proline.

    PubMed

    Shabnam, Nisha; Tripathi, Indu; Sharmila, P; Pardha-Saradhi, P

    2016-11-01

    Proline, a stress marker, is routinely quantified by a protocol that essentially uses hazardous toluene. Negative impacts of toluene on human health prompted us to develop a reliable alternate protocol for proline quantification. Absorbance of the proline-ninhydrin condensation product formed by reaction of proline with ninhydrin at 100 °C in the reaction mixture was significantly higher than that recorded after its transfer to toluene, revealing that toluene lowers sensitivity of this assay. λ max of the proline-ninhydrin complex in the reaction mixture and toluene were 508 and 513 nm, respectively. Ninhydrin in glacial acetic acid yielded higher quantity of the proline-ninhydrin condensation product compared to ninhydrin in mixture of glacial acetic acid and H 3 PO 4 , indicating negative impact of H 3 PO 4 on proline quantification. Further, maximum yield of the proline-ninhydrin complex with ninhydrin in glacial acetic acid and ninhydrin in mixture of glacial acetic acid and H 3 PO 4 was achieved within 30 and 60 min, respectively. This revealed that H 3 PO 4 has negative impact on the reaction rate and quantity of the proline-ninhydrin complex formed. In brief, our proline quantification protocol involves reaction of a 1-ml proline sample with 2 ml of 1.25 % ninhydrin in glacial acetic acid at 100 °C for 30 min, followed by recording absorbance of the proline-ninhydrin condensation product in the reaction mixture itself at 508 nm. Amongst proline quantification protocols known till date, our protocol is the most simple, rapid, reliable, cost-effective, and eco-friendlier.

  14. Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

    PubMed

    Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

    2012-08-15

    Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Universal fluorescent tri-probe ligation equipped with capillary electrophoresis for targeting SMN1 and SMN2 genes in diagnosis of spinal muscular atrophy.

    PubMed

    Wang, Chun-Chi; Shih, Chi-Jen; Jong, Yuh-Jyh; Wu, Shou-Mei

    2014-06-23

    This is the first ligase chain reaction used for diagnosis of spinal muscular atrophy (SMA). Universal fluorescent tri-probe ligation (UFTPL), a novel strategy used for distinguishing the multi-nucleotide alternations at single base, is developed to quantitatively analyze the SMN1/SMN2 genes in diagnosis of SMA. Ligase chain reaction was performed by adding three probes including universal fluorescent probe, connecting probe and recognizing probe to differentiate single nucleotide polymorphisms in UFTPL. Our approach was based on the two UFTPL products of survival motor neuron 1 (SMN1) and SMN2 genes (the difference of 9 mer) and analyzed by capillary electrophoresis (CE). We successfully determined various gene dosages of SMN1 and SMN2 genes in homologous or heterologous subjects. By using the UFTPL-CE method, the SMN1 and SMN2 genes were fully resolved with the resolution of 2.16±0.37 (n=3). The r values of SMN1 and SMN2 regression curves over a range of 1-4 copies were above 0.9944. Of the 48 DNA samples, the data of gene dosages were corresponding to that analyzed by conformation sensitive CE and denatured high-performance liquid chromatography (DHPLC). This technique was found to be a good methodology for quantification or determination of the relative genes having multi-nucleotide variants at single base. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. NanoString nCounter® Approach in Breast Cancer: A Comparative Analysis with Quantitative Real-Time Polymerase Chain Reaction, In Situ Hybridization, and Immunohistochemistry.

    PubMed

    Hyeon, Jiyeon; Cho, Soo Youn; Hong, Min Eui; Kang, So Young; Do, Ingu; Im, Young Hyuck; Cho, Eun Yoon

    2017-09-01

    Accurate testing for estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) is essential for breast cancer treatment. At present, immunohistochemistry (IHC)/florescence in situ hybridization (FISH) are widely accepted as the standard testing methods. To investigate the value of NanoString nCounter®, we performed its comparative analysis with IHC/FISH and real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) for the assessment of ER, PR, and HER2. Data on IHC/FISH results for ER, PR, and HER2 in 240 patients from a single tertiary hospital in Korea were collected and compared with NanoString nCounter® and qRT-PCR results at a single institution. Expression levels for each gene using NanoString nCounter® showed good correlation with the corresponding data for protein expression by IHC ( p <0.001) and gene amplification status for HER2 ( p <0.001). Comparisons between gene expression and IHC data showed good overall agreement with a high area under the curve (AUC) for ESR1 /ER (AUC=0.939), PgR /PR (AUC=0.796), and HER2 /HER2 (AUC=0.989) ( p <0.001). The quantification of ER , PgR , and HER2 mRNA expression with NanoString nCounter® may be a viable alternative to conventional IHC/FISH methods.

  17. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

    PubMed

    Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

    2015-01-01

    Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

  18. Quantifying Short-Chain Chlorinated Paraffin Congener Groups.

    PubMed

    Yuan, Bo; Bogdal, Christian; Berger, Urs; MacLeod, Matthew; Gebbink, Wouter A; Alsberg, Tomas; de Wit, Cynthia A

    2017-09-19

    Accurate quantification of short-chain chlorinated paraffins (SCCPs) poses an exceptional challenge to analytical chemists. SCCPs are complex mixtures of chlorinated alkanes with variable chain length and chlorination level; congeners with a fixed chain length (n) and number of chlorines (m) are referred to as a "congener group" C n Cl m . Recently, we resolved individual C n Cl m by mathematically deconvolving soft ionization high-resolution mass spectra of SCCP mixtures. Here we extend the method to quantifying C n Cl m by introducing C n Cl m specific response factors (RFs) that are calculated from 17 SCCP chain-length standards with a single carbon chain length and variable chlorination level. The signal pattern of each standard is measured on APCI-QTOF-MS. RFs of each C n Cl m are obtained by pairwise optimization of the normal distribution's fit to the signal patterns of the 17 chain-length standards. The method was verified by quantifying SCCP technical mixtures and spiked environmental samples with accuracies of 82-123% and 76-109%, respectively. The absolute differences between calculated and manufacturer-reported chlorination degrees were -0.9 to 1.0%Cl for SCCP mixtures of 49-71%Cl. The quantification method has been replicated with ECNI magnetic sector MS and ECNI-Q-Orbitrap-MS. C n Cl m concentrations determined with the three instruments were highly correlated (R 2 > 0.90) with each other.

  19. A quantitative headspace-solid-phase microextraction-gas chromatography-flame ionization detector method to analyze short chain free fatty acids in rat feces.

    PubMed

    Fiorini, Dennis; Boarelli, Maria Chiara; Gabbianelli, Rosita; Ballini, Roberto; Pacetti, Deborah

    2016-09-01

    This study sought to develop and validate a quantitative method to analyze short chain free fatty acids (SCFAs) in rat feces by solid-phase microextraction and gas chromatography (SPME-GC) using the salt mixture ammonium sulfate and sodium dihydrogen phosphate as salting out agent. Conditioning and extraction time, linearity, limits of detection and quantification, repeatability, and recovery were evaluated. The proposed method allows quantification with improved sensitivity as compared with other methods exploiting SPME-GC. The method has been applied to analyze rat fecal samples, quantifying acetic, propionic, isobutyric, butyric, isopentanoic, pentanoic, and hexanoic acids. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Real-time quantification of xeroderma pigmentosum mRNA from the mammalian cochlea

    PubMed Central

    Guthrie, O'neil W.; Carrero-Martínez, Franklin A.

    2010-01-01

    Short Summary Xeroderma pigmentosum (XP) is a genetic disease that results in poor genomic defense from endogenous and exogenous stressors. Patients with mutations in the XPC and XPA genes exhibit cochlear hearing loss and to date, the underlying molecular mechanism is unknown. However, recent evidence suggests that the cochlea experiences persistent oxidative stress under normal conditions. In the current study, XPC and XPA gene products were purified from the cochlea and quantitative polymerase chain reaction was used to study the kinetics and magnitude of their expression. Additionally, immunohistochemistry was used to locate their respective polypeptides in the cochlea. The results revealed a significant demand for XP genes in the mammalian cochlea, which suggest that XP genomic defenses contribute in counterbalancing endogenous stress in the peripheral end-organ under normal conditions. PMID:20539233

  1. McCune-Albright syndrome in a discordant monozygotic twin.

    PubMed

    Peleg, Roni; Luba, Avizov; Eliakim, Alon; Israeli-Shani, Lilach; Manor, Esther; Birk, Ruth; Parvari, Ruti

    2009-06-01

    McCune-Albright syndrome is a sporadic disorder characterized by polystotic fibrous dysplasia, pigmented patches of skin, and endocrinological abnormalities. To compare the genetic characteristics of the GNAS1 gene in a monozygotic pair of twins, one of whom was diagnosed with MAS while the other had no indication of the syndrome. We performed a molecular analysis of the GNAS1 gene in DNA extracted from peripheral blood cells and quantification of mRNA extracted from lymphoblastoid cells from both twins by quantitative real-time polymerase chain reaction. Monozygosity of the twins was confirmed by typing them to four highly polymorphic microsatellites. Molecular analysis of the GNAS1 gene extracted from both twins did not reveal the cause of this discordance. It is possible that the exact molecular mechanism for the MAS discordance can only be determined by sampling affected tissues.

  2. Somatic coliphages as surrogates for enteroviruses in sludge hygienization treatments.

    PubMed

    Martín-Díaz, Julia; Casas-Mangas, Raquel; García-Aljaro, Cristina; Blanch, Anicet R; Lucena, Francisco

    2016-01-01

    Conventional bacterial indicators present serious drawbacks giving information about viral pathogens persistence during sludge hygienization treatments. This calls for the search of alternative viral indicators. Somatic coliphages' (SOMCPH) ability for acting as surrogates for enteroviruses was assessed in 47 sludge samples subjected to novel treatment processes. SOMCPH, infectious enteroviruses and genome copies of enteroviruses were monitored. Only one of these groups, the bacteriophages, was present in the sludge at concentrations that allowed the evaluation of treatment's performance. An indicator/pathogen relationship of 4 log10 (PFU/g dw) was found between SOMCPH and infective enteroviruses and their detection accuracy was assessed. The obtained results and the existence of rapid and standardized methods encourage the inclusion of SOMCPH quantification in future sludge directives. In addition, an existing real-time quantitative polymerase chain reaction (RT-qPCR) for enteroviruses was adapted and applied.

  3. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  4. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  5. Recommendations for the generation, quantification, storage and handling of peptides used for mass spectrometry-based assays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoofnagle, Andrew N.; Whiteaker, Jeffrey R.; Carr, Steven A.

    2015-12-30

    The Clinical Proteomic Tumor Analysis Consortium (1) (CPTAC) of the National Cancer Institute (NCI) is a comprehensive and coordinated effort to accelerate the understanding of the molecular basis of cancer through the application of robust technologies and workflows for the quantitative measurements of proteins. The Assay Development Working Group of the CPTAC Program aims to foster broad uptake of targeted mass spectrometry-based assays employing isotopically labeled peptides for confident assignment and quantification, including multiple reaction monitoring (MRM; also referred to as Selected Reaction Monitoring), parallel reaction monitoring (PRM), and other targeted methods.

  6. A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

    PubMed

    Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

    2016-12-01

    To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

  7. Press Releases | Argonne National Laboratory

    Science.gov Websites

    Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

  8. Recent developments in capabilities for analysing chlorinated paraffins in environmental matrices: A review.

    PubMed

    van Mourik, Louise M; Leonards, Pim E G; Gaus, Caroline; de Boer, Jacob

    2015-10-01

    Concerns about the high production volumes, persistency, bioaccumulation potential and toxicity of chlorinated paraffin (CP) mixtures, especially short-chain CPs (SCCPs), are rising. However, information on their levels and fate in the environment is still insufficient, impeding international classifications and regulations. This knowledge gap is mainly due to the difficulties that arise with CP analysis, in particular the chromatographic separation within CPs and between CPs and other compounds. No fully validated routine analytical method is available yet and only semi-quantitative analysis is possible, although the number of studies reporting new and improved methods have rapidly increased since 2010. Better cleanup procedures that remove interfering compounds, and new instrumental techniques, which distinguish between medium-chain CPs (MCCPs) and SCCPs, have been developed. While gas chromatography coupled to an electron capture negative ionisation mass spectrometry (GC/ECNI-MS) remains the most commonly applied technique, novel and promising use of high resolution time of flight MS (TOF-MS) has also been reported. We expect that recent developments in high resolution TOF-MS and Orbitrap technologies will further improve the detection of CPs, including long-chain CPs (LCCPs), and the group separation and quantification of CP homologues. Also, new CP quantification methods have emerged, including the use of mathematical algorithms, multiple linear regression and principal component analysis. These quantification advancements are also reflected in considerably improved interlaboratory agreements since 2010. Analysis of lower chlorinated paraffins (

  9. Simultaneous determination of thermodynamic and kinetic parameters of aminopolycarbonate complexes of cobalt(II) and nickel(II) based on isothermal titration calorimetry data.

    PubMed

    Tesmar, Aleksandra; Wyrzykowski, Dariusz; Muñoz, Eva; Pilarski, Bogusław; Pranczk, Joanna; Jacewicz, Dagmara; Chmurzyński, Lech

    2017-04-01

    The influence of the different side chain residues on the thermodynamic and kinetic parameters for complexation reactions of the Co 2 + and Ni 2 + ions has been investigated by using the isothermal titration calorimetry (ITC) technique supported by potentiometric titration data. The study was concerned with the 2 common tripodal aminocarboxylate ligands, namely, nitrilotriacetic acid and N-(2-hydroxyethyl) iminodiacetic acid. Calorimetric measurements (ITC) were run in the 2-(N-morpholino)ethanesulfonic acid hydrate (2-(N-morpholino) ethanesulfonic acid), piperazine-N,N'-bis(2-ethanesulfonic acid), and dimethylarsenic acid buffers (0.1 mol L -1 , pH 6) at 298.15 K. The quantification of the metal-buffer interactions and their incorporation into the ITC data analysis enabled to obtain the pH-independent and buffer-independent thermodynamic parameters (K, ΔG, ΔH, and ΔS) for the reactions under study. Furthermore, the kinITC method was applied to obtain kinetic information on complexation reactions from the ITC data. Correlations, based on kinetic and thermodynamic data, between the kinetics of formation of Co 2 + and Ni 2 + complexes and their thermodynamic stabilities are discussed. Copyright © 2016 John Wiley & Sons, Ltd.

  10. Multiplex quantification of 16S rDNA of predominant bacteria group within human fecal samples by polymerase chain reaction--ligase detection reaction (PCR-LDR).

    PubMed

    Li, Kai; Chen, Bei; Zhou, Yuxun; Huang, Rui; Liang, Yinming; Wang, Qinxi; Xiao, Zhenxian; Xiao, Junhua

    2009-03-01

    A new method, based on ligase detection reaction (LDR), was developed for quantitative detection of multiplex PCR amplicons of 16S rRNA genes present in complex mixtures (specifically feces). LDR has been widely used in single nucleotide polymorphism (SNP) assay but never applied for quantification of multiplex PCR products. This method employs one pair of DNA probes, one of which is labeled with fluorescence for signal capture, complementary to the target sequence. For multiple target sequence analysis, probes were modified with different lengths of polyT at the 5' end and 3' end. Using a DNA sequencer, these ligated probes were separated and identified by size and dye color. Then, relative abundance of target DNA were normalized and quantified based on the fluorescence intensities and exterior size standards. 16S rRNA gene of three preponderant bacteria groups in human feces: Clostridium coccoides, Bacteroides and related genera, and Clostridium leptum group, were amplified and cloned into plasmid DNA so as to make standard curves. After PCR-LDR analysis, a strong linear relationship was found between the florescence intensity and the diluted plasmid DNA concentrations. Furthermore, based on this method, 100 human fecal samples were quantified for the relative abundance of the three bacterial groups. Relative abundance of C. coccoides was significantly higher in elderly people in comparison with young adults, without gender differences. Relative abundance of Bacteroides and related genera and C. leptum group were significantly higher in young and middle aged than in the elderly. Regarding the whole set of sample, C. coccoides showed the highest relative abundance, followed by decreasing groups Bacteroides and related genera, and C. leptum. These results imply that PCR-LDR can be feasible and flexible applied to large scale epidemiological studies.

  11. A novel tool for specific detection and quantification of chicken/turkey parvoviruses to trace poultry fecal contamination in the environment.

    PubMed

    Carratalà, Anna; Rusinol, Marta; Hundesa, Ayalkibet; Biarnes, Mar; Rodriguez-Manzano, Jesus; Vantarakis, Apostolos; Kern, Anita; Suñen, Ester; Girones, Rosina; Bofill-Mas, Sílvia

    2012-10-01

    Poultry farming may introduce pathogens into the environment and food chains. High concentrations of chicken/turkey parvoviruses were detected in chicken stools and slaughterhouse and downstream urban wastewaters by applying new PCR-based specific detection and quantification techniques. Our results confirm that chicken/turkey parvoviruses may be useful viral indicators of poultry fecal contamination.

  12. Advances in targeted proteomics and applications to biomedical research

    PubMed Central

    Shi, Tujin; Song, Ehwang; Nie, Song; Rodland, Karin D.; Liu, Tao; Qian, Wei-Jun; Smith, Richard D.

    2016-01-01

    Targeted proteomics technique has emerged as a powerful protein quantification tool in systems biology, biomedical research, and increasing for clinical applications. The most widely used targeted proteomics approach, selected reaction monitoring (SRM), also known as multiple reaction monitoring (MRM), can be used for quantification of cellular signaling networks and preclinical verification of candidate protein biomarkers. As an extension to our previous review on advances in SRM sensitivity herein we review recent advances in the method and technology for further enhancing SRM sensitivity (from 2012 to present), and highlighting its broad biomedical applications in human bodily fluids, tissue and cell lines. Furthermore, we also review two recently introduced targeted proteomics approaches, parallel reaction monitoring (PRM) and data-independent acquisition (DIA) with targeted data extraction on fast scanning high-resolution accurate-mass (HR/AM) instruments. Such HR/AM targeted quantification with monitoring all target product ions addresses SRM limitations effectively in specificity and multiplexing; whereas when compared to SRM, PRM and DIA are still in the infancy with a limited number of applications. Thus, for HR/AM targeted quantification we focus our discussion on method development, data processing and analysis, and its advantages and limitations in targeted proteomics. Finally, general perspectives on the potential of achieving both high sensitivity and high sample throughput for large-scale quantification of hundreds of target proteins are discussed. PMID:27302376

  13. Advances in targeted proteomics and applications to biomedical research

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shi, Tujin; Song, Ehwang; Nie, Song

    Targeted proteomics technique has emerged as a powerful protein quantification tool in systems biology, biomedical research, and increasing for clinical applications. The most widely used targeted proteomics approach, selected reaction monitoring (SRM), also known as multiple reaction monitoring (MRM), can be used for quantification of cellular signaling networks and preclinical verification of candidate protein biomarkers. As an extension to our previous review on advances in SRM sensitivity (Shi et al., Proteomics, 12, 1074–1092, 2012) herein we review recent advances in the method and technology for further enhancing SRM sensitivity (from 2012 to present), and highlighting its broad biomedical applications inmore » human bodily fluids, tissue and cell lines. Furthermore, we also review two recently introduced targeted proteomics approaches, parallel reaction monitoring (PRM) and data-independent acquisition (DIA) with targeted data extraction on fast scanning high-resolution accurate-mass (HR/AM) instruments. Such HR/AM targeted quantification with monitoring all target product ions addresses SRM limitations effectively in specificity and multiplexing; whereas when compared to SRM, PRM and DIA are still in the infancy with a limited number of applications. Thus, for HR/AM targeted quantification we focus our discussion on method development, data processing and analysis, and its advantages and limitations in targeted proteomics. Finally, general perspectives on the potential of achieving both high sensitivity and high sample throughput for large-scale quantification of hundreds of target proteins are discussed.« less

  14. Introduction to Polymer Chemistry.

    ERIC Educational Resources Information Center

    Harris, Frank W.

    1981-01-01

    Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

  15. Identification of Reliable Reference Genes for Quantification of MicroRNAs in Serum Samples of Sulfur Mustard-Exposed Veterans.

    PubMed

    Gharbi, Sedigheh; Shamsara, Mehdi; Khateri, Shahriar; Soroush, Mohammad Reza; Ghorbanmehr, Nassim; Tavallaei, Mahmood; Nourani, Mohammad Reza; Mowla, Seyed Javad

    2015-01-01

    In spite of accumulating information about pathological aspects of sulfur mustard (SM), the precise mechanism responsible for its effects is not well understood. Circulating microRNAs (miRNAs) are promising biomarkers for disease diagnosis and prognosis. Accurate normalization using appropriate reference genes, is a critical step in miRNA expression studies. In this study, we aimed to identify appropriate reference gene for microRNA quantification in serum samples of SM victims. In this case and control experimental study, using quantitative real-time polymerase chain reaction (qRT-PCR), we evaluated the suitability of a panel of small RNAs including SNORD38B, SNORD49A, U6, 5S rRNA, miR-423-3p, miR-191, miR-16 and miR-103 in sera of 28 SM-exposed veterans of Iran-Iraq war (1980-1988) and 15 matched control volunteers. Different statistical algorithms including geNorm, Normfinder, best-keeper and comparative delta-quantification cycle (Cq) method were employed to find the least variable reference gene. miR-423-3p was identified as the most stably expressed reference gene, and miR- 103 and miR-16 ranked after that. We demonstrate that non-miRNA reference genes have the least stabil- ity in serum samples and that some house-keeping miRNAs may be used as more reliable reference genes for miRNAs in serum. In addition, using the geometric mean of two reference genes could increase the reliability of the normalizers.

  16. Statistical Models for the Analysis and Design of Digital Polymerase Chain Reaction (dPCR) Experiments.

    PubMed

    Dorazio, Robert M; Hunter, Margaret E

    2015-11-03

    Statistical methods for the analysis and design of experiments using digital PCR (dPCR) have received only limited attention and have been misused in many instances. To address this issue and to provide a more general approach to the analysis of dPCR data, we describe a class of statistical models for the analysis and design of experiments that require quantification of nucleic acids. These models are mathematically equivalent to generalized linear models of binomial responses that include a complementary, log-log link function and an offset that is dependent on the dPCR partition volume. These models are both versatile and easy to fit using conventional statistical software. Covariates can be used to specify different sources of variation in nucleic acid concentration, and a model's parameters can be used to quantify the effects of these covariates. For purposes of illustration, we analyzed dPCR data from different types of experiments, including serial dilution, evaluation of copy number variation, and quantification of gene expression. We also showed how these models can be used to help design dPCR experiments, as in selection of sample sizes needed to achieve desired levels of precision in estimates of nucleic acid concentration or to detect differences in concentration among treatments with prescribed levels of statistical power.

  17. The quantification of cellular viability and inflammatory response to stainless steel alloys.

    PubMed

    Bailey, LeeAnn O; Lippiatt, Sherry; Biancanello, Frank S; Ridder, Stephen D; Washburn, Newell R

    2005-09-01

    The biocompatibility of metallic alloys is critical to the success of many orthopedic therapies. Corrosion resistance and the immune response of the body to wear debris products ultimately determine the performance of these devices. The establishment of quantitative tests of biocompatibility is an important issue for biomaterials development. We have developed an in vitro model to measure the pro-inflammatory cytokine production and in this study investigated the cellular responses induced by nitrogenated and 316L stainless steel alloys in both particulate and solid form. We utilized a murine macrophage cell line, RAW 264.7, to characterize and compare the mRNA profiles of TNF-alpha and IL-1beta in these cells using real time-polymerase chain reaction (RT-PCR). Fluorescence microscopy and flow cytometry were used to probe the viability of the population and to examine the apoptotic pathway. The goals of this work were to develop improved measurement methods for the quantification of cellular inflammatory responses to biomaterials and to obtain data that leads to an enhanced understanding of the ways in which the body responds to biomaterials. Using these techniques, we observed evidence for an association between the upregulation of IL-1beta and reversible apoptosis, and the upregulation of TNF-alpha and irreversible apoptosis.

  18. A new specific reference gene based on growth hormone gene (GH1) used for detection and relative quantification of Aquadvantage® GM salmon (Salmo salar L.) in food products.

    PubMed

    Hafsa, Ahmed Ben; Nabi, Nesrine; Zellama, Mohamed Salem; Said, Khaled; Chaouachi, Maher

    2016-01-01

    Genetic transformation of fish is mainly oriented towards the improvement of growth for the benefit of the aquaculture. Actually, Atlantic salmon (Salmo salar) is the species most transformed to achieve growth rates quite large compared to the wild. To anticipate the presence of contaminations with GM salmon in fish markets and the lack of labeling regulations with a mandatory threshold, the proper methods are needed to test the authenticity of the ingredients. A quantitative real-time polymerase chain reaction (QRT-PCR) method was used in this study. Ct values were obtained and validated using 15 processed food containing salmon. The relative and absolute limits of detection were 0.01% and 0.01 ng/μl of genomic DNA, respectively. Results demonstrate that the developed QRT-PCR method is suitable specifically for identification of S. salar in food ingredients based on the salmon growth hormone gene 1 (GH1). The processes used to develop the specific salmon reference gene case study are intended to serve as a model for performing quantification of Aquadvantage® GM salmon on future genetically modified (GM) fish to be commercialized. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Detection and quantification of long chain fatty acids in liquid and solid samples and its relevance to understand anaerobic digestion of lipids.

    PubMed

    Neves, L; Pereira, M A; Mota, M; Alves, M M

    2009-01-01

    A method for long chain fatty acids (LCFA) extraction, identification and further quantification by gas chromatography was developed and its application to liquid and solid samples collected from anaerobic digesters was demonstrated. After validation, the usefulness of this method was demonstrated in a cow manure digester receiving pulses of an industrial effluent containing high lipid content. From the LCFA analysis data it was showed that the conversion of oleic acid, the main LCFA fed to the reactor, by the adapted biomass became faster and more effective along the successive pulses. Conversely, the accumulation of palmitic acid in the solid phase suggests that degradation of this LCFA, under these conditions, is less effective.

  20. Polymerization as a Model Chain Reaction

    ERIC Educational Resources Information Center

    Morton, Maurice

    1973-01-01

    Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

  1. Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

    DOE R&D Accomplishments Database

    Weinberg, Alvin M.; Noderer, L. C.

    1951-05-15

    The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

  2. Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins

    NASA Astrophysics Data System (ADS)

    Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John

    2017-01-01

    DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.

  3. A Novel Tool for Specific Detection and Quantification of Chicken/Turkey Parvoviruses To Trace Poultry Fecal Contamination in the Environment

    PubMed Central

    Carratalà, Anna; Rusinol, Marta; Hundesa, Ayalkibet; Biarnes, Mar; Rodriguez-Manzano, Jesus; Vantarakis, Apostolos; Kern, Anita; Suñen, Ester; Bofill-Mas, Sílvia

    2012-01-01

    Poultry farming may introduce pathogens into the environment and food chains. High concentrations of chicken/turkey parvoviruses were detected in chicken stools and slaughterhouse and downstream urban wastewaters by applying new PCR-based specific detection and quantification techniques. Our results confirm that chicken/turkey parvoviruses may be useful viral indicators of poultry fecal contamination. PMID:22904047

  4. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  5. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  6. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  7. Emilio Segrè and Spontaneous Fission

    Science.gov Websites

    fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

  8. Precise Quantitation of MicroRNA in a Single Cell with Droplet Digital PCR Based on Ligation Reaction.

    PubMed

    Tian, Hui; Sun, Yuanyuan; Liu, Chenghui; Duan, Xinrui; Tang, Wei; Li, Zhengping

    2016-12-06

    MicroRNA (miRNA) analysis in a single cell is extremely important because it allows deep understanding of the exact correlation between the miRNAs and cell functions. Herein, we wish to report a highly sensitive and precisely quantitative assay for miRNA detection based on ligation-based droplet digital polymerase chain reaction (ddPCR), which permits the quantitation of miRNA in a single cell. In this ligation-based ddPCR assay, two target-specific oligonucleotide probes can be simply designed to be complementary to the half-sequence of the target miRNA, respectively, which avoids the sophisticated design of reverse transcription and provides high specificity to discriminate a single-base difference among miRNAs with simple operations. After the miRNA-templated ligation, the ddPCR partitions individual ligated products into a water-in-oil droplet and digitally counts the fluorescence-positive and negative droplets after PCR amplification for quantification of the target molecules, which possesses the power of precise quantitation and robustness to variation in PCR efficiency. By integrating the advantages of the precise quantification of ddPCR and the simplicity of the ligation-based PCR, the proposed method can sensitively measure let-7a miRNA with a detection limit of 20 aM (12 copies per microliter), and even a single-base difference can be discriminated in let-7 family members. More importantly, due to its high selectivity and sensitivity, the proposed method can achieve precise quantitation of miRNAs in single-cell lysate. Therefore, the ligation-based ddPCR assay may serve as a useful tool to exactly reveal the miRNAs' actions in a single cell, which is of great importance for the study of miRNAs' biofunction as well as for the related biomedical studies.

  9. Screening and identification of per- and polyfluoroalkyl substances in microwave popcorn bags.

    PubMed

    Zabaleta, Itsaso; Negreira, Noelia; Bizkarguenaga, Ekhine; Prieto, Ailette; Covaci, Adrian; Zuloaga, Olatz

    2017-09-01

    Liquid chromatography coupled to quadrupole time-of-flight mass spectrometry (LC-QToF-MS) was used for the accurate identification (<10ppm) of different polyfluoroalkylphosphates (PAPs) and their intermediate and end degradation products in popcorn bags. Up to 46 per- and polyfluoroalkyl substances (PFASs) and precursors were identified. Moreover, an accurate method based on focused ultrasonic solid-liquid extraction (FUSLE) and a clean-up step with Envi-Carb sorbent was validated and applied to the quantification of 24 PFASs in popcorn bags from over twelve European countries, three American countries and two Asian countries. To the best of our knowledge, this is the first time that identification and quantification of some intermediates of PFAS precursors (different chain length fluorotelomer saturated acids (FTCAs) and fluorotelomer unsaturated acids (FTUCAs)) have been reported. Moreover, different patterns in the microwave popcorn bag composition were observed within the countries; while in European and American countries short chain PFASs were detected, Asian countries still use long chain PFASs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Chain Reaction Polymerization.

    ERIC Educational Resources Information Center

    McGrath, James E.

    1981-01-01

    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  11. Characterizing Chain Processes in Visible Light Photoredox Catalysis

    PubMed Central

    Cismesia, Megan A.

    2015-01-01

    The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708

  12. Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia.

    PubMed

    Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son

    2013-12-01

    A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from < 3 up to > 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis.

  13. Molecular tools for investigating microbial community structure and function in oxygen-deficient marine waters.

    PubMed

    Hawley, Alyse K; Kheirandish, Sam; Mueller, Andreas; Leung, Hilary T C; Norbeck, Angela D; Brewer, Heather M; Pasa-Tolic, Ljiljana; Hallam, Steven J

    2013-01-01

    Water column oxygen (O2)-deficiency shapes food-web structure by progressively directing nutrients and energy away from higher trophic levels into microbial community metabolism resulting in fixed nitrogen loss and greenhouse gas production. Although respiratory O2 consumption during organic matter degradation is a natural outcome of a productive surface ocean, global-warming-induced stratification intensifies this process leading to oxygen minimum zone (OMZ) expansion. Here, we describe useful tools for detection and quantification of potential key microbial players and processes in OMZ community metabolism including quantitative polymerase chain reaction primers targeting Marine Group I Thaumarchaeota, SUP05, Arctic96BD-19, and SAR324 small-subunit ribosomal RNA genes and protein extraction methods from OMZ waters compatible with high-resolution mass spectrometry for profiling microbial community structure and functional dynamics. © 2013 Elsevier Inc. All rights reserved.

  14. Prevalence and quantification of Listeria monocytogenes in beef offal at retail level in Selangor, Malaysia

    PubMed Central

    Kuan, Chee Hao; Wong, Woan Chwen; Pui, Chai Fung; Mahyudin, Nor Ainy; Tang, John Yew Huat; Nishibuchi, Mitsuaki; Radu, Son

    2013-01-01

    A total of 63 beef offal samples (beef liver = 16; beef lung = 14; beef intestine = 9; beef tripe = 15; beef spleen = 9) from three wet markets (A, B, and C) in Selangor, Malaysia were examined for the prevalence and microbial load of Listeria monocytogenes. A combination of the most probable number and polymerase chain reaction (MPN-PCR) method was employed in this study. It was found that L. monocytogenes detected in 33.33% of the beef offal samples. The prevalence of L. monocytogenes in beef offal purchased from wet markets A, B, and C were 22.73%, 37.50% and 41.18% respectively. The density of L. monocytogenes in all the samples ranged from < 3 up to > 2,400 MPN/g. The findings in this study indicate that beef offal can be a potential vehicle of foodborne listeriosis. PMID:24688507

  15. A Short Interspersed Nuclear Element (SINE)-Based Real-Time PCR Approach to Detect and Quantify Porcine Component in Meat Products.

    PubMed

    Zhang, Chi; Fang, Xin; Qiu, Haopu; Li, Ning

    2015-01-01

    Real-time PCR amplification of mitochondria gene could not be used for DNA quantification, and that of single copy DNA did not allow an ideal sensitivity. Moreover, cross-reactions among similar species were commonly observed in the published methods amplifying repetitive sequence, which hindered their further application. The purpose of this study was to establish a short interspersed nuclear element (SINE)-based real-time PCR approach having high specificity for species detection that could be used in DNA quantification. After massive screening of candidate Sus scrofa SINEs, one optimal combination of primers and probe was selected, which had no cross-reaction with other common meat species. LOD of the method was 44 fg DNA/reaction. Further, quantification tests showed this approach was practical in DNA estimation without tissue variance. Thus, this study provided a new tool for qualitative detection of porcine component, which could be promising in the QC of meat products.

  16. Quantitative Real-time Polymerase Chain Reaction for Enteropathogenic Escherichia coli: A Tool for Investigation of Asymptomatic Versus Symptomatic Infections

    PubMed Central

    Barletta, Francesca; Mercado, Erik; Ruiz, Joaquim; Ecker, Lucie; Lopez, Giovanni; Mispireta, Monica; Gil, Ana I.; Lanata, Claudio F.; Cleary, Thomas G.

    2011-01-01

    Background. Enteropathogenic Escherichia coli (EPEC) strains are pediatric pathogens commonly isolated from both healthy and sick children with diarrhea in areas of endemicity. The aim of this study was to compare the bacterial load of EPEC isolated from stool samples from children with and without diarrhea to determine whether bacterial load might be a useful tool for further study of this phenomenon. Methods. EPEC was detected by polymerase chain reaction (PCR) of colonies isolated on MacConkey plates from 53 diarrheal and 90 healthy children aged <2 years. DNA was isolated from stool samples by cetyltrimethylammonium bromide extraction. To standardize quantification by quantitative real-time PCR (qRT-PCR), the correlation between fluorescence threshold cycle and copy number of the intimin gene of EPEC E2348/69 was determined. Results. The detection limit of qRT-PCR was 5 bacteria/mg stool. The geometric mean load in diarrhea was 299 bacteria/mg (95% confidence interval [CI], 77–1164 bacteria/mg), compared with 29 bacteria/mg (95% CI, 10–87 bacteria/mg) in control subjects (P = .016). Bacterial load was significantly higher in children with diarrhea than in control subjects among children <12 months of age (178 vs 5 bacteria/mg; P = .006) and among children with EPEC as the sole pathogen (463 vs 24 bacteria/mg; P = .006). Conclusions. EPEC load measured by qRT-PCR is higher in diarrheal than in healthy children. qRT-PCR may be useful to study the relationship between disease and colonization in settings of endemicity. PMID:22028433

  17. Regulation of acetylcholine receptor alpha subunit variants in human myasthenia gravis. Quantification of steady-state levels of messenger RNA in muscle biopsy using the polymerase chain reaction.

    PubMed Central

    Guyon, T; Levasseur, P; Truffault, F; Cottin, C; Gaud, C; Berrih-Aknin, S

    1994-01-01

    Myasthenia gravis (MG) is an autoimmune disease mediated by auto-antibodies that attack the nicotinic acetylcholine receptor (AChR). To elucidate the molecular mechanisms underlying the decrease in AChR levels at the neuromuscular junction, we investigated the regulation of AChR expression by analyzing mRNA of the two AChR alpha subunit isoforms (P3A+ and P3A-) in muscle samples from myasthenic patients relative to controls. We applied a quantitative method based on reverse transcription of total RNA followed by polymerase chain reaction (PCR), using an internal standard we constructed by site-directed mutagenesis. An increased expression of mRNA coding for the alpha subunit of the AChR isoforms was observed in severely affected patients (P < 0.003 versus controls) but not in moderately affected patients, independently of the anti-AChR antibody titer. Study of mRNA precursor levels indicates a higher expression in severely affected patients compared to controls, suggesting an enhanced rate of transcription of the message coding for the alpha subunit isoforms in these patients. We have also reported that mRNA encoding both isoforms are expressed at an approximate 1:1 ratio in controls and in patients. We have thus identified a new biological parameter correlated with disease severity, and provide evidence of a compensatory mechanism to balance the loss of AChR in human myasthenia gravis, which is probably triggered only above a certain degree of AChR loss. Images PMID:8040257

  18. The effectiveness of riboflavin and ultraviolet light pathogen reduction technology in eliminating Trypanosoma cruzi from leukoreduced whole blood.

    PubMed

    Jimenez-Marco, Teresa; Cancino-Faure, Beatriz; Girona-Llobera, Enrique; Alcover, M Magdalena; Riera, Cristina; Fisa, Roser

    2017-06-01

    The parasitic Chagas disease is caused by the protozoan Trypanosoma cruzi, which is mainly transmitted by insect vectors. Other infection routes, both in endemic and in nonendemic areas, include organ and marrow transplantation, congenital transmission, and blood transfusion. Asymptomatic chronic chagasic individuals may have a low and transient parasitemia in peripheral blood and, consequently, they can unknowingly transmit the disease via blood transfusion. Riboflavin and ultraviolet (UV) light pathogen reduction is a method to reduce pathogen transfusion transmission risk based on damage to the pathogen nucleic acids. In this study, we tested the effectiveness of this technology for the elimination of T. cruzi parasites in artificially contaminated whole blood units (WBUs) and thus for decreasing the risk of T. cruzi transfusion transmission. The contaminated WBUs were leukoreduced by filtration and treated with riboflavin and UV light. The level of pathogen reduction was quantified by a real-time polymerase chain reaction (qPCR) and a real-time reverse transcription-polymerase chain reaction (RT-qPCR) as a viability assay. The RNA (cDNA) quantification of the parasites showed a more than 99% reduction of viable T. cruzi parasites after leukoreduction and a complete reduction (100%) after the riboflavin and UV light treatment. Riboflavin and UV light treatment and leukoreduction used in conjunction appears to eliminate significant amounts of viable T. cruzi in whole blood. Both strategies could complement other blood bank measures already implemented to prevent the transmission of T. cruzi via blood transfusion. © 2017 AABB.

  19. Racial Differences in the Extracellular Matrix and Histone Acetylation of the Lamina Cribrosa and Peripapillary Sclera.

    PubMed

    Park, Hae-Young Lopilly; Kim, Jie Hyun; Jung, Younhea; Park, Chan Kee

    2017-08-01

    We investigated the extracellular matrix (ECM) of the lamina cribrosa (LC) and peripapillary sclera (PPS) and compared histone acetylation and related enzymes to identify racial differences between Korean and Caucasian donor eyes. Posterior segment tissues were obtained from 30 Caucasian donors and 42 age and axial length-matched Korean donors. Histone modification was assessed for histone deacetylase (HDAC) 2, HDAC3, and acetylated histone H3. The promoter regions of the major ECM in the LC and PPS including collagen type I and III, and elastic fiber components (elastin and fibrillin-1) and lysyl oxidase enzymes including lysyl oxidase-like 1 and 2 (LOXL2) were evaluated by chromatin immunoprecipitation (ChIP) assay. Protein and mRNA expression of major ECM components were assessed using real-time polymerase chain reaction analysis, western blot analysis, and immunohistochemical staining. HDAC2 and HDAC3 expression levels were decreased and acetylated histone H3 was increased in the LC and PPS of Korean eyes than Caucasian eyes. The promoter regions of LOXL2, elastin, and fribrillin-1 genes were highly acetylated in Korean LC. Expression of LOXL2 and elastic fiber components (elastin and fibrillin-1) were significantly increased in Korean LC and PPS than Caucasians according to the real-time polymerase chain reaction, western blot analyses, and quantification of elastic fiber staining. Histone acetylation status differed in the promoter regions of the elastic fiber components and LOXL2 in the LC and PPS according to race. Further study to reveal the association with these findings to the pathogenesis of glaucoma in Korean eyes is needed.

  20. Evaluation of reference gene suitability for quantitative expression analysis by quantitative polymerase chain reaction in the mandibular condyle of sheep.

    PubMed

    Jiang, Xin; Xue, Yang; Zhou, Hongzhi; Li, Shouhong; Zhang, Zongmin; Hou, Rui; Ding, Yuxiang; Hu, Kaijin

    2015-10-01

    Reference genes are commonly used as a reliable approach to normalize the results of quantitative polymerase chain reaction (qPCR), and to reduce errors in the relative quantification of gene expression. Suitable reference genes belonging to numerous functional classes have been identified for various types of species and tissue. However, little is currently known regarding the most suitable reference genes for bone, specifically for the sheep mandibular condyle. Sheep are important for the study of human bone diseases, particularly for temporomandibular diseases. The present study aimed to identify a set of reference genes suitable for the normalization of qPCR data from the mandibular condyle of sheep. A total of 12 reference genes belonging to various functional classes were selected, and the expression stability of the reference genes was determined in both the normal and fractured area of the sheep mandibular condyle. RefFinder, which integrates the following currently available computational algorithms: geNorm, NormFinder, BestKeeper, and the comparative ΔCt method, was used to compare and rank the candidate reference genes. The results obtained from the four methods demonstrated a similar trend: RPL19, ACTB, and PGK1 were the most stably expressed reference genes in the sheep mandibular condyle. As determined by RefFinder comprehensive analysis, the results of the present study suggested that RPL19 is the most suitable reference gene for studies associated with the sheep mandibular condyle. In addition, ACTB and PGK1 may be considered suitable alternatives.

  1. Real-time quantification of antibody-short interfering RNA conjugate in serum by antigen capture reverse transcription-polymerase chain reaction.

    PubMed

    Tan, Martha; Vernes, Jean-Michel; Chan, Joyce; Cuellar, Trinna L; Asundi, Aarati; Nelson, Christopher; Yip, Victor; Shen, Ben; Vandlen, Richard; Siebel, Christian; Meng, Y Gloria

    2012-11-15

    Short interfering RNA (siRNA) has therapeutic potential. However, efficient delivery is a formidable task. To facilitate delivery of siRNA into cells, we covalently conjugated siRNA to antibodies that bind to cell surface proteins and internalize. Understanding how these antibody-siRNA conjugates function in vivo requires pharmacokinetic analysis. Thus, we developed a simple real-time antigen capture reverse transcription-polymerase chain reaction (RT-PCR) assay to detect intact antibody-siRNA conjugates. Biotinylated antigen bound to streptavidin-coated PCR tubes was used to capture antibody-siRNA conjugate. The captured antibody-siRNA conjugate was then reverse-transcribed in the same tube, avoiding a sample transfer step. This reproducible assay had a wide standard curve range of 0.029 to 480ng/ml and could detect as low as 0.58ng/ml antibody-siRNA conjugates in mouse serum. The presence of unconjugated antibody that could be generated from siRNA degradation in vivo did not affect the assay as long as the total antibody concentration in the antigen capture step did not exceed 480ng/ml. Using this assay, we observed a more rapid decrease in serum antibody-siRNA conjugate concentrations than the total antibody concentrations in mice dosed with antibody-siRNA conjugates, suggesting loss of siRNA from the antibody. This assay is useful for optimizing antibody-siRNA and likely aptamer-siRNA conjugates to improve pharmacokinetics and aid siRNA delivery. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Quantitative real-time polymerase chain reaction for Streptococcus mutans and Streptococcus sobrinus in dental plaque samples and its association with early childhood caries.

    PubMed

    Choi, Eun-Jung; Lee, Sung-Hoon; Kim, Young-Jae

    2009-03-01

    Streptococcus mutans and Streptococcus sobrinus are closely associated with the development of early childhood caries (ECC). Recently, quantitative real-time polymerase chain reaction (qRT-PCR) has been used for rapid and accurate quantification of these bacterial species. This study aims to detect quantitatively the levels of S. mutans and S. sobrinus in plaque samples by qRT-PCR, and to assess their association with the prevalence of ECC in Korean preschool children. One hundred and five children (71 months old or younger) were examined and classified into three groups (caries-free, ECC, severe ECC). Dental plaque samples were collected and qRT-PCR was conducted using oligonucleotide primers specific for glucosyltransferase gene (S. mutans-gtfB, S. sobrinus-gtfU) and universal primer. Pearson's correlation test was conducted to evaluate the relationship between the dmfs (decayed, missing, or filled surfaces primary teeth) scores and the microbiological findings. There was a significant difference between the levels of S. mutans and S. sobrinus in the plaque samples of the three groups (P < 0.05). The proportion of S. sobrinus to S. mutans showed strong correlation to the dmfs scores (r = 0.748, P < 0.05). The qRT-PCR results of this study showed that children with ECC had higher level of S. mutans and S. sobrinus in their dental plaque samples. The children with higher ratio of S. sobrinus to S. mutans in their dental plaque showed higher incidence of ECC.

  3. Evaluation of the reliability of maize reference assays for GMO quantification.

    PubMed

    Papazova, Nina; Zhang, David; Gruden, Kristina; Vojvoda, Jana; Yang, Litao; Buh Gasparic, Meti; Blejec, Andrej; Fouilloux, Stephane; De Loose, Marc; Taverniers, Isabel

    2010-03-01

    A reliable PCR reference assay for relative genetically modified organism (GMO) quantification must be specific for the target taxon and amplify uniformly along the commercialised varieties within the considered taxon. Different reference assays for maize (Zea mays L.) are used in official methods for GMO quantification. In this study, we evaluated the reliability of eight existing maize reference assays, four of which are used in combination with an event-specific polymerase chain reaction (PCR) assay validated and published by the Community Reference Laboratory (CRL). We analysed the nucleotide sequence variation in the target genomic regions in a broad range of transgenic and conventional varieties and lines: MON 810 varieties cultivated in Spain and conventional varieties from various geographical origins and breeding history. In addition, the reliability of the assays was evaluated based on their PCR amplification performance. A single base pair substitution, corresponding to a single nucleotide polymorphism (SNP) reported in an earlier study, was observed in the forward primer of one of the studied alcohol dehydrogenase 1 (Adh1) (70) assays in a large number of varieties. The SNP presence is consistent with a poor PCR performance observed for this assay along the tested varieties. The obtained data show that the Adh1 (70) assay used in the official CRL NK603 assay is unreliable. Based on our results from both the nucleotide stability study and the PCR performance test, we can conclude that the Adh1 (136) reference assay (T25 and Bt11 assays) as well as the tested high mobility group protein gene assay, which also form parts of CRL methods for quantification, are highly reliable. Despite the observed uniformity in the nucleotide sequence of the invertase gene assay, the PCR performance test reveals that this target sequence might occur in more than one copy. Finally, although currently not forming a part of official quantification methods, zein and SSIIb assays are found to be highly reliable in terms of nucleotide stability and PCR performance and are proposed as good alternative targets for a reference assay for maize.

  4. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting.

    PubMed

    Rashed-Ul Islam, S M; Jahan, Munira; Tabassum, Shahina

    2015-01-01

    Virological monitoring is the best predictor for the management of chronic hepatitis B virus (HBV) infections. Consequently, it is important to use the most efficient, rapid and cost-effective testing systems for HBV DNA quantification. The present study compared the performance characteristics of a one-step HBV polymerase chain reaction (PCR) vs the two-step HBV PCR method for quantification of HBV DNA from clinical samples. A total of 100 samples consisting of 85 randomly selected samples from patients with chronic hepatitis B (CHB) and 15 samples from apparently healthy individuals were enrolled in this study. Of the 85 CHB clinical samples tested, HBV DNA was detected from 81% samples by one-step PCR method with median HBV DNA viral load (VL) of 7.50 × 10 3 lU/ml. In contrast, 72% samples were detected by the two-step PCR system with median HBV DNA of 3.71 × 10 3 lU/ml. The one-step method showed strong linear correlation with two-step PCR method (r = 0.89; p < 0.0001). Both methods showed good agreement at Bland-Altman plot, with a mean difference of 0.61 log 10 IU/ml and limits of agreement of -1.82 to 3.03 log 10 IU/ml. The intra-assay and interassay coefficients of variation (CV%) of plasma samples (4-7 log 10 IU/ml) for the one-step PCR method ranged between 0.33 to 0.59 and 0.28 to 0.48 respectively, thus demonstrating a high level of concordance between the two methods. Moreover, elimination of the DNA extraction step in the one-step PCR kit allowed time-efficient and significant labor and cost savings for the quantification of HBV DNA in a resource limited setting. Rashed-Ul Islam SM, Jahan M, Tabassum S. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting. Euroasian J Hepato-Gastroenterol 2015;5(1):11-15.

  5. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting

    PubMed Central

    Jahan, Munira; Tabassum, Shahina

    2015-01-01

    Virological monitoring is the best predictor for the management of chronic hepatitis B virus (HBV) infections. Consequently, it is important to use the most efficient, rapid and cost-effective testing systems for HBV DNA quantification. The present study compared the performance characteristics of a one-step HBV polymerase chain reaction (PCR) vs the two-step HBV PCR method for quantification of HBV DNA from clinical samples. A total of 100 samples consisting of 85 randomly selected samples from patients with chronic hepatitis B (CHB) and 15 samples from apparently healthy individuals were enrolled in this study. Of the 85 CHB clinical samples tested, HBV DNA was detected from 81% samples by one-step PCR method with median HBV DNA viral load (VL) of 7.50 × 103 lU/ml. In contrast, 72% samples were detected by the two-step PCR system with median HBV DNA of 3.71 × 103 lU/ml. The one-step method showed strong linear correlation with two-step PCR method (r = 0.89; p < 0.0001). Both methods showed good agreement at Bland-Altman plot, with a mean difference of 0.61 log10 IU/ml and limits of agreement of -1.82 to 3.03 log10 IU/ml. The intra-assay and interassay coefficients of variation (CV%) of plasma samples (4-7 log10 IU/ml) for the one-step PCR method ranged between 0.33 to 0.59 and 0.28 to 0.48 respectively, thus demonstrating a high level of concordance between the two methods. Moreover, elimination of the DNA extraction step in the one-step PCR kit allowed time-efficient and significant labor and cost savings for the quantification of HBV DNA in a resource limited setting. How to cite this article Rashed-Ul Islam SM, Jahan M, Tabassum S. Evaluation of a Rapid One-step Real-time PCR Method as a High-throughput Screening for Quantification of Hepatitis B Virus DNA in a Resource-limited Setting. Euroasian J Hepato-Gastroenterol 2015;5(1):11-15. PMID:29201678

  6. Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

    2016-09-15

    It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

  7. Specific and quantitative detection of human polyomaviruses BKV, JCV, and SV40 by real time PCR.

    PubMed

    McNees, Adrienne L; White, Zoe S; Zanwar, Preeti; Vilchez, Regis A; Butel, Janet S

    2005-09-01

    The polyomaviruses that infect humans, BK virus (BKV), JC virus (JCV), and simian virus 40 (SV40), typically establish subclinical persistent infections. However, reactivation of these viruses in immunocompromised hosts is associated with renal nephropathy and hemorrhagic cystitis (HC) caused by BKV and with progressive multifocal leukoencephalopathy (PML) caused by JCV. Additionally, SV40 is associated with several types of human cancers including primary brain and bone cancers, mesotheliomas, and non-Hodgkin's lymphoma. Advancements in detection of these viruses may contribute to improved diagnosis and treatment of affected patients. To develop sensitive and specific real time quantitative polymerase chain reaction (RQ-PCR) assays for the detection of T-antigen DNA sequences of the human polyomaviruses BKV, JCV, and SV40 using the ABI Prism 7000 Sequence Detection System. Assays for absolute quantification of the viral T-ag sequences were designed and the sensitivity and specificity were evaluated. A quantitative assay to measure the single copy human RNAse P gene was also developed and evaluated in order to normalize viral gene copy numbers to cell numbers. Quantification of the target genes is sensitive and specific over a 7 log dynamic range. Ten copies each of the viral and cellular genes are reproducibly and accurately detected. The sensitivity of detection of the RQ-PCR assays is increased 10- to 100-fold compared to conventional PCR and agarose gel protocols. The primers and probes used to detect the viral genes are specific for each virus and there is no cross reactivity within the dynamic range of the standard dilutions. The sensitivity of detection for these assays is not reduced in human cellular extracts; however, different DNA extraction protocols may affect quantification. These assays provide a technique for rapid and specific quantification of polyomavirus genomes per cell in human samples.

  8. Spin trapping combined with quantitative mass spectrometry defines free radical redistribution within the oxidized hemoglobin:haptoglobin complex.

    PubMed

    Vallelian, Florence; Garcia-Rubio, Ines; Puglia, Michele; Kahraman, Abdullah; Deuel, Jeremy W; Engelsberger, Wolfgang R; Mason, Ronald P; Buehler, Paul W; Schaer, Dominik J

    2015-08-01

    Extracellular or free hemoglobin (Hb) accumulates during hemolysis, tissue damage, and inflammation. Heme-triggered oxidative reactions can lead to diverse structural modifications of lipids and proteins, which contribute to the propagation of tissue damage. One important target of Hb׳s peroxidase reactivity is its own globin structure. Amino acid oxidation and crosslinking events destabilize the protein and ultimately cause accumulation of proinflammatory and cytotoxic Hb degradation products. The Hb scavenger haptoglobin (Hp) attenuates oxidation-induced Hb degradation. In this study we show that in the presence of hydrogen peroxide (H2O2), Hb and the Hb:Hp complex share comparable peroxidative reactivity and free radical generation. While oxidation of both free Hb and Hb:Hp complex generates a common tyrosine-based free radical, the spin-trapping reaction with 5,5-dimethyl-1-pyrroline N-oxide (DMPO) yields dissimilar paramagnetic products in Hb and Hb:Hp, suggesting that radicals are differently redistributed within the complex before reacting with the spin trap. With LC-MS(2) mass spectrometry we assigned multiple known and novel DMPO adduct sites. Quantification of these adducts suggested that the Hb:Hp complex formation causes extensive delocalization of accessible free radicals with drastic reduction of the major tryptophan and cysteine modifications in the β-globin chain of the Hb:Hp complex, including decreased βCys93 DMPO adduction. In contrast, the quantitative changes in DMPO adduct formation on Hb:Hp complex formation were less pronounced in the Hb α-globin chain. In contrast to earlier speculations, we found no evidence that free Hb radicals are delocalized to the Hp chain of the complex. The observation that Hb:Hp complex formation alters free radical distribution in Hb may help to better understand the structural basis for Hp as an antioxidant protein. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Distortion of genetically modified organism quantification in processed foods: influence of particle size compositions and heat-induced DNA degradation.

    PubMed

    Moreano, Francisco; Busch, Ulrich; Engel, Karl-Heinz

    2005-12-28

    Milling fractions from conventional and transgenic corn were prepared at laboratory scale and used to study the influence of sample composition and heat-induced DNA degradation on the relative quantification of genetically modified organisms (GMO) in food products. Particle size distributions of the obtained fractions (coarse grits, regular grits, meal, and flour) were characterized using a laser diffraction system. The application of two DNA isolation protocols revealed a strong correlation between the degree of comminution of the milling fractions and the DNA yield in the extracts. Mixtures of milling fractions from conventional and transgenic material (1%) were prepared and analyzed via real-time polymerase chain reaction. Accurate quantification of the adjusted GMO content was only possible in mixtures containing conventional and transgenic material in the form of analogous milling fractions, whereas mixtures of fractions exhibiting different particle size distributions delivered significantly over- and underestimated GMO contents depending on their compositions. The process of heat-induced nucleic acid degradation was followed by applying two established quantitative assays showing differences between the lengths of the recombinant and reference target sequences (A, deltal(A) = -25 bp; B, deltal(B) = +16 bp; values related to the amplicon length of the reference gene). Data obtained by the application of method A resulted in underestimated recoveries of GMO contents in the samples of heat-treated products, reflecting the favored degradation of the longer target sequence used for the detection of the transgene. In contrast, data yielded by the application of method B resulted in increasingly overestimated recoveries of GMO contents. The results show how commonly used food technological processes may lead to distortions in the results of quantitative GMO analyses.

  10. Characterization of the exogenous insert and development of event-specific PCR detection methods for genetically modified Huanong No. 1 papaya.

    PubMed

    Guo, Jinchao; Yang, Litao; Liu, Xin; Guan, Xiaoyan; Jiang, Lingxi; Zhang, Dabing

    2009-08-26

    Genetically modified (GM) papaya (Carica papaya L.), Huanong No. 1, was approved for commercialization in Guangdong province, China in 2006, and the development of the Huanong No. 1 papaya detection method is necessary for implementing genetically modified organism (GMO) labeling regulations. In this study, we reported the characterization of the exogenous integration of GM Huanong No. 1 papaya by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. The results suggested that one intact copy of the initial construction was integrated in the papaya genome and which probably resulted in one deletion (38 bp in size) of the host genomic DNA. Also, one unintended insertion of a 92 bp truncated NptII fragment was observed at the 5' end of the exogenous insert. Furthermore, we revealed its 5' and 3' flanking sequences between the insert DNA and the papaya genomic DNA, and developed the event-specific qualitative and quantitative PCR assays for GM Huanong No. 1 papaya based on the 5' integration flanking sequence. The relative limit of detection (LOD) of the qualitative PCR assay was about 0.01% in 100 ng of total papaya genomic DNA, corresponding to about 25 copies of papaya haploid genome. In the quantitative PCR, the limits of detection and quantification (LOD and LOQ) were as low as 12.5 and 25 copies of papaya haploid genome, respectively. In practical sample quantification, the quantified biases between the test and true values of three samples ranged from 0.44% to 4.41%. Collectively, we proposed that all of these results are useful for the identification and quantification of Huanong No. 1 papaya and its derivates.

  11. Quantification of multiple gene expression in individual cells.

    PubMed

    Peixoto, António; Monteiro, Marta; Rocha, Benedita; Veiga-Fernandes, Henrique

    2004-10-01

    Quantitative gene expression analysis aims to define the gene expression patterns determining cell behavior. So far, these assessments can only be performed at the population level. Therefore, they determine the average gene expression within a population, overlooking possible cell-to-cell heterogeneity that could lead to different cell behaviors/cell fates. Understanding individual cell behavior requires multiple gene expression analyses of single cells, and may be fundamental for the understanding of all types of biological events and/or differentiation processes. We here describe a new reverse transcription-polymerase chain reaction (RT-PCR) approach allowing the simultaneous quantification of the expression of 20 genes in the same single cell. This method has broad application, in different species and any type of gene combination. RT efficiency is evaluated. Uniform and maximized amplification conditions for all genes are provided. Abundance relationships are maintained, allowing the precise quantification of the absolute number of mRNA molecules per cell, ranging from 2 to 1.28 x 10(9) for each individual gene. We evaluated the impact of this approach on functional genetic read-outs by studying an apparently homogeneous population (monoclonal T cells recovered 4 d after antigen stimulation), using either this method or conventional real-time RT-PCR. Single-cell studies revealed considerable cell-to-cell variation: All T cells did not express all individual genes. Gene coexpression patterns were very heterogeneous. mRNA copy numbers varied between different transcripts and in different cells. As a consequence, this single-cell assay introduces new and fundamental information regarding functional genomic read-outs. By comparison, we also show that conventional quantitative assays determining population averages supply insufficient information, and may even be highly misleading.

  12. Evaluation of four commercial quantitative real-time PCR kits with inhibited and degraded samples.

    PubMed

    Holmes, Amy S; Houston, Rachel; Elwick, Kyleen; Gangitano, David; Hughes-Stamm, Sheree

    2018-05-01

    DNA quantification is a vital step in forensic DNA analysis to determine the optimal input amount for DNA typing. A quantitative real-time polymerase chain reaction (qPCR) assay that can predict DNA degradation or inhibitors present in the sample prior to DNA amplification could aid forensic laboratories in creating a more streamlined and efficient workflow. This study compares the results from four commercial qPCR kits: (1) Investigator® Quantiplex® Pro Kit, (2) Quantifiler® Trio DNA Quantification Kit, (3) PowerQuant® System, and (4) InnoQuant® HY with high molecular weight DNA, low template samples, degraded samples, and DNA spiked with various inhibitors.The results of this study indicate that all kits were comparable in accurately predicting quantities of high quality DNA down to the sub-picogram level. However, the InnoQuant(R) HY kit showed the highest precision across the DNA concentration range tested in this study. In addition, all kits performed similarly with low concentrations of forensically relevant PCR inhibitors. However, in general, the Investigator® Quantiplex® Pro Kit was the most tolerant kit to inhibitors and provided the most accurate quantification results with higher concentrations of inhibitors (except with salt). PowerQuant® and InnoQuant® HY were the most sensitive to inhibitors, but they did indicate significant levels of PCR inhibition. When quantifying degraded samples, each kit provided different degradation indices (DI), with Investigator® Quantiplex® Pro indicating the largest DI and Quantifiler® Trio indicating the smallest DI. When the qPCR kits were paired with their respective STR kit to genotype highly degraded samples, the Investigator® 24plex QS and GlobalFiler® kits generated more complete profiles when the small target concentrations were used for calculating input amount.

  13. Application of PCR and real-time PCR for monitoring cyanobacteria, Microcystis spp. and Cylindrospermopsis raciborskii in Macau freshwater reservoir

    NASA Astrophysics Data System (ADS)

    Zhang, Weiying; Lou, Inchio; Ung, Wai Kin; Kong, Yijun; Mok, Kai Meng

    2014-06-01

    Freshwater algal blooms have become a growing concern world-wide. They are caused by a high level of cyanobacteria, predominantly Microcystis spp. and Cylindrospermopsis raciborskii, which can produce microcystin and cylindrospermopsin, respectively. Longtime exposure to these cyanotoxins may affect public health, thus reliable detection, quantification, and enumeration of these harmful algae species has become a priority in water quality management. Traditional manual enumeration of algal bloom cells primarily involves microscopic identification which limited by inaccuracy and time-consumption.With the development of molecular techniques and an increasing number of microbial sequences available in the Genbank database, the use of molecular methods can be used for more rapid, reliable, and accurate detection and quantification. In this study, multiplex polymerase chain reaction (PCR) and real-time quantitative PCR (qPCR) techniques were developed and applied for monitoring cyanobacteria Microcystis spp. and C. raciborskii in the Macau Storage Reservoir (MSR). The results showed that the techniques were successful for identifying and quantifying the species in pure cultures and mixed cultures, and proved to be a potential application for water sampling in MSR. When the target species were above 1 million cells/L, similar cell numbers estimated by microscopic enumeration and qPCR were obtained. Further quantification in water samples indicated that the ratio of the estimated number of cell by microscopy and qPCR was 0.4-12.9 for cyanobacteria and 0.2-3.9 for C. raciborskii. However, Microcystis spp. was not observed by manual enumeration, while it was detected at low levels by qPCR, suggesting that qPCR is more sensitive and accurate. Thus the molecular approaches provide an additional reliable monitoring option to traditional microscopic enumeration for the ecosystems monitoring program.

  14. Basic fibroblastic growth factor affects the osteogenic differentiation of dental pulp stem cells in a treatment-dependent manner.

    PubMed

    Qian, J; Jiayuan, W; Wenkai, J; Peina, W; Ansheng, Z; Shukai, S; Shafei, Z; Jun, L; Longxing, N

    2015-07-01

    To determine how basic fibroblastic growth factor (bFGF) affected the osteogenic differentiation of human dental pulp stem cells (DPSCs) in vitro and in vivo. Basic fibroblastic growth factor stimulation of DPSCs was divided into a pre-treatment period and an osteogenic differentiation period. Alizarin red quantification experiments and alkaline phosphatase activity quantification assay were performed to examine the osteogenic differentiation of DPSCs after different bFGF stimulation. Quantification reverse transcription polymerase chain reaction was used to analyze the osteogenic gene expression of DPSCs after different bFGF stimulation. In addition, DPSCs that received the 1 and 2 weeks bFGF pre-treatments as in the in vitro experiments were mineralized for 1 week and seeded into hydroxyapatite/tricalcium phosphate (HA/TCP) pills and subcutaneously transplanted into naked mice for 2 or 3 months. The transplants were removed, sliced and stained using Modified Ponceau Trichrome Stain to observe the formation of mineralized tissue. Basic fibroblastic growth factor stimulation in the osteogenic differentiation period decreased the in vitro osteogenic differentiation ability of DPSCs. One week pre-treatment with bFGF increased the in vitro osteogenic differentiation ability of DPSCs, whereas 2 weeks pre-treatment with bFGF decreased the in vitro osteogenic differentiation ability of DPSCs. The pre-treatment period was vital for the osteogenic differentiation of DPSCs in vitro. The in vivo results were similar to the in vitro results. Basic fibroblastic growth factor affected the osteogenic differentiation of DPSCs in a treatment-dependent manner both in vitro and in vivo. © 2014 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  15. Quantification of superoxide radical production in thylakoid membrane using cyclic hydroxylamines.

    PubMed

    Kozuleva, Marina; Klenina, Irina; Mysin, Ivan; Kirilyuk, Igor; Opanasenko, Vera; Proskuryakov, Ivan; Ivanov, Boris

    2015-12-01

    Applicability of two lipophilic cyclic hydroxylamines (CHAs), CM-H and TMT-H, and two hydrophilic CHAs, CAT1-H and DCP-H, for detection of superoxide anion radical (O2(∙-)) produced by the thylakoid photosynthetic electron transfer chain (PETC) of higher plants under illumination has been studied. ESR spectrometry was applied for detection of the nitroxide radical originating due to CHAs oxidation by O2(∙-). CHAs and corresponding nitroxide radicals were shown to be involved in side reactions with PETC which could cause miscalculation of O2(∙-) production rate. Lipophilic CM-H was oxidized by PETC components, reducing the oxidized donor of Photosystem I, P700(+), while at the same concentration another lipophilic CHA, TMT-H, did not reduce P700(+). The nitroxide radical was able to accept electrons from components of the photosynthetic chain. Electrostatic interaction of stable cation CAT1-H with the membrane surface was suggested. Water-soluble superoxide dismutase (SOD) was added in order to suppress the reaction of CHA with O2(∙-) outside the membrane. SOD almost completely inhibited light-induced accumulation of DCP(∙), nitroxide radical derivative of hydrophilic DCP-H, in contrast to TMT(∙) accumulation. Based on the results showing that change in the thylakoid lumen pH and volume had minor effect on TMT(∙) accumulation, the reaction of TMT-H with O2(∙-) in the lumen was excluded. Addition of TMT-H to thylakoid suspension in the presence of SOD resulted in the increase in light-induced O2 uptake rate, that argued in favor of TMT-H ability to detect O2(∙-) produced within the membrane core. Thus, hydrophilic DCP-H and lipophilic TMT-H were shown to be usable for detection of O2(∙-) produced outside and within thylakoid membranes. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. In-line monitoring of cocrystallization process and quantification of carbamazepine-nicotinamide cocrystal using Raman spectroscopy and chemometric tools.

    PubMed

    Soares, Frederico L F; Carneiro, Renato L

    2017-06-05

    A cocrystallization process may involve several molecular species, which are generally solid under ambient conditions. Thus, accurate monitoring of different components that might appear during the reaction is necessary, as well as quantification of the final product. This work reports for the first time the synthesis of carbamazepine-nicotinamide cocrystal in aqueous media with a full conversion. The reactions were monitored by Raman spectroscopy coupled with Multivariate Curve Resolution - Alternating Least Squares, and the quantification of the final product among its coformers was performed using Raman spectroscopy and Partial Least Squares regression. The slurry reaction was made in four different conditions: room temperature, 40°C, 60°C and 80°C. The slurry reaction at 80°C enabled a full conversion of initial substrates into the cocrystal form, using water as solvent for a greener method. The employment of MCR-ALS coupled with Raman spectroscopy enabled to observe the main steps of the reactions, such as drug dissolution, nucleation and crystallization of the cocrystal. The PLS models gave mean errors of cross validation around 2.0 (% wt/wt), and errors of validation between 2.5 and 8.2 (% wt/wt) for all components. These were good results since the spectra of cocrystals and the physical mixture of the coformers present some similar peaks. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. In-line monitoring of cocrystallization process and quantification of carbamazepine-nicotinamide cocrystal using Raman spectroscopy and chemometric tools

    NASA Astrophysics Data System (ADS)

    Soares, Frederico L. F.; Carneiro, Renato L.

    2017-06-01

    A cocrystallization process may involve several molecular species, which are generally solid under ambient conditions. Thus, accurate monitoring of different components that might appear during the reaction is necessary, as well as quantification of the final product. This work reports for the first time the synthesis of carbamazepine-nicotinamide cocrystal in aqueous media with a full conversion. The reactions were monitored by Raman spectroscopy coupled with Multivariate Curve Resolution - Alternating Least Squares, and the quantification of the final product among its coformers was performed using Raman spectroscopy and Partial Least Squares regression. The slurry reaction was made in four different conditions: room temperature, 40 °C, 60 °C and 80 °C. The slurry reaction at 80 °C enabled a full conversion of initial substrates into the cocrystal form, using water as solvent for a greener method. The employment of MCR-ALS coupled with Raman spectroscopy enabled to observe the main steps of the reactions, such as drug dissolution, nucleation and crystallization of the cocrystal. The PLS models gave mean errors of cross validation around 2.0 (% wt/wt), and errors of validation between 2.5 and 8.2 (% wt/wt) for all components. These were good results since the spectra of cocrystals and the physical mixture of the coformers present some similar peaks.

  18. Peroxy radical detection by chemical amplification (PERCA)

    NASA Technical Reports Server (NTRS)

    Stedman, D. H.

    1986-01-01

    Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.

  19. Tangled nonlinear driven chain reactions of all optical singularities

    NASA Astrophysics Data System (ADS)

    Vasil'ev, V. I.; Soskin, M. S.

    2012-03-01

    Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

  20. A new approach for the quantification of synchrony of multivariate non-stationary psychophysiological variables during emotion eliciting stimuli

    PubMed Central

    Kelava, Augustin; Muma, Michael; Deja, Marlene; Dagdagan, Jack Y.; Zoubir, Abdelhak M.

    2015-01-01

    Emotion eliciting situations are accompanied by changes of multiple variables associated with subjective, physiological and behavioral responses. The quantification of the overall simultaneous synchrony of psychophysiological reactions plays a major role in emotion theories and has received increased attention in recent years. From a psychometric perspective, the reactions represent multivariate non-stationary intra-individual time series. In this paper, a new time-frequency based latent variable approach for the quantification of the synchrony of the responses is presented. The approach is applied to empirical data, collected during an emotion eliciting situation. The results are compared with a complementary inter-individual approach of Hsieh et al. (2011). Finally, the proposed approach is discussed in the context of emotion theories, and possible future applications and limitations are provided. PMID:25653624

  1. International collaborative study of the endogenous reference gene, sucrose phosphate synthase (SPS), used for qualitative and quantitative analysis of genetically modified rice.

    PubMed

    Jiang, Lingxi; Yang, Litao; Zhang, Haibo; Guo, Jinchao; Mazzara, Marco; Van den Eede, Guy; Zhang, Dabing

    2009-05-13

    One rice ( Oryza sativa ) gene, sucrose phosphate synthase (SPS), has been proven to be a suitable endogenous reference gene for genetically modified (GM) rice detection in a previous study. Herein are the reported results of an international collaborative ring trial for validation of the SPS gene as an endogenous reference gene and its optimized qualitative and quantitative polymerase chain reaction (PCR) systems. A total of 12 genetically modified organism (GMO) detection laboratories from seven countries participated in the ring trial and returned their results. The validated results confirmed the species specificity of the method through testing 10 plant genomic DNAs, low heterogeneity, and a stable single-copy number of the rice SPS gene among 7 indica varieties and 5 japonica varieties. The SPS qualitative PCR assay was validated with a limit of detection (LOD) of 0.1%, which corresponded to about 230 copies of haploid rice genomic DNA, while the limit of quantification (LOQ) for the quantitative PCR system was about 23 copies of haploid rice genomic DNA, with acceptable PCR efficiency and linearity. Furthermore, the bias between the test and true values of eight blind samples ranged from 5.22 to 26.53%. Thus, we believe that the SPS gene is suitable for use as an endogenous reference gene for the identification and quantification of GM rice and its derivates.

  2. Detection and Analysis of Circular RNAs by RT-PCR.

    PubMed

    Panda, Amaresh C; Gorospe, Myriam

    2018-03-20

    Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.

  3. Parasite Specific Antibody Levels, Interferon-γ and TLR2 and TLR4 Transcripts in Blood from Dogs with Different Clinical Stages of Leishmaniosis

    PubMed Central

    Montserrat-Sangrà, Sara; Ordeix, Laura; Martínez-Orellana, Pamela; Solano-Gallego, Laia

    2018-01-01

    Canine leishmaniosis has a wide range of disease severity from mild (stage I), to severe (stages II–III), or very severe disease (stage IV). The objective of the study was to evaluate and compare serum antibody levels, Leishmania infantum specific IFN-γ production and TLR2 and TLR4 transcripts in non-stimulated blood from dogs with different clinical stages at the time of diagnosis as well as blood parasitemia. Enzyme-Linked ImmunoSorbent Assay (ELISAs) were performed to determine serum antibody levels and IFN-γ production and quantitative polymerase chain reaction (qPCRs) in order to determine blood parasite load and TLR2 and TLR4 transcripts. Older dogs were significantly affected by more severe disease with higher antibody levels and blood parasitemia than dogs with mild disease. IFN-γ production was significantly higher in dogs with stage I disease when compared to dogs with more severe disease. Relative quantification of TLR2 in dogs with mild disease was similar to that of control dogs. On the other hand, TLR2 transcripts were significantly higher in dogs with severe disease as compared with that from control healthy dogs. No differences were found in TLR4 relative quantification between groups. This study demonstrates that dogs with different clinical stages of leishmaniosis present different levels of biological markers indicative of different immune responses. PMID:29547503

  4. Testing the interaction between analytical modules: an example with Roundup Ready® soybean line GTS 40-3-2

    PubMed Central

    2010-01-01

    Background The modular approach to analysis of genetically modified organisms (GMOs) relies on the independence of the modules combined (i.e. DNA extraction and GM quantification). The validity of this assumption has to be proved on the basis of specific performance criteria. Results An experiment was conducted using, as a reference, the validated quantitative real-time polymerase chain reaction (PCR) module for detection of glyphosate-tolerant Roundup Ready® GM soybean (RRS). Different DNA extraction modules (CTAB, Wizard and Dellaporta), were used to extract DNA from different food/feed matrices (feed, biscuit and certified reference material [CRM 1%]) containing the target of the real-time PCR module used for validation. Purity and structural integrity (absence of inhibition) were used as basic criteria that a DNA extraction module must satisfy in order to provide suitable template DNA for quantitative real-time (RT) PCR-based GMO analysis. When performance criteria were applied (removal of non-compliant DNA extracts), the independence of GMO quantification from the extraction method and matrix was statistically proved, except in the case of Wizard applied to biscuit. A fuzzy logic-based procedure also confirmed the relatively poor performance of the Wizard/biscuit combination. Conclusions For RRS, this study recognises that modularity can be generally accepted, with the limitation of avoiding combining highly processed material (i.e. biscuit) with a magnetic-beads system (i.e. Wizard). PMID:20687918

  5. Simultaneous quantification of cardiovascular disease related metabolic risk factors using liquid chromatography tandem mass spectrometry in human serum.

    PubMed

    Wang, Mo; Yang, Ruiyue; Dong, Jun; Zhang, Tianjiao; Wang, Siming; Zhou, Weiyan; Li, Hongxia; Zhao, Haijian; Zhang, Lijiao; Wang, Shu; Zhang, Chuanbao; Chen, Wenxiang

    2016-01-15

    Recent observations from metabonomic studies have consistently found that branched-chain amino acids (BCAAs), aromatic amino acids (AAAs), glutamine (Gln), glutamic acid (Glu), Gln/Glu ratio, carnitine, and several species of acylcarnitines and lysophosphatidylcholines (LPCs) are possible risk factors for metabolic diseases such as diabetes mellitus (DM) and cardiovascular diseases (CVD). We described here a simple and reliable method for simultaneous quantification of these metabolic risk factors by liquid chromatography tandem mass spectrometry (LC-MS/MS). Serum samples were extracted with isopropanol, and the extracted metabolites were separated by hydrophilic interaction liquid chromatography (HILIC) and detected with electrospary ionization (ESI) inpositive ion mode with multiple reaction monitor (MRM) mode. All the metabolites were effectively separated within 5.5min. Analytical recoveries were in the range of 92.8-106.9%, with an average of 100.6%. The intra- run and total imprecisions for the measurement of these metabolites were 1.2-3.8% and 1.5-7.4%, respectively. Serum concentrations of the metabolites were analyzed in 123 apparently healthy volunteers. Significant associations between the metabolites and traditional CVD risk factors were observed. The newly developed LC-MS/MS method was simple, precise, and accurate and can be used as an efficient tool in CVD research and studies. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. 18O-labeled proteome reference as global internal standards for targeted quantification by selected reaction monitoring-mass spectrometry.

    PubMed

    Kim, Jong-Seo; Fillmore, Thomas L; Liu, Tao; Robinson, Errol; Hossain, Mahmud; Champion, Boyd L; Moore, Ronald J; Camp, David G; Smith, Richard D; Qian, Wei-Jun

    2011-12-01

    Selected reaction monitoring (SRM)-MS is an emerging technology for high throughput targeted protein quantification and verification in biomarker discovery studies; however, the cost associated with the application of stable isotope-labeled synthetic peptides as internal standards can be prohibitive for screening a large number of candidate proteins as often required in the preverification phase of discovery studies. Herein we present a proof of concept study using an (18)O-labeled proteome reference as global internal standards (GIS) for SRM-based relative quantification. The (18)O-labeled proteome reference (or GIS) can be readily prepared and contains a heavy isotope ((18)O)-labeled internal standard for every possible tryptic peptide. Our results showed that the percentage of heavy isotope ((18)O) incorporation applying an improved protocol was >99.5% for most peptides investigated. The accuracy, reproducibility, and linear dynamic range of quantification were further assessed based on known ratios of standard proteins spiked into the labeled mouse plasma reference. Reliable quantification was observed with high reproducibility (i.e. coefficient of variance <10%) for analyte concentrations that were set at 100-fold higher or lower than those of the GIS based on the light ((16)O)/heavy ((18)O) peak area ratios. The utility of (18)O-labeled GIS was further illustrated by accurate relative quantification of 45 major human plasma proteins. Moreover, quantification of the concentrations of C-reactive protein and prostate-specific antigen was illustrated by coupling the GIS with standard additions of purified protein standards. Collectively, our results demonstrated that the use of (18)O-labeled proteome reference as GIS provides a convenient, low cost, and effective strategy for relative quantification of a large number of candidate proteins in biological or clinical samples using SRM.

  7. Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

    PubMed

    Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

    2018-06-01

    Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

  8. Mutations in TET2 and DNMT3A genes are associated with changes in global and gene-specific methylation in acute myeloid leukemia.

    PubMed

    Ponciano-Gómez, Alberto; Martínez-Tovar, Adolfo; Vela-Ojeda, Jorge; Olarte-Carrillo, Irma; Centeno-Cruz, Federico; Garrido, Efraín

    2017-10-01

    Acute myeloid leukemia is characterized by its high biological and clinical heterogeneity, which represents an important barrier for a precise disease classification and accurate therapy. While epigenetic aberrations play a pivotal role in acute myeloid leukemia pathophysiology, molecular signatures such as change in the DNA methylation patterns and genetic mutations in enzymes needed to the methylation process can also be helpful for classifying acute myeloid leukemia. Our study aims to unveil the relevance of DNMT3A and TET2 genes in global and specific methylation patterns in acute myeloid leukemia. Peripheral blood samples from 110 untreated patients with acute myeloid leukemia and 15 healthy control individuals were collected. Global 5-methylcytosine and 5-hydroxymethylcytosine in genomic DNA from peripheral blood leukocytes were measured by using the MethylFlashTM Quantification kits. DNMT3A and TET2 expression levels were evaluated by real-time quantitative polymerase chain reaction. The R882A hotspot of DNMT3A and exons 6-10 of TET2 were amplified by polymerase chain reaction and sequenced using the Sanger method. Methylation patterns of 16 gene promoters were evaluated by pyrosequencing after treating DNA with sodium bisulfite, and their transcriptional products were measured by real-time quantitative polymerase chain reaction.Here, we demonstrate altered levels of 5-methylcytosine and 5-hydroxymethylcytosine and highly variable transcript levels of DNMT3A and TET2 in peripheral blood leukocytes from acute myeloid leukemia patients. We found a mutation prevalence of 2.7% for DNMT3A and 11.8% for TET2 in the Mexican population with this disease. The average overall survival of acute myeloid leukemia patients with DNMT3A mutations was only 4 months. In addition, we showed that mutations in DNMT3A and TET2 may cause irregular DNA methylation patterns and transcriptional expression levels in 16 genes known to be involved in acute myeloid leukemia pathogenesis. Our findings suggest that alterations in DNMT3A and TET2 may be associated with acute myeloid leukemia prognosis. Furthermore, alterations in these enzymes affect normal methylation patterns in acute myeloid leukemia- specific genes, which in turn, may influence patient survival.

  9. Adaption of Ehrlich’s Reagent to a HPLC post-column reaction system for the quantification of limonoid glucosides (abstract)

    USDA-ARS?s Scientific Manuscript database

    Citrus limonoid glucosides are found in large quantities in citrus fruits and seeds. Characterization and quantification of these compounds is important because they contribute to citrus quality and are reported to be biologically active. Unlike other bioactive compounds (e.g., flavonoids) present...

  10. Topological dynamics of optical singularities in speckle-fields induced by photorefractive scattering in a LiNbO{sub 3} : Fe crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vasil'ev, Vasilii I; Soskin, M S

    2013-02-28

    A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less

  11. Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus".

    PubMed

    Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond

    2018-01-01

    Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.

  12. Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus"

    PubMed Central

    Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg

    2018-01-01

    Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium “Candidatus Liberibacter asiaticus” (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer. PMID:29772016

  13. Adenovirus-mediated in utero gene transfer in mice and guinea pigs: tissue distribution of recombinant adenovirus determined by quantitative TaqMan-polymerase chain reaction assay.

    PubMed

    Senoo, M; Matsubara, Y; Fujii, K; Nagasaki, Y; Hiratsuka, M; Kure, S; Uehara, S; Okamura, K; Yajima, A; Narisawa, K

    2000-04-01

    Fetal somatic cell gene therapy could become an attractive solution for some congenital genetic diseases or the disorders which manifest themselves during the fetal period. We performed adenovirus-mediated gene transfer to mice and guinea pig fetuses in utero and evaluated the efficiency of gene transfer by histochemical analysis and a quantitative TaqMan-polymerase chain reaction (TaqMan-PCR) assay. We first injected a replication-deficient recombinant adenovirus containing the Escherichia coli LacZ gene driven by a CAG promoter (AxCALacZ) into pregnant mice through the amniotic space, placenta, or intraperitoneal space of the fetus. Histochemical analysis showed limited transgene expression in fetal tissues. We then administered AxCALacZ to guinea pig fetuses in the late stage of pregnancy through the umbilical vein. The highest beta-galactosidase expression was observed in liver followed by moderate expression in heart, spleen, and adrenal gland. The transgene expression was also present in kidney, intestine, and placenta to a lesser degree. No positively stained cells were observed in lung, muscle, or pancreas except in the vascular endothelium of these organs. Quantitative measurement of recombinant adenoviral DNA by the TaqMan-PCR assay showed that the vast majority of the injected viruses was present in liver. The current study indicated that adenovirus-mediated gene transfer into guinea pig fetus through the umbilical vein is feasible and results in efficient transgene expression in fetal tissues. The experimental procedures using pregnant guinea pigs might serve as a good experimental model for in utero gene transfer. Since our TaqMan-PCR assay detects the LacZ gene, one of the most widely used reporter genes, it may be generally applicable to adenovirus quantification in various gene transfer experiments.

  14. Development of a microRNA-based molecular assay for the detection of papillary thyroid carcinoma in aspiration biopsy samples.

    PubMed

    Mazeh, Haggi; Mizrahi, Ido; Halle, David; Ilyayev, Nadia; Stojadinovic, Alexander; Trink, Barry; Mitrani-Rosenbaum, Stella; Roistacher, Marina; Ariel, Ilana; Eid, Ahmed; Freund, Herbert R; Nissan, Aviram

    2011-02-01

    Although thyroid nodules are common and diagnosed in over 5% of the adult population, only 5% harbor malignancy. Patients with clinically suspicious thyroid nodules need to undergo fine-needle aspiration biopsy (FNAB). The main limitation of FNAB remains indeterminate cytopathology. Only 20%-30% of the indeterminate nodules harbor malignancy, and therefore up to 80% of patients undergo unnecessary thyroidectomy. The aim of this study was to identify and validate a panel of microRNAs (miRNAs) that could serve as a platform for an FNAB-based diagnostic for thyroid neoplasms. The study population included 27 consecutive patients undergoing total thyroidectomy for FNAB-based papillary thyroid cancer (n = 20) and benign disorders (n = 7). Aspiration biopsy was performed from the index lesion and from the opposite lobe normal tissue in all study patients at the time of operation. RNA was extracted from all aspiration biopsy samples. Quantitative polymerase chain reaction on a panel of previously selected miRNAs was performed. Polymerase chain reaction results were compared with final histopathology. miRNA from tumor tissues was amplified using the highest value of each miRNA expression in normal tissue as a threshold for malignancy detection. Diagnostic characteristics were most favorable for mir-221 in differentiating benign from malignant thyroid pathology. mir-221 was overexpressed in 19 patients (p < 0.0001) with a sensitive yield of 95%. Specificity, negative and positive predictive value, and accuracy of the miRNA panel were 100%, 96%, 100%, and 98%, respectively. miRNA quantification for differential diagnosis of thyroid neoplasms within aspiration biopsy samples is feasible and may improve the accuracy of FNAB cytology.

  15. Detection and management of minimal residual disease in acute lymphoblastic leukemia.

    PubMed

    Schrappe, Martin

    2014-12-05

    The detection of minimal residual disease (MRD) has become part of the state-of-the-art diagnostics to guide treatment both in pediatric and adult acute lymphoblastic leukemia (ALL). This applies to the treatment of de novo and recurrent ALL. In high-risk ALL, MRD detection is considered an important tool to adjust therapy before and after hematopoietic stem cell transplantation. Precise quantification and quality control is instrumental to avoid false treatment assignment. A new methodological approach to analyzing MRD has become available and is based on next-generation sequencing. In principle, this technique will be able to detect a large number of leukemic subclones at a much higher speed than before. Carefully designed prospective studies need to demonstrate concordance or even superiority compared with those techniques in use right now: detection of aberrant expression of leukemia-specific antigens by flow cytometry of blood or bone marrow, or detection of specific rearrangements of the T-cell receptor or immunoglobulin genes by real-time quantitative polymerase chain reaction using DNA of leukemic cells. In some cases with known fusion genes, such as BCR/ABL, reverse transcriptase-polymerase chain reaction has been used as additional method to identify leukemic cells by analyzing RNA in patient samples. MRD detection may be used to modulate treatment intensity once it has been demonstrated at well-defined informative checkpoints that certain levels of MRD can reliably predict the risk of relapse. In addition, MRD is used as end point to determine the activity of a given agent or treatment protocol. If activity translates into antileukemic efficacy, MRD may be considered a surrogate clinical end point. © 2014 by The American Society of Hematology. All rights reserved.

  16. Advanced Caries Microbiota in Teeth with Irreversible Pulpitis.

    PubMed

    Rôças, Isabela N; Lima, Kenio C; Assunção, Isauremi V; Gomes, Patrícia N; Bracks, Igor V; Siqueira, José F

    2015-09-01

    Bacterial taxa in the forefront of caries biofilms are candidate pathogens for irreversible pulpitis and are possibly the first ones to invade the pulp and initiate endodontic infection. This study examined the microbiota of the most advanced layers of dentinal caries in teeth with irreversible pulpitis. DNA extracted from samples taken from deep dentinal caries associated with pulp exposures was analyzed for the presence and relative levels of 33 oral bacterial taxa by using reverse-capture checkerboard hybridization assay. Quantification of total bacteria, streptococci, and lactobacilli was also performed by using real-time quantitative polymerase chain reaction. Associations between the target bacterial taxa and clinical signs/symptoms were also evaluated. The most frequently detected taxa in the checkerboard assay were Atopobium genomospecies C1 (53%), Pseudoramibacter alactolyticus (37%), Streptococcus species (33%), Streptococcus mutans (33%), Parvimonas micra (13%), Fusobacterium nucleatum (13%), and Veillonella species (13%). Streptococcus species, Dialister invisus, and P. micra were significantly associated with throbbing pain, S. mutans with pain to percussion, and Lactobacillus with continuous pain (P < .05). Quantitative polymerase chain reaction revealed a mean total bacterial load of 1 × 10(8) (range, 2.05 × 10(5) to 4.5 × 10(8)) cell equivalents per milligram (wet weight) of dentin. Streptococci and lactobacilli were very prevalent but comprised only 0.09% and 2% of the whole bacterial population, respectively. Several bacterial taxa were found in advanced caries lesions in teeth with exposed pulps, and some of them were significantly associated with symptoms. A role for these taxa in the etiology of irreversible pulpitis is suspected. Copyright © 2015 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  17. Real-time polymerase chain reaction detection of cauliflower mosaic virus to complement the 35S screening assay for genetically modified organisms.

    PubMed

    Cankar, Katarina; Ravnikar, Maja; Zel, Jana; Gruden, Kristina; Toplak, Natasa

    2005-01-01

    Labeling of genetically modified organisms (GMOs) is now in place in many countries, including the European Union, in order to guarantee the consumer's choice between GM and non-GM products. Screening of samples is performed by polymerase chain reaction (PCR) amplification of regulatory sequences frequently introduced into genetically modified plants. Primers for the 35S promoter from Cauliflower mosaic virus (CaMV) are those most frequently used. In virus-infected plants or in samples contaminated with plant material carrying the virus, false-positive results can consequently occur. A system for real-time PCR using a TaqMan minor groove binder probe was designed that allows recognition of virus coat protein in the sample, thus allowing differentiation between transgenic and virus-infected samples. We measured the efficiency of PCR amplification, limits of detection and quantification, range of linearity, and repeatability of the assay in order to assess the applicability of the assay for routine analysis. The specificity of the detection system was tested on various virus isolates and plant species. All 8 CaMV isolates were successfully amplified using the designed system. No cross-reactivity was detected with DNA from 3 isolates of the closely related Carnation etched ring virus. Primers do not amplify plant DNA from available genetically modified maize and soybean lines or from different species of Brassicaceae or Solanaceae that are natural hosts for CaMV. We evaluated the assay for different food matrixes by spiking CaMV DNA into DNA from food samples and have successfully amplified CaMV from all samples. The assay was tested on rapeseed samples from routine GMO testing that were positive in the 35S screening assay, and the presence of the virus was confirmed.

  18. Determination of short chain carboxylic acids in vegetable oils and fats using ion exclusion chromatography electrospray ionization mass spectrometry.

    PubMed

    Viidanoja, Jyrki

    2015-02-27

    A new method for quantification of short chain C1-C6 carboxylic acids in vegetable oils and fats by employing Liquid Chromatography Mass Spectrometry (LC-MS) has been developed. The method requires minor sample preparation and applies non-conventional Electrospray Ionization (ESI) liquid phase chemistry. Samples are first dissolved in chloroform and then extracted using water that has been spiked with stable isotope labeled internal standards that are used for signal normalization and absolute quantification of selected acids. The analytes are separated using Ion Exclusion Chromatography (IEC) and detected with Electrospray Ionization Mass Spectrometry (ESI-MS) as deprotonated molecules. Prior to ionization the eluent that contains hydrochloric acid is modified post-column to ensure good ionization efficiency of the analytes. The averaged within run precision and between run precision were generally lower than 8%. The accuracy was between 85 and 115% for most of the analytes. The Lower Limit of Quantification (LLOQ) ranged from 0.006 to 7mg/kg. It is shown that this method offers good selectivity in cases where UV detection fails to produce reliable results. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Nuclemeter: A Reaction-Diffusion Column for Quantifying Nucleic Acids Undergoing Enzymatic Amplification

    NASA Astrophysics Data System (ADS)

    Bau, Haim; Liu, Changchun; Killawala, Chitvan; Sadik, Mohamed; Mauk, Michael

    2014-11-01

    Real-time amplification and quantification of specific nucleic acid sequences plays a major role in many medical and biotechnological applications. In the case of infectious diseases, quantification of the pathogen-load in patient specimens is critical to assessing disease progression, effectiveness of drug therapy, and emergence of drug-resistance. Typically, nucleic acid quantification requires sophisticated and expensive instruments, such as real-time PCR machines, which are not appropriate for on-site use and for low resource settings. We describe a simple, low-cost, reactiondiffusion based method for end-point quantification of target nucleic acids undergoing enzymatic amplification. The number of target molecules is inferred from the position of the reaction-diffusion front, analogous to reading temperature in a mercury thermometer. We model the process with the Fisher Kolmogoroff Petrovskii Piscounoff (FKPP) Equation and compare theoretical predictions with experimental observations. The proposed method is suitable for nucleic acid quantification at the point of care, compatible with multiplexing and high-throughput processing, and can function instrument-free. C.L. was supported by NIH/NIAID K25AI099160; M.S. was supported by the Pennsylvania Ben Franklin Technology Development Authority; C.K. and H.B. were funded, in part, by NIH/NIAID 1R41AI104418-01A1.

  20. C-reactive protein and interleukin 6 microfluidic immunoassays with on-chip pre-stored reagents and centrifugo-pneumatic liquid control.

    PubMed

    Zhao, Y; Czilwik, G; Klein, V; Mitsakakis, K; Zengerle, R; Paust, N

    2017-05-02

    We present a fully automated centrifugal microfluidic method for particle based protein immunoassays. Stick-pack technology is employed for pre-storage and release of liquid reagents. Quantitative layout of centrifugo-pneumatic particle handling, including timed valving, switching and pumping is assisted by network simulations. The automation is exclusively controlled by the spinning frequency and does not require any additional means. New centrifugal microfluidic process chains are developed in order to sequentially supply wash buffer based on frequency dependent stick-pack opening and pneumatic pumping to perform two washing steps from one stored wash buffer; pre-store and re-suspend functionalized microparticles on a disk; and switch between the path of the waste fluid and the path of the substrate reaction product with 100% efficiency. The automated immunoassay concept is composed of on demand ligand binding, two washing steps, the substrate reaction, timed separation of the reaction products, and termination of the substrate reaction. We demonstrated separation of particles from three different liquids with particle loss below 4% and residual liquid remaining within particles below 3%. The automated immunoassay concept was demonstrated by means of detecting C-reactive protein (CRP) in the range of 1-81 ng ml -1 and interleukin 6 (IL-6) in the range of 64-13 500 pg ml -1 . The limit of detection and quantification were 1.0 ng ml -1 and 2.1 ng ml -1 for CRP and 64 pg ml -1 and 205 pg ml -1 for IL-6, respectively.

  1. Quantification of susceptibility change at high-concentrated SPIO-labeled target by characteristic phase gradient recognition.

    PubMed

    Zhu, Haitao; Nie, Binbin; Liu, Hua; Guo, Hua; Demachi, Kazuyuki; Sekino, Masaki; Shan, Baoci

    2016-05-01

    Phase map cross-correlation detection and quantification may produce highlighted signal at superparamagnetic iron oxide nanoparticles, and distinguish them from other hypointensities. The method may quantify susceptibility change by performing least squares analysis between a theoretically generated magnetic field template and an experimentally scanned phase image. Because characteristic phase recognition requires the removal of phase wrap and phase background, additional steps of phase unwrapping and filtering may increase the chance of computing error and enlarge the inconsistence among algorithms. To solve problem, phase gradient cross-correlation and quantification method is developed by recognizing characteristic phase gradient pattern instead of phase image because phase gradient operation inherently includes unwrapping and filtering functions. However, few studies have mentioned the detectable limit of currently used phase gradient calculation algorithms. The limit may lead to an underestimation of large magnetic susceptibility change caused by high-concentrated iron accumulation. In this study, mathematical derivation points out the value of maximum detectable phase gradient calculated by differential chain algorithm in both spatial and Fourier domain. To break through the limit, a modified quantification method is proposed by using unwrapped forward differentiation for phase gradient generation. The method enlarges the detectable range of phase gradient measurement and avoids the underestimation of magnetic susceptibility. Simulation and phantom experiments were used to quantitatively compare different methods. In vivo application performs MRI scanning on nude mice implanted by iron-labeled human cancer cells. Results validate the limit of detectable phase gradient and the consequent susceptibility underestimation. Results also demonstrate the advantage of unwrapped forward differentiation compared with differential chain algorithms for susceptibility quantification at high-concentrated iron accumulation. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Multiple products monitoring as a robust approach for peptide quantification.

    PubMed

    Baek, Je-Hyun; Kim, Hokeun; Shin, Byunghee; Yu, Myeong-Hee

    2009-07-01

    Quantification of target peptides and proteins is crucial for biomarker discovery. Approaches such as selected reaction monitoring (SRM) and multiple reaction monitoring (MRM) rely on liquid chromatography and mass spectrometric analysis of defined peptide product ions. These methods are not very widespread because the determination of quantifiable product ion using either SRM or MRM is a very time-consuming process. We developed a novel approach for quantifying target peptides without such an arduous process of ion selection. This method is based on monitoring multiple product ions (multiple products monitoring: MpM) from full-range MS2 spectra of a target precursor. The MpM method uses a scoring system that considers both the absolute intensities of product ions and the similarities between the query MS2 spectrum and the reference MS2 spectrum of the target peptide. Compared with conventional approaches, MpM greatly improves sensitivity and selectivity of peptide quantification using an ion-trap mass spectrometer.

  3. Acetylene chain reaction on hydrogenated boron nitride monolayers: a density functional theory study.

    PubMed

    Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru

    2017-11-28

    Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.

  4. Hyperplex-MRM: a hybrid multiple reaction monitoring method using mTRAQ/iTRAQ labeling for multiplex absolute quantification of human colorectal cancer biomarker.

    PubMed

    Yin, Hong-Rui; Zhang, Lei; Xie, Li-Qi; Huang, Li-Yong; Xu, Ye; Cai, San-Jun; Yang, Peng-Yuan; Lu, Hao-Jie

    2013-09-06

    Novel biomarker verification assays are urgently required to improve the efficiency of biomarker development. Benefitting from lower development costs, multiple reaction monitoring (MRM) has been used for biomarker verification as an alternative to immunoassay. However, in general MRM analysis, only one sample can be quantified in a single experiment, which restricts its application. Here, a Hyperplex-MRM quantification approach, which combined mTRAQ for absolute quantification and iTRAQ for relative quantification, was developed to increase the throughput of biomarker verification. In this strategy, equal amounts of internal standard peptides were labeled with mTRAQ reagents Δ0 and Δ8, respectively, as double references, while 4-plex iTRAQ reagents were used to label four different samples as an alternative to mTRAQ Δ4. From the MRM trace and MS/MS spectrum, total amounts and relative ratios of target proteins/peptides of four samples could be acquired simultaneously. Accordingly, absolute amounts of target proteins/peptides in four different samples could be achieved in a single run. In addition, double references were used to increase the reliability of the quantification results. Using this approach, three biomarker candidates, ademosylhomocysteinase (AHCY), cathepsin D (CTSD), and lysozyme C (LYZ), were successfully quantified in colorectal cancer (CRC) tissue specimens of different stages with high accuracy, sensitivity, and reproducibility. To summarize, we demonstrated a promising quantification method for high-throughput verification of biomarker candidates.

  5. Supplement to Theory of Neutron Chain Reactions

    DOE R&D Accomplishments Database

    Weinberg, Alvin M.; Noderer, L. C.

    1952-05-26

    General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

  6. Detection and quantification of beef and pork materials in meat products by duplex droplet digital PCR.

    PubMed

    Cai, Yicun; He, Yuping; Lv, Rong; Chen, Hongchao; Wang, Qiang; Pan, Liangwen

    2017-01-01

    Meat products often consist of meat from multiple animal species, and inaccurate food product adulteration and mislabeling can negatively affect consumers. Therefore, a cost-effective and reliable method for identification and quantification of animal species in meat products is required. In this study, we developed a duplex droplet digital PCR (dddPCR) detection and quantification system to simultaneously identify and quantify the source of meat in samples containing a mixture of beef (Bos taurus) and pork (Sus scrofa) in a single digital PCR reaction tube. Mixed meat samples of known composition were used to test the accuracy and applicability of this method. The limit of detection (LOD) and the limit of quantification (LOQ) of this detection and quantification system were also identified. We conclude that our dddPCR detection and quantification system is suitable for quality control and routine analyses of meat products.

  7. Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

    PubMed

    Zhou, Yu; Pearson, John E; Auerbach, Anthony

    2005-12-01

    We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

  8. Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

    PubMed

    Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

    2017-11-01

    Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

  9. Rapid detection and quantification of Ebola Zaire virus by one-step real-time quantitative reverse transcription-polymerase chain reaction.

    PubMed

    Ro, Young-Tae; Ticer, Anysha; Carrion, Ricardo; Patterson, Jean L

    2017-04-01

    Given that Ebola virus causes severe hemorrhagic fever in humans with mortality rates as high as 90%, rapid and accurate detection of this virus is essential both for controlling infection and preventing further transmission. Here, a one-step qRT-PCR assay for rapid and quantitative detection of an Ebola Zaire strain using GP, VP24 or VP40 genes as a target is introduced. Routine assay conditions for hydrolysis probe detection were established from the manufacturer's protocol used in the assays. The analytical specificity and sensitivity of each assay was evaluated using in vitro synthesized viral RNA transcripts. The assays were highly specific for the RNA transcripts, no cross-reactivity being observed among them. The limits of detection of the assays ranged from 10 2 to 10 3 copies per reaction. The assays were also evaluated using viral RNAs extracted from cell culture-propagated viruses (Ebola Zaire, Sudan and Reston strains), confirming that they are gene- and strain-specific. The RT-PCR assays detected viral RNAs in blood samples from virus-infected animal, suggesting that they can be also a useful method for identifying Ebola virus in clinical samples. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  10. An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.

    PubMed

    Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján

    2016-02-20

    In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. An overview of dissolved organic carbon in groundwater and implications for drinking water safety

    NASA Astrophysics Data System (ADS)

    Regan, S.; Hynds, P.; Flynn, R.

    2017-06-01

    Dissolved organic carbon (DOC) is composed of a diverse array of compounds, predominantly humic substances, and is a near ubiquitous component of natural groundwater, notwithstanding climatic extremes such as arid and hyper-arid settings. Despite being a frequently measured parameter of groundwater quality, the complexity of DOC composition and reaction behaviour means that links between concentration and human health risk are difficult to quantify and few examples are reported in the literature. Measured concentrations from natural/unpolluted groundwater are typically below 4 mg C/l, whilst concentrations above these levels generally indicate anthropogenic influences and/or contamination issues and can potentially compromise water safety. Treatment processes are effective at reducing DOC concentrations, but refractory humic substance reaction with chlorine during the disinfection process produces suspected carcinogenic disinfectant by-products (DBPs). However, despite engineered artificial recharge systems being commonly used to remove DOC from recycled treated wastewaters, little research has been conducted on the presence of DBPs in potable groundwater systems. In recent years, the capacity to measure the influence of organic matter on colloidal contaminants and its influence on the mobility of pathogenic microorganisms has aided understanding of transport processes in aquifers. Additionally, advances in polymerase chain reaction techniques used for the detection, identification, and quantification of waterborne pathogens, provide a method to confidently investigate the behaviour of DOC and its effect on contaminant transfer in aquifers. This paper provides a summary of DOC occurrence in groundwater bodies and associated issues capable of indirectly affecting human health.

  12. Quantification of simian immunodeficiency virus cytotoxic T lymphocyte escape mutant viruses.

    PubMed

    Loh, Liyen; Kent, Stephen J

    2008-08-01

    Escape from cytotoxic T-lymphocyte (CTL) pressure is common in HIV-1 infection of humans and simian immunodeficiency virus (SIV) infections of macaques. CTL escape typically incurs a fitness cost as reversion back to wild-type can occur upon transmission. We utilized sequence-specific primers and DNA probes with real-time polymerase chain reaction (PCR) to sensitively and specifically track wild-type and escape mutant viremia at the Mane-A*17-restricted SIV Gag(371379) epitope AF9 in pigtail macaques. The generation of minor escape mutant populations is detected by the real-time PCR 2 weeks earlier than observed using standard sequencing techniques. We passaged the AF9 CTL escape mutant virus into two naïve Mane-A*17-negative pigtail macaques and showed that reversion to wild-type was rapid during acute infection and then slowed considerably at later stages of the infection. These data help refine our understanding of how CTL escape mutant viruses evolve.

  13. Recombinase polymerase amplification as a promising tool in hepatitis C virus diagnosis.

    PubMed

    Zaghloul, Hosam; El-Shahat, Mahmoud

    2014-12-27

    Hepatitis C virus (HCV) infection represents a significant health problem and represents a heavy load on some countries like Egypt in which about 20% of the total population are infected. Initial infection is usually asymptomatic and result in chronic hepatitis that give rise to complications including cirrhosis and hepatocellular carcinoma. The management of HCV infection should not only be focus on therapy, but also to screen carrier individuals in order to prevent transmission. In the present, molecular detection and quantification of HCV genome by real time polymerase chain reaction (PCR) represent the gold standard in HCV diagnosis and plays a crucial role in the management of therapeutic regimens. However, real time PCR is a complicated approach and of limited distribution. On the other hand, isothermal DNA amplification techniques have been developed and offer molecular diagnosis of infectious dieses at point-of-care. In this review we discuss recombinase polymerase amplification technique and illustrate its diagnostic value over both PCR and other isothermal amplification techniques.

  14. Expression levels of seven candidate genes in human peripheral blood mononuclear cells and their association with preeclampsia

    PubMed Central

    Garza-Veloz, I.; Carrillo-Sanchez, K.; Martinez-Gaytan, V.; Cortes-Flores, R.; Ochoa-Torres, M. A.; Guerrero, G. G.; Rodriguez-Sanchez, I. P.; Cancela-Murrieta, C. O.; Zamudio-Osuna, M.; Badillo-Almaraz, J. I.; Castruita-De la Rosa, C.

    2014-01-01

    Objective To evaluate the peripheral blood mononuclear cell (PBMC) expression levels of hemeoxygenase 1 (HMOX-1), superoxide dismutase 1 (SOD-1), vascular endothelial growth factor A (VEGF-A), transforming growth factor beta 1 (TGF-β1), interleukin (IL)-6, IL-15 and AdipoQ genes to study their association with preeclampsia (PE). Methods A total of 177 pregnant women were recruited: 108 cases and 69 controls. Quantification of gene expression was measured by quantitative real-time polymerase chain reaction (PCR) using TaqMan probes. Results Underexpression of VEGF-A and TGF-β1 was a constant in most of the cases (80.91% and 76.36%, respectively) and their expression was associated with onset and/or severity of disease (p values < 0.05). IL-6, IL-15 and AdipoQ, showed low or no expression in PBMC samples evaluated. Conclusion PBMC underexpression of VEGF-A and TGF-β1 is a hallmark of PE in the study population. PMID:24295154

  15. A Systematic Investigation of Parameters Influencing Droplet Rain in the Listeria monocytogenes prfA Assay - Reduction of Ambiguous Results in ddPCR

    PubMed Central

    Witte, Anna Kristina; Mester, Patrick; Fister, Susanne; Witte, Matthias; Schoder, Dagmar; Rossmanith, Peter

    2016-01-01

    The droplet digital polymerase chain reaction (ddPCR) determines DNA amounts based upon the pattern of positive and negative droplets, according to Poisson distribution, without the use of external standards. However, division into positive and negative droplets is often not clear because a part of the droplets has intermediate fluorescence values, appearing as “rain” in the plot. Despite the droplet rain, absolute quantification with ddPCR is possible, as shown previously for the prfA assay in quantifying Listeria monocytogenes. Nevertheless, reducing the rain, and thus ambiguous results, promotes the accuracy and credibility of ddPCR. In this study, we extensively investigated chemical and physical parameters for optimizing the prfA assay for ddPCR. While differences in the concentration of all chemicals and the dye, quencher and supplier of the probe did not alter the droplet pattern, changes in the PCR cycling program, such as prolonged times and increased cycle numbers, improved the assay. PMID:27992475

  16. A Systematic Investigation of Parameters Influencing Droplet Rain in the Listeria monocytogenes prfA Assay - Reduction of Ambiguous Results in ddPCR.

    PubMed

    Witte, Anna Kristina; Mester, Patrick; Fister, Susanne; Witte, Matthias; Schoder, Dagmar; Rossmanith, Peter

    2016-01-01

    The droplet digital polymerase chain reaction (ddPCR) determines DNA amounts based upon the pattern of positive and negative droplets, according to Poisson distribution, without the use of external standards. However, division into positive and negative droplets is often not clear because a part of the droplets has intermediate fluorescence values, appearing as "rain" in the plot. Despite the droplet rain, absolute quantification with ddPCR is possible, as shown previously for the prfA assay in quantifying Listeria monocytogenes. Nevertheless, reducing the rain, and thus ambiguous results, promotes the accuracy and credibility of ddPCR. In this study, we extensively investigated chemical and physical parameters for optimizing the prfA assay for ddPCR. While differences in the concentration of all chemicals and the dye, quencher and supplier of the probe did not alter the droplet pattern, changes in the PCR cycling program, such as prolonged times and increased cycle numbers, improved the assay.

  17. Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

    PubMed

    Umamaheswari, A; Venkateswarlu, K

    2004-06-01

    Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

  18. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  19. Detection and quantification of proteins and cells by use of elemental mass spectrometry: progress and challenges.

    PubMed

    Yan, Xiaowen; Yang, Limin; Wang, Qiuquan

    2013-07-01

    Much progress has been made in identification of the proteins in proteomes, and quantification of these proteins has attracted much interest. In addition to popular tandem mass spectrometric methods based on soft ionization, inductively coupled plasma mass spectrometry (ICPMS), a typical example of mass spectrometry based on hard ionization, usually used for analysis of elements, has unique advantages in absolute quantification of proteins by determination of an element with a definite stoichiometry in a protein or attached to the protein. In this Trends article, we briefly describe state-of-the-art ICPMS-based methods for quantification of proteins, emphasizing protein-labeling and element-tagging strategies developed on the basis of chemically selective reactions and/or biospecific interactions. Recent progress from protein to cell quantification by use of ICPMS is also discussed, and the possibilities and challenges of ICPMS-based protein quantification for universal, selective, or targeted quantification of proteins and cells in a biological sample are also discussed critically. We believe ICPMS-based protein quantification will become ever more important in targeted quantitative proteomics and bioanalysis in the near future.

  20. Direct qPCR quantification using the Quantifiler(®) Trio DNA quantification kit.

    PubMed

    Liu, Jason Yingjie

    2014-11-01

    The effectiveness of a direct quantification assay is essential to the adoption of the combined direct quantification/direct STR workflow. In this paper, the feasibility of using the Quantifiler(®) Trio DNA quantification kit for the direct quantification of forensic casework samples was investigated. Both low-level touch DNA samples and blood samples were collected on PE swabs and quantified directly. The increased sensitivity of the Quantifiler(®) Trio kit enabled the detection of less than 10pg of DNA in unprocessed touch samples and also minimizes the stochastic effect experienced by different targets in the same sample. The DNA quantity information obtained from a direct quantification assay using the Quantifiler(®) Trio kit can also be used to accurately estimate the optimal input DNA quantity for a direct STR amplification reaction. The correlation between the direct quantification results (Quantifiler(®) Trio kit) and the direct STR results (GlobalFiler™ PCR amplification kit(*)) for low-level touch DNA samples indicates that direct quantification using the Quantifiler(®) Trio DNA quantification kit is more reliable than the Quantifiler(®) Duo DNA quantification kit for predicting the STR results of unprocessed touch DNA samples containing less than 10pg of DNA. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  1. Novel Indicators for the Quantification of Resilience in Critical Material Supply Chains, with a 2010 Rare Earth Crisis Case Study

    PubMed Central

    2017-01-01

    We introduce several new resilience metrics for quantifying the resilience of critical material supply chains to disruptions and validate these metrics using the 2010 rare earth element (REE) crisis as a case study. Our method is a novel application of Event Sequence Analysis, supplemented with interviews of actors across the entire supply chain. We discuss resilience mechanisms in quantitative terms–time lags, response speeds, and maximum magnitudes–and in light of cultural differences between Japanese and European corporate practice. This quantification is crucial if resilience is ever to be taken into account in criticality assessments and a step toward determining supply and demand elasticities in the REE supply chain. We find that the REE system showed resilience mainly through substitution and increased non-Chinese primary production, with a distinct role for stockpiling. Overall, annual substitution rates reached 10% of total demand. Non-Chinese primary production ramped up at a speed of 4% of total market volume per year. The compound effect of these mechanisms was that recovery from the 2010 disruption took two years. The supply disruption did not nudge a system toward an appreciable degree of recycling. This finding has important implications for the circular economy concept, indicating that quite a long period of sustained material constraints will be necessary for a production-consumption system to naturally evolve toward a circular configuration. PMID:28257181

  2. [Quantitative PCR in the diagnosis of Leishmania].

    PubMed

    Mortarino, M; Franceschi, A; Mancianti, F; Bazzocchi, C; Genchi, C; Bandi, C

    2004-06-01

    Polymerase chain reaction (PCR) is a sensitive and rapid method for the diagnosis of canine Leishmania infection and can be performed on a variety of biological samples, including peripheral blood, lymph node, bone marrow and skin. Standard PCR requires electrophoretic analysis of the amplification products and is usually not suitable for quantification of the template DNA (unless competitor-based or other methods are developed), being of reduced usefulness when accurate monitoring of target DNA is required. Quantitative real-time PCR allows the continuous monitoring of the accumulation of PCR products during the amplification reaction. This allows the identification of the cycle of near-logarithmic PCR product generation (threshold cycle) and, by inference, the relative quantification of the template DNA present at the start of the reaction. Since the amplification product are monitored in "real-time" as they form cycle-by-cycle, no post-amplification handling is required. The absolute quantification is performed according either to an internal standard co-amplified with the sample DNA, or to an external standard curve obtained by parallel amplification of serial known concentrations of a reference DNA sequence. From the quantification of the template DNA, an estimation of the relative load of parasites in the different samples can be obtained. The advantages compared to standard and semi-quantitative PCR techniques are reduction of the assay's time and contamination risks, and improved sensitivity. As for standard PCR, the minimal components of the quantitative PCR reaction mixture are the DNA target of the amplification, an oligonucleotide primer pair flanking the target sequence, a suitable DNA polymerase, deoxynucleotides, buffer and salts. Different technologies have been set up for the monitoring of amplification products, generally based on the use of fluorescent probes. For instance, SYBR Green technology is a non-specific detection system based on a fluorescent dsDNA intercalator and it is applicable to all potential targets. TaqMan technology is more specific since performs the direct assessment of the amount of amplified DNA using a fluorescent probe specific for the target sequence flanked by the primer pair. This probe is an oligonucleotide labelled with a reporter dye (fluorescent) and a quencher (which absorbs the fluorescent signal generated by the reporter). The thermic protocol of amplification allows the binding of the fluorescent probe to the target sequence before the binding of the primers and the starting of the polymerization by Taq polymerase. During polymerization, 5'-3' exonuclease activity of Taq polymerase digests the probe and in this way the reporter dye is released from the probe and a fluorescent signal is detected. The intensity of the signal accumulates at the end of each cycle and is related to the amount of the amplification product. In recent years, quantitative PCR methods based either on SYBR Green or TaqMan technology have been set up for the quantification of Leishmania in mouse liver, mouse skin and human peripheral blood, targeting either single-copy chromosomal or multi-copy minicircle sequences with high sensitivity and reproducibility. In particular, real-time PCR seems to be a reliable, rapid and noninvasive method for the diagnosis and follow up of visceral leishmaniasis in humans. At present, the application of real-time PCR for research and clinical diagnosis of Leishmania infection in dogs is still foreseable. As for standard PCR, the high sensitivity of real-time PCR could allow the use of blood sampling that is less invasive and easily performed for monitoring the status of the dogs. The development of a real-time PCR assay for Leishmania infantum infection in dogs could support the standard and optimized serological and PCR methods currenly in use for the diagnosis and follow-up of canine leishmaniasis, and perhaps prediction of recurrences associated with tissue loads of residual pathogens after treatment. At this regard, a TaqMan Real Time PCR method developed for the quantification of Leishmania infantum minicircle DNA in peripheral blood of naturally infected dogs sampled before and at different time points after the beginning of a standard antileishmanial therapy will be illustrated.

  3. Droplet digital polymerase chain reaction (ddPCR) assays integrated with an internal control for quantification of bovine, porcine, chicken and turkey species in food and feed

    PubMed Central

    Shehata, Hanan R.; Li, Jiping; Redda, Helen; Cheng, Shumei; Tabujara, Nicole; Li, Honghong; Warriner, Keith; Hanner, Robert

    2017-01-01

    Food adulteration and feed contamination are significant issues in the food/feed industry, especially for meat products. Reliable techniques are needed to monitor these issues. Droplet Digital PCR (ddPCR) assays were developed and evaluated for detection and quantification of bovine, porcine, chicken and turkey DNA in food and feed samples. The ddPCR methods were designed based on mitochondrial DNA sequences and integrated with an artificial recombinant plasmid DNA to control variabilities in PCR procedures. The specificity of the ddPCR assays was confirmed by testing both target species and additional 18 non-target species. Linear regression established a detection range between 79 and 33200 copies of the target molecule from 0.26 to 176 pg of fresh animal tissue DNA with a coefficient of determination (R2) of 0.997–0.999. The quantification ranges of the methods for testing fortified heat-processed food and feed samples were 0.05–3.0% (wt/wt) for the bovine and turkey targets, and 0.01–1.0% (wt/wt) for pork and chicken targets. Our methods demonstrated acceptable repeatability and reproducibility for the analytical process for food and feed samples. Internal validation of the PCR process was monitored using a control chart for 74 consecutive ddPCR runs for quantifying bovine DNA. A matrix effect was observed while establishing calibration curves with the matrix type under testing, and the inclusion of an internal control in DNA extraction provides a useful means to overcome this effect. DNA degradation caused by heating, sonication or Taq I restriction enzyme digestion was found to reduce ddPCR readings by as much as 4.5 fold. The results illustrated the applicability of the methods to quantify meat species in food and feed samples without the need for a standard curve, and to potentially support enforcement activities for food authentication and feed control. Standard reference materials matching typical manufacturing processes are needed for future validation of ddPCR assays for absolute quantification of meat species. PMID:28796824

  4. Droplet digital polymerase chain reaction (ddPCR) assays integrated with an internal control for quantification of bovine, porcine, chicken and turkey species in food and feed.

    PubMed

    Shehata, Hanan R; Li, Jiping; Chen, Shu; Redda, Helen; Cheng, Shumei; Tabujara, Nicole; Li, Honghong; Warriner, Keith; Hanner, Robert

    2017-01-01

    Food adulteration and feed contamination are significant issues in the food/feed industry, especially for meat products. Reliable techniques are needed to monitor these issues. Droplet Digital PCR (ddPCR) assays were developed and evaluated for detection and quantification of bovine, porcine, chicken and turkey DNA in food and feed samples. The ddPCR methods were designed based on mitochondrial DNA sequences and integrated with an artificial recombinant plasmid DNA to control variabilities in PCR procedures. The specificity of the ddPCR assays was confirmed by testing both target species and additional 18 non-target species. Linear regression established a detection range between 79 and 33200 copies of the target molecule from 0.26 to 176 pg of fresh animal tissue DNA with a coefficient of determination (R2) of 0.997-0.999. The quantification ranges of the methods for testing fortified heat-processed food and feed samples were 0.05-3.0% (wt/wt) for the bovine and turkey targets, and 0.01-1.0% (wt/wt) for pork and chicken targets. Our methods demonstrated acceptable repeatability and reproducibility for the analytical process for food and feed samples. Internal validation of the PCR process was monitored using a control chart for 74 consecutive ddPCR runs for quantifying bovine DNA. A matrix effect was observed while establishing calibration curves with the matrix type under testing, and the inclusion of an internal control in DNA extraction provides a useful means to overcome this effect. DNA degradation caused by heating, sonication or Taq I restriction enzyme digestion was found to reduce ddPCR readings by as much as 4.5 fold. The results illustrated the applicability of the methods to quantify meat species in food and feed samples without the need for a standard curve, and to potentially support enforcement activities for food authentication and feed control. Standard reference materials matching typical manufacturing processes are needed for future validation of ddPCR assays for absolute quantification of meat species.

  5. Direct quantification of microRNA at low pM level in sera of glioma patients using a competitive hybridization followed by amplified voltammetric detection

    PubMed Central

    Wang, Jianxiu; Yi, Xinyao; Tang, Hailin; Han, Hongxing; Wu, Minghua; Zhou, Feimeng

    2012-01-01

    MicroRNAs (miRNAs), acting as oncogenes or tumor suppressors in humans, play a key role in regulating gene expression and are believed to be important for developing novel therapeutic treatments and clinical prognoses. Due to their short lengths (17–25 nucleotides) and extremely low concentrations (typically < pM) in biological samples, quantification of miRNAs has been challenging to conventional biochemical methods, such as Northern blotting, microarray, and quantitative polymerase chain reaction (qPCR). In this work, a biotinylated miRNA (biotin-miRNA) whose sequence is the same as that of a miRNA target is introduced into samples of interest and allowed to compete with the miRNA target for the oligonucleotide (ODN) probe preimmobilized onto an electrode. Voltammetric quantification of the miRNA target was accomplished after complexation of the biotin-miRNA with ferrocene (Fc)-capped gold nanoparticle/streptavidin conjugates. The Fc oxidation current was found to be inversely proportional to the concentration of target miRNA between 10 fM and 2.0 pM. The method is highly reproducible (RSD < 5%), regenerable (at least 8 regeneration/assay cycles without discernible signal decrease) and selective (with sequence specificity down to a single nucleotide mismatch). The low detection levels (10 fM or 0.1 attomoles of miRNA in a 10-HL solution) allow the direct quantification of miRNA-182, a marker correlated to the progression of glioma in patients, to be performed in serum samples without sample pretreatment and RNA extraction and enrichment. The concentration of miRNA-182 in glioma patients was found to be 3.1 times as high as that in healthy persons, a conclusion in excellent agreement with a separate qPCR measurement of the expression level. The obviations of the requirement of an internal reference in qPCR, simplicity, and cost-effectiveness are other additional advantages of this method for detection of nucleic acids in clinical samples. PMID:22788545

  6. The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

    PubMed

    Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

    2006-07-01

    We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

  7. Formation yields of C8 1,4-hydroxycarbonyls from OH + n-octane in the presence of NO.

    PubMed

    Aschmann, Sara M; Arey, Janet; Atkinson, Roger

    2012-12-18

    1,4-Hydroxycarbonyls are major products of the OH radical-initiated reactions of ≥ C₅ n-alkanes in the presence of NO. However, because of a lack of commercially available standards of 1,4-hydroxycarbonyls and difficulties in using gas chromatography for their analysis without prior derivatization, quantification of 1,4-hydroxycarbonyls in OH + alkane reactions has proven difficult. We have used an annular denuder coated with XAD resin and further coated with O-(2,3,4,5,6-pentafluorobenzyl)hydroxylamine for in situ derivatization of the 1,4-hydroxycarbonyls formed from the OH + n-octane reaction in the presence of NO. Quantification was achieved by using 2,5-hexanedione as an internal standard. Formation yields for (7-hydroxy-4-octanone + 6-hydroxy-3-octanone + 5-hydroxy-2-octanone) and of 4-hydroxyoctanal of 61 ± 11% and 2.1 ± 0.5%, respectively, were obtained. When combined with previously measured or estimated formation yields for octyl nitrates and hydroxyoctyl nitrates, 93 ± 15% of the overall reaction products are accounted for, indicating that no additional reaction pathways remain to be identified.

  8. Quantification of methionine and selenomethionine in biological samples using multiple reaction monitoring high performance liquid chromatography tandem mass spectrometry (MRM-HPLC-MS/MS).

    PubMed

    Vu, Dai Long; Ranglová, Karolína; Hájek, Jan; Hrouzek, Pavel

    2018-05-01

    Quantification of selenated amino-acids currently relies on methods employing inductively coupled plasma mass spectrometry (ICP-MS). Although very accurate, these methods do not allow the simultaneous determination of standard amino-acids, hampering the comparison of the content of selenated versus non-selenated species such as methionine (Met) and selenomethionine (SeMet). This paper reports two approaches for the simultaneous quantification of Met and SeMet. In the first approach, standard enzymatic hydrolysis employing Protease XIV was applied for the preparation of samples. The second approach utilized methanesulfonic acid (MA) for the hydrolysis of samples, either in a reflux system or in a microwave oven, followed by derivatization with diethyl ethoxymethylenemalonate. The prepared samples were then analyzed by multiple reaction monitoring high performance liquid chromatography tandem mass spectrometry (MRM-HPLC-MS/MS). Both approaches provided platforms for the accurate determination of selenium/sulfur substitution rate in Met. Moreover the second approach also provided accurate simultaneous quantification of Met and SeMet with a low limit of detection, low limit of quantification and wide linearity range, comparable to the commonly used gas chromatography mass spectrometry (GC-MS) method or ICP-MS. The novel method was validated using certified reference material in conjunction with the GC-MS reference method. Copyright © 2018. Published by Elsevier B.V.

  9. Evaluation of Direct Infusion-Multiple Reaction Monitoring Mass Spectrometry for Quantification of Heat Shock Proteins

    PubMed Central

    Xiang, Yun; Koomen, John M.

    2012-01-01

    Protein quantification with liquid chromatography-multiple reaction monitoring mass spectrometry (LC-MRM) has emerged as a powerful platform for assessing panels of biomarkers. In this study, direct infusion, using automated, chip-based nanoelectrospray ionization, coupled with MRM (DI-MRM) is used for protein quantification. Removal of the LC separation step increases the importance of evaluating the ratios between the transitions. Therefore, the effects of solvent composition, analyte concentration, spray voltage, and quadrupole resolution settings on fragmentation patterns have been studied using peptide and protein standards. After DI-MRM quantification was evaluated for standards, quantitative assays for the expression of heat shock proteins (HSPs) were translated from LC-MRM to DI-MRM for implementation in cell line models of multiple myeloma. Requirements for DI-MRM assay development are described. Then, the two methods are compared; criteria for effective DI-MRM analysis are reported based on the analysis of HSP expression in digests of whole cell lysates. The increased throughput of DI-MRM analysis is useful for rapid analysis of large batches of similar samples, such as time course measurements of cellular responses to therapy. PMID:22293045

  10. Accurate Quantification of Cardiovascular Biomarkers in Serum Using Protein Standard Absolute Quantification (PSAQ™) and Selected Reaction Monitoring*

    PubMed Central

    Huillet, Céline; Adrait, Annie; Lebert, Dorothée; Picard, Guillaume; Trauchessec, Mathieu; Louwagie, Mathilde; Dupuis, Alain; Hittinger, Luc; Ghaleh, Bijan; Le Corvoisier, Philippe; Jaquinod, Michel; Garin, Jérôme; Bruley, Christophe; Brun, Virginie

    2012-01-01

    Development of new biomarkers needs to be significantly accelerated to improve diagnostic, prognostic, and toxicity monitoring as well as therapeutic follow-up. Biomarker evaluation is the main bottleneck in this development process. Selected Reaction Monitoring (SRM) combined with stable isotope dilution has emerged as a promising option to speed this step, particularly because of its multiplexing capacities. However, analytical variabilities because of upstream sample handling or incomplete trypsin digestion still need to be resolved. In 2007, we developed the PSAQ™ method (Protein Standard Absolute Quantification), which uses full-length isotope-labeled protein standards to quantify target proteins. In the present study we used clinically validated cardiovascular biomarkers (LDH-B, CKMB, myoglobin, and troponin I) to demonstrate that the combination of PSAQ and SRM (PSAQ-SRM) allows highly accurate biomarker quantification in serum samples. A multiplex PSAQ-SRM assay was used to quantify these biomarkers in clinical samples from myocardial infarction patients. Good correlation between PSAQ-SRM and ELISA assay results was found and demonstrated the consistency between these analytical approaches. Thus, PSAQ-SRM has the capacity to improve both accuracy and reproducibility in protein analysis. This will be a major contribution to efficient biomarker development strategies. PMID:22080464

  11. Multiplex quantification of four DNA targets in one reaction with Bio-Rad droplet digital PCR system for GMO detection

    NASA Astrophysics Data System (ADS)

    Dobnik, David; Štebih, Dejan; Blejec, Andrej; Morisset, Dany; Žel, Jana

    2016-10-01

    The advantages of the digital PCR technology are already well documented until now. One way to achieve better cost efficiency of the technique is to use it in a multiplexing strategy. Droplet digital PCR platforms, which include two fluorescence filters, support at least duplex reactions and with some developments and optimization higher multiplexing is possible. The present study not only shows a development of multiplex assays in droplet digital PCR, but also presents a first thorough evaluation of several parameters in such multiplex digital PCR. Two 4-plex assays were developed for quantification of 8 different DNA targets (7 genetically modified maize events and maize endogene). Per assay, two of the targets were labelled with one fluorophore and two with another. As current analysis software does not support analysis of more than duplex, a new R- and Shiny-based web application analysis tool (http://bit.ly/ddPCRmulti) was developed that automates the analysis of 4-plex results. In conclusion, the two developed multiplex assays are suitable for quantification of GMO maize events and the same approach can be used in any other field with a need for accurate and reliable quantification of multiple DNA targets.

  12. Multiplex quantification of four DNA targets in one reaction with Bio-Rad droplet digital PCR system for GMO detection.

    PubMed

    Dobnik, David; Štebih, Dejan; Blejec, Andrej; Morisset, Dany; Žel, Jana

    2016-10-14

    The advantages of the digital PCR technology are already well documented until now. One way to achieve better cost efficiency of the technique is to use it in a multiplexing strategy. Droplet digital PCR platforms, which include two fluorescence filters, support at least duplex reactions and with some developments and optimization higher multiplexing is possible. The present study not only shows a development of multiplex assays in droplet digital PCR, but also presents a first thorough evaluation of several parameters in such multiplex digital PCR. Two 4-plex assays were developed for quantification of 8 different DNA targets (7 genetically modified maize events and maize endogene). Per assay, two of the targets were labelled with one fluorophore and two with another. As current analysis software does not support analysis of more than duplex, a new R- and Shiny-based web application analysis tool (http://bit.ly/ddPCRmulti) was developed that automates the analysis of 4-plex results. In conclusion, the two developed multiplex assays are suitable for quantification of GMO maize events and the same approach can be used in any other field with a need for accurate and reliable quantification of multiple DNA targets.

  13. Development and evaluation of an up-converting phosphor technology-based lateral flow assay for the rapid, simultaneous detection of Vibrio cholerae serogroups O1 and O139

    PubMed Central

    Li, Baisheng; Liu, Xiao; Zhao, Yong; Tan, Hailing; Sun, Chongyun; Wang, Xiaochen; Wang, Xinrui; Qiu, Haiyan; Wang, Duochun; Diao, Baowei; Jing, Huaiqi; Yang, Ruifu; Kan, Biao

    2017-01-01

    Vibrio cholerae serogroups O1 and O139 are etiological agents of cholera, a serious and acute diarrheal disease, and rapid detection of V. cholerae is a key method for preventing and controlling cholera epidemics. Here, a point of care testing (POCT) method called Vch-UPT-LF, which is an up-converting phosphor technology-based lateral flow (UPT-LF) assay with a dual-target detection mode, was developed to detect V. cholerae O1 and O139 simultaneously from one sample loading. Although applying an independent reaction pair made both detection results for the two Vch-UPT-LF detection channels more stable, the sensitivity slightly declined from 104 to 105 colony-forming units (CFU) mL−1 compared with that of the single-target assay, while the quantification ranges covering four orders of magnitude were maintained. The strip showed excellent specificity for seven Vibrio species that are highly related genetically, and nine food-borne species whose transmission routes are similar to those of V. cholerae. The legitimate arrangement of the two adjacent test lines lessened the mutual impact of the quantitation results between the two targets, and the quantification values did not differ by more than one order of magnitude when the samples contained high concentrations of both V. cholerae O1 and O139. Under pre-incubation conditions, 1×101 CFU mL−1 of V. cholerae O1 or O139 could be detected in fewer than 7 h, while the Vch-UPT-LF assay exhibited sensitivity as high as a real-time fluorescent polymerase chain reaction with fewer false-positive results. Therefore, successful development of Vch-UPT-LF as a dual-target assay for quantitative detection makes this assay a good candidate POCT method for the detection and surveillance of epidemic cholera. PMID:28662147

  14. Comprehensive Multiplex One-Step Real-Time TaqMan qRT-PCR Assays for Detection and Quantification of Hemorrhagic Fever Viruses

    PubMed Central

    Li, Jiandong; Qu, Jing; He, Chengcheng; Zhang, Shuo; Li, Chuan; Zhang, Quanfu; Liang, Mifang; Li, Dexin

    2014-01-01

    Background Viral hemorrhagic fevers (VHFs) are a group of animal and human illnesses that are mostly caused by several distinct families of viruses including bunyaviruses, flaviviruses, filoviruses and arenaviruses. Although specific signs and symptoms vary by the type of VHF, initial signs and symptoms are very similar. Therefore rapid immunologic and molecular tools for differential diagnosis of hemorrhagic fever viruses (HFVs) are important for effective case management and control of the spread of VHFs. Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assay is one of the reliable and desirable methods for specific detection and quantification of virus load. Multiplex PCR assay has the potential to produce considerable savings in time and resources in the laboratory detection. Results Primers/probe sets were designed based on appropriate specific genes for each of 28 HFVs which nearly covered all the HFVs, and identified with good specificity and sensitivity using monoplex assays. Seven groups of multiplex one-step real-time qRT-PCR assays in a universal experimental system were then developed by combining all primers/probe sets into 4-plex reactions and evaluated with serial dilutions of synthesized viral RNAs. For all the multiplex assays, no cross-reactivity with other HFVs was observed, and the limits of detection were mainly between 45 and 150 copies/PCR. The reproducibility was satisfactory, since the coefficient of variation of Ct values were all less than 5% in each dilution of synthesized viral RNAs for both intra-assays and inter-assays. Evaluation of the method with available clinical serum samples collected from HFRS patients, SFTS patients and Dengue fever patients showed high sensitivity and specificity of the related multiplex assays on the clinical specimens. Conclusions Overall, the comprehensive multiplex one-step real-time qRT-PCR assays were established in this study, and proved to be specific, sensitive, stable and easy to serve as a useful tool for rapid detection of HFVs. PMID:24752452

  15. Relative quantification of N(epsilon)-(Carboxymethyl)lysine, imidazolone A, and the Amadori product in glycated lysozyme by MALDI-TOF mass spectrometry.

    PubMed

    Kislinger, Thomas; Humeny, Andreas; Peich, Carlo C; Zhang, Xiaohong; Niwa, Toshimitsu; Pischetsrieder, Monika; Becker, Cord-Michael

    2003-01-01

    The nonenzymatic glycation of proteins by reducing sugars, also known as the Maillard reaction, has received increasing recognition from nutritional science and medical research. In this study, we applied matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) to perform relative and simultaneous quantification of the Amadori product, which is an early glycation product, and of N(epsilon)-(carboxymethyl)lysine and imidazolone A, two important advanced glycation end products. Therefore, native lysozyme was incubated with d-glucose for increasing periods of time (1, 4, 8, and 16 weeks) in phosphate-buffered saline pH 7.8 at 50 degrees C. After enzymatic digestion with endoproteinase Glu-C, the N-terminal peptide fragment (m/z 838; amino acid sequence KVFGRCE) and the C-terminal peptide fragment (m/z 1202; amino acid sequence VQAWIRGCRL) were used for relative quantification of the three Maillard products. Amadori product, N(epsilon)-(carboxymethyl)lysine, and imidazolone A were the main glycation products formed under these conditions. Their formation was dependent on glucose concentration and reaction time. The kinetics were similar to those obtained by competitive ELISA, an established method for quantification of N(epsilon)-(carboxymethyl)lysine and imidazolone A. Inhibition experiments showed that coincubation with N(alpha)-acetylargine suppressed formation of imidazolone A but not of the Amadori product or N(epsilon)-(carboxymethyl)lysine. The presence of N(alpha)-acetyllysine resulted in the inhibition of lysine modifications but in higher concentrations of imidazolone A. o-Phenylenediamine decreased the yield of the Amadori product and completely inhibited the formation of N(epsilon)-(carboxymethyl)lysine and imidazolone A. MALDI-TOF-MS proved to be a new analytical tool for the simultaneous, relative quantification of specific products of the Maillard reaction. For the first time, kinetic data of defined products on specific sites of glycated protein could be measured. This characterizes MALDI-TOF-MS as a valuable method for monitoring the Maillard reaction in the course of food processing.

  16. Urinary mRNA for the Diagnosis of Renal Allograft Rejection: The Issue of Normalization.

    PubMed

    Galichon, P; Amrouche, L; Hertig, A; Brocheriou, I; Rabant, M; Xu-Dubois, Y-C; Ouali, N; Dahan, K; Morin, L; Terzi, F; Rondeau, E; Anglicheau, D

    2016-10-01

    Urinary messenger RNA (mRNA) quantification is a promising method for noninvasive diagnosis of renal allograft rejection (AR), but the quantification of mRNAs in urine remains challenging due to degradation. RNA normalization may be warranted to overcome these issues, but the strategies of gene normalization have been poorly evaluated. Herein, we address this issue in a case-control study of 108 urine samples collected at time of allograft biopsy in kidney recipients with (n = 52) or without (n = 56) AR by comparing the diagnostic value of IP-10 and CD3ε mRNAs-two biomarkers of AR-after normalization by the total amount of RNA, normalization by one of the three widely used reference RNAs-18S, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and Hypoxanthine-guanine phosphoribosyltransferase (HPRT)-or normalization using uroplakin 1A (UPK) mRNA as a possible urine-specific reference mRNA. Our results show that normalization based on the total quantity of RNA is not substantially improved by additional normalization and may even be worsened with some classical reference genes that are overexpressed during rejection. However, considering that normalization by a reference gene is necessary to ensure polymerase chain reaction (PCR) quality and reproducibility and to suppress the effect of RNA degradation, we suggest that GAPDH and UPK1A are preferable to 18S or HPRT RNA. © Copyright 2016 The American Society of Transplantation and the American Society of Transplant Surgeons.

  17. Detection and quantification of major toxigenic Microcystis genotypes in Moo-Tan reservoir and associated water treatment plant.

    PubMed

    Yen, Hung-Kai; Lin, Tsair-Fuh; Tseng, I-Cheng

    2012-02-01

    Two molecular methods, denaturing gradient gel electrophoresis (DGGE) and quantitative real-time polymerase chain reaction (qPCR) with the Universal ProbeLibrary (UPL) probe, were developed and used for the characterization and quantification of several microcystin producers in Moo-Tan Reservoir (MTR), Taiwan and its associated water treatment plant (Shih-Men Water Treatment Plant, SMWTP). Internal transcribed spacer (ITS) sequence, a highly diversified region between the 16S rRNA and 23S rRNA genes, was used to further identify the isolated strains from MTR and also used in DGGE for the detection of the specific DNA fragments and biomarkers for 11 strains observed in MTR. These ITS-DGGE biomarkers were successfully applied to monitor the community changes of potential toxigenic Microcystis sp. over a period of five years. Two highly specific primers were combined with UPL probes to measure microcystins synthesis gene (mcyB) and phycocyanin intergenic spacer region (cpcB) concentrations in water samples. The copy concentrations of UPL-mcyB and UPL-cpcB correlated well with MC-RR concentrations/water temperature and Microcystis sp. cell numbers in the water samples, respectively. For SMWTP, toxin concentrations were low, but the DGGE bands clearly demonstrated the presence of potential microcystin producers in both water treatment plants and finished water samples. It was demonstrated that toxigenic Microcystis sp. may penetrate through the treatment processes and pose a potential risk to human health in the drinking water systems.

  18. A comparative kinetic RT/-PCR strategy for the quantitation of mRNAs in microdissected human renal biopsy specimens.

    PubMed

    Del Prete, D; Forino, M; Gambaro, G; D'Angelo, A; Baggio, B; Anglani, F

    1998-01-01

    Molecular biology techniques, to be applicable to a diagnostic renal biopsy specimen, should (1) be highly sensitive to be performed on a very small quantity of tissue; (2) be quantitative because they have to analyze genes normally expressed in the tissue and (3) allow the analysis of as large a number of genes as possible. Among different methods, only the reverse-transcriptase polymerase chain reaction (RT/-PCR) might comply with previous requisites, but the few RT/-PCR examples on renal biopsies in the literature do not allow starting RNA quantification and quality control; furthermore they have the drawback of analyzing only few genes. In an ongoing study to assess the expression of a number of genes in glomeruli and in tubulointerstitium of patients with different nephropathies, we developed a comparative RT/-PCR kinetic strategy based on the purification and quantification of total glomerular and tubulointerstitial RNA and on the use of an internal standard, the housekeeping gene G3PDH. We demonstrate that in microdissected diagnostic renal biopsies (1) glomerular and interstitial starting RNA can be quantified; (2) the G3PDH gene may be used both as an internal standard and as an indirect marker of RNA integrity; (3) as low as 28 ng of total RNA is sufficient to obtain PCR products of eight genes, and (4) it is worth to operate on microdissected biopsy specimens because of the different expression of genes in the two renal compartments.

  19. Isolation and Expression Profile of the Ca2+-Activated Chloride Channel-like Membrane Protein 6 Gene in Xenopus laevis

    PubMed Central

    Lee, Ra Mi; Ryu, Rae Hyung; Jeong, Seong Won; Oh, Soo Jin; Huang, Hue; Han, Jin Soo; Lee, Chi Ho; Lee, C. Justin; Jan, Lily Yeh

    2011-01-01

    To clone the first anion channel from Xenopus laevis (X. laevis), we isolated a calcium-activated chloride channel (CLCA)-like membrane protein 6 gene (CMP6) in X. laevis. As a first step in gene isolation, an expressed sequence tags database was screened to find the partial cDNA fragment. A putative partial cDNA sequence was obtained by comparison with rat CLCAs identified in our laboratory. First stranded cDNA was synthesized by reverse transcription polymerase-chain reaction (RT-PCR) using a specific primer designed for the target cDNA. Repeating the 5' and 3' rapid amplification of cDNA ends, full-length cDNA was constructed from the cDNA pool. The full-length CMP6 cDNA completed via 5'- and 3'-RACE was 2,940 bp long and had an open reading frame (ORF) of 940 amino acids. The predicted 940 polypeptides have four major transmembrane domains and showed about 50% identity with that of rat brain CLCAs in our previously published data. Semi-quantification analysis revealed that CMP6 was most abundantly expressed in small intestine, colon and liver. However, all tissues except small intestine, colon and liver had undetectable levels. This result became more credible after we did real-time PCR quantification for the target gene. In view of all CLCA studies focused on human or murine channels, this finding suggests a hypothetical protein as an ion channel, an X. laevis CLCA. PMID:21826170

  20. A survey of tools for the analysis of quantitative PCR (qPCR) data.

    PubMed

    Pabinger, Stephan; Rödiger, Stefan; Kriegner, Albert; Vierlinger, Klemens; Weinhäusel, Andreas

    2014-09-01

    Real-time quantitative polymerase-chain-reaction (qPCR) is a standard technique in most laboratories used for various applications in basic research. Analysis of qPCR data is a crucial part of the entire experiment, which has led to the development of a plethora of methods. The released tools either cover specific parts of the workflow or provide complete analysis solutions. Here, we surveyed 27 open-access software packages and tools for the analysis of qPCR data. The survey includes 8 Microsoft Windows, 5 web-based, 9 R-based and 5 tools from other platforms. Reviewed packages and tools support the analysis of different qPCR applications, such as RNA quantification, DNA methylation, genotyping, identification of copy number variations, and digital PCR. We report an overview of the functionality, features and specific requirements of the individual software tools, such as data exchange formats, availability of a graphical user interface, included procedures for graphical data presentation, and offered statistical methods. In addition, we provide an overview about quantification strategies, and report various applications of qPCR. Our comprehensive survey showed that most tools use their own file format and only a fraction of the currently existing tools support the standardized data exchange format RDML. To allow a more streamlined and comparable analysis of qPCR data, more vendors and tools need to adapt the standardized format to encourage the exchange of data between instrument software, analysis tools, and researchers.

  1. Faecal pollution along the southeastern coast of Florida and insight into the use of pepper mild mottle virus as an indicator.

    PubMed

    Symonds, E M; Sinigalliano, C; Gidley, M; Ahmed, W; McQuaig-Ulrich, S M; Breitbart, M

    2016-11-01

    To identify faecal pollution along the southeastern Florida coast and determine the performance of a reverse transcription-quantitative polymerase chain reaction (RT-qPCR) method for pepper mild mottle virus (PMMoV). In 2014, bimonthly surface water samples were collected from inlets, exposed to runoff and septic seepage, and coastal sites, exposed to ocean outfalls. Analysis of culturable enterococci and a suite of microbial source tracking (MST) markers (BacHum, CowM2, DogBact, HF183, HPyV, PMMoV) revealed faecal pollution, primarily of human origin, at all sites. Since PMMoV was detected more frequently than other MST markers, the process limits of quantification (undiluted to 10 -2 dilution) and detection (10 -2 dilution) for the RT-qPCR method were determined by seeding untreated wastewater into the coastal waters. Simulated quantitative microbial risk assessment, employing human norovirus as a reference pathogen, calculated a 0·286 median risk of gastrointestinal illness associated with the PMMoV limit of detection. All sites met the U.S. EPA recreational water criteria, despite detection of domestic wastewater-associated MST markers. PMMoV correlated only with human-associated MST markers. This study demonstrated that PMMoV is an important domestic wastewater-associated marker that should be included in the MST toolbox; therefore, future studies should thoroughly investigate the health risks associated with its detection and quantification in environmental waters. © 2016 The Society for Applied Microbiology.

  2. Use of Blood Smears and Dried Blood Spots for Polymerase Chain Reaction–Based Detection and Quantification of Bacterial Infection and Plasmodium falciparum in Severely Ill Febrile African Children

    PubMed Central

    Wihokhoen, Benchawan; Dondorp, Arjen M.; Turner, Paul; Woodrow, Charles J.; Imwong, Mallika

    2016-01-01

    Molecular approaches offer a means of testing archived samples stored as dried blood spots in settings where standard blood cultures are not possible. Peripheral blood films are one suggested source of material, although the sensitivity of this approach has not been well defined. Thin blood smears and dried blood spots from a severe pediatric malaria study were assessed using specific polymerase chain reaction (PCR) primers to detect non-typhoidal Salmonella (NTS; MisL gene), Streptococcus pneumoniae (lytA), and Plasmodium falciparum (18S rRNA). Of 16 cases of NTS and S. pneumoniae confirmed on blood culture, none were positive by PCR using DNA extracts from blood films or dried blood spots. In contrast, four of 36 dried blood spots and two of 178 plasma samples were PCR positive for S. pneumoniae, despite negative bacterial blood cultures, suggesting false positives. Quantitative assessment revealed that the effective concentration of P. falciparum DNA in blood films was three log orders of magnitude lower than for dried blood spots. The P. falciparum kelch13 gene could not be amplified from blood films. These findings question the value of blood PCR-based approaches for detection of NTS and S. pneumoniae, and show that stored blood films are an inefficient method of studying P. falciparum. PMID:26711525

  3. Portable gliadin-immunochip for contamination control on the food production chain.

    PubMed

    Chiriacò, Maria Serena; de Feo, Francesco; Primiceri, Elisabetta; Monteduro, Anna Grazia; de Benedetto, Giuseppe Egidio; Pennetta, Antonio; Rinaldi, Ross; Maruccio, Giuseppe

    2015-09-01

    Celiac disease (CD) is one of the most common digestive disorders caused by an abnormal immune reaction to gluten. So far there are no available therapies, the only solution is a strict gluten-free diet, which however could be very challenging as gluten can be hidden in many food products. Furthermore an additional problem is related to cross-contamination of nominal gluten-free foods with gluten-based ones during manufacturing. Here we propose a lab on chip platform as a powerful tool to help food manufacturers to evaluate the real amount of gluten in their products by an accurate in-situ control of the production chain and maybe to specify the real gluten content in packages labeling. Our portable gliadin-immunochips, based on an electrochemical impedance spectroscopy transduction method, were first calibrated and then validated for both liquid and solid food matrixes by analyzing different beers and flours. The high specificity of our assay was also demonstrated by performing control experiments on rice and potatoes flours containing prolamin-like proteins. We achieved limit of quantification of 0.5 ppm for gliadin that is 20 times lower than the worldwide limit established for gluten-free food while the method of analysis is faster and cheaper than currently employed ELISA-based methods. Moreover our results on food samples were validated through a mass spectrometry standard analysis. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  5. QUANTIFICATION OF FLUOROTELOMER-BASED CHEMICALS IN MAMMALIAN MATRICES BY MONITORING PERFLUOROALKYL CHAIN FRAGMENTS WITH GC/MS

    EPA Science Inventory

    Perfluorocarboxylic acids (PFCAs), namely perfluorooctanoic acid (PFOA) and perfluorononanoic acid (PFNA), have been identified as persistent, bioaccurnulative and potentially toxic compounds. The structural analog, 8-2 fluorotelomer alcohol (8-2 FTOH) is considered the probable ...

  6. Control and reduction of peak temperature in self-curing resins.

    PubMed

    Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A

    2009-07-01

    INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.

  7. Simultaneous quantification of alternatively spliced transcripts in a single droplet digital PCR reaction.

    PubMed

    Sun, Bing; Tao, Lian; Zheng, Yun-Ling

    2014-06-01

    Human telomerase reverse transcriptase (hTERT) is an essential component required for telomerase activity and telomere maintenance. Several alternatively spliced forms of hTERT mRNA have been reported in human primary and tumor cells. Currently, however, there is no sensitive and accurate method for the simultaneous quantification of multiple alternatively spliced RNA transcripts, such as in the case of hTERT. Here we show droplet digital PCR (ddPCR) provides sensitive, simultaneous digital quantification in a single reaction of two alternatively spliced single deletion hTERT transcripts (α-/β+ and α+/β-) as well as the opportunity to manually quantify non-deletion (α+/β+) and double deletion (α-/β-) transcripts. Our ddPCR method enables direct comparison among four alternatively spliced mRNAs without the need for internal standards or multiple primer pairs specific for each variant as real-time PCR (qPCR) requires, thus eliminating potential variation due to differences in PCR amplification efficiency.

  8. Neutron-Encoded Protein Quantification by Peptide Carbamylation

    NASA Astrophysics Data System (ADS)

    Ulbrich, Arne; Merrill, Anna E.; Hebert, Alexander S.; Westphall, Michael S.; Keller, Mark P.; Attie, Alan D.; Coon, Joshua J.

    2014-01-01

    We describe a chemical tag for duplex proteome quantification using neutron encoding (NeuCode). The method utilizes the straightforward, efficient, and inexpensive carbamylation reaction. We demonstrate the utility of NeuCode carbamylation by accurately measuring quantitative ratios from tagged yeast lysates mixed in known ratios and by applying this method to quantify differential protein expression in mice fed a either control or high-fat diet.

  9. Modeling competitive substitution in a polyelectrolyte complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu

    2015-12-28

    We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less

  10. Development of a Multiplexed Liquid Chromatography Multiple-Reaction-Monitoring Mass Spectrometry (LC-MRM/MS) Method for Evaluation of Salivary Proteins as Oral Cancer Biomarkers*

    PubMed Central

    Chen, Hsiao-Wei; Wu, Chun-Feng; Chu, Lichieh Julie; Chiang, Wei-Fang; Wu, Chih-Ching; Yu, Jau-Song; Tsai, Cheng-Han; Liang, Kung-Hao; Chang, Yu-Sun; Wu, Maureen; Ou Yang, Wei-Ting

    2017-01-01

    Multiple (selected) reaction monitoring (MRM/SRM) of peptides is a growing technology for target protein quantification because it is more robust, precise, accurate, high-throughput, and multiplex-capable than antibody-based techniques. The technique has been applied clinically to the large-scale quantification of multiple target proteins in different types of fluids. However, previous MRM-based studies have placed less focus on sample-preparation workflow and analytical performance in the precise quantification of proteins in saliva, a noninvasively sampled body fluid. In this study, we evaluated the analytical performance of a simple and robust multiple reaction monitoring (MRM)-based targeted proteomics approach incorporating liquid chromatography with mass spectrometry detection (LC-MRM/MS). This platform was used to quantitatively assess the biomarker potential of a group of 56 salivary proteins that have previously been associated with human cancers. To further enhance the development of this technology for assay of salivary samples, we optimized the workflow for salivary protein digestion and evaluated quantification performance, robustness and technical limitations in analyzing clinical samples. Using a clinically well-characterized cohort of two independent clinical sample sets (total n = 119), we quantitatively characterized these protein biomarker candidates in saliva specimens from controls and oral squamous cell carcinoma (OSCC) patients. The results clearly showed a significant elevation of most targeted proteins in saliva samples from OSCC patients compared with controls. Overall, this platform was capable of assaying the most highly multiplexed panel of salivary protein biomarkers, highlighting the clinical utility of MRM in oral cancer biomarker research. PMID:28235782

  11. Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

    PubMed

    Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

    2011-03-14

    Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Volatile Organic Silicon Compounds in Biogases: Development of Sampling and Analytical Methods for Total Silicon Quantification by ICP-OES

    PubMed Central

    Julien, Jennifer; Dumont, Nathalie; Lebouil, David; Germain, Patrick

    2014-01-01

    Current waste management policies favor biogases (digester gases (DGs) and landfill gases (LFGs)) valorization as it becomes a way for energy politics. However, volatile organic silicon compounds (VOSiCs) contained into DGs/LFGs severely damage combustion engines and endanger the conversion into electricity by power plants, resulting in a high purification level requirement. Assessing treatment efficiency is still difficult. No consensus has been reached to provide a standardized sampling and quantification of VOSiCs into gases because of their diversity, their physicochemical properties, and the omnipresence of silicon in analytical chains. Usually, samplings are done by adsorption or absorption and quantification made by gas chromatography-mass spectrometry (GC-MS) or inductively coupled plasma-optical emission spectrometry (ICP-OES). In this objective, this paper presents and discusses the optimization of a patented method consisting in VOSiCs sampling by absorption of 100% ethanol and quantification of total Si by ICP-OES. PMID:25379538

  13. Volatile organic silicon compounds in biogases: development of sampling and analytical methods for total silicon quantification by ICP-OES.

    PubMed

    Chottier, Claire; Chatain, Vincent; Julien, Jennifer; Dumont, Nathalie; Lebouil, David; Germain, Patrick

    2014-01-01

    Current waste management policies favor biogases (digester gases (DGs) and landfill gases (LFGs)) valorization as it becomes a way for energy politics. However, volatile organic silicon compounds (VOSiCs) contained into DGs/LFGs severely damage combustion engines and endanger the conversion into electricity by power plants, resulting in a high purification level requirement. Assessing treatment efficiency is still difficult. No consensus has been reached to provide a standardized sampling and quantification of VOSiCs into gases because of their diversity, their physicochemical properties, and the omnipresence of silicon in analytical chains. Usually, samplings are done by adsorption or absorption and quantification made by gas chromatography-mass spectrometry (GC-MS) or inductively coupled plasma-optical emission spectrometry (ICP-OES). In this objective, this paper presents and discusses the optimization of a patented method consisting in VOSiCs sampling by absorption of 100% ethanol and quantification of total Si by ICP-OES.

  14. Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

    PubMed

    Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

    2012-12-01

    Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  15. Silicon-based sleeve devices for chemical reactions

    DOEpatents

    Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

    1996-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  16. Silicon-based sleeve devices for chemical reactions

    DOEpatents

    Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

    1996-12-31

    A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

  17. Direct and Absolute Quantification of over 1800 Yeast Proteins via Selected Reaction Monitoring*

    PubMed Central

    Lawless, Craig; Holman, Stephen W.; Brownridge, Philip; Lanthaler, Karin; Harman, Victoria M.; Watkins, Rachel; Hammond, Dean E.; Miller, Rebecca L.; Sims, Paul F. G.; Grant, Christopher M.; Eyers, Claire E.; Beynon, Robert J.

    2016-01-01

    Defining intracellular protein concentration is critical in molecular systems biology. Although strategies for determining relative protein changes are available, defining robust absolute values in copies per cell has proven significantly more challenging. Here we present a reference data set quantifying over 1800 Saccharomyces cerevisiae proteins by direct means using protein-specific stable-isotope labeled internal standards and selected reaction monitoring (SRM) mass spectrometry, far exceeding any previous study. This was achieved by careful design of over 100 QconCAT recombinant proteins as standards, defining 1167 proteins in terms of copies per cell and upper limits on a further 668, with robust CVs routinely less than 20%. The selected reaction monitoring-derived proteome is compared with existing quantitative data sets, highlighting the disparities between methodologies. Coupled with a quantification of the transcriptome by RNA-seq taken from the same cells, these data support revised estimates of several fundamental molecular parameters: a total protein count of ∼100 million molecules-per-cell, a median of ∼1000 proteins-per-transcript, and a linear model of protein translation explaining 70% of the variance in translation rate. This work contributes a “gold-standard” reference yeast proteome (including 532 values based on high quality, dual peptide quantification) that can be widely used in systems models and for other comparative studies. PMID:26750110

  18. Automated muscle fiber type population analysis with ImageJ of whole rat muscles using rapid myosin heavy chain immunohistochemistry.

    PubMed

    Bergmeister, Konstantin D; Gröger, Marion; Aman, Martin; Willensdorfer, Anna; Manzano-Szalai, Krisztina; Salminger, Stefan; Aszmann, Oskar C

    2016-08-01

    Skeletal muscle consists of different fiber types which adapt to exercise, aging, disease, or trauma. Here we present a protocol for fast staining, automatic acquisition, and quantification of fiber populations with ImageJ. Biceps and lumbrical muscles were harvested from Sprague-Dawley rats. Quadruple immunohistochemical staining was performed on single sections using antibodies against myosin heavy chains and secondary fluorescent antibodies. Slides were scanned automatically with a slide scanner. Manual and automatic analyses were performed and compared statistically. The protocol provided rapid and reliable staining for automated image acquisition. Analyses between manual and automatic data indicated Pearson correlation coefficients for biceps of 0.645-0.841 and 0.564-0.673 for lumbrical muscles. Relative fiber populations were accurate to a degree of ± 4%. This protocol provides a reliable tool for quantification of muscle fiber populations. Using freely available software, it decreases the required time to analyze whole muscle sections. Muscle Nerve 54: 292-299, 2016. © 2016 Wiley Periodicals, Inc.

  19. Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

    PubMed

    Chen, Y T; Mercer, G O; Chen, Y

    1993-11-01

    Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

  20. Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

    PubMed

    Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

    2016-10-01

    The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

    PubMed

    Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

    2002-07-01

    Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

  2. Organic reactions mediated by electrochemically generated ArS+.

    PubMed

    Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi

    2011-04-21

    Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.

  3. qPCR (quantitative polymerase chain reaction) for the quantification of bacteriophages in stream water samples to investigate hydrological processes: a proof-of-concept study in the Huewelerbach experimental catchment (Luxembourg)

    NASA Astrophysics Data System (ADS)

    Antonelli, Marta; Narayanan Balasubramanian, Mukundh; Ogorzaly, Leslie; Pfister, Laurent

    2016-04-01

    Albeit recent technological developments (e.g. field deployable instruments operating at high temporal frequencies), experimental hydrology is a discipline that remains measurement limited. From this perspective, trans-disciplinary approaches may create valuable opportunities to enlarge the amount of tools available for investigating hydrological processes. Bacteriophages have been widely used in hydrology as biological tracer for investigating colloid transport and contamination of ground water systems. However, there are only a few studies focusing on the employability of bacteriophages as surface water tracers (i.e. phage transport, system functioning). Here, we present a proof-of-concept study carried out in the Huewelerbach catchment in Luxembourg in December 2015. The aim of this study was to investigate how viral particles can be used to detect hydrological connectivity between the riparian zone/river bank and the stream during rainfall events. Moreover, this study is one of the first attempts for applying the qPCR (quantitative polymerase chain reaction) technique for the quantification of bacteriophages in stream water samples to investigate hydrological processes. This technique is very sensitive and has a large dynamic range - enhancing ease and speed of phage detection. We used two different male-specific coliphages (GA phage, genogroup II and SP phage, genogroup IV). Two litres of GA phage were injected directly in the stream as a slug injection and two litres of SP phage were poured next to the river bank (alluvial deposition) close to the injection point. We also added NaCl (200 g) to both phage suspensions. We collected stream water samples 100 m and 500 m downstream (i.e. catchment outlet) of the injection point for one week. Phages were concentrated through ultracentrifugation of 100 ml of water sample followed by quantification via qPCR. Conductivity in stream water was monitored for the entire duration of the experiment. Discharge was monitored both immediately upstream of the injection point and at the catchment outlet. Preliminary results show that at the catchment outlet, the GA-phage injected in stream displayed almost complete mass recovery (~93 %), in contrast to the partial recovery (~12%) of the SP phage that was introduced on the river bank. Additionally, the amount of GA phages detected 100 m downstream of the injection point evolved back to its background level after six days. We could not observe a similar evolution for the SP phage. At the outlet, the amount of both phages did not return to background levels after six days. This can be due to a combined action of the occurrence of preferential flowpaths and the behaviour of colloids. During the monitored rain event we observed a dilution effect on both phages and a slight increase of the quantity of SP phage right after the peak of discharge. This finding suggests a release of viral particles from the river bank. Overall, we have demonstrated with this proof-of-concept study the value of phages as eco-hydrological tracer.

  4. High-Throughput Determination and Characterization of Short-, Medium-, and Long-Chain Chlorinated Paraffins in Human Blood.

    PubMed

    Li, Tong; Wan, Yi; Gao, Shixiong; Wang, Beili; Hu, Jianying

    2017-03-21

    The industrial chlorinated paraffins (CPs) are comprised of short-chain (SCCPs), medium chain (MCCPs), and long chain (LCCPs) CPs. Although SCCPs and MCCPs are environmentally ubiquitous, little is known about CPs in humans. This study established a method for simultaneous determination of 261 SCCP, MCCP, and LCCP congener groups in one injection by reversed ultrahigh-pressure liquid chromatography coupled with chlorine-enhanced electron spray ionization-quadrupole time-of-flight mass spectrometry. The method yielded good peak shapes, high sensitivities, and low coeluted interferences for all examined CPs. LCCPs with carbon numbers of 21 to 27 were detected in their standard technical mixtures, and MCCPs and LCCPs impurities were detected in the LCCP and MCCP standard technical mixtures, respectively, causing quantification deviations when these mixtures were used for calibration. After considering these impurities' contribution to the total concentrations, the quantification accuracies for ∑SCCPs, ∑MCCPs, and ∑LCCPs ranged from 95.1 ± 8.4% to 105.6 ± 9.2% in the eight CP technical mixtures. The method was successfully applied to determine CPs in about 6 g human blood samples from a general population, and estimated ∑SCCP, ∑MCCP, and ∑LCCP concentrations to be 370-35 000, 130-3200, and 22-530 ng/g lipid weight (n = 50), respectively. A comparison of blood and soil/air CP profiles from the same areas suggested a relatively higher potential for the accumulation of SCCPs, compared with MCCPs, in humans.

  5. Tissue Proteome Analysis of Different Grades of Human Gliomas Provides Major Cues for Glioma Pathogenesis.

    PubMed

    Gollapalli, Kishore; Ghantasala, Saicharan; Atak, Apurva; Rapole, Srikanth; Moiyadi, Aliasgar; Epari, Sridhar; Srivastava, Sanjeeva

    2017-05-01

    Gliomas are heterogeneous and most commonly occurring brain tumors. Blood-brain barrier restricts the entry of brain tumor proteins into blood stream thus limiting the usage of serum or plasma for proteomic analysis. Our study aimed at understanding the molecular basis of aggressiveness of various grades of brain tumors using isobaric tagging for relative and absolute quantification (iTRAQ) based mass spectrometry. Tissue proteomic analysis of various grades of gliomas was performed using four-plex iTRAQ. We labeled five sets (each set consists of control, grade-II, III, and IV tumor samples) of individual glioma patients using iTRAQ reagents. Significantly altered proteins were subjected to bioinformatics analysis using Database for Annotation, Visualization and Integrated Discovery (DAVID). Various metabolic pathways like glycolysis, TCA-cycle, electron transport chain, lactate metabolism, and blood coagulation pathways were majorly observed to be perturbed in gliomas. Most of the identified proteins involved in redox reactions, protein folding, pre-messenger RNA (mRNA) processing, antiapoptosis, and blood coagulation were found to be upregulated in gliomas. Transcriptomics data of glioblastoma multiforme (GBM), low-grade gliomas (LGGs), and controls were downloaded from The Cancer Genome Atlas (TCGA) data portal and further analyzed using BRB-Array tools. Expression levels of a few significantly altered proteins like lactate dehydrogenase, alpha-1 antitrypsin, fibrinogen alpha chain, nucleophosmin, annexin A5, thioredoxin, ferritin light chain, thymosin beta-4-like protein 3, superoxide dismutase-2, and peroxiredoxin-1 and 6 showed a positive correlation with increasing grade of gliomas thereby offering an insight into molecular basis behind their aggressive nature. Several proteins identified in different grades of gliomas are potential grade-specific markers, and perturbed pathways provide comprehensive overview of molecular cues involved in glioma pathogenesis.

  6. Surfactant-controlled polymerization of semiconductor clusters to quantum dots through competing step-growth and living chain-growth mechanisms.

    PubMed

    Evans, Christopher M; Love, Alyssa M; Weiss, Emily A

    2012-10-17

    This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.

  7. Kinetics of Chemical Reactions in Flames

    NASA Technical Reports Server (NTRS)

    Zeldovich, Y.; Semenov, N.

    1946-01-01

    In part I of the paper the theory of flame propagation is developed along the lines followed by Frank-Kamenetsky and one of the writers. The development of chain processes in flames is considered. A basis is given for the application of the method of stationary concentrations to reactions in flames; reactions with branching chains are analyzed. The case of a diffusion coefficient different from the coefficient of temperature conductivity is considered.

  8. Direct quantification of fatty acids in wet microalgal and yeast biomass via a rapid in situ fatty acid methyl ester derivatization approach.

    PubMed

    Dong, Tao; Yu, Liang; Gao, Difeng; Yu, Xiaochen; Miao, Chao; Zheng, Yubin; Lian, Jieni; Li, Tingting; Chen, Shulin

    2015-12-01

    Accurate determination of fatty acid contents is routinely required in microalgal and yeast biofuel studies. A method of rapid in situ fatty acid methyl ester (FAME) derivatization directly from wet fresh microalgal and yeast biomass was developed in this study. This method does not require prior solvent extraction or dehydration. FAMEs were prepared with a sequential alkaline hydrolysis (15 min at 85 °C) and acidic esterification (15 min at 85 °C) process. The resulting FAMEs were extracted into n-hexane and analyzed using gas chromatography. The effects of each processing parameter (temperature, reaction time, and water content) upon the lipids quantification in the alkaline hydrolysis step were evaluated with a full factorial design. This method could tolerate water content up to 20% (v/v) in total reaction volume, which equaled up to 1.2 mL of water in biomass slurry (with 0.05-25 mg of fatty acid). There were no significant differences in FAME quantification (p>0.05) between the standard AOAC 991.39 method and the proposed wet in situ FAME preparation method. This fatty acid quantification method is applicable to fresh wet biomass of a wide range of microalgae and yeast species.

  9. Protein turnover measurement using selected reaction monitoring-mass spectrometry (SRM-MS)

    PubMed Central

    Holman, Stephen W.; Hammond, Dean E.; Simpson, Deborah M.; Waters, John; Hurst, Jane L.

    2016-01-01

    Protein turnover represents an important mechanism in the functioning of cells, with deregulated synthesis and degradation of proteins implicated in many diseased states. Therefore, proteomics strategies to measure turnover rates with high confidence are of vital importance to understanding many biological processes. In this study, the more widely used approach of non-targeted precursor ion signal intensity (MS1) quantification is compared with selected reaction monitoring (SRM), a data acquisition strategy that records data for specific peptides, to determine if improved quantitative data would be obtained using a targeted quantification approach. Using mouse liver as a model system, turnover measurement of four tricarboxylic acid cycle proteins was performed using both MS1 and SRM quantification strategies. SRM outperformed MS1 in terms of sensitivity and selectivity of measurement, allowing more confident determination of protein turnover rates. SRM data are acquired using cheaper and more widely available tandem quadrupole mass spectrometers, making the approach accessible to a larger number of researchers than MS1 quantification, which is best performed on high mass resolution instruments. SRM acquisition is ideally suited to focused studies where the turnover of tens of proteins is measured, making it applicable in determining the dynamics of proteins complexes and complete metabolic pathways. This article is part of the themed issue ‘Quantitative mass spectrometry’. PMID:27644981

  10. ICPP: Identification and Quantification of Elementary Plasma Surface Processes during thin Film Growth

    NASA Astrophysics Data System (ADS)

    Keudell, A. V.

    2000-10-01

    The quantification of elementary plasma surface processes in glow discharges used for thin film deposition, is mandatory for a complete description of these low temperature plasmas. Since the surface to volume ratio in these discharge systems is often large, all particle densities in the discharge can be strongly influenced by any surface reactions. The identification and quantification of these surface processes will be illustrated for the plasma deposition of amorphous hydrogenated carbon films. A variety of experiments will be discussed ranging from plasma experiments using the cavity technique or ionization threshold mass spectrometry as well as a new class of experiments using quantified radical beams to quantify surface reactions in terms of sticking coefficients directly. It is shown that the reactivity of the hydrocarbon radicals depends strongly on the state of hybridization of the hydrocarbon growth precursor, and that the sticking coefficients for various hydrocarbon radicals are strongly influenced by the simultaneous interaction of several reactive species with the film surface. With the knowledge of these interaction mechanisms and the quantification of the corresponding cross sections, a better understanding of growth processes has become possible, ranging from the deposition of polycrystalline diamond in microwave discharges to the formation of re-deposited layers in fusion experiments.

  11. Multiplex quantification of four DNA targets in one reaction with Bio-Rad droplet digital PCR system for GMO detection

    PubMed Central

    Dobnik, David; Štebih, Dejan; Blejec, Andrej; Morisset, Dany; Žel, Jana

    2016-01-01

    The advantages of the digital PCR technology are already well documented until now. One way to achieve better cost efficiency of the technique is to use it in a multiplexing strategy. Droplet digital PCR platforms, which include two fluorescence filters, support at least duplex reactions and with some developments and optimization higher multiplexing is possible. The present study not only shows a development of multiplex assays in droplet digital PCR, but also presents a first thorough evaluation of several parameters in such multiplex digital PCR. Two 4-plex assays were developed for quantification of 8 different DNA targets (7 genetically modified maize events and maize endogene). Per assay, two of the targets were labelled with one fluorophore and two with another. As current analysis software does not support analysis of more than duplex, a new R- and Shiny-based web application analysis tool (http://bit.ly/ddPCRmulti) was developed that automates the analysis of 4-plex results. In conclusion, the two developed multiplex assays are suitable for quantification of GMO maize events and the same approach can be used in any other field with a need for accurate and reliable quantification of multiple DNA targets. PMID:27739510

  12. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    USDA-ARS?s Scientific Manuscript database

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  13. [Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

    PubMed

    Wang, F; Zhang, Y Q; Ding, J; Yu, L X

    2017-10-18

    To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

  14. Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

    PubMed

    Igarashi, T; Yamamoto, A; Goto, N

    1996-10-01

    Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

  15. Structure–Function Studies of Hydrophobic Residues That Clamp a Basic Glutamate Side Chain during Catalysis by Triosephosphate Isomerase

    PubMed Central

    2016-01-01

    Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328

  16. Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates.

    PubMed

    Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M

    2013-03-28

    This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

  17. Microfabricated electrochemiluminescence cell for chemical reaction detection

    DOEpatents

    Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

    2003-01-01

    A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  18. Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions

    NASA Astrophysics Data System (ADS)

    Zlokazov, V. B.; Utyonkov, V. K.

    2017-07-01

    The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.

  19. Determination of citrus limonoid glucosides by high performance liquid chromatography coupled to post-column reaction with Ehrlich’s Reagent

    USDA-ARS?s Scientific Manuscript database

    A method for the identification and quantification of citrus limonoid glucosides in juices based upon high performance liquid chromatography (HPLC) separation coupled to post-column reaction with Ehrlichs’s reagent has been developed. This method utilizes a phenyl stationary phase and an isocratic ...

  20. A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

    NASA Astrophysics Data System (ADS)

    Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua

    2017-08-01

    Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.

  1. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  2. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  3. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  4. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    EPA Science Inventory

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  5. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    USDA-ARS?s Scientific Manuscript database

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  6. Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

    PubMed

    Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

    2005-03-01

    We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

  7. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  8. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  9. Kinetics of Reactive Fronts in Porous Media: quantification through a laboratory experiment

    NASA Astrophysics Data System (ADS)

    De Anna, P.; Jimenez-Martinez, J.; Turuban, R.; Tabuteau, H.; Derrien, M.; Le Borgne, T.; Meheust, Y.

    2013-12-01

    The kinetics of reaction fronts in heterogeneous flows is tightly linked to the mixing dynamics governed by the combined action of stretching, diffusion and dispersion. Focusing on porous media flows, with a new experimental setup we show that the invading solute is organized into stretched lamellae, whose deformation and coalescence control the effective reaction kinetics of the mixing limited bimolecular reaction A + B --> C. While the classic advection-dispersion theory predicts a scaling of the cumulative product mass of C as t^(0.5), we observe two distinct kinetics regimes, one characterized by the stretching and the other by the coalescence of the invading lamellae, in which the mass of C scales faster than t^(0.5). The proposed experimental set up allows for direct quantification of mixing and reactive transport in porous media with a high spatial resolution, at the pore scale. The analogous two dimensional porous medium consists in a Hele-Shaw cell containing a single layer of cylindrical solid grains built by soft lithography. On the one hand, the measurement of the local, intra-pore, conservative concentration field is done using a fluorescent tracer. On the other hand, considering a fast bimolecular advection-dispersion reaction A + B --> C occurring as A displaces B, we quantify the reaction kinetics from the spatially-resolved measurement of the pore scale reaction rate, using a chemiluminescent reaction.

  10. A fluorescence-based thiol quantification assay for ultra-high-throughput screening for inhibitors of coenzyme A production.

    PubMed

    Chung, Christine C; Ohwaki, Kenji; Schneeweis, Jonathan E; Stec, Erica; Varnerin, Jeffrey P; Goudreau, Paul N; Chang, Amy; Cassaday, Jason; Yang, Lihu; Yamakawa, Takeru; Kornienko, Oleg; Hodder, Peter; Inglese, James; Ferrer, Marc; Strulovici, Berta; Kusunoki, Jun; Tota, Michael R; Takagi, Toshimitsu

    2008-06-01

    Here we report the development and miniaturization of a cell-free enzyme assay for ultra-high-throughput screening (uHTS) for inhibitors of two potential drug targets for obesity and cancer: fatty acid synthase (FAS) and acetyl-coenzyme A (CoA) carboxylase (ACC) 2. This assay detects CoA, a product of the FAS-catalyzed condensation of malonyl-CoA and acetyl-CoA. The free thiol of CoA can react with 7-diethylamino-3-(4'-maleimidylphenyl)-4-methylcoumarin (CPM), a profluorescent coumarin maleimide derivative that becomes fluorescent upon reaction with thiols. FAS produces long-chain fatty acid and CoA from the condensation of malonyl-CoA and acetyl-CoA. In our FAS assay, CoA released in the FAS reaction forms a fluorescence adduct with CPM that emits at 530 nm when excited at 405 nm. Using this detection method for CoA, we measured the activity of sequential enzymes in the fatty acid synthesis pathway to develop an ACC2/FAS-coupled assay where ACC2 produces malonyl-CoA from acetyl-CoA. We miniaturized the FAS and ACC2/FAS assays to 3,456- and 1,536-well plate format, respectively, and completed uHTSs for small molecule inhibitors of this enzyme system. This report shows the results of assay development, miniaturization, and inhibitor screening for these potential drug targets.

  11. Innovative qPCR using interfacial effects to enable low threshold cycle detection and inhibition relief

    PubMed Central

    Harshman, Dustin K.; Rao, Brianna M.; McLain, Jean E.; Watts, George S.; Yoon, Jeong-Yeol

    2015-01-01

    Molecular diagnostics offers quick access to information but fails to operate at a speed required for clinical decision-making. Our novel methodology, droplet-on-thermocouple silhouette real-time polymerase chain reaction (DOTS qPCR), uses interfacial effects for droplet actuation, inhibition relief, and amplification sensing. DOTS qPCR has sample-to-answer times as short as 3 min 30 s. In infective endocarditis diagnosis, DOTS qPCR demonstrates reproducibility, differentiation of antibiotic susceptibility, subpicogram limit of detection, and thermocycling speeds of up to 28 s/cycle in the presence of tissue contaminants. Langmuir and Gibbs adsorption isotherms are used to describe the decreasing interfacial tension upon amplification. Moreover, a log-linear relationship with low threshold cycles is presented for real-time quantification by imaging the droplet-on-thermocouple silhouette with a smartphone. DOTS qPCR resolves several limitations of commercially available real-time PCR systems, which rely on fluorescence detection, have substantially higher threshold cycles, and require expensive optical components and extensive sample preparation. Due to the advantages of low threshold cycle detection, we anticipate extending this technology to biological research applications such as single cell, single nucleus, and single DNA molecule analyses. Our work is the first demonstrated use of interfacial effects for sensing reaction progress, and it will enable point-of-care molecular diagnosis of infections. PMID:26601245

  12. Selected reaction monitoring as an effective method for reliable quantification of disease-associated proteins in maple syrup urine disease.

    PubMed

    Fernández-Guerra, Paula; Birkler, Rune I D; Merinero, Begoña; Ugarte, Magdalena; Gregersen, Niels; Rodríguez-Pombo, Pilar; Bross, Peter; Palmfeldt, Johan

    2014-09-01

    Selected reaction monitoring (SRM) mass spectrometry can quantitatively measure proteins by specific targeting of peptide sequences, and allows the determination of multiple proteins in one single analysis. Here, we show the feasibility of simultaneous measurements of multiple proteins in mitochondria-enriched samples from cultured fibroblasts from healthy individuals and patients with mutations in branched-chain α-ketoacid dehydrogenase (BCKDH) complex. BCKDH is a mitochondrial multienzyme complex and its defective activity causes maple syrup urine disease (MSUD), a rare but severe inherited metabolic disorder. Four different genes encode the catalytic subunits of BCKDH: E1α (BCKDHA), E1β (BCKDHB), E2 (DBT), and E3 (DLD). All four proteins were successfully quantified in healthy individuals. However, the E1α and E1β proteins were not detected in patients carrying mutations in one of those genes, whereas mRNA levels were almost unaltered, indicating instability of E1α and E1β monomers. Using SRM we elucidated the protein effects of mutations generating premature termination codons or misfolded proteins. SRM is a complement to transcript level measurements and a valuable tool to shed light on molecular mechanisms and on effects of pharmacological therapies at protein level. SRM is particularly effective for inherited disorders caused by multiple proteins such as defects in multienzyme complexes.

  13. Selected reaction monitoring as an effective method for reliable quantification of disease-associated proteins in maple syrup urine disease

    PubMed Central

    Fernández-Guerra, Paula; Birkler, Rune I D; Merinero, Begoña; Ugarte, Magdalena; Gregersen, Niels; Rodríguez-Pombo, Pilar; Bross, Peter; Palmfeldt, Johan

    2014-01-01

    Selected reaction monitoring (SRM) mass spectrometry can quantitatively measure proteins by specific targeting of peptide sequences, and allows the determination of multiple proteins in one single analysis. Here, we show the feasibility of simultaneous measurements of multiple proteins in mitochondria-enriched samples from cultured fibroblasts from healthy individuals and patients with mutations in branched-chain α-ketoacid dehydrogenase (BCKDH) complex. BCKDH is a mitochondrial multienzyme complex and its defective activity causes maple syrup urine disease (MSUD), a rare but severe inherited metabolic disorder. Four different genes encode the catalytic subunits of BCKDH: E1α (BCKDHA), E1β (BCKDHB), E2 (DBT), and E3 (DLD). All four proteins were successfully quantified in healthy individuals. However, the E1α and E1β proteins were not detected in patients carrying mutations in one of those genes, whereas mRNA levels were almost unaltered, indicating instability of E1α and E1β monomers. Using SRM we elucidated the protein effects of mutations generating premature termination codons or misfolded proteins. SRM is a complement to transcript level measurements and a valuable tool to shed light on molecular mechanisms and on effects of pharmacological therapies at protein level. SRM is particularly effective for inherited disorders caused by multiple proteins such as defects in multienzyme complexes. PMID:25333063

  14. Continuous flow real-time PCR device using multi-channel fluorescence excitation and detection.

    PubMed

    Hatch, Andrew C; Ray, Tathagata; Lintecum, Kelly; Youngbull, Cody

    2014-02-07

    High throughput automation is greatly enhanced using techniques that employ conveyor belt strategies with un-interrupted streams of flow. We have developed a 'conveyor belt' analog for high throughput real-time quantitative Polymerase Chain Reaction (qPCR) using droplet emulsion technology. We developed a low power, portable device that employs LED and fiber optic fluorescence excitation in conjunction with a continuous flow thermal cycler to achieve multi-channel fluorescence detection for real-time fluorescence measurements. Continuously streaming fluid plugs or droplets pass through tubing wrapped around a two-temperature zone thermal block with each wrap of tubing fluorescently coupled to a 64-channel multi-anode PMT. This work demonstrates real-time qPCR of 0.1-10 μL droplets or fluid plugs over a range of 7 orders of magnitude concentration from 1 × 10(1) to 1 × 10(7). The real-time qPCR analysis allows dynamic range quantification as high as 1 × 10(7) copies per 10 μL reaction, with PCR efficiencies within the range of 90-110% based on serial dilution assays and a limit of detection of 10 copies per rxn. The combined functionality of continuous flow, low power thermal cycling, high throughput sample processing, and real-time qPCR improves the rates at which biological or environmental samples can be continuously sampled and analyzed.

  15. Occurrence and quantification of Shiga toxin-producing Escherichia coli from food matrices

    PubMed Central

    Sethulekshmi, C.; Latha, C.; Anu, C. J.

    2018-01-01

    Aim: The objective of the study was to detect Shiga toxin-producing Escherichia coli (STEC) and develop a quantitative polymerase chain reaction (qPCR) assay to quantify the bacterial DNA present in different food matrices. Materials and Methods: A total of 758 samples were collected during a period from January 2015 to December 2016 from Kozhikode, Thrissur, and Alappuzha districts of Kerala. The samples consisted of raw milk (135), pasteurized milk (100), beef (132), buffalo meat (130), chevon (104), beef kheema (115), and beef sausage (42). All the samples collected were subjected to isolation and identification of STEC by conventional culture technique. Confirmation of virulence genes was carried out using PCR. For the quantification of STEC in different food matrices, a qPCR was standardized against stx1 gene of STEC by the construction of standard curve using SYBR green chemistry. Results: The overall occurrence of STEC in raw milk (n=135), beef (n=132), buffalo meat (n=130), chevon (n=104), and beef kheema (n=115) samples collected from Kozhikode, Thrissur, and Alappuzha districts of Kerala was 19.26%, 41.6%, 16.92%, 28.85%, and 41.74%, respectively. PCR revealed the presence of stx 1 and stx 2 genes in 88.46 and 83.64 and 30.77 and 40.00% of STEC isolates from raw milk and beef samples, respectively, while 100% of the STEC isolates from buffalo beef and beef kheema samples carried stx 1 gene. Real-time qPCR assay was used to quantify the bacterial cells present in different food matrices. The standard curve was developed, and the slopes, intercept, and R2 of linear regression curves were −3.10, 34.24, and 0.99, respectively. Conclusion: The considerably high occurrence of STEC in the study confirms the importance of foods of animal origin as a vehicle of infection to humans. In the present study, on comparing the overall occurrence of STEC, the highest percentage of occurrence was reported in beef kheema samples. The study shows the need for rigid food safety measures to combat the potential pathogenic effects of harmful bacteria throughout the production chain from production to consumption. PMID:29657388

  16. Development of a Multiplexed Liquid Chromatography Multiple-Reaction-Monitoring Mass Spectrometry (LC-MRM/MS) Method for Evaluation of Salivary Proteins as Oral Cancer Biomarkers.

    PubMed

    Chen, Yi-Ting; Chen, Hsiao-Wei; Wu, Chun-Feng; Chu, Lichieh Julie; Chiang, Wei-Fang; Wu, Chih-Ching; Yu, Jau-Song; Tsai, Cheng-Han; Liang, Kung-Hao; Chang, Yu-Sun; Wu, Maureen; Ou Yang, Wei-Ting

    2017-05-01

    Multiple (selected) reaction monitoring (MRM/SRM) of peptides is a growing technology for target protein quantification because it is more robust, precise, accurate, high-throughput, and multiplex-capable than antibody-based techniques. The technique has been applied clinically to the large-scale quantification of multiple target proteins in different types of fluids. However, previous MRM-based studies have placed less focus on sample-preparation workflow and analytical performance in the precise quantification of proteins in saliva, a noninvasively sampled body fluid. In this study, we evaluated the analytical performance of a simple and robust multiple reaction monitoring (MRM)-based targeted proteomics approach incorporating liquid chromatography with mass spectrometry detection (LC-MRM/MS). This platform was used to quantitatively assess the biomarker potential of a group of 56 salivary proteins that have previously been associated with human cancers. To further enhance the development of this technology for assay of salivary samples, we optimized the workflow for salivary protein digestion and evaluated quantification performance, robustness and technical limitations in analyzing clinical samples. Using a clinically well-characterized cohort of two independent clinical sample sets (total n = 119), we quantitatively characterized these protein biomarker candidates in saliva specimens from controls and oral squamous cell carcinoma (OSCC) patients. The results clearly showed a significant elevation of most targeted proteins in saliva samples from OSCC patients compared with controls. Overall, this platform was capable of assaying the most highly multiplexed panel of salivary protein biomarkers, highlighting the clinical utility of MRM in oral cancer biomarker research. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST

    PubMed Central

    Keil, Harry; Wasserman, David; Dawson, Charles R.

    1944-01-01

    1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415

  18. THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST.

    PubMed

    Keil, H; Wasserman, D; Dawson, C R

    1944-10-01

    1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.

  19. Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

    PubMed Central

    deWit, D; Wootton, M; Allan, B; Steyn, L

    1993-01-01

    A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

  20. Quantification of transcriptome responses of the rumen epithelium to butyrate infusion

    USDA-ARS?s Scientific Manuscript database

    Short-chain fatty acids (SCFAs), such as butyrate, produced by gut microorganisms play an important role in energy metabolism and physiology in ruminants as well as in human health. Butyrate is a preferred substrate in the rumen epithelium where approximately 90% of butyrate is metabolized. Additi...

  1. Microfabricated sleeve devices for chemical reactions

    DOEpatents

    Northrup, M. Allen

    2003-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  2. Quantitative Proteomics via High Resolution MS Quantification: Capabilities and Limitations

    PubMed Central

    Higgs, Richard E.; Butler, Jon P.; Han, Bomie; Knierman, Michael D.

    2013-01-01

    Recent improvements in the mass accuracy and resolution of mass spectrometers have led to renewed interest in label-free quantification using data from the primary mass spectrum (MS1) acquired from data-dependent proteomics experiments. The capacity for higher specificity quantification of peptides from samples enriched for proteins of biological interest offers distinct advantages for hypothesis generating experiments relative to immunoassay detection methods or prespecified peptide ions measured by multiple reaction monitoring (MRM) approaches. Here we describe an evaluation of different methods to post-process peptide level quantification information to support protein level inference. We characterize the methods by examining their ability to recover a known dilution of a standard protein in background matrices of varying complexity. Additionally, the MS1 quantification results are compared to a standard, targeted, MRM approach on the same samples under equivalent instrument conditions. We show the existence of multiple peptides with MS1 quantification sensitivity similar to the best MRM peptides for each of the background matrices studied. Based on these results we provide recommendations on preferred approaches to leveraging quantitative measurements of multiple peptides to improve protein level inference. PMID:23710359

  3. Enzymatic preparation of structured oils containing short-chain fatty acids.

    PubMed

    Kanda, Ayato; Namiki, Fusako; Hara, Setsuko

    2010-01-01

    Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.

  4. An ab initio molecular dynamics and density functional theory study of the formation of phosphate chains from metathiophosphates.

    PubMed

    Mosey, Nicholas J; Woo, Tom K

    2006-09-04

    The reactions that occur between metathiophosphate (MTP) molecules are identified and examined through ab initio molecular dynamics simulations and static quantum chemical calculations at the density functional level of theory. The simulations show that certain types of MTPs can react to yield phosphate chains, while others only dimerize. These differences are rationalized in terms of reaction energies and the electronic structures of these molecules. In the reaction leading to the formation of phosphate chains, the reactive center, a tri-coordinate phosphorus atom, is continually regenerated. A polymerization mechanism linking MTPs to phosphate chains is developed on the basis of these results. This information sheds light on the underlying processes that may be responsible for the formation of phosphates under high-temperature conditions and may prove useful in the development of protocols for the rational synthesis of complex phosphate structures.

  5. DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

    EPA Science Inventory

    The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

  6. 29 CFR 1910.155 - Scope, application and definitions applicable to this subpart.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... by inhibiting the chemical chain reaction of fuel and oxygen. It is also known as...F3) which is a medium for extinguishing fires by inhibiting the chemical chain reaction of fuel and..., odorless, electrically nonconductive inert gas (chemical formula CO2) that is a medium for extinguishing...

  7. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    ERIC Educational Resources Information Center

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  8. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  9. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    USDA-ARS?s Scientific Manuscript database

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  10. Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.

    PubMed

    Borkar, Santosh Ramdas; Aidhen, Indrapal Singh

    2017-04-18

    Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.

  11. Multi-scale modeling of diffusion-controlled reactions in polymers: renormalisation of reactivity parameters.

    PubMed

    Everaers, Ralf; Rosa, Angelo

    2012-01-07

    The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.

  12. A New Method to Develop Human Dental Pulp Cells and Platelet-rich Fibrin Complex.

    PubMed

    He, Xuan; Chen, Wen-Xia; Ban, Guifei; Wei, Wei; Zhou, Jun; Chen, Wen-Jin; Li, Xian-Yu

    2016-11-01

    Platelet-rich fibrin (PRF) has been used as a scaffold material in various tissue regeneration studies. In the previous methods to combine seed cells with PRF, the structure of PRF was damaged, and the manipulation time in vitro was also increased. The objective of this in vitro study was to explore an appropriate method to develop a PRF-human dental pulp cell (hDPC) complex to maintain PRF structure integrity and to find out the most efficient part of PRF. The PRF-hDPC complex was developed at 3 different time points during PRF preparation: (1) the before centrifugation (BC) group, the hDPC suspension was added to the venous blood before blood centrifugation; (2) the immediately after centrifugation (IAC) group, the hDPC suspension was added immediately after blood centrifugation; (3) the after centrifugation (AC) group, the hDPC suspension was added 10 minutes after blood centrifugation; and (4) the control group, PRF without hDPC suspension. The prepared PRF-hDPC complexes were cultured for 7 days. The samples were fixed for histologic, immunohistochemistry, and scanning electron microscopic evaluation. Real-time polymerase chain reaction was performed to evaluate messenger RNA expression of alkaline phosphatase and dentin sialophosphoprotein. Enzyme-linked immunosorbent assay quantification for growth factors was performed within the different parts of the PRF. Histologic, immunohistochemistry, and scanning electron microscopic results revealed that hDPCs were only found in the BC group and exhibited favorable proliferation. Real-time polymerase chain reaction revealed that alkaline phosphatase and dentin sialophosphoprotein expression increased in the cultured PRF-hDPC complex. The lower part of the PRF released the maximum quantity of growth factors. Our new method to develop a PRF-hDPCs complex maintained PRF structure integrity. The hDPCs were distributed in the buffy coat, which might be the most efficient part of PRF. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  13. Evaluation of Pneumococcal Load in Blood by Polymerase Chain Reaction for the Diagnosis of Pneumococcal Pneumonia in Young Children in the PERCH Study.

    PubMed

    Deloria Knoll, Maria; Morpeth, Susan C; Scott, J Anthony G; Watson, Nora L; Park, Daniel E; Baggett, Henry C; Brooks, W Abdullah; Feikin, Daniel R; Hammitt, Laura L; Howie, Stephen R C; Kotloff, Karen L; Levine, Orin S; O'Brien, Katherine L; Thea, Donald M; Ahmed, Dilruba; Antonio, Martin; Awori, Juliet O; Baillie, Vicky L; Chipeta, James; Deluca, Andrea N; Dione, Michel; Driscoll, Amanda J; Higdon, Melissa M; Jatapai, Anchalee; Karron, Ruth A; Mazumder, Razib; Moore, David P; Mwansa, James; Nyongesa, Sammy; Prosperi, Christine; Seidenberg, Phil; Siludjai, Duangkamon; Sow, Samba O; Tamboura, Boubou; Zeger, Scott L; Murdoch, David R; Madhi, Shabir A

    2017-06-15

    Detection of pneumococcus by lytA polymerase chain reaction (PCR) in blood had poor diagnostic accuracy for diagnosing pneumococcal pneumonia in children in 9 African and Asian sites. We assessed the value of blood lytA quantification in diagnosing pneumococcal pneumonia. The Pneumonia Etiology Research for Child Health (PERCH) case-control study tested whole blood by PCR for pneumococcus in children aged 1-59 months hospitalized with signs of pneumonia and in age-frequency matched community controls. The distribution of load among PCR-positive participants was compared between microbiologically confirmed pneumococcal pneumonia (MCPP) cases, cases confirmed for nonpneumococcal pathogens, nonconfirmed cases, and controls. Receiver operating characteristic analyses determined the "optimal threshold" that distinguished MCPP cases from controls. Load was available for 290 of 291 cases with pneumococcal PCR detected in blood and 273 of 273 controls. Load was higher in MCPP cases than controls (median, 4.0 × 103 vs 0.19 × 103 copies/mL), but overlapped substantially (range, 0.16-989.9 × 103 copies/mL and 0.01-551.9 × 103 copies/mL, respectively). The proportion with high load (≥2.2 log10 copies/mL) was 62.5% among MCPP cases, 4.3% among nonconfirmed cases, 9.3% among cases confirmed for a nonpneumococcal pathogen, and 3.1% among controls. Pneumococcal load in blood was not associated with respiratory tract illness in controls (P = .32). High blood pneumococcal load was associated with alveolar consolidation on chest radiograph in nonconfirmed cases, and with high (>6.9 log10 copies/mL) nasopharyngeal/oropharyngeal load and C-reactive protein ≥40 mg/L (both P < .01) in nonconfirmed cases but not controls. Quantitative pneumococcal PCR in blood has limited diagnostic utility for identifying pneumococcal pneumonia in individual children, but may be informative in epidemiological studies. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  14. Establishment of a real-time PCR method for quantification of geosmin-producing Streptomyces spp. in recirculating aquaculture systems.

    PubMed

    Auffret, Marc; Pilote, Alexandre; Proulx, Emilie; Proulx, Daniel; Vandenberg, Grant; Villemur, Richard

    2011-12-15

    Geosmin and 2-methylisoborneol (MIB) have been associated with off-flavour problems in fish and seafood products, generating a strong negative impact for aquaculture industries. Although most of the producers of geosmin and MIB have been identified as Streptomyces species or cyanobacteria, Streptomyces spp. are thought to be responsible for the synthesis of these compounds in indoor recirculating aquaculture systems (RAS). The detection of genes involved in the synthesis of geosmin and MIB can be a relevant indicator of the beginning of off-flavour events in RAS. Here, we report a real-time polymerase chain reaction (qPCR) protocol targeting geoA sequences that encode a germacradienol synthase involved in geosmin synthesis. New geoA-related sequences were retrieved from eleven geosmin-producing Actinomycete strains, among them two Streptomyces strains isolated from two RAS. Combined with geoA-related sequences available in gene databases, we designed primers and standards suitable for qPCR assays targeting mainly Streptomyces geoA. Using our qPCR protocol, we succeeded in measuring the level of geoA copies in sand filter and biofilters in two RAS. This study is the first to apply qPCR assays to detect and quantify the geosmin synthesis gene (geoA) in RAS. Quantification of geoA in RAS could permit the monitoring of the level of geosmin producers prior to the occurrence of geosmin production. This information will be most valuable for fish producers to manage further development of off-flavour events. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Role of microRNA-7 and selenoprotein P in hepatocellular carcinoma.

    PubMed

    Tarek, Marwa; Louka, Manal Louis; Khairy, Eman; Ali-Labib, Randa; Zakaria Zaky, Doaa; Montasser, Iman F

    2017-05-01

    There is an obvious need to diagnose hepatocellular carcinoma using novel non-invasive and sensitive biomarkers. In this regard, the aim of this study was to evaluate and correlate both relative quantification of microRNA-7 using quantitative real time polymerase chain reaction and quantitative analysis of selenoprotein P using enzyme-linked immunosorbent assay in sera of hepatocellular carcinoma patients, chronic liver disease patients, as well as normal healthy subjects in order to establish a new diagnostic biomarker with a valid non-invasive technique. In addition, this study aimed to investigate whether changes in selenium supply affect microRNA-7 expression and selenoprotein P levels in human hepatocarcinoma cell line (HepG2). The results showed a highly significant decrease in serum microRNA-7 relative quantification values and selenoprotein P levels in malignant group in comparison with benign and control groups. The best cutoff for serum microRNA-7 and selenoprotein P to discriminate hepatocellular carcinoma group from benign and control groups was 0.06 and 4.30 mg/L, respectively. Furthermore, this study showed that changes in selenium supply to HepG2 cell line can alter the microRNA-7 profile and are paralleled by changes in the concentration of its target protein (selenoprotein P). Hence, serum microRNA-7 and selenoprotein P appear to be potential non-invasive diagnostic markers for hepatocellular carcinoma. Moreover, the results suggest that selenium could be used as an anticancer therapy for hepatocellular carcinoma by affecting both microRNA-7 and selenoprotein P.

  16. chipPCR: an R package to pre-process raw data of amplification curves.

    PubMed

    Rödiger, Stefan; Burdukiewicz, Michał; Schierack, Peter

    2015-09-01

    Both the quantitative real-time polymerase chain reaction (qPCR) and quantitative isothermal amplification (qIA) are standard methods for nucleic acid quantification. Numerous real-time read-out technologies have been developed. Despite the continuous interest in amplification-based techniques, there are only few tools for pre-processing of amplification data. However, a transparent tool for precise control of raw data is indispensable in several scenarios, for example, during the development of new instruments. chipPCR is an R: package for the pre-processing and quality analysis of raw data of amplification curves. The package takes advantage of R: 's S4 object model and offers an extensible environment. chipPCR contains tools for raw data exploration: normalization, baselining, imputation of missing values, a powerful wrapper for amplification curve smoothing and a function to detect the start and end of an amplification curve. The capabilities of the software are enhanced by the implementation of algorithms unavailable in R: , such as a 5-point stencil for derivative interpolation. Simulation tools, statistical tests, plots for data quality management, amplification efficiency/quantification cycle calculation, and datasets from qPCR and qIA experiments are part of the package. Core functionalities are integrated in GUIs (web-based and standalone shiny applications), thus streamlining analysis and report generation. http://cran.r-project.org/web/packages/chipPCR. Source code: https://github.com/michbur/chipPCR. stefan.roediger@b-tu.de Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. Temperature control apparatus

    DOEpatents

    Northrup, M. Allen

    2003-08-05

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  18. Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

    PubMed

    Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

    2014-01-01

    Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  19. Metagenomic investigation of gastrointestinal microbiome in cattle

    PubMed Central

    Kim, Minseok; Park, Tansol; Yu, Zhongtang

    2017-01-01

    The gastrointestinal (GI) tract, including the rumen and the other intestinal segments of cattle, harbors a diverse, complex, and dynamic microbiome that drives feed digestion and fermentation in cattle, determining feed efficiency and output of pollutants. This microbiome also plays an important role in affecting host health. Research has been conducted for more than a century to understand the microbiome and its relationship to feed efficiency and host health. The traditional cultivation-based research elucidated some of the major metabolism, but studies using molecular biology techniques conducted from late 1980’s to the late early 2000’s greatly expanded our view of the diversity of the rumen and intestinal microbiome of cattle. Recently, metagenomics has been the primary technology to characterize the GI microbiome and its relationship with host nutrition and health. This review addresses the main methods/techniques in current use, the knowledge gained, and some of the challenges that remain. Most of the primers used in quantitative real-time polymerase chain reaction quantification and diversity analysis using metagenomics of ruminal bacteria, archaea, fungi, and protozoa were also compiled. PMID:28830126

  20. Expression profile of Lgi1 gene in mouse brain during development.

    PubMed

    Ribeiro, Patrícia A O; Sbragia, Lourenço; Gilioli, Rovilson; Langone, Francesco; Conte, Fábio F; Lopes-Cendes, Iscia

    2008-07-01

    Mutations in LGI1 were described in patients with autosomal dominant partial epilepsy with auditory features (ADPEAF), and recent clinical findings have implicated LGI1 in human brain development. However, the precise role of LGI1 in epileptogenesis remains largely unknown. The objective of this study was to determine the expression pattern of Lgi1 in mice brain during development and in adult animals. Real-time polymerase chain reaction (PCR) quantification and Western blot experiments showed a relative low expression during intrauterine stages, increasing until adulthood. In addition, we did not find significant differences between left and right hemispheres. The hippocampus presented higher levels of Lgi1 expression when compared to the neocortex and the cerebellum of adult animals; however, these results did not reach statistical significance. This study was the first to determine a specific profile of Lgi1 gene expression during central nervous system development, which suggests a possible inhibitory function in latter stages of development. In addition, we did not find differences in hemispheric expression that could explain the predominance of left-sided abnormalities in patients with ADPEAF.

  1. [Research of expression of L-DOPA decarboxylase in laryngeal cancer].

    PubMed

    Lai, Shisheng; Wan, Zhili

    2014-12-01

    This study aimed to investigate the expression levels of L-DOPA decarboxylase (DDC) mRNA and protein in laryngeal cancer, and to determine the clinical significance of DDC in diagnosis and prognosis of laryngeal cancer. Total RNA was isolated from 106 tissue samples surgically removed from 53 laryngeal cancer patients. A quantitative real-time polymerase chain reaction (RT-PCR) methodology based on SYBR Green I fluorescent dye was developed for the quantification of mRNA levels. In addition, Western Blot analysis was performed to detect the expression level of DDC protein. DDC mRNA expression in both primary (P= 0. 000) and recurrent (P=0. 033) laryngeal cancer samples downregulated significantly compared with their nonmalignant counterparts. Moreover, expression of DDC mRNA was not associated with age and histologic grade, but the significantly decreased mRNA were correlated with early TMN stage (P=0. 021). Additionally, DDC protein was detected in both cancerous and noncancerous tissues. Expression levels of DDC may play a vital role in the progression of laryngeal cancer, which can be served as a promising biomarker for the future clinical management of laryngeal cancer patients.

  2. Evaluation of viral removal by nanofiltration using real-time quantitative polymerase chain reaction.

    PubMed

    Zhao, Xiaowen; Bailey, Mark R; Emery, Warren R; Lambooy, Peter K; Chen, Dayue

    2007-06-01

    Nanofiltration is commonly introduced into purification processes of biologics produced in mammalian cells to serve as a designated step for removal of potential exogenous viral contaminants and endogenous retrovirus-like particles. The LRV (log reduction value) achieved by nanofiltration is often determined by cell-based infectivity assay, which is time-consuming and labour-intensive. We have explored the possibility of employing QPCR (quantitative PCR) to evaluate LRV achieved by nanofiltration in scaled-down studies using two model viruses, namely xenotropic murine leukemia virus and murine minute virus. We report here the successful development of a QPCR-based method suitable for quantification of virus removal by nanofiltration. The method includes a nuclease treatment step to remove free viral nucleic acids, while viral genome associated with intact virus particles is shielded from the nuclease. In addition, HIV Armored RNA was included as an internal control to ensure the accuracy and reliability of the method. The QPCRbased method described here provides several advantages such as better sensitivity, faster turnaround time, reduced cost and higher throughput over the traditional cell-based infectivity assays.

  3. Quantification of measles, mumps and rubella viruses using real-time quantitative TaqMan-based RT-PCR assay.

    PubMed

    Ammour, Y; Faizuloev, E; Borisova, T; Nikonova, A; Dmitriev, G; Lobodanov, S; Zverev, V

    2013-01-01

    In this study, a rapid quantitative method using TaqMan-based real-time reverse transcription-polymerase chain reaction (qPCR-RT) has been developed for estimating the titers of measles, mumps and rubella (MMR) viruses in infected cell culture supernatants. The qPCR-RT assay was demonstrated to be a specific, sensitive, efficient and reproducible method. For MMR viral samples obtained during MMR viral propagations in Vero cells at a different multiplicity of infection, titers determined by the qPCR-RT assay have been compared with estimates of infectious virus obtained by a traditional commonly used method for MMR viruses - 50% cell culture infective dose (CCID(50)) assay, in paired samples. Pearson analysis evidenced a significant correlation between both methods for a certain period after viral inoculation. Furthermore, the established qPCR-RT assay was faster and less-laborious. The developed method could be used as an alternative method or a supplementary tool for the routine titer estimation during MMR vaccine production. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Relationship of aquatic environmental factors with the abundance of Vibrio cholerae, Vibrio parahaemolyticus, Vibrio mimicus and Vibrio vulnificus in the coastal area of Guaymas, Sonora, Mexico.

    PubMed

    León Robles, A; Acedo Félix, E; Gomez-Gil, B; Quiñones Ramírez, E I; Nevárez-Martínez, M; Noriega-Orozco, L

    2013-12-01

    Members of the genus Vibrio are common in aquatic environments. Among them are V. cholerae, V. vulnificus, V. parahaemolyticus and V. mimicus. Several studies have shown that environmental factors, such as temperature, salinity, and dissolved oxygen, are involved in their epidemiology. Therefore, the main objective of this study is to determine if there is a correlation between the presence/amount of V. cholerae, V, vulnificus, V. parahaemolyticus and V. mimicus and the environmental conditions of the seawater off the coast of Guaymas, México. Quantification of all four pathogenic bacteria was performed using the most probable number method, and suspected colonies were identified by polymerase chain reaction (PCR). Correlations were found using principal component analysis. V. parahaemolyticus was the most abundant and widely distributed bacteria, followed by V. vulnificus, V. mimicus and V. cholerae. Positive correlations between V. parahaemolyticus, V. vulnificus and V. mimicus with temperature, salinity, electric conductivity, and total dissolved solids were found. The abundance of V. cholerae was mainly affected by the sampling site and not by physicochemical parameters.

  5. Dose-response algorithms for water-borne Pseudomonas aeruginosa folliculitis.

    PubMed

    Roser, D J; Van Den Akker, B; Boase, S; Haas, C N; Ashbolt, N J; Rice, S A

    2015-05-01

    We developed two dose-response algorithms for P. aeruginosa pool folliculitis using bacterial and lesion density estimates, associated with undetectable, significant, and almost certain folliculitis. Literature data were fitted to Furumoto & Mickey's equations, developed for plant epidermis-invading pathogens: N l = A ln(1 + BC) (log-linear model); P inf = 1-e(-r c C) (exponential model), where A and B are 2.51644 × 107 lesions/m2 and 2.28011 × 10-11 c.f.u./ml P. aeruginosa, respectively; C = pathogen density (c.f.u./ml), N l = folliculitis lesions/m2, P inf = probability of infection, and r C = 4·3 × 10-7 c.f.u./ml P. aeruginosa. Outbreak data indicates these algorithms apply to exposure durations of 41 ± 25 min. Typical water quality benchmarks (≈10-2 c.f.u./ml) appear conservative but still useful as the literature indicated repeated detection likely implies unstable control barriers and bacterial bloom potential. In future, culture-based outbreak testing should be supplemented with quantitative polymerase chain reaction and organic carbon assays, and quantification of folliculitis aetiology to better understand P. aeruginosa risks.

  6. Direct quantification and distribution of tetracycline-resistant genes in meat samples by real-time polymerase chain reaction.

    PubMed

    Guarddon, Mónica; Miranda, Jose M; Vázquez, Beatriz I; Cepeda, Alberto; Franco, Carlos M

    2012-07-01

    The evolution of antimicrobial-resistant bacteria has become a threat to food safety and methods to control them are necessary. Counts of tetracycline-resistant (TR) bacteria by microbiological methods were compared with those obtained by quantitative PCR (qPCR) in 80 meat samples. TR Enterobacteriaceae counts were similar between the count plate method and qPCR (P= 0.24), whereas TR aerobic mesophilic bacteria counts were significantly higher by the microbiological method (P < 0.001). The distribution of tetA and tetB genes was investigated in different types of meat. tetA was detected in chicken meat (40%), turkey meat (100%), pork (20%), and beef (40%) samples, whereas tetB was detected in chicken meat (45%), turkey meat (70%), pork (30%), and beef (35%) samples. The presence of tetracycline residues was also investigated by a receptor assay. This study offers an alternative and rapid method for monitoring the presence of TR bacteria in meat and furthers the understanding of the distribution of tetA and tetB genes. © 2012 Institute of Food Technologists®

  7. Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

    PubMed

    Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

    2013-09-15

    We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

    PubMed Central

    Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

    2015-01-01

    Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

  9. PCI-GC-MS-MS approach for identification of non-amino organic acid and amino acid profiles.

    PubMed

    Luan, Hemi; Yang, Lin; Ji, Fenfen; Cai, Zongwei

    2017-03-15

    Alkyl chloroformate have been wildly used for the fast derivatization of metabolites with amino and/or carboxyl groups, coupling of powerful separation and detection systems, such as GC-MS, which allows the comprehensive analysis of non-amino organic acids and amino acids. The reagents involving n-alkyl chloroformate and n-alcohol are generally employed for providing symmetric labeling terminal alkyl chain with the same length. Here, we developed an asymmetric labeling strategy and positive chemical ionization gas chromatography-tandem mass spectrometry (PCI-GC-MS-MS) approach for determination of non-amino organic acids and amino acids, as well as the short chain fatty acids. Carboxylic and amino groups could be selectively labelled by propyl and ethyl groups, respectively. The specific neutral loss of C 3 H 8 O (60Da), C 3 H 5 O 2 (74Da) and C 4 H 8 O 2 (88Da) were useful in the selective identification for qualitative analysis of organic acids and amino acid derivatives. PCI-GC-MS-MS using multiple reaction monitoring (MRM) was applied for semi-quantification of typical non-amino organic acids and amino acids. This method exhibited a wide range of linear range, good regression coefficient (R 2 ) and repeatability. The relative standard deviation (RSD) of targeted metabolites showed excellent intra- and inter-day precision (<5%). Our method provided a qualitative and semi-quantitative PCI-GC-MS-MS, coupled with alkyl chloroformate derivatization. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. LC-MS/MS quantification of next-generation biotherapeutics: a case study for an IgE binding Nanobody in cynomolgus monkey plasma.

    PubMed

    Sandra, Koen; Mortier, Kjell; Jorge, Lucie; Perez, Luis C; Sandra, Pat; Priem, Sofie; Poelmans, Sofie; Bouche, Marie-Paule

    2014-05-01

    Nanobodies(®) are therapeutic proteins derived from the smallest functional fragments of heavy chain-only antibodies. The development and validation of an LC-MS/MS-based method for the quantification of an IgE binding Nanobody in cynomolgus monkey plasma is presented. Nanobody quantification was performed making use of a proteotypic tryptic peptide chromatographically enriched prior to LC-MS/MS analysis. The validated LLOQ at 36 ng/ml was measured with an intra- and inter-assay precision and accuracy <20%. The required sensitivity could be obtained based on the selectivity of 2D LC combined with MS/MS. No analyte specific tools for affinity purification were used. Plasma samples originating from a PK/PD study were analyzed and compared with the results obtained with a traditional ligand-binding assay. Excellent correlations between the two techniques were obtained, and similar PK parameters were estimated. A 2D LC-MS/MS method was successfully developed and validated for the quantification of a next generation biotherapeutic.

  11. An improved reaction path optimization method using a chain of conformations

    NASA Astrophysics Data System (ADS)

    Asada, Toshio; Sawada, Nozomi; Nishikawa, Takuya; Koseki, Shiro

    2018-05-01

    The efficient fast path optimization (FPO) method is proposed to optimize the reaction paths on energy surfaces by using chains of conformations. No artificial spring force is used in the FPO method to ensure the equal spacing of adjacent conformations. The FPO method is applied to optimize the reaction path on two model potential surfaces. The use of this method enabled the optimization of the reaction paths with a drastically reduced number of optimization cycles for both potentials. It was also successfully utilized to define the MEP of the isomerization of the glycine molecule in water by FPO method.

  12. Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions

    NASA Astrophysics Data System (ADS)

    Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.

    2018-05-01

    It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

  13. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

  14. Basic design of MRM assays for peptide quantification.

    PubMed

    James, Andrew; Jorgensen, Claus

    2010-01-01

    With the recent availability and accessibility of mass spectrometry for basic and clinical research, the requirement for stable, sensitive, and reproducible assays to specifically detect proteins of interest has increased. Multiple reaction monitoring (MRM) or selective reaction monitoring (SRM) is a highly selective, sensitive, and robust assay to monitor the presence and amount of biomolecules. Until recently, MRM was typically used for the detection of drugs and other biomolecules from body fluids. With increased focus on biomarkers and systems biology approaches, researchers in the proteomics field have taken advantage of this approach. In this chapter, we will introduce the reader to the basic principle of designing and optimizing an MRM workflow. We provide examples of MRM workflows for standard proteomic samples and provide suggestions for the reader who is interested in using MRM for quantification.

  15. Large-scale isotype-specific quantification of Serum amyloid A 1/2 by multiple reaction monitoring in crude sera.

    PubMed

    Sung, Hye-Jin; Jeon, Seon-Ae; Ahn, Jung-Mo; Seul, Kyung-Jo; Kim, Jin Young; Lee, Ju Yeon; Yoo, Jong Shin; Lee, Soo-Youn; Kim, Hojoong; Cho, Je-Yoel

    2012-04-03

    Quantification is an essential step in biomarker development. Multiple reaction monitoring (MRM) is a new modified mass spectrometry-based quantification technology that does not require antibody development. Serum amyloid A (SAA) is a positive acute-phase protein identified as a lung cancer biomarker in our previous study. Acute SAA exists in two isoforms with highly similar (92%) amino acid sequences. Until now, studies of SAA have been unable to distinguish between SAA1 and SAA2. To overcome the unavailability of a SAA2-specific antibody, we developed MRM methodology for the verification of SAA1 and SAA2 in clinical crude serum samples from 99 healthy controls and 100 lung adenocarcinoma patients. Differential measurement of SAA1 and SAA2 was made possible for the first time with the developed isotype-specific MRM method. Most healthy control samples had small or no MS/MS peaks of the targeted peptides otherwise, higher peak areas with 10- to 34-fold increase over controls were detected in lung cancer samples. In addition, our SAA1 MRM data demonstrated good agreement with the SAA1 enzyme-linked immunosorbent assay (ELISA) data. Finally, successful quantification of SAA2 in crude serum by MRM, for the first time, shows that SAA2 can be a good biomarker for the detection of lung cancers. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Sub-Equimolar Hydrolysis and Condensation of Organophosphates

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alam, Todd M.; Kinnan, Mark K.; Wilson, Brendan W.

    We characterized the in-situ hydrolysis and subsequent condensation reaction of the chemical agent simulant diethyl chlorophosphate (DECP) by high-resolution 31P NMR spectroscopy following the addition of water in sub-equimolar concentrations. Moreover, the identification and quantification of the multiple pyrophosphate and larger polyphosphate chemical species formed through a series of self-condensation reactions are reported. Finally, the DECP hydrolysis kinetics and distribution of breakdown species was strongly influenced by the water concentration and reaction temperature.

  17. Sub-Equimolar Hydrolysis and Condensation of Organophosphates

    DOE PAGES

    Alam, Todd M.; Kinnan, Mark K.; Wilson, Brendan W.; ...

    2016-07-16

    We characterized the in-situ hydrolysis and subsequent condensation reaction of the chemical agent simulant diethyl chlorophosphate (DECP) by high-resolution 31P NMR spectroscopy following the addition of water in sub-equimolar concentrations. Moreover, the identification and quantification of the multiple pyrophosphate and larger polyphosphate chemical species formed through a series of self-condensation reactions are reported. Finally, the DECP hydrolysis kinetics and distribution of breakdown species was strongly influenced by the water concentration and reaction temperature.

  18. Ufd2p synthesizes branched ubiquitin chains to promote the degradation of substrates modified with atypical chains

    PubMed Central

    Liu, Chao; Liu, Weixiao; Ye, Yihong; Li, Wei

    2017-01-01

    Ubiquitination of a subset of proteins by ubiquitin chain elongation factors (E4), represented by Ufd2p in Saccharomyces cerevisiae, is a pivotal regulator for many biological processes. However, the mechanism of Ufd2p-mediated ubiquitination is largely unclear. Here, we show that Ufd2p catalyses K48-linked multi-monoubiquitination on K29-linked ubiquitin chains assembled by the ubiquitin ligase (Ufd4p), resulting in branched ubiquitin chains. This reaction depends on the interaction of K29-linked ubiquitin chains with two N-terminal loops of Ufd2p. Only following the addition of K48-linked ubiquitin to substrates modified with K29-linked ubiquitin chains, can the substrates be escorted to the proteasome for degradation. We demonstrate that this ubiquitin chain linkage switching reaction is essential for ERAD, oleic acid and acid pH resistance in yeast. Thus, our results suggest that Ufd2p functions by switching ubiquitin chain linkages to allow the degradation of proteins modified with a ubiquitin linkage, which is normally not targeted to the proteasome. PMID:28165462

  19. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  20. Identification of Brucella spp. by using the polymerase chain reaction.

    PubMed Central

    Herman, L; De Ridder, H

    1992-01-01

    The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

  1. Detection of Listeria monocytogenes by using the polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  2. Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

    PubMed

    Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

    2012-07-09

    Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. 9 CFR 145.33 - Terminology and classification; flocks and products.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    .... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

  4. Parallel and automated library synthesis of 2-long alkyl chain benzoazoles and azole[4,5-b]pyridines under microwave irradiation.

    PubMed

    Martínez-Palou, Rafael; Zepeda, L Gerardo; Höpfl, Herbert; Montoya, Ascensión; Guzmán-Lucero, Diego J; Guzmán, Javier

    2005-01-01

    A versatile route to 40-membered library of 2-long alkyl chain substituted benzoazoles (1 and 2) and azole[4,5-b]pyridines (3 and 4) via microwave-assisted combinatorial synthesis was developed. The reactions were carried out in both monomode and multimode microwave oven. With the latter, all reactions were performed in high-throughput experimental settings consisting of an 8 x 5 combinatorial library designed to synthesize 40 compounds. Each step, from the addition of reagents to the recovery of final products, was automated. The microwave-assisted N-long chain alkylation reactions of 2-alkyl-1H-benzimidazole (1) and 2-alkyl-1H-benzimidazole[4,5-b] pyridines (3) were also studied.

  5. Immediate hypersensitivity to moxifloxacin with tolerance to ciprofloxacin: report of three cases and review of the literature.

    PubMed

    Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth

    2010-04-01

    To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.

  6. No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

    PubMed

    D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

    2006-10-01

    Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

  7. New polymer systems: Chain extension by dianhydrides

    NASA Technical Reports Server (NTRS)

    Rhein, R. A.; Ingham, J. D.

    1972-01-01

    The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.

  8. 21 CFR 864.4020 - Analyte specific reagents.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... specific binding or chemical reaction with substances in a specimen, are intended for use in a diagnostic application for identification and quantification of an individual chemical substance or ligand in biological...

  9. 21 CFR 864.4020 - Analyte specific reagents.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... specific binding or chemical reaction with substances in a specimen, are intended for use in a diagnostic application for identification and quantification of an individual chemical substance or ligand in biological...

  10. 21 CFR 864.4020 - Analyte specific reagents.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... specific binding or chemical reaction with substances in a specimen, are intended for use in a diagnostic application for identification and quantification of an individual chemical substance or ligand in biological...

  11. 21 CFR 864.4020 - Analyte specific reagents.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... specific binding or chemical reaction with substances in a specimen, are intended for use in a diagnostic application for identification and quantification of an individual chemical substance or ligand in biological...

  12. An accurate proteomic quantification method: fluorescence labeling absolute quantification (FLAQ) using multidimensional liquid chromatography and tandem mass spectrometry.

    PubMed

    Liu, Junyan; Liu, Yang; Gao, Mingxia; Zhang, Xiangmin

    2012-08-01

    A facile proteomic quantification method, fluorescent labeling absolute quantification (FLAQ), was developed. Instead of using MS for quantification, the FLAQ method is a chromatography-based quantification in combination with MS for identification. Multidimensional liquid chromatography (MDLC) with laser-induced fluorescence (LIF) detection with high accuracy and tandem MS system were employed for FLAQ. Several requirements should be met for fluorescent labeling in MS identification: Labeling completeness, minimum side-reactions, simple MS spectra, and no extra tandem MS fragmentations for structure elucidations. A fluorescence dye, 5-iodoacetamidofluorescein, was finally chosen to label proteins on all cysteine residues. The fluorescent dye was compatible with the process of the trypsin digestion and MALDI MS identification. Quantitative labeling was achieved with optimization of reacting conditions. A synthesized peptide and model proteins, BSA (35 cysteines), OVA (five cysteines), were used for verifying the completeness of labeling. Proteins were separated through MDLC and quantified based on fluorescent intensities, followed by MS identification. High accuracy (RSD% < 1.58) and wide linearity of quantification (1-10(5) ) were achieved by LIF detection. The limit of quantitation for the model protein was as low as 0.34 amol. Parts of proteins in human liver proteome were quantified and demonstrated using FLAQ. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

    PubMed

    Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

    2014-07-24

    This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

  14. Real-space localization and quantification of hole distribution in chain-ladder Sr3Ca11Cu24O41 superconductor.

    PubMed

    Bugnet, Matthieu; Löffler, Stefan; Hawthorn, David; Dabkowska, Hanna A; Luke, Graeme M; Schattschneider, Peter; Sawatzky, George A; Radtke, Guillaume; Botton, Gianluigi A

    2016-03-01

    Understanding the physical properties of the chain-ladder Sr3Ca11Cu24O41 hole-doped superconductor has been precluded by the unknown hole distribution among chains and ladders. We use electron energy-loss spectrometry (EELS) in a scanning transmission electron microscope (STEM) at atomic resolution to directly separate the contributions of chains and ladders and to unravel the hole distribution from the atomic scale variations of the O-K near-edge structures. The experimental data unambiguously demonstrate that most of the holes lie within the chain layers. A quantitative interpretation supported by inelastic scattering calculations shows that about two holes are located in the ladders, and about four holes in the chains, shedding light on the electronic structure of Sr3Ca11Cu24O41. Combined atomic resolution STEM-EELS and inelastic scattering calculations is demonstrated as a powerful approach toward a quantitative understanding of the electronic structure of cuprate superconductors, offering new possibilities for elucidating their physical properties.

  15. Real-space localization and quantification of hole distribution in chain-ladder Sr3Ca11Cu24O41 superconductor

    PubMed Central

    Bugnet, Matthieu; Löffler, Stefan; Hawthorn, David; Dabkowska, Hanna A.; Luke, Graeme M.; Schattschneider, Peter; Sawatzky, George A.; Radtke, Guillaume; Botton, Gianluigi A.

    2016-01-01

    Understanding the physical properties of the chain-ladder Sr3Ca11Cu24O41 hole-doped superconductor has been precluded by the unknown hole distribution among chains and ladders. We use electron energy-loss spectrometry (EELS) in a scanning transmission electron microscope (STEM) at atomic resolution to directly separate the contributions of chains and ladders and to unravel the hole distribution from the atomic scale variations of the O-K near-edge structures. The experimental data unambiguously demonstrate that most of the holes lie within the chain layers. A quantitative interpretation supported by inelastic scattering calculations shows that about two holes are located in the ladders, and about four holes in the chains, shedding light on the electronic structure of Sr3Ca11Cu24O41. Combined atomic resolution STEM-EELS and inelastic scattering calculations is demonstrated as a powerful approach toward a quantitative understanding of the electronic structure of cuprate superconductors, offering new possibilities for elucidating their physical properties. PMID:27051872

  16. Sleeve reaction chamber system

    DOEpatents

    Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  17. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    PubMed

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  18. Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

    USDA-ARS?s Scientific Manuscript database

    Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

  19. MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

    DOEpatents

    Wigner, E.P.; Weinberg, A.M.

    1961-01-24

    A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

  20. DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

    EPA Science Inventory

    This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

  1. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  2. Technical advances in proteomics: new developments in data-independent acquisition.

    PubMed

    Hu, Alex; Noble, William S; Wolf-Yadlin, Alejandro

    2016-01-01

    The ultimate aim of proteomics is to fully identify and quantify the entire complement of proteins and post-translational modifications in biological samples of interest. For the last 15 years, liquid chromatography-tandem mass spectrometry (LC-MS/MS) in data-dependent acquisition (DDA) mode has been the standard for proteomics when sampling breadth and discovery were the main objectives; multiple reaction monitoring (MRM) LC-MS/MS has been the standard for targeted proteomics when precise quantification, reproducibility, and validation were the main objectives. Recently, improvements in mass spectrometer design and bioinformatics algorithms have resulted in the rediscovery and development of another sampling method: data-independent acquisition (DIA). DIA comprehensively and repeatedly samples every peptide in a protein digest, producing a complex set of mass spectra that is difficult to interpret without external spectral libraries. Currently, DIA approaches the identification breadth of DDA while achieving the reproducible quantification characteristic of MRM or its newest version, parallel reaction monitoring (PRM). In comparative de novo identification and quantification studies in human cell lysates, DIA identified up to 89% of the proteins detected in a comparable DDA experiment while providing reproducible quantification of over 85% of them. DIA analysis aided by spectral libraries derived from prior DIA experiments or auxiliary DDA data produces identification and quantification as reproducible and precise as that achieved by MRM/PRM, except on low‑abundance peptides that are obscured by stronger signals. DIA is still a work in progress toward the goal of sensitive, reproducible, and precise quantification without external spectral libraries. New software tools applied to DIA analysis have to deal with deconvolution of complex spectra as well as proper filtering of false positives and false negatives. However, the future outlook is positive, and various researchers are working on novel bioinformatics techniques to address these issues and increase the reproducibility, fidelity, and identification breadth of DIA.

  3. Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

    PubMed

    Adewale, B; Mafe, M A; Oyerinde, J P O

    2005-01-01

    Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

  4. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    PubMed

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

  5. [The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

    PubMed

    Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

    2014-04-01

    The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

  6. Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

    PubMed Central

    Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

    2014-01-01

    A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

  7. Safety of medium-chain triglycerides used as an intraocular tamponading agent in an experimental vitrectomy model rabbit.

    PubMed

    Auriol, Sylvain; Mahieu, Laurence; Brousset, Pierre; Malecaze, François; Mathis, Véronique

    2013-01-01

    To evaluate safety of medium-chain triglycerides used as a possible intraocular tamponading agent. A 20-gauge pars plana vitrectomy was performed in the right eye of 28 rabbits. An ophthalmologic examination was performed every week until rabbits were killed. At days 7, 30, 60, and 90, rabbits were killed and the treated eyes were examined macroscopically and prepared for histologic examination. Principal outcome was retinal toxicity evaluated by light and electron microscopy, and secondary outcomes were the presence of medium-chain triglyceride emulsification, inflammatory reactions, and the development of cataract. Histologic examination did not reveal any retinal toxicity. Two cases of moderate emulsification were observed, but in these cases, emulsification was caused by the perioperative injection of the agent and did not increase during the postoperative period. We noted 13 cases of inflammatory reaction in vitreous cavity and no case of inflammatory reaction in anterior chamber. Two eyes developed cataract as a result of perioperative trauma to the lens with the vitreous cutter and not secondary to the presence of medium-chain triglycerides in the vitreous cavity. Medium-chain triglycerides did not induce morphologic evidence of retinal toxicity. The results suggest that medium-chain triglycerides could be a promising alternative intraocular tamponading agent for the treatment of retinal detachments.

  8. Instrument for Real-Time Digital Nucleic Acid Amplification on Custom Microfluidic Devices

    PubMed Central

    Selck, David A.

    2016-01-01

    Nucleic acid amplification tests that are coupled with a digital readout enable the absolute quantification of single molecules, even at ultralow concentrations. Digital methods are robust, versatile and compatible with many amplification chemistries including isothermal amplification, making them particularly invaluable to assays that require sensitive detection, such as the quantification of viral load in occult infections or detection of sparse amounts of DNA from forensic samples. A number of microfluidic platforms are being developed for carrying out digital amplification. However, the mechanistic investigation and optimization of digital assays has been limited by the lack of real-time kinetic information about which factors affect the digital efficiency and analytical sensitivity of a reaction. Commercially available instruments that are capable of tracking digital reactions in real-time are restricted to only a small number of device types and sample-preparation strategies. Thus, most researchers who wish to develop, study, or optimize digital assays rely on the rate of the amplification reaction when performed in a bulk experiment, which is now recognized as an unreliable predictor of digital efficiency. To expand our ability to study how digital reactions proceed in real-time and enable us to optimize both the digital efficiency and analytical sensitivity of digital assays, we built a custom large-format digital real-time amplification instrument that can accommodate a wide variety of devices, amplification chemistries and sample-handling conditions. Herein, we validate this instrument, we provide detailed schematics that will enable others to build their own custom instruments, and we include a complete custom software suite to collect and analyze the data retrieved from the instrument. We believe assay optimizations enabled by this instrument will improve the current limits of nucleic acid detection and quantification, improving our fundamental understanding of single-molecule reactions and providing advancements in practical applications such as medical diagnostics, forensics and environmental sampling. PMID:27760148

  9. Multiplexed Detection of Cytokines Based on Dual Bar-Code Strategy and Single-Molecule Counting.

    PubMed

    Li, Wei; Jiang, Wei; Dai, Shuang; Wang, Lei

    2016-02-02

    Cytokines play important roles in the immune system and have been regarded as biomarkers. While single cytokine is not specific and accurate enough to meet the strict diagnosis in practice, in this work, we constructed a multiplexed detection method for cytokines based on dual bar-code strategy and single-molecule counting. Taking interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α) as model analytes, first, the magnetic nanobead was functionalized with the second antibody and primary bar-code strands, forming a magnetic nanoprobe. Then, through the specific reaction of the second antibody and the antigen that fixed by the primary antibody, sandwich-type immunocomplex was formed on the substrate. Next, the primary bar-code strands as amplification units triggered multibranched hybridization chain reaction (mHCR), producing nicked double-stranded polymers with multiple branched arms, which were served as secondary bar-code strands. Finally, the secondary bar-code strands hybridized with the multimolecule labeled fluorescence probes, generating enhanced fluorescence signals. The numbers of fluorescence dots were counted one by one for quantification with epi-fluorescence microscope. By integrating the primary and secondary bar-code-based amplification strategy and the multimolecule labeled fluorescence probes, this method displayed an excellent sensitivity with the detection limits were both 5 fM. Unlike the typical bar-code assay that the bar-code strands should be released and identified on a microarray, this method is more direct. Moreover, because of the selective immune reaction and the dual bar-code mechanism, the resulting method could detect the two targets simultaneously. Multiple analysis in human serum was also performed, suggesting that our strategy was reliable and had a great potential application in early clinical diagnosis.

  10. Detection of hemoplasma infection of goats by use of a quantitative polymerase chain reaction assay and risk factor analysis for infection.

    PubMed

    Johnson, Kathy A; do Nascimento, Naíla C; Bauer, Amy E; Weng, Hsin-Yi; Hammac, G Kenitra; Messick, Joanne B

    2016-08-01

    OBJECTIVE To develop and validate a real-time quantitative PCR (qPCR) assay for the detection and quantification of Mycoplasma ovis in goats and investigate the prevalence and risk factors for hemoplasma infection of goats located in Indiana. ANIMALS 362 adult female goats on 61 farms. PROCEDURES Primers were designed for amplification of a fragment of the dnaK gene of M ovis by use of a qPCR assay. Blood samples were collected into EDTA-containing tubes for use in total DNA extraction, blood film evaluation, and determination of PCV. Limit of detection, intra-assay variability, interassay variability, and specificity of the assay were determined. RESULTS Reaction efficiency of the qPCR assay was 94.45% (R(2), 0.99; slope, -3.4623), and the assay consistently detected as few as 10 copies of plasmid/reaction. Prevalence of infection in goats on the basis of results for the qPCR assay was 18.0% (95% confidence interval, 14% to 22%), with infected goats ranging from 1 to 14 years old, whereby 61% (95% confidence interval, 47% to 73%) of the farms had at least 1 infected goat. Bacterial load in goats infected with M ovis ranged from 1.05 × 10(3) target copies/mL of blood to 1.85 × 10(5) target copies/mL of blood; however, no bacteria were observed on blood films. Production use of a goat was the only risk factor significantly associated with hemoplasma infection. CONCLUSIONS AND CLINICAL RELEVANCE The qPCR assay was more sensitive for detecting hemoplasma infection than was evaluation of a blood film, and production use of a goat was a risk factor for infection.

  11. Rapid antigen tests for dengue virus serotypes and Zika virus in patient serum.

    PubMed

    Bosch, Irene; de Puig, Helena; Hiley, Megan; Carré-Camps, Marc; Perdomo-Celis, Federico; Narváez, Carlos F; Salgado, Doris M; Senthoor, Dewahar; O'Grady, Madeline; Phillips, Elizabeth; Durbin, Ann; Fandos, Diana; Miyazaki, Hikaru; Yen, Chun-Wan; Gélvez-Ramírez, Margarita; Warke, Rajas V; Ribeiro, Lucas S; Teixeira, Mauro M; Almeida, Roque P; Muñóz-Medina, José E; Ludert, Juan E; Nogueira, Mauricio L; Colombo, Tatiana E; Terzian, Ana C B; Bozza, Patricia T; Calheiros, Andrea S; Vieira, Yasmine R; Barbosa-Lima, Giselle; Vizzoni, Alexandre; Cerbino-Neto, José; Bozza, Fernando A; Souza, Thiago M L; Trugilho, Monique R O; de Filippis, Ana M B; de Sequeira, Patricia C; Marques, Ernesto T A; Magalhaes, Tereza; Díaz, Francisco J; Restrepo, Berta N; Marín, Katerine; Mattar, Salim; Olson, Daniel; Asturias, Edwin J; Lucera, Mark; Singla, Mohit; Medigeshi, Guruprasad R; de Bosch, Norma; Tam, Justina; Gómez-Márquez, Jose; Clavet, Charles; Villar, Luis; Hamad-Schifferli, Kimberly; Gehrke, Lee

    2017-09-27

    The recent Zika virus (ZIKV) outbreak demonstrates that cost-effective clinical diagnostics are urgently needed to detect and distinguish viral infections to improve patient care. Unlike dengue virus (DENV), ZIKV infections during pregnancy correlate with severe birth defects, including microcephaly and neurological disorders. Because ZIKV and DENV are related flaviviruses, their homologous proteins and nucleic acids can cause cross-reactions and false-positive results in molecular, antigenic, and serologic diagnostics. We report the characterization of monoclonal antibody pairs that have been translated into rapid immunochromatography tests to specifically detect the viral nonstructural 1 (NS1) protein antigen and distinguish the four DENV serotypes (DENV1-4) and ZIKV without cross-reaction. To complement visual test analysis and remove user subjectivity in reading test results, we used image processing and data analysis for data capture and test result quantification. Using a 30-μl serum sample, the sensitivity and specificity values of the DENV1-4 tests and the pan-DENV test, which detects all four dengue serotypes, ranged from 0.76 to 1.00. Sensitivity/specificity for the ZIKV rapid test was 0.81/0.86, respectively, using a 150-μl serum input. Serum ZIKV NS1 protein concentrations were about 10-fold lower than corresponding DENV NS1 concentrations in infected patients; moreover, ZIKV NS1 protein was not detected in polymerase chain reaction-positive patient urine samples. Our rapid immunochromatography approach and reagents have immediate application in differential clinical diagnosis of acute ZIKV and DENV cases, and the platform can be applied toward developing rapid antigen diagnostics for emerging viruses. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  12. The impact of carbon-13 and deuterium on relative quantification of proteins using stable isotope diethyl labeling.

    PubMed

    Koehler, Christian J; Arntzen, Magnus Ø; Thiede, Bernd

    2015-05-15

    Stable isotopic labeling techniques are useful for quantitative proteomics. A cost-effective and convenient method for diethylation by reductive amination was established. The impact using either carbon-13 or deuterium on quantification accuracy and precision was investigated using diethylation. We established an effective approach for stable isotope labeling by diethylation of amino groups of peptides. The approach was validated using matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) and nanospray liquid chromatography/electrospray ionization (nanoLC/ESI)-ion trap/orbitrap for mass spectrometric analysis as well as MaxQuant for quantitative data analysis. Reaction conditions with low reagent costs, high yields and minor side reactions were established for diethylation. Furthermore, we showed that diethylation can be applied to up to sixplex labeling. For duplex experiments, we compared diethylation in the analysis of the proteome of HeLa cells using acetaldehyde-(13) C(2)/(12) C(2) and acetaldehyde-(2) H(4)/(1) H(4). Equal numbers of proteins could be identified and quantified; however, (13) C(4)/(12) C(4) -diethylation revealed a lower variance of quantitative peptide ratios within proteins resulting in a higher precision of quantified proteins and less falsely regulated proteins. The results were compared with dimethylation showing minor effects because of the lower number of deuteriums. The described approach for diethylation of primary amines is a cost-effective and accurate method for up to sixplex relative quantification of proteomes. (13) C(4)/(12) C(4) -diethylation enables duplex quantification based on chemical labeling without using deuterium which reduces identification of false-negatives and increases the quality of the quantification results. Copyright © 2015 John Wiley & Sons, Ltd.

  13. Neutron-deficient superheavy nuclei obtained in the 240Pu+48Ca reaction

    NASA Astrophysics Data System (ADS)

    Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu. Ts.; Rykaczewski, K. P.; Abdullin, F. Sh.; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu. S.; Voinov, A. A.; Subbotin, V. G.; Sukhov, A. M.; Karpov, A. V.; Popeko, A. G.; Sabel'nikov, A. V.; Svirikhin, A. I.; Vostokin, G. K.; Hamilton, J. H.; Kovrizhnykh, N. D.; Schlattauer, L.; Stoyer, M. A.; Gan, Z.; Huang, W. X.; Ma, L.

    2018-01-01

    We present new results from investigations of the 240Pu+48Ca reaction at a projectile energy of 250 MeV. Three new decay chains of 285Fl were detected with decay properties mostly consistent with those measured in earlier studies. An additional chain was observed where the nuclei may decay through energy levels different from those of the other six chains registered so far. The cross section of the 240Pu(48Ca,3 n )285Fl reaction was measured to be 0 .58-0.33+0.60pb , which is a factor of about 4-5 lower than that measured in the previous experiment at 245 MeV beam energy [V. K. Utyonkov et al., Phys. Rev. C 92, 034609 (2015)., 10.1103/PhysRevC.92.034609], consistent with expectations. The origin of an additional chain consisting of a recoil, α particle, and fission event is analyzed. The assignment of 25 short-lived SF events observed in this experiment is also discussed.

  14. Autocatalytic formation of an iron(IV)-oxo complex via scandium ion-promoted radical chain autoxidation of an iron(II) complex with dioxygen and tetraphenylborate.

    PubMed

    Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi

    2014-06-04

    A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.

  15. Quantification of rapid environmental redox processes with quick-scanning x-ray absorption spectroscopy (Q-XAS)

    PubMed Central

    Ginder-Vogel, Matthew; Landrot, Gautier; Fischel, Jason S.; Sparks, Donald L.

    2009-01-01

    Quantification of the initial rates of environmental reactions at the mineral/water interface is a fundamental prerequisite to determining reaction mechanisms and contaminant transport modeling and predicting environmental risk. Until recently, experimental techniques with adequate time resolution and elemental sensitivity to measure initial rates of the wide variety of environmental reactions were quite limited. Techniques such as electron paramagnetic resonance and Fourier transform infrared spectroscopies suffer from limited elemental specificity and poor sensitivity to inorganic elements, respectively. Ex situ analysis of batch and stirred-flow systems provides high elemental sensitivity; however, their time resolution is inadequate to characterize rapid environmental reactions. Here we apply quick-scanning x-ray absorption spectroscopy (Q-XAS), at sub-second time-scales, to measure the initial oxidation rate of As(III) to As(V) by hydrous manganese(IV) oxide. Using Q-XAS, As(III) and As(V) concentrations were determined every 0.98 s in batch reactions. The initial apparent As(III) depletion rate constants (t < 30 s) measured with Q-XAS are nearly twice as large as rate constants measured with traditional analytical techniques. Our results demonstrate the importance of developing analytical techniques capable of analyzing environmental reactions on the same time scale as they occur. Given the high sensitivity, elemental specificity, and time resolution of Q-XAS, it has many potential applications. They could include measuring not only redox reactions but also dissolution/precipitation reactions, such as the formation and/or reductive dissolution of Fe(III) (hydr)oxides, solid-phase transformations (i.e., formation of layered-double hydroxide minerals), or almost any other reaction occurring in aqueous media that can be measured using x-ray absorption spectroscopy. PMID:19805269

  16. Terminal alkenes as versatile chemical reporter groups for metabolic oligosaccharide engineering.

    PubMed

    Späte, Anne-Katrin; Schart, Verena F; Schöllkopf, Sophie; Niederwieser, Andrea; Wittmann, Valentin

    2014-12-08

    The Diels-Alder reaction with inverse electron demand (DAinv reaction) of 1,2,4,5-tetrazines with electron rich or strained alkenes was proven to be a bioorthogonal ligation reaction that proceeds fast and with high yields. An important application of the DAinv reaction is metabolic oligosaccharide engineering (MOE) which allows the visualization of glycoconjugates in living cells. In this approach, a sugar derivative bearing a chemical reporter group is metabolically incorporated into cellular glycoconjugates and subsequently derivatized with a probe by means of a bioorthogonal ligation reaction. Here, we investigated a series of new mannosamine and glucosamine derivatives with carbamate-linked side chains of varying length terminated by alkene groups and their suitability for labeling cell-surface glycans. Kinetic investigations showed that the reactivity of the alkenes in DAinv reactions increases with growing chain length. When applied to MOE, one of the compounds, peracetylated N-butenyloxycarbonylmannosamine, was especially well suited for labeling cell-surface glycans. Obviously, the length of its side chain represents the optimal balance between incorporation efficiency and speed of the labeling reaction. Sialidase treatment of the cells before the bioorthogonal labeling reaction showed that this sugar derivative is attached to the glycans in form of the corresponding sialic acid derivative and not epimerized to another hexosamine derivative to a considerable extent. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. A reliable and rapid tool for plasma quantification of 18 psychotropic drugs by ESI tandem mass spectrometry.

    PubMed

    Vecchione, Gennaro; Casetta, Bruno; Chiapparino, Antonella; Bertolino, Alessandro; Tomaiuolo, Michela; Cappucci, Filomena; Gatta, Raffaella; Margaglione, Maurizio; Grandone, Elvira

    2012-01-01

    A simple liquid chromatographic tandem mass spectrometry (LC-MS/MS) method has been developed for simultaneous analysis of 17 basic and one acid psychotropic drugs in human plasma. The method relies on a protein precipitation step for sample preparation and offers high sensitivity, wide linearity without interferences from endogenous matrix components. Chromatography was run on a reversed-phase column with an acetonitrile-H₂O mixture. The quantification of target compounds was performed in multiple reaction monitoring (MRM) and by switching the ionization polarity within the analytical run. A further sensitivity increase was obtained by implementing the functionality "scheduled multiple reaction monitoring" (sMRM) offered by the recent version of the software package managing the instrument. The overall injection interval was less than 5.5 min. Regression coefficients of the calibration curves and limits of quantification (LOQ) showed a good coverage of over-therapeutic, therapeutic and sub-therapeutic ranges. Recovery rates, measured as percentage of recovery of spiked plasma samples, were ≥ 94%. Precision and accuracy data have been satisfactory for a therapeutic drug monitoring (TDM) service as for managing plasma samples from patients receiving psycho-pharmacological treatment. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Development and Evaluation of a Parallel Reaction Monitoring Strategy for Large-Scale Targeted Metabolomics Quantification.

    PubMed

    Zhou, Juntuo; Liu, Huiying; Liu, Yang; Liu, Jia; Zhao, Xuyang; Yin, Yuxin

    2016-04-19

    Recent advances in mass spectrometers which have yielded higher resolution and faster scanning speeds have expanded their application in metabolomics of diverse diseases. Using a quadrupole-Orbitrap LC-MS system, we developed an efficient large-scale quantitative method targeting 237 metabolites involved in various metabolic pathways using scheduled, parallel reaction monitoring (PRM). We assessed the dynamic range, linearity, reproducibility, and system suitability of the PRM assay by measuring concentration curves, biological samples, and clinical serum samples. The quantification performances of PRM and MS1-based assays in Q-Exactive were compared, and the MRM assay in QTRAP 6500 was also compared. The PRM assay monitoring 237 polar metabolites showed greater reproducibility and quantitative accuracy than MS1-based quantification and also showed greater flexibility in postacquisition assay refinement than the MRM assay in QTRAP 6500. We present a workflow for convenient PRM data processing using Skyline software which is free of charge. In this study we have established a reliable PRM methodology on a quadrupole-Orbitrap platform for evaluation of large-scale targeted metabolomics, which provides a new choice for basic and clinical metabolomics study.

  19. Facile Quantification and Identification Techniques for Reducing Gases over a Wide Concentration Range Using a MOS Sensor in Temperature-Cycled Operation.

    PubMed

    Schultealbert, Caroline; Baur, Tobias; Schütze, Andreas; Sauerwald, Tilman

    2018-03-01

    Dedicated methods for quantification and identification of reducing gases based on model-based temperature-cycled operation (TCO) using a single commercial MOS gas sensor are presented. During high temperature phases the sensor surface is highly oxidized, yielding a significant sensitivity increase after switching to lower temperatures (differential surface reduction, DSR). For low concentrations, the slope of the logarithmic conductance during this low-temperature phase is evaluated and can directly be used for quantification. For higher concentrations, the time constant for reaching a stable conductance during the same low-temperature phase is evaluated. Both signals represent the reaction rate of the reducing gas on the strongly oxidized surface at this low temperature and provide a linear calibration curve, which is exceptional for MOS sensors. By determining these reaction rates on different low-temperature plateaus and applying pattern recognition, the resulting footprint can be used for identification of different gases. All methods are tested over a wide concentration range from 10 ppb to 100 ppm (4 orders of magnitude) for four different reducing gases (CO, H₂, ammonia and benzene) using randomized gas exposures.

  20. A simple and selective method for the measurement of azadirachtin and related azadirachtoid levels in fruits and vegetables using liquid chromatography electrospray ionization tandem mass spectrometry.

    PubMed

    Sarais, Giorgia; Caboni, Pierluigi; Sarritzu, Erika; Russo, Mariateresa; Cabras, Paolo

    2008-05-14

    Neem-based insecticides containing azadirachtin and related azadirachtoids are widely used in agriculture. Here, we report an analytical method for the rapid and accurate quantification of the insecticide azadirachtin A and B and other azadirachtoids such as salannin, nimbin, and their deacetylated analogues on tomatoes and peaches. Azadirachtoids were extracted from fruits and vegetables with acetonitrile. Using high-performance liquid chromatography/electrospray ionization tandem mass spectrometer, azadirachtoids were selectively detected monitoring the multiple reaction transitions of sodium adduct precursor ions. For azadirachtin A, calibration was linear over a working range of 1-1000 microg/L with r > 0.996. The limit of detection and limit of quantification for azadirachtin A were 0.4 and 0.8 microg/kg, respectively. The presence of interfering compounds in the peach and tomato extracts was evaluated and found to be minimal. Because of the linear behavior, it was concluded that the multiple reaction transitions of sodium adduct ions can be used for analytical purposes, that is, for the identification and quantification of azadirachtin A and B and related azadirachtoids in fruit and vegetable extracts at trace levels.

  1. Facile Quantification and Identification Techniques for Reducing Gases over a Wide Concentration Range Using a MOS Sensor in Temperature-Cycled Operation

    PubMed Central

    Schultealbert, Caroline; Baur, Tobias; Schütze, Andreas; Sauerwald, Tilman

    2018-01-01

    Dedicated methods for quantification and identification of reducing gases based on model-based temperature-cycled operation (TCO) using a single commercial MOS gas sensor are presented. During high temperature phases the sensor surface is highly oxidized, yielding a significant sensitivity increase after switching to lower temperatures (differential surface reduction, DSR). For low concentrations, the slope of the logarithmic conductance during this low-temperature phase is evaluated and can directly be used for quantification. For higher concentrations, the time constant for reaching a stable conductance during the same low-temperature phase is evaluated. Both signals represent the reaction rate of the reducing gas on the strongly oxidized surface at this low temperature and provide a linear calibration curve, which is exceptional for MOS sensors. By determining these reaction rates on different low-temperature plateaus and applying pattern recognition, the resulting footprint can be used for identification of different gases. All methods are tested over a wide concentration range from 10 ppb to 100 ppm (4 orders of magnitude) for four different reducing gases (CO, H2, ammonia and benzene) using randomized gas exposures. PMID:29494545

  2. Near-source mobile methane emission estimates using EPA Method33a and a novel probabilistic approach as a basis for leak quantification in urban areas

    EPA Science Inventory

    Methane emissions from underground pipeline leaks remain an ongoing issue in the development of accurate methane emission inventories for the natural gas supply chain. Application of mobile methods during routine street surveys would help address this issue, but there are large ...

  3. Method for polymer synthesis in a reaction well

    DOEpatents

    Brennan, Thomas M.

    1998-01-01

    A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

  4. Method for polymer synthesis in a reaction well

    DOEpatents

    Brennan, T.M.

    1998-09-29

    A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

  5. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

    PubMed Central

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

  6. Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

    Treesearch

    David E. Schreiber; Karen J. Garner; James M. Slavicek

    1997-01-01

    Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

  7. Dietary cholecalciferol regulates the recruitment and growth of skeletal muscle fibers and the expressions of myogenic regulatory factors and the myosin heavy chain in European sea bass larvae.

    PubMed

    Alami-Durante, Hélène; Cluzeaud, Marianne; Bazin, Didier; Mazurais, David; Zambonino-Infante, José L

    2011-12-01

    The aim of this study was to determine whether dietary cholecalciferol affects the recruitment and growth of axial skeletal muscle fibers in first-feeding European sea bass. Larvae were fed diets containing 0.28 (VD-L, low dose), 0.69 (VD-C, control dose), or 3.00 (VD-H, high dose) mg cholecalciferol/kg from 9 to 44 d posthatching (dph). Larvae were sampled at 44 dph for quantification of somatic growth, muscle growth, and muscle growth dynamics and at 22 and 44 dph for the relative quantification of transcripts encoded by genes involved in myogenesis, cell proliferation, and muscle structure. The weight increase of the VD-L-fed larvae was less than that of the VD-H-fed group, whereas that of VD-C-fed larvae was intermediate. The level of expression of genes involved in cell proliferation (PCNA) and early myogenesis (Myf5) decreased between 22 and 44 dph, whereas that of the myogenic determination factor MyoD1 and that of genes involved in muscle structure and function (myosin heavy chain, myosin light chains 2 and 3) increased. Dietary cholecalciferol regulated Myf5, MyoD1, myogenin, and myosin heavy chain gene expression, with a gene-specific shape of response. The maximum hypertrophy of white muscle fibers was higher in larvae fed the VD-C and VD-H diets than in larvae fed the VD-L diet. White muscle hyperplasia was highly stimulated in VD-H-fed larvae compared to VD-L- and VD-C-fed ones. These findings demonstrate a dietary cholecalciferol effect on skeletal muscle growth mechanisms of a Teleost species.

  8. Colour thresholding and objective quantification in bioimaging

    NASA Technical Reports Server (NTRS)

    Fermin, C. D.; Gerber, M. A.; Torre-Bueno, J. R.

    1992-01-01

    Computer imaging is rapidly becoming an indispensable tool for the quantification of variables in research and medicine. Whilst its use in medicine has largely been limited to qualitative observations, imaging in applied basic sciences, medical research and biotechnology demands objective quantification of the variables in question. In black and white densitometry (0-256 levels of intensity) the separation of subtle differences between closely related hues from stains is sometimes very difficult. True-colour and real-time video microscopy analysis offer choices not previously available with monochrome systems. In this paper we demonstrate the usefulness of colour thresholding, which has so far proven indispensable for proper objective quantification of the products of histochemical reactions and/or subtle differences in tissue and cells. In addition, we provide interested, but untrained readers with basic information that may assist decisions regarding the most suitable set-up for a project under consideration. Data from projects in progress at Tulane are shown to illustrate the advantage of colour thresholding over monochrome densitometry and for objective quantification of subtle colour differences between experimental and control samples.

  9. The Beta-Delayed Proton and Gamma Decay of 27P for Nuclear Astrophysics

    NASA Astrophysics Data System (ADS)

    McCleskey, E.; Banu, A.; McCleskey, M.; Roeder, B.; Saastamoinen, A.; Spiridon, A.; Trache, L.; Tribble, R. E.; Davinson, T.; Doherty, D.; Lotay, G. J.; Wallace, J.; Woods, P. J.

    2013-10-01

    The main creation site of 26Al is currently under debate. The reactions for its creation or destruction are also not completely known. When 26Al is created in novae, the reaction chain is: 24Mg(p,γ)25Al(β + v)25Mg(p,γ)26Al, but this chain can be by-passed by another chain: 25Al(p,γ)26Si(p,γ)27P and it can also be destroyed directly. Another way to by-pass it is through 26mAl(p,γ)27Si* which is dominated by resonant capture. Using the Momentum Achromat Recoil Spectrometer (MARS) at the Texas A&M Cyclotron Institute and inverse kinematics, this destruction reaction was studied by the beta-delayed proton and gamma decay of 27P. Due to selection rules, states populated above the proton threshold in the compound system (27Si*) can decay to 26mAl, which are the states of interest for the capture reaction. James Madison University, VA, USA.

  10. Multiplex quantification of Escherichia coli, Salmonella typhi and Vibrio cholera with three DNA targets in single reaction assay.

    PubMed

    Jangampalli Adi, Pradeepkiran; Naidu, Jagadish R; Matcha, Bhaskar

    2017-09-01

    Escherichia coli (E. coli), Salmonella typhi and Vibrio cholera harmful pathogens, which causes various diseases in humans. Rapid diagnosis of bacterial infection is an important for patient management and appropriate therapy during the early phase of the bacterial infected diseases. Among the existing techniques for identifying pathogens were less sensitive and time-consuming processes. In the present study total, 48 clinical 31 blood and 17 urine samples of patients suspected with the infections were collected from SVRR Hospital and used to detect the pathogens. Multiplex polymerase chain reaction (PCR) assay was set to design for the identification of Escherichia coli, Salmonella typhi and Vibrio cholera from the different clinical samples. Rapid diagnosis of Escherichia coli (E. coli), Salmonella and Vibrio cholera pathogens can be done with simultaneously in a single multiplex PCR assay by using specific primers with adjusted PCR conditions. Through this approach, the results represented with out of 31 blood samples 1-15 shows the positive with E. coli and remaining 14 only 11 were correlated with multiplex results of Vibrio cholera, remaining the urine samples all are positive with 17 samples correlate with the Salmonella typhi. Through the high specificity benefits of excellent sensitivity, with high resolution and reproducibility. This method of results proved and illustrates the best potential system for diagnosing the infectious disease with modern trendy. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Critical assessment of digital PCR for the detection and quantification of genetically modified organisms.

    PubMed

    Demeke, Tigst; Dobnik, David

    2018-07-01

    The number of genetically modified organisms (GMOs) on the market is steadily increasing. Because of regulation of cultivation and trade of GMOs in several countries, there is pressure for their accurate detection and quantification. Today, DNA-based approaches are more popular for this purpose than protein-based methods, and real-time quantitative PCR (qPCR) is still the gold standard in GMO analytics. However, digital PCR (dPCR) offers several advantages over qPCR, making this new technique appealing also for GMO analysis. This critical review focuses on the use of dPCR for the purpose of GMO quantification and addresses parameters which are important for achieving accurate and reliable results, such as the quality and purity of DNA and reaction optimization. Three critical factors are explored and discussed in more depth: correct classification of partitions as positive, correctly determined partition volume, and dilution factor. This review could serve as a guide for all laboratories implementing dPCR. Most of the parameters discussed are applicable to fields other than purely GMO testing. Graphical abstract There are generally three different options for absolute quantification of genetically modified organisms (GMOs) using digital PCR: droplet- or chamber-based and droplets in chambers. All have in common the distribution of reaction mixture into several partitions, which are all subjected to PCR and scored at the end-point as positive or negative. Based on these results GMO content can be calculated.

  12. The quantification of free Amadori compounds and amino acids allows to model the bound Maillard reaction products formation in soybean products.

    PubMed

    Troise, Antonio Dario; Wiltafsky, Markus; Fogliano, Vincenzo; Vitaglione, Paola

    2018-05-01

    The quantification of protein bound Maillard reaction products (MRPs) is still a challenge in food chemistry. Protein hydrolysis is the bottleneck step: it is time consuming and the protein degradation is not always complete. In this study, the quantitation of free amino acids and Amadori products (APs) was compared to the percentage of blocked lysine by using chemometric tools. Eighty thermally treated soybean samples were analyzed by mass spectrometry to measure the concentration of free amino acids, free APs and the protein-bound markers of the Maillard reaction (furosine, Nε-(carboxymethyl)-l-lysine, Nε-(carboxyethyl)-l-lysine, total lysine). Results demonstrated that Discriminant Analysis (DA) and Correlated Component Regression (CCR) correctly estimated the percent of blocked lysine in a validation and prediction set. These findings indicate that the measure of free markers reflects the extent of protein damage in soybean samples and it suggests the possibility to obtain rapid information on the quality of the industrial processes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen

    NASA Astrophysics Data System (ADS)

    Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.

    2017-12-01

    The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.

  14. Identification and validation of reference genes for quantification of target gene expression with quantitative real-time PCR for tall fescue under four abiotic stresses.

    PubMed

    Yang, Zhimin; Chen, Yu; Hu, Baoyun; Tan, Zhiqun; Huang, Bingru

    2015-01-01

    Tall fescue (Festuca arundinacea Schreb.) is widely utilized as a major forage and turfgrass species in the temperate regions of the world and is a valuable plant material for studying molecular mechanisms of grass stress tolerance due to its superior drought and heat tolerance among cool-season species. Selection of suitable reference genes for quantification of target gene expression is important for the discovery of molecular mechanisms underlying improved growth traits and stress tolerance. The stability of nine potential reference genes (ACT, TUB, EF1a, GAPDH, SAND, CACS, F-box, PEPKR1 and TIP41) was evaluated using four programs, GeNorm, NormFinder, BestKeeper, and RefFinder. The combinations of SAND and TUB or TIP41 and TUB were most stably expressed in salt-treated roots or leaves. The combinations of GAPDH with TIP41 or TUB were stable in roots and leaves under drought stress. TIP41 and PEPKR1 exhibited stable expression in cold-treated roots, and the combination of F-box, TIP41 and TUB was also stable in cold-treated leaves. CACS and TUB were the two most stable reference genes in heat-stressed roots. TIP41 combined with TUB and ACT was stably expressed in heat-stressed leaves. Finally, quantitative real-time polymerase chain reaction (qRT-PCR) assays of the target gene FaWRKY1 using the identified most stable reference genes confirmed the reliability of selected reference genes. The selection of suitable reference genes in tall fescue will allow for more accurate identification of stress-tolerance genes and molecular mechanisms conferring stress tolerance in this stress-tolerant species.

  15. Optimization, validation, and application of a real-time PCR protocol for quantification of viable bacterial cells in municipal sewage sludge and biosolids using reporter genes and Escherichia coli.

    PubMed

    van Frankenhuyzen, Jessica K; Trevors, Jack T; Flemming, Cecily A; Lee, Hung; Habash, Marc B

    2013-11-01

    Biosolids result from treatment of sewage sludge to meet jurisdictional standards, including pathogen reduction. Once government regulations are met, materials can be applied to agricultural lands. Culture-based methods are used to enumerate pathogen indicator microorganisms but may underestimate cell densities, which is partly due to bacteria existing in a viable but non-culturable physiological state. Viable indicators can also be quantified by realtime polymerase chain reaction (qPCR) used with propidium monoazide (PMA), a dye that inhibits amplification of DNA found extracellularly or in dead cells. The objectives of this study were to test an optimized PMA-qPCR method for viable pathogen detection in wastewater solids and to validate it by comparing results to data obtained by conventional plating. Reporter genes from genetically marked Pseudomonas sp. UG14Lr and Agrobacterium tumefaciens 542 cells were spiked into samples of primary sludge, and anaerobically digested and Lystek-treated biosolids as cell-free DNA, dead cells, viable cells, and mixtures of live and dead cells, followed by DNA extraction with and without PMA, and qPCR. The protocol was then used for Escherichia coli quantification in the three matrices, and results compared to plate counts. PMA-qPCR selectively detected viable cells, while inhibiting signals from cell-free DNA and DNA found in membrane-compromised cells. PMA-qPCR detected 0.5-1 log unit more viable E. coli cells in both primary solids and dewatered biosolids than plate counts. No viable E. coli was found in Lystek-treated biosolids. These data suggest PMA-qPCR may more accurately estimate pathogen cell numbers than traditional culture methods.

  16. Absolute quantification of Aggregatibacter actinomycetemcomitans in patients carrying haplotypes associated with susceptibility to chronic periodontitis: multifaceted evaluation with periodontitis covariants.

    PubMed

    Cirelli, Thamiris; Finoti, Livia S; Corbi, Sâmia C T; Anovazzi, Giovana; Nepomuceno, Rafael; Orrico, Silvana R P; Cirelli, Joni A; Mayer, Márcia P A; Scarel-Caminaga, Raquel M

    2017-09-29

    This study aimed to evaluate the association between haplotypes in the interleukin 8 (IL8) and IL4 genes previously associated to chronic periodontitis (CP) and the levels of Aggregatibacter actinomycetemcomitans (A.a.) in subgingival sites of patients with and without CP. Moreover, multifaceted evaluations were made to search associations among patients' genetic background with the A.a. levels and previous clinical/immunological/microbiological findings. Subgingival sites (n = 596) of 104 patients were divided into susceptible to CP by the IL8 haplotype ATC/TTC (IL8+); non-susceptible to CP by the IL8 AGT/TTC (IL8-); susceptible to CP by the IL4 TCI/CCI (IL4+); protection against CP by the IL4 TTD/CTI (IL4-). Subgingival biofilm samples from diseased and healthy sites of CP patients and from control sites of health patients were obtained for absolute quantification of A.a. by quantitative real-time polymerase chain reaction. For diseased sites, samples were collected before and 45 days after periodontal treatment. The IL4 but not the IL8 haplotypes were associated with levels of A.a. (in both periods). After periodontal treatment, higher levels of A.a. were found in subgingival sites of (IL4-) patients, and higher levels of IL-4 were associated with deeper probing pockets in these same patients. Significant correlations were found among genetic (patients carrying IL8 or IL4 haplotypes), microbiological and immunological data showing the interrelationship of different factors in the CP. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. High sensitivity detection and quantitation of DNA copy number and single nucleotide variants with single color droplet digital PCR.

    PubMed

    Miotke, Laura; Lau, Billy T; Rumma, Rowza T; Ji, Hanlee P

    2014-03-04

    In this study, we present a highly customizable method for quantifying copy number and point mutations utilizing a single-color, droplet digital PCR platform. Droplet digital polymerase chain reaction (ddPCR) is rapidly replacing real-time quantitative PCR (qRT-PCR) as an efficient method of independent DNA quantification. Compared to quantative PCR, ddPCR eliminates the needs for traditional standards; instead, it measures target and reference DNA within the same well. The applications for ddPCR are widespread including targeted quantitation of genetic aberrations, which is commonly achieved with a two-color fluorescent oligonucleotide probe (TaqMan) design. However, the overall cost and need for optimization can be greatly reduced with an alternative method of distinguishing between target and reference products using the nonspecific DNA binding properties of EvaGreen (EG) dye. By manipulating the length of the target and reference amplicons, we can distinguish between their fluorescent signals and quantify each independently. We demonstrate the effectiveness of this method by examining copy number in the proto-oncogene FLT3 and the common V600E point mutation in BRAF. Using a series of well-characterized control samples and cancer cell lines, we confirmed the accuracy of our method in quantifying mutation percentage and integer value copy number changes. As another novel feature, our assay was able to detect a mutation comprising less than 1% of an otherwise wild-type sample, as well as copy number changes from cancers even in the context of significant dilution with normal DNA. This flexible and cost-effective method of independent DNA quantification proves to be a robust alternative to the commercialized TaqMan assay.

  18. Applicability of the quantification of genetically modified organisms to foods processed from maize and soy.

    PubMed

    Yoshimura, Tomoaki; Kuribara, Hideo; Matsuoka, Takeshi; Kodama, Takashi; Iida, Mayu; Watanabe, Takahiro; Akiyama, Hiroshi; Maitani, Tamio; Furui, Satoshi; Hino, Akihiro

    2005-03-23

    The applicability of quantifying genetically modified (GM) maize and soy to processed foods was investigated using heat treatment processing models. The detection methods were based on real-time quantitative polymerase chain reaction (PCR) analysis. Ground seeds of insect resistant GM maize (MON810) and glyphosate tolerant Roundup Ready (RR) soy were dissolved in water and were heat treated by autoclaving for various time intervals. The calculated copy numbers of the recombinant and taxon specific deoxyribonucleic acid (DNA) sequences in the extracted DNA solution were found to decrease with time. This decrease was influenced by the PCR-amplified size. The conversion factor (Cf), which is the ratio of the recombinant DNA sequence to the taxon specific DNA sequence and is used as a constant number for calculating GM% at each event, tended to be stable when the sizes of PCR products of two DNA sequences were nearly equal. The results suggested that the size of the PCR product plays a key role in the quantification of GM organisms in processed foods. It is believed that the Cf of the endosperm (3n) is influenced by whether the GM originated from a paternal or maternal source. The embryos and endosperms were separated from the F1 generation seeds of five GM maize events, and their Cf values were measured. Both paternal and maternal GM events were identified. In these, the endosperm Cf was lower than that of the embryo, and the embryo Cf was lower than that of the endosperm. These results demonstrate the difficulties encountered in the determination of GM% in maize grains (F2 generation) and in processed foods from maize and soy.

  19. Quantification and spread of Pneumocystis jirovecii in the surrounding air of patients with Pneumocystis pneumonia.

    PubMed

    Choukri, Firas; Menotti, Jean; Sarfati, Claudine; Lucet, Jean-Christophe; Nevez, Gilles; Garin, Yves J F; Derouin, Francis; Totet, Anne

    2010-08-01

    Airborne transmission of Pneumocystis has been demonstrated in animal models and is highly probable in humans. However, information concerning burdens of Pneumocystis jirovecii (human-derived Pneumocystis) in exhaled air from infected patients is lacking. Our objective is to evaluate P. jirovecii air diffusion in patients with Pneumocystis pneumonia. Patients admitted with Pneumocystis pneumonia were prospectively enrolled from 9 January 2008 to 21 July 2009. Air samples (1.5 m(3)) were collected on liquid medium with a commercial sampler at 1-, 3-, 5-, and 8-m distances from patients' heads. Air control samples were collected away from Pneumocystis pneumonia patient wards and outdoors. Samples were examined for P. jirovecii detection and quantification using a real-time polymerase chain reaction assay targeting the mitochondrial large subunit ribosomal RNA gene. Forty patients were diagnosed as having Pneumocystis pneumonia. Air sampling was performed in the environment for 19 of them. At a 1-m distance from patients' heads, P. jirovecii DNA was detected in 15 (79.8%) of 19 patients, with fungal burdens ranging from 7.5 X 10³ to 4.5 X 10⁶ gene copies/m(3). These levels decreased with distance from the patients (P < .002). Nevertheless, 4 (33.3%) of the 12 samples taken at 8 m, in the corridor adjacent to their room, were still positive. Forty control samples were collected and remained negative. This study provides the first quantitative data on the spread of P. jirovecii in exhaled air from infected patients. It sustains the risk of P. jirovecii direct transmission in close contact with patients with Pneumocystis pneumonia and leads the way for initiating a quantitative risk assessment for airborne transmission of P. jirovecii.

  20. Correction of the lack of commutability between plasmid DNA and genomic DNA for quantification of genetically modified organisms using pBSTopas as a model.

    PubMed

    Zhang, Li; Wu, Yuhua; Wu, Gang; Cao, Yinglong; Lu, Changming

    2014-10-01

    Plasmid calibrators are increasingly applied for polymerase chain reaction (PCR) analysis of genetically modified organisms (GMOs). To evaluate the commutability between plasmid DNA (pDNA) and genomic DNA (gDNA) as calibrators, a plasmid molecule, pBSTopas, was constructed, harboring a Topas 19/2 event-specific sequence and a partial sequence of the rapeseed reference gene CruA. Assays of the pDNA showed similar limits of detection (five copies for Topas 19/2 and CruA) and quantification (40 copies for Topas 19/2 and 20 for CruA) as those for the gDNA. Comparisons of plasmid and genomic standard curves indicated that the slopes, intercepts, and PCR efficiency for pBSTopas were significantly different from CRM Topas 19/2 gDNA for quantitative analysis of GMOs. Three correction methods were used to calibrate the quantitative analysis of control samples using pDNA as calibrators: model a, or coefficient value a (Cva); model b, or coefficient value b (Cvb); and the novel model c or coefficient formula (Cf). Cva and Cvb gave similar estimated values for the control samples, and the quantitative bias of the low concentration sample exceeded the acceptable range within ±25% in two of the four repeats. Using Cfs to normalize the Ct values of test samples, the estimated values were very close to the reference values (bias -13.27 to 13.05%). In the validation of control samples, model c was more appropriate than Cva or Cvb. The application of Cf allowed pBSTopas to substitute for Topas 19/2 gDNA as a calibrator to accurately quantify the GMO.

Top