Sample records for chain reaction sequence

  1. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    USDA-ARS?s Scientific Manuscript database

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  2. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  3. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  4. Identification of Brucella spp. by using the polymerase chain reaction.

    PubMed Central

    Herman, L; De Ridder, H

    1992-01-01

    The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

  5. Problem-Solving Test: Pyrosequencing

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2013-01-01

    Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…

  6. [The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

    PubMed

    D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

    1993-01-01

    The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

  7. Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

    PubMed

    Zhou, Yu; Pearson, John E; Auerbach, Anthony

    2005-12-01

    We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

  8. [Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

    PubMed

    Harano, K; Harano, T; Kushida, Y; Ueda, S

    1991-08-01

    Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

  9. Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

    PubMed

    Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

    2005-03-01

    We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

  10. Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins

    NASA Astrophysics Data System (ADS)

    Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John

    2017-01-01

    DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.

  11. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  12. Combined subtraction hybridization and polymerase chain reaction amplification procedure for isolation of strain-specific Rhizobium DNA sequences.

    PubMed Central

    Bjourson, A J; Stone, C E; Cooper, J E

    1992-01-01

    A novel subtraction hybridization procedure, incorporating a combination of four separation strategies, was developed to isolate unique DNA sequences from a strain of Rhizobium leguminosarum bv. trifolii. Sau3A-digested DNA from this strain, i.e., the probe strain, was ligated to a linker and hybridized in solution with an excess of pooled subtracter DNA from seven other strains of the same biovar which had been restricted, ligated to a different, biotinylated, subtracter-specific linker, and amplified by polymerase chain reaction to incorporate dUTP. Subtracter DNA and subtracter-probe hybrids were removed by phenol-chloroform extraction of a streptavidin-biotin-DNA complex. NENSORB chromatography of the sequences remaining in the aqueous layer captured biotinylated subtracter DNA which may have escaped removal by phenol-chloroform treatment. Any traces of contaminating subtracter DNA were removed by digestion with uracil DNA glycosylase. Finally, remaining sequences were amplified by polymerase chain reaction with a probe strain-specific primer, labelled with 32P, and tested for specificity in dot blot hybridizations against total genomic target DNA from each strain in the subtracter pool. Two rounds of subtraction-amplification were sufficient to remove cross-hybridizing sequences and to give a probe which hybridized only with homologous target DNA. The method is applicable to the isolation of DNA and RNA sequences from both procaryotic and eucaryotic cells. Images PMID:1637166

  13. Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

    PubMed

    Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

    2011-03-14

    Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Vertebral Osteomyelitis Caused by Helicobacter cinaedi Identified Using Broad-range Polymerase Chain Reaction with Sequencing of the Biopsied Specimen.

    PubMed

    Hase, Ryota; Hirooka, Takuya; Itabashi, Takashi; Endo, Yasunobu; Otsuka, Yoshihito

    2018-05-15

    A 65-year-old man presented with gradually exacerbating low back pain. Magnetic resonance imaging revealed vertebral osteomyelitis in the Th11-L2 vertebral bodies and discs. The patient showed negative findings on conventional cultures. Direct broad-range polymerase chain reaction (PCR) with sequencing of the biopsied specimen had the highest similarity to the 16S rRNA gene of Helicobacter cinaedi. This case suggests that direct broad-range PCR with sequencing should be considered when conventional cultures cannot identify the causative organism of vertebral osteomyelitis, and that this method may be particularly useful when the pathogen is a fastidious organism, such as H. cinaedi.

  15. Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

    PubMed Central

    Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

    2006-01-01

    Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

  16. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    PubMed

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  17. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  18. Sequences of heavy and light chain variable regions from four bovine immunoglobulins.

    PubMed

    Armour, K L; Tempest, P R; Fawcett, P H; Fernie, M L; King, S I; White, P; Taylor, G; Harris, W J

    1994-12-01

    Oligodeoxyribonucleotide primers based on the 5' ends of bovine IgG1/2 and lambda constant (C) region genes, together with primers encoding conserved amino acids at the N-terminus of mature variable (V) regions from other species, have been used in cDNA and polymerase chain reactions (PCRs) to amplify heavy and light chain V region cDNA from bovine heterohybridomas. The amino acid sequences of VH and V lambda from four bovine immunoglobulins of different specificities are presented.

  19. Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

    DOEpatents

    Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

    2001-01-01

    Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

  20. T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

    PubMed

    Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

    2012-01-01

    Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

  1. Population Based Assessment of MHC Class 1 Antigens Down Regulation as Marker in Increased Risk for Development and Progression of Breast Cancer From Benign Breast Lesions

    DTIC Science & Technology

    2006-01-01

    isolated using a routine salting-out method (DNA E-Z Prepkit, Orchid Diagnostics Europe, St Katelijne Waver, Belgium). Sequence based typing In...electrophoresis using ethidiumbromide to show the single 2 KB band before sequencing. Next, sequencing reactions were performed separately for exons 2, 3...Multiplex reverse transcription-polymerase chain reaction for simultaneous screening of 29 translocations and chromosomal aberrations in acute

  2. A novel gammaherpesvirus in a large flying fox (Pteropus vampyrus) with blepharitis.

    PubMed

    Paige Brock, A; Cortés-Hinojosa, Galaxia; Plummer, Caryn E; Conway, Julia A; Roff, Shannon R; Childress, April L; Wellehan, James F X

    2013-05-01

    A novel gammaherpesvirus was identified in a large flying fox (Pteropus vampyrus) with conjunctivitis, blepharitis, and meibomianitis by nested polymerase chain reaction and sequencing. Polymerase chain reaction amplification and sequencing of 472 base pairs of the DNA-dependent DNA polymerase gene were used to identify a novel herpesvirus. Bayesian and maximum likelihood phylogenetic analyses indicated that the virus is a member of the genus Percavirus in the subfamily Gammaherpesvirinae. Additional research is needed regarding the association of this virus with conjunctivitis and other ocular pathology. This virus may be useful as a biomarker of stress and may be a useful model of virus recrudescence in Pteropus spp.

  3. Molecular testing for familial hypercholesterolaemia-associated mutations in a UK-based cohort: development of an NGS-based method and comparison with multiplex polymerase chain reaction and oligonucleotide arrays.

    PubMed

    Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K

    2016-11-01

    Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.

  4. First report of Cocksfoot mottle virus infecting wheat (Triticum aestivum) in Ohio

    USDA-ARS?s Scientific Manuscript database

    Cocksfoot mottle virus (CfMV) was discovered in Ohio wheat during a 2016 field survey utilizing RNA-Seq to identify virus-like sequences. Virus sequences were confirmed by reverse transcriptase-polymerase chain reaction (RT-PCR) and Sanger sequencing, and CfMV was transmitted to orchardgrass and pas...

  5. A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

    PubMed

    Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

    2008-09-01

    Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

  6. No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

    PubMed

    D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

    2006-10-01

    Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

  7. High-throughput amplification of mature microRNAs in uncharacterized animal models using polyadenylated RNA and stem-loop reverse transcription polymerase chain reaction.

    PubMed

    Biggar, Kyle K; Wu, Cheng-Wei; Storey, Kenneth B

    2014-10-01

    This study makes a significant advancement on a microRNA amplification technique previously used for expression analysis and sequencing in animal models without annotated mature microRNA sequences. As research progresses into the post-genomic era of microRNA prediction and analysis, the need for a rapid and cost-effective method for microRNA amplification is critical to facilitate wide-scale analysis of microRNA expression. To facilitate this requirement, we have reoptimized the design of amplification primers and introduced a polyadenylation step to allow amplification of all mature microRNAs from a single RNA sample. Importantly, this method retains the ability to sequence reverse transcription polymerase chain reaction (RT-PCR) products, validating microRNA-specific amplification. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Basic quantitative polymerase chain reaction using real-time fluorescence measurements.

    PubMed

    Ares, Manuel

    2014-10-01

    This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.

  9. DNA Sequences from Formalin-Fixed Nematodes: Integrating Molecular and Morphological Approaches to Taxonomy

    PubMed Central

    Thomas, W. Kelley; Vida, J. T.; Frisse, Linda M.; Mundo, Manuel; Baldwin, James G.

    1997-01-01

    To effectively integrate DNA sequence analysis and classical nematode taxonomy, we must be able to obtain DNA sequences from formalin-fixed specimens. Microdissected sections of nematodes were removed from specimens fixed in formalin, using standard protocols and without destroying morphological features. The fixed sections provided sufficient template for multiple polymerase chain reaction-based DNA sequence analyses. PMID:19274156

  10. Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

    PubMed

    Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

    2011-11-01

    The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  11. A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

    PubMed Central

    Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

    2008-01-01

    Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880

  12. Molecular diagnostics of periodontitis.

    PubMed

    Korona-Głowniak, Izabela; Siwiec, Radosław; Berger, Marcin; Malm, Anna; Szymańska, Jolanta

    2017-01-28

    The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host's health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization) come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR), real-time polymerase chain reaction (real-time PCR), 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), as well as terminal restriction fragment length polymorphism (TRFLP) and next generation sequencing (NGS). The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.

  13. Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

    PubMed Central

    deWit, D; Wootton, M; Allan, B; Steyn, L

    1993-01-01

    A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

  14. New single-copy nuclear genes for scale insect systematics

    USDA-ARS?s Scientific Manuscript database

    Despite the advent of next-generation sequencing, the polymerase chain reaction (PCR) and Sanger sequencing remain useful tools for molecular identification and systematics. To date, molecular systematics of scale insects has been constrained by the paucity of loci that researchers have been able to...

  15. Detection and identification of cutaneous leishmaniasis isolates by culture, Polymerase chain reaction and sequence analyses in Syrian and Central Anatolia patients.

    PubMed

    Beyhan, Yunus E; Karakus, Mehmet; Karagoz, Alper; Mungan, Mesut; Ozkan, Aysegul T; Hokelek, Murat

    2017-09-01

    To characterize the cutaneous leishmaniasis (CL) isolates of Syrian and Central Anatolia patients at species levels. Methods: Skin scrapings of 3 patients (2 Syrian, 1 Turkish) were taken and examined by direct examination, culture in Novy-MacNeal-Nicole (NNN) medium, internal transcribed spacer polymerase chain reaction and sequence analysis (PCR). Results:According to microscopic examination, culture and PCR methods, 3 samples were detected positive. The sequencing results of all isolates in the study were identified as Leishmania tropica. The same genotypes were detected in the 3 isolates and nucleotide sequence submitted into GenBank with the accession number: KP689599. Conclusion: This finding could give information about the transmission of CL between Turkey and Syria. Because of the Syrian civil war, most of the Syrian citizens circulating in Turkey and different part of Europe, this can be increase the risk of spreading the disease. So, prevention measurements must be taken urgently.

  16. Targeting Conserved Genes in Penicillium Species.

    PubMed

    Peterson, Stephen W

    2017-01-01

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of dideoxynucleotide-labeled fragments or NGS. The sequences are compared to a database of validated isolates. Identification of species indicates the potential of the fungus to make particular mycotoxins.

  17. Design and synthesis of digitally encoded polymers that can be decoded and erased

    NASA Astrophysics Data System (ADS)

    Roy, Raj Kumar; Meszynska, Anna; Laure, Chloé; Charles, Laurence; Verchin, Claire; Lutz, Jean-François

    2015-05-01

    Biopolymers such as DNA store information in their chains using controlled sequences of monomers. Here we describe a non-natural information-containing macromolecule that can store and retrieve digital information. Monodisperse sequence-encoded poly(alkoxyamine amide)s were synthesized using an iterative strategy employing two chemoselective steps: the reaction of a primary amine with an acid anhydride and the radical coupling of a carbon-centred radical with a nitroxide. A binary code was implemented in the polymer chains using three monomers: one nitroxide spacer and two interchangeable anhydrides defined as 0-bit and 1-bit. This methodology allows encryption of any desired sequence in the chains. Moreover, the formed sequences are easy to decode using tandem mass spectrometry. Indeed, these polymers follow predictable fragmentation pathways that can be easily deciphered. Moreover, poly(alkoxyamine amide)s are thermolabile. Thus, the digital information encrypted in the chains can be erased by heating the polymers in the solid state or in solution.

  18. Design and synthesis of digitally encoded polymers that can be decoded and erased.

    PubMed

    Roy, Raj Kumar; Meszynska, Anna; Laure, Chloé; Charles, Laurence; Verchin, Claire; Lutz, Jean-François

    2015-05-26

    Biopolymers such as DNA store information in their chains using controlled sequences of monomers. Here we describe a non-natural information-containing macromolecule that can store and retrieve digital information. Monodisperse sequence-encoded poly(alkoxyamine amide)s were synthesized using an iterative strategy employing two chemoselective steps: the reaction of a primary amine with an acid anhydride and the radical coupling of a carbon-centred radical with a nitroxide. A binary code was implemented in the polymer chains using three monomers: one nitroxide spacer and two interchangeable anhydrides defined as 0-bit and 1-bit. This methodology allows encryption of any desired sequence in the chains. Moreover, the formed sequences are easy to decode using tandem mass spectrometry. Indeed, these polymers follow predictable fragmentation pathways that can be easily deciphered. Moreover, poly(alkoxyamine amide)s are thermolabile. Thus, the digital information encrypted in the chains can be erased by heating the polymers in the solid state or in solution.

  19. Geographic variation in marine turtle fibropapillomatosis

    USGS Publications Warehouse

    Greenblatt, R.J.; Work, Thierry M.; Dutton, P.; Sutton, C.A.; Spraker, T.R.; Casey, R.N.; Diez, C.E.; Parker, Dana C.; St. Ledger, J.; Balazs, G.H.; Casey, J.W.

    2005-01-01

    We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

  20. Geographic variation in marine turtle fibropapillomatosis.

    PubMed

    Greenblatt, Rebecca J; Work, Thierry M; Dutton, Peter; Sutton, Claudia A; Spraker, Terry R; Casey, Rufina N; Diez, Carlos E; Parker, Denise; St Leger, Judy; Balazs, George H; Casey, James W

    2005-09-01

    We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

  1. Molecular identification of Mango, Mangifera indica L.var. totupura

    PubMed Central

    Jagarlamudi, Sankar; G, Rosaiah; Kurapati, Ravi Kumar; Pinnamaneni, Rajasekhar

    2011-01-01

    Mango (>Mangifera indica) belonging to Anacardiaceae family is a fruit that grows in tropical regions. It is considered as the King of fruits. The present work was taken up to identify a tool in identifying the mango species at the molecular level. The chloroplast trnL-F region was amplified from extracted total genomic DNA using the polymerase chain reaction (PCR) and sequenced. Sequence of the dominant DGGE band revealed that Mangifera indica in tested leaves was Mangifera indica (100% similarity to the ITS sequences of Mangifera indica). This sequence was deposited in NCBI with the accession no. GQ927757. Abbreviations AFLP - Amplified fragment length polymorphism , cpDNA - Chloroplast DNA, DDGE - Denaturing gradient gel electrophoresis, DNA - Deoxyribo nucleic acid, EDTA - Ethylenediamine tetraacetic acid, HCl - Hydrochloric acid, ISSR - Inter simple sequence repeats, ITS - Internal transcribed spacer, MATAB - Methyl Ammonium Bromide, Na2SO3 - Sodium sulphite, NaCl - Sodium chloride, NCBI - National Centre for Biotechnology Information, PCR - Polymerase chain reaction, PEG - Polyethylene glycol, RAPD - Randomly amplified polymorphic DNA, trnL-F - Transfer RNA genes start codon- termination codon. PMID:21423885

  2. Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

    PubMed

    Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

    1999-08-02

    Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

  3. Wheat-specific gene, ribosomal protein l21, used as the endogenous reference gene for qualitative and real-time quantitative polymerase chain reaction detection of transgenes.

    PubMed

    Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai

    2014-10-29

    Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.

  4. DNA-Templated Polymerization of Side-Chain-Functionalized Peptide Nucleic Acid Aldehydes

    PubMed Central

    Kleiner, Ralph E.; Brudno, Yevgeny; Birnbaum, Michael E.; Liu, David R.

    2009-01-01

    The DNA-templated polymerization of synthetic building blocks provides a potential route to the laboratory evolution of sequence-defined polymers with structures and properties not necessarily limited to those of natural biopolymers. We previously reported the efficient and sequence-specific DNA-templated polymerization of peptide nucleic acid (PNA) aldehydes. Here, we report the enzyme-free, DNA-templated polymerization of side-chain-functionalized PNA tetramer and pentamer aldehydes. We observed that the polymerization of tetramer and pentamer PNA building blocks with a single lysine-based side chain at various positions in the building block could proceed efficiently and sequence-specifically. In addition, DNA-templated polymerization also proceeded efficiently and in a sequence-specific manner with pentamer PNA aldehydes containing two or three lysine side chains in a single building block to generate more densely functionalized polymers. To further our understanding of side-chain compatibility and expand the capabilities of this system, we also examined the polymerization efficiencies of 20 pentamer building blocks each containing one of five different side-chain groups and four different side-chain regio- and stereochemistries. Polymerization reactions were efficient for all five different side-chain groups and for three of the four combinations of side-chain regio- and stereochemistries. Differences in the efficiency and initial rate of polymerization correlate with the apparent melting temperature of each building block, which is dependent on side-chain regio- and stereochemistry, but relatively insensitive to side-chain structure among the substrates tested. Our findings represent a significant step towards the evolution of sequence-defined synthetic polymers and also demonstrate that enzyme-free nucleic acid-templated polymerization can occur efficiently using substrates with a wide range of side-chain structures, functionalization positions within each building block, and functionalization densities. PMID:18341334

  5. NASBA: A detection and amplification system uniquely suited for RNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sooknanan, R.; Malek, L.T.

    1995-06-01

    The invention of PCR (polymerase chain reaction) has revolutionized our ability to amplify and manipulate a nucleic acid sequence in vitro. The commercial rewards of this revolution have driven the development of other nuclei acid amplification and detection methodologies. This has created an alphabet soup of technologies that use different amplification methods, including NASBA (nucleic acid sequence-based amplification), LCR (ligase chain reaction), SDA (strand displacement amplification), QBR (Q-beta replicase), CPR (cycling probe reaction), and bDNA (branched DNA). Despite the differences in their processes, these amplification systems can be separated into two broad categories based on how they achieve their goal:more » sequence-based amplification systems, such as PCR, NASBA, and SDA, amplify a target nucleic acid sequence. Signal-based amplification systems, such as LCR, QBR, CPR and bDNA, amplify or alter a signal from a detection reaction that is target-dependent. While the various methods have relative strengths and weaknesses, only NASBA offers the unique ability to homogeneously amplify an RNA analyte in the presence of homologous genomic DNA under isothermal conditions. Since the detection of RNA sequences almost invariably measures biological activity, it is an excellent prognostic indicator of activities as diverse as virus production, gene expression, and cell viability. The isothermal nature of the reaction makes NASBA especially suitable for large-scale manual screening. These features extend NASBA`s application range from research to commercial diagnostic applications. Field test kits are presently under development for human diagnostics as well as the burgeoning fields of food and environmental diagnostic testing. These developments suggest future integration of NASBA into robotic workstations for high-throughput screening as well. 17 refs., 1 tab.« less

  6. Identification of the bacterial etiology of culture-negative endocarditis by amplification and sequencing of a small ribosomal RNA gene.

    PubMed

    Khulordava, Irakli; Miller, Geraldine; Haas, David; Li, Haijing; McKinsey, Joel; Vanderende, Daniel; Tang, Yi-Wei

    2003-05-01

    We report two cases of culture-negative bacterial endocarditis in which the organisms were identified by amplification and sequencing of the bacterial 16S rRNA gene. These results support an important role for polymerase chain reaction followed by direct sequencing to determine the etiology of culture-negative bacterial endocarditis and to guide appropriate antimicrobial therapy.

  7. Isolation and characterization of microsatellite markers in Fraser fir (Abies fraseri)

    Treesearch

    S.A. Josserand; K.M. Potter; G. Johnson; J.A. Bowen; J. Frampton; C.D. Nelson

    2006-01-01

    We describe the isolation and characterization of 14 microsatellite loci from Fraser fir (Abies fraseri). These markers originated from cloned inserts enriched for DNA sequences containing tandem di- and tri-nucleotide repeats. In total, 36 clones were selected, sequenced and evaluated. Polymerase chain reaction (PCR) primers for 14 of these...

  8. The design of strain-specific polymerase chain reactions for discrimination of the racoon rabies virus strain from indigenous rabies viruses of Ontario.

    PubMed

    Nadin-Davis, S A; Huang, W; Wandeler, A I

    1996-03-01

    Since its recognition as a discrete epizootic in Florida in the early 1950s, the raccoon strain of rabies virus (RV) has spread over almost the entire eastern seaboard of the US and now threatens to enter the southernmost regions of Canada. To characterise this RV strain in more detail, nucleotide sequencing of the N and G genes, encoding the nucleoprotein and glycoprotein, respectively, of representative isolates has been undertaken. This sequence information generated a conserved restriction map of the N gene, thereby permitting unequivocal identification of this strain by molecular techniques. Comparisons of the predicted nucleoprotein and glycoprotein products with those of other RV strains identified a number of amino acid sequence variations conserved only in the raccoon strain. This information was used to design strain-specific primers targeted to the N gene sequences encoding these residues. The incorporation of these primers into a multiplex polymerase chain reaction (PCR) protocol permitted easy and rapid discrimination between the raccoon RV strain and indigenous Ontario RVs.

  9. A Combined Photochemical and Multicomponent Reaction Approach to Precision Oligomers.

    PubMed

    Konrad, Waldemar; Bloesser, Fabian R; Wetzel, Katharina S; Boukis, Andreas C; Meier, Michael A R; Barner-Kowollik, Christopher

    2018-03-07

    We introduce the convergent synthesis of linear monodisperse sequence-defined oligomers through a unique approach, combining the Passerini three-component reaction (P-3CR) and a Diels-Alder (DA) reaction based on photocaged dienes. A set of oligomers is prepared resting on a Passerini linker unit carrying an isocyano group for chain extension by P-3CR and a maleimide moiety for photoenol conjugation enabling a modular approach for chain growth. Monodisperse oligomers are accessible in a stepwise fashion by switching between both reaction types. Employing sebacic acid as a core unit allows the synthesis of a library of symmetric sequence-defined oligomers. The oligomers consist of alternating P-3CR and photoblocks with molecular weights up to 3532.16 g mol -1 , demonstrating the successful switching from P-3CR to photoenol conjugation. In-depth characterization was carried out including size-exclusion chromatography (SEC), high-resolution electrospray ionization mass spectrometry (ESI-MS) and NMR spectroscopy, evidencing the monodisperse nature of the precision oligomers. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

    PubMed

    Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

    2008-07-23

    A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

  11. The actin multigene family and livestock speciation using the polymerase chain reaction.

    PubMed

    Fairbrother, K S; Hopwood, A J; Lockley, A K; Bardsley, R G

    1998-01-01

    Actins constitute a family of highly-conserved multifunctional intracellular proteins, best known as myofibrillar components in striated muscle fibres. Most vertebrate genomes contain numerous actin genes with high sequence homology in protein coding regions but considerable variability in intron number and sizes. This genetic diversity can be utilised for livestock speciation purposes. The high sequence conservation has enabled a single pair of oligonucleotides to be used to prime the polymerase chain reaction (PCR) with DNA extracted from all animals so far studied. Multiple amplification products were obtained which on gel electrophoresis constituted characteristic species-specific 'fingerprints'. The patterns were reproducible, did not vary between individuals of the same breed or between different breeds within a species, and could be generated even from heat-processed muscle held at 120 degrees C for one hour. Given the capacity of PCR to amplify relatively short sequences in highly-degraded DNA, this approach may be suitable for authentication of processed meat products.

  12. Development of a polymerase chain reaction assay for the specific identification of Burkholderia mallei and differentiation from Burkholderia pseudomallei and other closely related Burkholderiaceae.

    PubMed

    Ulrich, Ricky L; Ulrich, Melanie P; Schell, Mark A; Kim, H Stanley; DeShazer, David

    2006-05-01

    Burkholderia mallei and Burkholderia pseudomallei, the etiologic agents responsible for glanders and melioidosis, respectively, are genetically and phenotypically similar and are category B biothreat agents. We used an in silico approach to compare the B. mallei ATCC 23344 and B. pseudomallei K96243 genomes to identify nucleotide sequences unique to B. mallei. Five distinct B. mallei DNA sequences and/or genes were identified and evaluated for polymerase chain reaction (PCR) assay development. Genomic DNAs from a collection of 31 B. mallei and 34 B. pseudomallei isolates, obtained from various geographic, clinical, and environmental sources over a 70-year period, were tested with PCR primers targeted for each of the B. mallei ATCC 23344-specific nucleotide sequences. Of the 5 chromosomal targets analyzed, only PCR primers designed to bimA(Bm) were specific for B. mallei. These primers were used to develop a rapid PCR assay for the definitive identification of B. mallei and differentiation from all other bacteria.

  13. DNA typing by microbead arrays and PCR-SSP: apparent false-negative or -positive hybridization or amplification signals disclose new HLA-B and -DRB1 alleles.

    PubMed

    Rahal, M; Kervaire, B; Villard, J; Tiercy, J-M

    2008-03-01

    Human leukocyte antigen (HLA) typing by polymerase chain reaction-sequence-specific oligonucleotide (PCR-SSO) hybridization on solid phase (microbead assay) or polymerase chain reaction-sequence-specific primers (PCR-SSP) requires interpretation softwares to detect all possible allele combinations. These programs propose allele calls by taking into account false-positive or false-negative signal(s). The laboratory has the option to validate typing results in the presence of strongly cross-reacting or apparent false-negative signals. Alternatively, these seemingly aberrant signals may disclose novel variants. We report here four new HLA-B (B*5620 and B*5716) and HLA-DRB1 alleles (DRB1*110107 and DRB1*1474) that were detected by apparent false-negative or -positive hybridization or amplification patterns, and ultimately resolved by sequencing. To avoid allele misassignments, a comprehensive evaluation of acquired data as documented in a quality assurance system is therefore required to confirm unambiguous typing interpretation.

  14. No implication of Simian virus 40 in pathogenesis of malignant pleural mesothelioma in Slovenia.

    PubMed

    Hmeljak, Julija; Kern, Izidor; Cör, Andrej

    2010-01-01

    Malignant mesothelioma is predominantly caused by asbestos exposure, although the association of Simian virus 40 in its pathogenesis is currently still under debate. Simian virus 40, a DNA rhesus monkey virus with oncogenic properties, accidentally contaminated early batches of polio vaccine in the 1960s. In the 1990s, viral sequences and proteins were discovered in several human tumors, which triggered research to find a link between Simian virus 40 and human cancers, especially malignant mesothelioma. The aim of our study was to establish an effective laboratory procedure for Simian virus 40 detection and to investigate the presence of Simian virus 40 DNA and small t antigen in mesothelioma samples from Slovenian patients. Paraffin-embedded malignant pleural mesothelioma specimens from 103 Slovenian patients were collected and used for total DNA isolation and real-time polymerase chain reaction for Simian virus 40 small t and large T DNA analysis. Special attention was devoted to primer design, good laboratory practice and polymerase chain reaction contamination prevention. Polymerase chain reaction products were sequenced and BLAST aligned. One 5 microm thick paraffin section from each patient's tissue block was stained with hematoxylin and eosin for histological typing and one for immunohistochemical detection of Simian virus 40 small t antigen using a monoclonal antibody against Simian virus 40 (Pab280). SV40-expressing Wi-38 cells were used as positive control in both PCR and immunohistochemistry. In real-time polymerase chain reaction analyses, only 4 samples gave products with primer pairs amplifying small t antigen and were inconsistent and poorly reproducible. BLAST alignment showed no homology with any deposited SV40 sequences. No immunopositive staining for SV40 small t antigen was found in any of the samples. We found no evidence of SV40 presence in tissue samples from 103 Slovenian patients with malignant pleural mesothelioma. Asbestos exposure remains the main risk factor for malignant pleural mesothelioma in Slovenia.

  15. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

    PubMed

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

    2009-01-01

    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  16. Development of the polymerase chain reaction for diagnosis of chancroid.

    PubMed Central

    Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

    1993-01-01

    The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

  17. Food Fish Identification from DNA Extraction through Sequence Analysis

    ERIC Educational Resources Information Center

    Hallen-Adams, Heather E.

    2015-01-01

    This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…

  18. Molecular implementation of molecular shift register memories

    NASA Technical Reports Server (NTRS)

    Beratan, David N. (Inventor); Onuchic, Jose N. (Inventor)

    1991-01-01

    An electronic shift register memory (20) at the molecular level is described. The memory elements are based on a chain of electron transfer molecules (22) and the information is shifted by photoinduced (26) electron transfer reactions. Thus, multi-step sequences of charge transfer reactions are used to move charge with high efficiency down a molecular chain. The device integrates compositions of the invention onto a VLSI substrate (36), providing an example of a molecular electronic device which may be fabricated. Three energy level schemes, molecular implementation of these schemes, optical excitation strategies, charge amplification strategies, and error correction strategies are described.

  19. A de novo transcriptome and valid reference genes for quantitative real-time PCR in Colaphellus bowringi.

    PubMed

    Tan, Qian-Qian; Zhu, Li; Li, Yi; Liu, Wen; Ma, Wei-Hua; Lei, Chao-Liang; Wang, Xiao-Ping

    2015-01-01

    The cabbage beetle Colaphellus bowringi Baly is a serious insect pest of crucifers and undergoes reproductive diapause in soil. An understanding of the molecular mechanisms of diapause regulation, insecticide resistance, and other physiological processes is helpful for developing new management strategies for this beetle. However, the lack of genomic information and valid reference genes limits knowledge on the molecular bases of these physiological processes in this species. Using Illumina sequencing, we obtained more than 57 million sequence reads derived from C. bowringi, which were assembled into 39,390 unique sequences. A Clusters of Orthologous Groups classification was obtained for 9,048 of these sequences, covering 25 categories, and 16,951 were assigned to 255 Kyoto Encyclopedia of Genes and Genomes pathways. Eleven candidate reference gene sequences from the transcriptome were then identified through reverse transcriptase polymerase chain reaction. Among these candidate genes, EF1α, ACT1, and RPL19 proved to be the most stable reference genes for different reverse transcriptase quantitative polymerase chain reaction experiments in C. bowringi. Conversely, aTUB and GAPDH were the least stable reference genes. The abundant putative C. bowringi transcript sequences reported enrich the genomic resources of this beetle. Importantly, the larger number of gene sequences and valid reference genes provide a valuable platform for future gene expression studies, especially with regard to exploring the molecular mechanisms of different physiological processes in this species.

  20. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

    PubMed

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

    2015-04-01

    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  1. Label-free technology for the amplified detection of microRNA based on the allosteric hairpin DNA switch and hybridization chain reaction.

    PubMed

    Cai, Sheng; Cao, Zhijuan; Lau, Choiwan; Lu, Jianzhong

    2014-11-21

    By using the allosteric hairpin DNA switch, a novel assay for the detection of microRNA (miRNA) let-7a via a hybridization chain reaction (HCR) was introduced. Briefly, the hairpin DNA switch probe is a single-stranded DNA consisting of a streptavidin (SA) aptamer sequence, a target binding sequence and a certain sequence that acts as a trigger of the HCR. In the presence of target let-7a, the hairpin DNA switch would open and expose the stem region sequences, where a part of this sequence acts as initiator sequence strands for the HCR and triggers a cascade of hybridization events that yields nicked double helices analogous to alternating copolymers, another part is the SA aptamer sequence which activates its binding affinity to SA on SA-coated magnetic particles. The hybridization event could be sensitively detected via an instantaneous derivatization reaction between a special chemiluminescence (CL) reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG) and the guanine nucleotides within the target, the hairpin DNA switch probe, and HCR helices to form an unstable CL intermediate for the generation of light. Our results show that the coupling of the hairpin DNA switch probe and the HCR for the amplified detection of let-7a achieves a better performance (e.g. wide linear response range: 0.1-1000 fmol, low detection limit: 0.1 fmol, and high specificity). Furthermore, this approach could be easily applied to the detection of let-7a in human lung cells, and extended to detect other types of miRNA and proteins such as PDGF based on aptamers. We believe such advancements will represent a significant step towards improved diagnostics and more personalized medical treatment.

  2. Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

    PubMed

    Adewale, B; Mafe, M A; Oyerinde, J P O

    2005-01-01

    Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

  3. Integrating DNA strand displacement circuitry to the nonlinear hybridization chain reaction.

    PubMed

    Zhang, Zhuo; Fan, Tsz Wing; Hsing, I-Ming

    2017-02-23

    Programmable and modular attributes of DNA molecules allow one to develop versatile sensing platforms that can be operated isothermally and enzyme-free. In this work, we present an approach to integrate upstream DNA strand displacement circuits that can be turned on by a sequence-specific microRNA analyte with a downstream nonlinear hybridization chain reaction for a cascading hyperbranched nucleic acid assembly. This system provides a two-step amplification strategy for highly sensitive detection of the miRNA analyte, conducive for multiplexed detection. Multiple miRNA analytes were tested with our integrated circuitry using the same downstream signal amplification setting, showing the decoupling of nonlinear self-assembly with the analyte sequence. Compared with the reported methods, our signal amplification approach provides an additional control module for higher-order DNA self-assembly and could be developed into a promising platform for the detection of critical nucleic-acid based biomarkers.

  4. Short-term application of dexamethasone on stem cells derived from human gingiva reduces the expression of RUNX2 and β-catenin.

    PubMed

    Kim, Bo-Bae; Kim, Minji; Park, Yun-Hee; Ko, Youngkyung; Park, Jun-Beom

    2017-06-01

    Objective Next-generation sequencing was performed to evaluate the effects of short-term application of dexamethasone on human gingiva-derived mesenchymal stem cells. Methods Human gingiva-derived stem cells were treated with a final concentration of 10 -7  M dexamethasone and the same concentration of vehicle control. This was followed by mRNA sequencing and data analysis, gene ontology and pathway analysis, quantitative real-time polymerase chain reaction of mRNA, and western blot analysis of RUNX2 and β-catenin. Results In total, 26,364 mRNAs were differentially expressed. Comparison of the results of dexamethasone versus control at 2 hours revealed that 7 mRNAs were upregulated and 25 mRNAs were downregulated. The application of dexamethasone reduced the expression of RUNX2 and β-catenin in human gingiva-derived mesenchymal stem cells. Conclusion The effects of dexamethasone on stem cells were evaluated with mRNA sequencing, and validation of the expression was performed with qualitative real-time polymerase chain reaction and western blot analysis. The results of this study can provide new insights into the role of mRNA sequencing in maxillofacial areas.

  5. Description of polymerase chain reaction and sequencing DNA Mycobacterium tuberculosis from specimen sputum of tuberculosis patients in Medan

    NASA Astrophysics Data System (ADS)

    Lily; Siregar, Y.; Ilyas, S.

    2018-03-01

    This study purposed to describe the product Polymerase Chain Reaction (PCR) and sequencing of DNA Mycobacterium (M.) tuberculosis from sputum of tuberculosis (TB) patients in Medan. Sputum was collected from patients that diagnosed with pulmonary TB by a physician. Specimen processed by PCR method of Li et al. and sequencing at Macrogen Laboratory. All of 12 product PCR were showed brightness bands at 126 base pair (bp). These results indicated similarity to the study of Li et al. Sequencing analysis showed the presence of a mutation and non-mutation groups of M. tuberculosis. The reference and outcome berange of the mutation and non-mutation of M. tuberculosis were 56-107, 59-85, 60-120 and 63-94, respectively. The percentage bp difference between the outcome and references for mutation and non-mutation were 3.448-6.569and 3.278-7.428%, respectively. In conclusion, the successful amplification of PCR products in a 1.5% agarose gel electrophoresis where all 12 sputa contained rpoB-positive M. tuberculosis and 0.644% difference was found between the outcome with reference bp of the mutation and non-mutation M. tuberculosis groups.

  6. Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

    PubMed

    Navarro, B; Daròs, J A; Flores, R

    1998-07-01

    A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

  7. Accuracy of Reaction Cross Section for Exotic Nuclei in Glauber Model Based on MCMC Diagnostics

    NASA Astrophysics Data System (ADS)

    Rueter, Keiti; Novikov, Ivan

    2017-01-01

    Parameters of a nuclear density distribution for an exotic nuclei with halo or skin structures can be determined from the experimentally measured reaction cross-section. In the presented work, to extract parameters such as nuclear size information for a halo and core, we compare experimental data on reaction cross-sections with values obtained using expressions of the Glauber Model. These calculations are performed using a Markov Chain Monte Carlo algorithm. We discuss the accuracy of the Monte Carlo approach and its dependence on k*, the power law turnover point in the discreet power spectrum of the random number sequence and on the lag-1 autocorrelation time of the random number sequence.

  8. Use of extremely short Förster resonance energy transfer probes in real-time polymerase chain reaction

    PubMed Central

    Kutyavin, Igor V.

    2013-01-01

    Described in the article is a new approach for the sequence-specific detection of nucleic acids in real-time polymerase chain reaction (PCR) using fluorescently labeled oligonucleotide probes. The method is based on the production of PCR amplicons, which fold into dumbbell-like secondary structures carrying a specially designed ‘probe-luring’ sequence at their 5′ ends. Hybridization of this sequence to a complementary ‘anchoring’ tail introduced at the 3′ end of a fluorescent probe enables the probe to bind to its target during PCR, and the subsequent probe cleavage results in the florescence signal. As it has been shown in the study, this amplicon-endorsed and guided formation of the probe-target duplex allows the use of extremely short oligonucleotide probes, up to tetranucleotides in length. In particular, the short length of the fluorescent probes makes possible the development of a ‘universal’ probe inventory that is relatively small in size but represents all possible sequence variations. The unparalleled cost-effectiveness of the inventory approach is discussed. Despite the short length of the probes, this new method, named Angler real-time PCR, remains highly sequence specific, and the results of the study indicate that it can be effectively used for quantitative PCR and the detection of polymorphic variations. PMID:24013564

  9. Hybridization chain reaction-based instantaneous derivatization technology for chemiluminescence detection of specific DNA sequences.

    PubMed

    Wang, Xin; Lau, Choiwan; Kai, Masaaki; Lu, Jianzhong

    2013-05-07

    We propose here a new amplifying strategy that uses hybridization chain reaction (HCR) to detect specific sequences of DNA, where stable DNA monomers assemble on the magnetic beads only upon exposure to a target DNA. Briefly, in the HCR process, two complementary stable species of hairpins coexist in solution until the introduction of initiator reporter strands triggers a cascade of hybridization events that yield nicked double helices analogous to alternating copolymers. Moreover, a "sandwich-type" detection strategy is employed in our design. Magnetic beads, which are functionalized with capture DNA, are reacted with the target, and sandwiched with the above nicked double helices. Then, chemiluminescence (CL) detection proceeds via an instantaneous derivatization reaction between a specific CL reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG), and the guanine nucleotides within the target DNA, reporter strands and DNA monomers for the generation of light. Our results clearly show that the amplification detection of specific sequences of DNA achieves a better performance (e.g. wide linear response range, low detection limit, and high specificity) as compared to the traditional sandwich type (capture/target/reporter) assays. Upon modification, the approach presented could be extended to detect other types of targets. We believe that this simple technique is promising for improving medical diagnosis and treatment.

  10. Discrimination of the Lactobacillus acidophilus group using sequencing, species-specific PCR and SNaPshot mini-sequencing technology based on the recA gene.

    PubMed

    Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling

    2012-10-01

    To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.

  11. Detection of nonauthorized genetically modified organisms using differential quantitative polymerase chain reaction: application to 35S in maize.

    PubMed

    Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves

    2008-05-15

    Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.

  12. Human metapneumovirus-associated hospital admissions over five consecutive epidemic seasons: evidence for alternating circulation of different genotypes.

    PubMed

    Apostoli, Paola; Zicari, Sonia; Lo Presti, Alessandra; Ciccozzi, Massimo; Ciotti, Marco; Caruso, Arnaldo; Fiorentini, Simona

    2012-03-01

    Human metapneumovirus (hMPV) is a pathogen of the respiratory tract with a worldwide distribution. The purpose of this study was to identify hMPV as the cause of acute respiratory diseases in children admitted at Spedali Civili, a public hospital in Brescia, Italy. Eight hundred forty-six nasopharyngeal aspirate samples negative for the presence of other common respiratory viruses were tested for the presence of hMPV RNA by reverse transcription-polymerase chain reaction. Of the 846 samples, 79 (9.3%) were positive for hMPV. Polymerase chain reaction products, obtained by amplification of the partial nucleotide sequence of gene F, were sequenced and compared with sequences deposited in GenBank. All four hMPV subtypes were identified, including the proposed subtype A2 sublineages "A" and "B". In successive epidemic seasons, large outbreaks of hMPV alternated with small outbreaks in a biannual pattern. This local study provides further evidence that hMPV infection should be considered as a reason for hospital admission for acute respiratory disease in children. Copyright © 2012 Wiley Periodicals, Inc.

  13. Saponin Biosynthesis in Saponaria vaccaria. cDNAs Encoding β-Amyrin Synthase and a Triterpene Carboxylic Acid Glucosyltransferase1[OA

    PubMed Central

    Meesapyodsuk, Dauenpen; Balsevich, John; Reed, Darwin W.; Covello, Patrick S.

    2007-01-01

    Saponaria vaccaria (Caryophyllaceae), a soapwort, known in western Canada as cowcockle, contains bioactive oleanane-type saponins similar to those found in soapbark tree (Quillaja saponaria; Rosaceae). To improve our understanding of the biosynthesis of these saponins, a combined polymerase chain reaction and expressed sequence tag approach was taken to identify the genes involved. A cDNA encoding a β-amyrin synthase (SvBS) was isolated by reverse transcription-polymerase chain reaction and characterized by expression in yeast (Saccharomyces cerevisiae). The SvBS gene is predominantly expressed in leaves. A S. vaccaria developing seed expressed sequence tag collection was developed and used for the isolation of a full-length cDNA bearing sequence similarity to ester-forming glycosyltransferases. The gene product of the cDNA, classified as UGT74M1, was expressed in Escherichia coli, purified, and identified as a triterpene carboxylic acid glucosyltransferase. UGT74M1 is expressed in roots and leaves and appears to be involved in monodesmoside biosynthesis in S. vaccaria. PMID:17172290

  14. Molecular Evidence of Bartonella Infection in Domestic Dogs from Algeria, North Africa, by Polymerase Chain Reaction (PCR)

    PubMed Central

    Kernif, Tahar; Aissi, Meriem; Doumandji, Salah-Eddine; Chomel, Bruno B.; Raoult, Didier; Bitam, Idir

    2010-01-01

    Bartonella species are being recognized as important bacterial human and canine pathogens, and are associated with multiple arthropod vectors. Bartonella DNA extracted from blood samples was obtained from domestic dogs in Algiers, Algeria. Polymerase chain reaction (PCR) and DNA sequence analyses of the ftsZ gene and the 16S-23S intergenic spacer region (ITS) were performed. Three Bartonella species: Bartonella vinsonii subsp. berkhoffii, Bartonella clarridgeiae, and Bartonells elizabethae were detected infecting Algerian dogs. To our knowledge, this study is the first report of detection by PCR amplification of Bartonella in dogs in North Africa. PMID:20682871

  15. DIFFERENTIATING HUMAN FROM ANIMAL ISOLATES OF CRYPTOSPORIDIUM PARVUM

    EPA Science Inventory

    We analyzed 9s Cryptosporidium parvum isolates from humans and animals by a polymerase chain reaction/restriction fragment length polymorphism method based on the thrombospondin-related anonymous protein 2 gene sequence. Used as a molecular marker, this method can differentiate ...

  16. Unknown sequence amplification: Application to in vitro genome walking in Chlamydia trachomatis L2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Copley, C.G.; Boot, C.; Bundell, K.

    1991-01-01

    A recently described technique, Chemical Genetics' unknown sequence amplification method, which requires only one specific oligonucleotide, has broadened the applicability of the polymerase chain reaction to DNA of unknown sequence. The authors have adapted this technique to the study of the genome of Chlamydia trachomatis, an obligate intracellular bacterium, and describe modifications that significantly improve the utility of this approach. These techniques allow for rapid genomic analysis entirely in vitro, using DNA of limited quantity of purity.

  17. A Motif in the Clathrin Heavy Chain Required for the Hsc70/Auxilin Uncoating Reaction

    PubMed Central

    Rapoport, Iris; Boll, Werner; Yu, Anan; Böcking, Till

    2008-01-01

    The 70-kDa heat-shock cognate protein (Hsc70) chaperone is an ATP-dependent “disassembly enzyme” for many subcellular structures, including clathrin-coated vesicles where it functions as an uncoating ATPase. Hsc70, and its cochaperone auxilin together catalyze coat disassembly. Like other members of the Hsp70 chaperone family, it is thought that ATP-bound Hsc70 recognizes the clathrin triskelion through an unfolded exposed hydrophobic segment. The best candidate is the unstructured C terminus (residues 1631–1675) of the heavy chain at the foot of the tripod below the hub, containing the sequence motif QLMLT, closely related to the sequence bound preferentially by the substrate groove of Hsc70 (Fotin et al., 2004b). To test this hypothesis, we generated in insect cells recombinant mammalian triskelions that in vitro form clathrin cages and clathrin/AP-2 coats exactly like those assembled from native clathrin. We show that coats assembled from recombinant clathrin are good substrates for ATP- and auxilin-dependent, Hsc70-catalyzed uncoating. Finally, we show that this uncoating reaction proceeds normally when the coats contain recombinant heavy chains truncated C-terminal to the QLMLT motif, but very inefficiently when the motif is absent. Thus, the QLMLT motif is required for Hsc-70–facilitated uncoating, consistent with the proposal that this sequence is a specific target of the chaperone. PMID:17978091

  18. USE OF TAQMAN TO ENUMERATE ENTEROCOCCUS FAECALIS IN WATER

    EPA Science Inventory

    The Polymerase Chain Reaction (PCR) has become a useful tool in the detection of microorganisms. However, conventional PCR is somewhat time-consuming considering that additional steps (e.g., gel electrophoresis and gene sequencing) are required to confirm the presence of the tar...

  19. Conservation of the sequence of the Alzheimer's disease amyloid peptide in dog, polar bear and five other mammals by cross-species polymerase chain reaction analysis.

    PubMed

    Johnstone, E M; Chaney, M O; Norris, F H; Pascual, R; Little, S P

    1991-07-01

    Neuritic plaque and cerebrovascular amyloid deposits have been detected in the aged monkey, dog, and polar bear and have rarely been found in aged rodents (Biochem. Biophy. Res. Commun., 12 (1984) 885-890; Proc. Natl. Acad. Sci. U.S.A., 82 (1985) 4245-4249). To determine if the primary structure of the 42-43 residue amyloid peptide is conserved in species that accumulate plaques, the region of the amyloid precursor protein (APP) cDNA that encodes the peptide region was amplified by the polymerase chain reaction and sequenced. The deduced amino acid sequence was compared to those species where amyloid accumulation has not been detected. The DNA sequences of dog, polar bear, rabbit, cow, sheep, pig and guinea pig were compared and a phylogenetic tree was generated. We conclude that the amino acid sequence of dog and polar bear and other mammals which may form amyloid plaques is conserved and the species where amyloid has not been detected (mouse, rat) may be evolutionarily a distinct group. In addition, the predicted secondary structure of mouse and rat amyloid that differs from that of amyloid bearing species is its lack of propensity to form a beta sheeted structure. Thus, a cross-species examination of the amyloid peptide may suggest what is essential for amyloid deposition.

  20. Isolation and characterization of DNA from archaeological bone.

    PubMed

    Hagelberg, E; Clegg, J B

    1991-04-22

    DNA was extracted from human and animal bones recovered from archaeological sites and mitochondrial DNA sequences were amplified from the extracts using the polymerase chain reaction. Evidence is presented that the amplified sequences are authentic and do not represent contamination by extraneous DNA. The results show that significant amounts of genetic information can survive for long periods in bone, and have important implications for evolutionary genetics, anthropology and forensic science.

  1. Two methods for construction of internal amplification controls for the detection of Escherichia coli O157 by polymerase chain reaction.

    PubMed

    Abdulmawjood, A; Roth, S; Bülte, M

    2002-10-01

    For the detection of food born bacteria by polymerase chain reaction (PCR) in food products, an internal amplification control (IAC) is required in order to prevent false negative results that might be caused by PCR inhibitors. In the present study, two IACs were constructed using two different methods. These IACs were designed in a way that the same primer pair can be used to amplify the target DNA and coamplify the IAC. The first IAC with a size of approximately 200 bp was constructed by deleting a part of the amplicon of the original target DNA (500 bp) between the two primer sites to produce an IAC smaller than the target DNA. The second IAC with a size of approximately 600 bp was synthesized in a one step PCR reaction. The primers used in this reaction possessed 5' over-hanging ends, which were identical to the primers used in the diagnostic reaction, whereas their 3' ends were complementary to the (pUC19) predetermined DNA sequence of defined length and sequence. The concentration of IACs appeared to be critical. Too much IAC DNA template would out-compete the target DNA template, thus giving a false negative result. However the use of an optimal IAC concentration increased the reliability of the PCR assays and appeared to be useful for food diagnostics.

  2. Design of multi-phase dynamic chemical networks

    NASA Astrophysics Data System (ADS)

    Chen, Chenrui; Tan, Junjun; Hsieh, Ming-Chien; Pan, Ting; Goodwin, Jay T.; Mehta, Anil K.; Grover, Martha A.; Lynn, David G.

    2017-08-01

    Template-directed polymerization reactions enable the accurate storage and processing of nature's biopolymer information. This mutualistic relationship of nucleic acids and proteins, a network known as life's central dogma, is now marvellously complex, and the progressive steps necessary for creating the initial sequence and chain-length-specific polymer templates are lost to time. Here we design and construct dynamic polymerization networks that exploit metastable prion cross-β phases. Mixed-phase environments have been used for constructing synthetic polymers, but these dynamic phases emerge naturally from the growing peptide oligomers and create environments suitable both to nucleate assembly and select for ordered templates. The resulting templates direct the amplification of a phase containing only chain-length-specific peptide-like oligomers. Such multi-phase biopolymer dynamics reveal pathways for the emergence, self-selection and amplification of chain-length- and possibly sequence-specific biopolymers.

  3. Development and in-house validation of the event-specific polymerase chain reaction detection methods for genetically modified soybean MON89788 based on the cloned integration flanking sequence.

    PubMed

    Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing

    2009-11-25

    Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.

  4. Biochemical Characterization of α‐Fetoprotein and Other Serum Proteins Produced by a Uterine Endometrial Adenocarcinoma

    PubMed Central

    Taketa, Kazuhisa; Azuma, Masaki; Yamamoto, Ritsu; Fujimoto, Seiichiro; Nishi, Shinzo

    1996-01-01

    A high serum α‐fetoprotein (AFP) level was found in a patient with endometrial adenocarcinoma of the uterus, which appeared to be hepatoid on histological examination. The AFP of this unusual patient was purified hy immunoaffinity chromatography and characterized. The electrophoretic profiles on sodium dodecyl sulfate‐polyacrylamide gel electrophoresis both before and after glycopeptidase F treatment were indistinguishable from those of a hepatoma AFP. This indicates that the patient's AFP was also composed of a single polypeptide chain of Mr 67,000 and an N‐linked sugar chain of Mr 3,000. Amino acid sequence analyses of this AFP, and of AFP from hepatoma and umbilical cord serum indicated that the N‐terminal sequences were essentially the same. The sequence, Arg‐Thr‐Leu‐His‐Arg‐Asn‐Glu‐Tyr‐Gly‐Ile, was slightly different from previous reports, but matched that deduced from the cDNA sequence. AFP isoforms due to microheterogeneity of the sugar chain were analyzed by lectin affinity electrophoresis using a series of lectins. The AFP isoform profiles were distinct from those of proteins derived from cord serum, hepatoma, yolk sac tumor and gastric cancer. The reverse‐transcription of RNA from the tumor tissue followed by a polymerase chain reaction using primers with AFP‐specific sequences gave a product of the size and nucleotide sequence expected for AFP. mRNAs possessing the requisite sequences for albumin and transferrin syntheses were also detected in the tumor. The expression of these hepatocyte‐specific proteins supported the hepatoid nature of this tumor. PMID:8766525

  5. The Molecular Basis of Muscular Dystrophy in the mdx Mouse: A Point Mutation

    NASA Astrophysics Data System (ADS)

    Sicinski, Piotr; Geng, Yan; Ryder-Cook, Allan S.; Barnard, Eric A.; Darlison, Mark G.; Barnard, Pene J.

    1989-06-01

    The mdx mouse is an X-linked myopathic mutant, an animal model for human Duchenne muscular dystrophy. In both mouse and man the mutations lie within the dystrophin gene, but the phenotypic differences of the disease in the two species confer much interest on the molecular basis of the mdx mutation. The complementary DNA for mouse dystrophin has been cloned, and the sequence has been used in the polymerase chain reaction to amplify normal and mdx dystrophin transcripts in the area of the mdx mutation. Sequence analysis of the amplification products showed that the mdx mouse has a single base substitution within an exon, which causes premature termination of the polypeptide chain.

  6. Molecular Diagnostic Analysis of Outbreak Scenarios

    ERIC Educational Resources Information Center

    Morsink, M. C.; Dekter, H. E.; Dirks-Mulder, A.; van Leeuwen, W. B.

    2012-01-01

    In the current laboratory assignment, technical aspects of the polymerase chain reaction (PCR) are integrated in the context of six different bacterial outbreak scenarios. The "Enterobacterial Repetitive Intergenic Consensus Sequence" (ERIC) PCR was used to analyze different outbreak scenarios. First, groups of 2-4 students determined optimal…

  7. Event specific qualitative and quantitative polymerase chain reaction detection of genetically modified MON863 maize based on the 5'-transgene integration sequence.

    PubMed

    Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing

    2005-11-30

    Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.

  8. Detection of trypanosomatid Phytomonas parasitic in plants by polymerase chain reaction amplification of small subunit ribosomal DNA.

    PubMed

    Teixeira, M M; Campaner, M; Camargo, E P

    1994-01-01

    To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.

  9. Diagnostic exercise: chronic vomiting in a dog.

    PubMed

    Ellis, A E; Brown, C A; Miller, D L

    2010-09-01

    An approximately one-and-a-half-year-old, neutered male, mixed-breed dog was presented for a chronic history of vomiting. Profuse diarrhea was also noted during examination. An exploratory laparotomy was performed, bone chips were removed from the stomach, and a raised, circular area of gastric mucosa was biopsied. Histologically, there was severe gastric cryptosporidiosis as well as numerous spiral bacteria, consistent with Helicobacter spp. Polymerase chain reaction revealed visible bands for the 18S ribosomal RNA gene for Cryptosporidium spp. The polymerase chain reaction product was sequenced and was found to be most similar to Cryptosporidium muris. Both the gastric location and the species of Cryptosporidium are unusual in a dog.

  10. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A [Albuquerque, NM; Palmisano, William A [Edgewood, NM

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  11. Integrative genomic mining for enzyme function to enable engineering of a non-natural biosynthetic pathway.

    PubMed

    Mak, Wai Shun; Tran, Stephen; Marcheschi, Ryan; Bertolani, Steve; Thompson, James; Baker, David; Liao, James C; Siegel, Justin B

    2015-11-24

    The ability to biosynthetically produce chemicals beyond what is commonly found in Nature requires the discovery of novel enzyme function. Here we utilize two approaches to discover enzymes that enable specific production of longer-chain (C5-C8) alcohols from sugar. The first approach combines bioinformatics and molecular modelling to mine sequence databases, resulting in a diverse panel of enzymes capable of catalysing the targeted reaction. The median catalytic efficiency of the computationally selected enzymes is 75-fold greater than a panel of naively selected homologues. This integrative genomic mining approach establishes a unique avenue for enzyme function discovery in the rapidly expanding sequence databases. The second approach uses computational enzyme design to reprogramme specificity. Both approaches result in enzymes with >100-fold increase in specificity for the targeted reaction. When enzymes from either approach are integrated in vivo, longer-chain alcohol production increases over 10-fold and represents >95% of the total alcohol products.

  12. Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction.

    PubMed

    Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I

    1999-07-01

    Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

  13. Bioinspired synthesis of pentalene-based chromophores from an oligoketone chain.

    PubMed

    Saito, Yuki; Higuchi, Masayuki; Yoshioka, Shota; Senboku, Hisanori; Inokuma, Yasuhide

    2018-04-24

    We report a bioinspired synthesis of 2,5-dihydropentalene-based chromophores from an aliphatic oligoketone bearing 1,3- and 1,4-diketone subunits. Unlike the natural polyketone sequence, fused five-membered rings were formed via an intramolecular aldol condensation. A subsequent Knoevenagel condensation reaction with malononitrile furnished a multiply cross-conjugated π-system with low-lying LUMO levels. Furthermore, pentalenes obtained from a non-conjugated aliphatic chain exhibited visible absorption and solid-state fluorescence.

  14. Sequence differences in the diagnostic region of the cysteine protease 8 gene of Tritrichomonas foetus parasites of cats and cattle.

    PubMed

    Sun, Zichen; Stack, Colin; Šlapeta, Jan

    2012-05-25

    In order to investigate the genetic variation between Tritrichomonas foetus from bovine and feline origins, cysteine protease 8 (CP8) coding sequence was selected as the polymorphic DNA marker. Direct sequencing of CP8 coding sequence of T. foetus from four feline isolates and two bovine isolates with polymerase chain reaction successfully revealed conserved nucleotide polymorphisms between feline and bovine isolates. These results provide useful information for CP8-based molecular differentiation of T. foetus genotypes. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. DNA capture elements for rapid detection and identification of biological agents

    NASA Astrophysics Data System (ADS)

    Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva

    2004-08-01

    DNA capture elements (DCEs; aptamers) are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. Reporter molecules were attached to the finished sequences. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. These DCEs have demonstrated specificity and sensitivity equal to or better than antibody.

  16. Detection of a putative novel adenovirus by PCR amplification, sequencing and phylogenetic characterisation of two gene fragments from formalin-fixed paraffin-embedded tissues of a cat diagnosed with disseminated adenovirus disease.

    PubMed

    Lakatos, Béla; Hornyák, Ákos; Demeter, Zoltán; Forgách, Petra; Kennedy, Frances; Rusvai, Miklós

    2017-12-01

    Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in formalin-fixed paraffin-embedded tissue samples of a cat that had suffered from disseminated adenovirus infection. The identity of the amplified products from the hexon and DNA-dependent DNA polymerase genes was confirmed by DNA sequencing. The sequences were clearly distinguishable from corresponding hexon and polymerase sequences of other mastadenoviruses, including human adenoviruses. These results suggest the possible existence of a distinct feline adenovirus.

  17. Generation of human Fab antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences.

    PubMed

    Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F

    2011-09-01

    The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human Fab (fragment antigen binding) antibody libraries. In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final Fab products that are used for cloning.

  18. Implementation of Amplicon Parallel Sequencing Leads to Improvement of Diagnosis and Therapy of Lung Cancer Patients.

    PubMed

    König, Katharina; Peifer, Martin; Fassunke, Jana; Ihle, Michaela A; Künstlinger, Helen; Heydt, Carina; Stamm, Katrin; Ueckeroth, Frank; Vollbrecht, Claudia; Bos, Marc; Gardizi, Masyar; Scheffler, Matthias; Nogova, Lucia; Leenders, Frauke; Albus, Kerstin; Meder, Lydia; Becker, Kerstin; Florin, Alexandra; Rommerscheidt-Fuss, Ursula; Altmüller, Janine; Kloth, Michael; Nürnberg, Peter; Henkel, Thomas; Bikár, Sven-Ernö; Sos, Martin L; Geese, William J; Strauss, Lewis; Ko, Yon-Dschun; Gerigk, Ulrich; Odenthal, Margarete; Zander, Thomas; Wolf, Jürgen; Merkelbach-Bruse, Sabine; Buettner, Reinhard; Heukamp, Lukas C

    2015-07-01

    The Network Genomic Medicine Lung Cancer was set up to rapidly translate scientific advances into early clinical trials of targeted therapies in lung cancer performing molecular analyses of more than 3500 patients annually. Because sequential analysis of the relevant driver mutations on fixated samples is challenging in terms of workload, tissue availability, and cost, we established multiplex parallel sequencing in routine diagnostics. The aim was to analyze all therapeutically relevant mutations in lung cancer samples in a high-throughput fashion while significantly reducing turnaround time and amount of input DNA compared with conventional dideoxy sequencing of single polymerase chain reaction amplicons. In this study, we demonstrate the feasibility of a 102 amplicon multiplex polymerase chain reaction followed by sequencing on an Illumina sequencer on formalin-fixed paraffin-embedded tissue in routine diagnostics. Analysis of a validation cohort of 180 samples showed this approach to require significantly less input material and to be more reliable, robust, and cost-effective than conventional dideoxy sequencing. Subsequently, 2657 lung cancer patients were analyzed. We observed that comprehensive biomarker testing provided novel information in addition to histological diagnosis and clinical staging. In 2657 consecutively analyzed lung cancer samples, we identified driver mutations at the expected prevalence. Furthermore we found potentially targetable DDR2 mutations at a frequency of 3% in both adenocarcinomas and squamous cell carcinomas. Overall, our data demonstrate the utility of systematic sequencing analysis in a clinical routine setting and highlight the dramatic impact of such an approach on the availability of therapeutic strategies for the targeted treatment of individual cancer patients.

  19. Evaluation of a Campylobacter fetus subspecies venerealis real-time quantitative polymerase chain reaction for direct analysis of bovine preputial samples

    PubMed Central

    Chaban, Bonnie; Chu, Shirley; Hendrick, Steven; Waldner, Cheryl; Hill, Janet E.

    2012-01-01

    The detection and subspeciation of Campylobacter fetus subsp. venerealis (CFV) from veterinary samples is important for both clinical and economic reasons. Campylobacter fetus subsp. venerealis is the causative agent of bovine genital campylobacteriosis, a venereal disease that can lead to serious reproductive problems in cattle, and strict international regulations require animals and animal products to be CFV-free for trade. This study evaluated methods reported in the literature for CFV detection and reports the translation of an extensively tested CFV-specific polymerase chain reaction (PCR) primer set; including the VenSF/VenSR primers and a real-time, quantitative PCR (qPCR) platform using SYBR Green chemistry. Three methods of preputial sample preparation for direct qPCR were evaluated and a heat lysis DNA extraction method was shown to allow for CFV detection at the level of approximately one cell equivalent per reaction (or 1.0 × 103 CFU/mL) from prepuce. The optimized sample preparation and qPCR protocols were then used to evaluate 3 western Canadian bull cohorts, which included 377 bulls, for CFV. The qPCR assay detected 11 positive bulls for the CFV-specific parA gene target. DNA sequence data confirmed the identity of the amplified product and revealed that positive samples were comprised of 2 sequence types; one identical to previously reported CFV parA gene sequences and one with a 9% sequence divergence. These results add valuable information towards our understanding of an important CFV subspeciation target and offer a significantly improved format for an internationally recognized PCR test. PMID:23277694

  20. Isolation of a full-length CC-NBS-LRR resistance gene analog candidate from sugar pine showing low nucleotide diversity.

    Treesearch

    K.D. Jermstad; L.A. Sheppard; B.B. Kinloch; A. Delfino-Mix; E.S. Ersoz; K.V. Krutovsky; D.B Neale

    2006-01-01

    The nucleotide-binding-site and leucine-rich-repeat (NBS–LRR) class of R proteins is abundant and widely distributed in plants. By using degenerate primers designed on the NBS domain in lettuce, we amplified sequences in sugar pine that shared sequence identity with many of the NBS–LRR class resistance genes catalogued in GenBank. The polymerase chain reaction products...

  1. Species specific identification of spore-producing microbes using the gene sequence of small acid-soluble spore coat proteins for amplification based diagnostics

    DOEpatents

    McKinney, Nancy

    2002-01-01

    PCR (polymerase chain reaction) primers for the detection of certain Bacillus species, such as Bacillus anthracis. The primers specifically amplify only DNA found in the target species and can distinguish closely related species. Species-specific PCR primers for Bacillus anthracis, Bacillus globigii and Clostridium perfringens are disclosed. The primers are directed to unique sequences within sasp (small acid soluble protein) genes.

  2. BIALLELIC POLYMORPHISM IN THE INTRON REGION OF B-TUBULIN GENE OF CRYPTOSPORIDIUM PARASITES

    EPA Science Inventory

    Nucleotide sequencing of polymerase chain reaction-amplified intron region of the Cryptosporidium parvum B-tubulin gene in 26 human and 15 animal isolates revealed distinct genetic polymorphism between the human and bovine genotypes. The separation of 2 genotypes of C. parvum is...

  3. DEVELOPMENT OF A MOLECULAR METHOD TO IDENTIFY HEPATITIS E VIRUS IN WATER

    EPA Science Inventory

    Hepatitis E virus (HEV) causes an infectious form of hepatitis associated with contaminated water. By analyzing the sequence of several HEV isolates, a reverse transciption-polymerase chain reaction method was developed and optimized that should be able to identify all of the kn...

  4. Artificial mismatch hybridization

    DOEpatents

    Guo, Zhen; Smith, Lloyd M.

    1998-01-01

    An improved nucleic acid hybridization process is provided which employs a modified oligonucleotide and improves the ability to discriminate a control nucleic acid target from a variant nucleic acid target containing a sequence variation. The modified probe contains at least one artificial mismatch relative to the control nucleic acid target in addition to any mismatch(es) arising from the sequence variation. The invention has direct and advantageous application to numerous existing hybridization methods, including, applications that employ, for example, the Polymerase Chain Reaction, allele-specific nucleic acid sequencing methods, and diagnostic hybridization methods.

  5. Generation of human scFv antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences.

    PubMed

    Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F

    2011-09-01

    The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human scFv (single chain antibody fragment) libraries using a short linker (GGSSRSS) or a long linker (GGSSRSSSSGGGGSGGGG). In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final scFv products that are used for cloning.

  6. Dynamics and control of DNA sequence amplification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marimuthu, Karthikeyan; Chakrabarti, Raj, E-mail: raj@pmc-group.com, E-mail: rajc@andrew.cmu.edu; Division of Fundamental Research, PMC Advanced Technology, Mount Laurel, New Jersey 08054

    2014-10-28

    DNA amplification is the process of replication of a specified DNA sequence in vitro through time-dependent manipulation of its external environment. A theoretical framework for determination of the optimal dynamic operating conditions of DNA amplification reactions, for any specified amplification objective, is presented based on first-principles biophysical modeling and control theory. Amplification of DNA is formulated as a problem in control theory with optimal solutions that can differ considerably from strategies typically used in practice. Using the Polymerase Chain Reaction as an example, sequence-dependent biophysical models for DNA amplification are cast as control systems, wherein the dynamics of the reactionmore » are controlled by a manipulated input variable. Using these control systems, we demonstrate that there exists an optimal temperature cycling strategy for geometric amplification of any DNA sequence and formulate optimal control problems that can be used to derive the optimal temperature profile. Strategies for the optimal synthesis of the DNA amplification control trajectory are proposed. Analogous methods can be used to formulate control problems for more advanced amplification objectives corresponding to the design of new types of DNA amplification reactions.« less

  7. A SIMPLE POLYMERASE CHAIN REACTION-SEQUENCING ANALYSIS CAPABLE OF IDENTIFYING MULTIPLE MEDICALLY RELEVANT FILAMENTOUS FUNGAL SPECIES

    EPA Science Inventory

    Due to the accumulating evidence that suggests that numerous unhealthy conditions in the indoor environment are the result of abnormal growth of the filamentous fungi (mold) in and on building surfaces, it is necessary to accurately determine the organisms responsible for these m...

  8. UW Team Reaches Out to Grade- and High-School Students.

    ERIC Educational Resources Information Center

    Hood, Leroy

    1994-01-01

    Describes an outreach program designed to expose high school students to cutting-edge science. High school students are provided with hands-on experience in molecular biology (polymerase chain reaction, restriction mapping, chromatography, gel electrophoresis, human DNA sequencing, etc.) and may have an opportunity to participate in the Human…

  9. Isolation and characterization of an AGAMOUS homolog from Fraxinus pennsylvanica

    Treesearch

    Ningxia Du; Paula M. Pijut

    2010-01-01

    An AGAMOUS homolog (FpAG) was isolated from green ash (Fraxinus pennsylvanica) using a reverse transcriptase polymerase chain reaction method. Southern blot analysis indicated that FpAG was present as a single-copy sequence in the genome of green ash. RNA accumulated in the reproductive tissues (female...

  10. A Practical Workshop for Generating Simple DNA Fingerprints of Plants

    ERIC Educational Resources Information Center

    Rouziere, A.-S.; Redman, J. E.

    2011-01-01

    Gel electrophoresis DNA fingerprints offer a graphical and visually appealing illumination of the similarities and differences between DNA sequences of different species and individuals. A polymerase chain reaction (PCR) and restriction digest protocol was designed to give high-school students the opportunity to generate simple fingerprints of…

  11. Checking of individuality by DNA profiling.

    PubMed

    Brdicka, R; Nürnberg, P

    1993-08-25

    A review of methods of DNA analysis used in forensic medicine for identification, paternity testing, etc. is provided. Among other techniques, DNA fingerprinting using different probes and polymerase chain reaction-based techniques such as amplified sequence polymorphisms and minisatellite variant repeat mapping are thoroughly described and both theoretical and practical aspects are discussed.

  12. In situ amplified electrochemical aptasensing for sensitive detection of adenosine triphosphate by coupling target-induced hybridization chain reaction with the assembly of silver nanotags.

    PubMed

    Zhou, Qian; Lin, Youxiu; Lin, Yuping; Wei, Qiaohua; Chen, Guonan; Tang, Dianping

    2016-01-01

    Biomolecular immobilization and construction of the sensing platform are usually crucial for the successful development of a high-efficiency detection system. Herein we report on a novel and label-free signal-amplified aptasensing for sensitive electrochemical detection of small molecules (adenosine triphosphate, ATP, used in this case) by coupling with target-induced hybridization chain reaction (HCR) and the assembly of electroactive silver nanotags. The system mainly consisted of two alternating hairpin probes, a partial-pairing trigger-aptamer duplex DNA and a capture probe immobilized on the electrode. Upon target ATP introduction, the analyte attacked the aptamer and released the trigger DNA, which was captured by capture DNA immobilized on the electrode to form a newly partial-pairing double-stranded DNA. Thereafter, the exposed domain at trigger DNA could be utilized as the initator strand to open the hairpin probes in sequence, and propagated a chain reaction of hybridization events between two alternating hairpins to form a long nicked double-helix. The electrochemical signal derived from the assembled silver nanotags on the nicked double-helix. Under optimal conditions, the electrochemical aptasensor could exhibit a high sensitivity and a low detection limit, and allowed the detection of ATP at a concentration as low as 0.03 pM. Our design showed a high selectivity for target ATP against its analogs because of the high-specificity ATP-aptamer reaction, and its applicable for monitoring ATP in the spiking serum samples. Improtantly, the distinct advantages of the developed aptasensor make it hold a great potential for the development of simple and robust sensing strategies for the detection of other small molecules by controlling the apatmer sequence. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Expression and mutational analysis of Cip/Kip family in early glottic cancer.

    PubMed

    Kim, D-K; Lee, J H; Lee, O J; Park, C H

    2015-02-01

    Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

  14. Development and validation of a novel hydrolysis probe real-time polymerase chain reaction for agamid adenovirus 1 in the central bearded dragon (Pogona vitticeps).

    PubMed

    Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X

    2015-03-01

    Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. © 2015 The Author(s).

  15. Molecular cloning and expression analysis of annexin A2 gene in sika deer antler tip.

    PubMed

    Xia, Yanling; Qu, Haomiao; Lu, Binshan; Zhang, Qiang; Li, Heping

    2018-04-01

    Molecular cloning and bioinformatics analysis of annexin A2 ( ANXA2 ) gene in sika deer antler tip were conducted. The role of ANXA2 gene in the growth and development of the antler were analyzed initially. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to clone the cDNA sequence of the ANXA2 gene from antler tip of sika deer ( Cervus Nippon hortulorum ) and the bioinformatics methods were applied to analyze the amino acid sequence of Anxa2 protein. The mRNA expression levels of the ANXA2 gene in different growth stages were examined by real time reverse transcriptase polymerase chain reaction (real time RT-PCR). The nucleotide sequence analysis revealed an open reading frame of 1,020 bp encoding 339 amino acids long protein of calculated molecular weight 38.6 kDa and isoelectric point 6.09. Homologous sequence alignment and phylogenetic analysis indicated that the Anxa2 mature protein of sika deer had the closest genetic distance with Cervus elaphus and Bos mutus . Real time RT-PCR results showed that the gene had differential expression levels in different growth stages, and the expression level of the ANXA2 gene was the highest at metaphase (rapid growing period). ANXA2 gene may promote the cell proliferation, and the finding suggested Anxa2 as an important candidate for regulating the growth and development of deer antler.

  16. Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

    PubMed

    Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

    2017-08-01

    The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

  17. Lateral flow nucleic acid biosensor for sensitive detection of microRNAs based on the dual amplification strategy of duplex-specific nuclease and hybridization chain reaction.

    PubMed

    Ying, Na; Ju, Chuanjing; Sun, Xiuwei; Li, Letian; Chang, Hongbiao; Song, Guangping; Li, Zhongyi; Wan, Jiayu; Dai, Enyong

    2017-01-01

    MicroRNAs (miRNAs) constitute novel biomarkers for various diseases. Accurate and quantitative analysis of miRNA expression is critical for biomedical research and clinical theranostics. In this study, a method was developed for sensitive and specific detection of miRNAs via dual signal amplification based on duplex specific nuclease (DSN) and hybridization chain reaction (HCR). A reporter probe (RP), comprising recognition sequence (3' end modified with biotin) for a target miRNA of miR-21 and capture sequence (5' end modified with Fam) for HCR product, was designed and synthesized. HCR was initiated by partial sequence of initiator probe (IP), the other part of which can hybridize with capture sequence of RP, and was assembled by hairpin probes modified with biotin (H1-bio and H2-bio). A miR-21 triggered cyclical DSN cleavage of RP, which was immobilized to a streptavidin (SA) coated magnetic bead (MB). The released Fam labeled capture sequence then hybridized with the HCR product to generate a detectable dsDNA. This polymer was then dropped on lateral flow strip and positive result was observed. The proposed method allowed quantitative sequence-specific detection of miR-21 (with a detection limit of 2.1 fM, S/N = 3) in a dynamic range from 100 fM to 100 pM, with an excellent ability to discriminate differences in miRNAs. The method showed acceptable testing recoveries for the determination of miRNAs in serum.

  18. Ubiquiter circovirus sequences raise challenges in laboratory diagnosis: the case of honey bee and bee mite, reptiles, and free living amoebae.

    PubMed

    Marton, Szilvia; Ihász, Katalin; Lengyel, György; Farkas, Szilvia L; Dán, Ádám; Paulus, Petra; Bányai, Krisztián; Fehér, Enikő

    2015-03-01

    Circoviruses of pigs and birds are established pathogens, however, the exact role of other, recently described circoviruses and circovirus-like viruses remains to be elucidated. The aim of this study was the detection of circoviruses in neglected host species, including honey bees, exotic reptiles and free-living amoebae by widely used broad-spectrum polymerase chain reaction (PCR) assays specific for the replication initiation protein coding gene of these viruses. The majority of sequences obtained from honey bees were highly similar to canine and porcine circoviruses, or, were distantly related to dragonfly cycloviruses. Other rep sequences detected in some honey bees, reptiles and amoebae showed similarities to various rep sequences deposited in the GenBank. Back-to-back PCR primers designed for the amplification of whole viral genomes failed to work that suggested the existence of integrated rep-like elements in many samples. Rolling circle amplification and exonuclease treatment confirmed the absence of small circular DNA genomes in the specimens analysed. In case of honey bees Varroa mite DNA contamination might be a source of the identified endogenous rep-like elements. The reptile and amoebae rep-like sequences were nearly identical with each other and with sequences detected in chimpanzee feces raising the possibility that detection of novel or unusual rep-like elements in some host species might originate from the microbial community of the host. Our results indicate that attention is needed when broad-spectrum rep gene specific polymerase chain reaction is chosen for laboratory diagnosis of circovirus infections.

  19. Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

    PubMed

    McMeel, O M; Hoey, E M; Ferguson, A

    2001-01-01

    The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

  20. Filling reference gaps via assembling DNA barcodes using high-throughput sequencing-moving toward barcoding the world.

    PubMed

    Liu, Shanlin; Yang, Chentao; Zhou, Chengran; Zhou, Xin

    2017-12-01

    Over the past decade, biodiversity researchers have dedicated tremendous efforts to constructing DNA reference barcodes for rapid species registration and identification. Although analytical cost for standard DNA barcoding has been significantly reduced since early 2000, further dramatic reduction in barcoding costs is unlikely because Sanger sequencing is approaching its limits in throughput and chemistry cost. Constraints in barcoding cost not only led to unbalanced barcoding efforts around the globe, but also prevented high-throughput sequencing (HTS)-based taxonomic identification from applying binomial species names, which provide crucial linkages to biological knowledge. We developed an Illumina-based pipeline, HIFI-Barcode, to produce full-length Cytochrome c oxidase subunit I (COI) barcodes from pooled polymerase chain reaction amplicons generated by individual specimens. The new pipeline generated accurate barcode sequences that were comparable to Sanger standards, even for different haplotypes of the same species that were only a few nucleotides different from each other. Additionally, the new pipeline was much more sensitive in recovering amplicons at low quantity. The HIFI-Barcode pipeline successfully recovered barcodes from more than 78% of the polymerase chain reactions that didn't show clear bands on the electrophoresis gel. Moreover, sequencing results based on the single molecular sequencing platform Pacbio confirmed the accuracy of the HIFI-Barcode results. Altogether, the new pipeline can provide an improved solution to produce full-length reference barcodes at about one-tenth of the current cost, enabling construction of comprehensive barcode libraries for local fauna, leading to a feasible direction for DNA barcoding global biomes. © The Authors 2017. Published by Oxford University Press.

  1. Novel Mutations in pncA Gene of Pyrazinamide Resistant Clinical Isolates of Mycobacterium tuberculosis.

    PubMed

    Kahbazi, Manijeh; Sarmadian, Hossein; Ahmadi, Azam; Didgar, Farshideh; Sadrnia, Maryam; Poolad, Toktam; Arjomandzadegan, Mohammad

    2018-04-16

    In clinical isolates of Mycobacterium tuberculosis (MTB), resistance to pyrazinamide occurs by mutations in any positions of the pncA gene (NC_000962.3) especially in nucleotides 359 and 374. In this study we examined the pncA gene sequence in clinical isolates of MTB. Genomic DNA of 33 clinical isolates of MTB was extracted by the Chelex100 method. The polymerase chain reactions (PCR) were performed using specific primers for amplification of 744 bp amplicon comprising the coding sequences (CDS) of the pncA gene. PCR products were sequenced by an automated sequencing Bioscience system. Additionally, semi Nested-allele specific (sNASP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods were carried out for verification of probable mutations in nucleotides 359 and 374. Sequencing results showed that from 33 MTB clinical isolates, nine pyrazinamide-resistant isolates have mutations. Furthermore, no mutation was detected in 24 susceptible strains in the entire 561 bp of the pncA gene. Moreover, new mutations of G→A at position 3 of the pncA gene were identified in some of the resistant isolates. Results showed that the sNASP method could detect mutations in nucleotide 359 and 374 of the pncA gene, but the PCR-RFLP method by the SacII enzyme could not detect these mutations. In conclusion, the identification of new mutations in the pncA gene confirmed the probable occurrence of mutations in any nucleotides of the pncA gene sequence in resistant isolates of MTB.

  2. Removal of inhibitor(s) of the polymerase chain reaction from formalin fixed, paraffin wax embedded tissues.

    PubMed

    An, S F; Fleming, K A

    1991-11-01

    A problem associated with use of the polymerase chain reaction to amplify specific DNA fragments from formalin fixed, paraffin wax embedded tissues is the not infrequent failure of amplification. One possible reason for this could be the presence of inhibitor(s), which interfere with the activity of the reaction. It has been shown that such inhibitor(s) exist when amplifying the human beta globin gene (which exists in human genomic DNA as a single copy gene) from routine clinical samples. A variety of methods to remove such inhibitor(s) were investigated. The results indicate that inhibitor(s) are removed by proteinase K digestion, followed by purification with phenol/chloroform, and centrifugation through a Centricon-30 membrane (30,000 molecular weight cut off). Other factors, including the length and concentration of the DNA sequence to be amplified, can also affect amplification.

  3. Detection of human Pneumocystis carinii by the polymerase chain reaction.

    PubMed

    Becker-Hapak, M; Liberator, P; Graves, D

    1991-01-01

    Oligonucleotide primers were prepared from a clone (B12) which has been shown to be a repetitive sequence in the rat P. carinii genome. Polymerase chain reaction was employed to amplify both rat and human P. carinii DNA. The detection limit of the assay was approximately 600 ng of total nucleic acid. Amplification products from both the rat and human isolates (ca. 780 bp) were characterized by denaturing gradient gel electrophoresis after digestion with Sau3A. No amplification products were obtained when DNA from the following potential pulmonary pathogens were used in identical reactions: Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Mycobacterium avium-intracellulare and cytomegalovirus. In a blind study using the B12 primers, P. carinii DNA was successfully amplified in clinical samples which were positive by direct immunofluorescence assay (IFA) as well as in some specimens not identified by direct IFA.

  4. Polymerase chain displacement reaction.

    PubMed

    Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

    2013-02-01

    Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.

  5. Nanosilver-based surface-enhanced Raman spectroscopic determination of DNA methyltransferase activity through real-time hybridization chain reaction.

    PubMed

    Hu, Ping Ping; Liu, Hui; Zhen, Shu Jun; Li, Chun Mei; Huang, Cheng Zhi

    2015-11-15

    In this manuscript, a nanosilver enhanced SERS strategy was successfully constructed for the determination of DNA methyltransferase activity in soulution combined with hybridization chain reaction (HCR). The proposed method was mainly on the basis of excellent separation ability of magnetic microparticles (MMPs), HCR as signal amplification unit and assembled AgNPs as enhancement substrate. In the presence of M. SssI MTase, the duplex sequence (5'-CCGG-3') tethered to MMPs was methylated, which cannot be cleaved by HpaII endonuclease. The resulted DNA skeleton captured on MMPs then triggered the HCR reaction, generated a polymerized and extended symmetrical sequence, in which more biotin terminal was available for the conjugation of AgNPs-SA, leading to significantly amplified SERS response. When it was used to analyze M. SssI activity, a linear equation ∆ISERS=1215.32+446.80 cM.SssI was obtained with the M. SssI activity ranged from 0.1 to 10.0 U with the correlation coefficient (r(2)) of 0.97. The most important advantage of this method is the combination of SERS and HCR in solution for the first time and its good selectivity, which enabled the detection of even one-base mismatched sequence. The new assay method holds great promising application to be a versatile platform for sensitive, high-throughput detection, and the screening of new anticancer drugs on DNA MTase. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Gemi: PCR Primers Prediction from Multiple Alignments

    PubMed Central

    Sobhy, Haitham; Colson, Philippe

    2012-01-01

    Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117

  7. The complete mitochondrial genome of Lota lota (Gadiformes: Gadidae) from the Burqin River in China.

    PubMed

    Lu, Zhichuang; Zhang, Nan; Song, Na; Gao, Tianxiang

    2016-05-01

    In this study, the complete mitochondrial genome (mitogenome) sequence of Lota lota has been determined by long polymerase chain reaction and primer walking methods. The mitogenome is a circular molecule of 16,519 bp in length and contains 37 mitochondrial genes including 13 protein-coding genes, 2 ribosomal RNA (rRNA), 22 transfer RNA (tRNA) and a control region as other bony fishes. Within the control region, we identified the termination-associated sequence domain (TAS), the central conserved sequence block domains (CSB-F and CSB-D), and the conserved sequence block domains (CSB-1, CSB-2 and CSB-3).

  8. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.

    2000-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  9. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.

    2001-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  10. Next-generation sequencing library preparation method for identification of RNA viruses on the Ion Torrent Sequencing Platform.

    PubMed

    Chen, Guiqian; Qiu, Yuan; Zhuang, Qingye; Wang, Suchun; Wang, Tong; Chen, Jiming; Wang, Kaicheng

    2018-05-09

    Next generation sequencing (NGS) is a powerful tool for the characterization, discovery, and molecular identification of RNA viruses. There were multiple NGS library preparation methods published for strand-specific RNA-seq, but some methods are not suitable for identifying and characterizing RNA viruses. In this study, we report a NGS library preparation method to identify RNA viruses using the Ion Torrent PGM platform. The NGS sequencing adapters were directly inserted into the sequencing library through reverse transcription and polymerase chain reaction, without fragmentation and ligation of nucleic acids. The results show that this method is simple to perform, able to identify multiple species of RNA viruses in clinical samples.

  11. Accurate multiplex polony sequencing of an evolved bacterial genome.

    PubMed

    Shendure, Jay; Porreca, Gregory J; Reppas, Nikos B; Lin, Xiaoxia; McCutcheon, John P; Rosenbaum, Abraham M; Wang, Michael D; Zhang, Kun; Mitra, Robi D; Church, George M

    2005-09-09

    We describe a DNA sequencing technology in which a commonly available, inexpensive epifluorescence microscope is converted to rapid nonelectrophoretic DNA sequencing automation. We apply this technology to resequence an evolved strain of Escherichia coli at less than one error per million consensus bases. A cell-free, mate-paired library provided single DNA molecules that were amplified in parallel to 1-micrometer beads by emulsion polymerase chain reaction. Millions of beads were immobilized in a polyacrylamide gel and subjected to automated cycles of sequencing by ligation and four-color imaging. Cost per base was roughly one-ninth as much as that of conventional sequencing. Our protocols were implemented with off-the-shelf instrumentation and reagents.

  12. Rapid identification of fungal pathogens in BacT/ALERT, BACTEC, and BBL MGIT media using polymerase chain reaction and DNA sequencing of the internal transcribed spacer regions.

    PubMed

    Pryce, Todd M; Palladino, Silvano; Price, Diane M; Gardam, Dianne J; Campbell, Peter B; Christiansen, Keryn J; Murray, Ronan J

    2006-04-01

    We report a direct polymerase chain reaction/sequence (d-PCRS)-based method for the rapid identification of clinically significant fungi from 5 different types of commercial broth enrichment media inoculated with clinical specimens. Media including BacT/ALERT FA (BioMérieux, Marcy l'Etoile, France) (n = 87), BACTEC Plus Aerobic/F (Becton Dickinson, Microbiology Systems, Sparks, MD) (n = 16), BACTEC Peds Plus/F (Becton Dickinson) (n = 15), BACTEC Lytic/10 Anaerobic/F (Becton Dickinson) (n = 11) bottles, and BBL MGIT (Becton Dickinson) (n = 11) were inoculated with specimens from 138 patients. A universal DNA extraction method was used combining a novel pretreatment step to remove PCR inhibitors with a column-based DNA extraction kit. Target sequences in the noncoding internal transcribed spacer regions of the rRNA gene were amplified by PCR and sequenced using a rapid (24 h) automated capillary electrophoresis system. Using sequence alignment software, fungi were identified by sequence similarity with sequences derived from isolates identified by upper-level reference laboratories or isolates defined as ex-type strains. We identified Candida albicans (n = 14), Candida parapsilosis (n = 8), Candida glabrata (n = 7), Candida krusei (n = 2), Scedosporium prolificans (n = 4), and 1 each of Candida orthopsilosis, Candida dubliniensis, Candida kefyr, Candida tropicalis, Candida guilliermondii, Saccharomyces cerevisiae, Cryptococcus neoformans, Aspergillus fumigatus, Histoplasma capsulatum, and Malassezia pachydermatis by d-PCRS analysis. All d-PCRS identifications from positive broths were in agreement with the final species identification of the isolates grown from subculture. Earlier identification of fungi using d-PCRS may facilitate prompt and more appropriate antifungal therapy.

  13. [Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

    PubMed

    Wang, F; Zhang, Y Q; Ding, J; Yu, L X

    2017-10-18

    To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

  14. Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

    PubMed

    Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

    2000-12-01

    ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

  15. An improved and validated RNA HLA class I SBT approach for obtaining full length coding sequences.

    PubMed

    Gerritsen, K E H; Olieslagers, T I; Groeneweg, M; Voorter, C E M; Tilanus, M G J

    2014-11-01

    The functional relevance of human leukocyte antigen (HLA) class I allele polymorphism beyond exons 2 and 3 is difficult to address because more than 70% of the HLA class I alleles are defined by exons 2 and 3 sequences only. For routine application on clinical samples we improved and validated the HLA sequence-based typing (SBT) approach based on RNA templates, using either a single locus-specific or two overlapping group-specific polymerase chain reaction (PCR) amplifications, with three forward and three reverse sequencing reactions for full length sequencing. Locus-specific HLA typing with RNA SBT of a reference panel, representing the major antigen groups, showed identical results compared to DNA SBT typing. Alleles encountered with unknown exons in the IMGT/HLA database and three samples, two with Null and one with a Low expressed allele, have been addressed by the group-specific RNA SBT approach to obtain full length coding sequences. This RNA SBT approach has proven its value in our routine full length definition of alleles. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Multiplexed enrichment of rare DNA variants via sequence-selective and temperature-robust amplification

    PubMed Central

    Wu, Lucia R.; Chen, Sherry X.; Wu, Yalei; Patel, Abhijit A.; Zhang, David Yu

    2018-01-01

    Rare DNA-sequence variants hold important clinical and biological information, but existing detection techniques are expensive, complex, allele-specific, or don’t allow for significant multiplexing. Here, we report a temperature-robust polymerase-chain-reaction method, which we term blocker displacement amplification (BDA), that selectively amplifies all sequence variants, including single-nucleotide variants (SNVs), within a roughly 20-nucleotide window by 1,000-fold over wild-type sequences. This allows for easy detection and quantitation of hundreds of potential variants originally at ≤0.1% in allele frequency. BDA is compatible with inexpensive thermocycler instrumentation and employs a rationally designed competitive hybridization reaction to achieve comparable enrichment performance across annealing temperatures ranging from 56 °C to 64 °C. To show the sequence generality of BDA, we demonstrate enrichment of 156 SNVs and the reliable detection of single-digit copies. We also show that the BDA detection of rare driver mutations in cell-free DNA samples extracted from the blood plasma of lung-cancer patients is highly consistent with deep sequencing using molecular lineage tags, with a receiver operator characteristic accuracy of 95%. PMID:29805844

  17. Identification of Forensic Samples via Mitochondrial DNA in the Undergraduate Biochemistry Laboratory

    NASA Astrophysics Data System (ADS)

    Millard, Julie T.; Pilon, André M.

    2003-04-01

    A recent forensic approach for identification of unknown biological samples is mitochondrial DNA (mtDNA) sequencing. We describe a laboratory exercise suitable for an undergraduate biochemistry course in which the polymerase chain reaction is used to amplify a 440 base pair hypervariable region of human mtDNA from a variety of "crime scene" samples (e.g., teeth, hair, nails, cigarettes, envelope flaps, toothbrushes, and chewing gum). Amplification is verified via agarose gel electrophoresis and then samples are subjected to cycle sequencing. Sequence alignments are made via the program CLUSTAL W, allowing students to compare samples and solve the "crime."

  18. Sequence analysis of dolphin ferritin H and L subunits and possible iron-dependent translational control of dolphin ferritin gene

    PubMed Central

    Takaesu, Azusa; Watanabe, Kiyotaka; Takai, Shinji; Sasaki, Yukako; Orino, Koichi

    2008-01-01

    Background Iron-storage protein, ferritin plays a central role in iron metabolism. Ferritin has dual function to store iron and segregate iron for protection of iron-catalyzed reactive oxygen species. Tissue ferritin is composed of two kinds of subunits (H: heavy chain or heart-type subunit; L: light chain or liver-type subunit). Ferritin gene expression is controlled at translational level in iron-dependent manner or at transcriptional level in iron-independent manner. However, sequencing analysis of marine mammalian ferritin subunits has not yet been performed fully. The purpose of this study is to reveal cDNA-derived amino acid sequences of cetacean ferritin H and L subunits, and demonstrate the possibility of expression of these subunits, especially H subunit, by iron. Methods Sequence analyses of cetacean ferritin H and L subunits were performed by direct sequencing of polymerase chain reaction (PCR) fragments from cDNAs generated via reverse transcription-PCR of leukocyte total RNA prepared from blood samples of six different dolphin species (Pseudorca crassidens, Lagenorhynchus obliquidens, Grampus griseus, Globicephala macrorhynchus, Tursiops truncatus, and Delphinapterus leucas). The putative iron-responsive element sequence in the 5'-untranslated region of the six different dolphin species was revealed by direct sequencing of PCR fragments obtained using leukocyte genomic DNA. Results Dolphin H and L subunits consist of 182 and 174 amino acids, respectively, and amino acid sequence identities of ferritin subunits among these dolphins are highly conserved (H: 99–100%, (99→98) ; L: 98–100%). The conserved 28 bp IRE sequence was located -144 bp upstream from the initiation codon in the six different dolphin species. Conclusion These results indicate that six different dolphin species have conserved ferritin sequences, and suggest that these genes are iron-dependently expressed. PMID:18954429

  19. A simple nucleic acid hybridization/latex agglutination assay for the rapid detection of polymerase chain reaction amplicons.

    PubMed

    Vollenhofer-Schrumpf, Sabine; Buresch, Ronald; Schinkinger, Manfred

    2007-03-01

    We have developed a new method for the detection of nucleic acid hybridization, based on a simple latex agglutination test that can be evaluated by the unaided eye. Nucleic acid, e.g., a polymerase chain reaction (PCR) product, is denatured and incubated with polystyrene beads carrying covalently bound complementary oligonucleotide sequences. Hybridization of the nucleic acids leads to aggregation of the latex particles, thereby verifying the presence of target sequence. The test is performed at room temperature, and results are available within 10 min. As a proof of principle, the hybridization/latex agglutination assay was applied to the detection of purified PCR fragments either specific for Salmonella spp. or a synthetic sequence, and to the detection of Salmonella enterica in artificially contaminated chicken samples. A few nanograms of purified PCR fragments were detectable. In artificially contaminated chicken samples, 3 colony-forming units (cfu)/25 g were detected in one of three replicates, and 30 cfu/25 g were detected in both of two replicates when samples for PCR were taken directly from primary enrichment, demonstrating the practical applicability of this test system. Even multiplex detection might be achievable. This novel kind of assay could be useful for a range of applications where hybridization of nucleic acids, e.g., PCR fragments, is to be detected.

  20. Polymerase chain reaction-hybridization method using urease gene sequences for high-throughput Ureaplasma urealyticum and Ureaplasma parvum detection and differentiation.

    PubMed

    Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing

    2016-04-15

    In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Evidence of West Nile virus infection in Nepal.

    PubMed

    Rutvisuttinunt, Wiriya; Chinnawirotpisan, Piyawan; Klungthong, Chonticha; Shrestha, Sanjaya Kumar; Thapa, Amod Bahadur; Pant, Arjun; Yingst, Samuel L; Yoon, In-Kyu; Fernandez, Stefan; Pavlin, Julie A

    2014-11-27

    Acute febrile illness is common among those seeking medical care and is frequently treated empirically with the underlying illness remaining undiagnosed in resource-poor countries. A febrile illness study was conducted 2009-2010 to identify known and unknown pathogens circulating in Nepal. Study methods included diagnostic testing and preliminary ELISA screening of acute and convalescent samples for diseases both known and unknown to be circulating in Nepal, including West Nile virus (WNV). The molecular assays including Polymerase Chain Reaction (PCR), Sanger sequencing and ultra deep sequencing on MiSeq Illumina Platform were conducted to further confirm the presence of WNV. The study enrolled 2,046 patients presenting undifferentiated febrile illness with unknown etiology. Sera from 14 out of 2,046 patients were tested positive for west nile virus (WNV) by nested Reverse Transcription-Polymerase Chain Reaction (RT-PCR). Only two out of 14 cases were confirmed for the presence of WNV by sequencing and identified as WNV lineage 1 phylogentically. The two patients were adult males with fever and no neurological symptoms from Kathmandu and Bharatpur, Nepal. Two out of 2,046 serum samples contained fragments of WNV genome resembling WNV lineage 1, which is evidence of the continued spread of WNV which should be considered a possible illness cause in Nepal.

  2. The Power of Real-Time PCR

    ERIC Educational Resources Information Center

    Valasek, Mark A.; Repa, Joyce J.

    2005-01-01

    In recent years, real-time polymerase chain reaction (PCR) has emerged as a robust and widely used methodology for biological investigation because it can detect and quantify very small amounts of specific nucleic acid sequences. As a research tool, a major application of this technology is the rapid and accurate assessment of changes in gene…

  3. PCR Cloning of Partial "nbs" Sequences from Grape ("Vitis aestivalis" Michx)

    ERIC Educational Resources Information Center

    Chang, Ming-Mei; DiGennaro, Peter; Macula, Anthony

    2009-01-01

    Plants defend themselves against pathogens via the expressions of disease resistance (R) genes. Many plant R gene products contain the characteristic nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. There are highly conserved motifs within the NBS domain which could be targeted for polymerase chain reaction (PCR) cloning of R…

  4. 'Candidatus Phytoplasma sudamericanum' a novel taxon from diseased passion fruit (Passiflora edulis f. flavicarpa Deg.)

    USDA-ARS?s Scientific Manuscript database

    Symptoms of abnormal proliferation of shoots resulting in formation of witches’ broom growths were observed in diseased plants of passion fruit (Passiflora edulis f. flavicarpa Deg.) in Brazil. RFLP analysis of 16S rRNA gene sequences amplified in polymerase chain reactions containing template DNAs...

  5. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  6. Phylogeographic patterns of Armillaria ostoyae in the western United States

    Treesearch

    J. W. Hanna; N. B. Klopfenstein; M. -S. Kim; G. I. McDonald; J. A. Moore

    2007-01-01

    Nuclear ribosomal DNA regions (i.e. large subunit, internal transcribed spacer, 5.8S and intergenic spacer) were sequenced using a direct-polymerase chain reaction method from Armillaria ostoyae genets collected from the western USA. Many of the A. ostoyae genets contained heterogeneity among rDNA repeats, indicating intragenomic variation and likely intraspecific...

  7. [Prevalence of Bartonella henselae in blood donors and risk of blood transmission in Chile].

    PubMed

    Núñez, M Antonieta; Contreras, Karla; Depix, M Soledad; Geoffroy, Enrique; Villagra, Nicolás; Mellado, Sandra; Salinas, Ana M

    2017-12-01

    Bartonella henselae is the causal agent of cat scratch disease in immunocompetent persons and bacterial angiomatosis in immunocompromised patients. In Chile, the prevalence of antibodies against B. henselae in healthy children and adolescents is 13.3%, in persons with occupational risk 60.5%, and in cats 85.6%. There are no published data regarding the seroprevalence in blood donors in our country, so determining if B. henselae is present in the blood of donors at the time of donation is very important, since this microorganism can survive up to 35 days in the red blood cells stored in a blood bank at 4 °C. To determine the prevalence of B. henselae in blood donors. 140 donor blood samples were analyzed to detect the presence of B. henselae, using the polymerase chain reaction technique. 13.6% of the blood donors with positive polymerase chain reaction for B. henselae were obtained. The sequence of the amplified fragments showed an identity of over 98% with respect to B. henselae reference sequences. The risk of blood transmission is due to a country with high B. henselae infection.

  8. Detection of potentially cariogenic strains of Streptococcus mutans using the polymerase chain reaction.

    PubMed

    Aguilera Galaviz, Luis Alejandro; Aceves Medina, Ma del Carmen; Estrada García, Iris C

    2002-01-01

    Streptococcus mutans is a pathogen related to the occurrence of human dental caries. The determination of total amounts of mutans streptococci, as well as the proportion related to other oral bacteria, is of interest when assessing the risk of developing caries. In this context, it is better to use a sensitive, specific and non-time consuming method such as the polymerase chain reaction (PCR), than to use culture and biochemical identification methods. In this work we identified potentially cariogenic strains of S. mutans and assessed the relationship with the dmft, DMFT or dmft/DMFT index. Using DNA isolated from dental plaque, a 192 bp sequence was identified and amplified from the spaP gene and a 722 bp sequence from the dexA gene. The results suggest that it is important to evaluate the presence of cariogenic S. mutans strains in plaque content rather than the accumulation of plaque itself However, other factors like diet, hygiene, genetic background, the flow rate of saliva and the presence of specific antibodies, also play a key role in the development of caries.

  9. Optimization of the performance of the polymerase chain reaction in silicon-based microstructures.

    PubMed Central

    Taylor, T B; Winn-Deen, E S; Picozza, E; Woudenberg, T M; Albin, M

    1997-01-01

    We have demonstrated the ability to perform real-time homogeneous, sequence specific detection of PCR products in silicon microstructures. Optimal design/ processing result in equivalent performance (yield and specificity) for high surface-to-volume silicon structures as compared to larger volume reactions in polypropylene tubes. Amplifications in volumes as small as 0.5 microl and thermal cycling times reduced as much as 5-fold from that of conventional systems have been demonstrated for the microstructures. PMID:9224619

  10. A HIV-1 heterosexual transmission chain in Guangzhou, China: a molecular epidemiological study.

    PubMed

    Han, Zhigang; Leung, Tommy W C; Zhao, Jinkou; Wang, Ming; Fan, Lirui; Li, Kai; Pang, Xinli; Liang, Zhenbo; Lim, Wilina W L; Xu, Huifang

    2009-09-25

    We conducted molecular analyses to confirm four clustering HIV-1 infections (Patient A, B, C & D) in Guangzhou, China. These cases were identified by epidemiological investigation and suspected to acquire the infection through a common heterosexual transmission chain. Env C2V3V4 region, gag p17/p24 junction and partial pol gene of HIV-1 genome from serum specimens of these infected cases were amplified by reverse transcription polymerase chain reaction (RT-PCR) and nucleotide sequenced. Phylogenetic analyses indicated that their viral nucleotide sequences were significantly clustered together (bootstrap value is 99%, 98% and 100% in env, gag and pol tree respectively). Evolutionary distance analysis indicated that their genetic diversities of env, gag and pol genes were significantly lower than non-clustered controls, as measured by unpaired t-test (env gene comparison: p < 0.005; gag gene comparison: p < 0.005; pol gene comparison: p < 0.005). Epidemiological results and molecular analyses consistently illustrated these four cases represented a transmission chain which dispersed in the locality through heterosexual contact involving commercial sex worker.

  11. Identification of verotoxin type 2 variant B subunit genes in Escherichia coli by the polymerase chain reaction and restriction fragment length polymorphism analysis.

    PubMed Central

    Tyler, S D; Johnson, W M; Lior, H; Wang, G; Rozee, K R

    1991-01-01

    A set of synthetic oligonucleotide primers was designed for use in a polymerase chain reaction protocol to specifically detect the B subunit genes in vtx2ha and vtx2hb, which code for the production of the VT2 (Shiga-like toxin II) variant cytotoxins VT2v-a and VT2v-b, respectively. An additional set of primers amplified a fragment common to the B subunits of the VT2 and the VT2 variant genes. Subsequent restriction endonuclease digestion of this amplicon permitted prediction of specific VT2 and variant genotypes on the basis of predetermined restriction fragment length polymorphisms. Genotypes of 21 VT2-producing strains of Escherichia coli were determined using this polymerase chain reaction-restriction fragment length polymorphism procedure. Four strains contained B subunit target sequences only for VT2 genes, 9 strains contained sequences only for VT2v-a genes, and 3 strains contained sequences only for VT2v-b. For genes in combination, one strain contained B subunit genes for both VT2 and VT2v-a and two strains contained B subunit genes for VT2 and VT2v-b. Two strains of E. coli O91:H21 contained both VT2v-a and VT2v-b B subunit genes. The VT2 reference strain of E. coli, E32511, was found to contain the targeted sequences from both VT2 and VT2v-a genes, whereas the recombinant E. coli, pEB1, possessed only that of the VT2 gene. The specific activities of extracellular VT2 determined in HeLa cells ranged from 0.3 to 41.7 TCD50 per microgram of protein in strains carrying the VT2 gene target and from 0 to 50.0 TCD50 per microgram of protein in strains carrying only the VT2 variant target (TCD50 is the tissue culture dose by which 50% of the cells were affected), suggesting that phenotypic expression does not correlate with genotype. Images PMID:1679436

  12. COLD-PCR Technologies in the Area of Personalized Medicine: Methodology and Applications.

    PubMed

    Mauger, Florence; How-Kit, Alexandre; Tost, Jörg

    2017-06-01

    Somatic mutations bear great promise for use as biomarkers for personalized medicine, but are often present only in low abundance in biological material and are therefore difficult to detect. Many assays for mutation analysis in cancer-related genes (hotspots) have been developed to improve diagnosis, prognosis, prediction of drug resistance, and monitoring of the response to treatment. Two major approaches have been developed: mutation-specific amplification methods and methods that enrich and detect mutations without prior knowledge on the exact location and identity of the mutation. CO-amplification at Lower Denaturation temperature Polymerase Chain Reaction (COLD-PCR) methods such as full-, fast-, ice- (improved and complete enrichment), enhanced-ice, and temperature-tolerant COLD-PCR make use of a critical temperature in the polymerase chain reaction to selectively denature wild-type-mutant heteroduplexes, allowing the enrichment of rare mutations. Mutations can subsequently be identified using a variety of laboratory technologies such as high-resolution melting, digital polymerase chain reaction, pyrosequencing, Sanger sequencing, or next-generation sequencing. COLD-PCR methods are sensitive, specific, and accurate if appropriately optimized and have a short time to results. A large variety of clinical samples (tumor DNA, circulating cell-free DNA, circulating cell-free fetal DNA, and circulating tumor cells) have been studied using COLD-PCR in many different applications including the detection of genetic changes in cancer and infectious diseases, non-invasive prenatal diagnosis, detection of microorganisms, or DNA methylation analysis. In this review, we describe in detail the different COLD-PCR approaches, highlighting their specificities, advantages, and inconveniences and demonstrating their use in different fields of biological and biomedical research.

  13. Allele-Specific Polymerase Chain Reaction for the Imatinib-Resistant KIT D816V and D816F Mutations in Mastocytosis and Acute Myelogenous Leukemia

    PubMed Central

    Corless, Christopher L.; Harrell, Patina; Lacouture, Mario; Bainbridge, Troy; Le, Claudia; Gatter, Ken; White, Clifton; Granter, Scott; Heinrich, Michael C.

    2006-01-01

    Oncogenic mutations of the receptor tyrosine kinase KIT contribute to the pathogenesis of gastrointestinal stromal tumors, systemic mastocytosis (SM), and some cases of acute myelogenous leukemia (AML). The D816V substitution in the activation loop of KIT results in relative resistance to the kinase inhibitor imatinib (Gleevec). Because this mutation occurs in 80 to 95% of adult SM, its detection has diagnostic and predictive significance. Unfortunately, the fraction of mutation-positive cells in clinical SM samples is often below the 20 to 30% threshold needed for detection by direct DNA sequencing. We have developed an allele-specific polymerase chain reaction assay using a mutation-specific primer combined with a wild-type blocking oligonucleotide that amplifies D816V at the level of 1% mutant allele in DNA extracted from formalin-fixed, paraffin-embedded tissue. There were no amplifications among 64 KIT wild-type tumors and cell lines, whereas all D816V-mutant samples (eight AML and 11 mast cell disease) were positive. Other D816 substitutions associated with resistance to imatinib in vitro are rare in SM. Among these D816F was detectable with the assay whereas D816H, D816Y, and D816G did not amplify. Nine biopsies (bone marrow, skin, or colon) with suspected SM were negative by denaturing high performance liquid chromatography and/or DNA sequencing but positive by allele-specific polymerase chain reaction. Thus, the assay may be useful in confirming the diagnosis of SM. PMID:17065430

  14. Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

    PubMed

    Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

    2017-02-15

    Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Multisite analytic performance studies of a real-time polymerase chain reaction assay for the detection of BRAF V600E mutations in formalin-fixed, paraffin-embedded tissue specimens of malignant melanoma.

    PubMed

    Anderson, Steven; Bloom, Kenneth J; Vallera, Dino U; Rueschoff, Josef; Meldrum, Cliff; Schilling, Robert; Kovach, Barbara; Lee, Ju Ruey-Jiuan; Ochoa, Pam; Langland, Rachel; Halait, Harkanwal; Lawrence, H Jeffrey; Dugan, Michael C

    2012-11-01

    A polymerase chain reaction-based companion diagnostic (cobas 4800 BRAF V600 Mutation Test) was recently approved by the US Food and Drug Administration to select patients with BRAF-mutant metastatic melanoma for treatment with the BRAF inhibitor vemurafenib. (1) To compare the analytic performance of the cobas test to Sanger sequencing by using screening specimens from phase II and phase III trials of vemurafenib, and (2) to assess the reproducibility of the cobas test at different testing sites. Specimens from 477 patients were used to determine positive and negative percent agreements between the cobas test and Sanger sequencing for detecting V600E (1799T>A) mutations. Specimens were evaluated with a massively parallel pyrosequencing method (454) to resolve discordances between polymerase chain reaction and Sanger results. Reproducibility of the cobas test was assessed at 3 sites by using 3 reagent lots and an 8-member panel of melanoma samples. A valid cobas result was obtained for all eligible patients. Sanger sequencing had a failure rate of 9.2% (44 of 477). For the remaining 433 specimens, positive percent agreement was 96.4% (215 of 223) and negative percent agreement, 80% (168 of 210). Among 42 cobas mutation-positive/Sanger V600E-negative specimens, 17 were V600E positive and 24 were V600K positive by 454. The cobas test detected 70% of V600K mutations. In the reproducibility study, a correct interpretation was made for 100% of wild-type specimens and specimens with greater than 5% mutant alleles; V600E mutations were detected in 90% of specimens with less than 5% mutant alleles. The cobas test (1) had a lower assay failure rate than that of Sanger, (2) was more sensitive in detecting V600E mutations, (3) detected most V600K mutations, and (4) was highly reproducible.

  16. Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Flores, J.; Sears, J.; Schael, I.P.

    1990-08-01

    We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated frommore » field studies.« less

  17. Subacute Sclerosing Panencephalitis in an Infant: Diagnostic Role of Viral Genome Analysis

    PubMed Central

    Baram, Tallie Z.; Gonzalez-Gomez, Ignacio; Xie, Zong-De; Yao, Dapeng; Gilles, Floyd H.; Nelson, Marvin D.; Nguyen, Hahn T.; Peters, Julius

    2013-01-01

    Subacute sclerosing panencephalitis (SSPE) is related to “defective” measles virus or vaccination, though an association with parainfluenza viruses has been reported. SSPE is characterized by a slow, erratic course and elevated cerebrospinal fluid measles titers. An immunocompetent, vaccinated infant, with onset of symptoms in parainfiuenza virus season and a catastrophic course is described. Cerebrospinal fluid titers were negative, but postmortem brain had typical SSPE lesions. Patient brain-derived RNA, subjected to reverse transcription followed by polymerase chain reaction yielded polymerase chain reaction products with measles virus but not parainfluenza virus genes. The sequenced fragment revealed multiple mutations, typical for SSPE. SSPE can thus present in infants, with short latency and no cerebrospinal fluid antibodies. Viral genomic analysis may be diagnostic, permitting early therapy. PMID:8024248

  18. A family of glycoproteins (GP55), which inhibit neurite outgrowth, are members of the Ig superfamily and are related to OBCAM, neurotrimin, LAMP and CEPU-1.

    PubMed

    Wilson, D J; Kim, D S; Clarke, G A; Marshall-Clarke, S; Moss, D J

    1996-12-01

    We have previously identified a glycosylphosphatidylinositol-linked glycoprotein of 55 kDa (GP55) which inhibits neurite outgrowth. We now provide evidence that GP55, isolated from adult chick brain, consists of at least two bands, both of which are active, i.e., block outgrowth of neurites from chick dorsal root ganglion neurons. An antiserum raised against the adult proteins reverses the inhibition and preliminary experiments suggest that GP55 is restricted to the nervous system, increases during development from very low levels at embryonic day 10 and is most abundant after hatching. Immunofluorescence reveals that GP55 is expressed on neurons cultured from an embryonic day 14 chick brain but is barely detectable on embryonic day 10 dorsal root ganglion neurons or embryonic day 8 forebrain neurons; the neurons which respond to substrate-bound GP55. Peptide sequencing revealed considerable homology with OBCAM, a protein previously identified on the basis of binding opiates. Nested polymerase chain reaction using primers to the OBCAM sequence and internal primers to GP55 peptides produced two different polymerase chain reaction fragments with homology to OBCAM. A full length clone (E19S) corresponding to one polymerase chain reaction product and a partial length clone (E14S) corresponding to the second have been isolated from an embryonic chick brain library. Both are members of the immunoglobulin superfamily and have (or are expected to have) three C2 domains. E19S has 90% homology with LAMP at the amino acid level. This sequence only partially matches the peptides from the adult protein and hence is probably not a major component of the adult proteins. E14S (GP55-A) has 83% homology to OBCAM at the amino acid level over the region sequenced. The sequence matches several of the peptides from the adult protein and is hence likely to correspond to a major component of the adult proteins. Thus members of the GP55 family are related to OBCAM, neurotrimin, LAMP and a recently discovered chick protein CEPU-1. Our results suggest molecules within this family are capable of acting as cell adhesion molecules and inhibitors of neurite outgrowth.

  19. Affordable hands-on DNA sequencing and genotyping: an exercise for teaching DNA analysis to undergraduates.

    PubMed

    Shah, Kushani; Thomas, Shelby; Stein, Arnold

    2013-01-01

    In this report, we describe a 5-week laboratory exercise for undergraduate biology and biochemistry students in which students learn to sequence DNA and to genotype their DNA for selected single nucleotide polymorphisms (SNPs). Students use miniaturized DNA sequencing gels that require approximately 8 min to run. The students perform G, A, T, C Sanger sequencing reactions. They prepare and run the gels, perform Southern blots (which require only 10 min), and detect sequencing ladders using a colorimetric detection system. Students enlarge their sequencing ladders from digital images of their small nylon membranes, and read the sequence manually. They compare their reads with the actual DNA sequence using BLAST2. After mastering the DNA sequencing system, students prepare their own DNA from a cheek swab, polymerase chain reaction-amplify a region of their DNA that encompasses a SNP of interest, and perform sequencing to determine their genotype at the SNP position. A family pedigree can also be constructed. The SNP chosen by the instructor was rs17822931, which is in the ABCC11 gene and is the determinant of human earwax type. Genotypes at the rs178229931 site vary in different ethnic populations. © 2013 by The International Union of Biochemistry and Molecular Biology.

  20. Filling reference gaps via assembling DNA barcodes using high-throughput sequencing—moving toward barcoding the world

    PubMed Central

    Zhou, Chengran

    2017-01-01

    Abstract Over the past decade, biodiversity researchers have dedicated tremendous efforts to constructing DNA reference barcodes for rapid species registration and identification. Although analytical cost for standard DNA barcoding has been significantly reduced since early 2000, further dramatic reduction in barcoding costs is unlikely because Sanger sequencing is approaching its limits in throughput and chemistry cost. Constraints in barcoding cost not only led to unbalanced barcoding efforts around the globe, but also prevented high-throughput sequencing (HTS)–based taxonomic identification from applying binomial species names, which provide crucial linkages to biological knowledge. We developed an Illumina-based pipeline, HIFI-Barcode, to produce full-length Cytochrome c oxidase subunit I (COI) barcodes from pooled polymerase chain reaction amplicons generated by individual specimens. The new pipeline generated accurate barcode sequences that were comparable to Sanger standards, even for different haplotypes of the same species that were only a few nucleotides different from each other. Additionally, the new pipeline was much more sensitive in recovering amplicons at low quantity. The HIFI-Barcode pipeline successfully recovered barcodes from more than 78% of the polymerase chain reactions that didn’t show clear bands on the electrophoresis gel. Moreover, sequencing results based on the single molecular sequencing platform Pacbio confirmed the accuracy of the HIFI-Barcode results. Altogether, the new pipeline can provide an improved solution to produce full-length reference barcodes at about one-tenth of the current cost, enabling construction of comprehensive barcode libraries for local fauna, leading to a feasible direction for DNA barcoding global biomes. PMID:29077841

  1. Insights into the Performance of SD Bioline Malaria Ag P.f/Pan Rapid Diagnostic Test and Plasmodium falciparum Histidine-Rich Protein 2 Gene Variation in Madagascar.

    PubMed

    Willie, Nigani; Mehlotra, Rajeev K; Howes, Rosalind E; Rakotomanga, Tovonahary A; Ramboarina, Stephanie; Ratsimbasoa, Arsène C; Zimmerman, Peter A

    2018-06-01

    Plasmodium falciparum histidine-rich protein 2 (PfHRP2) forms the basis of many current malaria rapid diagnostic tests (RDTs). However, the parasites lacking part or all of the pfhrp2 gene do not express the PfHRP2 protein and are, therefore, not identifiable by PfHRP2-detecting RDTs. We evaluated the performance of the SD Bioline Malaria Ag P.f/Pan RDT together with pfhrp2 variation in Madagascar. Genomic DNA isolated from 260 patient blood samples were polymerase chain reaction (PCR)-amplified for the parasite 18S rRNA and pfhrp2 genes. Post-PCR ligation detection reaction-fluorescent microsphere assay (LDR-FMA) was performed for the identification of parasite species. Plasmodium falciparum histidine-rich protein 2 amplicons were sequenced. Polymerase chain reaction diagnosis of patient samples showed that 29% (75/260) were infected and P. falciparum was present in 95% (71/75) of these PCR-positive samples. Comparing RDT and P. falciparum detection by LDR-FMA, eight samples were RDT negative but P. falciparum positive (false negatives), all of which were pfhrp2 positive. The sensitivity and specificity of the RDT were 87% and 90%, respectively. Seventy-three samples were amplified for pfhrp2 , from which nine randomly selected amplicons were sequenced, yielding 13 sequences. Amplification of pfhrp2 , combined with RDT analysis and P. falciparum detection by LDR-FMA, showed that there was no indication of pfhrp2 deletion. Sequence analysis of pfhrp2 showed that the correlation between pfhrp2 sequence structure and RDT detection rates was unclear. Although the observed absence of pfhrp2 deletion from the samples screened here is encouraging, continued monitoring of the efficacy of the SD Bioline Malaria Ag P.f/Pan RDT for malaria diagnosis in Madagascar is warranted.

  2. Analysis of the major epitope of the alpha2 chain of bovine type I collagen in children with bovine gelatin allergy.

    PubMed

    Hori, Hisae; Hattori, Shunji; Inouye, Sakae; Kimura, Akinori; Irie, Shinkichi; Miyazawa, Hiroshi; Sakaguchi, Masahiro

    2002-10-01

    Anaphylaxis to measles, mumps, and rubella vaccines has been reported. It has been found that most of these reactions to live vaccines are caused by type I allergy with the bovine gelatin present in the vaccines as an allergen. Gelatin mainly includes denatured type I collagen, which consists of alpha1 and alpha2 chains. We previously reported that allergic reactions to gelatin are caused by the type I collagen alpha2 (alpha2[I]) chain. To aid in the development of gelatin that has little or no allergenicity in human subjects, we investigated epitopes of bovine alpha2(I) chain with use of IgE in gelatin-sensitive children. Serum samples were collected from 15 patients who had systemic allergic reactions to vaccines and high levels of specific IgE to bovine gelatin. Eleven overlapping recombinant proteins that cover bovine alpha2(I) were prepared with a bacterial expression vector. We examined IgE reactivity to these recombinant proteins by means of ELISA. Fifteen peptides covering a major reactive recombinant protein were synthesized. The IgE-reacting epitope was identified by means of IgE-ELISA inhibition with these synthetic peptides and pooled serum from the patients. We found that of the 15 patients, 13 showed IgE reactivity to a recombinant protein (no. 3) spanning the central region of the collagenous domain ((418)Gly-(662)Pro). Furthermore, all 13 patients showed IgE reactivity to the 4-kd recombinant protein (no. 3a) spanning the region from (461)Pro to (500)Glu. In IgE-ELISA inhibition we found that a minimum IgE epitope of gelatin allergen was composed of the 10-amino-acid sequence (485)Ile-Pro-Gly-Glu-Phe-Gly-Leu-Pro-Gly-Pro(494). This sequence is not observed in the human type I collagen alpha1 and alpha2 chains, nor is it found in the bovine type I collagen alpha1 chain. We found that Ile-Pro-Gly-Glu-Phe-Gly-Leu-Pro-Gly-Pro is a major IgE epitope of the alpha2 chain of bovine type I collagen in patients with gelatin allergy. The degree of anaphylaxis to gelatin in vaccines might be reduced by digestion of this IgE-binding site in gelatin.

  3. Characterization of a marsupial sperm protamine gene and its transcripts from the North American opossum (Didelphis marsupialis).

    PubMed

    Winkfein, R J; Nishikawa, S; Connor, W; Dixon, G H

    1993-07-01

    A synthetic oligonucleotide primer, designed from marsupial protamine protein-sequence data [Balhorn, R., Corzett, M., Matrimas, J. A., Cummins, J. & Faden, B. (1989) Analysis of protamines isolated from two marsupials, the ring-tailed wallaby and gray short-tailed opossum, J. Cell. Biol. 107] was used to amplify, via the polymerase chain reaction, protamine sequences from a North American opossum (Didelphis marsupialis) cDNA. Using the amplified sequences as probes, several protamine cDNA clones were isolated. The protein sequence, predicted from the cDNA sequences, consisted of 57 amino acids, contained a large number of arginine residues and exhibited the sequence ARYR at its amino terminus, which is conserved in avian and most eutherian mammal protamines. Like the true protamines of trout and chicken, the opossum protamine lacked cysteine residues, distinguishing it from placental mammalian protamine 1 (P1 or stable) protamines. Examination of the protamine gene, isolated by polymerase-chain-reaction amplification of genomic DNA, revealed the presence of an intron dividing the protamine-coding region, a common characteristic of all mammalian P1 genes. In addition, extensive sequence identity in the 5' and 3' flanking regions between mouse and opossum sequences classify the marsupial protamine as being closely related to placental mammal P1. Protamine transcripts, in both birds and mammals, are present in two size classes, differing by the length of their poly(A) tails (either short or long). Examination of opossum protamine transcripts by Northern hybridization revealed four distinct mRNA species in the total RNA fraction, two of which were enriched in the poly(A)-rich fraction. Northern-blot analysis, using an intron-specific probe, revealed the presence of intron sequences in two of the four protamine transcripts. If expressed, the corresponding protein from intron-containing transcripts would differ from spliced transcripts by length (49 versus 57 amino acids) and would contain a cysteine residue.

  4. Electrochemical detection of sequence-specific DNA based on formation of G-quadruplex-hemin through continuous hybridization chain reaction.

    PubMed

    Sun, Xiaofan; Chen, Haohan; Wang, Shuling; Zhang, Yiping; Tian, Yaping; Zhou, Nandi

    2018-08-27

    A high-sensitive detection of sequence-specific DNA was established based on the formation of G-quadruplex-hemin complex through continuous hybridization chain reaction (HCR). Taking HIV DNA sequence as an example, a capture probe complementary to part of HIV DNA was firstly self-assembled onto the surface of Au electrode. Then a specially designed assistant probe with both terminals complementary to the target DNA and a G-quadruplex-forming sequence in the center was introduced into the detection solution. In the presence of both the target DNA and the assistant probe, the target DNA can be captured on the electrode surface and then a continuous HCR can be conducted due to the mutual recognition of the target DNA and the assistant probe, leading to the formation of a large number of G-quadruplex on the electrode surface. With the help of hemin, a pronounced electrochemical signal can be observed in differential pulse voltammetry (DPV), due to the formation of G-quadruplex-hemin complex. The peak current is linearly related with the logarithm of the concentration of the target DNA in the range from 10 fM to 10 pM. The electrochemical sensor has high selectivity to clearly discriminate single-base mismatched and three-base mismatched sequences from the original HIV DNA sequence. Moreover, the established DNA sensor was challenged by detection of HIV DNA in human serum samples, which showed the low detection limit of 6.3 fM. Thus it has great application prospect in the field of clinical diagnosis and environmental monitoring. Copyright © 2018 Elsevier B.V. All rights reserved.

  5. Large scale DNA microsequencing device

    DOEpatents

    Foote, Robert S.

    1997-01-01

    A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

  6. Large scale DNA microsequencing device

    DOEpatents

    Foote, Robert S.

    1999-01-01

    A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

  7. PCR amplification of 16S rDNA from lyophilized cell cultures facilitates studies in molecular systematics

    NASA Technical Reports Server (NTRS)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.

    1990-01-01

    The sequence of the major portion of a Bacillus cycloheptanicus strain SCH(T) 16S rRNA gene is reported. This sequence suggests that B. cycloheptanicus is genetically quite distinct from traditional Bacillus strains (e.g., B. subtilis) and may be properly regarded as belonging to a different genus. The sequence was determined from DNA that was produced by direct amplification of ribosomal DNA from a lyophilized cell pellet with straightforward polymerase chain reaction (PCR) procedures. By obviating the need to revive cell cultures from the lyophile pellet, this approach facilitates rapid 16S rDNA sequencing and thereby advances studies in molecular systematics.

  8. The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea.

    PubMed

    Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun

    2016-07-01

    The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.

  9. Large scale DNA microsequencing device

    DOEpatents

    Foote, R.S.

    1999-08-31

    A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 11 figs.

  10. Whole genome sequence analysis of unidentified genetically modified papaya for development of a specific detection method.

    PubMed

    Nakamura, Kosuke; Kondo, Kazunari; Akiyama, Hiroshi; Ishigaki, Takumi; Noguchi, Akio; Katsumata, Hiroshi; Takasaki, Kazuto; Futo, Satoshi; Sakata, Kozue; Fukuda, Nozomi; Mano, Junichi; Kitta, Kazumi; Tanaka, Hidenori; Akashi, Ryo; Nishimaki-Mogami, Tomoko

    2016-08-15

    Identification of transgenic sequences in an unknown genetically modified (GM) papaya (Carica papaya L.) by whole genome sequence analysis was demonstrated. Whole genome sequence data were generated for a GM-positive fresh papaya fruit commodity detected in monitoring using real-time polymerase chain reaction (PCR). The sequences obtained were mapped against an open database for papaya genome sequence. Transgenic construct- and event-specific sequences were identified as a GM papaya developed to resist infection from a Papaya ringspot virus. Based on the transgenic sequences, a specific real-time PCR detection method for GM papaya applicable to various food commodities was developed. Whole genome sequence analysis enabled identifying unknown transgenic construct- and event-specific sequences in GM papaya and development of a reliable method for detecting them in papaya food commodities. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Method for phosphorothioate antisense DNA sequencing by capillary electrophoresis with UV detection.

    PubMed

    Froim, D; Hopkins, C E; Belenky, A; Cohen, A S

    1997-11-01

    The progress of antisense DNA therapy demands development of reliable and convenient methods for sequencing short single-stranded oligonucleotides. A method of phosphorothioate antisense DNA sequencing analysis using UV detection coupled to capillary electrophoresis (CE) has been developed based on a modified chain termination sequencing method. The proposed method reduces the sequencing cost since it uses affordable CE-UV instrumentation and requires no labeling with minimal sample processing before analysis. Cycle sequencing with ThermoSequenase generates quantities of sequencing products that are readily detectable by UV. Discrimination of undesired components from sequencing products in the reaction mixture, previously accomplished by fluorescent or radioactive labeling, is now achieved by bringing concentrations of undesired components below the UV detection range which yields a 'clean', well defined sequence. UV detection coupled with CE offers additional conveniences for sequencing since it can be accomplished with commercially available CE-UV equipment and is readily amenable to automation.

  12. Method for phosphorothioate antisense DNA sequencing by capillary electrophoresis with UV detection.

    PubMed Central

    Froim, D; Hopkins, C E; Belenky, A; Cohen, A S

    1997-01-01

    The progress of antisense DNA therapy demands development of reliable and convenient methods for sequencing short single-stranded oligonucleotides. A method of phosphorothioate antisense DNA sequencing analysis using UV detection coupled to capillary electrophoresis (CE) has been developed based on a modified chain termination sequencing method. The proposed method reduces the sequencing cost since it uses affordable CE-UV instrumentation and requires no labeling with minimal sample processing before analysis. Cycle sequencing with ThermoSequenase generates quantities of sequencing products that are readily detectable by UV. Discrimination of undesired components from sequencing products in the reaction mixture, previously accomplished by fluorescent or radioactive labeling, is now achieved by bringing concentrations of undesired components below the UV detection range which yields a 'clean', well defined sequence. UV detection coupled with CE offers additional conveniences for sequencing since it can be accomplished with commercially available CE-UV equipment and is readily amenable to automation. PMID:9336449

  13. RIKEN Integrated Sequence Analysis (RISA) System—384-Format Sequencing Pipeline with 384 Multicapillary Sequencer

    PubMed Central

    Shibata, Kazuhiro; Itoh, Masayoshi; Aizawa, Katsunori; Nagaoka, Sumiharu; Sasaki, Nobuya; Carninci, Piero; Konno, Hideaki; Akiyama, Junichi; Nishi, Katsuo; Kitsunai, Tokuji; Tashiro, Hideo; Itoh, Mari; Sumi, Noriko; Ishii, Yoshiyuki; Nakamura, Shin; Hazama, Makoto; Nishine, Tsutomu; Harada, Akira; Yamamoto, Rintaro; Matsumoto, Hiroyuki; Sakaguchi, Sumito; Ikegami, Takashi; Kashiwagi, Katsuya; Fujiwake, Syuji; Inoue, Kouji; Togawa, Yoshiyuki; Izawa, Masaki; Ohara, Eiji; Watahiki, Masanori; Yoneda, Yuko; Ishikawa, Tomokazu; Ozawa, Kaori; Tanaka, Takumi; Matsuura, Shuji; Kawai, Jun; Okazaki, Yasushi; Muramatsu, Masami; Inoue, Yorinao; Kira, Akira; Hayashizaki, Yoshihide

    2000-01-01

    The RIKEN high-throughput 384-format sequencing pipeline (RISA system) including a 384-multicapillary sequencer (the so-called RISA sequencer) was developed for the RIKEN mouse encyclopedia project. The RISA system consists of colony picking, template preparation, sequencing reaction, and the sequencing process. A novel high-throughput 384-format capillary sequencer system (RISA sequencer system) was developed for the sequencing process. This system consists of a 384-multicapillary auto sequencer (RISA sequencer), a 384-multicapillary array assembler (CAS), and a 384-multicapillary casting device. The RISA sequencer can simultaneously analyze 384 independent sequencing products. The optical system is a scanning system chosen after careful comparison with an image detection system for the simultaneous detection of the 384-capillary array. This scanning system can be used with any fluorescent-labeled sequencing reaction (chain termination reaction), including transcriptional sequencing based on RNA polymerase, which was originally developed by us, and cycle sequencing based on thermostable DNA polymerase. For long-read sequencing, 380 out of 384 sequences (99.2%) were successfully analyzed and the average read length, with more than 99% accuracy, was 654.4 bp. A single RISA sequencer can analyze 216 kb with >99% accuracy in 2.7 h (90 kb/h). For short-read sequencing to cluster the 3′ end and 5′ end sequencing by reading 350 bp, 384 samples can be analyzed in 1.5 h. We have also developed a RISA inoculator, RISA filtrator and densitometer, RISA plasmid preparator which can handle throughput of 40,000 samples in 17.5 h, and a high-throughput RISA thermal cycler which has four 384-well sites. The combination of these technologies allowed us to construct the RISA system consisting of 16 RISA sequencers, which can process 50,000 DNA samples per day. One haploid genome shotgun sequence of a higher organism, such as human, mouse, rat, domestic animals, and plants, can be revealed by seven RISA systems within one month. PMID:11076861

  14. Design of a glutamine substrate tag enabling protein labelling mediated by Bacillus subtilis transglutaminase.

    PubMed

    Oteng-Pabi, Samuel K; Clouthier, Christopher M; Keillor, Jeffrey W

    2018-01-01

    Transglutaminases (TGases) are enzymes that catalyse protein cross-linking through a transamidation reaction between the side chain of a glutamine residue on one protein and the side chain of a lysine residue on another. Generally, TGases show low substrate specificity with respect to their amine substrate, such that a wide variety of primary amines can participate in the modification of specific glutamine residue. Although a number of different TGases have been used to mediate these bioconjugation reactions, the TGase from Bacillus subtilis (bTG) may be particularly suited to this application. It is smaller than most TGases, can be expressed in a soluble active form, and lacks the calcium dependence of its mammalian counterparts. However, little is known regarding this enzyme and its glutamine substrate specificity, limiting the scope of its application. In this work, we designed a FRET-based ligation assay to monitor the bTG-mediated conjugation of the fluorescent proteins Clover and mRuby2. This assay allowed us to screen a library of random heptapeptide glutamine sequences for their reactivity with recombinant bTG in bacterial cells, using fluorescence assisted cell sorting. From this library, several reactive sequences were identified and kinetically characterized, with the most reactive sequence (YAHQAHY) having a kcat/KM value of 19 ± 3 μM-1 min-1. This sequence was then genetically appended onto a test protein as a reactive 'Q-tag' and fluorescently labelled with dansyl-cadaverine, in the first demonstration of protein labelling mediated by bTG.

  15. The Glyoxylate Cycle in an Arbuscular Mycorrhizal Fungus. Carbon Flux and Gene Expression

    PubMed Central

    Lammers, Peter J.; Jun, Jeongwon; Abubaker, Jehad; Arreola, Raul; Gopalan, Anjali; Bago, Berta; Hernandez-Sebastia, Cinta; Allen, James W.; Douds, David D.; Pfeffer, Philip E.; Shachar-Hill, Yair

    2001-01-01

    The arbuscular mycorrhizal (AM) symbiosis is responsible for huge fluxes of photosynthetically fixed carbon from plants to the soil. Lipid, which is the dominant form of stored carbon in the fungal partner and which fuels spore germination, is made by the fungus within the root and is exported to the extraradical mycelium. We tested the hypothesis that the glyoxylate cycle is central to the flow of carbon in the AM symbiosis. The results of 13C labeling of germinating spores and extraradical mycelium with 13C2-acetate and 13C2-glycerol and analysis by nuclear magnetic resonance spectroscopy indicate that there are very substantial fluxes through the glyoxylate cycle in the fungal partner. Full-length sequences obtained by polymerase chain reaction from a cDNA library from germinating spores of the AM fungus Glomus intraradices showed strong homology to gene sequences for isocitrate lyase and malate synthase from plants and other fungal species. Quantitative real-time polymerase chain reaction measurements show that these genes are expressed at significant levels during the symbiosis. Glyoxysome-like bodies were observed by electron microscopy in fungal structures where the glyoxylate cycle is expected to be active, which is consistent with the presence in both enzyme sequences of motifs associated with glyoxysomal targeting. We also identified among several hundred expressed sequence tags several enzymes of primary metabolism whose expression during spore germination is consistent with previous labeling studies and with fluxes into and out of the glyoxylate cycle. PMID:11706207

  16. Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

    USGS Publications Warehouse

    Taylor, P.W.; Winton, J.R.

    2002-01-01

    Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

  17. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    PubMed

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  18. Backbone degradable multiblock N-(2-hydroxypropyl)methacrylamide copolymer conjugates via reversible addition-fragmentation chain transfer polymerization and thiol-ene coupling reaction.

    PubMed

    Pan, Huaizhong; Yang, Jiyuan; Kopecková, Pavla; Kopecek, Jindrich

    2011-01-10

    Telechelic water-soluble HPMA copolymers and HPMA copolymer-doxorubicin (DOX) conjugates have been synthesized by RAFT polymerization mediated by a new bifunctional chain transfer agent (CTA) that contains an enzymatically degradable oligopeptide sequence. Postpolymerization aminolysis followed by chain extension with a bis-maleimide resulted in linear high molecular weight multiblock HPMA copolymer conjugates. These polymers are enzymatically degradable; in addition to releasing the drug (DOX), the degradation of the polymer backbone resulted in products with molecular weights similar to the starting material and below the renal threshold. The new multiblock HPMA copolymers hold potential as new carriers of anticancer drugs.

  19. Polymerase chain reaction detection of Bartonella spp. in dogs from Spain with blood culture-negative infectious endocarditis.

    PubMed

    Roura, X; Santamarina, G; Tabar, M-D; Francino, O; Altet, L

    2018-05-25

    The presence of Bartonella spp. was detected by polymerase chain reaction (PCR) in dogs from Spain with blood culture-negative endocarditis. The aim of this study is to add information about canine infectious endocarditis in Europe. Thirty dogs with naturally occurring blood culture-negative endocarditis were examined from 2010 to 2017 at three veterinary referral hospitals, located in northwest, northeast, and southeast of Spain. It is a retrospective study. Medical records were reviewed to extract relevant data. Frozen or paraffin-embedded cardiac valve tissue and/or ethylenediamine tetraacetic acid blood samples were evaluated by PCR for the presence of Bartonella DNA. Positive results were sequenced to confirm the species. Polymerase chain reaction was positive for eight out of 30 dogs included (26.6%). Bartonella rochalimae, Bartonella vinsonii subsp. berkhoffii, and Bartonella koehlerae were detected in valve tissue or blood. Bartonella could be an important cause of blood culture-negative infectious endocarditis in dogs from Spain. The outcome for those dogs affected with Bartonella spp. was grave. Prompt empirical treatment with amoxicillin-clavulanate plus fluoroquinolones could be of value in cases of blood culture-negative endocarditis. Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Zepto-molar electrochemical detection of Brucella genome based on gold nanoribbons covered by gold nanoblooms

    NASA Astrophysics Data System (ADS)

    Rahi, Amid; Sattarahmady, Naghmeh; Heli, Hossein

    2015-12-01

    Gold nanoribbons covered by gold nanoblooms were sonoelectrodeposited on a polycrystalline gold surface at -1800 mV (vs. AgCl) with the assistance of ultrasound and co-occurrence of the hydrogen evolution reaction. The nanostructure, as a transducer, was utilized to immobilize a Brucella-specific probe and fabrication of a genosensor, and the process of immobilization and hybridization was detected by electrochemical methods, using methylene blue as a redox marker. The proposed method for detection of the complementary sequence, sequences with base-mismatched (one-, two- and three-base mismatches), and the sequence of non-complementary sequence was assayed. The fabricated genosensor was evaluated for the assay of the bacteria in the cultured and human samples without polymerase chain reactions (PCR). The genosensor could detect the complementary sequence with a calibration sensitivity of 0.40 μA dm3 mol-1, a linear concentration range of 10 zmol dm-3 to 10 pmol dm-3, and a detection limit of 1.71 zmol dm-3.

  1. Sequencing the oligosaccharide pool in the low molecular weight heparin dalteparin with offline HPLC and ESI-MS/MS.

    PubMed

    Wang, Zhangjie; Zhang, Tianji; Xie, Shaoshuai; Liu, Xinyue; Li, Hongmei; Linhardt, Robert J; Chi, Lianli

    2018-03-01

    Low molecular weight heparins (LMWHs) are widely used anticoagulant drugs. The composition and sequence of LMWH oligosaccharides determine their safety and efficacy. The short oligosaccharide pool in LMWHs undergoes more depolymerization reactions than the longer chains and is the most sensitive indicator of the manufacturing process. Electrospray ionization tandem mass spectrometry (ESI-MS/MS) has been demonstrated as a powerful tool to sequence synthetic heparin oligosaccharide but never been applied to analyze complicated mixture like LMWHs. We established an offline strong anion exchange (SAX)-high performance liquid chromatography (HPLC) and ESI-MS/MS approach to sequence the short oligosaccharides of dalteparin sodium. With the help of in-house developed MS/MS interpretation software, the sequences of 18 representative species ranging from tetrasaccharide to octasaccharide were obtained. Interestingly, we found a novel 2,3-disulfated hexauronic acid structure and reconfirmed it by complementary heparinase digestion and LC-MS/MS analysis. This approach provides straightforward and in-depth insight to the structure of LMWHs and the reaction mechanism of heparin depolymerization. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Microsatellite DNA as shared genetic markers among conifer species

    Treesearch

    C.S. Echt; G.G. Vendramin; C. D. Nelson; Paula E. Marquardt

    1999-01-01

    Polymerase chain reaction (PCR) primer pairs for 21 simple sequence repeat (SSR) loci in Pinus strobus L, and 6 in Pinus radiata D. Don were evaluated to determine whether SSR marker amplification could be achieved in 1O other conifer species. Eighty percent of SSR primer pairs for (AC) loci that were polymorphic in P. ...

  3. Cowpox Virus Transmission from Rats to Monkeys, the Netherlands

    PubMed Central

    Martina, Byron E.E.; van Doornum, Gerard; Dorrestein, Gerry M.; Niesters, Hubert G.M.; Stittelaar, Koert J.; Wolters, Marno A.B.I.; van Bolhuis, Hester G.H.

    2006-01-01

    We report an outbreak of cowpox virus among monkeys at a sanctuary for exotic animals. Serologic analysis and polymerase chain reaction were performed on blood and swab samples from different rodent species trapped at the sanctuary during the outbreak. Sequence comparison and serologic results showed that brown rats (Rattus norvegicus) transmitted the virus to monkeys. PMID:16707063

  4. A Mini-Library of Sequenced Human DNA Fragments: Linking Bench Experiments with Informatics

    ERIC Educational Resources Information Center

    Dalgleish, Raymond; Shanks, Morag E.; Monger, Karen; Butler, Nicola J.

    2012-01-01

    We describe the development of a mini-library of human DNA fragments for use in an enquiry-based learning (EBL) undergraduate practical incorporating "wet-lab" and bioinformatics tasks. In spite of the widespread emergence of the polymerase chain reaction (PCR), the cloning and analysis of DNA fragments in "Escherichia coli"…

  5. Microsatellite DNA as shared genetic markers among conifer species

    Treesearch

    Craig S. Echt; G.G. Vendramin; C.D. Nelson; P. Marquardt

    1999-01-01

    Polymerase chain reaction (PCR) primer pairs for 21 simple sequence repeat (SSR) loci in Pinus strobus L. and 6 in Pinus radiata D. Don. were evaluated to determine whether SSR marker amplification could be achieved in 10 other conifer species. Eighty percent of SSR primer pairs for (AC)n loci that were polymorphic in P. ...

  6. Development of a non invasion real-time PCR assay for the quantitation of chicken parvovirus in fecal swabs

    USDA-ARS?s Scientific Manuscript database

    The present study describes the development of a real time Taqman polymerase chain reaction (PCR) assay using a fluorescent labeled probe for the detection and quantitation of chicken parvovirus (ChPV) in feces. The primers and probes were designed based on the nucleotide sequence of the non struct...

  7. Rapid detection of Mannheimia haemolytica in lung tissues of sheep and from bacterial culture.

    PubMed

    Kumar, Jyoti; Dixit, Shivendra Kumar; Kumar, Rajiv

    2015-09-01

    This study was aimed to detect Mannheimia haemolytica in lung tissues of sheep and from a bacterial culture. M. haemolytica is one of the most important and well-established etiological agents of pneumonia in sheep and other ruminants throughout the world. Accurate diagnosis of M. haemolytica primarily relies on bacteriological examination, biochemical characteristics and, biotyping and serotyping of the isolates. In an effort to facilitate rapid M. haemolytica detection, polymerase chain reaction assay targeting Pasteurella haemolytica serotype-1 specific antigens (PHSSA), Rpt2 and 12S ribosomal RNA (rRNA) genes were used to detect M. haemolytica directly from lung tissues and from bacterial culture. A total of 12 archived lung tissues from sheep that died of pneumonia on an organized farm were used. A multiplex polymerase chain reaction (mPCR) based on two-amplicons targeted PHSSA and Rpt2 genes of M. haemolytica were used for identification of M. haemolytica isolates in culture from the lung samples. All the 12 lung tissue samples were tested for the presence M. haemolytica by PHSSA and Rpt2 genes based PCR and its confirmation by sequencing of the amplicons. All the 12 lung tissue samples tested for the presence of PHSSA and Rpt2 genes of M. haemolytica by mPCR were found to be positive. Amplification of 12S rRNA gene fragment as internal amplification control was obtained with each mPCR reaction performed from DNA extracted directly from lung tissue samples. All the M. haemolytica were also positive for mPCR. No amplified DNA bands were observed for negative control reactions. All the three nucleotide sequences were deposited in NCBI GenBank (Accession No. KJ534629, KJ534630 and KJ534631). Sequencing of the amplified products revealed the identity of 99-100%, with published sequence of PHSSA and Rpt2 genes of M. haemolytica available in the NCBI database. Sheep specific mitochondrial 12S rRNA gene sequence also revealed the identity of 98% with published sequences in the NCBI database. The present study emphasized the PCR as a valuable tool for rapid detection of M. haemolytica in clinical samples from animals. In addition, it offers the opportunity to perform large-scale epidemiological studies regarding the role of M. haemolytica in clinical cases of pneumonia and other disease manifestations in sheep and other ruminants, thereby providing the basis for effective preventive strategies.

  8. Phylogenetic position of parabasalid symbionts from the termite Calotermes flavicollis based on small subunit rRNA sequences.

    PubMed

    Gerbod, D; Edgcomb, V P; Noël, C; Delgado-Viscogliosi, P; Viscogliosi, E

    2000-09-01

    Small subunit rDNA genes were amplified by polymerase chain reaction using specific primers from mixed-population DNA obtained from the whole hindgut of the termite Calotermes flavicollis. Comparative sequence analysis of the clones revealed two kinds of sequences that were both from parabasalid symbionts. In a molecular tree inferred by distance, parsimony and likelihood methods, and including 27 parabasalid sequences retrieved from the data bases, the sequences of the group II (clones Cf5 and Cf6) were closely related to the Devescovinidae/Calonymphidae species and thus were assigned to the Devescovinidae Foaina. The sequence of the group I (clone Cf1) emerged within the Trichomonadinae and strongly clustered with Tetratrichomonas gallinarum. On the basis of morphological data, the Monocercomonadidae Hexamastix termitis might be the most likely origin of this sequence.

  9. Complete mitochondrial genome sequence of northeastern sika deer (Cervus nippon hortulorum).

    PubMed

    Shao, Yuanchen; Zha, Daiming; Xing, Xiumei; Su, Weilin; Liu, Huamiao; Zhang, Ranran

    2016-01-01

    The complete mitochondrial genome of the northeastern sika deer, Cervus nippon hortulorum, was determined by accurate polymerase chain reaction. The entire genome is 16,434 bp in length and contains 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and 1 control region, all of which are arranged in a typical vertebrate manner. The overall base composition of the northeastern sika deer's mitochondrial genome is 33.3% of A, 24.5% of C, 28.7% of T and 13.5% of G. A termination associated sequence and several conserved central sequence block domains were discovered within the control region.

  10. ECB deacylase mutants

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Zhao, Huimin; Giver, Lorraine J.

    2002-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  11. Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

    NASA Astrophysics Data System (ADS)

    Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

    1989-04-01

    The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

  12. Characterization of milled solid residue from cypress liquefaction in sub- and super ethanol.

    PubMed

    Liu, Hua-Min; Liu, Yu-Lan

    2014-01-01

    Cypress liquefaction in sub- and super ethanol was carried out in an autoclave at various temperatures. Milled solid residue (MSR) was isolated from solid residue remaining from the liquefaction process, and its chemical characteristics was comparatively investigated with milled wood lignin (MWL) of cypress by sugar analysis, elemental analysis, FT-IR analysis, gel permeation chromatography, and NMR analysis. Results showed that there were two reactions (de-polymerization and re-polymerization) during the cypress liquefaction in sub- and super ethanol and the re-polymerization reactions were the main reaction at 220-260°C. Considering the stability of side-chain, the stability of lignin side-chain in cypress during liquefaction process in ethanol could be sequenced as follows: β-5>β-β'>β-O-4'. The MSR were mainly from the decomposition and re-polymerization of lignin. This study suggests that characterization of MSR provides a promising method to investigate the mechanisms of cypress liquefaction in ethanol. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  13. Phenotypic and genotypic analysis of Borrelia burgdorferi isolates from various sources.

    PubMed Central

    Adam, T; Gassmann, G S; Rasiah, C; Göbel, U B

    1991-01-01

    A total of 17 B. burgdorferi isolates from various sources were characterized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins, restriction enzyme analysis, Southern hybridization with probes complementary to unique regions of evolutionarily conserved genes (16S rRNA and fla), and direct sequencing of in vitro polymerase chain reaction-amplified fragments of the 16S rRNA gene. Three groups were distinguished on the basis of phenotypic and genotypic traits, the latter traced to the nucleotide sequence level. Images PMID:1649797

  14. cDNA encoding a polypeptide including a hevein sequence

    DOEpatents

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  15. Isolation and identification of a thermophilic strain producing trehalose synthase from geothermal water in China.

    PubMed

    Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun

    2008-08-01

    A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.

  16. Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

    PubMed

    Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

    2011-05-01

    A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

  17. Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

    PubMed

    Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

    2008-12-01

    One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

  18. Norrie disease in a family with a manifesting female carrier.

    PubMed

    Sims, K B; Irvine, A R; Good, W V

    1997-04-01

    To show that Norrie disease can occur in a girl and to describe her ophthalmologic and genetic features. Amplification of DNA polymerase chain reaction and sequencing of asymmetric polymerase chain reaction for exon 3 were performed on the blood specimen obtained from a girl born with bilateral retinal detachments. A female child with bilateral retinal detachment who had 2 uncles in whom Norrie disease had already been diagnosed. The child had a mutation in the third exon (T776-->A; Ile 123-->Asn) identical to the mutation found in her uncles. Norrie disease can occur in girls. The most likely explanation is nonrandom or unfavorable X inactivation, although timing of development of the peripheral retina and its blood supply could render it vulnerable to effects of the mutant allele at a critical developmental phase.

  19. VH gene expression and regulation in the mutant Alicia rabbit. Rescue of VHa2 allotype expression.

    PubMed

    Chen, H T; Alexander, C B; Young-Cooper, G O; Mage, R G

    1993-04-01

    Rabbits of the Alicia strain, derived from rabbits expressing the VHa2 allotype, have a mutation in the H chain locus that has a cis effect upon the expression of VHa2 and VHa- genes. A small deletion at the most J-proximal (3') end of the VH locus leads to low expression of all the genes on the entire chromosome in heterozygous ali mutants and altered relative expression of VH genes in homozygotes. To study VH gene expression and regulation, we used the polymerase chain reaction to amplify the VH genes expressed in spleens of young and adult wild-type and mutant Alicia rabbits. The cDNA from reverse transcription of splenic mRNA was amplified and polymerase chain reaction libraries were constructed and screened with oligonucleotides from framework regions 1 and 3, as well as JH. Thirty-three VH-positive clones were sequenced and analyzed. We found that in mutant Alicia rabbits, products of the first functional VH gene (VH4a2), (or VH4a2-like genes) were expressed in 2- to 8-wk-olds. Expression of both the VHx and VHy types of VHa- genes was also elevated but the relative proportions of VHx and VHy, especially VHx, decreased whereas the relative levels of expression of VH4a2 or VH4a2-like genes increased with age. Our results suggest that the appearance of sequences resembling that of the VH1a2, which is deleted in the mutant ali rabbits, could be caused by alterations of the sequences of the rearranged VH4a2 genes by gene conversions and/or rearrangement of upstream VH1a2-like genes later in development.

  20. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

    PubMed Central

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features. PMID:26579116

  1. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food.

    PubMed

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

  2. Progranulin mutation causes frontotemporal dementia in the Swedish Karolinska family.

    PubMed

    Chiang, Huei-Hsin; Rosvall, Lina; Brohede, Jesper; Axelman, Karin; Björk, Behnosh F; Nennesmo, Inger; Robins, Tiina; Graff, Caroline

    2008-11-01

    Frontotemporal dementia (FTD) is a neurodegenerative disease characterized by cognitive impairment, language dysfunction, and/or changes in personality. Recently it has been shown that progranulin (GRN) mutations can cause FTD as well as other neurodegenerative phenotypes. DNA from 30 family members, of whom seven were diagnosed with FTD, in the Karolinska family was available for GRN sequencing. Fibroblast cell mRNA from one affected family member and six control individuals was available for relative quantitative real-time polymerase chain reaction to investigate the effect of the mutation. Furthermore, the cDNA of an affected individual was sequenced. Clinical and neuropathologic findings of a previously undescribed family branch are presented. A frameshift mutation in GRN (g.102delC) was detected in all affected family members and absent in four unaffected family members older than 70 years. Real-time polymerase chain reaction data showed an approximately 50% reduction of GRN fibroblast mRNA in an affected individual. The mutated mRNA transcripts were undetectable by cDNA sequencing. Segregation and RNA analyses showed that the g.102delC mutation, previously reported, causes FTD in the Karolinska family. Our findings add further support to the significance of GRN in FTD etiology and the presence of modifying genes, which emphasize the need for further studies into the mechanisms of clinical heterogeneity. However, the results already call for attention to the complexity of predictive genetic testing of GRN mutations.

  3. Kinetic Induction of Oat Shoot Pulvinus Invertase mRNA by Gravistimulation and Partial cDNA Cloning by the Polymerase Chain Reaction

    NASA Technical Reports Server (NTRS)

    Wu, Liu-Lai; Song, Il; Karuppiah, Nadarajah; Kaufman, Peter B.

    1993-01-01

    An asymmetric (top vs. bottom halves of pulvini) induction of invertase mRNA by gravistimulation was analyzed in oat shoot pulvini. Total RNA and poly(A)(+) RNA, isolated from oat pulvini, and two oli-gonucleotide primers, corresponding to two conserved amino acid sequences (NDPNG and WECPD) found in invertase from other species, were used for the polymerase chain reaction (PCR). A partial length cDNA (550 bp) was obtained and characterized. A 62% nucleotide sequence homology and 58% deduced amino acid sequence homology, as compared to beta-fructosidase of carrot cell wall, was found. Northern blot analysis showed that there was an obviously transient induction of invertase mRNA by gravistimulation in the oat pulvinus system. The mRNA was rapidly induced to a maximum level at 1 hour after gravistimulation treatment and gradually decreased afterwards. The mRNA level in the bottom half of the oat pulvinus was significantly higher than that in the top half of the pulvinus tissue. The kinetic induction of invertase mRNA was consistent with the transient accumulation of invertase activity during the graviresponse of the pulvinus. This indicates that the expression of the invertase gene(s) could be regulated by gravistimulation at the transcriptional level. Southern blot analysis showed that there were two to three genomic DNA fragments which hybridized with the partial-length invertase cDNA.

  4. Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter with application of high-processivity polymerase and novel internal amplification controls for rapid and specific detection.

    PubMed

    Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S

    2012-02-01

    Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications. Published by Elsevier Inc.

  5. Genetic Relatedness Among Shiga Toxin-Producing Escherichia coli Isolated Along the Animal Food Supply Chain and in Gastroenteritis Cases in Qatar Using Multilocus Sequence Typing.

    PubMed

    Palanisamy, Srikanth; Chang, YuChen; Scaria, Joy; Penha Filho, Rafael Antonio Casarin; Peters, Kenlyn E; Doiphode, Sanjay H; Sultan, Ali; Mohammed, Hussni O

    2017-06-01

    Pathogenic Escherichia coli has been listed among the most important bacteria associated with foodborne illnesses around the world. We investigated the genetic relatedness among Shiga toxin-producing E. coli (STEC) isolated along the animal food supply chain and from humans diagnosed with gastroenteritis in Qatar. Samples were collected from different sources along the food supply chain and from patients admitted to the hospital with complaints of gastroenteritis. All samples were screened for the presence of E. coli O157:H7 and non-O157 STEC using a combination of bacterial enrichment and molecular detection techniques. A proportional sampling approach was used to select positive samples from each source for further multilocus sequence typing (MLST) analysis. Seven housekeeping genes described for STEC were amplified by polymerase chain reaction, sequenced, and analyzed by MLST. Isolates were characterized by allele composition, sequence type (ST) and assessed for epidemiologic relationship within and among different sources. Nei's genetic distance was calculated at the allele level between sample pools in each site downstream. E. coli O157:H7 occurred at a higher rate in slaughterhouse and retail samples than at the farm or in humans in our sampling. The ST171, an ST common to enterotoxigenic E. coli and atypical enteropathogenic E. coli, was the most common ST (15%) in the food supply chain. None of the genetic distances among the different sources was statistically significant. Enterohemorrhagic E. coli pathogenic strains are present along the supply chain at different levels and with varying relatedness. Clinical isolates were the most diverse, as expected, considering the polyclonal diversity in the human microbiota. The high occurrence of these food adulterants among the farm products suggests that implementation of sanitary measures at that level might reduce the risk of human exposure.

  6. Terminations of DNA synthesis on 'proflavine and light'-treated phi X174 single-stranded DNA.

    PubMed

    Piette, J; Calberg-Bacq, C M; Lopez, M; van de Vorst, A

    1984-04-05

    Bacteriophage phi X174 single-stranded DNA molecules were primed with five different restriction fragments and irradiated with visible light in the presence of proflavine. This photodamaged DNA was used as template for the in vitro complementary chain synthesis by E. coli DNA polymerase I (Klenow fragment). Chain terminations were observed by polyacrylamide gel electrophoresis of the synthesized products and localized by comparison with standard sequencing performed simultaneously on the untreated template. 90% of the chain terminations occurred one nucleotide before a guanine residue in the template strand. More than 80% of the sequenced guanine residues were blocking lesions demonstrating the absence of 'hot-spots' for the photodamaging effect of proflavine. At a defined position, the chain termination frequency increased linearly with the irradiation time and was directly influenced by the proflavine concentration present. An important part of lesions resulted from the action of singlet oxygen produced by excited proflavine as shown by the effect that both NaN3 and 2H2O exerted on the reaction. The induced blocking lesions must be important in vivo since no complete replicative forms could be extracted from cell infected with bacteriophages inactivated by 'proflavine and light' treatment.

  7. Heterocyclic alpha-alkylidene cyclopentenones obtained via a Pauson-Khand reaction of amino acid derived allenynes. A scope and limitation study directed toward the preparation of a tricyclic pyrrole library.

    PubMed

    Brummond, Kay M; Curran, Dennis P; Mitasev, Branko; Fischer, Stefan

    2005-03-04

    The synthesis of a novel class of tricyclic pyrroles has been accomplished by using a Pauson-Khand/Stetter/Paal-Knorr reaction sequence. Full details of the Pauson-Khand reaction of amino acid tethered allenynes 4a-e and 9a-d are disclosed. The study of this reaction led to the discovery of an unprecedented substituent effect on the diastereoselectivity of the Mo(CO)6 mediated allenic Pauson-Khand reaction. It was found that amino acid tethered allenynes with aromatic side chains afford alpha-alkylidene cyclopentenones with the opposite diastereoselectivity compared to those with aliphatic side chains. This effect has been attributed to complexation of the metal mediator to the aromatic ring in the substrate. Furthermore, an isomerization of one of the diastereomers of the alpha-alkylidene cyclopentenones was encountered, leading to eventual decomposition. The stable diastereomers were found to react well in the Stetter reaction leading to 1,4-diketones that were converted to pyrroles. The observation that the first generation of 2-alkyl-substituted pyrroles was unstable led to a second generation of 2-carboxamide pyrroles with sufficient stability for biological tests which are in progress.

  8. Mechanisms of tail resorption during anuran metamorphosis.

    PubMed

    Nakai, Yuya; Nakajima, Keisuke; Yaoita, Yoshio

    2017-09-26

    Amphibian metamorphosis has historically attracted a good deal of scientific attention owing to its dramatic nature and easy observability. However, the genetic mechanisms of amphibian metamorphosis have not been thoroughly examined using modern techniques such as gene cloning, DNA sequencing, polymerase chain reaction or genomic editing. Here, we review the current state of knowledge regarding molecular mechanisms underlying tadpole tail resorption.

  9. The Function of Neuroendocrine Cells in Prostate Cancer

    DTIC Science & Technology

    2013-04-01

    integration site. We then performed deep sequencing and aligned reads to the genome. Our analysis revealed that both histological phenotypes are derived from...lentiviral integration site analysis . (B) Laser capture microdissection was performed on individual glands containing both squamous and...lentiviral integration site analysis . LTR: long terminal repeat (viral DNA), PCR: polymerase chain reaction. (D) Venn diagrams depict shared lentiviral

  10. Quick detection of Leifsonia xyli subsp. xyli by PCR and necleotide sequence analysis of PCR amplicons from Chinese Leifsonia xyli subsp. xyli isolates

    USDA-ARS?s Scientific Manuscript database

    A quick polymerase chain reaction (PCR) assay was developed for the detection of Leifsonia xyli subsp. xyli (Lxx), the bacterial causal agent of ratoon stunting disease (RSD) of sugarcane, in crude juice samples from stalks. After removal of abiotic impurities and large molecular weight microorgani...

  11. Analysis of sequences from field samples reveals the presence of the recently described pepper vein yellows virus (genus Polerovirus) in six additional countries.

    PubMed

    Knierim, Dennis; Tsai, Wen-Shi; Kenyon, Lawrence

    2013-06-01

    Polerovirus infection was detected by reverse transcription polymerase chain reaction (RT-PCR) in 29 pepper plants (Capsicum spp.) and one black nightshade plant (Solanum nigrum) sample collected from fields in India, Indonesia, Mali, Philippines, Thailand and Taiwan. At least two representative samples for each country were selected to generate a general polerovirus RT-PCR product of 1.4 kb length for sequencing. Sequence analysis of the partial genome sequences revealed the presence of pepper vein yellows virus (PeVYV) in all 13 samples. A 1990 Australian herbarium sample of pepper described by serological means as infected with capsicum yellows virus (CYV) was identified by sequence analysis of a partial CP sequence as probably infected with a potato leaf roll virus (PLRV) isolate.

  12. Development of a peptide nucleic acid polymerase chain reaction clamping assay for semiquantitative evaluation of genetically modified organism content in food.

    PubMed

    Peano, C; Lesignoli, F; Gulli, M; Corradini, R; Samson, M C; Marchelli, R; Marmiroli, N

    2005-09-15

    In the present study a peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping method was developed and applied to the detection of genetically modified organisms (GMO), to test PCR products for band identity and to obtain a semiquantitative evaluation of GMO content. The minimal concentration of PNA necessary to block the PCR was determined by comparing PCRs containing a constant amount of DNA in the presence of increasing concentration of target-specific PNA. The lowest PNA concentration at which specific inhibition took place, by the inhibition of primer extension and/or steric hindrance, was the most efficient condition. Optimization of PCR clamping by PNA was observed by testing five different PNAs with a minimum of 13 bp to a maximum of 15 bp, designed on the target sequence of Roundup Ready soybean. The results obtained on the DNA extracted from Roundup Ready soybean standard flour were verified also on DNA extracted from standard flours of maize GA21, Bt176, Bt11, and MON810. A correlation between the PNA concentration necessary for inducing PCR clamping and the percentage of the GMO target sequence in the sample was found.

  13. Blood-Borne Candidatus Borrelia algerica in a Patient with Prolonged Fever in Oran, Algeria

    PubMed Central

    Fotso Fotso, Aurélien; Angelakis, Emmanouil; Mouffok, Nadjet; Drancourt, Michel; Raoult, Didier

    2015-01-01

    To improve the knowledge base of Borrelia in north Africa, we tested 257 blood samples collected from febrile patients in Oran, Algeria, between January and December 2012 for Borrelia species using flagellin gene polymerase chain reaction sequencing. A sequence indicative of a new Borrelia sp. named Candidatus Borrelia algerica was detected in one blood sample. Further multispacer sequence typing indicated this Borrelia sp. had 97% similarity with Borrelia crocidurae, Borrelia duttonii, and Borrelia recurrentis. In silico comparison of Candidatus B. algerica spacer sequences with those of Borrelia hispanica and Borrelia garinii revealed 94% and 89% similarity, respectively. Candidatus B. algerica is a new relapsing fever Borrelia sp. detected in Oran. Further studies may help predict its epidemiological importance. PMID:26416117

  14. A family of cellular proteins related to snake venom disintegrins.

    PubMed

    Weskamp, G; Blobel, C P

    1994-03-29

    Disintegrins are short soluble integrin ligands that were initially identified in snake venom. A previously recognized cellular protein with a disintegrin domain was the guinea pig sperm protein PH-30, a protein implicated in sperm-egg membrane binding and fusion. Here we present peptide sequences that are characteristic for several cellular disintegrin-domain proteins. These peptide sequences were deduced from cDNA sequence tags that were generated by polymerase chain reaction from various mouse tissue and a mouse muscle cell line. Northern blot analysis with four sequence tags revealed distinct mRNA expression patterns. Evidently, cellular proteins containing a disintegrin domain define a superfamily of potential integrin ligands that are likely to function in important cell-cell and cell-matrix interactions.

  15. Large scale DNA microsequencing device

    DOEpatents

    Foote, R.S.

    1997-08-26

    A microminiature sequencing apparatus and method provide a means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus cosists of a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 17 figs.

  16. Orthogonal Polynomials Associated with Complementary Chain Sequences

    NASA Astrophysics Data System (ADS)

    Behera, Kiran Kumar; Sri Ranga, A.; Swaminathan, A.

    2016-07-01

    Using the minimal parameter sequence of a given chain sequence, we introduce the concept of complementary chain sequences, which we view as perturbations of chain sequences. Using the relation between these complementary chain sequences and the corresponding Verblunsky coefficients, the para-orthogonal polynomials and the associated Szegő polynomials are analyzed. Two illustrations, one involving Gaussian hypergeometric functions and the other involving Carathéodory functions are also provided. A connection between these two illustrations by means of complementary chain sequences is also observed.

  17. cDNA, genomic sequence cloning, and overexpression of EIF1 from the giant panda (Ailuropoda Melanoleuca) and the black bear (Ursus Thibetanus Mupinensis).

    PubMed

    Hou, Wan-ru; Tang, Yun; Hou, Yi-ling; Song, Yan; Zhang, Tian; Wu, Guang-fu

    2010-07-01

    Eukaryotic initiation factor (eIF) EIF1 is a universally conserved translation factor that is involved in translation initiation site selection. The cDNA and the genomic sequences of EIF1 were cloned successfully from the giant panda (Ailuropoda melanoleuca) and the black bear (Ursus thibetanus mupinensis) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-polymerase chain reaction, respectively. The cDNAs of the EIF1 cloned from the giant panda and the black bear are 418 bp in size, containing an open reading frame (ORF) of 342 bp encoding 113 amino acids. The length of the genomic sequence of the giant panda is 1909 bp, which contains four exons and three introns. The length of the genomic sequence of the black bear is 1897 bp, which also contains four exons and three introns. Sequence alignment indicates a high degree of homology to those of Homo sapiens, Mus musculus, Rattus norvegicus, and Bos Taurus at both amino acid and DNA levels. Topology prediction shows there are one N-glycosylation site, two Casein kinase II phosphorylation sites, and a Amidation site in the EIF1 protein of the giant panda and black bear. In addition, there is a protein kinase C phosphorylation site in EIF1 of the giant panda. The giant panda and the black bear EIF1 genes were overexpressed in E. coli BL21. The results indicated that the both EIF1 fusion proteins with the N-terminally His-tagged form gave rise to the accumulation of two expected 19 kDa polypeptide. The expression products obtained could be used to purify the proteins and study their function further.

  18. Rubisco activase is required for optimal photosynthesis in the green alga Chlamydomonas reinhardtii in a low-CO(2) atmosphere.

    PubMed

    Pollock, Steve V; Colombo, Sergio L; Prout, Davey L; Godfrey, Ashley C; Moroney, James V

    2003-12-01

    This report describes a Chlamydomonas reinhardtii mutant that lacks Rubisco activase (Rca). Using the BleR (bleomycin resistance) gene as a positive selectable marker for nuclear transformation, an insertional mutagenesis screen was performed to select for cells that required a high-CO2 atmosphere for optimal growth. The DNA flanking the BleR insert of one of the high-CO2-requiring strains was cloned using thermal asymmetric interlaced-polymerase chain reaction and inverse polymerase chain reaction and sequenced. The flanking sequence matched the C. reinhardtii Rca cDNA sequence previously deposited in the National Center for Biotechnology Information database. The loss of a functional Rca in the strain was confirmed by the absence of Rca mRNA and protein. The open reading frame for Rca was cloned and expressed in pSL18, a C. reinhardtii expression vector conferring paromomycin resistance. This construct partially complemented the mutant phenotype, supporting the hypothesis that the loss of Rca was the reason the mutant grew poorly in a low-CO2 atmosphere. Sequencing of the C. reinhardtii Rca gene revealed that it contains 10 exons ranging in size from 18 to 470 bp. Low-CO2-grown rca1 cultures had a growth rate and maximum rate of photosynthesis 60% of wild-type cells. Results obtained from experiments on a cia5 rca1 double mutant also suggest that the CO2-concentrating mechanism partially compensates for the absence of an active Rca in the green alga C. reinhardtii.

  19. Polymerase chain reaction (PCR) amplification of a nucleoprotein gene sequence of infectious hematopoietic necrosis virus

    USGS Publications Warehouse

    Arakawa, C.K.; Deering, R.E.; Higman, K.H.; Oshima, K.H.; O'Hara, P.J.; Winton, J.R.

    1990-01-01

    The polymerase chain reaction [PCR) was used to amplify a portion of the nucleoprotein [NI gene of infectious hematopoietic necrosis virus (IHNV). Using a published sequence for the Round Butte isolate of IHNV, a pair of PCR pnmers was synthesized that spanned a 252 nucleotide region of the N gene from residue 319 to residue 570 of the open reading frame. This region included a 30 nucleotide target sequence for a synthetic oligonucleotide probe developed for detection of IHNV N gene messenger RNA. After 25 cycles of amplification of either messenger or genomic RNA, the PCR product (DNA) of the expected size was easily visible on agarose gels stained with ethidium bromide. The specificity of the amplified DNA was confirmed by Southern and dot-blot analysis using the biotinylated oligonucleotide probe. The PCR was able to amplify the N gene sequence of purified genomic RNA from isolates of IHNV representing 5 different electropherotypes. Using the IHNV primer set, no PCR product was obtained from viral hemorrhagic septicemia virus RNA, but 2 higher molecular weight products were synthesized from hirame rhabdovirus RNA that did not hybridize with the biotinylated probe. The PCR could be efficiently performed with all IHNV genomic RNA template concentrations tested (1 ng to 1 pg). The lowest level of sensitivity was not determined. The PCR was used to amplify RNA extracted from infected cell cultures and selected tissues of Infected rainbow trout. The combination of PCR and nucleic acid probe promises to provide a detection method for IHNV that is rapid, h~ghly specific, and sensitive.

  20. 16S rDNA-based metagenomic analysis of dental plaque and lung bacteria in patients with severe acute exacerbations of chronic obstructive pulmonary disease.

    PubMed

    Tan, L; Wang, H; Li, C; Pan, Y

    2014-12-01

    Acute exacerbations of chronic obstructive pulmonary disease (AE-COPD) are leading causes of mortality in hospital intensive care units. We sought to determine whether dental plaque biofilms might harbor pathogenic bacteria that can eventually cause lung infections in patients with severe AE-COPD. Paired samples of subgingival plaque biofilm and tracheal aspirate were collected from 53 patients with severe AE-COPD. Total bacterial DNA was extracted from each sample individually for polymerase chain reaction amplification and/or generation of bacterial 16S rDNA sequences and cDNA libraries. We used a metagenomic approach, based on bacterial 16S rDNA sequences, to compare the distribution of species present in dental plaque and lung. Analysis of 1060 sequences (20 clones per patient) revealed a wide range of aerobic, anaerobic, pathogenic, opportunistic, novel and uncultivable bacterial species. Species indistinguishable between the paired subgingival plaque and tracheal aspirate samples (97-100% similarity in 16S rDNA sequence) were dental plaque pathogens (Aggregatibacter actinomycetemcomitans, Capnocytophaga sputigena, Porphyromonas gingivalis, Tannerella forsythia and Treponema denticola) and lung pathogens (Acinetobacter baumannii, Klebsiella pneumoniae, Pseudomonas aeruginosa and Streptococcus pneumoniae). Real-time polymerase chain reaction of 16S rDNA indicated lower levels of Pseudomonas aeruginosa and Porphyromonas gingivalis colonizing the dental plaques compared with the paired tracheal aspirate samples. These results support the hypothesis that dental bacteria may contribute to the pathology of severe AE-COPD. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. Use of Base Modifications in Primers and Amplicons to Improve Nucleic Acids Detection in the Real-Time Snake Polymerase Chain Reaction

    PubMed Central

    2011-01-01

    Abstract The addition of relatively short flap sequence at the 5′-end of one of the polymerase chain reaction (PCR) primers considerably improves performance of real-time assays based on 5′-nuclease activity. This new technology, called Snake, was shown to supersede the conventional methods like TaqMan, Molecular Beacons, and Scorpions in the signal productivity and discrimination of target polymorphic variations as small as single nucleotides. The present article describes a number of reaction conditions and methods that allow further improvement of the assay performance. One of the identified approaches is the use of duplex-destabilizing modifications such as deoxyinosine and deoxyuridine in the design of the Snake primers. This approach was shown to solve the most serious problem associated with the antisense amplicon folding and cleavage. As a result, the method permits the use of relatively long—in this study—14-mer flap sequences. Investigation also revealed that only the 5′-segment of the flap requires the deoxyinosine/deoxyuridine destabilization, whereas the 3′-segment is preferably left unmodified or even stabilized using 2-amino deoxyadenosine d(2-amA) and 5-propynyl deoxyuridine d(5-PrU) modifications. The base-modification technique is especially effective when applied in combination with asymmetric three-step PCR. The most valuable discovery of the present study is the effective application of modified deoxynucleoside 5′-triphosphates d(2-amA)TP and d(5-PrU)TP in Snake PCR. This method made possible the use of very short 6-8-mer 5′-flap sequences in Snake primers. PMID:21050073

  2. Ultrasensitive and selective signal-on electrochemical DNA detection via exonuclease III catalysis and hybridization chain reaction amplification.

    PubMed

    Ren, Wang; Gao, Zhong Feng; Li, Nian Bing; Luo, Hong Qun

    2015-01-15

    This work reported a novel, ultrasensitive, and selective platform for electrochemical detection of DNA, employing an integration of exonuclease III (Exo-III) assisted target recycling and hybridization chain reaction (HCR) for the dual signal amplification strategy. The hairpin capture probe DNA (C-DNA) with an Exo-III 3' overhang end was self-assembled on a gold electrode. In the presence of target DNA (T-DNA), C-DNA hybridized with the T-DNA to form a duplex region, exposing its 5' complementary sequence (initiator). Exo-III was applied to selectively digest duplex region from its 3-hydroxyl termini until the duplex was fully consumed, leaving the remnant initiator. The intact T-DNA spontaneously dissociated from the structure and then initiated the next hybridization process as a result of catalysis of the Exo-III. HCR event was triggered by the initiator and two hairpin helper signal probes labeled with methylene blue, facilitating the polymerization of oligonucleotides into a long nicked dsDNA molecule. The numerous exposed remnant initiators can trigger more HCR events. Because of integration of dual signal amplification and the specific HCR process reaction, the resultant sensor showed a high sensitivity for the detection of the target DNA in a linear range from 1.0 fM to 1.0 nM, and a detection limit as low as 0.2 fM. The proposed dual signal amplification strategy provides a powerful tool for detecting different sequences of target DNA by changing the sequence of capture probe and signal probes, holding a great potential for early diagnosis in gene-related diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Hammondia heydorni oocysts in the faeces of a greyhound in New Zealand.

    PubMed

    Ellis, J T; Pomroy, W E

    2003-02-01

    To identify oocysts found in faecal material of a greyhound. Polymerase chain reaction (PCR) and DNA sequencing were used to study genomic DNA isolated from oocysts purified from faeces of a greyhound. Database searches with the DNA sequences obtained showed they were derived from Hammondia heydorni. A species-specific PCR was developed to detect H. heydorni DNA. Light microscopy in conjunction with PCR and DNA sequencing definitively identified the presence of H. heydorni oocysts in faeces of a greyhound. This study confirms the presence of H. heydorni in New Zealand and indicates the need to correctly identify similar oocysts from dogs, rather than assume they are Neospora caninum.

  4. The complete mitochondrial genome of Pholis nebulosus (Perciformes: Pholidae).

    PubMed

    Wang, Zhongquan; Qin, Kaili; Liu, Jingxi; Song, Na; Han, Zhiqiang; Gao, Tianxiang

    2016-11-01

    In this study, the complete mitochondrial genome (mitogenome) sequence of Pholis nebulosus has been determined by long polymerase chain reaction and primer-walking methods. The mitogenome is a circular molecule of 16 524 bp in length, including the typical structure of 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes and 2 non-coding regions (L-strand replication origin and control region), the gene contents of which are identical to those observed in most bony fishes. Within the control region, we identified the termination-associated sequence domain (TAS), and the conserved sequence block domain (CSB-F, CSB-E, CSB-D, CSB-C, CSB-B, CSB-A, CSB-1, CSB-2, CSB-3).

  5. Experimental study of electrochemical fluorination of trichloroethylene

    NASA Technical Reports Server (NTRS)

    Polisena, C.; Liu, C. C.; Savinell, R. F.

    1982-01-01

    The electrochemical fluorination of trichloroethylene in anhydrous hydrogen fluoride at 0 C and at constant cell potential was investigated. A microprocessor-aided electrochemical fluorination reactor system that yields highly reproducible results was utilized. The following major two-carbon-chain products were observed: CHCl2-CCl2F, CHCl2-CClF2, CHClF-CCl2F, and CCl2F-CClF2. The first step in the reaction sequence was determined to be fluorine addition to the double bond, followed by replacement of first hydrogen and then chlorine by fluorine. Polymerization reactions yielded higher molecular weight or possible ring-type chlorofluorohydrocarbons. A comparison of the reaction products of electrochemical and chemical fluorinations of trichloroethylene is also discussed.

  6. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

  7. Identification of branched-chain amino acid aminotransferases active towards (R)-(+)-1-phenylethylamine among PLP fold type IV transaminases.

    PubMed

    Bezsudnova, Ekaterina Yu; Dibrova, Daria V; Nikolaeva, Alena Yu; Rakitina, Tatiana V; Popov, Vladimir O

    2018-04-10

    New class IV transaminases with activity towards L-Leu, which is typical of branched-chain amino acid aminotransferases (BCAT), and with activity towards (R)-(+)-1-phenylethylamine ((R)-PEA), which is typical of (R)-selective (R)-amine:pyruvate transaminases, were identified by bioinformatics analysis, obtained in recombinant form, and analyzed. The values of catalytic activities in the reaction with L-Leu and (R)-PEA are comparable to those measured for characteristic transaminases with the corresponding specificity. Earlier, (R)-selective class IV transaminases were found to be active, apart from (R)-PEA, only with some other (R)-primary amines and D-amino acids. Sequences encoding new transaminases with mixed type of activity were found by searching for changes in the conserved motifs of sequences of BCAT by different bioinformatics tools. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

    PubMed

    Ririe, K M; Rasmussen, R P; Wittwer, C T

    1997-02-15

    A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

  9. Theory and applications of the polymerase chain reaction.

    PubMed

    Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

    1990-04-01

    The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

  10. Molecular Detection and Identification of Rickettsia Species in Ixodes pacificus in California

    PubMed Central

    Phan, Jimmy Ninh; Lu, Casey Roy; Bender, William Garrett; Smoak, Robert Marion

    2011-01-01

    Abstract We amplified 16S rRNA, gltA, and ompA genes from Ixodes pacificus by polymerase chain reaction. Sequencing, BLAST analysis, and phylogenetic constructions indicated that two Rickettsia phylotypes are present in I. pacificus. While phylotype G021 has high homology to Ixodes scapularis endosymbiotic Rickettsia, phylotype G022 is a deeply branched novel spotted fever group Rickettsia. PMID:21413886

  11. Cryptosporidium canis in Two Mexican Toddlers.

    PubMed

    González-Díaz, Mariana; Urrea-Quezada, Alejandro; Villegas-Gómez, Isaac; Durazo, María; Garibay-Escobar, Adriana; Hernández, Jesús; Xiao, Lihua; Valenzuela, Olivia

    2016-11-01

    Cryptosporidium canis is reported for the first time in 2 toddlers in Northwestern Mexico. The 2 toddlers (33 and 34 months old) were symptomatic at diagnosis, presenting diarrhea and fever, and 1 case presented chronic malnutrition. Both toddlers were HIV-negative. C. canis was identified by SspI and VspI restriction enzyme digestion of the 18S rRNA polymerase chain reaction products and confirmed by sequence analysis.

  12. Updated Distribution Records for Anopheles vagus (Diptera: Culicidae) in the Republic of Philippines, and Considerations Regarding Its Secondary Vector Roles in Southeast Asia

    DTIC Science & Technology

    2011-01-01

    larvae were collected from three habitats (rice fields, irrigation ditches and drainage ditches) in Laguna Province in July 2002 using a plastic dipper ...Wilkerson et al. (2003). The rDNA ITS2 was amplified, and polymerase chain reaction (PCR) products were directly sequenced using Big Dye 3.0 (Applied

  13. Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

    DTIC Science & Technology

    1990-01-30

    bisphosphate carboxylase We designed from published sequence information oligonucleotide primers which are complementary to conserved regions on RubisCO ...large and small subunit genes. These primers were used successfully to amplify using polymerase chain reaction (PCR) specific regions of RubisCO ...for the large subunit of ribulose bisphosphate carboxylase/oxygenase ( RubisCO ) to symbiont DNA shows that the symbionts from both deep-sea and shallow

  14. Detection of a Bacteriophage Gene Encoding a Mu-like Portal Protein in Haemophilus parasuis Reference Strains and Field Isolates by Nested Polymerase Chain Reaction

    USDA-ARS?s Scientific Manuscript database

    A nested PCR assay was developed to determine the presence of a gene encoding a bacteriophage Mu-like portal protein, gp29, in 15 reference strains and 31 field isolates of Haemophilus parasuis. Specific primers, based on the gene’s sequence, were utilized. A majority of the virulent reference strai...

  15. Modulation of frustration in folding by sequence permutation.

    PubMed

    Nobrega, R Paul; Arora, Karunesh; Kathuria, Sagar V; Graceffa, Rita; Barrea, Raul A; Guo, Liang; Chakravarthy, Srinivas; Bilsel, Osman; Irving, Thomas C; Brooks, Charles L; Matthews, C Robert

    2014-07-22

    Folding of globular proteins can be envisioned as the contraction of a random coil unfolded state toward the native state on an energy surface rough with local minima trapping frustrated species. These substructures impede productive folding and can serve as nucleation sites for aggregation reactions. However, little is known about the relationship between frustration and its underlying sequence determinants. Chemotaxis response regulator Y (CheY), a 129-amino acid bacterial protein, has been shown previously to populate an off-pathway kinetic trap in the microsecond time range. The frustration has been ascribed to premature docking of the N- and C-terminal subdomains or, alternatively, to the formation of an unproductive local-in-sequence cluster of branched aliphatic side chains, isoleucine, leucine, and valine (ILV). The roles of the subdomains and ILV clusters in frustration were tested by altering the sequence connectivity using circular permutations. Surprisingly, the stability and buried surface area of the intermediate could be increased or decreased depending on the location of the termini. Comparison with the results of small-angle X-ray-scattering experiments and simulations points to the accelerated formation of a more compact, on-pathway species for the more stable intermediate. The effect of chain connectivity in modulating the structures and stabilities of the early kinetic traps in CheY is better understood in terms of the ILV cluster model. However, the subdomain model captures the requirement for an intact N-terminal domain to access the native conformation. Chain entropy and aliphatic-rich sequences play crucial roles in biasing the early events leading to frustration in the folding of CheY.

  16. Natural selection of the major histocompatibility complex (Mhc) in Hawaiian honeycreepers (Drepanidinae)

    USGS Publications Warehouse

    Jarvi, S.I.; Tarr, C.L.; Mcintosh, C.E.; Atkinson, C.T.; Fleischer, R.C.

    2004-01-01

    The native Hawaiian honeycreepers represent a classic example of adaptive radiation and speciation, but currently face one the highest extinction rates in the world. Although multiple factors have likely influenced the fate of Hawaiian birds, the relatively recent introduction of avian malaria is thought to be a major factor limiting honeycreeper distribution and abundance. We have initiated genetic analyses of class II ?? chain Mhc genes in four species of honeycreepers using methods that eliminate the possibility of sequencing mosaic variants formed by cloning heteroduplexed polymerase chain reaction products. Phylogenetic analyses group the honeycreeper Mhc sequences into two distinct clusters. Variation within one cluster is high, with dN > d S and levels of diversity similar to other studies of Mhc (B system) genes in birds. The second cluster is nearly invariant and includes sequences from honeycreepers (Fringillidae), a sparrow (Emberizidae) and a blackbird (Emberizidae). This highly conserved cluster appears reminiscent of the independently segregating Rfp-Y system of genes defined in chickens. The notion that balancing selection operates at the Mhc in the honeycreepers is supported by transpecies polymorphism and strikingly high dN/dS ratios at codons putatively involved in peptide interaction. Mitochondrial DNA control region sequences were invariant in the i'iwi, but were highly variable in the 'amakihi. By contrast, levels of variability of class II ?? chain Mhc sequence codons that are hypothesized to be directly involved in peptide interactions appear comparable between i'iwi and 'amakihi. In the i'iwi, natural selection may have maintained variation within the Mhc, even in the face of what appears to a genetic bottleneck.

  17. Singular trajectories: space-time domain topology of developing speckle fields

    NASA Astrophysics Data System (ADS)

    Vasil'ev, Vasiliy; Soskin, Marat S.

    2010-02-01

    It is shown the space-time dynamics of optical singularities is fully described by singularities trajectories in space-time domain, or evolution of transverse coordinates(x, y) in some fixed plane z0. The dynamics of generic developing speckle fields was realized experimentally by laser induced scattering in LiNbO3:Fe photorefractive crystal. The space-time trajectories of singularities can be divided topologically on two classes with essentially different scenario and duration. Some of them (direct topological reactions) consist from nucleation of singularities pair at some (x, y, z0, t) point, their movement and annihilation. They possess form of closed loops with relatively short time of existence. Another much more probable class of trajectories are chain topological reactions. Each of them consists from sequence of links, i.e. of singularities nucleation in various points (xi yi, ti) and following annihilation of both singularities in other space-time points with alien singularities of opposite topological indices. Their topology and properties are established. Chain topological reactions can stop on the borders of a developing speckle field or go to infinity. Examples of measured both types of topological reactions for optical vortices (polarization C points) in scalar (elliptically polarized) natural developing speckle fields are presented.

  18. Assignment of the human PAX4 gene to chromosome band 7q32 by fluorescence in situ hybridization.

    PubMed

    Tamura, T; Izumikawa, Y; Kishino, T; Soejima, H; Jinno, Y; Niikawa, N

    1994-01-01

    Of the nine known members of a human paired box-containing gene family (Pax), only PAX4 has not been precisely localized. We screened a cosmid library of human genomic DNA using polymerase chain reaction products for PAX4 as a probe and isolated three positive cosmid clones. Sequence analysis revealed that at least two of them had exon-like sequences and showed extensive homology to Pax-4 in the mouse. These two cosmid clones were mapped to human chromosome band 7q32 by fluorescence in situ hybridization.

  19. Genomic characterization of Indian isolates of egg drop syndrome 1976 virus.

    PubMed

    Raj, G D; Sivakumar, S; Sudharsan, S; Mohan, A C; Nachimuthu, K

    2001-02-01

    Five Indian isolates of egg drop syndrome (EDS) 1976 virus and the reference strain 127 were compared by restriction enzyme analysis of viral DNA, and the hexon gene amplified by polymerase chain reaction. Using these techniques, no differences were seen among these viruses. However, partial sequencing of the hexon gene revealed major differences (4.6%) in one of the isolates sequenced, EDS Kerala. Phylogenetic analysis also placed this isolate in a different lineage compared with the other isolates. The need for constant monitoring of the genetic nature of the field isolates of EDS viruses is emphasized.

  20. DNASynth: a software application to optimization of artificial gene synthesis

    NASA Astrophysics Data System (ADS)

    Muczyński, Jan; Nowak, Robert M.

    2017-08-01

    DNASynth is a client-server software application in which the client runs in a web browser. The aim of this program is to support and optimize process of artificial gene synthesizing using Ligase Chain Reaction. Thanks to LCR it is possible to obtain DNA strand coding defined by user peptide. The DNA sequence is calculated by optimization algorithm that consider optimal codon usage, minimal energy of secondary structures and minimal number of required LCR. Additionally absence of sequences characteristic for defined by user set of restriction enzymes is guaranteed. The presented software was tested on synthetic and real data.

  1. Radical chemistry of artemisinin

    NASA Astrophysics Data System (ADS)

    Denisov, Evgenii T.; Solodova, S. L.; Denisova, Taisa G.

    2010-12-01

    The review summarizes physicochemical characteristics of the natural sesquiterpene peroxide artemisinin. The kinetic schemes of transformations of artemisinin radicals under anaerobic conditions are presented and analyzed. The sequence of radical reactions of artemisinin in the presence of oxygen is considered in detail. Special emphasis is given to the intramolecular chain oxidation resulting in the transformation of artemisinin into polyatomic hydroperoxide. The kinetic characteristics of elementary reaction steps involving alkyl, alkoxyl, and peroxyl radicals generated from artemisinin are discussed. The results of testing of artemisinin and its derivatives for the antimalarial activity and the scheme of the biochemical synthesis of artemisinin in nature are considered.

  2. A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.

    PubMed

    Kemp, S J; Maillard, J C; Teale, A J

    1993-04-01

    A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.

  3. [Study on correlation between ITS sequence of Arctium lappa and quality of Fructus Arctii].

    PubMed

    Xu, Liang; Dou, Deqiang; Wang, Bing; Yang, Yanyun; Kang, Tingguo

    2011-07-01

    To study the correlation between ITS sequence of Arctium lappa and Fructus Arctii quality of different origin. The samples of Fructu arctii materials were collected from 26 different producing areas. Their ITS sequence were determined after polymerase chain reaction (PCR) and quality were evaluated through the determination of arctiin content by HPLC. Genetic diversity, genotype and correlation were analyzed by ClustalX (1.81), Mage 4.0, SPSS 13.0 statistical software. ITS sequence of A. was obtained from 26 samples, and was registered in the GenBank. Corresponding arctiin content of Fructus arctii and 1000-grain weight were determined. A. lappa genotype correlated with Fructus arctii quality by statistical analysis. The research provided a foundation for revealing the molecular mechanism of Fructus arctii geoherbs.

  4. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    PubMed

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  5. Hb Molfetta [beta126(H4)Val-->Leu, GTG-->CTG]: a new, silent, neutral beta chain variant found in an Italian woman.

    PubMed

    Qualtieri, Antonio; Le, Pera Maria; Pedace, Vera; Magariello, Angela; Brancati, Carlo

    2002-02-01

    We have identified a new neutral hemoglobin variant in a pregnant Italian woman, that resulted from a GTG-->CTG replacement at codon 126 of the beta chain, corresponding to a Val-->Leu amino acid change at position beta126(H4). Thermal and isopropanol stability tests were normal and there were no abnormal clinical features. Routine electrophoretic and ion exchange chromatographic methods for hemoglobin separation failed to show this variant, but reversed phase high performance liquid chromatography revealed an abnormal peak eluting near the normal beta chain. No abnormal tryptic peptide was revealed on the high performance liquid chromatographic elution pattern of the total globin digest. The mutation was determined at the DNA level by amplification of the three beta exons by polymerase chain reaction and direct sequencing of one exon that showed an abnormal migration on single strand conformational polymorphism analysis.

  6. Unique vaginal microbiota that includes an unknown Mycoplasma-like organism is associated with Trichomonas vaginalis infection.

    PubMed

    Martin, David H; Zozaya, Marcela; Lillis, Rebecca A; Myers, Leann; Nsuami, M Jacques; Ferris, Michael J

    2013-06-15

    The prevalence of Trichomonas vaginalis infection is highest in women with intermediate Nugent scores. We hypothesized that the vaginal microbiota in T. vaginalis-infected women differs from that in T. vaginalis-uninfected women. Vaginal samples from 30 T. vaginalis-infected women were matched by Nugent score to those from 30 T. vaginalis-uninfected women. Equal numbers of women with Nugent scores categorized as normal, intermediate, and bacterial vaginosis were included. The vaginal microbiota was assessed using 454 pyrosequencing analysis of polymerase chain reaction-amplified 16S ribosomal RNA gene sequences. The 16S ribosomal RNA gene sequence of an unknown organism was obtained by universal bacterial polymerase chain reaction amplification, cloning, and sequencing. Principal coordinates analysis of the pyrosequencing data showed divergence of the vaginal microbiota in T. vaginalis-infected and T. vaginalis-uninfected patients among women with normal and those with intermediate Nugent scores but not among women with bacterial vaginosis. Cluster analysis revealed 2 unique groups of T. vaginalis-infected women. One had high abundance of Mycoplasma hominis and other had high abundance of an unknown Mycoplasma species. Women in the former group had clinical evidence of enhanced vaginal inflammation. T. vaginalis may alter the vaginal microbiota in a manner that is favorable to its survival and/or transmissibility. An unknown Mycoplasma species plays a role in some of these transformations. In other cases, these changes may result in a heightened host inflammatory response.

  7. Identification of the structural mutation responsible for the dibucaine-resistant (atypical) variant form of human serum cholinesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McGuire, M.C.; Nogueira, C.P.; Bartels, C.F.

    1989-02-01

    A point mutation in the gene for human serum cholinesterase was identified that changes Asp-70 to Gly in the atypical form of serum cholinesterase. The mutation in nucleotide 209, which changes codon 70 from GAT to GGT, was found by sequencing a genomic clone and sequencing selected regions of DNA amplified by the polymerase chain reaction. The entire coding sequences for usual and atypical cholinesterases were compared, and no other consistent base differences were found. The nucleotide-209 mutation was detected in all five atypical cholinesterase families examined. There was complete concordance between this mutation and serum cholinesterase phenotypes for allmore » 14 heterozygous and 6 homozygous atypical subjects tested. The mutation causes the loss of a Sau3A1 restriction site; the resulting DNA fragment length polymorphism was verified by electrophoresis of {sup 32}P-labeled DNA restriction fragments from usual and atypical subjects. Dot-blot hybridization analysis with a 19-mer allele-specific probe to the DNA amplified by the polymerase chain reaction distinguished between the usual and atypical genotypes. The authors conclude that the Asp-70 {yields} Gly mutation accounts for reduced affinity of atypical cholinesterase for choline esters and that Asp-70 must be an important component of the anionic site. Heterogeneity in atypical alleles may exist, but the Asp-70 point mutation may represent an appreciable portion of the atypical gene pool.« less

  8. Acid-fast Smear and Histopathology Results Provide Guidance for the Appropriate Use of Broad-Range Polymerase Chain Reaction and Sequencing for Mycobacteria.

    PubMed

    Miller, Kennon; Harrington, Susan M; Procop, Gary W

    2015-08-01

    New molecular diagnostic tests are attractive because of the potential they hold for improving diagnostics in microbiology. The value of these tests, which is often assumed, should be investigated to determine the best use of these potentially powerful tools. To investigate the usefulness of broad-range polymerase chain reaction (PCR), followed by sequencing, in mycobacterial infections. We reviewed the test performance of acid-fast bacilli (AFB) PCR and traditional diagnostic methods (histopathology, AFB smear, and culture). We assessed the diagnostic effect and cost of the unrestricted ordering of broad-range PCR for the detection and identification of mycobacteria in clinical specimens. The AFB PCR was less sensitive than culture and histopathology and was less specific than culture, AFB smear, and histopathology. During 18 months, $93 063 was spent on 183 patient specimens for broad-range PCR and DNA sequencing for mycobacteria to confirm one culture-proven Mycobacterium tuberculosis infection that was also known to be positive by AFB smear and histopathology. In this cohort, there was a false-negative AFB PCR for M tuberculosis and a false-positive AFB PCR for Mycobacterium lentiflavum . Testing of AFB smear-negative specimens from patients without an inflammatory response supportive of a mycobacterial infection is costly and has not been proven to improve patient care. Traditional diagnostics (histopathology, AFB smear, and culture) should remain the primary methods for the detection of mycobacteria in clinical specimens.

  9. Designing and conducting in silico analysis for identifying of Echinococcus spp. with discrimination of novel haplotypes: an approach to better understanding of parasite taxonomic.

    PubMed

    Spotin, Adel; Gholami, Shirzad; Nasab, Abbas Najafi; Fallah, Esmaeil; Oskouei, Mahmoud Mahami; Semnani, Vahid; Shariatzadeh, Seyyed Ali; Shahbazi, Abbas

    2015-04-01

    The definitive identification of Echinococcus species is currently carried out by sequencing and phylogenetic strategies. However, the application of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) patterns is not broadly used as a result of heterogeneity traits of Echinococcus genome in different regions of the world. Therefore, designing and conducting a standardized pattern should indigenously be considered in under-studied areas. In this investigation, an in silico mapping was designed and developed for eight Echinococcus spp. on the basis of regional sequences in Iran and the world. The numbers of 60 Echinococcus isolates were collected from the liver and lungs of 15 human, 15 sheep, 15 cattle, and 15 camel cases in Semnan province, Central Iran. DNA samples were extracted and examined by polymerase chain reaction of ribosomal DNA (rDNA) internal transcribed spacer 1 (ITS1) and PCR-RFLP via Rsa1 endonuclease enzyme. Moreover, 15 amplicons of cytochrome oxidase 1 (Cox1) were directly sequenced in order to identify the strains/haplotypes. PCR-RFLP and phylogenetic analyses revealed firmly the presence of the G1 and G6 genotypes with heterogeneity (three novel haplotypes) of Cox1 gene although no other expected genotypes were found in the region. Finding shows that the identification of novel haplotypes along with discrimination of Echinococcus spp. through regional patterns can unambiguously illustrate the real taxonomic status of parasite in Central Iran.

  10. Using newly developed multiplex polymerase chain reaction and melting curve analysis for detection and discrimination of β-lactamases in Escherichia coli isolates from intensive care patients.

    PubMed

    Chromá, Magdaléna; Hricová, Kristýna; Kolář, Milan; Sauer, Pavel; Koukalová, Dagmar

    2011-11-01

    A total of 78 bacterial strains with known β-lactamases were used to optimize a rapid detection system consisting of multiplex polymerase chain reaction and melting curve analysis to amplify and identify blaTEM, blaSHV, and blaCTX-M genes in a single reaction. Additionally, to evaluate the applicability of this method, 32 clinical isolates of Escherichia coli displaying an extended-spectrum β-lactamase phenotype from patients hospitalized at intensive care units were tested. Results were analyzed by the Rotor-Gene operating software and Rotor-Gene ScreenClust HRM Software. The individual melting curves differed by a temperature shift or curve shape, according to the presence of β-lactamase genes. With the use of this method and direct sequencing, blaCTX-M-15-like was identified as the most prevalent β-lactamase gene. In conclusion, this novel detection system seems to be a suitable tool for rapid detection of present β-lactamase genes and their characterization. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. A multiple multicomponent approach to chimeric peptide-peptoid podands.

    PubMed

    Rivera, Daniel G; León, Fredy; Concepción, Odette; Morales, Fidel E; Wessjohann, Ludger A

    2013-05-10

    The success of multi-armed, peptide-based receptors in supramolecular chemistry traditionally is not only based on the sequence but equally on an appropriate positioning of various peptidic chains to create a multivalent array of binding elements. As a faster, more versatile and alternative access toward (pseudo)peptidic receptors, a new approach based on multiple Ugi four-component reactions (Ugi-4CR) is proposed as a means of simultaneously incorporating several binding and catalytic elements into organizing scaffolds. By employing α-amino acids either as the amino or acid components of the Ugi-4CRs, this multiple multicomponent process allows for the one-pot assembly of podands bearing chimeric peptide-peptoid chains as appended arms. Tripodal, bowl-shaped, and concave polyfunctional skeletons are employed as topologically varied platforms for positioning the multiple peptidic chains formed by Ugi-4CRs. In a similar approach, steroidal building blocks with several axially-oriented isocyano groups are synthesized and utilized to align the chimeric chains with conformational constrains, thus providing an alternative to the classical peptido-steroidal receptors. The branched and hybrid peptide-peptoid appendages allow new possibilities for both rational design and combinatorial production of synthetic receptors. The concept is also expandable to other multicomponent reactions. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

    PubMed Central

    Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

    2016-01-01

    Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

  13. Droplet digital PCR technology promises new applications and research areas.

    PubMed

    Manoj, P

    2016-01-01

    Digital Polymerase Chain Reaction (dPCR) is used to quantify nucleic acids and its applications are in the detection and precise quantification of low-level pathogens, rare genetic sequences, quantification of copy number variants, rare mutations and in relative gene expressions. Here the PCR is performed in large number of reaction chambers or partitions and the reaction is carried out in each partition individually. This separation allows a more reliable collection and sensitive measurement of nucleic acid. Results are calculated by counting amplified target sequence (positive droplets) and the number of partitions in which there is no amplification (negative droplets). The mean number of target sequences was calculated by Poisson Algorithm. Poisson correction compensates the presence of more than one copy of target gene in any droplets. The method provides information with accuracy and precision which is highly reproducible and less susceptible to inhibitors than qPCR. It has been demonstrated in studying variations in gene sequences, such as copy number variants and point mutations, distinguishing differences between expression of nearly identical alleles, assessment of clinically relevant genetic variations and it is routinely used for clonal amplification of samples for NGS methods. dPCR enables more reliable predictors of tumor status and patient prognosis by absolute quantitation using reference normalizations. Rare mitochondrial DNA deletions associated with a range of diseases and disorders as well as aging can be accurately detected with droplet digital PCR.

  14. Identification and analysis of Escherichia albertii isolates from chicken rinses using polymerase chain reaction, pulse field gel electrophoresis and sequencing a 610bp section of the rpoB gene

    USDA-ARS?s Scientific Manuscript database

    Escherichia albertii is a recently described organism that has been associated with diarrhea in humans and with infection and death in birds. It has also been found in healthy birds. E. albertii has been found in two healthy chickens from Australia and a dead chicken from Washington state. The pr...

  15. HLA-B73: An atypical HLA-B molecule carrying a Bw6-epitope motif variant and a B pocket identical to HLA-B27

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vilches, C.; Pablo, R. de; Herrero, M.J.

    1994-12-31

    HLA-B73, first described by Mayr and Kirnbauer (1981), is a poorly characterized allospecificity, serologically related to the B7-CREG. We polymerase chain reaction-amplified, cloned and sequenced the HLA-B alleles of the B-LCL LE023, established from a Spanish Caucasoid individual expressing HLA-B73. 5 refs., 2 figs.

  16. Valley Fever: Finding New Places for an Old Disease: Coccidioides immitis Found in Washington State Soil Associated With Recent Human Infection

    PubMed Central

    Litvintseva, Anastasia P.; Marsden-Haug, Nicola; Hurst, Steven; Hill, Heather; Gade, Lalitha; Driebe, Elizabeth M.; Ralston, Cindy; Roe, Chandler; Barker, Bridget M.; Goldoft, Marcia; Keim, Paul; Wohrle, Ron; Thompson, George R.; Engelthaler, David M.; Brandt, Mary E.; Chiller, Tom

    2015-01-01

    We used real-time polymerase chain reaction and culture to demonstrate persistent colonization of soils by Coccidioides immitis, an agent of valley fever, in Washington State linked to recent human infections and located outside the endemic range. Whole-genome sequencing confirmed genetic identity between isolates from soil and one of the case-patients. PMID:25165087

  17. Incorporating microbiota data into epidemiologic models: examples from vaginal microbiota research.

    PubMed

    van de Wijgert, Janneke H; Jespers, Vicky

    2016-05-01

    Next generation sequencing and quantitative polymerase chain reaction technologies are now widely available, and research incorporating these methods is growing exponentially. In the vaginal microbiota (VMB) field, most research to date has been descriptive. The purpose of this article is to provide an overview of different ways in which next generation sequencing and quantitative polymerase chain reaction data can be used to answer clinical epidemiologic research questions using examples from VMB research. We reviewed relevant methodological literature and VMB articles (published between 2008 and 2015) that incorporated these methodologies. VMB data have been analyzed using ecologic methods, methods that compare the presence or relative abundance of individual taxa or community compositions between different groups of women or sampling time points, and methods that first reduce the complexity of the data into a few variables followed by the incorporation of these variables into traditional biostatistical models. To make future VMB research more clinically relevant (such as studying associations between VMB compositions and clinical outcomes and the effects of interventions on the VMB), it is important that these methods are integrated with rigorous epidemiologic methods (such as appropriate study designs, sampling strategies, and adjustment for confounding). Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.

  18. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed Central

    Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.

    1994-01-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934

  19. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed

    Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L

    1994-05-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.

  20. Hypothalamic amenorrhea in a Camurati-Engelmann disease--a case report.

    PubMed

    Meczekalski, Blazej; Czyzyk, Adam; Podfigurna-Stopa, Agnieszka; Rydzewski, Bogdan; Sroczynski, Jakub; Lipinska, Małgorzata; Sokalski, Jerzy; Krawczynski, Maciej; Jamsheer, Aleksander; Katulski, Krzysztof; Genazzani, Alessandro

    2013-05-01

    A case report of a patient diagnosed with Camurati-Engelmann Disease (CED) in association with the functional hypothalamic amenorrhea disturbances. CED is a very rare genetically determined disorder classified as a type of bone dysplasia. Case report. Department of Gynecological Endocrinology, 3rd grade Medical University Hospital. Twenty-one years old female patient with CED admitted to the hospital because of primary amenorrhea. Her history revealed skeletal deformities and hearing impairment. Clinical examination, ultrasound, laboratory evaluations (including serum gonadotropins (FSH, LH) at basal state and after stimulation with gonadotropin-releasing hormone, serum basal estradiol) radiological studies (X-ray of the head, the lumbar spine and lower extremities; a computed tomography of the head), G-banding karyotype, polymerase chain reaction and DNA sequencing. Hormonal serum evaluations were made using an enzyme-linked immunosorbent assay. The exon 4 of the transforming growth factor beta 1 gene was amplified by a polymerase chain reaction and the product was directly sequenced. The hormonal analysis was characteristic for the hypogonadotropic hypogonadism. Radiological and molecular analyses confirmed CED diagnosis. The hypothalamic amenorrhea in a patient with CED may be explained as a consequence of fat hypotrophy and very low body mass index. Therefore, impairment within hypothalamic-pituitary axis in patients with CED should be treated with special attention.

  1. Bacterial analysis of combined periodontal-endodontic lesions by polymerase chain reaction-denaturing gradient gel electrophoresis.

    PubMed

    Xia, Minghui; Qi, Qingguo

    2013-01-01

    We used denaturing gradient gel electrophoresis (DGGE) to compare bacterial profiles in periodontium and root canals of teeth with combined periodontal-endodontic lesions. Samples of dental plaque and necrotic pulp were collected from thirteen extracted teeth with advanced periodontitis. Genomic DNA was extracted for polymerase chain reaction (PCR) analysis using universal bacterial primers. The PCR products were then loaded onto DGGE gels to obtain fractionated bands. Characteristic DGGE bands were excised and DNA was cloned and sequenced. The number of bands, which indicates the number of bacterial species, was compared between dental plaques and necrotic pulp tissues from the same tooth. Although the difference was statistically significant (P < 0.01), there was no positive correlation; similarity (Dice coefficient) was 13.1% to 62.5%. Some bacteria species were present in both the periodontal pockets and root canals of the same tooth; however, periodontal bacteria did not always invade the root canals, and some bacteria in root canals were not present in periodontal pockets of the same tooth. In some teeth, unique bacteria in root canals had not passed from periodontal pockets. A basic local alignment search tool (BLAST) sequence search in Genbank indicated that new bacteria species were present in periodontal pockets and root canals. Their characteristics must thus be further analyzed.

  2. Strongylus asini (Nematoda, Strongyloidea): genetic relationships with other Strongylus species determined by ribosomal DNA.

    PubMed

    Hung, G C; Jacobs, D E; Krecek, R C; Gasser, R B; Chilton, N B

    1996-12-01

    Genomic DNA was isolated from adult Strongylus asini collected from zebra. The second ribosomal transcribed spacer (ITS-2) was amplified and sequenced using polymerase chain reaction (PCR) based techniques. The DNA sequence was compared with previously published data for 3 related Strongylus species. A PCR-linked restriction fragment length polymorphism method allowed the 4 species to be differentiated unequivocally. The ITS-2 sequence of S. asini was found to be more similar to those of S. edentatus (87.1%) and S. equinus (95.3%) than to that of S vulgaris (73.9%). This result confirms that S. Asini and S vulgaris represent separate species and supports the retention of the 4 species within 1 genus.

  3. [Recombinant OspC identification and antigenicity detection from Borrelia burgdorferi PD91 in China].

    PubMed

    Chen, Jian; Wan, Kang-Lin

    2003-10-01

    To recombine OspC gene from Borrelia burgdorferi PD91 of China and expressed it in E. coli for early diagnosis of Lyme disease. The OspC gene was amplified from the genome of Borrelia burgdorferi PD91 strain by polymerase chain reaction and recombined with plasmid PET-11D. The recombinant plasmid PET-11D-OspC was identified with PCR, restriction endonuclease analysis and sequencing. The antigenicity was verified with Western Blot. OspC gene was cloned correctly into vector PET-11D. The resultant sequence was definitely different from the published sequence. The recombinant OspC seemed to have had strong antigenicity. The findings laid basis for the studies on early diagnosis of Lyme disease.

  4. Droplet Microfluidic Device Fabrication and Use for Isothermal Amplification and Detection of MicroRNA.

    PubMed

    Giuffrida, Maria Chiara; D'Agata, Roberta; Spoto, Giuseppe

    2017-01-01

    Droplet microfluidics combined with the isothermal circular strand displacement polymerization (ICSDP) represents a powerful new technique to detect both single-stranded DNA and microRNA sequences. The method here described helps in overcoming some drawbacks of the lately introduced droplet polymerase chain reaction (PCR) amplification when implemented in microfluidic devices. The method also allows the detection of nanoliter droplets of nucleic acids sequences solutions, with a particular attention to microRNA sequences that are detected at the picomolar level. The integration of the ICSDP amplification protocol in droplet microfluidic devices reduces the time of analysis and the amount of sample required. In addition, there is also the possibility to design parallel analyses to be integrated in portable devices.

  5. Multiplex Detection of Aspergillus Species.

    PubMed

    Martínez-Culebras, Pedro; Selma, María Victoria; Aznar, Rosa

    2017-01-01

    Multiplex real-time polymerase chain reaction (PCR) provides a fast and accurate DNA-based tool for the simultaneous amplification of more than one target sequence in a single reaction. Here a duplex real-time PCR assay is described for the simultaneous detection of Aspergillus carbonarius and members of the Aspergillus niger aggregate, which are the main responsible species for ochratoxin A (OTA) contamination in grapes. This single tube reaction targets the beta-ketosynthase and the acyl transferase domains of the polyketide synthase of A. carbonarius and the A. niger aggregate, respectively.Besides, a rapid and efficient fungi DNA extraction procedure is described suitable to be applied in wine grapes. It includes a pulsifier equipment to remove conidia from grapes which prevents releasing of PCR inhibitors.

  6. Comparative sequence analysis of B5R gene of zoonotic buffalo pox virus isolates with other orthopoxviruses.

    PubMed

    Chandranaik, B M; Singh, Raj Kumar; Hosamani, Mahusudan; Krishnappa, Giriappa; Harish, Balur R; Chethana, C S; Renukaprasad, C

    2011-02-01

    The present paper describes the isolation of buffalo pox virus from scab lesions and its molecular characterization through B5R gene sequencing. During our study, pustular pox lesions were observed on the teats and mammary parenchyma of cattle and buffaloes, and the disease was of significant zoonotic importance since similar lesions were produced on the hands, legs, and face of people in close contact with the affected animals. The collected scab materials were subjected for virus isolation in 9-11-day-old chicken embryos by the chorioallontoic membrane route and in the Vero cell line. The virus was confirmed by a sensitive and rapid diagnostic polymerase chain reaction using the primers that amplify "A type inclusion" gene, and further, B5R gene of the virus was sequenced and compared with the corresponding sequences of other orthopoxviruses. The results showed high sequence homology of our isolates with other orthopoxviruses.

  7. Sequence analysis of the 5.8S ribosomal DNA and internal transcribed spacers (ITS1 and ITS2) from five species of the Oxalis tuberosa alliance.

    PubMed

    Tosto, D S; Hopp, H E

    1996-01-01

    The internal transcribed spacer region (ITS1 and ITS2) of the 18S-25S nuclear ribosomal DNA sequence and the intervening 5.8S region from five species of the genus Oxalis was amplified by polymerase chain reaction and subjected to direct DNA sequencing. On the basis of cytogenetic studies some species of this genus were postulated to be related by the number of chromosomes. Sequence homologies in the ITS1, 5.8S and ITS2 among species are in good agreement with previous relationships established on the basis of chromosome numbers. We also identified a highly conserved sequence of six bp in the ITS1, reported to be present in a wide range of flowering plants, but not in the Oxalidaceae family to which the genus Oxalis belongs to.

  8. Amino terminal sequence of heavy and light chains from ratfish immunoglobulin.

    PubMed

    De Ioannes, A E; Aguila, H L

    1989-01-01

    The ratfish, Callorhinchus callorhinchus, a representative of the Holocephali, has a natural serum hemagglutinin (Mr 960,000), composed of heavy (Mr 71,000), light (Mr 22,500), and J (Mr 16,000) chains. To approach the mechanisms that generate diversity at this level of evolution, the amino terminal sequence of the heavy and light chains was determined by automated microsequencing. The chains are unblocked and have modest internal sequence heterogeneity. The heavy chains show sequence similarity with the terminal region of the heavy chain from the horned shark, Heterodontus francisci, and other species. In contrast to the heavy chain, the ratfish light chains display low sequence similarity with their shark kappa counterparts. However, their similarity with the variable region of the chicken lambda light chains is about 75%.

  9. Characterization and Amplification of Gene-Based Simple Sequence Repeat (SSR) Markers in Date Palm.

    PubMed

    Zhao, Yongli; Keremane, Manjunath; Prakash, Channapatna S; He, Guohao

    2017-01-01

    The paucity of molecular markers limits the application of genetic and genomic research in date palm (Phoenix dactylifera L.). Availability of expressed sequence tag (EST) sequences in date palm may provide a good resource for developing gene-based markers. This study characterizes a substantial fraction of transcriptome sequences containing simple sequence repeats (SSRs) from the EST sequences in date palm. The EST sequences studied are mainly homologous to those of Elaeis guineensis and Musa acuminata. A total of 911 gene-based SSR markers, characterized with functional annotations, have provided a useful basis not only for discovering candidate genes and understanding genetic basis of traits of interest but also for developing genetic and genomic tools for molecular research in date palm, such as diversity study, quantitative trait locus (QTL) mapping, and molecular breeding. The procedures of DNA extraction, polymerase chain reaction (PCR) amplification of these gene-based SSR markers, and gel electrophoresis of PCR products are described in this chapter.

  10. A screening method for the detection of the 35S promoter and the nopaline synthase terminator in genetically modified organisms in a real-time multiplex polymerase chain reaction using high-resolution melting-curve analysis.

    PubMed

    Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko

    2009-11-01

    To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.

  11. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

    PubMed Central

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-01-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  12. The hydrothermolysis of the picrate anion: Kinetics and mechanism

    USGS Publications Warehouse

    Ross, D.S.; Jayaweera, I.

    2002-01-01

    The hydrothermolysis of the picrate anion in aqueous solution has been studied at 260-325??C in liquid water. At starting pH values above 12, the disappearance of picrate begins immediately and is first order in OH-. At lower pH, there is an induction period preceding the disappearance, and over the pH range 6.7-11.9 there is no pH dependence in the developed reaction phase. Added borate and silicate salts promote the reaction, suggesting their acting as nucleophiles at hydrothermal conditions. Nitrite is an initial product, while acetate is a final product and reflective of a vigorous oxidative sequence consuming the intermediate products. A reaction sequence consistent with the results at the lower pH includes initiation of a chain process by displacement of nitrite by water, followed by nucleophilic displacement of nitrite by nitrite such that a nitro group is replaced by an O-N=O group. The ester then rapidly hydrolyzes, and the net reaction is the production of an additional nitrite with each cycle. A simple modeling of this system satisfactorily fits the experimental findings. ?? 2002 Elsevier Science B.V. All rights reserved.

  13. copia-like retrotransposons are ubiquitous among plants.

    PubMed Central

    Voytas, D F; Cummings, M P; Koniczny, A; Ausubel, F M; Rodermel, S R

    1992-01-01

    Transposable genetic elements are assumed to be a feature of all eukaryotic genomes. Their identification, however, has largely been haphazard, limited principally to organisms subjected to molecular or genetic scrutiny. We assessed the phylogenetic distribution of copia-like retrotransposons, a class of transposable element that proliferates by reverse transcription, using a polymerase chain reaction assay designed to detect copia-like element reverse transcriptase sequences. copia-like retrotransposons were identified in 64 plant species as well as the photosynthetic protist Volvox carteri. The plant species included representatives from 9 of 10 plant divisions, including bryophytes, lycopods, ferns, gymnosperms, and angiosperms. DNA sequence analysis of 29 cloned PCR products and of a maize retrotransposon cDNA confirmed the identity of these sequences as copia-like reverse transcriptase sequences, thereby demonstrating that this class of retrotransposons is a ubiquitous component of plant genomes. Images PMID:1379734

  14. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.

    1991-02-15

    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5{prime} end of the mutation site, and either an {alpha}-{sup 32}P-labeled nucleotide corresponding tomore » the normal coding sequence at the mutation site or an {alpha}-{sup 32}P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3{prime} to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation.« less

  15. Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

    PubMed

    Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

    2013-06-01

    Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

  16. Simple model of inhibition of chain-branching combustion processes

    NASA Astrophysics Data System (ADS)

    Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.

    2017-11-01

    A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.

  17. [A new human leukocyte antigen class I allele, HLA- B*52:11].

    PubMed

    Li, Xiao-feng; Zhang, Xu; Zhang, Kun-lian; Chen, Yang; Liu, Xian-zhi; Li, Jian-ping

    2011-12-01

    To identify and confirm a novel HLA allele. A new human leukocyte antigen class I allele was found during routine HLA genotyping by polymerase chain reaction-sequence specific oligonucleotide probes (PCR-SSOP) and sequencing-based typing (SBT). The novel HLA-B*52 allele was identical to B*52:01:01 with an exception of one base substitution at position 583 of exon 3 where a C was changed to T resulting in codon 195 changed from CAC(H) to TAC(Y). A new HLA class I allele, B*52:11, is identified, and is named officially by the WHO Nomenclature Committee.

  18. Molecular characterization of canine parvovirus (CPV) infection in dogs in Turkey.

    PubMed

    Timurkan, Mehmet; Oğuzoğlu, Tuba

    2015-01-01

    This study provides data about canine parvovirus (CPV) types circulating among dogs in Turkey. Sixty-five samples from dogs with and without clinical signs of parvovirus infection were collected between April 2009 and February 2010. The samples were subsequently tested for CPV using polymerase chain reaction (PCR). Twenty-five samples (38.4%) were positive; when positive samples were characterized by sequence analysis, results showed that both CPV-2a (17/25, 68%) and CPV-2b (8/25, 32%) strains are circulating among domestic dogs in Turkey. This is the first molecular characterization study of CPVs from dogs based on partial VP2 gene sequences in Turkey.

  19. The mini-exon genes of three Phytomonas isolates that differ in plant tissue tropism.

    PubMed

    Sturm, N R; Fernandes, O; Campbell, D A

    1995-08-01

    The tandem mini-exon gene repeat is an ideal diagnostic target for trypanosomatids because it includes sequences that are conserved absolutely coupled with regions of extreme variability. We have exploited these features and the polymerase chain reaction to differentiate Phytomonas strains isolated from phloem, fruit or latex of various host plants. While the transcribed regions are nearly identical, the intergenic sequences are variable in size and content (130-332 base pairs). The mini-exon genes of these phytomonads can therefore be distinguished from each other and from the corresponding genes in insect trypanosomes, with which they are oft confused.

  20. AlignMiner: a Web-based tool for detection of divergent regions in multiple sequence alignments of conserved sequences

    PubMed Central

    2010-01-01

    Background Multiple sequence alignments are used to study gene or protein function, phylogenetic relations, genome evolution hypotheses and even gene polymorphisms. Virtually without exception, all available tools focus on conserved segments or residues. Small divergent regions, however, are biologically important for specific quantitative polymerase chain reaction, genotyping, molecular markers and preparation of specific antibodies, and yet have received little attention. As a consequence, they must be selected empirically by the researcher. AlignMiner has been developed to fill this gap in bioinformatic analyses. Results AlignMiner is a Web-based application for detection of conserved and divergent regions in alignments of conserved sequences, focusing particularly on divergence. It accepts alignments (protein or nucleic acid) obtained using any of a variety of algorithms, which does not appear to have a significant impact on the final results. AlignMiner uses different scoring methods for assessing conserved/divergent regions, Entropy being the method that provides the highest number of regions with the greatest length, and Weighted being the most restrictive. Conserved/divergent regions can be generated either with respect to the consensus sequence or to one master sequence. The resulting data are presented in a graphical interface developed in AJAX, which provides remarkable user interaction capabilities. Users do not need to wait until execution is complete and can.even inspect their results on a different computer. Data can be downloaded onto a user disk, in standard formats. In silico and experimental proof-of-concept cases have shown that AlignMiner can be successfully used to designing specific polymerase chain reaction primers as well as potential epitopes for antibodies. Primer design is assisted by a module that deploys several oligonucleotide parameters for designing primers "on the fly". Conclusions AlignMiner can be used to reliably detect divergent regions via several scoring methods that provide different levels of selectivity. Its predictions have been verified by experimental means. Hence, it is expected that its usage will save researchers' time and ensure an objective selection of the best-possible divergent region when closely related sequences are analysed. AlignMiner is freely available at http://www.scbi.uma.es/alignminer. PMID:20525162

  1. [Research of Human-mouse Chimeric Antibodies Against Ebola Virus Nucleoprotein].

    PubMed

    Zhou, Rongping; Sun, Lina; Liu, Yang; Wu, Wei; Li, Chuan; Liang, Mifang; Qiu, Peihong

    2016-01-01

    The Ebola virus is highly infectious and can result in death in ≤ 90% of infected subjects. Detection of the Ebola virus and diagnosis of infection are extremely important for epidemic control. Presently, Chinese laboratories detect the nucleic acids of the Ebola virus by real-time reverse transcription-polymerase chain reaction (RT-PCR). However, such detection takes a relatively long time and necessitates skilled personnel and expensive equipment. Enzyme-linked immunosorbent assay (ELISA) of serum is simple, easy to operate, and can be used to ascertain if a patient is infected with the Ebola virus as well as the degree of infection. Hence, ELISA can be used in epidemiological investigations and is a strong complement to detection of nucleic acids. Cases of Ebola hemorrhagic fever have not been documented in China, so quality-control material for positive serology is needed. Construction and expression of human-mouse chimeric antibodies against the nucleoprotein of the Ebola virus was carried out. Genes encoding variable heavy (VH) and variable light (VL) chains were extracted and amplified from murine hybridoma cells. Genes encoding the VH and VL chains of monoclonal antibodies were amplified by RT-PCR. According to sequence analyses, a primer was designed to amplify functional sequences relative to VH and VL chain. The eukaryotic expression vector HL51-14 carrying some human antibody heavy chain- and light chain-constant regions was used. IgG antibodies were obtained by transient transfection of 293T cells. Subsequently, immunological detection and immunological identification were identified by ELISA, immunofluorescence assay, and western blotting. These results showed that we constructed and purified two human- mouse chimeric antibodies.

  2. Human papillomavirus DNA detected in breast milk.

    PubMed

    Sarkola, Marja; Rintala, Marjut; Grénman, Seija; Syrjänen, Stina

    2008-06-01

    Human papillomavirus (HPV) testing of 223 breast milk samples 3 days postpartum was performed with polymerase chain reaction, hybridization, and sequencing. HPV-16-DNA was detected in 4.0% of the samples. HPV carriage in the breast milk was not correlated with mother's oral or cervical HPV-status or the demographic data. Oral HPV-infection of the spouse at month 6 and 12 postpartum was statistically significantly associated with HPV carriage in the breast milk.

  3. Fasciola hepatica Infection in an Indigenous Community of the Peruvian Jungle

    PubMed Central

    Cabada, Miguel M.; Castellanos-Gonzalez, Alejandro; Lopez, Martha; Caravedo, María Alejandra; Arque, Eulogia; White, Arthur Clinton

    2016-01-01

    Fasciola hepatica is a zoonotic infection with a worldwide distribution. Autochthonous cases have not been reported in the Amazon region of Peru. Operculated eggs resembling F. hepatica were identified in the stools of five out of 215 subjects in a remote indigenous community of the Peruvian jungle. Polymerase chain reaction targeting Fasciola hepatica cytochrome oxidase subunit 1 (COI) gene and sequencing of the products confirmed Fasciola infection. PMID:26976892

  4. Scope and mechanism in palladium-catalyzed isomerizations of highly substituted allylic, homoallylic, and alkenyl alcohols.

    PubMed

    Larionov, Evgeny; Lin, Luqing; Guénée, Laure; Mazet, Clément

    2014-12-03

    Herein we report the palladium-catalyzed isomerization of highly substituted allylic alcohols and alkenyl alcohols by means of a single catalytic system. The operationally simple reaction protocol is applicable to a broad range of substrates and displays a wide functional group tolerance, and the products are usually isolated in high chemical yield. Experimental and computational mechanistic investigations provide complementary and converging evidence for a chain-walking process consisting of repeated migratory insertion/β-H elimination sequences. Interestingly, the catalyst does not dissociate from the substrate in the isomerization of allylic alcohols, whereas it disengages during the isomerization of alkenyl alcohols when additional substituents are present on the alkyl chain.

  5. Development of a nested polymerase chain reaction for amplification of a sequence of the p57 gene of Renibacterium salmoninarum that provides a highly sensitive method for detection of the bacterium in salmonid kidney

    USGS Publications Warehouse

    Chase, D.M.; Pascho, R.J.

    1998-01-01

    Nucleic acid-based assays have shown promise for diagnosing Renibacterium salmoninarum in tissues and body fluids of salmonids. DeVelopment of a nested polymerase chain reaction (PCR) method to detect a 320 bp DNA segment of the gene encoding the p57 protein of R. salmoninarum is described. Whereas a conventional PCR for a 383 bp segment of the p57 gene reliably detected 1000 R. salmoninarum cells per reaction in kidney tissue, the nested PCR detected as few as 10 R. salmoninarum per reaction in kidney tissue. Two DNA extraction methods for the nested PCR were compared and the correlation between replicate samples was generally higher in samples extracted by the QIAamp system compared with those extracted by the phenol/chloroform method. The specificity of the nested PCR was confirmed by testing DNA extracts of common bacterial fish pathogens and a panel of bacterial species reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA) and the fluorescent antibody test (FAT) for R. salmoninarum. Kidney samples from 74 naturally infected chinook Salmon were examined by the nested PCR, the ELISA, and the FAT, and the detected prevalences of R. salmoninarum were 61, 47, and 43%, respectively.

  6. Chain-reaction crash in traffic flow controlled by taillights

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-02-01

    We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.

  7. Dynamics of Delayed p53 Mutations in Mice Given Whole-Body Irradiation at 8 Weeks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okazaki, Ryuji, E-mail: ryuji-o@med.uoeh-u.ac.j; Ootsuyama, Akira; Kakihara, Hiroyo

    2011-01-01

    Purpose: Ionizing irradiation might induce delayed genotoxic effects in a p53-dependent manner. However, a few reports have shown a p53 mutation as a delayed effect of radiation. In this study, we investigated the p53 gene mutation by the translocation frequency in chromosome 11, loss of p53 alleles, p53 gene methylation, p53 nucleotide sequence, and p53 protein expression/phosphorylation in p53{sup +/+} and p53{sup +/-} mice after irradiation at a young age. Methods and Materials: p53{sup +/+} and p53{sup +/-} mice were exposed to 3 Gy of whole-body irradiation at 8 weeks of age. Chromosome instability was evaluated by fluorescence in situmore » hybridization analysis. p53 allele loss was evaluated by polymerase chain reaction, and p53 methylation was evaluated by methylation-specific polymerase chain reaction. p53 sequence analysis was performed. p53 protein expression was evaluated by Western blotting. Results: The translocation frequency in chromosome 11 showed a delayed increase after irradiation. In old irradiated mice, the number of mice that showed p53 allele loss and p53 methylation increased compared to these numbers in old non-irradiated mice. In two old irradiated p53{sup +/-} mice, the p53 sequence showed heteromutation. In old irradiated mice, the p53 and phospho-p53 protein expressions decreased compared to old non-irradiated mice. Conclusion: We concluded that irradiation at a young age induced delayed p53 mutations and p53 protein suppression.« less

  8. Identification of the structural mutation responsible for the dibucaine-resistant (atypical) variant form of human serum cholinesterase.

    PubMed Central

    McGuire, M C; Nogueira, C P; Bartels, C F; Lightstone, H; Hajra, A; Van der Spek, A F; Lockridge, O; La Du, B N

    1989-01-01

    A point mutation in the gene for human serum cholinesterase was identified that changes Asp-70 to Gly in the atypical form of serum cholinesterase. The mutation in nucleotide 209, which changes codon 70 from GAT to GGT, was found by sequencing a genomic clone and sequencing selected regions of DNA amplified by the polymerase chain reaction. The entire coding sequences for usual and atypical cholinesterases were compared, and no other consistent base differences were found. A polymorphic site near the C terminus of the coded region was detected, but neither allele at this locus segregated consistently with the atypical trait. The nucleotide-209 mutation was detected in all five atypical cholinesterase families examined. There was complete concordance between this mutation and serum cholinesterase phenotypes for all 14 heterozygous and 6 homozygous atypical subjects tested. The mutation causes the loss of a Sau3A1 restriction site; the resulting DNA fragment length polymorphism was verified by electrophoresis of 32P-labeled DNA restriction fragments from usual and atypical subjects. Dot-blot hybridization analysis with a 19-mer allele-specific probe to the DNA amplified by the polymerase chain reaction distinguished between the usual and atypical genotypes. We conclude that the Asp-70----Gly mutation (acidic to neutral amino acid substitution) accounts for reduced affinity of atypical cholinesterase for choline esters and that Asp-70 must be an important component of the anionic site. Heterogeneity in atypical alleles may exist, but the Asp-70 point mutation may represent an appreciable portion of the atypical gene pool. Images PMID:2915989

  9. Analysis of p53 gene mutations in human gliomas by polymerase chain reaction-based single-strand conformation polymorphism and DNA sequencing.

    PubMed

    Sarkar, F H; Kupsky, W J; Li, Y W; Sreepathi, P

    1994-03-01

    Mutations in the p53 gene have been recognized in brain tumors, and clonal expansion of p53 mutant cells has been shown to be associated with glioma progression. However, studies on the p53 gene have been limited by the need for frozen tissues. We have developed a method utilizing polymerase chain reaction (PCR) for the direct analysis of p53 mutation by single-strand conformation polymorphism (SSCP) and by direct DNA sequencing of the p53 gene using a single 10-microns paraffin-embedded tissue section. We applied this method to screen for p53 gene mutations in exons 5-8 in human gliomas utilizing paraffin-embedded tissues. Twenty paraffin blocks containing tumor were selected from surgical specimens from 17 different adult patients. Tumors included six anaplastic astrocytomas (AAs), nine glioblastomas (GBs), and two mixed malignant gliomas (MMGs). The tissue section on the stained glass slide was used to guide microdissection of an unstained adjacent tissue section to ensure > 90% of the tumor cell population for p53 mutational analysis. Simultaneously, microdissection of the tissue was also carried out to obtain normal tissue from adjacent areas as a control. Mutations in the p53 gene were identified in 3 of 17 (18%) patients by PCR-SSCP analysis and subsequently confirmed by PCR-based DNA sequencing. Mutations in exon 5 resulting in amino acid substitution were found in one thalamic AA (codon 158, CGC > CTT: Arg > Leu) and one cerebral hemispheric GB (codon 151, CCG > CTG: Pro > Leu).(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Rapid and Reliable Genotyping of HLA-B*57:01 in Four Chinese Populations Using a Single-Tube Duplex Real-Time Polymerase Chain Reaction Assay.

    PubMed

    Han, Min; Kang, Xing; Liu, Zhengbin; Zhang, Tingting; Li, Yanwei; Chen, Chao; Wang, Huijuan

    2017-07-01

    HLA-B*57:01 is strongly associated with severe adverse drug reaction induced by the anti-HIV drug abacavir (ABC) and antibiotic flucloxacillin. This study was dedicated to establishing a new method for HLA-B*57:01 genotyping and investigating the HLA-B*57:01 distribution pattern in four Chinese populations. A single-tube duplex real-time polymerase chain reaction (PCR) system was established by combining the amplification refractory mutation system and TaqMan probe. The reliability of this assay was validated by comparing the genotyping results with those by sequence-based typing. With this assay, the distribution of HLA-B*57:01 in 354 blood samples from four ethnic groups, namely, Han, Tibetan, Uighur, and Buyei, was determined. A 100% concordance was observed between the results of real-time PCR and sequence-based typing in 50 Uighur samples. As low as 0.016 ng DNA that carried HLA-B*57:01 could be detected with this assay. HLA-B*57:01 carriers identified in 100 Northern Han Chinese, 104 Buyeis, 100 Tibetans, and 50 Uighurs were 0, 1 (0.96%), 3 (3%), and 6 (12%), respectively. The carrier rate of HLA-B*57:01 in Uighur was significantly higher than those in Northern Han (p = .001) and Buyei (p = .005). The newly established real-time PCR assay provides a rapid and reliable tool for HLA-B*57:01 allele screening before the prescription of ABC and flucloxacillin in clinical practice.

  11. Characterization of Satellite DNA Sequences from the Commercially Important Marine Rotifers Brachionus rotundiformis and Brachionus plicatilis.

    PubMed

    Boehm; Gibson; Lubzens

    2000-01-01

    This study was initiated to search for species-specific and strain-specific satellite DNA sequences for which oligonucleotide primers could be designed to differentiate between various commercially important strains of the marine monogonont rotifers Brachionus rotundiformis and Brachionus plicatilis. Two unrelated, highly reiterated satellite sequences were cloned and characterized. The eight sequenced monomers from B. rotundiformis and six from B. plicatilis had low intrarepeat variability and were similar in their overall lengths, A + T compositions, and high degrees of repeated motif substructure. However, hybridizations to 19 representative strains, sequence characterizations, and GenBank searches indicated that these two satellites are morphotype-specific and population-specific, respectively, and share little homology to each other or to other characterized sequences in the database. Primer pairs designed for the B. rotundiformis satellite confirmed hybridization specificities on polymerase chain reaction and could serve as a useful molecular diagnostic tool to identify strains belonging to the SS morphotype, which are gaining widespread usage as first feeds for marine fish in commercial production.

  12. Cloning and sequence analysis of Hemonchus contortus HC58cDNA.

    PubMed

    Muleke, Charles I; Ruofeng, Yan; Lixin, Xu; Xinwen, Bo; Xiangrui, Li

    2007-06-01

    The complete coding sequence of Hemonchus contortus HC58cDNA was generated by rapid amplification of cDNA ends and polymerase chain reaction using primers based on the 5' and 3' ends of the parasite mRNA, accession no. AF305964. The HC58cDNA gene was 851 bp long, with open reading frame of 717 bp, precursors to 239 amino acids coding for approximately 27 kDa protein. Analysis of amino acid sequence revealed conserved residues of cysteine, histidine, asparagine, occluding loop pattern, hemoglobinase motif and glutamine of the oxyanion hole characteristic of cathepsin B like proteases (CBL). Comparison of the predicted amino acid sequences showed the protein shared 33.5-58.7% identity to cathepsin B homologues in the papain clan CA family (family C1). Phylogenetic analysis revealed close evolutionary proximity of the protein sequence to counterpart sequences in the CBL, suggesting that HC58cDNA was a member of the papain family.

  13. Bio-barcode gel assay for microRNA

    NASA Astrophysics Data System (ADS)

    Lee, Hyojin; Park, Jeong-Eun; Nam, Jwa-Min

    2014-02-01

    MicroRNA has been identified as a potential biomarker because expression level of microRNA is correlated with various cancers. Its detection at low concentrations would be highly beneficial for cancer diagnosis. Here, we develop a new type of a DNA-modified gold nanoparticle-based bio-barcode assay that uses a conventional gel electrophoresis platform and potassium cyanide chemistry and show this assay can detect microRNA at aM levels without enzymatic amplification. It is also shown that single-base-mismatched microRNA can be differentiated from perfectly matched microRNA and the multiplexed detection of various combinations of microRNA sequences is possible with this approach. Finally, differently expressed microRNA levels are selectively detected from cancer cells using the bio-barcode gel assay, and the results are compared with conventional polymerase chain reaction-based results. The method and results shown herein pave the way for practical use of a conventional gel electrophoresis for detecting biomolecules of interest even at aM level without polymerase chain reaction amplification.

  14. Actinomyces israelii in radicular cysts: a molecular study.

    PubMed

    Gomes, Nathália Rodrigues; Diniz, Marina Gonçalves; Pereira, Thais Dos Santos Fontes; Estrela, Carlos; de Macedo Farias, Luiz; de Andrade, Bruno Augusto Benevenuto; Gomes, Carolina Cavaliéri; Gomez, Ricardo Santiago

    2017-05-01

    To investigate whether the microscopic filamentous aggregates observed in radicular cysts are associated with the molecular identification of Actinomyces israelii. Moreover, to verify whether this bacterium can be detected in radicular cyst specimens not presenting aggregates. Microscopic colonies suggestive of Actinomyces were found in 8 out of 279 radicular cyst samples (case group). The case and control groups (n = 12; samples without filamentous colonies) were submitted to the semi-nested polymerase chain reaction to test the presence of A israelii. DNA sequencing was performed to validate polymerase chain reaction results. Two and 3 samples in the case and control groups, respectively, did not present a functional genomic DNA template and were excluded from the study. A israelii was identified in all samples of the case group and in 3 out of 9 samples of the control group. Although A israelii is more commonly identified in radicular cysts presenting filamentous aggregates, it also appears to be detected in radicular cysts without this microscopic finding. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Genetic diversity of Chlamydia among captive birds from central Argentina.

    PubMed

    Frutos, María C; Monetti, Marina S; Vaulet, Lucia Gallo; Cadario, María E; Fermepin, Marcelo Rodríguez; Ré, Viviana E; Cuffini, Cecilia G

    2015-01-01

    To study the occurrence of Chlamydia spp. and their genetic diversity, we analysed 793 cloacal swabs from 12 avian orders, including 76 genera, obtained from 80 species of asymptomatic wild and captive birds that were examined with conventional nested polymerase chain reaction and quantitative polymerase chain reaction. Chlamydia spp. were not detected in wild birds; however, four species (Chlamydia psittaci, Chlamydia pecorum, Chlamydia pneumoniae and Chlamydia gallinacea) were identified among captive birds (Passeriformes, n = 20; Psittaciformes, n = 15; Rheiformes, n = 8; Falconiformes n = 2; Piciformes n = 2; Anseriformes n = 1; Galliformes n = 1; Strigiformes n = 1). Two pathogens (C. pneumoniae and C. pecorum) were identified simultaneously in samples obtained from captive birds. Based on nucleotide-sequence variations of the ompA gene, three C. psittaci-positive samples detected were grouped into a cluster with the genotype WC derived from mammalian hosts. A single positive sample was phylogenetically related to a new strain of C. gallinacea. This report contributes to our increasing understanding of the abundance of Chlamydia in the animal kingdom.

  16. Polymerase chain reaction for detection of Leptospira spp. in clinical samples.

    PubMed Central

    Mérien, F; Amouriaux, P; Perolat, P; Baranton, G; Saint Girons, I

    1992-01-01

    A sensitive assay for Leptospira spp., the causative agent of leptospirosis, was developed on the basis of the polymerase chain reaction (PCR). A 331-bp sequence from the Leptospira interrogans serovar canicola rrs (16S) gene was amplified, and the PCR products were analyzed by DNA-DNA hybridization by using a 289-bp fragment internal to the amplified DNA. Specific PCR products also were obtained with DNA from the closely related nonpathogenic Leptospira biflexa but not with DNA from other spirochetes, such as Borrelia burgdorferi, Borrelia hermsii, Treponema denticola, Treponema pallidum, Spirochaeta aurantia, or more distant organisms such as Escherichia coli, Staphylococcus aureus, Mycobacterium tuberculosis, and Proteus mirabilis. The assay was able to detect as few as 10 bacteria. Leptospira DNA was detected in urine from experimentally infected mice. In addition, the test was found to be suitable for diagnosing leptospirosis in humans. Cerebrospinal fluid and urine from patients with leptospirosis were positive, whereas samples from control uninfected patients were negative. Images PMID:1400983

  17. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

    PubMed

    Kalendar, Ruslan; Lee, David; Schulman, Alan H

    2011-08-01

    The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. A real-time TaqMan polymerase chain reaction for the identification of Culex vectors of West Nile and Saint Louis encephalitis viruses in North America.

    PubMed

    Sanogo, Yibayiri O; Kim, Chang-Hyun; Lampman, Richard; Novak, Robert J

    2007-07-01

    In North America, West Nile and St. Louis encephalitis viruses have been detected in a wide range of vector species, but the majority of isolations continue to be from pools of mixed mosquitoes in the Culex subgenus Culex. Unfortunately, the morphologic identification of these important disease vectors is often difficult, particularly in regions of sympatry. We developed a sensitive real-time TaqMan polymerase chain reaction assay that allows reliable identification of Culex mosquitoes including Culex pipiens pipiens, Cx. p. quinquefasciatus, Cx. restuans, Cx. salinarius, Cx. nigripalpus, and Cx. tarsalis. Primers and fluorogenic probes specific to each species were designed based on sequences of the acetylcholinesterase gene (Ace2). Both immature and adult mosquitoes were successfully identified as individuals and as mixed species pools. This identification technique provides the basis for a rapid, sensitive, and high-throughput method for expounding the species-specific contribution of vectors to various phases of arbovirus transmission.

  19. Detection of the reemerging agent Burkholderia mallei in a recent outbreak of glanders in the United Arab Emirates by a newly developed fliP-based polymerase chain reaction assay.

    PubMed

    Scholz, Holger C; Joseph, Marina; Tomaso, Herbert; Al Dahouk, Sascha; Witte, Angela; Kinne, Joerg; Hagen, Ralph M; Wernery, Renate; Wernery, Ulrich; Neubauer, Heinrich

    2006-04-01

    A polymerase chain reaction (PCR) assay targeting the flagellin P (fliP)-I S407A genomic region of Burkholderia mallei was developed for the specific detection of this organism in pure cultures and clinical samples from a recent outbreak of equine glanders. Primers deduced from the known fliP-IS407A sequence of B. mallei American Type Culture Collection (ATCC) 23344(T) allowed the specific amplification of a 989-bp fragment from each of the 20 B. mallei strains investigated, whereas other closely related organisms tested negative. The detection limit of the assay was 10 fg for purified DNA of B. mallei ATCC 23344(T). B. mallei DNA was also amplified from various tissues of horses with a generalized B. mallei infection. The developed PCR assay can be used as a simple and rapid tool for the specific and sensitive detection of B. mallei in clinical samples.

  20. Novel cytochrome P450 genes, CYP6EB1 and CYP6EC1, are over-expressed in acrinathrin-resistant Frankliniella occidentalis (Thysanoptera: Thripidae).

    PubMed

    Cifuentes, D; Chynoweth, R; Guillén, J; De la Rúa, P; Bielza, P

    2012-06-01

    Control of Frankliniella occidentalis (Pergande) is a serious problem for agriculture all over the world because of the limited range of insecticides that are available. Insecticide resistance in F. occidentalis has been reported for all major insecticide groups. Our previous studies showed that cytochrome P450-mediated detoxification is a major mechanism responsible for insecticide resistance in this pest. Degenerate polymerase chain reaction was used to identify P450 genes that might be involved in acrinathrin resistance, in a laboratory population of F. occidentalis. Associated sequences were classified as belonging to the CYP4 and CYP6 families. Real-time quantitative polymerase chain reaction analyses revealed that two genes, CYP6EB1 and CYP6EC1, were over-expressed in adults and L2 larvae of the resistant population, when compared with the susceptible population, suggesting their possible involvement in resistance to acrinathrin.

  1. Inkjet Printing Based Droplet Generation for Integrated Online Digital Polymerase Chain Reaction.

    PubMed

    Zhang, Weifei; Li, Nan; Koga, Daisuke; Zhang, Yong; Zeng, Hulie; Nakajima, Hizuru; Lin, Jin-Ming; Uchiyama, Katsumi

    2018-04-17

    We report on the development of a novel and flexible online digital polymerase chain reaction (dPCR) system. The system was composed of three parts: an inkjet for generating the droplets, a coiled fused-silica capillary for thermal cycling, and a laser-induced fluorescence detector (LIFD) for positive droplet counting. Upon inkjet printing, monodisperse droplets were continuously generated in the oil phase and then introduced into the capillary in the form of a stable dispersion. The droplets containing one or zero molecules of target DNA passed through the helical capillary that was attached to a cylindrical thermal cycler for PCR amplification, resulting in the generation of fluorescence for the DNA-positive droplet. After 36 PCR cycles, the fluorescence signal intensity was detected by laser-induced fluorescence located at the downstream of the capillary, followed by a positive/negative counting. The present system was successfully applied to the absolute quantification of the HPV sequence in Caski cells with dynamic ranges spanning 4 orders of magnitude.

  2. Characterization of a prototype strain of hepatitis E virus.

    PubMed

    Tsarev, S A; Emerson, S U; Reyes, G R; Tsareva, T S; Legters, L J; Malik, I A; Iqbal, M; Purcell, R H

    1992-01-15

    A strain of hepatitis E virus (SAR-55) implicated in an epidemic of enterically transmitted non-A, non-B hepatitis, now called hepatitis E, was characterized extensively. Six cynomolgus monkeys (Macaca fascicularis) were infected with a strain of hepatitis E virus from Pakistan. Reverse transcription-polymerase chain reaction was used to determine the pattern of virus shedding in feces, bile, and serum relative to hepatitis and induction of specific antibodies. Virtually the entire genome of SAR-55 (7195 nucleotides) was sequenced. Comparison of the sequence of SAR-55 with that of a Burmese strain revealed a high level of homology except for one region encoding 100 amino acids of a putative nonstructural polyprotein. Identification of this region as hypervariable was obtained by partial sequencing of a third isolate of hepatitis E virus from Kirgizia.

  3. Identification of two novel pathogenic compound heterozygous MYO7A mutations in Usher syndrome by whole exome sequencing.

    PubMed

    Jia, Ying; Li, Xiaoge; Yang, Dong; Xu, Yi; Guo, Ying; Li, Xin

    2018-01-01

    The current study aims to identify the pathogenic sites in a core pedigree of Usher syndrome (USH). A core pedigree of USH was analyzed by whole exome sequencing (WES). Mutations were verified by polymerase chain reaction (PCR) amplification and Sanger sequencing. Two pathogenic variations (c.849+2T>C and c.5994G>A) in MYO7A were successfully identified and individually separated from parents. One variant (c.849+2T>C) was nonsense mutation, causing the protein terminated in advance, and the other one (c.5994G>A) located near the boundary of exon could cause aberrant splicing. This study provides a meaningful exploration for identification of clinical core genetic pedigrees. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. cDNA sequences and organization of IgM heavy chain genes in two holostean fish.

    PubMed

    Wilson, M R; van Ravenstein, E; Miller, N W; Clem, L W; Middleton, D L; Warr, G W

    1995-01-01

    Immunoglobulin M heavy chain (mu) sequences of two holostean fish, the bowfin, Amia calva, and the longnose gar, Lepisosteus osseus, were amplified from spleen mRNA by RACE-PCR, cloned, and sequenced. Each mu chain showed the conserved four constant domain structure typical of a secreted mu chain. Southern blot analyses with specific heavy chain variable (VH) and constant (CH) region probes suggest that both fish possess an IgH locus that resembles that of the teleosts, amphibians, and mammals in its organization. The overall sequence similarity of gar and bowfin mu chains was 60% and 48% at the nucleotide and amino acid levels, respectively, while similarity to the mu chains of teleosts and elasmobranchs was lower. The bowfin mu chain possesses a distinctive proline-rich sequence at the C mu 1/C mu 2 boundary; a shorter proline-rich sequence is present at this position in the gar mu chain. Both gar and bowfin show, in their C mu 4 sequences, motifs that could serve as cryptic splice donor sites for the production of mRNA encoding the membrane-bound form of the mu chains, and the bowfin also shows a potential cryptic splice donor site in the C mu 3 exon.

  5. ONR Far East Scientific Information Bulletin

    DTIC Science & Technology

    1990-09-01

    In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by

  6. Effect of perception irregularity on chain-reaction crash in low visibility

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-06-01

    We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.

  7. Integrating metabolomics and transcriptomics data to discover a biocatalyst that can generate the amine precursors for alkamide biosynthesis

    PubMed Central

    Rizhsky, Ludmila; Jin, Huanan; Shepard, Michael R.; Scott, Harry W.; Teitgen, Alicen M.; Perera, M. Ann; Mhaske, Vandana; Jose, Adarsh; Zheng, Xiaobin; Crispin, Matt; Wurtele, Eve S.; Jones, Dallas; Hur, Manhoi; Góngora-Castillo, Elsa; Buell, C. Robin; Minto, Robert E.; Nikolau, Basil J.

    2016-01-01

    Summary The Echinacea genus is exemplary of over 30 plant families that produce a set of bioactive amides, called alkamides. The Echinacea alkamides may be assembled from two distinct moieties, a branched-chain amine that is acylated with a novel polyunsaturated fatty acid. In this study we identified the potential enzymological source of the amine moiety as a pyridoxal phosphate dependent decarboxylating enzyme that uses branched chain amino acids as substrate. This identification was based on a correlative analysis of the transcriptomes and metabolomes of 36 different E. purpurea tissues and organs, which expressed distinct alkamide profiles. Although no correlation was found between the accumulation patterns of the alkamides and their putative metabolic precursors (i.e., fatty acids and branched chain amino acids), isotope-labeling analyses supported the transformation of valine and isoleucine to isobutylamine and 2-methylbutylamine as reactions of alkamide biosynthesis. Sequence homology identified the pyridoxal phosphate dependent decarboxylase-like proteins in the translated proteome of E. purpurea. These sequences were prioritized for direct characterization by correlating their transcript levels with alkamide accumulation patterns in different organs and tissues, and this multi-pronged approach led to the identification and characterization of a branched-chain amino acid decarboxylase, which would appear to be responsible for generating the amine moieties of naturally occurring alkamides. PMID:27497272

  8. Clusters of isoleucine, leucine, and valine side chains define cores of stability in high-energy states of globular proteins: Sequence determinants of structure and stability.

    PubMed

    Kathuria, Sagar V; Chan, Yvonne H; Nobrega, R Paul; Özen, Ayşegül; Matthews, C Robert

    2016-03-01

    Measurements of protection against exchange of main chain amide hydrogens (NH) with solvent hydrogens in globular proteins have provided remarkable insights into the structures of rare high-energy states that populate their folding free-energy surfaces. Lacking, however, has been a unifying theory that rationalizes these high-energy states in terms of the structures and sequences of their resident proteins. The Branched Aliphatic Side Chain (BASiC) hypothesis has been developed to explain the observed patterns of protection in a pair of TIM barrel proteins. This hypothesis supposes that the side chains of isoleucine, leucine, and valine (ILV) residues often form large hydrophobic clusters that very effectively impede the penetration of water to their underlying hydrogen bond networks and, thereby, enhance the protection against solvent exchange. The linkage between the secondary and tertiary structures enables these ILV clusters to serve as cores of stability in high-energy partially folded states. Statistically significant correlations between the locations of large ILV clusters in native conformations and strong protection against exchange for a variety of motifs reported in the literature support the generality of the BASiC hypothesis. The results also illustrate the necessity to elaborate this simple hypothesis to account for the roles of adjacent hydrocarbon moieties in defining stability cores of partially folded states along folding reaction coordinates. © 2015 The Protein Society.

  9. Substrate Shuttling Between Active Sites of Uroporphyrinogen Decarboxylase in Not Required to Generate Coproporphyrinogen

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Phillips, J.; Warby, C; Whitby, F

    2009-01-01

    Uroporphyrinogen decarboxylase (URO-D; EC 4.1.1.37), the fifth enzyme of the heme biosynthetic pathway, is required for the production of heme, vitamin B12, siroheme, and chlorophyll precursors. URO-D catalyzes the sequential decarboxylation of four acetate side chains in the pyrrole groups of uroporphyrinogen to produce coproporphyrinogen. URO-D is a stable homodimer, with the active-site clefts of the two subunits adjacent to each other. It has been hypothesized that the two catalytic centers interact functionally, perhaps by shuttling of reaction intermediates between subunits. We tested this hypothesis by construction of a single-chain protein (single-chain URO-D) in which the two subunits were connectedmore » by a flexible linker. The crystal structure of this protein was shown to be superimposable with wild-type activity and to have comparable catalytic activity. Mutations that impaired one or the other of the two active sites of single-chain URO-D resulted in approximately half of wild-type activity. The distributions of reaction intermediates were the same for mutant and wild-type sequences and were unaltered in a competition experiment using I and III isomer substrates. These observations indicate that communication between active sites is not required for enzyme function and suggest that the dimeric structure of URO-D is required to achieve conformational stability and to create a large active-site cleft.« less

  10. Multiplexed resequencing analysis to identify rare variants in pooled DNA with barcode indexing using next-generation sequencer.

    PubMed

    Mitsui, Jun; Fukuda, Yoko; Azuma, Kyo; Tozaki, Hirokazu; Ishiura, Hiroyuki; Takahashi, Yuji; Goto, Jun; Tsuji, Shoji

    2010-07-01

    We have recently found that multiple rare variants of the glucocerebrosidase gene (GBA) confer a robust risk for Parkinson disease, supporting the 'common disease-multiple rare variants' hypothesis. To develop an efficient method of identifying rare variants in a large number of samples, we applied multiplexed resequencing using a next-generation sequencer to identification of rare variants of GBA. Sixteen sets of pooled DNAs from six pooled DNA samples were prepared. Each set of pooled DNAs was subjected to polymerase chain reaction to amplify the target gene (GBA) covering 6.5 kb, pooled into one tube with barcode indexing, and then subjected to extensive sequence analysis using the SOLiD System. Individual samples were also subjected to direct nucleotide sequence analysis. With the optimization of data processing, we were able to extract all the variants from 96 samples with acceptable rates of false-positive single-nucleotide variants.

  11. Identification of tissue-embedded ascarid larvae by ribosomal DNA sequencing.

    PubMed

    Ishiwata, Kenji; Shinohara, Akio; Yagi, Kinpei; Horii, Yoichiro; Tsuchiya, Kimiyuki; Nawa, Yukifumi

    2004-01-01

    Polymerase chain reaction (PCR) was applied to identify tissue-embedded ascarid nematode larvae. Two sequences of the internal transcribed spacer (ITS) regions of ribosomal DNA (rDNA), ITS1 and ITS2, of the ascarid parasites were amplified and compared with those of ascarid-nematodes registered in a DNA database (GenBank). The ITS sequences of the PCR products obtained from the ascarid parasite specimen in our laboratory were compatible with those of registered adult Ascaris and Toxocara parasites. PCR amplification of the ITS regions was sensitive enough to detect a single larva of Ascaris suum mixed with porcine liver tissue. Using this method, ascarid larvae embedded in the liver of a naturally infected turkey were identified as Toxocara canis. These results suggest that even a single larva embedded in tissues from patients with larva migrans could be identified by sequencing the ITS regions.

  12. SxtA gene sequence analysis of dinoflagellate Alexandrium minutum

    NASA Astrophysics Data System (ADS)

    Norshaha, Safida Anira; Latib, Norhidayu Abdul; Usup, Gires; Yusof, Nurul Yuziana Mohd

    2015-09-01

    The dinoflagellate Alexandrium minutum is typically known for the production of potent neurotoxins such as saxitoxin, affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). These phenomena is related to the harmful algal blooms (HABs) that is believed to be influenced by environmental and nutritional factors. Previous study has revealed that SxtA gene is a starting gene that involved in the saxitoxin production pathway. The aim of this study was to analyse the sequence of the sxtA gene in A. minutum. The dinoflagellates culture was cultured at temperature 26°C with 16:8-hour light:dark photocycle. After the samples were harvested, RNA was extracted, complementary DNA (cDNA) was synthesised and amplified by polymerase chain reaction (PCR). The PCR products were then purified and cloned before sequenced. The SxtA sequence obtained was then analyzed in order to identify the presence of SxtA gene in Alexandrium minutum.

  13. Nucleotide sequences of the tet(M) genes from the American and Dutch type tetracycline resistance plasmids of Neisseria gonorrhoeae.

    PubMed

    Gascoyne-Binzi, D M; Heritage, J; Hawkey, P M

    1993-11-01

    High-level tetracycline-resistant Neisseria gonorrhoeae (TRNG) has been associated with the presence of a plasmid approximately 25.2 MDa in size which carries a Tet M tetracycline resistance determinant. Two different plasmid types, American and Dutch, have previously been described, based on the restriction endonuclease digestion pattern. In this study, the tet(M) genes from the two plasmid types have been amplified by the polymerase chain reaction (PCR) and then sequenced. The gene sequences from the two plasmids shared 96.8% identity, and showed similarities with different segments of the tet(M) gene sequences from Tn1545, Tn916 and Ureaplasma urealyticum. The data suggest that it is highly likely that the Tet M determinant found in the American type plasmid has a different origin from that present in the Dutch plasmid.

  14. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India.

    PubMed

    Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj

    2010-01-01

    Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.

  15. Reactivity ratios and sequence structures of the copolymers prepared using photo-induced copolymerization of MMA with MTMP.

    PubMed

    Liu, Xiaoxuan; Zhang, Yongtao; Cui, Yanyan; Dong, Zhixian

    2012-05-01

    4-Methacryloyl-2,2,6,6-tetramethyl-piperidine (MTMP) was applied as reactive hindered amine piperidine. Photo-induced copolymerization of methyl methacrylate (MMA, M(1)) with MTMP (M(2)) was carried out in benzene solution at ambient temperature. The reactivity ratios for these monomers were measured by running a series of reactions at various feed ratios of initial monomers, and the monomer incorporation into copolymer was determined using (1)H NMR. Reactivity ratios of the MMA/MTMP system were measured to be r(1)= 0.37 and r(2)= 1.14 from extended Kelen-Tüdos method. The results show that monomer MTMP prefers homopolymerization to copolymerization in the system, whereas monomer MMA prefers copolymerization to homopolymerization. Sequence structures of the MMA/MTMP copolymers were characterized using (1)H NMR. The results show that the sequence structure for the main chain of the MMA/MTMP copolymers is mainly composed of a syndiotactic configuration, only with a little heterotactic configuration. Three kinds of the sequences of rr, rr', and lr' in the syndiotactic configuration are found. The sequence-length distribution in the MMA/MTMP copolymers is also obtained. For f(1)= 0.2, the monomer unit of MMA is mostly separated by MTMP units, and for f(1)= 0.6, the alternating tendency prevails and a large number of mono-sequences are formed; further up to f(1)= 0.8, the monomer unit of MTMP with the sequence of one unit is interspersed among the chain of MMA. Copyright © 2012 John Wiley & Sons, Ltd.

  16. Salt Effect Accelerates Site-Selective Cysteine Bioconjugation

    PubMed Central

    2016-01-01

    Highly efficient and selective chemical reactions are desired. For small molecule chemistry, the reaction rate can be varied by changing the concentration, temperature, and solvent used. In contrast for large biomolecules, the reaction rate is difficult to modify by adjusting these variables because stringent biocompatible reaction conditions are required. Here we show that adding salts can change the rate constant over 4 orders of magnitude for an arylation bioconjugation reaction between a cysteine residue within a four-residue sequence (π-clamp) and a perfluoroaryl electrophile. Biocompatible ammonium sulfate significantly enhances the reaction rate without influencing the site-specificity of π-clamp mediated arylation, enabling the fast synthesis of two site-specific antibody–drug conjugates that selectively kill HER2-positive breast cancer cells. Computational and structure–reactivity studies indicate that salts may tune the reaction rate through modulating the interactions between the π-clamp hydrophobic side chains and the electrophile. On the basis of this understanding, the salt effect is extended to other bioconjugation chemistry, and a new regioselective alkylation reaction at π-clamp cysteine is developed. PMID:27725962

  17. Distemper outbreak and its effect on African wild dog conservation.

    PubMed

    van de Bildt, Marco W G; Kuiken, Thijs; Visee, Aart M; Lema, Sangito; Fitzjohn, Tony R; Osterhaus, Albert D M E

    2002-02-01

    In December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV) by means of histologic examination, virus isolation, reverse transcriptase-polymerase chain reaction analysis, and nucleotide sequencing. This report emphasizes the importance of adequate protection against infectious diseases for the successful outcome of captive breeding programs of endangered species.

  18. Fasciola hepatica Infection in an Indigenous Community of the Peruvian Jungle.

    PubMed

    Cabada, Miguel M; Castellanos-Gonzalez, Alejandro; Lopez, Martha; Caravedo, María Alejandra; Arque, Eulogia; White, Arthur Clinton

    2016-06-01

    Fasciola hepatica is a zoonotic infection with a worldwide distribution. Autochthonous cases have not been reported in the Amazon region of Peru. Operculated eggs resembling F. hepatica were identified in the stools of five out of 215 subjects in a remote indigenous community of the Peruvian jungle. Polymerase chain reaction targeting Fasciola hepatica cytochrome oxidase subunit 1 (COI) gene and sequencing of the products confirmed Fasciola infection. © The American Society of Tropical Medicine and Hygiene.

  19. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates.

    PubMed

    Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R

    1994-10-01

    We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.

  20. Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

    PubMed

    Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

    2013-09-23

    Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Molecular basis of beta-thalassemia in the Maldives.

    PubMed

    Furuumi, H; Firdous, N; Inoue, T; Ohta, H; Winichagoon, P; Fucharoen, S; Fukumaki, Y

    1998-03-01

    We have systematically analyzed beta-thalassemia genes using polymerase chain reaction-related techniques, dot-blot hybridization with oligonucleotide probes, allele specific-polymerase chain reaction, and sequencing of amplified DNA fragments from 41 unrelated patients, including 37 beta-thalassemia homozygotes, three with beta-thalassemia/Hb E, and one with beta-thalassemia/Hb S. Four different beta-thalassemia mutations were detected in 78 alleles. These are the IVS-I-5 (G-->C), codon 30 (AGG-->ACG) [also indicated as IVS-I (-1)], IVS-I-1 (G-->A), and codons 41/42 (-TTCT) mutations. The distribution of the beta-thalassemia mutations in the Maldives is 58 alleles (74.3%) with the IVS-I-5 (G-->C) mutation, 12 (15.4%) with the codon 30 (AGG-->ACG) mutation, seven (9%) with the IVS-I-1 (G-->A) mutation, and one with the codons 41/42 (-TTCT) mutation. The first three mutations account for 98.7% of the total number of beta-thalassemia chromosomes studied. These mutations are clustered in the region spanning 6 bp around the junction of exon 1 and the first intervening sequence of the beta-globin gene. These observations have significant implications for setting up a thalassemia prevention and control program in the Maldives. Analysis of haplotypes and frameworks of chromosomes bearing each beta-thalassemia mutation suggested that the origin and spread of these mutations were reflected by the historical record.

  2. A novel EML4-ALK variant: exon 6 of EML4 fused to exon 19 of ALK.

    PubMed

    Penzel, Roland; Schirmacher, Peter; Warth, Arne

    2012-07-01

    Cytotoxic chemotherapy remains the mainstay of treatment for most patients with advanced disease. Recently, anaplastic lymphoma kinase (ALK) expression as a major target for successful treatment with ALK inhibitors was detected in a subset of non-small-cell lung carcinomas, usually as a result of echinoderm microtubule-associated protein-like 4 (EML4)-ALK rearrangements. Although the chromosomal breakpoint within the EML4 gene varied, the breakpoint within ALK was most frequently reported within intron 19 or rarely in exon 20. Therefore, the different EML4-ALK variants so far contain the same 3' portion of ALK starting with exon 20. Here, we report a novel EML4-ALK variant detected by reverse transcription polymerase chain reaction analysis. Subsequent sequencing revealed an EML4-ALK fusion variant in which exon 6 of EML4 was fused to exon 19 of ALK. It occurred in a predominant solid pulmonary adenocarcinoma of a 65-year-old woman with a clear split signal of ALK in fluorescence in situ hybridization analysis and a weakly homogeneous ALK expression in immunohistochemical staining. Because of the growing number of fusion variants a primary reverse transcription polymerase chain reaction-based screening for ALK-positive non-small-cell lung carcinoma patients may not be sufficient for predictive diagnostics but transcript-based approaches and sequencing of ALK fusion variants might finally contribute to an optimized selection of patients.

  3. Detection of novel strains genetically related to Anaplasma platys in Tunisian one-humped camels (Camelus dromedarius).

    PubMed

    Belkahia, Hanène; Ben Said, Mourad; Sayahi, Lotfi; Alberti, Alberto; Messadi, Lilia

    2015-10-29

    Little information is currently available regarding the presence of Anaplasma species in North African dromedaries. To fill this gap in knowledge, the prevalence, risk factors, and genetic diversity of Anaplasma species were investigated in Tunisian dromedary camels. A total of 226 camels from three different bioclimatic areas were sampled and tested for the presence of Anaplasma species by quantitative polymerase chain reaction (qPCR) and nested polymerase chain reaction (nPCR) assays. Detected Anaplasma strains were characterized by 16S rRNA sequence analysis. Overall infection rate of Anaplasma spp. was 17.7%, and was significantly higher in females. Notably, A. marginale, A. centrale, A. bovis, and A. phagocytophilum were not detected. Animals were severely infested by three tick species belonging to the genus Hyalomma (H. dromedarii, H. impeltatum, and H. excavatum). Alignment, similarity comparison, and phylogenetic analysis of the 16S rRNA sequence variants obtained in this study suggest that Tunisian dromedaries are infected by more than one novel Anaplasma strain genetically related to A. platys. This study reports the presence of novel Anaplasma sp. strains genetically related to A. platys in dromedaries from various bioclimatic areas of Tunisia. Findings raise new concerns about the specificity of the direct and indirect diagnostic tests routinely used to detect different Anaplasma species in ruminants and provide useful molecular information to elucidate the evolutionary history of bacterial species related to A. platys.

  4. Designing a Polymerase Chain Reaction Device Working with Radiation and Convection Heat Transfer

    NASA Astrophysics Data System (ADS)

    Madadelahi, M.; Kalan, K.; Shamloo, A.

    2018-05-01

    Gene proliferation is vital for infectious and genetic diseases diagnosis from a blood sample, even before birth. In addition, DNA sequencing, genetic finger-print analyzing, and genetic mutation detecting can be mentioned as other procedures requiring gene reproduction. Polymerase chain reaction, briefly known as PCR, is a convenient and effective way to accomplish this task; where the DNA containing sample faces three temperature phases alternatively. These phases are known as denaturation, annealing, and elongation/extension which in this study -regarding the type of the primers and the target DNA sequence- are set to occur at 95, 58, and 72 degrees of Celsius. In this study, a PCR device has been designed and fabricated which uses radiation and convection heat transfer at the same time to set and control the mentioned thermal sections. A 300W incandescent light bulb able to immediately turn off and on along with two 8×8 cm DC fans, controlled by a microcontroller as well as PID and PD controller codes are used to monitor the applied thermal cycles. In designing the controller codes it has been concerned that they not only control the temperature over the set-points as well as possible, but also increase the temperature variation rate between each two phases. The temperature data were plotted and DNA samples were used to assess the device function.

  5. AJIPHASE®: A Highly Efficient Synthetic Method for One-Pot Peptide Elongation in the Solution Phase by an Fmoc Strategy.

    PubMed

    Takahashi, Daisuke; Inomata, Tatsuji; Fukui, Tatsuya

    2017-06-26

    We previously reported an efficient peptide synthesis method, AJIPHASE®, that comprises repeated reactions and isolations by precipitation. This method utilizes an anchor molecule with long-chain alkyl groups as a protecting group for the C-terminus. To further improve this method, we developed a one-pot synthesis of a peptide sequence wherein the synthetic intermediates were isolated by solvent extraction instead of precipitation. A branched-chain anchor molecule was used in the new process, significantly enhancing the solubility of long peptides and the operational efficiency compared with the previous method, which employed precipitation for isolation and a straight-chain aliphatic group. Another prerequisite for this solvent-extraction-based strategy was the use of thiomalic acid and DBU for Fmoc deprotection, which facilitates the removal of byproducts, such as the fulvene adduct. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Chain-reaction crash on a highway in high visibility

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2016-05-01

    We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

  7. An electrochemical impedance biosensor for Hg2+ detection based on DNA hydrogel by coupling with DNAzyme-assisted target recycling and hybridization chain reaction.

    PubMed

    Cai, Wei; Xie, Shunbi; Zhang, Jin; Tang, Dianyong; Tang, Ying

    2017-12-15

    In this work, an electrochemical impedance biosensor for high sensitive detection of Hg 2+ was presented by coupling with Hg 2+ -induced activation of Mg 2+ -specific DNAzyme (Mg 2+ -DNAzyme) for target cycling and hybridization chain reaction (HCR) assembled DNA hydrogel for signal amplification. Firstly, we synthesized two different copolymer chains P1 and P2 by modifying hairpin DNA H3 and H4 with acrylamide polymer, respectively. Subsequently, Hg 2+ was served as trigger to activate the Mg 2+ -DNAzyme for selectively cleavage ribonucleobase-modified substrate in the presence of Mg 2+ . The partial substrate strand could dissociate from DNAzyme structure, and hybridize with capture probe H1 to expose its concealed sequence for further hybridization. With the help of the exposed sequence, the HCR between hairpin DNA H3 and H4 in P1 and P2 was initiated, and assembled a layer of DNA cross-linked hydrogel on the electrode surface. The formed non-conductive DNA hydrogel film could greatly hinder the interfacial electronic transfer which provided a possibility for us to construct a high sensitive impedance biosensor for Hg 2+ detection. Under the optimal conditions, the impedance biosensor showed an excellent sensitivity and selectivity toward Hg 2+ in a concentration range of 0.1pM - 10nM with a detection limit of 0.042pM Moreover, the real sample analysis reveal that the proposed biosensor is capable of discriminating Hg 2+ ions in reliable and quantitative manners, indicating this method has a promising potential for preliminary application in routine tests. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. HIP1-ALK, a novel fusion protein identified in lung adenocarcinoma.

    PubMed

    Hong, Mineui; Kim, Ryong Nam; Song, Ji-Young; Choi, So-Jung; Oh, Ensel; Lira, Maruja E; Mao, Mao; Takeuchi, Kengo; Han, Joungho; Kim, Jhingook; Choi, Yoon-La

    2014-03-01

    The most common mechanism underlying overexpression and activation of anaplastic lymphoma kinase (ALK) in non-small-cell lung carcinoma could be attributed to the formation of a fusion protein. To date, five fusion partners of ALK have been reported, namely, echinoderm microtubule associated protein like 4, tropomyosin-related kinase-fused gene, kinesin family member 5B, kinesin light chain 1, and protein tyrosine phosphatase, nonreceptor type 3. In this article, we report a novel fusion gene huntingtin interacting protein 1 (HIP1)-ALK, which is conjoined between the huntingtin-interacting protein 1 gene HIP1 and ALK. Reverse-transcriptase polymerase chain reaction and immunohistochemical analysis were used to detect this fusion gene's transcript and protein expression, respectively. We had amplified the full-length cDNA sequence of this novel fusion gene by using 5'-rapid amplification of cDNA ends. The causative genomic translocation t(2;7)(p23;q11.23) for generating this novel fusion gene was verified by using genomic sequencing. The examined adenocarcinoma showed predominant acinar pattern, and ALK immunostaining was localized to the cytoplasm, with intense staining in the submembrane region. In break-apart, fluorescence in situ hybridization analysis for ALK, split of the 5' and 3' probe signals, and isolated 3' signals were observed. Reverse-transcriptase polymerase chain reaction revealed that the tumor harbored a novel fusion transcript in which exon 21 of HIP1 was fused to exon 20 of ALK in-frame. The novel fusion gene and its protein HIP1-ALK harboring epsin N-terminal homology, coiled-coil, juxtamembrane, and kinase domains, which could play a role in carcinogenesis, could become diagnostic and therapeutic target of the lung adenocarcinoma and deserve a further study in the future.

  9. Effect of vehicular size on chain-reaction crash

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-11-01

    We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

  10. Kinetic aspects of chain growth in Fischer-Tropsch synthesis.

    PubMed

    Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M

    2017-04-28

    Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.

  11. Fragmentation of whole-transcriptome RNA using E. coli RNase III.

    PubMed

    Ares, Manuel

    2013-05-01

    High-throughput sequencing (HTS) methods can provide short sequence reads for many millions of individual molecules in a sample, allowing the use of sequencing to measure the abundance of RNA molecules. To quantify the amount of a particular sequence in a sample of large RNAs (e.g., mRNAs), it is important to fragment the RNA into short pieces that can be ligated to oligonucleotides that allow polymerase chain reaction (PCR) amplification and sequencing. The most desired end structure of RNA for such ligation steps is a 5' phosphate and a 3' OH. Thus, enzymes that leave these groups after cleavage are of particular utility, avoiding the need to dephosphorylate the 3' end with phosphatases or phosphorylate the 5' end with kinase before proceeding. One such enzyme, RNase III, is widely available. Although it primarily cuts duplex RNA, this specificity is salt- and concentration-dependent, and many RNAs that lack strong extended duplexes are nonetheless susceptible to cleavage at many spots. RNA fragmentation by RNase III does not seem to grossly affect the distribution of RNA sequencing reads. Thus, it has become a standard method for creating nominally representative pools of transcriptome sequences with 5' phosphates and 3' OH for library construction. Three steps in preparing fragmented transcriptome RNA for sequencing library construction are described here: (1) fragmenting the RNA with RNase III to the extent that ~60-100-nucleotide fragments are created, (2) purifying the RNA from the RNase III reaction, and (3) analyzing the digestion products for their suitability in library production.

  12. Replaceable Microfluidic Cartridges for a PCR Biosensor

    NASA Technical Reports Server (NTRS)

    Francis, Kevin; Sullivan, Ron

    2005-01-01

    The figure depicts a replaceable microfluidic cartridge that is a component of a miniature biosensor that detects target deoxyribonucleic acid (DNA) sequences. The biosensor utilizes (1) polymerase chain reactions (PCRs) to multiply the amount of DNA to be detected, (2) fluorogenic polynucleotide probe chemicals for labeling the target DNA sequences, and (3) a high-sensitivity epifluorescence-detection optoelectronic subsystem. Microfluidics is a relatively new field of device development in which one applies techniques for fabricating microelectromechanical systems (MEMS) to miniature systems for containing and/or moving fluids. Typically, microfluidic devices are microfabricated, variously, from silicon or polymers. The development of microfluidic devices for applications that involve PCR and fluorescence-based detection of PCR products poses special challenges

  13. Demonstration of vaginal colonization with GusA-expressing Lactobacillus jensenii following oral delivery in rhesus macaques

    PubMed Central

    Lagenaur, Laurel A; Lee, Peter P; Hamer, Dean H; Sanders-Beer, Brigitte E

    2012-01-01

    The vaginal microbiome, which harbors beneficial Lactobacillus strains, is believed to be a major host defense mechanism for preventing infections of the urogenital tract. It has been suggested that the gastrointestinal tract serves as a reservoir for lactobacilli that colonize the vagina. Using rhesus macaques, we examined whether oral delivery of human vaginal Lactobacillus jensenii-1153-1646, a GusA-producing strain, would result in colonization of the rectum and the vagina. Lactobacilli were identified from the vagina tracts of three macaques on the basis of β-glucuronidase enzyme production, 16S rRNA gene sequence and DNA homology using a repetitive sequence-based polymerase chain reaction. PMID:21907793

  14. Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

    PubMed

    Hussey, Richard S; Huang, Guozhong; Allen, Rex

    2011-01-01

    Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

  15. Cloning and sequencing the genes encoding goldfish and carp ependymin.

    PubMed

    Adams, D S; Shashoua, V E

    1994-04-20

    Ependymins (EPNs) are brain glycoproteins thought to function in optic nerve regeneration and long-term memory consolidation. To date, epn genes have been characterized in two orders of teleost fish. In this study, polymerase chain reactions (PCR) were used to amplify the complete 1.6-kb epn genes, gf-I and cc-I, from genomic DNA of Cypriniformes, goldfish and carp, respectively. Amplified bands were cloned and sequenced. Each gene consists of six exons and five introns. The exon portion of gf-I encodes a predicted 215-amino-acid (aa) protein previously characterized as GF-I, while cc-I encodes a predicted 215-aa protein 95% homologous to GF-I.

  16. Gene cloning and overexpression of a geranylgeranyl diphosphate synthase of an extremely thermophilic bacterium, Thermus thermophilus.

    PubMed

    Ohto, C; Ishida, C; Koike-Takeshita, A; Yokoyama, K; Muramatsu, M; Nishino, T; Obata, S

    1999-02-01

    A geranylgeranyl diphosphate (GGPP) synthase gene of an extremely thermophilic bacterium, Thermus thermophilus, was cloned and sequenced. T. thermophilus GGPP synthase, overexpressed in Escherichia coli cells as a glutathione S-transferase fusion protein, was purified and characterized. The fusion protein, retaining thermostability, formed a homodimer, and showed higher specific activity than did a partially purified thermostable enzyme previously reported. Optimal reaction conditions and kinetic parameters were also examined. The deduced amino acid sequence indicated that T. thermophilus GGPP synthase was excluded from the group of bacterial type GGPP synthases and lacked the insertion amino acid residues in the first aspartate-rich motif as do archaeal and eukaryotic short-chain prenyltransferases.

  17. Isolation of a new dual-functional caffeine synthase gene encoding an enzyme for the conversion of 7-methylxanthine to caffeine from coffee (Coffea arabica L.).

    PubMed

    Mizuno, Kouichi; Okuda, Akira; Kato, Misako; Yoneyama, Naho; Tanaka, Hiromi; Ashihara, Hiroshi; Fujimura, Tatsuhito

    2003-01-16

    In coffee and tea plants, caffeine is synthesized from xanthosine via a pathway that includes three methylation steps. We report the isolation of a bifunctional coffee caffeine synthase (CCS1) clone from coffee endosperm by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) technique using previously reported sequence information for theobromine synthases (CTSs). The predicted amino acid sequences of CCS1 are more than 80% identical to CTSs and are about 40% similar to those of tea caffeine synthase (TCS1). Interestingly, CCS1 has dual methylation activity like tea TCS1.

  18. Sequence Analysis and Domain Motifs in the Porcine Skin Decorin Glycosaminoglycan Chain*

    PubMed Central

    Zhao, Xue; Yang, Bo; Solakylidirim, Kemal; Joo, Eun Ji; Toida, Toshihiko; Higashi, Kyohei; Linhardt, Robert J.; Li, Lingyun

    2013-01-01

    Decorin proteoglycan is comprised of a core protein containing a single O-linked dermatan sulfate/chondroitin sulfate glycosaminoglycan (GAG) chain. Although the sequence of the decorin core protein is determined by the gene encoding its structure, the structure of its GAG chain is determined in the Golgi. The recent application of modern MS to bikunin, a far simpler chondroitin sulfate proteoglycans, suggests that it has a single or small number of defined sequences. On this basis, a similar approach to sequence the decorin of porcine skin much larger and more structurally complex dermatan sulfate/chondroitin sulfate GAG chain was undertaken. This approach resulted in information on the consistency/variability of its linkage region at the reducing end of the GAG chain, its iduronic acid-rich domain, glucuronic acid-rich domain, and non-reducing end. A general motif for the porcine skin decorin GAG chain was established. A single small decorin GAG chain was sequenced using MS/MS analysis. The data obtained in the study suggest that the decorin GAG chain has a small or a limited number of sequences. PMID:23423381

  19. Selection of an Aptamer Antidote to the Anticoagulant Drug Bivalirudin

    PubMed Central

    Martin, Jennifer A.; Parekh, Parag; Kim, Youngmi; Morey, Timothy E.; Sefah, Kwame; Gravenstein, Nikolaus; Dennis, Donn M.; Tan, Weihong

    2013-01-01

    Adverse drug reactions, including severe patient bleeding, may occur following the administration of anticoagulant drugs. Bivalirudin is a synthetic anticoagulant drug sometimes employed as a substitute for heparin, a commonly used anticoagulant that can cause a condition called heparin-induced thrombocytopenia (HIT). Although bivalrudin has the advantage of not causing HIT, a major concern is lack of an antidote for this drug. In contrast, medical professionals can quickly reverse the effects of heparin using protamine. This report details the selection of an aptamer to bivalirudin that functions as an antidote in buffer. This was accomplished by immobilizing the drug on a monolithic column to partition binding sequences from nonbinding sequences using a low-pressure chromatography system and salt gradient elution. The elution profile of binding sequences was compared to that of a blank column (no drug), and fractions with a chromatographic difference were analyzed via real-time PCR (polymerase chain reaction) and used for further selection. Sequences were identified by 454 sequencing and demonstrated low micromolar dissociation constants through fluorescence anisotropy after only two rounds of selection. One aptamer, JPB5, displayed a dose-dependent reduction of the clotting time in buffer, with a 20 µM aptamer achieving a nearly complete antidote effect. This work is expected to result in a superior safety profile for bivalirudin, resulting in enhanced patient care. PMID:23483901

  20. Expanding the Halohydrin Dehalogenase Enzyme Family: Identification of Novel Enzymes by Database Mining.

    PubMed

    Schallmey, Marcus; Koopmeiners, Julia; Wells, Elizabeth; Wardenga, Rainer; Schallmey, Anett

    2014-12-01

    Halohydrin dehalogenases are very rare enzymes that are naturally involved in the mineralization of halogenated xenobiotics. Due to their catalytic potential and promiscuity, many biocatalytic reactions have been described that have led to several interesting and industrially important applications. Nevertheless, only a few of these enzymes have been made available through recombinant techniques; hence, it is of general interest to expand the repertoire of these enzymes so as to enable novel biocatalytic applications. After the identification of specific sequence motifs, 37 novel enzyme sequences were readily identified in public sequence databases. All enzymes that could be heterologously expressed also catalyzed typical halohydrin dehalogenase reactions. Phylogenetic inference for enzymes of the halohydrin dehalogenase enzyme family confirmed that all enzymes form a distinct monophyletic clade within the short-chain dehydrogenase/reductase superfamily. In addition, the majority of novel enzymes are substantially different from previously known phylogenetic subtypes. Consequently, four additional phylogenetic subtypes were defined, greatly expanding the halohydrin dehalogenase enzyme family. We show that the enormous wealth of environmental and genome sequences present in public databases can be tapped for in silico identification of very rare but biotechnologically important biocatalysts. Our findings help to readily identify halohydrin dehalogenases in ever-growing sequence databases and, as a consequence, make even more members of this interesting enzyme family available to the scientific and industrial community. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  1. Computational analysis of stochastic heterogeneity in PCR amplification efficiency revealed by single molecule barcoding

    PubMed Central

    Best, Katharine; Oakes, Theres; Heather, James M.; Shawe-Taylor, John; Chain, Benny

    2015-01-01

    The polymerase chain reaction (PCR) is one of the most widely used techniques in molecular biology. In combination with High Throughput Sequencing (HTS), PCR is widely used to quantify transcript abundance for RNA-seq, and in the context of analysis of T and B cell receptor repertoires. In this study, we combine DNA barcoding with HTS to quantify PCR output from individual target molecules. We develop computational tools that simulate both the PCR branching process itself, and the subsequent subsampling which typically occurs during HTS sequencing. We explore the influence of different types of heterogeneity on sequencing output, and compare them to experimental results where the efficiency of amplification is measured by barcodes uniquely identifying each molecule of starting template. Our results demonstrate that the PCR process introduces substantial amplification heterogeneity, independent of primer sequence and bulk experimental conditions. This heterogeneity can be attributed both to inherited differences between different template DNA molecules, and the inherent stochasticity of the PCR process. The results demonstrate that PCR heterogeneity arises even when reaction and substrate conditions are kept as constant as possible, and therefore single molecule barcoding is essential in order to derive reproducible quantitative results from any protocol combining PCR with HTS. PMID:26459131

  2. Biochemistry of Catabolic Reductive Dehalogenation.

    PubMed

    Fincker, Maeva; Spormann, Alfred M

    2017-06-20

    A wide range of phylogenetically diverse microorganisms couple the reductive dehalogenation of organohalides to energy conservation. Key enzymes of such anaerobic catabolic pathways are corrinoid and Fe-S cluster-containing, membrane-associated reductive dehalogenases. These enzymes catalyze the reductive elimination of a halide and constitute the terminal reductases of a short electron transfer chain. Enzymatic and physiological studies revealed the existence of quinone-dependent and quinone-independent reductive dehalogenases that are distinguishable at the amino acid sequence level, implying different modes of energy conservation in the respective microorganisms. In this review, we summarize current knowledge about catabolic reductive dehalogenases and the electron transfer chain they are part of. We review reaction mechanisms and the role of the corrinoid and Fe-S cluster cofactors and discuss physiological implications.

  3. Identification of genes from pattern formation, tyrosine kinase, and potassium channel families by DNA amplification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kamb, A.; Weir, M.; Rudy, B.

    1989-06-01

    The study of gene family members has been aided by the isolation of related genes on the basis of DNA homology. The authors have adapted the polymerase chain reaction to screen animal genomes very rapidly and reliably for likely gene family members. Using conserved amino acid sequences to design degenerate oligonucleotide primers, they have shown that the genome of the nematode Caenorhabditis elegans contains sequences homologous to many Drosophila genes involved in pattern formation, including the segment polarity gene wingless (vertebrate int-1), and homeobox sequences characteristic of the Antennapedia, engrailed, and paired families. In addition, they have used this methodmore » to show that C. elegans contains at least five different sequences homologous to genes in the tyrosine kinase family. Lastly, they have isolated six potassium channel sequences from humans, a result that validates the utility of the method with large genomes and suggests that human potassium channel gene diversity may be extensive.« less

  4. Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

    PubMed

    Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

    2014-01-01

    The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

  5. Differences in a ribosomal DNA sequence of Strongylus species allows identification of single eggs.

    PubMed

    Campbell, A J; Gasser, R B; Chilton, N B

    1995-03-01

    In the current study, molecular techniques were evaluated for the species identification of individual strongyle eggs. Adult worms of Strongylus edentatus, S. equinus and S. vulgaris were collected at necropsy from horses from Australia and the U.S.A. Genomic DNA was isolated and a ribosomal transcribed spacer (ITS-2) amplified and sequenced using polymerase chain reaction (PCR) techniques. The length of the ITS-2 sequence of S. edentatus, S. equinus and S. vulgaris ranged between 217 and 235 nucleotides. Extensive sequence analysis demonstrated a low degree (0-0.9%) of intraspecific variation in the ITS-2 for the Strongylus species examined, whereas the levels of interspecific differences (13-29%) were significantly greater. Interspecific differences in the ITS-2 sequences allowed unequivocal species identification of single worms and eggs using PCR-linked restriction fragment length polymorphism. These results demonstrate the potential of the ribosomal spacers as genetic markers for species identification of single strongyle eggs from horse faeces.

  6. Evaluation of the cationic trypsinogen gene for potential mutations in miniature schnauzers with pancreatitis

    PubMed Central

    2004-01-01

    Abstract The purpose of this study was to evaluate the cationic trypsinogen gene in miniature schnauzers for possible mutations. Genetic mutations have been linked with hereditary pancreatitis in humans. Four miniature schnauzers were selected on the basis of a clinical history of pancreatitis. One healthy miniature schnauzer and 1 healthy mixed breed canine were enrolled as controls. DNA was extracted from these canines using a commercial kit. Primers were designed to amplify the entire canine cationic trypsinogen cDNA sequence. A polymerase chain reaction (PCR) was performed and products were purified and sequenced. All sequences were then compared. The healthy control canine, a healthy miniature schnauzer, and the 4 miniature schnauzers with pancreatitis showed identical sequences of the cationic trypsinogen gene to the published sequence. We conclude that, in contrast to humans with hereditary pancreatitis, mutations of the cationic trypsinogen gene do not play a major role in the genesis of pancreatitis in the miniature schnauzer. PMID:15581228

  7. Evaluation of the cationic trypsinogen gene for potential mutations in miniature schnauzers with pancreatitis.

    PubMed

    Bishop, Micah A; Steiner, Jörg M; Moore, Lisa E; Williams, David A

    2004-10-01

    The purpose of this study was to evaluate the cationic trypsinogen gene in miniature schnauzers for possible mutations. Genetic mutations have been linked with hereditary pancreatitis in humans. Four miniature schnauzers were selected on the basis of a clinical history of pancreatitis. One healthy miniature schnauzer and 1 healthy mixed breed canine were enrolled as controls. DNA was extracted from these canines using a commercial kit. Primers were designed to amplify the entire canine cationic trypsinogen cDNA sequence. A polymerase chain reaction (PCR) was performed and products were purified and sequenced. All sequences were then compared. The healthy control canine, a healthy miniature schnauzer, and the 4 miniature schnauzers with pancreatitis showed identical sequences of the cationic trypsinogen gene to the published sequence. We conclude that, in contrast to humans with hereditary pancreatitis, mutations of the cationic trypsinogen gene do not play a major role in the genesis of pancreatitis in the miniature schnauzer.

  8. Spliced RNA of woodchuck hepatitis virus.

    PubMed

    Ogston, C W; Razman, D G

    1992-07-01

    Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.

  9. Helicase-dependent amplification of nucleic acids.

    PubMed

    Cao, Yun; Kim, Hyun-Jin; Li, Ying; Kong, Huimin; Lemieux, Bertrand

    2013-10-11

    Helicase-dependent amplification (HDA) is a novel method for the isothermal in vitro amplification of nucleic acids. The HDA reaction selectively amplifies a target sequence by extension of two oligonucleotide primers. Unlike the polymerase chain reaction (PCR), HDA uses a helicase enzyme to separate the deoxyribonucleic acid (DNA) strands, rather than heat denaturation. This allows DNA amplification without the need for thermal cycling. The helicase used in HDA is a helicase super family II protein obtained from a thermophilic organism, Thermoanaerobacter tengcongensis (TteUvrD). This thermostable helicase is capable of unwinding blunt-end nucleic acid substrates at elevated temperatures (60° to 65°C). The HDA reaction can also be coupled with reverse transcription for ribonucleic acid (RNA) amplification. The products of this reaction can be detected during the reaction using fluorescent probes when incubations are conducted in a fluorimeter. Alternatively, products can be detected after amplification using a disposable amplicon containment device that contains an embedded lateral flow strip. Copyright © 2013 John Wiley & Sons, Inc.

  10. Plant n-alkane production from litterfall altered the diversity and community structure of alkane degrading bacteria in litter layer in lowland subtropical rainforest in Taiwan

    NASA Astrophysics Data System (ADS)

    Huang, Tung-Yi; Hsu, Bing-Mu; Chao, Wei-Chun; Fan, Cheng-Wei

    2018-03-01

    n-Alkane and alkane-degrading bacteria have long been used as crucial biological indicators of paleoecology, petroleum pollution, and oil and gas prospecting. However, the relationship between n-alkane and alkane-degrading bacteria in natural forests is still poorly understood. In this study, long-chain n-alkane (C14-C35) concentrations in litterfall, litter layer, and topsoil as well as the diversity and abundance of n-alkane-degrading bacterial communities in litter layers were investigated in three habitats across a lowland subtropical rainforest in southern Taiwan: ravine, windward, and leeward habitats in Nanjenshan. Our results demonstrate that the litterfall yield and productivity of long-chain n-alkane were highest in the ravine habitats. However, long-chain n-alkane concentrations in all habitats were decreased drastically to a similar low level from the litterfall to the bulk soil, suggesting a higher rate of long-chain n-alkane degradation in the ravine habitat. Operational taxonomic unit (OTU) analysis using next-generation sequencing data revealed that the relative abundances of microbial communities in the windward and leeward habitats were similar and different from that in the ravine habitat. Data mining of community amplicon sequencing using the NCBI database revealed that alkB-gene-associated bacteria (95 % DNA sequence similarity to alkB-containing bacteria) were most abundant in the ravine habitat. Empirical testing of litter layer samples using semi-quantitative polymerase chain reaction for determining alkB gene levels confirmed that the ravine habitat had higher alkB gene levels than the windward and leeward habitats. Heat map analysis revealed parallels in pattern color between the plant and microbial species compositions of the habitats, suggesting a causal relationship between the plant n-alkane production and microbial community diversity. This finding indicates that the diversity and relative abundance of microbial communities in the litter layer are affected by n-alkane plant composition in the litterfall.

  11. Tracking polypeptide folds on the free energy surface: effects of the chain length and sequence.

    PubMed

    Brukhno, Andrey V; Ricchiuto, Piero; Auer, Stefan

    2012-07-26

    Characterization of the folding transition in polypeptides and assessing the thermodynamic stability of their structured folds are of primary importance for approaching the problem of protein folding. We use molecular dynamics simulations for a coarse grained polypeptide model in order to (1) obtain the equilibrium conformation diagram of homopolypeptides in a broad range of the chain lengths, N = 10, ..., 100, and temperatures, T (in a multicanonical ensemble), and (2) determine free energy profiles (FEPs) projected onto an optimal, so-called "natural", reaction coordinate that preserves the height of barriers and the diffusion coefficients on the underlying free energy hyper-surface. We then address the following fundamental questions. (i) How well does a kinetically determined free energy landscape of a single chain represent the polypeptide equilibrium (ensemble) behavior? In particular, under which conditions might the correspondence be lost, and what are the possible implications for the folding processes? (ii) How does the free energy landscape depend on the chain length (homopolypeptides) and the monomer interaction sequence (heteropolypeptides)? Our data reveal that at low T values equilibrium structures adopted by relatively short homopolypeptides (N < 60) are dominated by α-helical folds which correspond to the primary and secondary minima of the FEP. In contrast, longer homopolypeptides (N > 70), upon quasi-equilibrium cooling, fold preferentially in β-bundles with small helical portions, while the FEPs exhibit no distinct global minima. Moreover, subject to the choice of the initial configuration, at sufficiently low T, essentially metastable structures can be found and prevail far from the true thermodynamic equilibrium. We also show that, by sequence-enabling the polypeptide model, it is possible to restrict the chain to a very specific part of the configuration space, which results in substantial simplification and smoothing of the free energy landscape as compared to the case of the corresponding homopolypeptide.

  12. An enzyme-free flow cytometric bead assay for the sensitive detection of microRNAs based on click nucleic acid ligation-mediated signal amplification.

    PubMed

    Qi, Yan; Qiu, Liying; Fan, Wenjiao; Liu, Chenghui; Li, Zhengping

    2017-08-07

    A versatile flow cytometric bead assay (FCBA) coupled with a completely enzyme-free signal amplification mechanism is developed for the sensitive detection of microRNAs (miRNAs). This new strategy integrates click chemistry-mediated ligation chain reaction (CLCR) with hybridization chain reaction (HCR) for enzyme-free signal amplification on magnetic beads (MBs), and a flow cytometer for the robust fluorescence readout of the MBs. Firstly, target miRNA can initiate CLCR on the surface of MBs based on the click chemical ligation between dibenzocyclooctyne (DBCO)- and azide-modified single-stranded DNA (ssDNA) probes, and the amount of ligated ssDNA sequences on the MBs will be proportional to the dosage of target miRNA. Afterward, each of the ligated ssDNA products can trigger a cascade chain reaction of hybridization events between two alternating fluorophore-tagged hairpin probes, resulting in another signal amplification pathway with an amplified accumulation of fluorophores on the MBs. Finally, the fluorophore-anchored MBs are directly and rapidly analyzed by using a flow cytometer without any separation or elution processes. Herein, the click nucleic acid ligation only occurs on the surface of MBs, so the nonspecific ligations are greatly inhibited compared with that of ligation reaction performed in homogeneous solution. Furthermore, the signal amplification by CLCR-HCR is highly efficient but totally enzyme-free, which may overcome the potential drawbacks of conventional enzyme-catalyzed signal amplification protocols and lead to a high sensitivity. The CLCR-HCR-based FCBA has pushed the detection limit of let-7a miRNA down to the femtomolar (fM) level, showing great potential in miRNA-related biological studies and disease diagnosis.

  13. Real-time PCR probe optimization using design of experiments approach.

    PubMed

    Wadle, S; Lehnert, M; Rubenwolf, S; Zengerle, R; von Stetten, F

    2016-03-01

    Primer and probe sequence designs are among the most critical input factors in real-time polymerase chain reaction (PCR) assay optimization. In this study, we present the use of statistical design of experiments (DOE) approach as a general guideline for probe optimization and more specifically focus on design optimization of label-free hydrolysis probes that are designated as mediator probes (MPs), which are used in reverse transcription MP PCR (RT-MP PCR). The effect of three input factors on assay performance was investigated: distance between primer and mediator probe cleavage site; dimer stability of MP and target sequence (influenza B virus); and dimer stability of the mediator and universal reporter (UR). The results indicated that the latter dimer stability had the greatest influence on assay performance, with RT-MP PCR efficiency increased by up to 10% with changes to this input factor. With an optimal design configuration, a detection limit of 3-14 target copies/10 μl reaction could be achieved. This improved detection limit was confirmed for another UR design and for a second target sequence, human metapneumovirus, with 7-11 copies/10 μl reaction detected in an optimum case. The DOE approach for improving oligonucleotide designs for real-time PCR not only produces excellent results but may also reduce the number of experiments that need to be performed, thus reducing costs and experimental times.

  14. Peroxy radical measurements with NCAR's chemical amplifier

    NASA Technical Reports Server (NTRS)

    Cantrell, Christopher; Shetter, Richard; Calvert, Jack G.

    1994-01-01

    The present NCAR instrument for HO2/RO2 measurements has been described previously. It is based on the reactions involving HO2, RO2, and HO radicals with CO and NO. Since (HO2) + (RO2) + (HO) is much greater than (HO) for most atmospheres, it is useful as a peroxy radical detector. Operation of the instrument depends on the creation of a chemical chain reaction which is initiated as HO2 and RO2 radicals in ambient air encounter added NO gas; this forms an NO2 molecule and an HO or RO radical: HO2(RO2) + NO yields HO(RO) + NO2. RO radicals react relatively efficiently with O2 to form an HO2 radical, and subsequently an HO-radical, by reaction with NO. CO gas added to the reaction chamber during part of the operating cycle, recycles the HO to HO2; HO + CO (+O2) yields HO2 + CO2. The reaction sequence may form several hundred NO2 molecules per HO2 (RO2) originally present, before chain termination occurs. The added CO is replaced by N2 addition periodically so that the chain reaction is suppressed, and a 'blank' signal resulting from NO2, O3 and possibly other NO2-forming species (non-chain processes) in ambient air is recorded. The difference between the signal with and without CO is proportional to the peroxy radical concentration. The NO2 produced is monitored using a sensitive luminol chemiluminescence detector system. In the NCAR instrument the length of the amplification chain is determined using a stable source of HO2 radicals (H2O2 thermal decomposition); the ratio of the signal seen with CO present to that with N2 present gives the sensitivity of the instrument to HO2 (molecules of NO2 formed/peroxy radical). The instrument is automated to carry out in hourly repeated cycles: (1) chain length determination; (2) NO2 calibration; and (3) linearity check on the response of signals. One minute averages of signals are normally recorded. The sensitivity of the instrument to detect peroxy radicals is in the pptv range. The present instrument has operated continuously (24 hr/day) in the field studies which extended over a period of several weeks. The major advantages of this instrument are as follows: (1) its relative simplicity; (2) low power requirements; and (3) its rapid response to all types of peroxy radicals--HO2, CH3O2 and the higher alkyl and acyl peroxy radicals; however not all RO2 species generate HO2 radicals with perfect efficiency and hence have somewhat lower response/molecule than HO2 radicals.

  15. Optimal Conditions for the Asymmetric Polymerase Chain Reaction for Detecting Food Pathogenic Bacteria Using a Personal SPR Sensor.

    PubMed

    Nagai, Haruka; Tomioka, Kanji; Okumura, Shiro

    2018-06-26

    We have been developing quick and simple system for detecting food-poisoning bacteria using a combination of an asymmetric PCR and a portable surface plasmon resonance (SPR) sensor. The system would be suitable for point-of-care detection of food-poisoning bacteria in the field of food industry. In this study, we established a novel method for quantifying the amplified forward (F) and reverse (R) chains of Staphylococcus aureus separately by high-performance liquid chromatography (HPLC). The concentration of single-stranded DNA amplicon excessively amplified, which is crucial for the system, could be calculated as the difference between those of the F- and R-chains. For the R-chain, a correction based on the F-chain concentration in the sample was used to obtain a more accurate value, because the determination of the R-chain concentration was affected by that of the coexisting F-chain. The concentration values were also determined by fluorescence imaging for electrophoresis gels of amplicons with FITC- or Cy5-conjugated primers, and they were in good agreement with the values by the HPLC. The measured concentration of the single-strand F-chain correlated well with the value of the SPR response against the probe that was a complementary sequence of the F-chain, immobilized on the sensor chip of the SPR sensor.

  16. Characterization of a prototype strain of hepatitis E virus.

    PubMed Central

    Tsarev, S A; Emerson, S U; Reyes, G R; Tsareva, T S; Legters, L J; Malik, I A; Iqbal, M; Purcell, R H

    1992-01-01

    A strain of hepatitis E virus (SAR-55) implicated in an epidemic of enterically transmitted non-A, non-B hepatitis, now called hepatitis E, was characterized extensively. Six cynomolgus monkeys (Macaca fascicularis) were infected with a strain of hepatitis E virus from Pakistan. Reverse transcription-polymerase chain reaction was used to determine the pattern of virus shedding in feces, bile, and serum relative to hepatitis and induction of specific antibodies. Virtually the entire genome of SAR-55 (7195 nucleotides) was sequenced. Comparison of the sequence of SAR-55 with that of a Burmese strain revealed a high level of homology except for one region encoding 100 amino acids of a putative nonstructural polyprotein. Identification of this region as hypervariable was obtained by partial sequencing of a third isolate of hepatitis E virus from Kirgizia. Images PMID:1731327

  17. [The development of molecular human genetics and its significance for perspectives of modern medicine].

    PubMed

    Coutelle, C; Speer, A; Grade, K; Rosenthal, A; Hunger, H D

    1989-01-01

    The introduction of molecular human genetics has become a paradigma for the application of genetic engineering in medicine. The main principles of this technology are the isolation of molecular probes, their application in hybridization reactions, specific gene-amplification by the polymerase chain reaction, and DNA sequencing reactions. These methods are used for the analysis of monogenic diseases by linkage studies and the elucidation of the molecular defect causing these conditions, respectively. They are also the basis for genomic diagnosis of monogenic diseases, introduced into the health care system of the GDR by a national project on Duchenne/Becker muscular dystrophy, Cystic Fibrosis and Phenylketonuria. The rapid development of basic research on the molecular analysis of the human genome and genomic diagnosis indicates, that human molecular genetics is becoming a decisive basic discipline of modern medicine.

  18. Why barcode? High-throughput multiplex sequencing of mitochondrial genomes for molecular systematics.

    PubMed

    Timmermans, M J T N; Dodsworth, S; Culverwell, C L; Bocak, L; Ahrens, D; Littlewood, D T J; Pons, J; Vogler, A P

    2010-11-01

    Mitochondrial genome sequences are important markers for phylogenetics but taxon sampling remains sporadic because of the great effort and cost required to acquire full-length sequences. Here, we demonstrate a simple, cost-effective way to sequence the full complement of protein coding mitochondrial genes from pooled samples using the 454/Roche platform. Multiplexing was achieved without the need for expensive indexing tags ('barcodes'). The method was trialled with a set of long-range polymerase chain reaction (PCR) fragments from 30 species of Coleoptera (beetles) sequenced in a 1/16th sector of a sequencing plate. Long contigs were produced from the pooled sequences with sequencing depths ranging from ∼10 to 100× per contig. Species identity of individual contigs was established via three 'bait' sequences matching disparate parts of the mitochondrial genome obtained by conventional PCR and Sanger sequencing. This proved that assembly of contigs from the sequencing pool was correct. Our study produced sequences for 21 nearly complete and seven partial sets of protein coding mitochondrial genes. Combined with existing sequences for 25 taxa, an improved estimate of basal relationships in Coleoptera was obtained. The procedure could be employed routinely for mitochondrial genome sequencing at the species level, to provide improved species 'barcodes' that currently use the cox1 gene only.

  19. Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

    PubMed

    Nadal, Anna; Esteve, Teresa; Pla, Maria

    2009-01-01

    A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (<1.7% of false classification rate), with limit of detection values of 0.1% for each event, which were also achieved with simulated mixtures at different relative percentages of targets. The assay was further combined with a second multiplex PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary.

  20. Variant translocation partners of the anaplastic lymphoma kinase (ALK) gene in two cases of anaplastic large cell lymphoma, identified by inverse cDNA polymerase chain reaction.

    PubMed

    Takeoka, Kayo; Okumura, Atsuko; Honjo, Gen; Ohno, Hitoshi

    2014-01-01

    In anaplastic large cell lymphoma (ALCL), the anaplastic lymphoma kinase (ALK) gene is rearranged with diverse partners due to variant translocations/inversions. Case 1 was a 39-year-old man who developed multiple tumors in the mediastinum, psoas muscle, lung, and lymph nodes. A biopsy specimen of the inguinal node was effaced by large tumor cells expressing CD30, epithelial membrane antigen, and cytoplasmic ALK, which led to a diagnosis of ALK(+) ALCL. Case 2 was a 51-year-old man who was initially diagnosed with undifferentiated carcinoma. He developed multiple skin tumors eight years after his initial presentation, and was finally diagnosed with ALK(+) ALCL. He died of therapy-related acute myeloid leukemia. G-banding and fluorescence in situ hybridization using an ALK break-apart probe revealed the rearrangement of ALK and suggested variant translocation in both cases. We applied an inverse cDNA polymerase chain reaction (PCR) strategy to identify the partner of ALK. Nucleotide sequencing of the PCR products and a database search revealed that the sequences of ATIC in case 1 and TRAF1 in case 2 appeared to follow those of ALK. We subsequently confirmed ATIC-ALK and TRAF1-ALK fusions by reverse transcriptase PCR and nucleotide sequencing. We successfully determined the partner gene of ALK in two cases of ALK(+) ALCL. ATIC is the second most common partner of variant ALK rearrangements, while the TRAF1-ALK fusion gene was first reported in 2013, and this is the second reported case of ALK(+) ALCL carrying TRAF1-ALK.

  1. Highly parallel single-molecule amplification approach based on agarose droplet polymerase chain reaction for efficient and cost-effective aptamer selection.

    PubMed

    Zhang, Wei Yun; Zhang, Wenhua; Liu, Zhiyuan; Li, Cong; Zhu, Zhi; Yang, Chaoyong James

    2012-01-03

    We have developed a novel method for efficiently screening affinity ligands (aptamers) from a complex single-stranded DNA (ssDNA) library by employing single-molecule emulsion polymerase chain reaction (PCR) based on the agarose droplet microfluidic technology. In a typical systematic evolution of ligands by exponential enrichment (SELEX) process, the enriched library is sequenced first, and tens to hundreds of aptamer candidates are analyzed via a bioinformatic approach. Possible candidates are then chemically synthesized, and their binding affinities are measured individually. Such a process is time-consuming, labor-intensive, inefficient, and expensive. To address these problems, we have developed a highly efficient single-molecule approach for aptamer screening using our agarose droplet microfluidic technology. Statistically diluted ssDNA of the pre-enriched library evolved through conventional SELEX against cancer biomarker Shp2 protein was encapsulated into individual uniform agarose droplets for droplet PCR to generate clonal agarose beads. The binding capacity of amplified ssDNA from each clonal bead was then screened via high-throughput fluorescence cytometry. DNA clones with high binding capacity and low K(d) were chosen as the aptamer and can be directly used for downstream biomedical applications. We have identified an ssDNA aptamer that selectively recognizes Shp2 with a K(d) of 24.9 nM. Compared to a conventional sequencing-chemical synthesis-screening work flow, our approach avoids large-scale DNA sequencing and expensive, time-consuming DNA synthesis of large populations of DNA candidates. The agarose droplet microfluidic approach is thus highly efficient and cost-effective for molecular evolution approaches and will find wide application in molecular evolution technologies, including mRNA display, phage display, and so on. © 2011 American Chemical Society

  2. Deletion patterns of the STS gene and flanking sequences in Israeli X-linked ichthyosis patients and carriers: analysis by polymerase chain reaction and fluorescence in situ hybridization techniques.

    PubMed

    Aviram-Goldring, A; Goldman, B; Netanelov-Shapira, I; Chen-Shtoyerman, R; Zvulunov, A; Tal, O; Ilan, T; Peleg, L

    2000-03-01

    Deletion of the entire steroid sulfatase (STS) gene is the most common molecular defect in X-linked ichthyosis (XLI) patients. Usually, additional flanking sequences are also missing. The aim of this study was to estimate the extent of deletions in an ethnically heterogeneous population of Israeli XLI patients. Multiplex polymerase chain reaction (PCR) and fluorescence in situ hybridization (FISH) techniques were applied in the analysis of blood samples of 24 patients and amniotic cells of seven affected fetuses from 22 unrelated families. In 19 families, a large deletion of the 2-3 megabase was found. It included the whole STS gene and spanned adjacent areas up- and downstream between the loci DXS 1139 and DXS 1132. Two unrelated families of Iraqi ancestry had a partial deletion of the gene and its centromeric adjacent sequence. In another family, the telomeric end of the extragenic segment was only partially missing. Application of FISH on metaphase blood cells and interphase amniotic cells confirmed the diagnosis of XLI in all patients, except the three with partial intragenic deletion. In those cases, the remaining fraction of the gene was sufficient to provide a false negative result. Diagnosis of carriers and prenatal diagnosis in uncultured cells was applicable only by FISH. Our study revealed a remarkable heterogeneity in the deletion pattern among Israeli patients with XLI. This heterogeneity could not be attributed to specific ethnic groups because of the small size of the study group. More studies involving patients of various ancestries should be carried out. In addition, this study demonstrated the usefulness of the FISH technique in the prenatal diagnosis of fetuses with suspected XLI.

  3. Analysis of a repetitive DNA sequence from Bordetella pertussis and its application to the diagnosis of pertussis using the polymerase chain reaction.

    PubMed Central

    Glare, E M; Paton, J C; Premier, R R; Lawrence, A J; Nisbet, I T

    1990-01-01

    A tandemly repeated 1,046-base-pair (bp) ClaI DNA fragment from Bordetella pertussis was cloned into Escherichia coli by using the vector pUC19. This fragment, when isolated, hybridized strongly to DNA from all 100 clinical isolates of B. pertussis tested. It was shown to have homology to single-copy sequences in Bordetella bronchiseptica but not Bordetella parapertussis and did not hybridize to lysate blots of a wide range of other bacteria, including members of the closely related genera Pasteurella, Alcaligenes, and Haemophilus. The 1,046-bp fragment was sequenced, and complementary synthetic oligonucleotides flanking a 153-bp region within the repeated element were used as primers for specific amplification of this region using the polymerase chain reaction (PCR). This procedure was then applied to the rapid (5-h) detection of B. pertussis in nasopharyngeal secretions collected from 332 children with suspected pertussis. The test yielded positive results in a total of 98 samples, compared with 66 for culture and 33 for direct immunofluorescence (IF). All of the IF-positive samples were PCR positive, as were 63 of the samples from which B. pertussis was eventually cultured. Two hundred thirty-one specimens which were negative by IF and culture were also negative in the PCR assay. However, 33 culture- and IF-negative specimens were positive by PCR assay. Several of these specimens were collected from close contacts of culture-proven pertussis patients, were follow-up specimens from such patients, or were from patients with serological evidence of pertussis and therefore may be true-rather than false-positives. Images PMID:2229381

  4. Real-time reverse transcription polymerase chain reaction method for detection of Canine distemper virus modified live vaccine shedding for differentiation from infection with wild-type strains.

    PubMed

    Wilkes, Rebecca P; Sanchez, Elena; Riley, Matthew C; Kennedy, Melissa A

    2014-01-01

    Canine distemper virus (CDV) remains a common cause of infectious disease in dogs, particularly in high-density housing situations such as shelters. Vaccination of all dogs against CDV is recommended at the time of admission to animal shelters and many use a modified live virus (MLV) vaccine. From a diagnostic standpoint for dogs with suspected CDV infection, this is problematic because highly sensitive diagnostic real-time reverse transcription polymerase chain reaction (RT-PCR) tests are able to detect MLV virus in clinical samples. Real-time PCR can be used to quantitate amount of virus shedding and can differentiate vaccine strains from wild-type strains when shedding is high. However, differentiation by quantitation is not possible in vaccinated animals during acute infection, when shedding is low and could be mistaken for low level vaccine virus shedding. While there are gel-based RT-PCR assays for differentiation of vaccine strains from field strains based on sequence differences, the sensitivity of these assays is unable to match that of the real-time RT-PCR assay currently used in the authors' laboratory. Therefore, a real-time RT-PCR assay was developed that detects CDV MLV vaccine strains and distinguishes them from wild-type strains based on nucleotide sequence differences, rather than the amount of viral RNA in the sample. The test is highly sensitive, with detection of as few as 5 virus genomic copies (corresponding to 10(-1) TCID(50)). Sequencing of the DNA real-time products also allows phylogenetic differentiation of the wild-type strains. This test will aid diagnosis during outbreaks of CDV in recently vaccinated animals.

  5. Three cases of mumps virus and enterovirus coinfection in children with enteroviral meningitis

    PubMed Central

    Rasti, Mojtaba; Makvandi, Manoochehr; Neisi, Niloofar; Azaran, Azarakhsh; Rastegarvand, Nasrin; Khalafkhany, Davod; Jahangirnezhad, Emad; Teimoori, Ali; Hadian, Maryam; Shabani, Abdolnabi; Shamsizadeh, Ahmad; Nikfar, Roya; Varnaseri, Mehran

    2016-01-01

    Abstract Several viruses are responsible for aseptic meningitis; however, in the region of Southwest Iran, the role played by each virus is still not very well known. The aim of this study is to determine the relative frequencies of mumps virus, herpes viruses, and enteroviruses, as well as coinfections among them, in patients with aseptic meningitis. In this cross-sectional study, samples of cerebrospinal fluid were collected between December 2012 and December 2013 from patients under 14 years, who were hospitalized in Abuzar Children's Hospital in Ahvaz, Southwest Iran (the only children's hospital in Khuzestan province and Southwest Iran). All 66 cerebrospinal fluid samples and corresponding clinical data were collected from patients with aseptic meningitis by specialists, and with the patients’ consent. The DNA and RNA were extracted from these samples and subjected to polymerase chain reaction as well as reverse transcription polymerase chain reaction (RT-PCR) for detection of mumps virus, herpes viruses, and enteroviruses. Nine of the samples (3 mumps-positive and 6 enterovirus-positive) were sequenced. The mumps virus sequences were investigated for possible mutations in the SH and partial HN regions. Up to 39 patients (59.09%) were found to be positive for enteroviruses, 3 (4.5%) for mumps virus, and 1 (1.5%) for herpes viruses (specifically, the varicella-zoster virus). Two patients (3.03%) had a mumps virus and enterovirus coinfection. Among the 3 detected mumps virus samples, 1 belonged to genotype B, while the others belonged to genotype N. Six sequenced enteroviruses indicated the highest similarity with Echovirus 30. An amino acid substitution at position 51 (N→T) was detected in the HN region of genotype N mumps virus samples, in comparison to the reference strain. PMID:27930588

  6. Three cases of mumps virus and enterovirus coinfection in children with enteroviral meningitis.

    PubMed

    Rasti, Mojtaba; Makvandi, Manoochehr; Neisi, Niloofar; Azaran, Azarakhsh; Rastegarvand, Nasrin; Khalafkhany, Davod; Jahangirnezhad, Emad; Teimoori, Ali; Hadian, Maryam; Shabani, Abdolnabi; Shamsizadeh, Ahmad; Nikfar, Roya; Varnaseri, Mehran

    2016-12-01

    Several viruses are responsible for aseptic meningitis; however, in the region of Southwest Iran, the role played by each virus is still not very well known. The aim of this study is to determine the relative frequencies of mumps virus, herpes viruses, and enteroviruses, as well as coinfections among them, in patients with aseptic meningitis.In this cross-sectional study, samples of cerebrospinal fluid were collected between December 2012 and December 2013 from patients under 14 years, who were hospitalized in Abuzar Children's Hospital in Ahvaz, Southwest Iran (the only children's hospital in Khuzestan province and Southwest Iran).All 66 cerebrospinal fluid samples and corresponding clinical data were collected from patients with aseptic meningitis by specialists, and with the patients' consent. The DNA and RNA were extracted from these samples and subjected to polymerase chain reaction as well as reverse transcription polymerase chain reaction (RT-PCR) for detection of mumps virus, herpes viruses, and enteroviruses. Nine of the samples (3 mumps-positive and 6 enterovirus-positive) were sequenced. The mumps virus sequences were investigated for possible mutations in the SH and partial HN regions.Up to 39 patients (59.09%) were found to be positive for enteroviruses, 3 (4.5%) for mumps virus, and 1 (1.5%) for herpes viruses (specifically, the varicella-zoster virus). Two patients (3.03%) had a mumps virus and enterovirus coinfection. Among the 3 detected mumps virus samples, 1 belonged to genotype B, while the others belonged to genotype N. Six sequenced enteroviruses indicated the highest similarity with Echovirus 30. An amino acid substitution at position 51 (N→T) was detected in the HN region of genotype N mumps virus samples, in comparison to the reference strain.

  7. Fatal Powassan Encephalitis (Deer Tick Virus, Lineage II) in a Patient With Fever and Orchitis Receiving Rituximab.

    PubMed

    Solomon, Isaac H; Spera, Kristyn M; Ryan, Sophia L; Helgager, Jeffrey; Andrici, Juliana; Zaki, Sherif R; Vaitkevicius, Henrikas; Leon, Kristoffer E; Wilson, Michael R; DeRisi, Joseph L; Koo, Sophia; Smirnakis, Stelios M; De Girolami, Umberto

    2018-06-01

    Powassan virus is a rare but increasingly recognized cause of severe neurological disease. To highlight the diagnostic challenges and neuropathological findings in a fatal case of Powassan encephalitis caused by deer tick virus (lineage II) in a patient with follicular lymphoma receiving rituximab, with nonspecific anti-GAD65 antibodies, who was initially seen with fever and orchiepididymitis. Comparison of clinical, radiological, histological, and laboratory findings, including immunohistochemistry, real-time polymerase chain reaction, antibody detection, and unbiased sequencing assays, in a single case report (first seen in December 2016) at an academic medical center. Infection with Powassan virus. Results of individual assays compared retrospectively. In a 63-year-old man with fatal Powassan encephalitis, serum and cerebrospinal fluid IgM antibodies were not detected via standard methods, likely because of rituximab exposure. Neuropathological findings were extensive, including diffuse leptomeningeal and parenchymal lymphohistiocytic infiltration, microglial proliferation, marked neuronal loss, and white matter microinfarctions most severely involving the cerebellum, thalamus, and basal ganglia. Diagnosis was made after death by 3 independent methods, including demonstration of Powassan virus antigen in brain biopsy and autopsy tissue, detection of viral RNA in serum and cerebrospinal fluid by targeted real-time polymerase chain reaction, and detection of viral RNA in cerebrospinal fluid by unbiased sequencing. Extensive testing for other etiologies yielded negative results, including mumps virus owing to prodromal orchiepididymitis. Low-titer anti-GAD65 antibodies identified in serum, suggestive of limbic encephalitis, were not detected in cerebrospinal fluid. Owing to the rarity of Powassan encephalitis, a high degree of suspicion is required to make the diagnosis, particularly in an immunocompromised patient, in whom antibody-based assays may be falsely negative. Unbiased sequencing assays have the potential to detect uncommon infectious agents and may prove useful in similar scenarios.

  8. Diazotrophic bacterioplankton in a coral reef lagoon: phylogeny, diel nitrogenase expression and response to phosphate enrichment.

    PubMed

    Hewson, Ian; Moisander, Pia H; Morrison, Amanda E; Zehr, Jonathan P

    2007-05-01

    We investigated diazotrophic bacterioplankton assemblage composition in the Heron Reef lagoon (Great Barrier Reef, Australia) using culture-independent techniques targeting the nifH fragment of the nitrogenase gene. Seawater was collected at 3 h intervals over a period of 72 h (i.e. over diel as well as tidal cycles). An incubation experiment was also conducted to assess the impact of phosphate (PO(4)3*) availability on nifH expression patterns. DNA-based nifH libraries contained primarily sequences that were most similar to nifH from sediment, microbial mat and surface-associated microorganisms, with a few sequences that clustered with typical open ocean phylotypes. In contrast to genomic DNA sequences, libraries prepared from gene transcripts (mRNA amplified by reverse transcription-polymerase chain reaction) were entirely cyanobacterial and contained phylotypes similar to those observed in open ocean plankton. The abundance of Trichodesmium and two uncultured cyanobacterial phylotypes from previous studies (group A and group B) were studied by quantitative-polymerase chain reaction in the lagoon samples. These were detected as transcripts, but were not detected in genomic DNA. The gene transcript abundance of these phylotypes demonstrated variability over several diel cycles. The PO(4)3* enrichment experiment had a clearer pattern of gene expression over diel cycles than the lagoon sampling, however PO(4)3* additions did not result in enhanced transcript abundance relative to control incubations. The results suggest that a number of diazotrophs in bacterioplankton of the reef lagoon may originate from sediment, coral or beachrock surfaces, sloughing into plankton with the flooding tide. The presence of typical open ocean phylotype transcripts in lagoon bacterioplankton may indicate that they are an important component of the N cycle of the coral reef.

  9. Disseminated histoplasmosis in a domestic cat imported from the USA to Austria

    PubMed Central

    Klang, Andrea; Loncaric, Igor; Spergser, Joachim; Eigelsreiter, Sabine; Weissenböck, Herbert

    2013-01-01

    We present a case of disseminated histoplasmosis in a domestic cat imported from the USA to Austria. Histopathological examination revealed a systemic mycosis with most severe involvement of the lungs suggestive of Histoplasma (H.) capsulatum-infection. Molecular confirmation was based on polymerase chain reaction (PCR) and sequence analysis of a fungal culture from liver samples. This is the first case of feline histoplasmosis proven by molecular diagnostic technique in Europe and reported in Austria, etc. PMID:24432230

  10. Trypanosoma lewisi or T. lewisi-like infection in a 37-day-old Indian infant.

    PubMed

    Verma, Archana; Manchanda, Samiksha; Kumar, Nirmal; Sharma, Archna; Goel, Masha; Banerjee, Partha Sarathi; Garg, Rajat; Singh, Brahma Pal; Balharbi, Fatima; Lejon, Veerle; Deborggraeve, Stijn; Singh Rana, Udai Veer; Puliyel, Jacob

    2011-08-01

    Trypanosomes were observed in the peripheral blood smear of a 37-day-old Indian infant admitted off feeds, with fever and convulsions. Trypanosoma (Herpetosoma) lewisi was identified in the blood. The species identification was confirmed by morphometry, polymerase chain reaction, and sequencing. Human infection with this organism is rare. Only seven cases of this infection have been reported previously in humans. The cases reported are reviewed to develop a composite picture of this disease.

  11. Trypanosoma lewisi or T. lewisi-like Infection in a 37-Day-Old Indian Infant

    PubMed Central

    Verma, Archana; Manchanda, Samiksha; Kumar, Nirmal; Sharma, Archna; Goel, Masha; Banerjee, Partha Sarathi; Garg, Rajat; Singh, Brahma Pal; Balharbi, Fatima; Lejon, Veerle; Deborggraeve, Stijn; Singh Rana, Udai Veer; Puliyel, Jacob

    2011-01-01

    Trypanosomes were observed in the peripheral blood smear of a 37-day-old Indian infant admitted off feeds, with fever and convulsions. Trypanosoma (Herpetosoma) lewisi was identified in the blood. The species identification was confirmed by morphometry, polymerase chain reaction, and sequencing. Human infection with this organism is rare. Only seven cases of this infection have been reported previously in humans. The cases reported are reviewed to develop a composite picture of this disease. PMID:21813838

  12. Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

    DTIC Science & Technology

    2007-05-08

    deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

  13. Cutaneous chancroid in a visitor from Vanuatu.

    PubMed

    McBride, William J H; Hannah, Rory C S; Le Cornec, Genevera M; Bletchly, Cheryl

    2008-05-01

    A 23-year-old woman from Vanuatu presented to an Australian hospital with a 3-week history of a non-healing ulcer on the lower leg. A swab was submitted for a multiplex polymerase chain reaction designed to investigate genital ulcerative conditions. Haemophilus ducreyi was detected and the gene product was subsequently sequenced, confirming the diagnosis of cutaneous chancroid. The lesion responded to intramuscular benzathine penicillin. This report adds further evidence that cutaneous chancroid should be considered in the evaluation of skin ulcers in the south Pacific.

  14. Distemper Outbreak and Its Effect on African Wild Dog Conservation

    PubMed Central

    van de Bildt, Marco W.G.; Kuiken, Thijs; Visee, Aart M.; Lema, Sangito; Fitzjohn, Tony R.

    2002-01-01

    In December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV) by means of histologic examination, virus isolation, reverse transcriptase-polymerase chain reaction analysis, and nucleotide sequencing. This report emphasizes the importance of adequate protection against infectious diseases for the successful outcome of captive breeding programs of endangered species. PMID:11897078

  15. DNA methods for identification of Chinese medicinal materials

    PubMed Central

    Yip, Pui Ying; Chau, Chi Fai; Mak, Chun Yin; Kwan, Hoi Shan

    2007-01-01

    As adulterated and substituted Chinese medicinal materials are common in the market, therapeutic effectiveness of such materials cannot be guaranteed. Identification at species-, strain- and locality-levels, therefore, is required for quality assurance/control of Chinese medicine. This review provides an informative introduction to DNA methods for authentication of Chinese medicinal materials. Technical features and examples of the methods based on sequencing, hybridization and polymerase chain reaction (PCR) are described and their suitability for different identification objectives is discussed. PMID:17803808

  16. Columbid herpesvirus-1 mortality in great horned owls (Bubo virginianus) from Calgary, Alberta

    PubMed Central

    Rose, Nicole; Warren, Amy L.; Whiteside, Douglas; Bidulka, Julie; Robinson, John H.; Illanes, Oscar; Brookfield, Caroline

    2012-01-01

    Four cases of Columbid herpesvirus-1 infection in great horned owls (Bubo virginianus) were identified in Calgary, Alberta. Necropsy findings included severe multifocal hepatic and splenic necrosis, pharyngeal ulceration and necrosis, and gastrointestinal necrosis. Occasional eosinophilic intranuclear viral inclusion bodies were associated with the foci of necrosis and polymerase chain reaction (PCR) testing confirmed a diagnosis of herpesvirus-induced disease. The sequence of a PCR amplicon had 99.7% homology to Columbid herpesvirus-1. PMID:22942441

  17. Standard Free Droplet Digital Polymerase Chain Reaction as a New Tool for the Quality Control of High-Capacity Adenoviral Vectors in Small-Scale Preparations

    PubMed Central

    Boehme, Philip; Stellberger, Thorsten; Solanki, Manish; Zhang, Wenli; Schulz, Eric; Bergmann, Thorsten; Liu, Jing; Doerner, Johannes; Baiker, Armin E.

    2015-01-01

    Abstract High-capacity adenoviral vectors (HCAdVs) are promising tools for gene therapy as well as for genetic engineering. However, one limitation of the HCAdV vector system is the complex, time-consuming, and labor-intensive production process and the following quality control procedure. Since HCAdVs are deleted for all viral coding sequences, a helper virus (HV) is needed in the production process to provide the sequences for all viral proteins in trans. For the purification procedure of HCAdV, cesium chloride density gradient centrifugation is usually performed followed by buffer exchange using dialysis or comparable methods. However, performing these steps is technically difficult, potentially error-prone, and not scalable. Here, we establish a new protocol for small-scale production of HCAdV based on commercially available adenovirus purification systems and a standard method for the quality control of final HCAdV preparations. For titration of final vector preparations, we established a droplet digital polymerase chain reaction (ddPCR) that uses a standard free-end-point PCR in small droplets of defined volume. By using different probes, this method is capable of detecting and quantifying HCAdV and HV in one reaction independent of reference material, rendering this method attractive for accurately comparing viral titers between different laboratories. In summary, we demonstrate that it is possible to produce HCAdV in a small scale of sufficient quality and quantity to perform experiments in cell culture, and we established a reliable protocol for vector titration based on ddPCR. Our method significantly reduces time and required equipment to perform HCAdV production. In the future the ddPCR technology could be advantageous for titration of other viral vectors commonly used in gene therapy. PMID:25640117

  18. Identification and validation of biomarkers of IgV(H) mutation status in chronic lymphocytic leukemia using microfluidics quantitative real-time polymerase chain reaction technology.

    PubMed

    Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R

    2007-09-01

    To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.

  19. Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

    PubMed Central

    Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

    1986-01-01

    Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

  20. Assessment of Epstein-Barr virus nucleic acids in gastric but not in breast cancer by next-generation sequencing of pooled Mexican samples

    PubMed Central

    Fuentes-Pananá, Ezequiel M; Larios-Serrato, Violeta; Méndez-Tenorio, Alfonso; Morales-Sánchez, Abigail; Arias, Carlos F; Torres, Javier

    2016-01-01

    Gastric (GC) and breast (BrC) cancer are two of the most common and deadly tumours. Different lines of evidence suggest a possible causative role of viral infections for both GC and BrC. Wide genome sequencing (WGS) technologies allow searching for viral agents in tissues of patients with cancer. These technologies have already contributed to establish virus-cancer associations as well as to discovery new tumour viruses. The objective of this study was to document possible associations of viral infection with GC and BrC in Mexican patients. In order to gain idea about cost effective conditions of experimental sequencing, we first carried out an in silico simulation of WGS. The next-generation-platform IlluminaGallx was then used to sequence GC and BrC tumour samples. While we did not find viral sequences in tissues from BrC patients, multiple reads matching Epstein-Barr virus (EBV) sequences were found in GC tissues. An end-point polymerase chain reaction confirmed an enrichment of EBV sequences in one of the GC samples sequenced, validating the next-generation sequencing-bioinformatics pipeline. PMID:26910355

  1. Assessment of Epstein-Barr virus nucleic acids in gastric but not in breast cancer by next-generation sequencing of pooled Mexican samples.

    PubMed

    Fuentes-Pananá, Ezequiel M; Larios-Serrato, Violeta; Méndez-Tenorio, Alfonso; Morales-Sánchez, Abigail; Arias, Carlos F; Torres, Javier

    2016-03-01

    Gastric (GC) and breast (BrC) cancer are two of the most common and deadly tumours. Different lines of evidence suggest a possible causative role of viral infections for both GC and BrC. Wide genome sequencing (WGS) technologies allow searching for viral agents in tissues of patients with cancer. These technologies have already contributed to establish virus-cancer associations as well as to discovery new tumour viruses. The objective of this study was to document possible associations of viral infection with GC and BrC in Mexican patients. In order to gain idea about cost effective conditions of experimental sequencing, we first carried out an in silico simulation of WGS. The next-generation-platform IlluminaGallx was then used to sequence GC and BrC tumour samples. While we did not find viral sequences in tissues from BrC patients, multiple reads matching Epstein-Barr virus (EBV) sequences were found in GC tissues. An end-point polymerase chain reaction confirmed an enrichment of EBV sequences in one of the GC samples sequenced, validating the next-generation sequencing-bioinformatics pipeline.

  2. Drivers of the dynamics of diazotrophs and denitrifiers in North Sea bottom waters and sediments

    PubMed Central

    Fan, Haoxin; Bolhuis, Henk; Stal, Lucas J.

    2015-01-01

    The fixation of dinitrogen (N2) and denitrification are two opposite processes in the nitrogen cycle. The former transfers atmospheric dinitrogen gas into bound nitrogen in the biosphere, while the latter returns this bound nitrogen back to atmospheric dinitrogen. It is unclear whether or not these processes are intimately connected in any microbial ecosystem or that they are spatially and/or temporally separated. Here, we measured seafloor nitrogen fixation and denitrification as well as pelagic nitrogen fixation by using the stable isotope technique. Alongside, we measured the diversity, abundance, and activity of nitrogen-fixing and denitrifying microorganisms at three stations in the southern North Sea. Nitrogen fixation ranged from undetectable to 2.4 nmol N L−1 d−1 and from undetectable to 8.2 nmol N g−1 d−1 in the water column and seafloor, respectively. The highest rates were measured in August at Doggersbank, both for the water column and for the seafloor. Denitrification ranged from 1.7 to 208.8 μmol m−2 d−1 and the highest rates were measured in May at the Oyster Grounds. DNA sequence analysis showed sequences of nifH, a structural gene for nitrogenase, related to sequences from anaerobic sulfur/iron reducers and sulfate reducers. Sequences of the structural gene for nitrite reductase, nirS, were related to environmental clones from marine sediments. Quantitative polymerase chain reaction (qPCR) data revealed the highest abundance of nifH and nirS genes at the Oyster Grounds. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) data revealed the highest nifH expression at Doggersbank and the highest nirS expression at the Oyster Grounds. The distribution of the diazotrophic and denitrifying communities seems to be subject to different selecting factors, leading to spatial and temporal separation of nitrogen fixation and denitrification. These selecting factors include temperature, organic matter availability, and oxygen concentration. PMID:26257718

  3. Cloning and pharmacological characterization of the rabbit bradykinin B2 receptor.

    PubMed

    Bachvarov, D R; Saint-Jacques, E; Larrivée, J F; Levesque, L; Rioux, F; Drapeau, G; Marceau, F

    1995-12-01

    Degenerate primers, corresponding to consensus sequences of third and sixth transmembrane domains of G protein-coupled receptor superfamily, were used for the polymerase chain reaction amplification and consecutive characterization of G protein-coupled receptors present in cultured rabbit aortic smooth muscle cells. One of the isolated resulting fragments was highly homologous to the corresponding region of the bradykinin (BK) B2 receptor cloned in other species. The polymerase chain reaction fragment was used to screen a rabbit genomic library, which allowed the identification of an intronless 1101-nucleotide open reading frame which codes for a 367-amino acid receptor protein. The rabbit B2 receptor sequence is more than 80% identical to the ones determined in three other species and retain putative glycosylation, palmitoylation and phosphorylation sites. In the rabbit genomic sequence, an acceptor splice sequence was found 8 base pairs upstream of the start codon. Northern blot analysis showed a high expression of a major transcript (4.2 kilobases) in the rabbit kidney and duodenum, and a less abundant expression in other tissues. Southern blot experiments suggest that a single copy of this gene exists in the rabbit genome. The cloned rabbit B2 receptor expressed in COS-1 cells binds [3H]BK in a saturable manner (KD 2.1 nM) and this ligand competes with a series of kinin agonists and antagonist with a rank order consistent with the B2 receptor identity. The insurmountable character of the antagonism exerted by Hoe 140 against BK on the rabbit B2 receptor, previously shown in pharmacological experiments, was confirmed in binding experiments with the cloned receptor expressed in a controlled manner. By contrast, Hoe 140 competed with [3H]BK in a surmountable manner for the human B2 receptor expressed in COS-1 cells. The cloning of the rabbit B2 receptor will be useful notably for the study of the structural basis of antagonist binding and for studies on receptor regulation in a relatively large animal.

  4. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

    PubMed

    Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

    2015-01-01

    Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

  5. Diversity of phytases in the rumen.

    PubMed

    Nakashima, Brenda A; McAllister, Tim A; Sharma, Ranjana; Selinger, L Brent

    2007-01-01

    Examples of a new class of phytase related to protein tyrosine phosphatases (PTP) were recently isolated from several anaerobic bacteria from the rumen of cattle. In this study, the diversity of PTP-like phytase gene sequences in the rumen was surveyed by using the polymerase chain reaction (PCR). Two sets of degenerate primers were used to amplify sequences from rumen fluid total community DNA and genomic DNA from nine bacterial isolates. Four novel PTP-like phytase sequences were retrieved from rumen fluid, whereas all nine of the anaerobic bacterial isolates investigated in this work contained PTP-like phytase sequences. One isolate, Selenomonas lacticifex, contained two distinct PTP-like phytase sequences, suggesting that multiple phytate hydrolyzing enzymes are present in this bacterium. The degenerate primer and PCR conditions described here, as well as novel sequences obtained in this study, will provide a valuable resource for future studies on this new class of phytase. The observed diversity of microbial phytases in the rumen may account for the ability of ruminants to derive a significant proportion of their phosphorus requirements from phytate.

  6. Detection of Plasmodium sp. in capybara.

    PubMed

    dos Santos, Leonilda Correia; Curotto, Sandra Mara Rotter; de Moraes, Wanderlei; Cubas, Zalmir Silvino; Costa-Nascimento, Maria de Jesus; de Barros Filho, Ivan Roque; Biondo, Alexander Welker; Kirchgatter, Karin

    2009-07-07

    In the present study, we have microscopically and molecularly surveyed blood samples from 11 captive capybaras (Hydrochaeris hydrochaeris) from the Sanctuary Zoo for Plasmodium sp. infection. One animal presented positive on blood smear by light microscopy. Polymerase chain reaction was carried out accordingly using a nested genus-specific protocol, which uses oligonucleotides from conserved sequences flanking a variable sequence region in the small subunit ribosomal RNA (ssrRNA) of all Plasmodium organisms. This revealed three positive animals. Products from two samples were purified and sequenced. The results showed less than 1% divergence between the two capybara sequences. When compared with GenBank sequences, a 55% similarity was obtained to Toxoplasma gondii and a higher similarity (73-77.2%) was found to ssrRNAs from Plasmodium species that infect reptile, avian, rodents, and human beings. The most similar Plasmodium sequence was from Plasmodium mexicanum that infects lizards of North America, where around 78% identity was found. This work is the first report of Plasmodium in capybaras, and due to the low similarity with other Plasmodium species, we suggest it is a new species, which, in the future could be denominated "Plasmodium hydrochaeri".

  7. Identification of Y-Chromosome Sequences in Turner Syndrome.

    PubMed

    Silva-Grecco, Roseane Lopes da; Trovó-Marqui, Alessandra Bernadete; Sousa, Tiago Alves de; Croce, Lilian Da; Balarin, Marly Aparecida Spadotto

    2016-05-01

    To investigate the presence of Y-chromosome sequences and determine their frequency in patients with Turner syndrome. The study included 23 patients with Turner syndrome from Brazil, who gave written informed consent for participating in the study. Cytogenetic analyses were performed in peripheral blood lymphocytes, with 100 metaphases per patient. Genomic DNA was also extracted from peripheral blood lymphocytes, and gene sequences DYZ1, DYZ3, ZFY and SRY were amplified by Polymerase Chain Reaction. The cytogenetic analysis showed a 45,X karyotype in 9 patients (39.2 %) and a mosaic pattern in 14 (60.8 %). In 8.7 % (2 out of 23) of the patients, Y-chromosome sequences were found. This prevalence is very similar to those reported previously. The initial karyotype analysis of these patients did not reveal Y-chromosome material, but they were found positive for Y-specific sequences in the lymphocyte DNA analysis. The PCR technique showed that 2 (8.7 %) of the patients with Turner syndrome had Y-chromosome sequences, both presenting marker chromosomes on cytogenetic analysis.

  8. Label-Free Fluorescent DNA Dendrimers for microRNA Detection Based On Nonlinear Hybridization Chain Reaction-Mediated Multiple G-Quadruplex with Low Background Signal.

    PubMed

    Xue, Qingwang; Liu, Chunxue; Li, Xia; Dai, Li; Wang, Huaisheng

    2018-04-18

    Various fluorescent sensing systems for miRNA detection have been developed, but they mostly contain enzymatic amplification reactions and label procedures. The strict reaction conditions of tool enzymes and the high cost of labeling limit their potential applications, especially in complex biological matrices. Here, we have addressed the difficult problems and report a strategy for label-free fluorescent DNA dendrimers based on enzyme-free nonlinear hybridization chain reaction (HCR)-mediated multiple G-quadruplex for simple, sensitive, and selective detection of miRNAs with low-background signal. In the strategy, a split G-quadruplex (3:1) sequence is ingeniously designed at both ends of two double-stranded DNAs, which is exploited as building blocks for nonlinear HCR assembly, thereby acquiring a low background signal. A hairpin switch probe (HSP) was employed as recognition and transduction element. Upon sensing the target miRNA, the nonlinear HCR assembly of two blocks (blocks-A and blocks-B) was initiated with the help of two single-stranded DNA assistants, resulting in chain-branching growth of DNA dendrimers with multiple G-quadruplex incorporation. With the zinc(II)-protoporphyrin IX (ZnPPIX) selectively intercalated into the multiple G-quadruplexes, fluorescent DNA dendrimers were obtained, leading to an exponential fluorescence intensity increase. Benefiting from excellent performances of nonlinear HCR and low background signal, this strategy possesses the characteristics of a simplified reaction operation process, as well as high sensitivity. Moreover, the proposed fluorescent sensing strategy also shows preferable selectivity, and can be implemented without modified DNA blocks. Importantly, the strategy has also been tested for miRNA quantification with high confidence in breast cancer cells. Thus, this proposed strategy for label-free fluorescent DNA dendrimers based on a nonlinear HCR-mediated multiple G-quadruplex will be turned into an alternative approach for simple, sensitive, and selective miRNA quantification.

  9. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  10. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  11. Closed Circular Chains

    ERIC Educational Resources Information Center

    Caglayan, Günhan

    2016-01-01

    A Steiner chain is defined as the sequence of n circles that are all tangent to two given non-intersecting circles. A closed chain, in particular, is one in which every circle in the sequence is tangent to the previous and next circles of the chain. In a closed Steiner chain the first and the "n"th circles of the chain are also tangent…

  12. A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

    PubMed

    Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

    2016-12-01

    To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

  13. Cloning, expression, and characterization of a novel (S)-specific alcohol dehydrogenase from Lactobacillus kefir.

    PubMed

    Chen, Qilei; Hu, Youjia; Zhao, Wenjie; Zhu, Chunbao; Zhu, Baoquan

    2010-01-01

    A gene encoding a novel (S)-specific NADH-dependent alcohol dehydrogenase (LK-ADH) was isolated from the genomic DNA of Lactobacillus kefir DSM 20587 by thermal asymmetric interlaced-polymerase chain reaction. The nucleotide sequence of (S)-LK-ADH gene (adhS) was determined, which consists of an open reading frame of 1,044 bp, coding for 347 amino acids with a molecular mass of 37.065 kDa. After a BLAST similarity search in GenBank database, the amino acid sequence of (S)-LK-ADH showed some homologies to several zinc containing medium-chain alcohol dehydrogenases. This novel gene was deposited into GenBank with the accession number of EU877965. adhS gene was subcloned into plasmid pET-28a(+), and recombinant (S)-LK-ADH was successfully expressed in E. coli BL21(DE3) by isopropyl-beta-D-1-thiogalactopyranoside induction. Purified enzyme showed a high enantioselectivity in the reduction of acetophenone to (S)-phenylethanol with an ee value of 99.4%. The substrate specificity and cofactor preference of recombinant (S)-LK-ADH were also tested.

  14. Effects of side chains in helix nucleation differ from helix propagation

    PubMed Central

    Miller, Stephen E.; Watkins, Andrew M.; Kallenbach, Neville R.; Arora, Paramjit S.

    2014-01-01

    Helix–coil transition theory connects observable properties of the α-helix to an ensemble of microstates and provides a foundation for analyzing secondary structure formation in proteins. Classical models account for cooperative helix formation in terms of an energetically demanding nucleation event (described by the σ constant) followed by a more facile propagation reaction, with corresponding s constants that are sequence dependent. Extensive studies of folding and unfolding in model peptides have led to the determination of the propagation constants for amino acids. However, the role of individual side chains in helix nucleation has not been separately accessible, so the σ constant is treated as independent of sequence. We describe here a synthetic model that allows the assessment of the role of individual amino acids in helix nucleation. Studies with this model lead to the surprising conclusion that widely accepted scales of helical propensity are not predictive of helix nucleation. Residues known to be helix stabilizers or breakers in propagation have only a tenuous relationship to residues that favor or disfavor helix nucleation. PMID:24753597

  15. Generation and reactivation of T-cell receptor A joining region pseudogenes in primates

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thiel, C.; Lanchbury, J.S.; Otting, N.

    1996-06-01

    Tandemly duplicated T-cell receptor (Tcr) AJ (J{alpha}) segments contribute significantly to TCRA chain junctional region diversity in mammals. Since only limited data exists on TCRA diversity in nonhuman primates, we examined the TCRAJ regions of 37 chimpanzee and 71 rhesus macaque TCRA cDNA clones derived from inverse polymerase chain reaction on peripheral blood mononuclear cell cDNA of healthy animals. Twenty-five different TCRAJ regions were characterized in the chimpanzee and 36 in the rhesus macaque. Each bears a close structural relationship to an equivalent human TCRAJ region. Conserved amino acid motifs are shared between all three species. There are indications thatmore » differences between nonhuman primates and humans exist in the generation of TCRAJ pseudogenes. The nucleotide and amino acid sequences of the various characterized TCRAJ of each species are reported and we compare our results to the available information on human genomic sequences. Although we provide evidence of dynamic processes modifying TCRAJ segments during primate evolution, their repertoire and primary structure appears to be relatively conserved. 21 refs., 2 figs.« less

  16. Market surveillance on non-halal additives incorporated in surimi based products using polymerase chain reaction (PCR)-southern hybridization analysis

    NASA Astrophysics Data System (ADS)

    Aravindran, S.; Sahilah, A. M.; Aminah, A.

    2014-09-01

    Halal surveillance on halal ingredients incorporated in surimi based products were studied using polymerase chain reaction (PCR)-southern hybridization on chip analysis. The primers used in this technique were targeted on mitochondria DNA (mtDNA) of cytochrome b (cyt b) gene sequence which able to differentiate 7 type (beef, chicken, duck, goat, buffalo, lamb and pork) of species on a single chip. 17 (n = 17*3) different brands of surimi-based product were purchased randomly from Selangor local market in January 2013. Of 17 brands, 3 (n = 3*3) brands were positive for chicken DNA, 1 (n = 1*3) brand was positive for goat DNA, and the remainder 13 brands (n = 13*3) have no DNA species detected. The sensitivity of PCR-southern hybridization primers to detect each meat species was 0.1 ng. In the present study, it is evidence that PCR-Southern Hybridization analysis offered a reliable result due to its highly specific and sensitive properties in detecting non-halal additive such as plasma protein incorporation in surimi-based product.

  17. Susceptibility Testing by Polymerase Chain Reaction DNA Quantitation: A Method to Measure Drug Resistance of Human Immunodeficiency Virus Type 1 Isolates

    NASA Astrophysics Data System (ADS)

    Eron, Joseph J.; Gorczyca, Paul; Kaplan, Joan C.; D'Aquila, Richard T.

    1992-04-01

    Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing rapidly and directly measures nucleoside sensitivity of human immunodeficiency virus type 1 (HIV-1) isolates. PCR is used to quantitate the amount of HIV-1 DNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of HIV-1 DNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. The results of PDQ susceptibility testing of 2- or 3-day cultures are supported by assays measuring HIV-1 p24 antigen production in supernatants of 7- or 10-day cultures. DNA sequence analyses to identify mutations in the reverse transcriptase gene that cause resistance to 3'-azido-3'-deoxythymidine also support the PDQ results. With the PDQ method, both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells. PDQ susceptibility testing should facilitate epidemiologic studies of the clinical significance of drug-resistant HIV-1 isolates.

  18. Identification of Echinococcus granulosus strains using polymerase chain reaction-restriction fragment length polymorphism amongst livestock in Moroto district, Uganda.

    PubMed

    Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah

    2016-07-29

    A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.

  19. Detection and Identification of Psilocybe cubensis DNA Using a Real-Time Polymerase Chain Reaction High Resolution Melt Assay.

    PubMed

    Cowan, Ashley F; Elkins, Kelly M

    2017-12-01

    Psilocybe cubensis, or "magic mushroom," is the most common species of fungus with psychedelic characteristics. Two primer sets were designed to target Psilocybe DNA using web-based software and NBCI gene sequences. DNA was extracted from eighteen samples, including twelve mushroom species, using the Qiagen DNeasy ® Plant Mini Kit. The DNA was amplified by the polymerase chain reaction (PCR) using the primers and a master mix containing either a SYBR ® Green I, Radiant™ Green, or LCGreen Plus ® intercalating dye; amplicon size was determined using agarose gel electrophoresis. The PCR assays were tested for amplifiability, specificity, reproducibility, robustness, sensitivity, and multiplexing with primers that target marijuana. The observed high resolution melt (HRM) temperatures for primer sets 1 and 7 were 78.85 ± 0.31°C and 73.22 ± 0.61°C, respectively, using SYBR ® Green I dye and 81.67 ± 0.06°C and 76.04 ± 0.11°C, respectively, using Radiant™ Green dye. © 2017 American Academy of Forensic Sciences.

  20. [Association of muscle segment homeobox gene 1 polymorphisms with nonsyndromic cleft lip with or without cleft palate].

    PubMed

    Zhang, Li; Tang, Jun-Ling; Liang, Shang-Zheng

    2008-06-01

    Muscle segment homeobox gene (MSX)1 has been proposed as a gene in which mutations may contribute to nonsyndromic cleft lip with or without cleft palate (NSCL/P). To study MSX1 polymorphisms in NSCL/ P by means of polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP), and investigate the association of MSX1 exons 1 polymorphisms with NSCL/P. DNA were extracted from blood samples from NSCL/P and unrelated normal subjects. Genome DNA from peripheral leukocyte with these blood samples were extracted, which was used as template to amplify desired gene fragment of MSX1 exons 1 by means of polymerase chain reaction (PCR). The PCR products were examined by single-strand conformation polymorphism (SSCP). The MSX1 exons 1 polymorphisms were examined by sequencing if mutations were found. MSX1 genes of exon 1 mutation was not been found in the NSCL/P and unrelated normal subjects by SSCP. No correlation between MSX1 exon 1 and NSCL/P was found. MSX1 exon 1 may not be a key gene (susceptibility gene) in NSCL/P.

  1. Quantitative competitive (QC) PCR for quantification of porcine DNA.

    PubMed

    Wolf, C; Lüthy, J

    2001-02-01

    Many meat products nowadays may contain several species in different proportions. To protect consumers from fraud and misdeclarations, not only a qualitative but also a quantitative monitoring of ingredients of complex food products is necessary. DNA based techniques like the polymerase chain reaction (PCR) are widely used for identification of species but no answer to the proportional amount of a certain species could be given using current techniques. In this study we report the development and evaluation of a quantitative competitive polymerase chain reaction (QC-PCR) for detection and quantification of porcine DNA using a new porcine specific PCR system based on the growth hormone gene of sus scrofa. A DNA competitor differing by 30 bp in length from the porcine target sequence was constructed and used for PCR together with the target DNA. Specificity of the new primers was evaluated with DNA from cattle, sheep, chicken and turkey. The competitor concentration was adjusted to porcine DNA contents of 2 or 20% by coamplification of mixtures containing porcine and corresponding amounts of bovine DNA in defined ratios.

  2. A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

    PubMed

    Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

    2011-06-01

    The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

  3. Press Releases | Argonne National Laboratory

    Science.gov Websites

    Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

  4. Human papillomavirus type 2 associated with pyogenic granuloma in patients without clinical evidence of warts.

    PubMed

    Vázquez-Martínez, Osvaldo T; González-Betancourt, Anajulia; Barboza-Cerda, María Carmen; González-González, Sergio E; Lugo-Trampe, Ángel; Welsh, Oliverio; Rojas-Martínez, Augusto; Martínez-Rodríguez, Herminia G; Ocampo-Candiani, Jorge; Ortiz-López, Rocío

    2016-07-01

    Pyogenic granuloma is a non-neoplastic lesion that frequently occurs in the skin and mucous membranes of children and pregnant women. The anatomical sites of pyogenic granulomas overlap with those of wart infections caused by the human papillomavirus (HPV). This study assessed the presence of HPV DNA in pyogenic granuloma samples by polymerase chain reaction. Eighteen pyogenic granuloma biopsies from patients without a clinical history or evidence of verruca in the studied area were tested for the presence of the HPV genome. The presence of HPV DNA was screened by three independent polymerase chain reaction reactions using standard consensus primer sets targeted to the L1 or E1 consensus regions of HPV genome. The HPV DNA-positive samples were genotyped using methodologies enabling the identification of up to 30 HPVs, including oncogenic, nononcogenic, and cutaneous viral types. The HPV DNA was detected in 44.4% (eight of 18) of the samples, with HPV-2 being the only type in the eight HPV DNA-positive samples. Contamination with HPV-2 sequences throughout the entire process was reliably eliminated. This report is the first to suggest an association between HPV-2 and pyogenic granuloma. This relationship is similar to that observed between HPV-2 and nongenital warts. © 2015 The International Society of Dermatology.

  5. Identification of human antibody fragment clones specific for tetanus toxoid in a bacteriophage. lambda. immunoexpression library

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mullinax, R.L.; Gross, E.A.; Amberg, J.R.

    1990-10-01

    The authors have applied a molecular biology approach to the identification of human monoclonal antibodies. Human peripheral blood lymphocyte mRNA was converted to cDNA and a select subset was amplified by the polymerase chain reaction. These products, containing coding sequences for numerous immunoglobulin heavy- and {kappa} light-chain variable and constant region domains, were inserted into modified bacteriophase {lambda} expression vectors and introduced into Escherichia coli by infection to yield a combinatorial immunoexpression library. Clones with binding activity to tetanus toxoid were identified by filter hybridization with radiolabeled antigen and appeared at a frequency of 0.2{percent} in the library. These humanmore » antigen binding fragments, consisting of a heavy-chain fragment covalently linked to a light chain, displayed high affinity of binding to tetanus toxoid with equilibrium constants in the nanomolar range but did not cross-react with other proteins tested. They estimate that this human immunoexpression library contains 20,000 clones with high affinity and specificity to our chosen antigen.« less

  6. Evolution of the biosynthesis of the branched-chain amino acids

    NASA Technical Reports Server (NTRS)

    Keefe, Anthony D.; Lazcano, Antonio; Miller, Stanley L.

    1995-01-01

    The origins of the biosynthetic pathways for the branched-chain amino acids cannot be understood in terms of the backwards development of the present acetolactate pathway because it contains unstable intermediates. We propose that the first biosynthesis of the branched-chain amino acids was by the reductive carboxylation of short branched chain fatty acids giving keto acids which were then transaminated. Similar reaction sequences mediated by nonspecific enzymes would produce serine and threomine from the abundant prebiotic compounds glycolic and lactic acids. The aromatic amino acids may also have first been synthesized in this way, e.g. tryptophan from indole acetic acid. The next step would have been the biosynthesis of leucine from alpha-ketoisovalerc acid. The acetolactate pathway developed subsequently. The first version of the Krebs cycle, which was used for amino acid biosynthesis, would have been assembled by making use fo the reductive carboxylation and leucine biosynthesis enzymes, and completed with the development of a single new enzyme, succinate dehydrogenase. This evolutionary scheme suggests that there may be limitations to inferring the origins of metabolism by a simple back extrapolation of current pathways.

  7. Development of an ELA-DRA gene typing method based on pyrosequencing technology.

    PubMed

    Díaz, S; Echeverría, M G; It, V; Posik, D M; Rogberg-Muñoz, A; Pena, N L; Peral-García, P; Vega-Pla, J L; Giovambattista, G

    2008-11-01

    The polymorphism of equine lymphocyte antigen (ELA) class II DRA gene had been detected by polymerase chain reaction-single-strand conformational polymorphism (PCR-SSCP) and reference strand-mediated conformation analysis. These methodologies allowed to identify 11 ELA-DRA exon 2 sequences, three of which are widely distributed among domestic horse breeds. Herein, we describe the development of a pyrosequencing-based method applicable to ELA-DRA typing, by screening samples from eight different horse breeds previously typed by PCR-SSCP. This sequence-based method would be useful in high-throughput genotyping of major histocompatibility complex genes in horses and other animal species, making this system interesting as a rapid screening method for animal genotyping of immune-related genes.

  8. Mapping genes to human chromosome 19

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Connolly, Sarah

    1996-05-01

    For this project, 22 Expressed Sequence Tags (ESTs) were fine mapped to regions of human chromosome 19. An EST is a short DNA sequence that occurs once in the genome and corresponds to a single expressed gene. {sup 32}P-radiolabeled probes were made by polymerase chain reaction for each EST and hybridized to filters containing a chromosome 19-specific cosmid library. The location of the ESTs on the chromosome was determined by the location of the ordered cosmid to which the EST hybridized. Of the 22 ESTs that were sublocalized, 6 correspond to known genes, and 16 correspond to anonymous genes. Thesemore » localized ESTs may serve as potential candidates for disease genes, as well as markers for future physical mapping.« less

  9. Lyme neuroborreliosis in 2 horses.

    PubMed

    Imai, D M; Barr, B C; Daft, B; Bertone, J J; Feng, S; Hodzic, E; Johnston, J M; Olsen, K J; Barthold, S W

    2011-11-01

    Lyme neuroborreliosis--characterized as chronic, necrosuppurative to nonsuppurative, perivascular to diffuse meningoradiculoneuritis--was diagnosed in 2 horses with progressive neurologic disease. In 1 horse, Borrelia burgdorferi sensu stricto was identified by polymerase chain reaction amplification of B burgdorferi sensu stricto-specific gene targets (ospA, ospC, flaB, dbpA, arp). Highest spirochetal burdens were in tissues with inflammation, including spinal cord, muscle, and joint capsule. Sequence analysis of ospA, ospC, and flaB revealed 99.9% sequence identity to the respective genes in B burgdorferi strain 297, an isolate from a human case of neuroborreliosis. In both horses, spirochetes were visualized in affected tissues with Steiner silver impregnation and by immunohistochemistry, predominantly within the dense collagenous tissue of the dura mater and leptomeninges.

  10. Molecular evidence of simian virus 40 infections in children

    NASA Technical Reports Server (NTRS)

    Butel, J. S.; Arrington, A. S.; Wong, C.; Lednicky, J. A.; Finegold, M. J.

    1999-01-01

    Recent studies have detected simian virus 40 (SV40) DNA in certain human tumors and normal tissues. The significance of human infections by SV40, which was first discovered as a contaminant of poliovirus vaccines used between 1955 and 1963, remains unknown. The occurrence of SV40 infections in unselected hospitalized children was evaluated. Polymerase chain reaction and DNA sequence analyses were done on archival tissue specimens from patients positive for SV40 neutralizing antibody. SV40 DNA was identified in samples from 4 of 20 children (1 Wilms' tumor, 3 transplanted kidney samples). Sequence variation among SV40 regulatory regions ruled out laboratory contamination of specimens. This study shows the presence of SV40 infections in pediatric patients born after 1982.

  11. Molecular characterization of vancomycin-resistant Enterococcus faecium isolates from Bermuda

    PubMed Central

    Akpaka, Patrick Eberechi; Kissoon, Shivnarine; Wilson, Clyde; Jayaratne, Padman; Smith, Ashley; Golding, George R.

    2017-01-01

    Molecular characteristics of vancomycin resistant enterococci isolates from Bermuda Island is currently unknown. This study was conducted to investigate phenotypic and genotypic characteristics of VRE isolates from Bermuda Island using the chromogenic agar, E-tests, polymerase chain reaction (PCR), pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Eighteen E. faecium isolates were completely analyzed and were all resistant to vancomycin, susceptible to linezolid and quinupristin/dalfopristin, positive for vanA and esp genes. The MLST analysis confirmed most isolates were of the sequence types linked to clonal complex 17 (CC17) that is widely associated with outbreaks in hospitals. Infection control measures, antibiotic stewardship, and surveillance activities will continue to be a priority in hospital on the Island. PMID:28267763

  12. Molecular characterization of vancomycin-resistant Enterococcus faecium isolates from Bermuda.

    PubMed

    Akpaka, Patrick Eberechi; Kissoon, Shivnarine; Wilson, Clyde; Jayaratne, Padman; Smith, Ashley; Golding, George R

    2017-01-01

    Molecular characteristics of vancomycin resistant enterococci isolates from Bermuda Island is currently unknown. This study was conducted to investigate phenotypic and genotypic characteristics of VRE isolates from Bermuda Island using the chromogenic agar, E-tests, polymerase chain reaction (PCR), pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Eighteen E. faecium isolates were completely analyzed and were all resistant to vancomycin, susceptible to linezolid and quinupristin/dalfopristin, positive for vanA and esp genes. The MLST analysis confirmed most isolates were of the sequence types linked to clonal complex 17 (CC17) that is widely associated with outbreaks in hospitals. Infection control measures, antibiotic stewardship, and surveillance activities will continue to be a priority in hospital on the Island.

  13. Identification and expression analysis of genes involved in early ovary development in diploid gynogenetic hybrids of red crucian carp x common carp.

    PubMed

    Liu, Dong; Liu, Shaojun; You, Cuiping; Chen, Lin; Liu, Zhen; Liu, Liangguo; Wang, Jing; Liu, Yun

    2010-04-01

    Diploid eggs of allotetraploid hybrids (red crucian carp female symbol x common carp male symbol), when activated by UV-irradiated sperm of scatter scale carp, can develop into diploid progenies without chromosome duplication treatment. Diploid progenies produce diploid eggs, which develop into diploid population by the same way. To understand the molecular mechanism underlying the production of diploid eggs by the diploid fish, we constructed a forward suppression subtractive hybridization complementary DNA (cDNA) library. The cDNAs from the ovary in proliferation phase were employed as the "tester," and those in growth phase were used as the "driver." Seventy-three cDNA clones that are specifically expressed in proliferation phase were detected by dot-blot hybridization. Sequencing analyses revealed that several of these cDNAs have high homologies to the known sequences in the NCBI database. Their encoded proteins include the protein preventing mitosis catastrophe (PMC), the signal recognition particle 9, the ATP-binding cassette transporter, the glucanase-xylanase fusion protein, and others. These genes were confirmed by reverse transcriptase-polymerase chain reaction. The expression profile of the PMC gene at different time points was analyzed by quantitative real-time polymerase chain reaction. The results indicated that the expression of this suppression subtractive hybridization-identified gene changed during the time course, corresponding with the cellular phenomenon in the ovary development. Our studies provide insights into the molecular mechanism underlying the ovary development of diploid gynogenetic fish.

  14. Is Malassezia nana the main species in horses' ear canal microbiome?

    PubMed

    Aldrovandi, Ana Lúcia; Osugui, Lika; Acqua Coutinho, Selene Dall'

    2016-01-01

    The objective of this study was to characterize genotypically Malassezia spp. isolated from the external ear canal of healthy horses. Fifty-five horses, 39 (70.9%) males and 16 (29.1%) females, from different breeds and adults were studied. External ear canals were cleaned and a sterile cotton swab was introduced to collect cerumen. A total of 110 samples were cultured into Dixon medium and were incubated at 32°C for up to 15 days. Macro- and micromorphology and phenotypic identification were performed. DNA was extracted, strains were submitted to polymerase chain reaction technique, and the products obtained were submitted to Restriction Fragment Length Polymorphism using the restriction enzymes BstCI and HhaI. Strains were sent off to genetic sequencing of the regions 26S rDNA D1/D2 and ITS1-5.8S-ITS2 rDNA. Malassezia spp. were isolated from 33/55 (60%) animals and 52/110 (47%) ear canals. No growth on Sabouraud dextrose agar was observed, confirming the lipid dependence of all strains. Polymerase chain reaction-Restriction fragment length polymorphism permitted the molecular identification of Malassezia nana - 42/52 (81%) and Malassezia slooffiae - 10/52 (19%). Sequencing confirmed RFLP identification. It was surprising that M. nana represented over 80% of the strains and no Malassezia equina was isolated in this study, differing from what was expected. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  15. Ultrasensitive electrochemical detection of avian influenza A (H7N9) virus DNA based on isothermal exponential amplification coupled with hybridization chain reaction of DNAzyme nanowires.

    PubMed

    Yu, Yanyan; Chen, Zuanguang; Jian, Wensi; Sun, Duanping; Zhang, Beibei; Li, Xinchun; Yao, Meicun

    2015-02-15

    In this work, a simple and label-free electrochemical biosensor with duel amplification strategy was developed for DNA detection based on isothermal exponential amplification (EXPAR) coupled with hybridization chain reaction (HCR) of DNAzymes nanowires. Through rational design, neither the primer nor the DNAzymes containing molecular beacons (MBs) could react with the duplex probe which were fixed on the electrode surface. Once challenged with target, the duplex probe cleaved and triggered the EXPAR mediated target recycle and regeneration circles as well as the HCR process. As a result, a greater amount of targets were generated to cleave the duplex probes. Subsequently, the nanowires consisting of the G-quadruplex units were self-assembled through hybridization with the strand fixed on the electrode surface. In the presence of hemin, the resulting catalytic G-quadruplex-hemin HRP-mimicking DNAzymes were formed. Electrochemical signals can be obtained by measuring the increase in reduction current of oxidized 3.3',5.5'-tetramethylbenzidine sulfate (TMB), which was generated by DNAzyme in the presence of H2O2. This method exhibited ultrahigh sensitivity towards avian influenza A (H7N9) virus DNA sequence with detection limits of 9.4 fM and a detection range of 4 orders of magnitude. The biosensor was also capable of discriminating single-nucleotide difference among concomitant DNA sequences and performed well in spiked cell lysates. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Molecular characterization of Toxocara spp. from soil of public areas in Ahvaz southwestern Iran.

    PubMed

    Khademvatan, Shahram; Abdizadeh, Rahman; Tavalla, Mahdi

    2014-07-01

    In the present study, the microscopy and polymerase chain reaction methods were used for detection and identification of soil contamination by Toxocara eggs in squares, streets, public parks, and rubbish dumps in Ahvaz, southwestern Iran. A total of 210 soil samples were collected from different parts of the city and examined by microscopy and polymerase chain reaction (PCR) methods, following sodium nitrate flotation. Nucleotide sequencing was performed to confirm the results of the PCR method. Toxocara eggs were found in 64 and 71 soil samples using the microscopy and PCR methods, respectively. The highest contamination rate was observed in the central part of Ahvaz (39.5% and 46.5% by the microscopy and PCR methods, respectively). Based on internal transcribed spacer 2 (ITS2) PCR identification, 28% of the samples were diagnosed as Toxocara cati and 5.7% as Toxocara canis; no mixed contamination was observed. DNA sequencing of the ITS2 gene confirmed our findings. Compared to the conventional microscopic detection following by flotation, used as the gold standard, the PCR method appears to be rapid and sensitive as well as allows analysis of Toxocara spp. isolated from soil independent of the stage of egg development. Therefore, the PCR method appears to be a valuable tool for the diagnosis and differentiation of Toxocara spp. from soil samples in epidemiological studies, and will help the local health systems in effective prevention and control of disease. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Development of multiplex polymerase chain reaction assay for simultaneous detection of clostero-, badna- and mandari-viruses along with huanglongbing bacterium in citrus trees.

    PubMed

    Meena, Ram Prasnna; Baranwal, V K

    2016-09-01

    Citrus trees harbor a large number of viral and bacterial pathogens. Citrus yellow vein clearing virus (CYVCV), Indian citrus ringspot virus (ICRSV), Citrus yellow mosaic virus (CYMV), Citrus tristeza virus (CTV) and a bacterium, Candidatus Liberibacter asiaticus (CLa) associated with huanglongbing (HLB) disease, the most prevalent pathogens in citrus orchards of different regions in India and are responsible for debilitating citriculture. For detection of these viral and bacterial pathogens a quick, sensitive and cost effective detection method is required. With this objective a multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of four viruses and a bacterium in citrus. Several sets of primers were designed for each virus based on the retrieved reference sequences from the GenBank. A primer pair published previously was used for greening bacterium. Each pair of primers was evaluated for their sensitivity and differentiation by simplex and mPCR. The constant amplified products were identified on the basis of molecular size in mPCR and were compared with standard PCR. The amplicons were cloned and results were confirmed with sequencing analysis. The mPCR assay was validated using naturally infected field samples for one or more citrus viruses and the huanglongbing bacterium. The mPCR assay developed here will aid in the production of virus free planting materials and rapid indexing for certification of citrus budwood programme. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase.

    PubMed

    Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi; Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki; Noda, Mamoru; Igimi, Shizunobu; Ikebukuro, Kazunori

    2013-11-01

    An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268-luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF-luciferase fusion protein. By means of the automatic analyzer with ZF-luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0×10 to 1.0×10(6) copies. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Identification of duck plague virus by polymerase chain reaction.

    PubMed

    Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague.

  20. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    NASA Astrophysics Data System (ADS)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  1. Sensitivity, specificity and comparison of three commercially available immunological tests in the diagnosis of Cryptosporidium species in animals.

    PubMed

    Danišová, Olga; Halánová, Monika; Valenčáková, Alexandra; Luptáková, Lenka

    The study was conducted to compare the specificity of immunological diagnostic methods used for the diagnosis of Cryptosporidium species capable of causing life-threatening infection in both immunosuppressed and immunocompetent patients. For the detection of Cryptosporidium species in 79 animals with diarrhoea, we used three Copro-antigen tests: RIDASCREEN ® Cryptosporidium test, Cryptosporidium 2nd Generation (ELISA) and RIDA ® QUICK Cryptosporidium. For immunoassays we used positive and negative samples detected by means of polymerase chain reaction and validated by sequencing and nested polymerase chain reaction to confirm the presence six different species of Cryptosporidium species. Prevalence of cryptosporidiosis in the entire group determined by enzyme immunoassay, enzyme linked immunosorbent assay, immuno-chromatographic test and polymerase chain reaction was 34.17%, 27.84%, 6.33% and 27.84%, respectively. Sensitivity of animal samples with enzyme immunoassay, enzyme linked immunosorbent assay, and immuno-chromatographic test was 63.6%, 40.9% and 22.7%, resp., when questionable samples were considered positive, whereas specificity of enzyme immunoassay, enzyme linked immunosorbent assay and immuno-chromatographic test was 75.9%, 78.9% and 100%, respectively. Positive predictive values and negative predictive values were different for all the tests. These differences results are controversial and therefore reliability and reproducibility of immunoassays as the only diagnostic method is questionable. The use of various Cryptosporidium species in diagnosis based on immunological testing and different results obtained by individual tests indicate potential differences in Copro-antigens produced by individual Cryptosporidium species. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  2. Identification of Colletotrichum spp. isolated from strawberry in Zhejiang Province and Shanghai City, China*

    PubMed Central

    Xie, Liu; Zhang, Jing-ze; Wan, Yao; Hu, Dong-wei

    2010-01-01

    Strawberry anthracnose, caused by Colletotrichum spp., is a major disease of cultivated strawberry. This study identifies 31 isolates of Colletotrichum spp. which cause strawberry anthracnose in Zhejiang Province and Shanghai City, China. Eleven isolates were identified as C. acutatum, 10 as C. gloeosporioides and 10 as C. fragariae based on morphological characteristics, phylogenetic and sequence analyses. Species-specific polymerase chain reaction (PCR) and enzyme digestion further confirmed the identification of the Colletotrichum spp., demonstrating that these three species are currently the causal agents of strawberry anthracnose in the studied regions. Based on analysis of rDNA internal transcribed spacers (ITS) sequences, sequences of all C. acutatum were identical, and little genetic variability was observed between C. fragariae and C. gloeosporioides. However, the conservative nature of the MvnI specific site from isolates of C. gloeosporioides was confirmed, and this site could be used to differentiate C. gloeosporioides from C. fragariae. PMID:20043353

  3. The complete mitochondrial genome and phylogenetic analysis of the giant panda (Ailuropoda melanoleuca).

    PubMed

    Peng, Rui; Zeng, Bo; Meng, Xiuxiang; Yue, Bisong; Zhang, Zhihe; Zou, Fangdong

    2007-08-01

    The complete mitochondrial genome sequence of the giant panda, Ailuropoda melanoleuca, was determined by the long and accurate polymerase chain reaction (LA-PCR) with conserved primers and primer walking sequence methods. The complete mitochondrial DNA is 16,805 nucleotides in length and contains two ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes and one control region. The total length of the 13 protein-coding genes is longer than the American black bear, brown bear and polar bear by 3 amino acids at the end of ND5 gene. The codon usage also followed the typical vertebrate pattern except for an unusual ATT start codon, which initiates the NADH dehydrogenase subunit 5 (ND5) gene. The molecular phylogenetic analysis was performed on the sequences of 12 concatenated heavy-strand encoded protein-coding genes, and suggested that the giant panda is most closely related to bears.

  4. The DL1 repeats in the genome of Diphyllobothrium latum.

    PubMed

    Usmanova, Nadezhda M; Kazakov, Vasiliy I

    2010-07-01

    Diphyllobothrium latum is a widespread intestinal parasite, which has a great clinical relevance, but there are no sequences of its nuclear genome. In this paper, a repetitive element in the D. latum genome is firstly described. The adult D. latum was obtained in the result of expulsion from intestinum of a patient suffering from diphyllobothriasis. Genomic DNA was isolated from several proglottids of this individual. PstI restriction products of D. latum genomic DNA were sequenced. Polymerase chain reaction (PCR) amplification of these products using genomic DNA and selected primers was carried out. Thereby a cluster of a repetitive element, called DL1, was discovered. For precise identification of a beginning and an end of the repeat, a product of PCR amplification of D. latum genomic DNA with one specific primer was sequenced. In discussion, several evidences that DL1 repeat is a member of the SINE family of retroposons were adduced.

  5. Prevalence of Microsporidia, Cryptosporidium spp., and Giardia spp. in beavers (Castor canadensis) in Massachusetts

    USGS Publications Warehouse

    Fayer, R.; Santin, M.; Trout, J.M.; DeStefano, S.; Koenen, K.; Kaur, T.

    2006-01-01

    Feces from 62 beavers (Castor canadensis) in Massachusetts were examined by fluorescence microscopy (IFA) and polymerase chain reaction (PCR) for Microsporidia species, Cryptosporidium spp., and Giardia spp. between January 2002 and December 2004. PCR-positive specimens were further examined by gene sequencing. Protist parasites were detected in 6.4% of the beavers. All were subadults and kits. Microsporidia species were not detected. Giardia spp. was detected by IFA from four beavers; Cryptosporidium spp. was also detected by IFA from two of these beavers. However, gene sequence data for the ssrRNA gene from these two Cryptosporidium spp.-positive beavers were inconclusive in identifying the species. Nucleotide sequences of the TPI, ssrRNA, and ??-giardin genes for Giardia spp. (deposited in GenBank) indicated that the four beavers were excreting Giardia duodenalis Assemblage B, the zoonotic genotype representing a potential source of waterborne Giardia spp. cysts. Copyright 2006 by American Association of Zoo Veterinarians.

  6. Molecular identification of Giardia and Cryptosporidium from dogs and cats

    PubMed Central

    Sotiriadou, Isaia; Pantchev, Nikola; Gassmann, Doreen; Karanis, Panagiotis

    2013-01-01

    The aim of the present study was to diagnose the presence of Giardia cysts and Cryptosporidium oocysts in household animals using nested polymerase chain reaction (PCR) and sequence analysis. One hundred faecal samples obtained from 81 dogs and 19 cats were investigated. The Cryptosporidium genotypes were determined by sequencing a fragment of the small subunit (SSU) rRNA gene, while the Giardia Assemblages were determined through analysis of the glutamate dehydrogenase (GDH) locus. Isolates from five dogs and two cats were positive by PCR for the presence of Giardia, and their sequences matched the zoonotic Assemblage A of Giardia. Cryptosporidium spp. isolated from one dog and one cat were both found to be C. parvum. One dog isolate harboured a mixed infection of C. parvum and Giardia Assemblage A. These findings support the growing evidence that household animals are potential reservoirs of the zoonotic pathogens Giardia spp. and Cryptosporidium spp. for infections in humans. PMID:23477297

  7. Transcriptome sequencing and annotation of the halophytic microalga Dunaliella salina * #

    PubMed Central

    Hong, Ling; Liu, Jun-li; Midoun, Samira Z.; Miller, Philip C.

    2017-01-01

    The unicellular green alga Dunaliella salina is well adapted to salt stress and contains compounds (including β-carotene and vitamins) with potential commercial value. A large transcriptome database of D. salina during the adjustment, exponential and stationary growth phases was generated using a high throughput sequencing platform. We characterized the metabolic processes in D. salina with a focus on valuable metabolites, with the aim of manipulating D. salina to achieve greater economic value in large-scale production through a bioengineering strategy. Gene expression profiles under salt stress verified using quantitative polymerase chain reaction (qPCR) implied that salt can regulate the expression of key genes. This study generated a substantial fraction of D. salina transcriptional sequences for the entire growth cycle, providing a basis for the discovery of novel genes. This first full-scale transcriptome study of D. salina establishes a foundation for further comparative genomic studies. PMID:28990374

  8. Evaluation of point mutations in dystrophin gene in Iranian Duchenne and Becker muscular dystrophy patients: introducing three novel variants.

    PubMed

    Haghshenas, Maryam; Akbari, Mohammad Taghi; Karizi, Shohreh Zare; Deilamani, Faravareh Khordadpoor; Nafissi, Shahriar; Salehi, Zivar

    2016-06-01

    Duchenne and Becker muscular dystrophies (DMD and BMD) are X-linked neuromuscular diseases characterized by progressive muscular weakness and degeneration of skeletal muscles. Approximately two-thirds of the patients have large deletions or duplications in the dystrophin gene and the remaining one-third have point mutations. This study was performed to evaluate point mutations in Iranian DMD/BMD male patients. A total of 29 DNA samples from patients who did not show any large deletion/duplication mutations following multiplex polymerase chain reaction (PCR) and multiplex ligation-dependent probe amplification (MLPA) screening were sequenced for detection of point mutations in exons 50-79. Also exon 44 was sequenced in one sample in which a false positive deletion was detected by MLPA method. Cycle sequencing revealed four nonsense, one frameshift and two splice site mutations as well as two missense variants.

  9. Isolation, sequence identification and tissue expression profiles of 3 novel porcine genes: ASPA, NAGA, and HEXA.

    PubMed

    Shu, Xianghua; Liu, Yonggang; Yang, Liangyu; Song, Chunlian; Hou, Jiafa

    2008-01-01

    The complete coding sequences of 3 porcine genes - ASPA, NAGA, and HEXA - were amplified by the reverse transcriptase polymerase chain reaction (RT-PCR) based on the conserved sequence information of the mouse or other mammals and referenced pig ESTs. These 3 novel porcine genes were then deposited in the NCBI database and assigned GeneIDs: 100142661, 100142664 and 100142667. The phylogenetic tree analysis revealed that the porcine ASPA, NAGA, and HEXA all have closer genetic relationships with the ASPA, NAGA, and HEXA of cattle. Tissue expression profile analysis was also carried out and results revealed that swine ASPA, NAGA, and HEXA genes were differentially expressed in various organs, including skeletal muscle, the heart, liver, fat, kidney, lung, and small and large intestines. Our experiment is the first one to establish the foundation for further research on these 3 swine genes.

  10. Switchable photosystem-II designer algae for photobiological hydrogen production

    DOEpatents

    Lee, James Weifu

    2010-01-05

    A switchable photosystem-II designer algae for photobiological hydrogen production. The designer transgenic algae includes at least two transgenes for enhanced photobiological H.sub.2 production wherein a first transgene serves as a genetic switch that can controls photosystem II (PSII) oxygen evolution and a second transgene encodes for creation of free proton channels in the algal photosynthetic membrane. In one embodiment, the algae includes a DNA construct having polymerase chain reaction forward primer (302), a inducible promoter (304), a PSII-iRNA sequence (306), a terminator (308), and a PCR reverse primer (310). In other embodiments, the PSII-iRNA sequence (306) is replaced with a CF.sub.1-iRNA sequence (312), a streptomycin-production gene (314), a targeting sequence (316) followed by a proton-channel producing gene (318), or a PSII-producing gene (320). In one embodiment, a photo-bioreactor and gas-product separation and utilization system produce photobiological H.sub.2 from the switchable PSII designer alga.

  11. Viruses associated with Antarctic wildlife: From serology based detection to identification of genomes using high throughput sequencing.

    PubMed

    Smeele, Zoe E; Ainley, David G; Varsani, Arvind

    2018-01-02

    The Antarctic, sub-Antarctic islands and surrounding sea-ice provide a unique environment for the existence of organisms. Nonetheless, birds and seals of a variety of species inhabit them, particularly during their breeding seasons. Early research on Antarctic wildlife health, using serology-based assays, showed exposure to viruses in the families Birnaviridae, Flaviviridae, Herpesviridae, Orthomyxoviridae and Paramyxoviridae circulating in seals (Phocidae), penguins (Spheniscidae), petrels (Procellariidae) and skuas (Stercorariidae). It is only during the last decade or so that polymerase chain reaction-based assays have been used to characterize viruses associated with Antarctic animals. Furthermore, it is only during the last five years that full/whole genomes of viruses (adenoviruses, anelloviruses, orthomyxoviruses, a papillomavirus, paramyoviruses, polyomaviruses and a togavirus) have been sequenced using Sanger sequencing or high throughput sequencing (HTS) approaches. This review summaries the knowledge of animal Antarctic virology and discusses potential future directions with the advent of HTS in virus discovery and ecology. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Ultrasensitive electrochemical biosensor for detection of DNA from Bacillus subtilis by coupling target-induced strand displacement and nicking endonuclease signal amplification.

    PubMed

    Hu, Yuhua; Xu, Xueqin; Liu, Qionghua; Wang, Ling; Lin, Zhenyu; Chen, Guonan

    2014-09-02

    A simple, ultrasensitive, and specific electrochemical biosensor was designed to determine the given DNA sequence of Bacillus subtilis by coupling target-induced strand displacement and nicking endonuclease signal amplification. The target DNA (TD, the DNA sequence from the hypervarient region of 16S rDNA of Bacillus subtilis) could be detected by the differential pulse voltammetry (DPV) in a range from 0.1 fM to 20 fM with the detection limit down to 0.08 fM at the 3s(blank) level. This electrochemical biosensor exhibits high distinction ability to single-base mismatch, double-bases mismatch, and noncomplementary DNA sequence, which may be expected to detect single-base mismatch and single nucleotide polymorphisms (SNPs). Moreover, the applicability of the designed biosensor for detecting the given DNA sequence from Bacillus subtilis was investigated. The result obtained by electrochemical method is approximately consistent with that by a real-time quantitative polymerase chain reaction detecting system (QPCR) with SYBR Green.

  13. A novel recessive mutation in the gene ELOVL4 causes a neuro-ichthyotic disorder with variable expressivity

    PubMed Central

    2014-01-01

    Background A rare neuro-ichthyotic disorder characterized by ichthyosis, spastic quadriplegia and intellectual disability and caused by recessive mutations in ELOVL4, encoding elongase-4 protein has recently been described. The objective of the study was to search for sequence variants in the gene ELOVL4 in three affected individuals of a consanguineous Pakistani family exhibiting features of neuro-ichthyotic disorder. Methods Linkage in the family was searched by genotyping microsatellite markers linked to the gene ELOVL4, mapped at chromosome 6p14.1. Exons and splice junction sites of the gene ELOVL4 were polymerase chain reaction amplified and sequenced in an automated DNA sequencer. Results DNA sequence analysis revealed a novel homozygous nonsense mutation (c.78C > G; p.Tyr26*). Conclusions Our report further confirms the recently described ELOVL4-related neuro-ichthyosis and shows that the neurological phenotype can be absent in some individuals. PMID:24571530

  14. Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.

    PubMed

    Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F

    2000-08-01

    Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.

  15. High prevalence of DUOX2 mutations in Japanese patients with permanent congenital hypothyroidism or transient hypothyroidism.

    PubMed

    Matsuo, Kumihiro; Tanahashi, Yusuke; Mukai, Tokuo; Suzuki, Shigeru; Tajima, Toshihiro; Azuma, Hiroshi; Fujieda, Kenji

    2016-07-01

    Dual oxidase 2 (DUOX2) mutations are a cause of dyshormonogenesis (DH) and have been identified in patients with permanent congenital hypothyroidism (PH) and with transient hypothyroidism (TH). We aimed to elucidate the prevalence and phenotypical variations of DUOX2 mutations. Forty-eight Japanese DH patients were enroled and analysed for sequence variants of DUOX2, DUOXA2, and TPO using polymerase chain reaction-amplified direct sequencing. Fourteen sequence variants of DUOX2, including 10 novel variants, were identified in 11 patients. DUOX2 variants were more prevalent (11/48, 22.9%) than TPO (3/48, 6.3%) (p=0.020). The prevalence of DUOX2 variants in TH was slightly, but not significantly, higher than in PH. Furthermore, one patient had digenic heterozygous sequence variants of both DUOX2 and TPO. Our results suggest that DUOX2 mutations might be the most common cause of both PH and TH, and that phenotypes of these mutations might be milder than those of other causes.

  16. Short communication: development and characterization of novel transcriptome-derived microsatellites for genetic analysis of persimmon.

    PubMed

    Luo, C; Zhang, Q L; Luo, Z R

    2014-04-16

    Oriental persimmon (Diospyros kaki Thunb.) (2n = 6x = 90) is a major commercial and deciduous fruit tree that is believed to have originated in China. However, rare transcriptomic and genomic information on persimmon is available. Using Roche 454 sequencing technology, the transcriptome from RNA of the flowers of D. kaki was analyzed. A total of 1,250,893 reads were generated and 83,898 unigenes were assembled. A total of 42,711 SSR loci were identified from 23,494 unigenes and 289 polymerase chain reaction primer pairs were designed. Of these 289 primers, 155 (53.6%) showed robust PCR amplification and 98 revealed polymorphism between 15 persimmon genotypes, indicating a polymorphic rate of 63.23% of the productive primers for characterization and genotyping of the genus Diospyros. Transcriptome sequence data generated from next-generation sequencing technology to identify microsatellite loci appears to be rapid and cost-efficient, particularly for species with no genomic sequence information available.

  17. Introduction to Polymer Chemistry.

    ERIC Educational Resources Information Center

    Harris, Frank W.

    1981-01-01

    Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

  18. Formation of pyroglutamic acid from N-terminal glutamic acid in immunoglobulin gamma antibodies.

    PubMed

    Chelius, Dirk; Jing, Kay; Lueras, Alexis; Rehder, Douglas S; Dillon, Thomas M; Vizel, Alona; Rajan, Rahul S; Li, Tiansheng; Treuheit, Michael J; Bondarenko, Pavel V

    2006-04-01

    The status of the N-terminus of proteins is important for amino acid sequencing by Edman degradation, protein identification by shotgun and top-down techniques, and to uncover biological functions, which may be associated with modifications. In this study, we investigated the pyroglutamic acid formation from N-terminal glutamic acid residues in recombinant monoclonal antibodies. Almost half the antibodies reported in the literature contain a glutamic acid residue at the N-terminus of the light or the heavy chain. Our reversed-phase high-performance liquid chromatography-mass spectrometry method could separate the pyroglutamic acid-containing light chains from the native light chains of reduced and alkylated recombinant monoclonal antibodies. Tryptic peptide mapping and tandem mass spectrometry of the reduced and alkylated proteins was used for the identification of the pyroglutamic acid. We identified the formation of pyroglutamic acid from N-terminal glutamic acid in the heavy chains and light chains of several antibodies, indicating that this nonenzymatic reaction does occur very commonly and can be detected after a few weeks of incubation at 37 and 45 degrees C. The rate of this reaction was measured in several aqueous buffers with different pH values, showing minimal formation of pyroglutamic acid at pH 6.2 and increased formation of pyroglutamic acid at pH 4 and pH 8. The half-life of the N-terminal glutamic acid was approximately 9 months in a pH 4.1 buffer at 45 degrees C. To our knowledge, we showed for the first time that glutamic acid residues located at the N-terminus of proteins undergo pyroglutamic acid formation in vitro.

  19. MerMade: An Oligodeoxyribonucleotide Synthesizer for High Throughput Oligonucleotide Production in Dual 96-Well Plates

    PubMed Central

    Rayner, Simon; Brignac, Stafford; Bumeister, Ron; Belosludtsev, Yuri; Ward, Travis; Grant, O’dell; O’Brien, Kevin; Evans, Glen A.; Garner, Harold R.

    1998-01-01

    We have designed and constructed a machine that synthesizes two standard 96-well plates of oligonucleotides in a single run using standard phosphoramidite chemistry. The machine is capable of making a combination of standard, degenerate, or modified oligos in a single plate. The run time is typically 17 hr for two plates of 20-mers and a reaction scale of 40 nm. The reaction vessel is a standard polypropylene 96-well plate with a hole drilled in the bottom of each well. The two plates are placed in separate vacuum chucks and mounted on an xy table. Each well in turn is positioned under the appropriate reagent injection line and the reagent is injected by switching a dedicated valve. All aspects of machine operation are controlled by a Macintosh computer, which also guides the user through the startup and shutdown procedures, provides a continuous update on the status of the run, and facilitates a number of service procedures that need to be carried out periodically. Over 25,000 oligos have been synthesized for use in dye terminator sequencing reactions, polymerase chain reactions (PCRs), hybridization, and RT–PCR. Oligos up to 100 bases in length have been made with a coupling efficiency in excess of 99%. These machines, working in conjunction with our oligo prediction code are particularly well suited to application in automated high throughput genomic sequencing. PMID:9685322

  20. MerMade: an oligodeoxyribonucleotide synthesizer for high throughput oligonucleotide production in dual 96-well plates.

    PubMed

    Rayner, S; Brignac, S; Bumeister, R; Belosludtsev, Y; Ward, T; Grant, O; O'Brien, K; Evans, G A; Garner, H R

    1998-07-01

    We have designed and constructed a machine that synthesizes two standard 96-well plates of oligonucleotides in a single run using standard phosphoramidite chemistry. The machine is capable of making a combination of standard, degenerate, or modified oligos in a single plate. The run time is typically 17 hr for two plates of 20-mers and a reaction scale of 40 nM. The reaction vessel is a standard polypropylene 96-well plate with a hole drilled in the bottom of each well. The two plates are placed in separate vacuum chucks and mounted on an xy table. Each well in turn is positioned under the appropriate reagent injection line and the reagent is injected by switching a dedicated valve. All aspects of machine operation are controlled by a Macintosh computer, which also guides the user through the startup and shutdown procedures, provides a continuous update on the status of the run, and facilitates a number of service procedures that need to be carried out periodically. Over 25,000 oligos have been synthesized for use in dye terminator sequencing reactions, polymerase chain reactions (PCRs), hybridization, and RT-PCR. Oligos up to 100 bases in length have been made with a coupling efficiency in excess of 99%. These machines, working in conjunction with our oligo prediction code are particularly well suited to application in automated high throughput genomic sequencing.

  1. Miniaturized isothermal nucleic acid amplification, a review.

    PubMed

    Asiello, Peter J; Baeumner, Antje J

    2011-04-21

    Micro-Total Analysis Systems (µTAS) for use in on-site rapid detection of DNA or RNA are increasingly being developed. Here, amplification of the target sequence is key to increasing sensitivity, enabling single-cell and few-copy nucleic acid detection. The several advantages to miniaturizing amplification reactions and coupling them with sample preparation and detection on the same chip are well known and include fewer manual steps, preventing contamination, and significantly reducing the volume of expensive reagents. To-date, the majority of miniaturized systems for nucleic acid analysis have used the polymerase chain reaction (PCR) for amplification and those systems are covered in previous reviews. This review provides a thorough overview of miniaturized analysis systems using alternatives to PCR, specifically isothermal amplification reactions. With no need for thermal cycling, isothermal microsystems can be designed to be simple and low-energy consuming and therefore may outperform PCR in portable, battery-operated detection systems in the future. The main isothermal methods as miniaturized systems reviewed here include nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), rolling circle amplification (RCA), and strand displacement amplification (SDA). Also, important design criteria for the miniaturized devices are discussed. Finally, the potential of miniaturization of some new isothermal methods such as the exponential amplification reaction (EXPAR), isothermal and chimeric primer-initiated amplification of nucleic acids (ICANs), signal-mediated amplification of RNA technology (SMART) and others is presented.

  2. An artificial molecular machine that builds an asymmetric catalyst

    NASA Astrophysics Data System (ADS)

    De Bo, Guillaume; Gall, Malcolm A. Y.; Kuschel, Sonja; De Winter, Julien; Gerbaux, Pascal; Leigh, David A.

    2018-05-01

    Biomolecular machines perform types of complex molecular-level tasks that artificial molecular machines can aspire to. The ribosome, for example, translates information from the polymer track it traverses (messenger RNA) to the new polymer it constructs (a polypeptide)1. The sequence and number of codons read determines the sequence and number of building blocks incorporated into the biomachine-synthesized polymer. However, neither control of sequence2,3 nor the transfer of length information from one polymer to another (which to date has only been accomplished in man-made systems through template synthesis)4 is easily achieved in the synthesis of artificial macromolecules. Rotaxane-based molecular machines5-7 have been developed that successively add amino acids8-10 (including β-amino acids10) to a growing peptide chain by the action of a macrocycle moving along a mono-dispersed oligomeric track derivatized with amino-acid phenol esters. The threaded macrocycle picks up groups that block its path and links them through successive native chemical ligation reactions11 to form a peptide sequence corresponding to the order of the building blocks on the track. Here, we show that as an alternative to translating sequence information, a rotaxane molecular machine can transfer the narrow polydispersity of a leucine-ester-derivatized polystyrene chain synthesized by atom transfer radical polymerization12 to a molecular-machine-made homo-leucine oligomer. The resulting narrow-molecular-weight oligomer folds to an α-helical secondary structure13 that acts as an asymmetric catalyst for the Juliá-Colonna epoxidation14,15 of chalcones.

  3. Statistical theory for protein combinatorial libraries. Packing interactions, backbone flexibility, and the sequence variability of a main-chain structure.

    PubMed

    Kono, H; Saven, J G

    2001-02-23

    Combinatorial experiments provide new ways to probe the determinants of protein folding and to identify novel folding amino acid sequences. These types of experiments, however, are complicated both by enormous conformational complexity and by large numbers of possible sequences. Therefore, a quantitative computational theory would be helpful in designing and interpreting these types of experiment. Here, we present and apply a statistically based, computational approach for identifying the properties of sequences compatible with a given main-chain structure. Protein side-chain conformations are included in an atom-based fashion. Calculations are performed for a variety of similar backbone structures to identify sequence properties that are robust with respect to minor changes in main-chain structure. Rather than specific sequences, the method yields the likelihood of each of the amino acids at preselected positions in a given protein structure. The theory may be used to quantify the characteristics of sequence space for a chosen structure without explicitly tabulating sequences. To account for hydrophobic effects, we introduce an environmental energy that it is consistent with other simple hydrophobicity scales and show that it is effective for side-chain modeling. We apply the method to calculate the identity probabilities of selected positions of the immunoglobulin light chain-binding domain of protein L, for which many variant folding sequences are available. The calculations compare favorably with the experimentally observed identity probabilities.

  4. Generation of 2A-linked multicistronic cassettes by recombinant PCR.

    PubMed

    Szymczak-Workman, Andrea L; Vignali, Kate M; Vignali, Dario A A

    2012-02-01

    The need for reliable, multicistronic vectors for multigene delivery is at the forefront of biomedical technology. It is now possible to express multiple proteins from a single open reading frame (ORF) using 2A peptide-linked multicistronic vectors. These small sequences, when cloned between genes, allow for efficient, stoichiometric production of discrete protein products within a single vector through a novel "cleavage" event within the 2A peptide sequence. Expression of more than two genes using conventional approaches has several limitations, most notably imbalanced protein expression and large size. The use of 2A peptide sequences alleviates these concerns. They are small (18-22 amino acids) and have divergent amino-terminal sequences, which minimizes the chance for homologous recombination and allows for multiple, different 2A peptide sequences to be used within a single vector. Importantly, separation of genes placed between 2A peptide sequences is nearly 100%, which allows for stoichiometric and concordant expression of the genes, regardless of the order of placement within the vector. This protocol describes the use of recombinant polymerase chain reaction (PCR) to connect multiple 2A-linked protein sequences. The final construct is subcloned into an expression vector.

  5. Polymerization as a Model Chain Reaction

    ERIC Educational Resources Information Center

    Morton, Maurice

    1973-01-01

    Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

  6. Labeling milk along its production chain with DNA encapsulated in silica.

    PubMed

    Bloch, Madeleine S; Paunescu, Daniela; Stoessel, Philipp R; Mora, Carlos A; Stark, Wendelin J; Grass, Robert N

    2014-10-29

    The capability of tracing a food product along its production chain is important to ensure food safety and product authenticity. For this purpose and as an application example, recently developed Silica Particles with Encapsulated DNA (SPED) were added to milk at concentrations ranging from 0.1 to 100 ppb (μg per kg milk). Thereby the milk, as well as the milk-derived products yoghurt and cheese, could be uniquely labeled with a DNA tag. Procedures for the extraction of the DNA tags from the food matrixes were elaborated and allowed identification and quantification of previously marked products by quantitative polymerase chain reaction (qPCR) with detection limits below 1 ppb of added particles. The applicability of synthetic as well as naturally occurring DNA sequences was shown. The usage of approved food additives as DNA carrier (silica = E551) and the low cost of the technology (<0.1 USD per ton of milk labeled with 10 ppb of SPED) display the technical applicability of this food labeling technology.

  7. Probing Protein Structure by Amino Acid-Specific Covalent Labeling and Mass Spectrometry

    PubMed Central

    Mendoza, Vanessa Leah; Vachet, Richard W.

    2009-01-01

    For many years, amino acid-specific covalent labeling has been a valuable tool to study protein structure and protein interactions, especially for systems that are difficult to study by other means. These covalent labeling methods typically map protein structure and interactions by measuring the differential reactivity of amino acid side chains. The reactivity of amino acids in proteins generally depends on the accessibility of the side chain to the reagent, the inherent reactivity of the label and the reactivity of the amino acid side chain. Peptide mass mapping with ESI- or MALDI-MS and peptide sequencing with tandem MS are typically employed to identify modification sites to provide site-specific structural information. In this review, we describe the reagents that are most commonly used in these residue-specific modification reactions, details about the proper use of these covalent labeling reagents, and information about the specific biochemical problems that have been addressed with covalent labeling strategies. PMID:19016300

  8. Expression optimization and biochemical characterization of a recombinant gamma-glutamyltranspeptidase from Escherichia coli novablue.

    PubMed

    Yao, Ya-Feng; Weng, Yih-Ming; Hu, Hui-Yu; Ku, Kuo-Lung; Lin, Long-Liu

    2006-09-01

    A truncated Escherichia coli Novablue gamma-glutamyltranspeptidase (EcGGT) gene lacking the first 48-bp coding sequence for part of the signal sequence was amplified by polymerase chain reaction and cloned into expression vector pQE-30 to generate pQE-EcGGT. The maximum production of His(6)-tagged enzyme by E. coli M15 (pQE-EcGGT) was achieved with 0.1 mM IPTG induction for 12 h at 20 degrees C. The overexpressed enzyme was purified to homogeneity by nickel-chelate chromatography to a specific transpeptidase activity of 4.25 U/mg protein and a final yield of 83%. The molecular masses of the subunits of the purified enzyme were estimated to be 41 and 21 kDa respectively by SDS-PAGE, indicating EcGGT still undergoes the post-translational cleavage even in the truncation of signal sequence. The optimum temperature and pH for the recombinant enzyme were 40 degrees C and 9, respectively. The apparent K (m) and V (max) values for gamma-glutamyl-p-nitroanilide as gamma-glutamyl donor in the transpeptidation reaction were 37.9 microM and 53.7 x 10(-3) mM min(-1), respectively. The synthesis of L -theanine was performed in a reaction mixture containing 10 mM L -Gln, 40 mM ethylamine, and 1.04 U His(6)-tagged EcGGT/ml, pH 10, and a conversion rate of 45% was obtained.

  9. Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

    DOE R&D Accomplishments Database

    Weinberg, Alvin M.; Noderer, L. C.

    1951-05-15

    The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

  10. Optimal choice of word length when comparing two Markov sequences using a χ 2-statistic.

    PubMed

    Bai, Xin; Tang, Kujin; Ren, Jie; Waterman, Michael; Sun, Fengzhu

    2017-10-03

    Alignment-free sequence comparison using counts of word patterns (grams, k-tuples) has become an active research topic due to the large amount of sequence data from the new sequencing technologies. Genome sequences are frequently modelled by Markov chains and the likelihood ratio test or the corresponding approximate χ 2 -statistic has been suggested to compare two sequences. However, it is not known how to best choose the word length k in such studies. We develop an optimal strategy to choose k by maximizing the statistical power of detecting differences between two sequences. Let the orders of the Markov chains for the two sequences be r 1 and r 2 , respectively. We show through both simulations and theoretical studies that the optimal k= max(r 1 ,r 2 )+1 for both long sequences and next generation sequencing (NGS) read data. The orders of the Markov chains may be unknown and several methods have been developed to estimate the orders of Markov chains based on both long sequences and NGS reads. We study the power loss of the statistics when the estimated orders are used. It is shown that the power loss is minimal for some of the estimators of the orders of Markov chains. Our studies provide guidelines on choosing the optimal word length for the comparison of Markov sequences.

  11. Topological frustration in βα-repeat proteins: sequence diversity modulates the conserved folding mechanisms of α/β/α sandwich proteins

    PubMed Central

    Hills, Ronald D.; Kathuria, Sagar V.; Wallace, Louise A.; Day, Iain J.; Brooks, Charles L.; Matthews, C. Robert

    2010-01-01

    The thermodynamic hypothesis of Anfinsen postulates that structures and stabilities of globular proteins are determined by their amino acid sequences. Chain topology, however, is known to influence the folding reaction, in that motifs with a preponderance of local interactions typically fold more rapidly than those with a larger fraction of non-local interactions. Together, the topology and sequence can modulate the energy landscape and influence the rate at which the protein folds to the native conformation. To explore the relationship of sequence and topology in the folding of βα–repeat proteins, which are dominated by local interactions, a combined experimental and simulation analysis was performed on two members of the flavodoxin-like, α/β/α sandwich fold. Spo0F and the N-terminal receiver domain of NtrC (NT-NtrC) have similar topologies but low sequence identity, enabling a test of the effects of sequence on folding. Experimental results demonstrated that both response-regulator proteins fold via parallel channels through highly structured sub-millisecond intermediates before accessing their cis prolyl peptide bond-containing native conformations. Global analysis of the experimental results preferentially places these intermediates off the productive folding pathway. Sequence-sensitive Gō-model simulations conclude that frustration in the folding in Spo0F, corresponding to the appearance of the off-pathway intermediate, reflects competition for intra-subdomain van der Waals contacts between its N- and C-terminal subdomains. The extent of transient, premature structure appears to correlate with the number of isoleucine, leucine and valine (ILV) side-chains that form a large sequence-local cluster involving the central β-sheet and helices α2, α3 and α4. The failure to detect the off-pathway species in the simulations of NT-NtrC may reflect the reduced number of ILV side-chains in its corresponding hydrophobic cluster. The location of the hydrophobic clusters in the structure may also be related to the differing functional properties of these response regulators. Comparison with the results of previous experimental and simulation analyses on the homologous CheY argues that prematurely-folded unproductive intermediates are a common property of the βα-repeat motif. PMID:20226790

  12. Identification of four novel HLA-B alleles, B*1590, B*1591, B*2726, and B*4705, from an East African population by high-resolution sequence-based typing.

    PubMed

    Luo, M; Mao, X; Plummer, F A

    2005-02-01

    We report here four novel HLA-B alleles, B*1590, B*1591, B*2726, and B*4705, identified from an East African population during sequence-based HLA-B typing. The novel alleles were confirmed by sequencing two separate polymerase chain reaction products, and by molecular cloning and sequencing multiple clones. B*1590 is identical to B*1510 at exon 2 and exon 3, except for a difference (GCCGTC) at codon 158. Sequence differences at codon 152 (GAGGTG) and codon 167 (TGGTCG) differentiate B*1591 from B*1503 at exon 3. B*2726 is identical to B*2708 at exon 2 and exon 3, except for a difference (AAGCAG) at codon 70. B*4705 was identified in three Kenyan women. The allele is identical to B*47010101/02 at exon 2 and exon 3, except for differences at codon 97 (AGGAAT) and codon 99 (TTTTAT). These new alleles have been named by the WHO Nomenclature Committee. Identification of these novel HLA-B alleles reflects the genetic diversity of this East African population.

  13. Whole Wiskott‑Aldrich syndrome protein gene deletion identified by high throughput sequencing.

    PubMed

    He, Xiangling; Zou, Runying; Zhang, Bing; You, Yalan; Yang, Yang; Tian, Xin

    2017-11-01

    Wiskott‑Aldrich syndrome (WAS) is a rare X‑linked recessive immunodeficiency disorder, characterized by thrombocytopenia, small platelets, eczema and recurrent infections associated with increased risk of autoimmunity and malignancy disorders. Mutations in the WAS protein (WASP) gene are responsible for WAS. To date, WASP mutations, including missense/nonsense, splicing, small deletions, small insertions, gross deletions, and gross insertions have been identified in patients with WAS. In addition, WASP‑interacting proteins are suspected in patients with clinical features of WAS, in whom the WASP gene sequence and mRNA levels are normal. The present study aimed to investigate the application of next generation sequencing in definitive diagnosis and clinical therapy for WAS. A 5 month‑old child with WAS who displayed symptoms of thrombocytopenia was examined. Whole exome sequence analysis of genomic DNA showed that the coverage and depth of WASP were extremely low. Quantitative polymerase chain reaction indicated total WASP gene deletion in the proband. In conclusion, high throughput sequencing is useful for the verification of WAS on the genetic profile, and has implications for family planning guidance and establishment of clinical programs.

  14. Characterization of complete genome sequence of the spring viremia of carp virus isolated from common carp (Cyprinus carpio) in China.

    PubMed

    Teng, Y; Liu, H; Lv, J Q; Fan, W H; Zhang, Q Y; Qin, Q W

    2007-01-01

    The complete genome of spring viraemia of carp virus (SVCV) strain A-1 isolated from cultured common carp (Cyprinus carpio) in China was sequenced and characterized. Reverse transcription-polymerase chain reaction (RT-PCR) derived clones were constructed and the DNA was sequenced. It showed that the entire genome of SVCV A-1 consists of 11,100 nucleotide base pairs, the predicted size of the viral RNA of rhabdoviruses. However, the additional insertions in bp 4633-4676 and bp 4684-4724 of SVCV A-1 were different from the other two published SVCV complete genomes. Five open reading frames (ORFs) of SVCV A-1 were identified and further confirmed by RT-PCR and DNA sequencing of their respective RT-PCR products. The 5 structural proteins encoded by the viral RNA were ordered 3'-N-P-M-G-L-5'. This is the first report of a complete genome sequence of SVCV isolated from cultured carp in China. Phylogenetic analysis indicates that SVCV A-1 is closely related to the members of the genus Vesiculovirus, family Rhabdoviridae.

  15. Stress-induced rearrangement of Fusarium retrotransposon sequences.

    PubMed

    Anaya, N; Roncero, M I

    1996-11-27

    Rearrangement of fusarium oxysporum retrotransposon skippy was induced by growth in the presence of potassium chlorate. Three fungal strains, one sensitive to chlorate (Co60) and two resistant to chlorate and deficient for nitrate reductase (Co65 and Co94), were studied by Southern analysis of their genomic DNA. Polymorphism was detected in their hybridization banding pattern, relative to the wild type grown in the absence of chlorate, using various enzymes with or without restriction sites within the retrotransposon. Results were consistent with the assumption that three different events had occurred in strain Co60: genomic amplification of skippy yielding tandem arrays of the element, generation of new skippy sequences, and deletion of skippy sequences. Amplification of Co60 genomic DNA using the polymerase chain reaction and divergent primers derived from the retrotransposon generated a new band, corresponding to one long terminal repeat plus flanking sequences, that was not present in the wild-type strain. Molecular analysis of nitrate reductase-deficient mutants showed that generation and deletion of skippy sequences, but not genomic amplification in tandem repeats, had occurred in their genomes.

  16. Fingerprinting and quantification of GMOs in the agro-food sector.

    PubMed

    Taverniers, I; Van Bockstaele, E; De Loose, M

    2003-01-01

    Most strategies for analyzing GMOs in plants and derived food and feed products, are based on the polymerase chain reaction (PCR) technique. In conventional PCR methods, a 'known' sequence between two specific primers is amplified. To the contrary, with the 'anchor PCR' technique, unknown sequences adjacent to a known sequence, can be amplified. Because T-DNA/plant border sequences are being amplified, anchor PCR is the perfect tool for unique identification of transgenes, including non-authorized GMOs. In this work, anchor PCR was applied to characterize the 'transgene locus' and to clarify the complete molecular structure of at least six different commercial transgenic plants. Based on sequences of T-DNA/plant border junctions, obtained by anchor PCR, event specific primers were developed. The junction fragments, together with endogeneous reference gene targets, were cloned in plasmids. The latter were then used as event specific calibrators in real-time PCR, a new technique for the accurate relative quantification of GMOs. We demonstrate here the importance of anchor PCR for identification and the usefulness of plasmid DNA calibrators in quantification strategies for GMOs, throughout the agro-food sector.

  17. Detection of viral sequences in archival spinal cords from fatal cases of poliomyelitis in 1951-1952.

    PubMed

    Rekand, Tiina; Male, Rune; Myking, Andreas O; Nygaard, Svein J T; Aarli, Johan A; Haarr, Lars; Langeland, Nina

    2003-12-01

    Poliovirus (PV) subjected to genetic characterization is often isolated from faecal carriage. Such virus is not necessarily identical to the virus causing paralytic disease since genetic modifications may occur during replication outside the nervous system. We have searched for poliovirus genomes in the 14 fatal cases occurring during the last epidemics in Norway in 1951-1952. A method was developed for isolation and analysis of poliovirus RNA from formalin-fixed and paraffin-embedded archival tissue. RNA was purified by incubation with Chelex-100 and heating followed by treatment with the proteinase K and chloroform extraction. Viral sequences were amplified by a reverse transcriptase-polymerase chain reaction (RT-PCR), the products subjected to TA cloning and sequenced. RNA from the beta-actin gene, as a control, was identified in 13 cases, while sequences specific for poliovirus were achieved in 11 cases. The sequences from the 2C region of poliovirus were rather conserved while those in the 5'-untranslated region were variable. The developed method should be suitable also for other genetic studies of old archival material.

  18. Analytical validation of a real-time reverse transcription polymerase chain reaction test for Pan-American lineage H7 subtype Avian influenza viruses

    USGS Publications Warehouse

    Spackman, Erica; Ip, Hon S.; Suarez, D.L.; Slemons, R.D.; Stallknecht, D.E.

    2008-01-01

    A real-time reverse transcription polymerase chain reaction test for the identification of the H7 subtype in North American Avian influenza viruses (AIVs) was first reported in 2002; however, recent AIV surveillance efforts in wild birds and H7 outbreaks in poultry demonstrated that the 2002 test did not detect all H7 AIVs present in North and South America. Therefore, a new test, the 2008 Pan-American H7 test, was developed by using recently available H7 nucleotide sequences. The analytical specificity of the new assay was characterized with an RNA panel composed of 19 H7 viruses from around the world and RNA from all hemagglutinin subtypes except H16. Specificity for North and South American lineage H7 viruses was observed. Assay limits of detection were determined to be between 103 and 104 gene copies per reaction with in vitro transcribed RNA, and 100.0 and 10 0.8 50% egg infectious doses per reaction. The 2008 Pan-American H7 test also was shown to perform similarly to the 2002 test with specimens from chickens experimentally exposed to A/Chicken/BritishColumbia/314514-2/04 H7N3 highly pathogenic AIV. Furthermore, the 2008 test was able to detect 100% (n = 27) of the H7 AIV isolates recovered from North American wild birds in a 2006-2007 sample set (none of which were detected by the 2002 H7 test).

  19. Effect of sustained elevated temperature prior to amplification on template copy number estimation using digital polymerase chain reaction.

    PubMed

    Bhat, Somanath; McLaughlin, Jacob L H; Emslie, Kerry R

    2011-02-21

    Digital polymerase chain reaction (dPCR) has the potential to enable accurate quantification of target DNA copy number provided that all target DNA molecules are successfully amplified. Following duplex dPCR analysis from a linear DNA target sequence that contains single copies of two independent template sequences, we have observed that amplification of both templates in a single partition does not always occur. To investigate this finding, we heated the target DNA solution to 95 °C for increasing time intervals and then immediately chilled on ice prior to preparing the dPCR mix. We observed an exponential decline in estimated copy number (R(2)≥ 0.98) of the two template sequences when amplified from either a linearized plasmid or a 388 base pair (bp) amplicon containing the same two template sequences. The distribution of amplifiable templates and the final concentration (copies per µL) were both affected by heat treatment of the samples at 95 °C from 0 s to 30 min. The proportion of target sequences from which only one of the two templates was amplified in a single partition (either 1507 or hmg only) increased over time, while the proportion of target sequences where both templates were amplified (1507 and hmg) in each individual partition declined rapidly from 94% to 52% (plasmid) and 88% to 31% (388 bp amplicon) suggesting an increase in number of targets from which both templates no longer amplify. A 10 min incubation at 95 °C reduced the initial amplifiable template concentration of the plasmid and the 388 bp amplicon by 59% and 91%, respectively. To determine if a similar decrease in amplifiable target occurs during the default pre-activation step of typical PCR amplification protocol, we used mastermixes with a 20 s or 10 min hot-start. The choice of mastermix and consequent pre-activation time did not affect the estimated plasmid concentration. Therefore, we conclude that prolonged exposure of this DNA template to elevated temperatures could lead to significant bias in dPCR measurements. However, care must be taken when designing PCR and non-PCR based experiments by reducing exposure of the DNA template to sustained elevated temperatures in order to improve accuracy in copy number estimation and concentration determination.

  20. Chemoselective O-acylation of hydroxyamino acids and amino alcohols under acidic reaction conditions: History, scope and applications

    PubMed Central

    2015-01-01

    Summary Amino acids, whether natural, semisynthetic or synthetic, are among the most important and useful chiral building blocks available for organic chemical synthesis. In principle, they can function as inexpensive, chiral and densely functionalized starting materials. On the other hand, the use of amino acid starting materials routinely necessitates protective group chemistry, and in reality, large-scale preparations of even the simplest side-chain derivatives of many amino acids often become annoyingly strenuous due to the necessity of employing protecting groups, on one or more of the amino acid functionalities, during the synthetic sequence. However, in the case of hydroxyamino acids such as hydroxyproline, serine, threonine, tyrosine and 3,4-dihydroxyphenylalanine (DOPA), many O-acyl side-chain derivatives are directly accessible via a particularly expedient and scalable method not commonly applied until recently. Direct acylation of unprotected hydroxyamino acids with acyl halides or carboxylic anhydrides under appropriately acidic reaction conditions renders possible chemoselective O-acylation, furnishing the corresponding side-chain esters directly, on multigram-scale, in a single step, and without chromatographic purification. Assuming a certain degree of stability under acidic reaction conditions, the method is also applicable for a number of related compounds, such as various amino alcohols and the thiol-functional amino acid cysteine. While the basic methodology underlying this approach has been known for decades, it has evolved through recent developments connected to amino acid-derived chiral organocatalysts to become a more widely recognized procedure for large-scale preparation of many useful side-chain derivatives of hydroxyamino acids and related compounds. Such derivatives are useful in peptide chemistry and drug development, as amino acid amphiphiles for asymmetric catalysis, and as amino acid acrylic precursors for preparation of catalytically active macromolecular networks in the form of soluble polymers, crosslinked polymer beads or nanoparticulate systems. The objective of the present review is to increase awareness of the existence and convenience of this methodology, assess its competitiveness compared to newer and more elaborate procedures for chemoselective O-acylation reactions, spur its further development, and finally to chronicle the informative, but poorly documented history of its development. PMID:25977719

  1. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, S. N.

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  2. Bilateral lenticular Encephalitozoon cuniculi infection in a snow leopard (Panthera uncia).

    PubMed

    Scurrell, Emma Jane; Holding, Ellen; Hopper, Jane; Denk, Daniela; Fuchs-Baumgartinger, Andrea; Silbermayr, Katja; Nell, Barbara

    2015-01-01

    Bilateral phacoclastic uveitis caused by lenticular infection with Encephalitozoon cuniculi is described in a snow leopard. The diagnosis was made on histopathological and immunohistological examination of both eyes submitted after postmortem examination. There was a positive antibody titer for E. cuniculi (1:320). Polymerase chain reaction (PCR) and sequence analysis of formalin-fixed, paraffin-embedded ocular tissue detected the DNA of E. cuniculi, strain III. No other systemic lesions attributable to the E. cuniculi infection were identified. © 2014 American College of Veterinary Ophthalmologists.

  3. Ostertagia circumcincta: isolation of a partial cDNA encoding an unusual member of the mitochondrial processing peptidase subfamily of M16 metallopeptidases.

    PubMed

    Walker, J; Tait, A

    1997-11-01

    A reverse-transcriptase polymerase chain reaction (PCR) procedure was used to isolate an Ostertagia circumcincta partial cDNA encoding a protein with general primary sequence features characteristic of members of the mitochondrial processing peptidase (MPP) subfamily of M16 metallopeptidases. The structural relationships of the predicted protein (Oc MPPX) with MPP subfamily proteins from other species (including the model free-living nematode Caenorhabditis elegans) were examined, and Northern analysis confirmed the expression of the Oc mppx gene in adult nematodes.

  4. Mycobacterial lesions in fish, amphibians, reptiles, rodents, lagomorphs, and ferrets with reference to animal models.

    PubMed

    Reavill, Drury R; Schmidt, Robert E

    2012-01-01

    Mycobacteriosis is a serious disease across many animal species. Approximately more than 120 species are currently recognized in the genus Mycobacterium. This article describes the zoonotic potential of mycobacteria and mycobacteriosis in fish, amphibians, rodents, rabbits, and ferrets. It considers clinical signs; histology; molecular methods of identification, such as polymerase chain reaction and DNA sequencing; routes of infection; and disease progression. Studying the disease in animals may aid in understanding the pathogenesis of mycobacterial infections in humans and identify better therapy and preventative options such as vaccines.

  5. CYP3A4*18: it is not rare allele in Japanese population.

    PubMed

    Yamamoto, Takehito; Nagafuchi, Nobue; Ozeki, Takeshi; Kubota, Takahiro; Ishikawa, Hiroshi; Ogawa, Seishi; Yamada, Yasuhiko; Hirai, Hisamaru; Iga, Tatsuji

    2003-01-01

    We sequenced all 13 exons of the CYP3A4 gene derived from 48 Japanese subjects. One subject possess the 20070 T>C mutation in the exon 10 (result in leu293Pro substitution, namely CYP3A4(*)18), as heterozygote. Thus, we investigated the frequency of CYP3A4(*)18 in 118 Japanese population using polymerase chain reaction-restriction fragment length polymorphism with Msp I and determined that the frequency of the CYP3A4(*)18 allele was 1.3%.

  6. Differentiation among isolates of prunus necrotic ringspot virus by transcript conformation polymorphism.

    PubMed

    Rosner, A; Maslenin, L; Spiegel, S

    1998-09-01

    A method based on differences in electrophoretic mobility of RNA transcripts made from polymerase chain reaction (PCR) products was used for differentiation among virus isolates. A T7 RNA polymerase promoter was attached to amplified prunus necrotic ringspot virus (PNRSV) sequences by PCR. The PCR products then served as a template for transcription. Single-stranded transcripts originated from different PNRSV isolates varied in electrophoretic mobility in polyacrylamide gels, presumably because of transcript conformation polymorphism (TCP). This procedure was applied for the differentiation of PNRSV isolates.

  7. Huntingtin-interacting protein 1 (Hip1) and Hip1-related protein (Hip1R) bind the conserved sequence of clathrin light chains and thereby influence clathrin assembly in vitro and actin distribution in vivo.

    PubMed

    Chen, Chih-Ying; Brodsky, Frances M

    2005-02-18

    Clathrin heavy and light chains form triskelia, which assemble into polyhedral coats of membrane vesicles that mediate transport for endocytosis and organelle biogenesis. Light chain subunits regulate clathrin assembly in vitro by suppressing spontaneous self-assembly of the heavy chains. The residues that play this regulatory role are at the N terminus of a conserved 22-amino acid sequence that is shared by all vertebrate light chains. Here we show that these regulatory residues and others in the conserved sequence mediate light chain interaction with Hip1 and Hip1R. These related proteins were previously found to be enriched in clathrin-coated vesicles and to promote clathrin assembly in vitro. We demonstrate Hip1R binding preference for light chains associated with clathrin heavy chain and show that Hip1R stimulation of clathrin assembly in vitro is blocked by mutations in the conserved sequence of light chains that abolish interaction with Hip1 and Hip1R. In vivo overexpression of a fragment of clathrin light chain comprising the Hip1R-binding region affected cellular actin distribution. Together these results suggest that the roles of Hip1 and Hip1R in affecting clathrin assembly and actin distribution are mediated by their interaction with the conserved sequence of clathrin light chains.

  8. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  9. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  10. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  11. Emilio Segrè and Spontaneous Fission

    Science.gov Websites

    fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

  12. Sensitive electrochemical assaying of DNA methyltransferase activity based on mimic-hybridization chain reaction amplified strategy.

    PubMed

    Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin

    2016-08-24

    A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. DNA assembly with error correction on a droplet digital microfluidics platform.

    PubMed

    Khilko, Yuliya; Weyman, Philip D; Glass, John I; Adams, Mark D; McNeil, Melanie A; Griffin, Peter B

    2018-06-01

    Custom synthesized DNA is in high demand for synthetic biology applications. However, current technologies to produce these sequences using assembly from DNA oligonucleotides are costly and labor-intensive. The automation and reduced sample volumes afforded by microfluidic technologies could significantly decrease materials and labor costs associated with DNA synthesis. The purpose of this study was to develop a gene assembly protocol utilizing a digital microfluidic device. Toward this goal, we adapted bench-scale oligonucleotide assembly methods followed by enzymatic error correction to the Mondrian™ digital microfluidic platform. We optimized Gibson assembly, polymerase chain reaction (PCR), and enzymatic error correction reactions in a single protocol to assemble 12 oligonucleotides into a 339-bp double- stranded DNA sequence encoding part of the human influenza virus hemagglutinin (HA) gene. The reactions were scaled down to 0.6-1.2 μL. Initial microfluidic assembly methods were successful and had an error frequency of approximately 4 errors/kb with errors originating from the original oligonucleotide synthesis. Relative to conventional benchtop procedures, PCR optimization required additional amounts of MgCl 2 , Phusion polymerase, and PEG 8000 to achieve amplification of the assembly and error correction products. After one round of error correction, error frequency was reduced to an average of 1.8 errors kb - 1 . We demonstrated that DNA assembly from oligonucleotides and error correction could be completely automated on a digital microfluidic (DMF) platform. The results demonstrate that enzymatic reactions in droplets show a strong dependence on surface interactions, and successful on-chip implementation required supplementation with surfactants, molecular crowding agents, and an excess of enzyme. Enzymatic error correction of assembled fragments improved sequence fidelity by 2-fold, which was a significant improvement but somewhat lower than expected compared to bench-top assays, suggesting an additional capacity for optimization.

  14. Linkage analysis with multiplexed short tandem repeat polymorphisms using infrared fluorescence and M13 tailed primers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oetting, W.S.; Lee, H.K.; Flanders, D.J.

    The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less

  15. Chain Reaction Polymerization.

    ERIC Educational Resources Information Center

    McGrath, James E.

    1981-01-01

    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  16. Characterizing Chain Processes in Visible Light Photoredox Catalysis

    PubMed Central

    Cismesia, Megan A.

    2015-01-01

    The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708

  17. Sequence-Based Discovery Demonstrates That Fixed Light Chain Human Transgenic Rats Produce a Diverse Repertoire of Antigen-Specific Antibodies.

    PubMed

    Harris, Katherine E; Aldred, Shelley Force; Davison, Laura M; Ogana, Heather Anne N; Boudreau, Andrew; Brüggemann, Marianne; Osborn, Michael; Ma, Biao; Buelow, Benjamin; Clarke, Starlynn C; Dang, Kevin H; Iyer, Suhasini; Jorgensen, Brett; Pham, Duy T; Pratap, Payal P; Rangaswamy, Udaya S; Schellenberger, Ute; van Schooten, Wim C; Ugamraj, Harshad S; Vafa, Omid; Buelow, Roland; Trinklein, Nathan D

    2018-01-01

    We created a novel transgenic rat that expresses human antibodies comprising a diverse repertoire of heavy chains with a single common rearranged kappa light chain (IgKV3-15-JK1). This fixed light chain animal, called OmniFlic, presents a unique system for human therapeutic antibody discovery and a model to study heavy chain repertoire diversity in the context of a constant light chain. The purpose of this study was to analyze heavy chain variable gene usage, clonotype diversity, and to describe the sequence characteristics of antigen-specific monoclonal antibodies (mAbs) isolated from immunized OmniFlic animals. Using next-generation sequencing antibody repertoire analysis, we measured heavy chain variable gene usage and the diversity of clonotypes present in the lymph node germinal centers of 75 OmniFlic rats immunized with 9 different protein antigens. Furthermore, we expressed 2,560 unique heavy chain sequences sampled from a diverse set of clonotypes as fixed light chain antibody proteins and measured their binding to antigen by ELISA. Finally, we measured patterns and overall levels of somatic hypermutation in the full B-cell repertoire and in the 2,560 mAbs tested for binding. The results demonstrate that OmniFlic animals produce an abundance of antigen-specific antibodies with heavy chain clonotype diversity that is similar to what has been described with unrestricted light chain use in mammals. In addition, we show that sequence-based discovery is a highly effective and efficient way to identify a large number of diverse monoclonal antibodies to a protein target of interest.

  18. MHC Class I Chain-Related Gene A Polymorphisms and Linkage Disequilibrium with HLA-B and HLA-C Alleles in Ocular Toxoplasmosis.

    PubMed

    Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos

    2015-01-01

    This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05-4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22-0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population.

  19. MHC Class I Chain-Related Gene A Polymorphisms and Linkage Disequilibrium with HLA-B and HLA-C Alleles in Ocular Toxoplasmosis

    PubMed Central

    Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos

    2015-01-01

    This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05–4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22–0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population. PMID:26672749

  20. Molecular cloning of the myo-inositol oxygenase gene from the kidney of baboons

    PubMed Central

    González-Álvarez, Rafael; Pérez-Ibave, Diana Cristina; Garza-Rodríguez, María Lourdes; Lugo-Trampe, Ángel; Delgado-Enciso, Iván; Tejero-Barrera, María Elizabeth; Martínez-De-Villarreal, Laura Elia; Garza-Guajardo, Raquel; Sánchez-Chaparro, María Marisela; Ruiz-Ayma, Gabriel; Barboza-Quintana, Oralia; Barrera-Saldaña, Hugo Alberto; Rocha-Pizaña, María Del Refugio; Rodríguez-Sánchez, Irám Pablo

    2017-01-01

    The enzyme myo-Inositol oxygenase (MIOX) is also termed ALDRL6. It is a kidney-specific member of the aldo-keto reductase family. MIOX catalyzes the first reaction involved in the myo-inositol metabolism signaling pathway and is fully expressed in mammalian tissues. MIOX catalyzes the oxidative cleavage of myo-Inositol and its epimer, D-chiro-Inositol to D-glucuronate. The dioxygen-dependent cleavage of the C6 and C1 bond in myo-Inositol is achieved by utilizing the Fe2+/Fe3+ binuclear iron center of MIOX. This enzyme has also been implicated in the complications of diabetes, including diabetic nephropathy. The MIOX gene was amplified with reverse transcription-polymerase chain reaction from baboon tissue samples, and the product was cloned and sequenced. MIOX expression in the baboon kidney is described in the present study. The percentages of nucleotide and amino acid similarities between baboons and humans were 95 and 96%, respectively. The MIOX protein of the baboon may be structurally identical to that of humans. Furthermore, the evolutionary changes, which have affected these sequences, have resulted from purifying forces. PMID:29085625

  1. Molecular cloning of the myo-inositol oxygenase gene from the kidney of baboons.

    PubMed

    González-Álvarez, Rafael; Pérez-Ibave, Diana Cristina; Garza-Rodríguez, María Lourdes; Lugo-Trampe, Ángel; Delgado-Enciso, Iván; Tejero-Barrera, María Elizabeth; Martínez-De-Villarreal, Laura Elia; Garza-Guajardo, Raquel; Sánchez-Chaparro, María Marisela; Ruiz-Ayma, Gabriel; Barboza-Quintana, Oralia; Barrera-Saldaña, Hugo Alberto; Rocha-Pizaña, María Del Refugio; Rodríguez-Sánchez, Irám Pablo

    2017-10-01

    The enzyme myo-Inositol oxygenase (MIOX) is also termed ALDRL6. It is a kidney-specific member of the aldo-keto reductase family. MIOX catalyzes the first reaction involved in the myo-inositol metabolism signaling pathway and is fully expressed in mammalian tissues. MIOX catalyzes the oxidative cleavage of myo-Inositol and its epimer, D-chiro-Inositol to D-glucuronate. The dioxygen-dependent cleavage of the C6 and C1 bond in myo-Inositol is achieved by utilizing the Fe 2+ /Fe 3+ binuclear iron center of MIOX. This enzyme has also been implicated in the complications of diabetes, including diabetic nephropathy. The MIOX gene was amplified with reverse transcription-polymerase chain reaction from baboon tissue samples, and the product was cloned and sequenced. MIOX expression in the baboon kidney is described in the present study. The percentages of nucleotide and amino acid similarities between baboons and humans were 95 and 96%, respectively. The MIOX protein of the baboon may be structurally identical to that of humans. Furthermore, the evolutionary changes, which have affected these sequences, have resulted from purifying forces.

  2. Non-lethal sampling for the detection of Myxobolus cerebralis in asymptomatic rainbow trout

    USGS Publications Warehouse

    Schill, Bane; Waldrop, Thomas; Densmore, Christine; Blazer, Vicki

    1999-01-01

    We have described in previous reports (Schill et al., 1998) the development of a polymerase chain reaction (PCR) amplification of 18S ribosomal RNA for the detection of Myxozoan parasites. Oligonucleotide primers were developed by multiple alignment of Myxozoan sequence information and analysis by a custom-written computer program (PRIM). Candidate pairs of primer sequences were then analyzed for specificity by BLAST (Basic Local Alignment Search Tool). From these, a set of promising primers (MYXFWD and MYXREV) was chosen for further testing. These were chosen because they should direct detection of a number of Myxozoan species (Table 1). PCR using MXYFWD and MYXREV proved to be robust and relatively free of artifact products. Further, we were able to routinely detect Myxobolus cerebralis in fish tissues (Figure 1).

  3. GATA3 mutation in a family with hypoparathyroidism, deafness and renal dysplasia syndrome.

    PubMed

    Zhu, Zi-Yang; Zhou, Qiao-Li; Ni, Shi-Ning; Gu, Wei

    2014-08-01

    The hypoparathyroidism, deafness and renal dysplasia (HDR) syndrome is an autosomal dominant disorder primarily caused by GATA3 gene mutation. We report here a case that both of a Chinese boy and his father had HDR syndrome which caused by a novel mutation of GATA3. Polymerase chain reaction and DNA sequencing was performed to detect the exons of the GATA3 gene for mutation analysis. Sequence analysis of GATA3 revealed a heterozygous nonsense mutation in this family: a mutation of GATA3 at exon 2 (c.515C >A) that resulted in a premature stop at codon 172 (p.S172X) with a loss of two zinc finger domains. We identified a novel nonsense mutation which will expand the spectrum of HDR-associated GATA3 mutations.

  4. Isolation and characterization of cDNAs encoding wheat 3-hydroxy-3-methylglutaryl coenzyme A reductase.

    PubMed Central

    Aoyagi, K; Beyou, A; Moon, K; Fang, L; Ulrich, T

    1993-01-01

    The enzyme 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR, EC 1.1.1.34) is a key enzyme in the isoprenoid biosynthetic pathway. We have isolated partial cDNAs from wheat (Triticum aestivum) using the polymerase chain reaction. Comparison of deduced amino acid sequences of these cDNAs shows that they represent a small family of genes that share a high degree of sequence homology among themselves as well as among genes from other organisms including tomato, Arabidopsis, hamster, human, Drosophila, and yeast. Southern blot analysis reveals the presence of at least four genes. Our results concerning the tissue-specific expression as well as developmental regulation of these HMGR cDNAs highlight the important role of this enzyme in the growth and development of wheat. PMID:8108513

  5. Siadenovirus infection in two psittacine bird species.

    PubMed

    Wellehan, James F X; Greenacre, Cheryl B; Fleming, Gregory J; Stetter, Mark D; Childress, April L; Terrell, Scott P

    2009-10-01

    Consensus polymerase chain reaction was used to identify a novel adenovirus from two psittacine birds: a plum-headed parakeet (Psittacula cyanocephala) with lethargy, weight loss, and marked leukocytosis; and an umbrella cockatoo (Cacatua alba) with lethargy, weight loss, and feather abnormalities. Phylogenetic and comparative sequence analysis suggested that this virus is a member of the genus Siadenovirus, and is here termed psittacine adenovirus 2. This extends the characterized adenoviruses of psittacine birds beyond Aviadenovirus to include the genus Siadenovirus. Identification and further study of adenoviral types and species will provide useful diagnostic, prognostic, and epidemiologic information for the clinician. Like other known members of the genus Siadenovirus, Psittacine adenovirus 2 is AT-rich over the region sequenced, and it is hypothesized that this may be associated with shorter host-virus evolutionary association.

  6. Gold nanoparticles for high-throughput genotyping of long-range haplotypes

    NASA Astrophysics Data System (ADS)

    Chen, Peng; Pan, Dun; Fan, Chunhai; Chen, Jianhua; Huang, Ke; Wang, Dongfang; Zhang, Honglu; Li, You; Feng, Guoyin; Liang, Peiji; He, Lin; Shi, Yongyong

    2011-10-01

    Completion of the Human Genome Project and the HapMap Project has led to increasing demands for mapping complex traits in humans to understand the aetiology of diseases. Identifying variations in the DNA sequence, which affect how we develop disease and respond to pathogens and drugs, is important for this purpose, but it is difficult to identify these variations in large sample sets. Here we show that through a combination of capillary sequencing and polymerase chain reaction assisted by gold nanoparticles, it is possible to identify several DNA variations that are associated with age-related macular degeneration and psoriasis on significant regions of human genomic DNA. Our method is accurate and promising for large-scale and high-throughput genetic analysis of susceptibility towards disease and drug resistance.

  7. Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

    2016-09-15

    It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

  8. Haplosporidium nelsoni (MSX) in Japanese scallops Patinopecten yessoensis (Jay, 1857) from Dalian along the northern coast of the Yellow Sea, China.

    PubMed

    Wang, Zhongwei; Lu, Xin; Liang, Yubo

    2012-04-01

    The protozoan parasite Haplosporidium nelsoni (MSX) was identified in Japanese scallops Patinopecten yessoensis (Jay, 1857) from Dalian along the northern coast of the Yellow Sea, China by histopathologic examination, polymerase chain reaction (PCR) amplification, and in situ hybridization (ISH) assay. H. nelsoni plasmodia-like structures were identified in the digestive glands of scallops by histologic examination, but no parasite spores were observed. PCR using the Hap-F2, R2 primer pair produced a sequence with 100% homology with the corresponding small subunit rDNA region of H. nelsoni. An ISH assay using the oligonucleotide probe MSX1347 produced a positive reaction with the Japanese scallop parasite. This is the first report of H. nelsoni in P. yessoensis in China.

  9. Synthesis of functionalized imidazolidine-2-thiones via NHC/base-promoted aza-benzoin/aza-acetalization domino reactions.

    PubMed

    Di Carmine, Graziano; Ragno, Daniele; De Risi, Carmela; Bortolini, Olga; Giovannini, Pier Paolo; Fantin, Giancarlo; Massi, Alessandro

    2017-10-25

    A strategy for the synthesis of biologically relevant 5-hydroxy-imidazolidine-2-thione derivatives is presented. A novel class of α-sulfonylamines have been suitably prepared (46-81% yield) as precursors of formal benzylidenethiourea acceptors; these are generated in situ and intercepted by N-heterocyclic carbene (NHC)-activated aldehydes affording open-chain aza-benzoin-type adducts, which in turn undergo an intramolecular aza-acetalization reaction in a one-pot fashion. A thiazolium salt/triethylamine couple proved to be the more effective system to trigger the domino sequence giving the target heterocycles in good yields (45-97%) and diastereoselectivities (up to 99 : 1 dr). The multigram scale synthesis and elaboration of a selected 5-hydroxy-imidazolidine-2-thione compound is also described.

  10. A nucleotide sequence comparison of coxsackievirus B4 isolates from aquatic samples and clinical specimens.

    PubMed Central

    Hughes, M. S.; Hoey, E. M.; Coyle, P. V.

    1993-01-01

    Ten coxsackievirus B4 (CVB4) strains isolated from clinical and environmental sources in Northern Ireland in 1985-7, were compared at the nucleotide sequence level. Dideoxynucleotide sequencing of a polymerase chain reaction (PCR) amplified fragment, spanning the VP1/P2A genomic region, classified the isolates into two distinct groups or genotypes as defined by Rico-Hesse and colleagues for poliovirus type 1. Isolates within each group shared approximately 99% sequence identity at the nucleotide level whereas < or = 86% sequence identity was shared between groups. One isolate derived from a clinical specimen in 1987 was grouped with six CVB4 isolates recovered from the aquatic environment in 1986-7. The second group comprised CVB4 isolates from clinical specimens in 1985-6. Both groups were different at the nucleotide level from the prototype strain isolated in 1950. It was concluded that the method could be used to sub-type CVB4 isolates and would be of value in epidemiological studies of CVB4. Predicted amino acid sequences revealed non-conservation of the tyrosine residue at the VP1/P2A cleavage site but were of little value in distinguishing CVB4 variants. PMID:8386098

  11. Analysis for complete genomic sequence of HLA-B and HLA-C alleles in the Chinese Han population.

    PubMed

    Zhu, F; He, Y; Zhang, W; He, J; He, J; Xu, X; Lv, H; Yan, L

    2011-08-01

    In the present study, we have determined the complete genomic sequence and analysed the intron polymorphism of partial HLA-B and HLA-C alleles in the Chinese Han population. Over 3.0 kb DNA fragments of HLA-B and HLA-C loci were amplified by polymerase chain reaction from partial 5' untranslated region to 3' noncoding region respectively, and then the amplified products were sequenced. Full-length nucleotide sequences of 14 HLA-B alleles and 10 HLA-C alleles were obtained and have been submitted to GenBank and IMGT/HLA database. Two novel alleles of HLA-B*52:01:01:02 and HLA-B*59:01:01:02 were identified, and the complete genomic sequence of HLA-B*52:01:01:01 was firstly reported. Totally 157 and 167 polymorphism positions were found in the full-length genomic sequence of HLA-B and HLA-C loci respectively. Our results suggested that many single nucleotide polymorphisms existed in the exon and intron regions, and the data can provide useful information for understanding the evolution of HLA-B and HLA-C alleles. © 2011 Blackwell Publishing Ltd.

  12. An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

    PubMed

    Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

    2011-01-01

    cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

  13. Gambling on a shortcut to genome sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Roberts, L.

    1991-06-21

    Almost from the start of the Human Genome Project, a debate has been raging over whether to sequence the entire human genome, all 3 billion bases, or just the genes - a mere 2% or 3% of the genome, and by far the most interesting part. In England, Sydney Brenner convinced the Medical Research Council (MRC) to start with the expressed genes, or complementary DNAs. But the US stance has been that the entire sequence is essential if we are to understand the blueprint of man. Craig Venter of the National Institute of Neurological Disorders and Stroke says that focusingmore » on the expressed genes may be even more useful than expected. His strategy involves randomly selecting clones from cDNA libraries which theoretically contain all the genes that are switched on at a particular time in a particular tissue. Then the researchers sequence just a short stretch of each clone, about 400 to 500 bases, to create can expressed sequence tag or EST. The sequences of these ESTs are then stored in a database. Using that information, other researchers can then recreate that EST by using polymerase chain reaction techniques.« less

  14. Hepatitis C virus genotypes in Singapore and Indonesia.

    PubMed

    Ng, W C; Guan, R; Tan, M F; Seet, B L; Lim, C A; Ngiam, C M; Sjaifoellah Noer, H M; Lesmana, L

    1995-01-01

    5' untranslated and partial core (C) region sequence of hepatitis C virus (HCV) in 21 Singaporean and 15 Indonesian isolates were amplified by reverse-transcription polymerase chain reaction and sequenced with the use of conserved primer sequences deduced from HCV genomes identified in other geographical regions. The HCV genotypes are predominantly that of Simmonds type 1 and less of type 2 and 3 with the latter genotype currently not detected in Indonesia. The 5' untranslated sequences are related to HCV-1. DK-7 (Denmark), US-11 (United States of America), HCV-J4, SA-10 (South Africa), T-3 (Taiwan), HCV-J6, HCV-J8, Eb-1 and Eb-8. When compared with the prototype HCV-1, insertions are found within the 5' untranslated region of Singaporean isolates and not in the Indonesians. There are Singaporean and Indonesian isolates that have sequences within the 5' untranslated region that differ slightly from each other. Microheterogeneity is observed in the core region of two Singaporeans and one Indonesian isolate. Finally, not all HCV isolates can be amplified with the conserved core sequence primers when compared with the ease with which these isolates can be amplified with 5' untranslated region conserved primers.

  15. VarDict: a novel and versatile variant caller for next-generation sequencing in cancer research

    PubMed Central

    Lai, Zhongwu; Markovets, Aleksandra; Ahdesmaki, Miika; Chapman, Brad; Hofmann, Oliver; McEwen, Robert; Johnson, Justin; Dougherty, Brian; Barrett, J. Carl; Dry, Jonathan R.

    2016-01-01

    Abstract Accurate variant calling in next generation sequencing (NGS) is critical to understand cancer genomes better. Here we present VarDict, a novel and versatile variant caller for both DNA- and RNA-sequencing data. VarDict simultaneously calls SNV, MNV, InDels, complex and structural variants, expanding the detected genetic driver landscape of tumors. It performs local realignments on the fly for more accurate allele frequency estimation. VarDict performance scales linearly to sequencing depth, enabling ultra-deep sequencing used to explore tumor evolution or detect tumor DNA circulating in blood. In addition, VarDict performs amplicon aware variant calling for polymerase chain reaction (PCR)-based targeted sequencing often used in diagnostic settings, and is able to detect PCR artifacts. Finally, VarDict also detects differences in somatic and loss of heterozygosity variants between paired samples. VarDict reprocessing of The Cancer Genome Atlas (TCGA) Lung Adenocarcinoma dataset called known driver mutations in KRAS, EGFR, BRAF, PIK3CA and MET in 16% more patients than previously published variant calls. We believe VarDict will greatly facilitate application of NGS in clinical cancer research. PMID:27060149

  16. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    PubMed

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  17. Characterization of Fasciola samples by ITS of rDNA sequences revealed the existence of Fasciola hepatica and Fasciola gigantica in Yunnan Province, China.

    PubMed

    Shu, Fan-Fan; Lv, Rui-Qing; Zhang, Yi-Fang; Duan, Gang; Wu, Ding-Yu; Li, Bi-Feng; Yang, Jian-Fa; Zou, Feng-Cai

    2012-08-01

    On mainland China, liver flukes of Fasciola spp. (Digenea: Fasciolidae) can cause serious acute and chronic morbidity in numerous species of mammals such as sheep, goats, cattle, and humans. The objective of the present study was to examine the taxonomic identity of Fasciola species in Yunnan province by sequences of the first and second internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA). The ITS rDNA was amplified from 10 samples representing Fasciola species in cattle from 2 geographical locations in Yunnan Province, by polymerase chain reaction (PCR), and the products were sequenced directly. The lengths of the ITS-1 and ITS-2 sequences were 422 and 361-362 base pairs, respectively, for all samples sequenced. Using ITS sequences, 2 Fasciola species were revealed, namely Fasciola hepatica and Fasciola gigantica. This is the first demonstration of F. gigantica in cattle in Yunnan Province, China using a molecular approach; our findings have implications for studying the population genetic characterization of the Chinese Fasciola species and for the prevention and control of Fasciola spp. in this province.

  18. Enrichment of individual KIR2DL4 sequences from genomic DNA using long-template PCR and allele-specific hybridization to magnetic bead-bound oligonucleotide probes.

    PubMed

    Roberts, C H; Turino, C; Madrigal, J A; Marsh, S G E

    2007-06-01

    DNA enrichment by allele-specific hybridization (DEASH) was used as a means to isolate individual alleles of the killer cell immunoglobulin-like receptor (KIR2DL4) gene from heterozygous genomic DNA. Using long-template polymerase chain reaction (LT-PCR), the complete KIR2DL4 gene was amplified from a cell line that had previously been characterized for its KIR gene content by PCR using sequence-specific primers (PCR-SSP). The whole gene amplicons were sequenced and we identified two heterozygous positions in accordance with the predictions of the PCR-SSP. The amplicons were then hybridized to allele-specific, biotinylated oligonucleotide probes and through binding to streptavidin-coated beads, the targeted alleles were enriched. A second PCR amplified only the exonic regions of the enriched allele, and these were then sequenced in full. We show DEASH to be capable of enriching single alleles from a heterozygous PCR product, and through sequencing the enriched DNA, we are able to produce complete coding sequences of the KIR2DL4 alleles in accordance with the typing predicted by PCR-SSP.

  19. Characterization of four species of Trichuris (Nematoda: Enoplida) by their second internal transcribed spacer ribosomal DNA sequence.

    PubMed

    Oliveros, R; Cutillas, C; De Rojas, M; Arias, P

    2000-12-01

    Adult worms of Trichuris ovis and T. globulosa were collected from Ovis aries (sheep) and Capra hircus (goats). T. suis was isolated from Sus scrofa domestica (swine) and T. leporis was isolated from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and a ribosomal internal transcribed spacer (ITS2) was amplified and sequenced using polymerase-chain-reaction (PCR) techniques. The ITS2 of T. ovis and T. globulosa was 407 nucleotides in length and had a GC content of about 62%. Furthermore, the ITS2 of T. suis and T. leporis was 534 and 418 nucleotides in length and had a GC content of about 64.8% and 62.4%, respectively. There was evidence of slight variation in the sequence within individuals of all species analyzed, indicating intraindividual variation in the sequence of different copies of the ribosomal DNA. Furthermore, low-level intraspecific variation was detected. Sequence analyses of ITS2 products of T. ovis and T. globulosa demonstrated no sequence difference between them. Nevertheless, differences were detected between the ITS2 sequences of T. suis, T. leporis, and T. ovis, indicating that Trichuris species can reliably be differentiated by their ITS2 sequences and PCR-linked restriction-fragment-length polymorphism (RFLP).

  20. Diagnosing leprosy: revisiting the role of the slit-skin smear with critical analysis of the applicability of polymerase chain reaction in diagnosis.

    PubMed

    Banerjee, Surajita; Biswas, Nibir; Kanti Das, Nilay; Sil, Amrita; Ghosh, Pramit; Hasanoor Raja, Abu Hena; Dasgupta, Sarbani; Kanti Datta, Pijush; Bhattacharya, Basudev

    2011-12-01

    Diagnosing leprosy is challenging, especially in early-stage cases, and the need for a sensitive diagnostic tool is urgent. Polymerase chain reaction (PCR) holds promise as a simple and sensitive diagnostic tool, but its usefulness in the Indian context requires further evaluation. Slit-skin smear (SSS) remains the conventional method of leprosy detection. Hence, this study was undertaken to evaluate and compare the diagnostic efficacy of PCR versus that of SSS. Punch biopsy of skin and SSS were obtained from the active margins of lesions. Cases were clinically grouped according to whether they were multibacillary (MB) or paucibacillary (PB) and classified into tuberculoid (TT), borderline tuberculoid (BT), borderline lepromatous (BL), lepromatous (LL), histoid, and indeterminate groups after clinicopathological correlation. DNA was extracted from biopsy specimens, and multiplex PCR was carried out incorporating primers intended for the amplification of a specific 372-bp fragment of a repetitive sequence of Mycobacterium leprae DNA. Among 164 patients, PCR was positive in 82.3%. The sensitivity of PCR was significantly greater (P < 0.0001) than that of SSS in both the MB (85.9% vs. 59.8%) and PB (75.4% vs. 1.8%) subgroups; the difference in sensitivity in the PB subgroup is remarkable. Positivity by PCR and SSS was found in 100% of LL and histoid leprosy, but PCR had significantly greater (P < 0.0001) positivity in BT leprosy and was of definite increased value in indeterminate and TT leprosy. Polymerase chain reaction had higher sensitivity compared with SSS, especially in diagnostically challenging and PB cases. Thus, the use of this costly but sensitive tool should be restricted to this subgroup, because SSS is sufficiently sensitive in the diagnosis of LL and histoid leprosy. © 2011 The International Society of Dermatology.

Top