Effect of vehicular size on chain-reaction crash

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-11-01

We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

Kinetic aspects of chain growth in Fischer-Tropsch synthesis.

PubMed

Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M

2017-04-28

Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.

Organic reactions mediated by electrochemically generated ArS+.

PubMed

Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi

2011-04-21

Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.

Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

USDA-ARS?s Scientific Manuscript database

This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

PubMed

Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

2016-10-01

The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions

NASA Astrophysics Data System (ADS)

Zlokazov, V. B.; Utyonkov, V. K.

2017-07-01

The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

Press Releases | Argonne National Laboratory

Science.gov Websites

Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

EPA Science Inventory

This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

PubMed

Adewale, B; Mafe, M A; Oyerinde, J P O

2005-01-01

Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

2013-06-28

Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

PubMed Central

Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

2015-01-01

Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

Control and reduction of peak temperature in self-curing resins.

PubMed

Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A

2009-07-01

INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.

Introduction to Polymer Chemistry.

ERIC Educational Resources Information Center

Harris, Frank W.

1981-01-01

Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

An ab initio molecular dynamics and density functional theory study of the formation of phosphate chains from metathiophosphates.

PubMed

Mosey, Nicholas J; Woo, Tom K

2006-09-04

The reactions that occur between metathiophosphate (MTP) molecules are identified and examined through ab initio molecular dynamics simulations and static quantum chemical calculations at the density functional level of theory. The simulations show that certain types of MTPs can react to yield phosphate chains, while others only dimerize. These differences are rationalized in terms of reaction energies and the electronic structures of these molecules. In the reaction leading to the formation of phosphate chains, the reactive center, a tri-coordinate phosphorus atom, is continually regenerated. A polymerization mechanism linking MTPs to phosphate chains is developed on the basis of these results. This information sheds light on the underlying processes that may be responsible for the formation of phosphates under high-temperature conditions and may prove useful in the development of protocols for the rational synthesis of complex phosphate structures.

Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

PubMed

Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

2014-07-24

This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

PubMed

Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

2012-12-01

Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Parallel and automated library synthesis of 2-long alkyl chain benzoazoles and azole[4,5-b]pyridines under microwave irradiation.

PubMed

Martínez-Palou, Rafael; Zepeda, L Gerardo; Höpfl, Herbert; Montoya, Ascensión; Guzmán-Lucero, Diego J; Guzmán, Javier

2005-01-01

A versatile route to 40-membered library of 2-long alkyl chain substituted benzoazoles (1 and 2) and azole[4,5-b]pyridines (3 and 4) via microwave-assisted combinatorial synthesis was developed. The reactions were carried out in both monomode and multimode microwave oven. With the latter, all reactions were performed in high-throughput experimental settings consisting of an 8 x 5 combinatorial library designed to synthesize 40 compounds. Each step, from the addition of reagents to the recovery of final products, was automated. The microwave-assisted N-long chain alkylation reactions of 2-alkyl-1H-benzimidazole (1) and 2-alkyl-1H-benzimidazole[4,5-b] pyridines (3) were also studied.

Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins

NASA Astrophysics Data System (ADS)

Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John

2017-01-01

DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.

Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2014 CFR

2014-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2013 CFR

2013-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2012 CFR

2012-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

Emilio Segrè and Spontaneous Fission

Science.gov Websites

fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

Modeling the SOA Forming Potential of Substituted Dihydrofurans from Alkane + OH Reactions in the Atmosphere

NASA Astrophysics Data System (ADS)

Jordan, C. E.; Griffin, R. J.; Lim, Y. B.; Ziemann, P. J.; Atkinson, R.; Arey, J.

2005-12-01

Recent laboratory studies show that δ-hydroxycarbonyls formed in the atmosphere via OH-initiated reactions with alkanes can cyclize then dehydrate to form substituted dihydrofurans. These dihydrofurans are highly reactive, with lifetimes in the atmosphere of 1.3 h (OH), 24 s (NO3), and 7 min (O3). The ability of the δ-hydroxycarbonyls to cyclize and dehydrate has been shown to increase with increasing carbon number. Recent laboratory results show that the secondary organic aerosol (SOA) yields from alkanes also increase with carbon number reaching ~53% for C15. The reaction mechanism proposed based on the chamber results is the basis of the modeling study presented here. We have incorporated this proposed mechanism into the Caltech Atmospheric Chemistry Mechanism (CACM). For computational reasons, similar compounds are lumped together and represented by a single suitable compound. In the present case, alkanes are lumped into 3 groups: short chains (≤C6), medium chains (C7 - C12), and long chains (≥C13). SOA yields obtained in chamber studies increase dramatically from 0.5% for C8 to 25% for C12. The most dramatic increase is observed from C11 (8%) to C13 (~50%). This is attributed to the low volatility of first generation products contributing to the SOA from longer chain alkanes. Here we have studied OH reactions with the substituted dihydrofurans for medium (represented by C10) and long (represented by C16) chain alkanes using CACM along with the aerosol partitioning module MPMPO (Model to Predict the Multi-phase Partitioning of Organics). We will present the results of this modeling study, characterizing the influence of substituted dihydrofurans on the SOA forming potential of alkanes.

Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

PubMed

Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

1997-09-01

In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

Chain Reaction Polymerization.

ERIC Educational Resources Information Center

McGrath, James E.

1981-01-01

The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

Characterizing Chain Processes in Visible Light Photoredox Catalysis

PubMed Central

Cismesia, Megan A.

2015-01-01

The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708

THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST

PubMed Central

Keil, Harry; Wasserman, David; Dawson, Charles R.

1944-01-01

1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415

THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST.

PubMed

Keil, H; Wasserman, D; Dawson, C R

1944-10-01

1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.

Efficient sampling of reversible cross-linking polymers: Self-assembly of single-chain polymeric nanoparticles

NASA Astrophysics Data System (ADS)

Oyarzún, Bernardo; Mognetti, Bortolo Matteo

2018-03-01

We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.

Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

2016-09-15

It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

Excitation wavelength dependence of excited state intramolecular proton transfer reaction of 4'-N,N-diethylamino-3-hydroxyflavone in room temperature ionic liquids studied by optical Kerr gate fluorescence measurement.

PubMed

Suda, Kayo; Terazima, Masahide; Sato, Hirofumi; Kimura, Yoshifumi

2013-10-17

Excited state intramolecular proton transfer reactions (ESIPT) of 4'-N,N-diethylamino-3-hydroxyflavone (DEAHF) in ionic liquids have been studied by steady-state and time-resolved fluorescence measurements at different excitation wavelengths. Steady-state measurements show the relative yield of the tautomeric form to the normal form of DEAHF decreases as excitation wavelength is increased from 380 to 450 nm. The decrease in yield is significant in ionic liquids that have cations with long alkyl chains. The extent of the decrease is correlated with the number of carbon atoms in the alkyl chains. Time-resolved fluorescence measurements using optical Kerr gate spectroscopy show that ESIPT rate has a strong excitation wavelength dependence. There is a large difference between the spectra at a 200 ps delay from different excitation wavelengths in each ionic liquid. The difference is pronounced in ionic liquids having a long alkyl chain. The equilibrium constant in the electronic excited state obtained at a 200 ps delay and the average reaction rate are also correlated with the alkyl chain length. Considering the results of the steady-state fluorescence and time-resolved measurements, the excitation wavelength dependence of ESIPT is explained by state selective excitation due to the difference of the solvation, and the number of alkyl chain carbon atoms is found to be a good indicator of the effect of inhomogeneity for this reaction.

Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

PubMed

Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

2014-01-01

Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

Structure–Function Studies of Hydrophobic Residues That Clamp a Basic Glutamate Side Chain during Catalysis by Triosephosphate Isomerase

PubMed Central

2016-01-01

Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328

Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen

NASA Astrophysics Data System (ADS)

Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.

2017-12-01

The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.

Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

PubMed

Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

2014-03-01

The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

Preemptive Isolation Precautions of Patients at High Risk for Methicillin-Resistant Staphylococcus aureus in Combination With Ultrarapid Polymerase Chain Reaction Screening as an Effective Tool for Infection Control.

PubMed

Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael

2016-12-01

This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.

Synthesis of Side-Chain Oxysterols and their Enantiomers through Cross-Metathesis Reactions of Δ22 Steroids

PubMed Central

Brownholland, David P.

2017-01-01

A synthetic route that utilizes a cross-metathesis reaction with Δ22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. PMID:28300584

Neutron-deficient superheavy nuclei obtained in the 240Pu+48Ca reaction

NASA Astrophysics Data System (ADS)

Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu. Ts.; Rykaczewski, K. P.; Abdullin, F. Sh.; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu. S.; Voinov, A. A.; Subbotin, V. G.; Sukhov, A. M.; Karpov, A. V.; Popeko, A. G.; Sabel'nikov, A. V.; Svirikhin, A. I.; Vostokin, G. K.; Hamilton, J. H.; Kovrizhnykh, N. D.; Schlattauer, L.; Stoyer, M. A.; Gan, Z.; Huang, W. X.; Ma, L.

2018-01-01

We present new results from investigations of the 240Pu+48Ca reaction at a projectile energy of 250 MeV. Three new decay chains of 285Fl were detected with decay properties mostly consistent with those measured in earlier studies. An additional chain was observed where the nuclei may decay through energy levels different from those of the other six chains registered so far. The cross section of the 240Pu(48Ca,3 n )285Fl reaction was measured to be 0 .58-0.33+0.60pb , which is a factor of about 4-5 lower than that measured in the previous experiment at 245 MeV beam energy [V. K. Utyonkov et al., Phys. Rev. C 92, 034609 (2015)., 10.1103/PhysRevC.92.034609], consistent with expectations. The origin of an additional chain consisting of a recoil, α particle, and fission event is analyzed. The assignment of 25 short-lived SF events observed in this experiment is also discussed.

[Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

PubMed

Wang, F; Zhang, Y Q; Ding, J; Yu, L X

2017-10-18

To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

Additional chain-branching pathways in the low-temperature oxidation of branched alkanes

DOE PAGES

Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; ...

2015-12-31

Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C 8H 14O 4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C 8H 16O 5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C 8H 16O 5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O 2 addition, intramolecular isomerization, and OH release; C 8H 14O 4 species are proposed to result from subsequent reactions of C 8H 16O 5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less

[The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

PubMed

Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

2014-04-01

The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

A chain reaction approach to modelling gene pathways.

PubMed

Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

2012-08-01

BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By applying it to microarray data, the chain reaction model computed a set of reaction rates to examine the effects of three polyphenols (EGCG, genistein, and resveratrol) on gene expression in this pathway during puberty. We first performed statistical analysis to test the time factor on the estrogen synthesis pathway. Global tests were used to evaluate an overall gene expression change during puberty for each experimental group. Then, a chain reaction model was employed to simulate the estrogen synthesis pathway. Specifically, the model computed the reaction rates in a set of ordinary differential equations to describe interactions between genes in the pathway (A reaction rate K of A to B represents gene A will induce gene B per unit at a rate of K; we give details in the "method" section). Since disparate changes of gene expression may cause numerical error problems in solving these differential equations, we used an implicit scheme to address this issue. We first applied the chain reaction model to obtain the reaction rates for the control group. A sensitivity study was conducted to evaluate how well the model fits to the control group data at Day 50. Results showed a small bias and mean square error. These observations indicated the model is robust to low random noises and has a good fit for the control group. Then the chain reaction model derived from the control group data was used to predict gene expression at Day 50 for the three polyphenol groups. If these nutrients affect the estrogen synthesis pathways during puberty, we expect discrepancy between observed and expected expressions. Results indicated some genes had large differences in the EGCG (e.g., Hsd3b and Sts) and the resveratrol (e.g., Hsd3b and Hrmt12) groups. CONCLUSIONS: In the present study, we have presented (I) experimental studies of the effect of nutrient diets on the gene expression changes in a selected estrogen synthesis pathway. This experiment is valuable because it allows us to examine how the nutrient-containing diets regulate gene expression in the estrogen synthesis pathway during puberty; (II) global tests to assess an overall association of this particular pathway with time factor by utilizing generalized linear models to analyze microarray data; and (III) a chain reaction model to simulate the pathway. This is a novel application because we are able to translate the gene pathway into the chemical reactions in which each reaction channel describes gene-gene relationship in the pathway. In the chain reaction model, the implicit scheme is employed to efficiently solve the differential equations. Data analysis results show the proposed model is capable of predicting gene expression changes and demonstrating the effect of nutrient-containing diets on gene expression changes in the pathway. One of the objectives of this study is to explore and develop a numerical approach for simulating the gene expression change so that it can be applied and calibrated when the data of more time slices are available, and thus can be used to interpolate the expression change at a desired time point without conducting expensive experiments for a large amount of time points. Hence, we are not claiming this is either essential or the most efficient way for simulating this problem, rather a mathematical/numerical approach that can model the expression change of a large set of genes of a complex pathway. In addition, we understand the limitation of this experiment and realize that it is still far from being a complete model of predicting nutrient-gene interactions. The reason is that in the present model, the reaction rates were estimated based on available data at two time points; hence, the gene expression change is dependent upon the reaction rates and a linear function of the gene expressions. More data sets containing gene expression at various time slices are needed in order to improve the present model so that a non-linear variation of gene expression changes at different time can be predicted.

Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

NASA Technical Reports Server (NTRS)

Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

1998-01-01

Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

Blood grouping based on PCR methods and agarose gel electrophoresis.

PubMed

Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

2015-01-01

The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

The Beta-Delayed Proton and Gamma Decay of 27P for Nuclear Astrophysics

NASA Astrophysics Data System (ADS)

McCleskey, E.; Banu, A.; McCleskey, M.; Roeder, B.; Saastamoinen, A.; Spiridon, A.; Trache, L.; Tribble, R. E.; Davinson, T.; Doherty, D.; Lotay, G. J.; Wallace, J.; Woods, P. J.

2013-10-01

The main creation site of 26Al is currently under debate. The reactions for its creation or destruction are also not completely known. When 26Al is created in novae, the reaction chain is: 24Mg(p,γ)25Al(β + v)25Mg(p,γ)26Al, but this chain can be by-passed by another chain: 25Al(p,γ)26Si(p,γ)27P and it can also be destroyed directly. Another way to by-pass it is through 26mAl(p,γ)27Si* which is dominated by resonant capture. Using the Momentum Achromat Recoil Spectrometer (MARS) at the Texas A&M Cyclotron Institute and inverse kinematics, this destruction reaction was studied by the beta-delayed proton and gamma decay of 27P. Due to selection rules, states populated above the proton threshold in the compound system (27Si*) can decay to 26mAl, which are the states of interest for the capture reaction. James Madison University, VA, USA.

Peroxy radical detection by chemical amplification (PERCA)

NASA Technical Reports Server (NTRS)

Stedman, D. H.

1986-01-01

Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.

Synthesis of side-chain oxysterols and their enantiomers through cross-metathesis reactions of Δ22 steroids.

PubMed

Brownholland, David P; Covey, Douglas F

2017-05-01

A synthetic route that utilizes a cross-metathesis reaction with Δ 22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. Copyright © 2017 Elsevier Inc. All rights reserved.

Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

USDA-ARS?s Scientific Manuscript database

The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

A computational study of pyrolysis reactions of lignin model compounds

Treesearch

Thomas Elder

2010-01-01

Enthalpies of reaction for the initial steps in the pyrolysis of lignin have been evaluated at the CBS-4m level of theory using fully substituted b-O-4 dilignols. Values for competing unimolecular decomposition reactions are consistent with results previously published for phenethyl phenyl ether models, but with lowered selectivity. Chain propagating reactions of free...

Quasi-free Proton Knockout Reactions on the Oxygen Isotopic Chain

NASA Astrophysics Data System (ADS)

Atar, Leyla; Aumann, Thomas; Bertulani, Carlos; Paschalis, Stefanos; R3B Collaboration

2017-09-01

It is well known from electron-induced knockout data that the single-particle (SP) strength is reduced to about 60-70% for stable nuclei in comparison to the independent particle model due to the presence of short- and long-range correlations. This finding has been confirmed by nuclear knockout reactions using stable and exotic beams, however, with a strong dependency on the proton-neutron asymmetry. The observed strong reduction of SP cross sections for the deeply bound valence nucleons in asymmetric nuclei is theoretically not understood. To understand this dependency quantitatively a complementary approach, quasi-free (QF) knockout reactions in inverse kinematics, is introduced. We have performed a systematic study of spectroscopic strength of oxygen isotopes using QF (p,2p) knockout reactions in complete kinematics at the R3B/LAND setup at GSI with secondary beams containing 13-24O. The oxygen isotopic chain covers a large variation of separ ation energies, which allow a systematic study of SF with respect to isospin asymmetry. We will present results on the (p,2p) cross sections for the entire oxygen isotopic chain obtained from a single experiment. By comparison with the Eikonal reaction theory the SF and reduction factors will be presented. The work is supported by GSI-TU Darmstadt cooperation and BMBF project 05P15RDFN1.

Tangled nonlinear driven chain reactions of all optical singularities

NASA Astrophysics Data System (ADS)

Vasil'ev, V. I.; Soskin, M. S.

2012-03-01

Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

NASA Astrophysics Data System (ADS)

Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

2015-07-01

Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

Computational study on UV curing characteristics in nanoimprint lithography: Stochastic simulation

NASA Astrophysics Data System (ADS)

Koyama, Masanori; Shirai, Masamitsu; Kawata, Hiroaki; Hirai, Yoshihiko; Yasuda, Masaaki

2017-06-01

A computational simulation model of UV curing in nanoimprint lithography based on a simplified stochastic approach is proposed. The activated unit reacts with a randomly selected monomer within a critical reaction radius. Cluster units are chained to each other. Then, another monomer is activated and the next chain reaction occurs. This process is repeated until a virgin monomer disappears within the reaction radius or until the activated monomers react with each other. The simulation model well describes the basic UV curing characteristics, such as the molecular weight distributions of the reacted monomers and the effect of the initiator concentration on the conversion ratio. The effects of film thickness on UV curing characteristics are also studied by the simulation.

Analysis of self-oscillating behaviors aimed at the development of a molecular robot with organic acids as fuel

NASA Astrophysics Data System (ADS)

Nakazumi, Tomoka; Hara, Yusuke

2017-09-01

We studied the transmittance self-oscillation of a polymer chain driven by an organic acid as the fuel. The self-oscillating polymer chain consists of 4-acryloylmorpholine (ACMO) and the Ru catalyst (Ru(bpy)3) of the Belousov-Zhabotinsky (BZ) reaction. The transmittance self-oscillating behavior was affected significantly by the temperature. As the amplitude of the transmittance self-oscillation, which is reflected by the aggregation state, decreased with time, the oscillation period also decreased. This trend indicates that the polymer aggregation affects the rate of the BZ reaction significantly. The activation energy of the self-oscillating value was almost the same in the normal BZ reaction, which does not include Ru(bpy)3 complexes in the polymer chains. In addition, we demonstrated the effect of one BZ substrate (sodium bromate or malonic acid) on the transmittance self-oscillation period.

Oxidative transformation of tunichromes - Model studies with 1,2-dehydro-N-acetyldopamine and N-acetylcysteine.

PubMed

Kuang, Qun F; Abebe, Adal; Evans, Jason; Sugumaran, Manickam

2017-08-01

Tunichromes are 1,2-dehydrodopa containing bioactive peptidyl derivatives found in blood cells of several tunicates. They have been implicated in metal sequestering, tunic formation, wound healing and defense reaction. Earlier studies conducted on these compounds indicate their extreme liability, high reactivity and easy oxidative polymerization. Their reactions are also complicated by the presence of multiple dehydrodopyl units. Since they have been invoked in crosslinking and covalent binding, to understand the reactivities of these novel compounds, we have taken a simple model compound that possess the tunichrome reactive group viz., 1,2-dehydro-N-acetyldopamine (Dehydro NADA) and examined its reaction with N-acetylcysteine in presence of oxygen under both enzymatic and nonenzymatic conditions. Ultraviolet and visible spectral studies of reaction mixtures containing dehydro NADA and N-acetylcysteine in different molar ratios indicated the production of side chain and ring adducts of N-acetylcysteine to dehydro NADA. Liquid chromatography and mass spectral studies supported this contention and confirmed the production of several different products. Mass spectral analysis of these products show the potentials of dehydro NADA to form side chain adducts that can lead to polymeric products. This is the first report demonstrating the ability of dehydro dopyl units to form adducts and crosslinks with amino acid side chains. Copyright © 2017 Elsevier Inc. All rights reserved.

Chain photoreduction of CCl3F in TiO2 suspensions: enhancement induced by O2.

PubMed

Winkelmann, Kurt; Calhoun, Robert L; Mills, German

2006-12-28

Trichlorofluoromethane (CFC 11) was photoreduced in aqueous suspensions of TiO2 particles containing HCO2- ions and air. Dissolved O2 inhibited the reaction during an induction period that preceded the rapid formation of chloride ions. Reaction rates were higher in systems containing O2 as compared to analogous reactions that occurred in anaerobic suspensions. High photonic efficiencies of Cl- formation (> or =15) were achieved using suspensions with pH > or = 5. As was the case for studies with air-free suspensions, reactions are best described using a photoinitiated chain mechanism that produced CHCl2F and Cl- during the propagation steps. The enhanced yields obtained in the presence of air are attributed to the removal by O2 of electrons trapped in the oxide, which are converted first into H2O2 and then into reducing radicals that participate in the chain process. Enhanced yields of Freon photoreduction were also observed during illumination of air-free suspensions containing hydrogen peroxide, which were interpreted using a similar mechanism.

Density functional computational studies on the glucose and glycine Maillard reaction: Formation of the Amadori rearrangement products

NASA Astrophysics Data System (ADS)

Jalbout, Abraham F.; Roy, Amlan K.; Shipar, Abul Haider; Ahmed, M. Samsuddin

Theoretical energy changes of various intermediates leading to the formation of the Amadori rearrangement products (ARPs) under different mechanistic assumptions have been calculated, by using open chain glucose (O-Glu)/closed chain glucose (A-Glu and B-Glu) and glycine (Gly) as a model for the Maillard reaction. Density functional theory (DFT) computations have been applied on the proposed mechanisms under different pH conditions. Thus, the possibility of the formation of different compounds and electronic energy changes for different steps in the proposed mechanisms has been evaluated. B-Glu has been found to be more efficient than A-Glu, and A-Glu has been found more efficient than O-Glu in the reaction. The reaction under basic condition is the most favorable for the formation of ARPs. Other reaction pathways have been computed and discussed in this work.0

Supplement to Theory of Neutron Chain Reactions

DOE R&D Accomplishments Database

Weinberg, Alvin M.; Noderer, L. C.

1952-05-26

General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

Chemical reactions directed Peptide self-assembly.

PubMed

Rasale, Dnyaneshwar B; Das, Apurba K

2015-05-13

Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.

Chemical Reactions Directed Peptide Self-Assembly

PubMed Central

Rasale, Dnyaneshwar B.; Das, Apurba K.

2015-01-01

Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly. PMID:25984603

Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

PubMed

Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

2017-11-01

Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+{sup 11}B process

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belyaev, V. S.; Krainov, V. P., E-mail: vpkrainov@mail.ru; Zagreev, B. V.

2015-07-15

Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+{sup 11}B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from {sup 11}B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+{sup 11}B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons amongmore » fusion products. Nuclear reactions that follow the p+{sup 11}B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+{sup 11}B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.« less

Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

PubMed

Umamaheswari, A; Venkateswarlu, K

2004-06-01

Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Cerebrospinal fluid PCR analysis and biochemistry in bodies with severe decomposition.

PubMed

Palmiere, Cristian; Vanhaebost, Jessica; Ventura, Francesco; Bonsignore, Alessandro; Bonetti, Luca Reggiani

2015-02-01

The aim of this study was to assess whether Neisseria meningitidis, Listeria monocytogenes, Streptococcus pneumoniae and Haemophilus influenzae can be identified using the polymerase chain reaction technique in the cerebrospinal fluid of severely decomposed bodies with known, noninfectious causes of death or whether postmortem changes can lead to false positive results and thus erroneous diagnostic information. Biochemical investigations, postmortem bacteriology and real-time polymerase chain reaction analysis in cerebrospinal fluid were performed in a series of medico-legal autopsies that included noninfectious causes of death with decomposition, bacterial meningitis without decomposition, bacterial meningitis with decomposition, low respiratory tract infections with decomposition and abdominal infections with decomposition. In noninfectious causes of death with decomposition, postmortem investigations failed to reveal results consistent with generalized inflammation or bacterial infections at the time of death. Real-time polymerase chain reaction analysis in cerebrospinal fluid did not identify the studied bacteria in any of these cases. The results of this study highlight the usefulness of molecular approaches in bacteriology as well as the use of alternative biological samples in postmortem biochemistry in order to obtain suitable information even in corpses with severe decompositional changes. Copyright © 2014 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

PubMed

Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

2006-07-01

We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

Kinetics of the Br2-CH3CHO Photochemical Chain Reaction

NASA Technical Reports Server (NTRS)

Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.

1997-01-01

Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).

Guaiacol hydrodeoxygenation mechanism on Pt(111): Insights from density functional theory and linear free energy relations

USDA-ARS?s Scientific Manuscript database

In this study density functional theory (DFT) was used to study the adsorption of guaiacol and its initial hydrodeoxygenation (HDO) reactions on Pt(111). Previously reported Brønsted–Evans–Polanyi (BEP) correlations for small open chain molecules are found to be inadequate in estimating the reaction...

The Learning Gains and Student Perceptions of a Second Life Virtual Lab

ERIC Educational Resources Information Center

Cobb, Stephanie; Heaney, Rose; Corcoran, Olivia; Henderson-Begg, Stephanie

2009-01-01

This study examines students' reactions to the virtual biosciences laboratory developed in Second Life[R] (SL) at the University of East London. Final year undergraduates and masters students studying biotechnology took part in a trial of a virtual Polymerase Chain Reaction (PCR) experiment in Second Life and evaluated their experience by…

One-step production of long-chain hydrocarbons from waste-biomass-derived chemicals using bi-functional heterogeneous catalysts.

PubMed

Wen, Cun; Barrow, Elizabeth; Hattrick-Simpers, Jason; Lauterbach, Jochen

2014-02-21

In this study, we demonstrate the production of long-chain hydrocarbons (C8+) from 2-methylfuran (2MF) and butanal in a single step reactive process by utilizing a bi-functional catalyst with both acid and metallic sites. Our approach utilizes a solid acid for the hydroalkylation function and as a support as well as a transition metal as hydrodeoxygenation catalyst. A series of solid acids was screened, among which MCM-41 demonstrated the best combination of activity and stability. Platinum nanoparticles were then incorporated into the MCM-41. The Pt/MCM-41 catalyst showed 96% yield for C8+ hydrocarbons and the catalytic performance was stable over four reaction cycles of 20 hour each. The reaction pathways for the production of long-chain hydrocarbons is probed with a combination of infrared spectroscopy and steady-state reaction experiments. It is proposed that 2MF and butanal go through hydroalkylation first on the acid site followed by hydrodeoxygenation to produce the hydrocarbon fuels.

Palladium-Catalyzed Oxidative Couplings and Applications to the Synthesis of Macrocycles and Strained Cyclic Dienes

NASA Astrophysics Data System (ADS)

Boon, Byron Adrian

The palladium(II)-catalyzed oxidative macrocyclization of bis(vinylboronate esters) is demonstrated as an efficient method for the synthesis of macrocyclic dienes. The macrocyclization reactions feature mild conditions due to a palladium(II) catalytic cycle which obviates the need for a high energy oxidative addition step of standard palladium(0) catalytic cycles. Instead, this oxidative coupling is promoted by chloroacetone as a terminal re-oxidant in the catalytic cycle. An extension of the oxidative coupling/macrocyclization strategy is highlighted where molecular oxygen may be used in place of chloroacetone as the terminal re-oxidant. Homocoupling reactions of vinylboronate esters served as a template to screen reaction conditions for this method. From these experiments, multiple reaction conditions gave the oxidative homocoupling product in high yield. These reaction conditions were successfully applied to the oxidative macrocyclization of a bis(vinylboronate ester) using molecular oxygen as a re-oxidant. Syntheses of strained cyclic dienes were accomplished via the palladium(II)-catalyzed oxidative cyclizations of terminal bis(vinylboronate esters). The reactions generated strained (E,E)-1,3-dienes that underwent spontaneous 4?-electrocyclizations to form bicyclic cyclobutenes. Formation of the cyclobutenes is driven by strain in the medium-ring (E,E)-1,3-diene intermediates. Thermal ring openings of the cyclobutenes give (Z,Z)-1,3-diene products, again for thermodynamic reasons. These results are in contrast with typical acyclic trans-3,4-dialkyl cyclobutenes, which favor outward torquoselective ring-openings to give (E,E)-1,3-dienes. DFT calculations verified the thermodynamic versus kinetic control of the reactions and kinetic studies are in excellent agreement with the calculated energy changes. Investigations on the transannular Pauson-Khand reaction are also highlighted. The Pauson-Khand reaction is a powerful tool for the synthesis of cyclopentenones through the efficient [2+2+1] cycloaddition of dicobalt alkyne complexes with alkenes. While intermolecular and intramolecular variants are widely known, transannular versions of this reaction are unknown and the basis of this study. Our successful transannular Pauson-Khand reaction required a cyclic enyne incorporating one short three-membered linker chain and a rigid aryl linker in the backbone of the long linker chain. This rigidity of the aryl linker is proposed to facilitate the transannular [2+2+1] cyclization. Computational studies revealed that transannular Pauson-Khand reactions are thermodynamically favored for cyclic enynes featuring a long linker of at least 5 carbons, but with smaller chains the reactions are thermodynamically disfavored. Experimental studies show that long linking chains with more than 5 members are required to prevent to steric interactions between the dicobalt hexacarbonyl moiety and the linking chain to allow the reaction to be kinetically favored. The final part of this work highlights progress towards the total synthesis of (+)-kingianin A. This natural product was isolated as a racemic mixture from the bark of Endiandra kingiana and is an inhibitor of antiapoptotic protein Bcl-Xl, highlighting its potential use in cancer treatments. Its structure is proposed to arise from an intermolecular Diels-Alder dimerization reaction of bicyclo[4.2.0]octadiene fragments derived from an 8pi/6pi-electrocyclization cascade. Although two total syntheses of (+/-)-kingianin A have been reported, an enantioselective synthesis has not been achieved and is the purpose of this study. This synthetic route begins from L-(+)-dimethyl tartrate, a cheap and commercially available starting material, and aims to follow a biomimetic synthetic pathway featuring a substrate controlled diastereoselective palladium(II)-catalyzed oxidative cyclization and 8pi/6pi-electrocyclization cascade. Although the feasibility of this cascade pathway has not yet been realized, key synthetic transformations to install the requisite carbocyclic framework of (+)-kingianin A have been discovered, paving the way for future investigations on the palladium(II)-catalyzed coupling/electrocyclization cascade and completion of the synthesis.

Polymerase chain reaction system

DOEpatents

Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

2004-03-02

A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

Selected spectroscopic results on element 115 decay chains

DOE PAGES

Rudolph, D.; Forsberg, U.; Golubev, P.; ...

2014-08-24

We observed thirty correlated α-decay chains in an experiment studying the fusion-evaporation reaction 48Ca + 243Am at the GSI Helmholtzzentrum fur Schwerionenforschung. The decay characteristics of the majority of these 30 chains are consistent with previous observations and interpretations of such chains to originate from isotopes of element Z = 115. High-resolution α-photon coincidence spectroscopy in conjunction with comprehensive Monte-Carlo simulations allow to propose excitation schemes of atomic nuclei of the heaviest elements, thereby probing nuclear structure models near the 'Island of Stability' with unprecedented experimental precision.

Thermochemistry analyses for transformation of C6 glucose compound into C9, C12 and C15 alkanes using density functional theory

NASA Astrophysics Data System (ADS)

Verma, Anand Mohan; Kishore, Nanda

2017-02-01

The hydrolysis of cellulose fraction of biomass yields C6 glucose which further can be transformed into long-chain hydrocarbons by C-C coupling. In this study, C6 glucose is transformed into three chain alkanes, namely, C9, C12 and C15 using C-C coupling reactions under the gas and aqueous phase milieus. The geometry optimisation and vibrational frequency calculations are carried out at well-known hybrid-GGA functional, B3LYP with the basis set of 6-31+g(d,p) under the density functional theory framework. The single point energetics are calculated at M05-2X/6-311+g(3df,2p) level of theory. All thermochemical properties are calculated over a wide range of temperature between 300 and 900 K at an interval of 100 K. The thermochemistry suggested that the aqueous phase behaviour is suitable for the hydrolysis of sugar into long-chain alkanes compared to gas-phase environment. The hydrodeoxygenation reactions under each reaction pathway are found as most favourable reactions in both phases; however, aqueous phase dominates over gas phase in all discussed thermodynamic parameters.

Modeling competitive substitution in a polyelectrolyte complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu

2015-12-28

We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less

Hydrolysis of the amorphous cellulose in cotton-based paper.

PubMed

Stephens, Catherine H; Whitmore, Paul M; Morris, Hannah R; Bier, Mark E

2008-04-01

Hydrolysis of cellulose in Whatman no. 42 cotton-based paper was studied using gel permeation chromatography (GPC), electrospray ionization-mass spectrometry (ESI-MS), and uniaxial tensile testing to understand the course and kinetics of the reaction. GPC results suggested that scission reactions passed through three stages. Additionally, the evolution of soluble oligomers in the ESI-MS data and the steady course of strength loss showed that the hydrolysis reaction occurred at a constant rate. These findings are explained with a more detailed description of the cellulose hydrolysis, which includes multiple chain scissions on amorphous segments. The breaks occur with increasing frequency near the ends of amorphous segments, where chains protrude from crystalline domains. Oligomers unattached to crystalline domains are eventually created. Late-stage reactions near the ends of amorphous segments produce a kinetic behavior that falsely suggests that hydrolysis had ceased. Monte Carlo simulations of cellulose degradation corroborated the experimental findings.

Ionizing radiation-induced destruction of benzene and dienes in aqueous media.

PubMed

Al-Sheikhly, Mohamad; Poster, Dianne L; An, Jung-Chul; Neta, Pedatsur; Silverman, Joseph; Huie, Robert E

2006-05-01

Pulse radiolysis with spectrophotometric and conductometric detection was utilized to study the formation and reactions of radicals from benzene and dienes in aqueous solutions. The benzene OH adduct, *C6H6OH, reacts with O2 (k = 3 x 10(8) L mol(-1) s(-1)) in a reversible reaction. The peroxyl radical, HOC6H6O2*, undergoes O2*- elimination, bimolecular decay, and reaction with benzene to initiate a chain reaction, depending on the dose rate, benzene concentration, and pH. The occurrence of the chain reaction is demonstrated in low-dose-rate gamma radiolysis experiments where the consumption of O2 was monitored. 1,4-Cyclohexadiene, 1,4-hexadiene, and 1,4-pentadiene form OH-adducts and undergo H-abstraction by O*- radicals. The OH-adducts react with O2 to form peroxyl radicals. These peroxyl radicals, however, do not undergo unimolecular O2*- elimination but rather decay by second-order processes, which lead to subsequent steps of O2*- elimination.

Recoil-α-fission and recoil-α-α-fission events observed in the reaction 48Ca + 243Am

NASA Astrophysics Data System (ADS)

Forsberg, U.; Rudolph, D.; Andersson, L.-L.; Di Nitto, A.; Düllmann, Ch. E.; Fahlander, C.; Gates, J. M.; Golubev, P.; Gregorich, K. E.; Gross, C. J.; Herzberg, R.-D.; Heßberger, F. P.; Khuyagbaatar, J.; Kratz, J. V.; Rykaczewski, K.; Sarmiento, L. G.; Schädel, M.; Yakushev, A.; Åberg, S.; Ackermann, D.; Block, M.; Brand, H.; Carlsson, B. G.; Cox, D.; Derkx, X.; Dobaczewski, J.; Eberhardt, K.; Even, J.; Gerl, J.; Jäger, E.; Kindler, B.; Krier, J.; Kojouharov, I.; Kurz, N.; Lommel, B.; Mistry, A.; Mokry, C.; Nazarewicz, W.; Nitsche, H.; Omtvedt, J. P.; Papadakis, P.; Ragnarsson, I.; Runke, J.; Schaffner, H.; Schausten, B.; Shi, Yue; Thörle-Pospiech, P.; Torres, T.; Traut, T.; Trautmann, N.; Türler, A.; Ward, A.; Ward, D. E.; Wiehl, N.

2016-09-01

Products of the fusion-evaporation reaction 48Ca + 243Am were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt, Germany. Amongst the detected thirty correlated α-decay chains associated with the production of element Z = 115, two recoil-α-fission and five recoil- α- α-fission events were observed. The latter five chains are similar to four such events reported from experiments performed at the Dubna gas-filled separator, and three such events reported from an experiment at the Berkeley gas-filled separator. The four chains observed at the Dubna gas-filled separator were assigned to start from the 2n-evaporation channel 289115 due to the fact that these recoil- α- α-fission events were observed only at low excitation energies. Contrary to this interpretation, we suggest that some of these recoil- α- α-fission decay chains, as well as some of the recoil- α- α-fission and recoil-α-fission decay chains reported from Berkeley and in this article, start from the 3n-evaporation channel 288115.

Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

PubMed

Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

2011-03-14

Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DL-ADR: a novel deep learning model for classifying genomic variants into adverse drug reactions.

PubMed

Liang, Zhaohui; Huang, Jimmy Xiangji; Zeng, Xing; Zhang, Gang

2016-08-10

Genomic variations are associated with the metabolism and the occurrence of adverse reactions of many therapeutic agents. The polymorphisms on over 2000 locations of cytochrome P450 enzymes (CYP) due to many factors such as ethnicity, mutations, and inheritance attribute to the diversity of response and side effects of various drugs. The associations of the single nucleotide polymorphisms (SNPs), the internal pharmacokinetic patterns and the vulnerability of specific adverse reactions become one of the research interests of pharmacogenomics. The conventional genomewide association studies (GWAS) mainly focuses on the relation of single or multiple SNPs to a specific risk factors which are a one-to-many relation. However, there are no robust methods to establish a many-to-many network which can combine the direct and indirect associations between multiple SNPs and a serial of events (e.g. adverse reactions, metabolic patterns, prognostic factors etc.). In this paper, we present a novel deep learning model based on generative stochastic networks and hidden Markov chain to classify the observed samples with SNPs on five loci of two genes (CYP2D6 and CYP1A2) respectively to the vulnerable population of 14 types of adverse reactions. A supervised deep learning model is proposed in this study. The revised generative stochastic networks (GSN) model with transited by the hidden Markov chain is used. The data of the training set are collected from clinical observation. The training set is composed of 83 observations of blood samples with the genotypes respectively on CYP2D6*2, *10, *14 and CYP1A2*1C, *1 F. The samples are genotyped by the polymerase chain reaction (PCR) method. A hidden Markov chain is used as the transition operator to simulate the probabilistic distribution. The model can perform learning at lower cost compared to the conventional maximal likelihood method because the transition distribution is conditional on the previous state of the hidden Markov chain. A least square loss (LASSO) algorithm and a k-Nearest Neighbors (kNN) algorithm are used as the baselines for comparison and to evaluate the performance of our proposed deep learning model. There are 53 adverse reactions reported during the observation. They are assigned to 14 categories. In the comparison of classification accuracy, the deep learning model shows superiority over the LASSO and kNN model with a rate over 80 %. In the comparison of reliability, the deep learning model shows the best stability among the three models. Machine learning provides a new method to explore the complex associations among genomic variations and multiple events in pharmacogenomics studies. The new deep learning algorithm is capable of classifying various SNPs to the corresponding adverse reactions. We expect that as more genomic variations are added as features and more observations are made, the deep learning model can improve its performance and can act as a black-box but reliable verifier for other GWAS studies.

Sensitive and specific identification by polymerase chain reaction of Eimeria tenella and Eimeria maxima, important protozoan pathogens in laboratory avian facilities.

PubMed

Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho; Kim, Okjin

2011-09-01

Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities.

Polymerase chain reaction detection of Bartonella spp. in dogs from Spain with blood culture-negative infectious endocarditis.

PubMed

Roura, X; Santamarina, G; Tabar, M-D; Francino, O; Altet, L

2018-05-25

The presence of Bartonella spp. was detected by polymerase chain reaction (PCR) in dogs from Spain with blood culture-negative endocarditis. The aim of this study is to add information about canine infectious endocarditis in Europe. Thirty dogs with naturally occurring blood culture-negative endocarditis were examined from 2010 to 2017 at three veterinary referral hospitals, located in northwest, northeast, and southeast of Spain. It is a retrospective study. Medical records were reviewed to extract relevant data. Frozen or paraffin-embedded cardiac valve tissue and/or ethylenediamine tetraacetic acid blood samples were evaluated by PCR for the presence of Bartonella DNA. Positive results were sequenced to confirm the species. Polymerase chain reaction was positive for eight out of 30 dogs included (26.6%). Bartonella rochalimae, Bartonella vinsonii subsp. berkhoffii, and Bartonella koehlerae were detected in valve tissue or blood. Bartonella could be an important cause of blood culture-negative infectious endocarditis in dogs from Spain. The outcome for those dogs affected with Bartonella spp. was grave. Prompt empirical treatment with amoxicillin-clavulanate plus fluoroquinolones could be of value in cases of blood culture-negative endocarditis. Copyright © 2018 Elsevier B.V. All rights reserved.

[Roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis].

PubMed

Dai, Lin; Huang, Juan; Tang, Yuan; Liao, Dian-ying; Dong, Dan-dan; Xu, Gang; Li, Gan-di

2010-06-01

To study the roles of histologic examination and polymerase chain reaction in diagnosis of toxoplasmic lymphadenitis (TL). Forty-six archival cases of histologically diagnosed TL, encountered during the period from April, 1999 to September, 2009 and with the paraffin-embedded lymph node tissue blocks available, were enrolled into the study. The presence of genome fragments of Toxoplasma gondii (T. gondii) was analyzed using semi-nested polymerase chain reaction (PCR). Thirty cases of one or two histopathologic triad of TL as the controls. The positive rate of PCR in TL group was 76.1% (35/46), as compared to 10.0% (3/30) in the control group. The difference was of statistical significance. The sensitivity and specificity of the histologic triad in diagnosing TL was 92.1% (35/38) and 71.1% (27/38), respectively. The predictive value of positive and negative PCR results was 76.1% (35/46) and 90.0% (27/30). respectively. The high specificity but low sensitivity of applying the histologic triad in diagnosing TL cases may be due to the occurrence of atypical histologic pattern. The sensitivity is improved with the use of semi-nested PCR in detecting T. gondii DNA.

Silicon-based sleeve devices for chemical reactions

DOEpatents

Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

1996-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Silicon-based sleeve devices for chemical reactions

DOEpatents

Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

1996-12-31

A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

PubMed

Chen, Y T; Mercer, G O; Chen, Y

1993-11-01

Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

PubMed

Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

2002-07-01

Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

Surfactant-controlled polymerization of semiconductor clusters to quantum dots through competing step-growth and living chain-growth mechanisms.

PubMed

Evans, Christopher M; Love, Alyssa M; Weiss, Emily A

2012-10-17

This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.

Kinetics of Chemical Reactions in Flames

NASA Technical Reports Server (NTRS)

Zeldovich, Y.; Semenov, N.

1946-01-01

In part I of the paper the theory of flame propagation is developed along the lines followed by Frank-Kamenetsky and one of the writers. The development of chain processes in flames is considered. A basis is given for the application of the method of stationary concentrations to reactions in flames; reactions with branching chains are analyzed. The case of a diffusion coefficient different from the coefficient of temperature conductivity is considered.

Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

USDA-ARS?s Scientific Manuscript database

This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

PubMed

Igarashi, T; Yamamoto, A; Goto, N

1996-10-01

Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

PubMed

Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

2017-01-01

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

Development of a Novel, Rapid Multiplex Polymerase Chain Reaction Assay for the Detection and Differentiation of Salmonella enterica Serovars Enteritidis and Typhimurium Using Ultra-Fast Convection Polymerase Chain Reaction.

PubMed

Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee

2017-10-01

Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.

Gel Point Suppression in RAFT Polymerization of Pure Acrylic Cross-Linker Derived from Soybean Oil.

PubMed

Yan, Mengguo; Huang, Yuerui; Lu, Mingjia; Lin, Fang-Yi; Hernández, Nacú B; Cochran, Eric W

2016-08-08

Here we report the reversible addition-fragmentation chain transfer (RAFT) polymerization of acrylated epoxidized soybean oil (AESO), a cross-linker molecule, to high conversion (>50%) and molecular weight (>100 kDa) without macrogelation. Surprisingly, gelation is suppressed in this system far beyond the expectations predicated both on Flory-Stockmeyer theory and multiple other studies of RAFT polymerization featuring cross-linking moieties. By varying AESO and initiator concentrations, we show how intra- versus intermolecular cross-linking compete, yielding a trade-off between the degree of intramolecular linkages and conversion at gel point. We measured polymer chain characteristics, including molecular weight, chain dimensions, polydispersity, and intrinsic viscosity, using multidetector gel permeation chromatography and NMR to track polymerization kinetics. We show that not only the time and conversion at macrogelation, but also the chain architecture, is largely affected by these reaction conditions. At maximal AESO concentration, the gel point approaches that predicted by the Flory-Stockmeyer theory, and increases in an exponential fashion as the AESO concentration decreases. In the most dilute solutions, macrogelation cannot be detected throughout the entire reaction. Instead, cyclization/intramolecular cross-linking reactions dominate, leading to microgelation. This work is important, especially in that it demonstrates that thermoplastic rubbers could be produced based on multifunctional renewable feedstocks.

Microfabricated electrochemiluminescence cell for chemical reaction detection

DOEpatents

Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

2003-01-01

A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Heterocyclic alpha-alkylidene cyclopentenones obtained via a Pauson-Khand reaction of amino acid derived allenynes. A scope and limitation study directed toward the preparation of a tricyclic pyrrole library.

PubMed

Brummond, Kay M; Curran, Dennis P; Mitasev, Branko; Fischer, Stefan

2005-03-04

The synthesis of a novel class of tricyclic pyrroles has been accomplished by using a Pauson-Khand/Stetter/Paal-Knorr reaction sequence. Full details of the Pauson-Khand reaction of amino acid tethered allenynes 4a-e and 9a-d are disclosed. The study of this reaction led to the discovery of an unprecedented substituent effect on the diastereoselectivity of the Mo(CO)6 mediated allenic Pauson-Khand reaction. It was found that amino acid tethered allenynes with aromatic side chains afford alpha-alkylidene cyclopentenones with the opposite diastereoselectivity compared to those with aliphatic side chains. This effect has been attributed to complexation of the metal mediator to the aromatic ring in the substrate. Furthermore, an isomerization of one of the diastereomers of the alpha-alkylidene cyclopentenones was encountered, leading to eventual decomposition. The stable diastereomers were found to react well in the Stetter reaction leading to 1,4-diketones that were converted to pyrroles. The observation that the first generation of 2-alkyl-substituted pyrroles was unstable led to a second generation of 2-carboxamide pyrroles with sufficient stability for biological tests which are in progress.

Problem-Solving Test: Real-Time Polymerase Chain Reaction

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

EPA Science Inventory

Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

ERIC Educational Resources Information Center

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

EPA Science Inventory

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

USDA-ARS?s Scientific Manuscript database

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

PubMed

Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

2005-03-01

We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

EPA Science Inventory

A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

EPA Science Inventory

Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

Chain reaction: an exploratory study of nursing home bankruptcy in California.

PubMed

Kitchener, Martin; O'neill, Ciaran; Harrington, Charlene

2005-01-01

This paper reports on an exploratory study of nursing home bankruptcy. From state and industry data regarding nearly 1,000 California facilities, it was possible to identify 155 homes in five chains (multi-facility organizations) that were operating in bankruptcy in 2000. When compared with facilities in non-bankrupt chains, while the bankrupt chain facilities had significantly worse financial liquidity, higher administrative costs, and higher payables to related parties, they also had more Medicare residents, fewer Medicaid residents, better solvency, and were located in less competitive county markets and in areas with higher Medicaid reimbursement rates. These findings indicate that, rather than facility characteristics and local market factors, strategic decisions taken at the corporate (chain) level are the major determinants of nursing facility bankruptcy status.

Expression and mutational analysis of Cip/Kip family in early glottic cancer.

PubMed

Kim, D-K; Lee, J H; Lee, O J; Park, C H

2015-02-01

Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

PubMed Central

Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

2006-01-01

Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

PubMed

Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

2015-03-01

Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.

Barriers affecting successful technology enablement of supply chain: An Indian perspective

NASA Astrophysics Data System (ADS)

Arora, R.; Haleem, A.; Farooquie, J. A.

2018-03-01

In order to compete, organizations need to focus on improving supply chain and technology acts as a major enabler. Technology enablement of supply chain has not always been successful and has been examined by many researchers. The purpose of this paper is to do a systematic literature review of technology enabled supply chain from a strategic viewpoint. The literature is examined from two perspectives. Firstly, it studies the growing interest in technology-enabled supply chain in India. Secondly, it studies barriers affecting technology enablement of supply chain. The literature review identifies that technology enabled supply chain helps in improving performance via effective decision making, monitoring entire supply chain, faster reaction to customer service problems, etc. The research has emphasized the importance of 12 barriers affecting technology enablement. This research will help as a guide for practitioners in order to successfully implement technology and fills the gap in existing literature by highlighting and consolidating the significant research work done in past.

IgE reactivity to alpha1 and alpha2 chains of bovine type 1 collagen in children with bovine gelatin allergy.

PubMed

Sakaguchi, M; Hori, H; Hattori, S; Irie, S; Imai, A; Yanagida, M; Miyazawa, H; Toda, M; Inouye, S

1999-09-01

Anaphylactic reactions to measles, mumps, and rubella vaccines, including gelatin as a stabilizer, have been reported. It had been found that most of these reactions to live vaccines are caused by the bovine gelatin included in these vaccines. Gelatin mainly includes denatured type I collagen, which consists of alpha1 and alpha2 chains. The current study was designed to investigate the IgE reactivity to alpha1 and alpha2 chains of bovine type I collagen in gelatin-sensitive children. Serum samples were taken from 10 children who had anaphylaxis to the vaccines and high levels of specific IgE to bovine gelatin. Bovine type I collagen was isolated from bovine skin and then separated to alpha1 and alpha2 chains by column chromatography. IgE reactivity to denatured type I collagen and its alpha1 and alpha2 chains was analyzed by immunoblotting, ELISA, and histamine release from the mast cells passive sensitized with IgE antibodies in pooled serum of the children. All children had specific IgE to bovine type I collagen. Furthermore, IgE antibodies in their sera reacted with the alpha;2 chain but not with the alpha1 chain. Similarly, the mast cells sensitized with pooled sera in the children showed alpha2 chain-specific histamine release but not alpha1 chain-specific histamine release. In gelatin allergy denatured bovine type I collagen is a major allergen and IgE-binding sites exist in the alpha2 chain of type I collagen.

Asymptotic study of pulsating evolution of overdriven and CJ detonation with a chain-branching kinetics model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Short, Mark; Chliquete, Carlos

2011-01-20

The pulsating dynamics of gaseous detonations with a model two-step chain-branching kinetic mechanism are studied both numerically and asymptotically. The model studied here was also used in [4], [3] and [2] and mimics the attributes of some chain-branching reaction mechanisms. Specifically, the model comprises a chain-initiationlbranching zone with an Arrhenius temperature-sensitive rate behind the detonation shock where fuel is converted into chain-radical with no heat release. This is followed by a chain-termination zone having a temperature insensitive rate where the exothermic heat of reaction is released. The lengths of these two zones depend on the relative rates of each stage.more » It was determined in [4] and [3] via asymptotic and numerical analysis that the ratio of the length of the chain-branching zone to that of the chain-initation zone relative to the size of the von Neumann state scaled activation energy in the chain initiation/branching zone has a primary influence of the stability of one-dimensional pulsating instability behavior for this model. In [2], the notion of a specific stability parameter related to this ratio was proposed that determines the boundary between stable and unstable waves. In [4], a slow-time varying asymptotic study was conducted of pulsating instability of Chapman-Jouguet (CJ) detonations with the above two-step rate model, assuming a large activation energy for the chain-initiation zone and a chain-termination zone longer than the chain-initiation zone. Deviations D{sub n}{sup (1)} ({tau}) of the detonation velocity from Chapman-Jouguet were of the order of the non-dimensional activation energy. Solutions were sought for a pulsation timescale of the order of the non-dimensional activation energy times the particle transit time through the induction zone. On this time-scale, the evolution of the chain-initation zone is quasi-steady. In [4], a time-dependent non-linear evolution equation for D{sub n}{sup (1)} ({tau}) was then constructed via a perturbation procedure for cases where the ratio of the length of the chain-termination zone to chain-initiation zone was less than the non-dimensional activation energy. To leading order, the steady CJ detonation was found to be unstable; higher-order corrections lead to the construction of a stability limit between stable and unsteady pulsating solutions. One conclusion from this study is that for a stability limit to occur at leading order, the period of pulsation of the detonation must occur on the time scale of particle passage through the longer chain-termination zone, while the length of the chain-termination zone must be of order of the non-dimensional activation energy longer than the chain-initiation zone. The relevance of these suggested scalings was verified via numerical solutions of the full Euler system in [3], and formed the basis of the stability parameter criteria suggested in [2]. In the following, we formulate an asymptotic study based on these new suggested scales, studying the implications for describing pulsating behavior in gaseous chain-branching detonations. Specifically, we find that the chain-induction zone structure is the same as that studied in [4]. However, the study of unsteady evolution in the chain-termination region is now governed by a set of asymptotically derived nonlinear POEs. Equations for the linear stablity behavior of this set of POE's is obtained, while the nonlinear POEs are solved numerically using a shock-attached, shock-fitting method developed by Henrick et aJ. [1]. The results thus far show that the stability threshold calculated using the new ratio of the chain-termination zone length to that of the chain-initiation zone yields a marked improvement over [2]. Additionally, solutions will be compared with predictions obtained from the solution of the full Euler system. Finally, the evolution equation previously derived in [4] has been generalized to consider both arbitrary reaction orders and any degree of overdrive.« less

Epstein-Barr viral load before a liver transplant in children with chronic liver disease.

PubMed

Shakibazad, Nader; Honar, Naser; Dehghani, Seyed Mohsen; Alborzi, Abdolvahab

2014-12-01

Many children with chronic liver disease require a liver transplant. These patients are prone to various infections, including Epstein-Barr virus infection. This study sought to measure the Epstein-Barr viral load by polymerase chain reaction before a liver transplant. This cross-sectional study was done at the Shiraz University of Medical Sciences, Shiraz, Iran, in 2011. All patients were aged younger than 18 years with chronic liver disease and were candidates for a liver transplant at the Shiraz Nemazee Hospital Organ Transplant Center. They had been investigated regarding their demographic characteristics, underlying disease, laboratory findings, and Epstein-Barr viral load by real-time TaqMan polymerase chain reaction. Ninety-eight patients were studied and the mean age was 6.5 ± 5.9 years. Cryptogenic cirrhosis was the most-prevalent reason for liver transplant, and the death rate before a transplant was 15%. Among the study subjects, 6 had measurable Epstein-Barr viral load by polymerase chain reaction before the transplant, and 4 of them had considerably higher Epstein-Barr viral loads (more than 1000 copies/mL). With respect to the close prevalence of posttransplant lymphoproliferative disease (6%) and the high Epstein-Barr viral load in the patients before a transplant (4%), high pretransplant Epstein-Barr viral load can be considered a risk factor for posttransplant lymphoproliferative disorder.

Detection of egg drop syndrome 1976 virus by polymerase chain reaction and study of its persistence in experimentally infected layer birds.

PubMed

Kumar, N S; Kataria, J M; Koti, M; Dhama, K; Toroghi, R

2003-01-01

Polymerase chain reaction (PCR) assay was developed for the detection of Egg drop syndrome 1976 (EDS-76) virus in tissues, namely in the uterus, spleen and buffy coat. It was also used to study the persistence of the virus in tissues of experimentally infected layer birds. The PCR assay could detect as little as 10 fg of purified EDS-76 viral DNA. It also amplified the DNA of Fowl adenovirus serotypes 4 (FAV-4) and 8 (FAV-8). The virus persisted in the uterus up to day 21 post infection (p.i.). Detection of EDS-76 viral DNA in the buffy coat could be useful for studying the occurrence of the respective disease in layer bird flocks.

The Synergize effect of Chain extender to Phosporic acid catalyst to the ultimate property of Soy-Polyurethane

NASA Astrophysics Data System (ADS)

Elvistia Firdaus, Flora

2016-04-01

The polyurethanes (PUs) foam were made from vegetable oil; a soybean based polyol. The foams were categorized into flexible and semi rigid. This research is manufacturally designed polyurethane foams by a process requiring the reaction of mixture of 2, 4- and 2, 6-Toluene di Isocyanate isomers, soy polyol in the presence of other ingredients. The objective of this work was to functionalized soy-polyol using phosporic acid catalyst and chain extender, study their collaborative reaction in producing ultimate property of PU foam. Correlates the foam morphology images in accordance to mechanical properties of foams.

Molecular Evidence of Bartonella Infection in Domestic Dogs from Algeria, North Africa, by Polymerase Chain Reaction (PCR)

PubMed Central

Kernif, Tahar; Aissi, Meriem; Doumandji, Salah-Eddine; Chomel, Bruno B.; Raoult, Didier; Bitam, Idir

2010-01-01

Bartonella species are being recognized as important bacterial human and canine pathogens, and are associated with multiple arthropod vectors. Bartonella DNA extracted from blood samples was obtained from domestic dogs in Algiers, Algeria. Polymerase chain reaction (PCR) and DNA sequence analyses of the ftsZ gene and the 16S-23S intergenic spacer region (ITS) were performed. Three Bartonella species: Bartonella vinsonii subsp. berkhoffii, Bartonella clarridgeiae, and Bartonells elizabethae were detected infecting Algerian dogs. To our knowledge, this study is the first report of detection by PCR amplification of Bartonella in dogs in North Africa. PMID:20682871

Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

PubMed

Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

2012-01-01

The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

PubMed Central

deWit, D; Wootton, M; Allan, B; Steyn, L

1993-01-01

A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

Microfabricated sleeve devices for chemical reactions

DOEpatents

Northrup, M. Allen

2003-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

An intact eight-membered water chain in drosophilid alcohol dehydrogenases is essential for optimal enzyme activity.

PubMed

Wuxiuer, Yimingjiang; Morgunova, Ekaterina; Cols, Neus; Popov, Alexander; Karshikoff, Andrey; Sylte, Ingebrigt; Gonzàlez-Duarte, Roser; Ladenstein, Rudolf; Winberg, Jan-Olof

2012-08-01

All drosophilid alcohol dehydrogenases contain an eight-member water chain connecting the active site with the solvent at the dimer interface. A similar water chain has also been shown to exist in other short-chain dehydrogenase/reductase (SDR) enzymes, including therapeutically important SDRs. The role of this water chain in the enzymatic reaction is unknown, but it has been proposed to be involved in a proton relay system. In the present study, a connecting link in the water chain was removed by mutating Thr114 to Val114 in Scaptodrosophila lebanonensis alcohol dehydrogenase (SlADH). This threonine is conserved in all drosophilid alcohol dehydrogenases but not in other SDRs. X-ray crystallography of the SlADH(T114V) mutant revealed a broken water chain, the overall 3D structure of the binary enzyme-NAD(+) complex was almost identical to the wild-type enzyme (SlADH(wt) ). As for the SlADH(wt) , steady-state kinetic studies revealed that catalysis by the SlADH(T114V) mutant was consistent with a compulsory ordered reaction mechanism where the co-enzyme binds to the free enzyme. The mutation caused a reduction of the k(on) velocity for NAD(+) and its binding strength to the enzyme, as well as the rate of hydride transfer (k) in the ternary enzyme-NAD(+) -alcohol complex. Furthermore, it increased the pK(a) value of the group in the binary enzyme-NAD(+) complex that regulates the k(on) velocity of alcohol and alcohol-competitive inhibitors. Overall, the results indicate that an intact water chain is essential for optimal enzyme activity and participates in a proton relay system during catalysis. © 2012 The Authors Journal compilation © 2012 FEBS.

Enzymatic preparation of structured oils containing short-chain fatty acids.

PubMed

Kanda, Ayato; Namiki, Fusako; Hara, Setsuko

2010-01-01

Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.

DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

EPA Science Inventory

The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

29 CFR 1910.155 - Scope, application and definitions applicable to this subpart.

Code of Federal Regulations, 2010 CFR

2010-07-01

... by inhibiting the chemical chain reaction of fuel and oxygen. It is also known as...F3) which is a medium for extinguishing fires by inhibiting the chemical chain reaction of fuel and..., odorless, electrically nonconductive inert gas (chemical formula CO2) that is a medium for extinguishing...

Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

ERIC Educational Resources Information Center

Phelps, Tara L.; And Others

1996-01-01

Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

Determining Annealing Temperatures for Polymerase Chain Reaction

ERIC Educational Resources Information Center

Porta, Angela R.; Enners, Edward

2012-01-01

The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

USDA-ARS?s Scientific Manuscript database

A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.

PubMed

Borkar, Santosh Ramdas; Aidhen, Indrapal Singh

2017-04-18

Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.

Multi-scale modeling of diffusion-controlled reactions in polymers: renormalisation of reactivity parameters.

PubMed

Everaers, Ralf; Rosa, Angelo

2012-01-07

The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.

Temperature control apparatus

DOEpatents

Northrup, M. Allen

2003-08-05

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Endogenous ethanol affects biopolyester molecular weight in recombinant Escherichia coli.

PubMed

Hiroe, Ayaka; Hyakutake, Manami; Thomson, Nicholas M; Sivaniah, Easan; Tsuge, Takeharu

2013-11-15

In biopolyester synthesis, polyhydroxyalkanoate (PHA) synthase (PhaC) catalyzes the polymerization of PHA in bacterial cells, followed by a chain transfer (CT) reaction in which the PHA polymer chain is transferred from PhaC to a CT agent. Accordingly, the frequency of CT reaction determines PHA molecular weight. Previous studies have shown that exogenous alcohols are effective CT agents. This study aimed to clarify the effect of endogenous ethanol as a CT agent for poly[(R)-3-hydroxybutyrate] [P(3HB)] synthesis in recombinant Escherichia coli, by comparing with that of exogenous ethanol. Ethanol supplementation to the culture medium reduced P(3HB) molecular weights by up to 56% due to ethanol-induced CT reaction. NMR analysis of P(3HB) polymers purified from the culture supplemented with (13)C-labeled ethanol showed the formation of a covalent bond between ethanol and P(3HB) chain at the carboxyl end. Cultivation without ethanol supplementation resulted in the reduction of P(3HB) molecular weight with increasing host-produced ethanol depending on culture aeration. On the other hand, production in recombinant BW25113(ΔadhE), an alcohol dehydrogenase deletion strain, resulted in a 77% increase in molecular weight. Analysis of five E. coli strains revealed that the estimated number of CT reactions was correlated with ethanol production. These results demonstrate that host-produced ethanol acts as an equally effective CT agent as exogenous ethanol, and the control of ethanol production is important to regulate the PHA molecular weight.

Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

PubMed

Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

2013-09-15

We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

PubMed

Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

2015-07-01

Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

PubMed

Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

2017-02-15

Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

DFT-based prediction of reactivity of short-chain alcohol dehydrogenase

NASA Astrophysics Data System (ADS)

Stawoska, I.; Dudzik, A.; Wasylewski, M.; Jemioła-Rzemińska, M.; Skoczowski, A.; Strzałka, K.; Szaleniec, M.

2017-06-01

The reaction mechanism of ketone reduction by short chain dehydrogenase/reductase, ( S)-1-phenylethanol dehydrogenase from Aromatoleum aromaticum, was studied with DFT methods using cluster model approach. The characteristics of the hydride transfer process were investigated based on reaction of acetophenone and its eight structural analogues. The results confirmed previously suggested concomitant transfer of hydride from NADH to carbonyl C atom of the substrate with proton transfer from Tyr to carbonyl O atom. However, additional coupled motion of the next proton in the proton-relay system, between O2' ribose hydroxyl and Tyr154 was observed. The protonation of Lys158 seems not to affect the pKa of Tyr154, as the stable tyrosyl anion was observed only for a neutral Lys158 in the high pH model. The calculated reaction energies and reaction barriers were calibrated by calorimetric and kinetic methods. This allowed an excellent prediction of the reaction enthalpies (R2 = 0.93) and a good prediction of the reaction kinetics (R2 = 0.89). The observed relations were validated in prediction of log K eq obtained for real whole-cell reactor systems that modelled industrial synthesis of S-alcohols.

An improved reaction path optimization method using a chain of conformations

NASA Astrophysics Data System (ADS)

Asada, Toshio; Sawada, Nozomi; Nishikawa, Takuya; Koseki, Shiro

2018-05-01

The efficient fast path optimization (FPO) method is proposed to optimize the reaction paths on energy surfaces by using chains of conformations. No artificial spring force is used in the FPO method to ensure the equal spacing of adjacent conformations. The FPO method is applied to optimize the reaction path on two model potential surfaces. The use of this method enabled the optimization of the reaction paths with a drastically reduced number of optimization cycles for both potentials. It was also successfully utilized to define the MEP of the isomerization of the glycine molecule in water by FPO method.

Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions

NASA Astrophysics Data System (ADS)

Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.

2018-05-01

It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

Parvovirus B19 Infection in Children With Arterial Ischemic Stroke.

PubMed

Fullerton, Heather J; Luna, Jorge M; Wintermark, Max; Hills, Nancy K; Tokarz, Rafal; Li, Ying; Glaser, Carol; DeVeber, Gabrielle A; Lipkin, W Ian; Elkind, Mitchell S V

2017-10-01

Case-control studies suggest that acute infection transiently increases the risk of childhood arterial ischemic stroke. We hypothesized that an unbiased pathogen discovery approach utilizing MassTag-polymerase chain reaction would identify pathogens in the blood of childhood arterial ischemic stroke cases. The multicenter international VIPS study (Vascular Effects of Infection in Pediatric Stroke) enrolled arterial ischemic stroke cases, and stroke-free controls, aged 29 days through 18 years. Parental interview included questions on recent infections. In this pilot study, we used MassTag-polymerase chain reaction to test the plasma of the first 161 cases and 34 controls enrolled for a panel of 28 common bacterial and viral pathogens. Pathogen DNA was detected in no controls and 14 cases (8.7%): parvovirus B19 (n=10), herpesvirus 6 (n=2), adenovirus (n=1), and rhinovirus 6C (n=1). Parvovirus B19 infection was confirmed by serologies in all 10; infection was subclinical in 8. Four cases with parvovirus B19 had underlying congenital heart disease, whereas another 5 had a distinct arteriopathy involving a long-segment stenosis of the distal internal carotid and proximal middle cerebral arteries. Using MassTag-polymerase chain reaction, we detected parvovirus B19-a virus known to infect erythrocytes and endothelial cells-in some cases of childhood arterial ischemic stroke. This approach can generate new, testable hypotheses about childhood stroke pathogenesis. © 2017 American Heart Association, Inc.

Electron-beam generated porous dextran gels: experimental and quantum chemical studies.

PubMed

Naumov, Sergej; Knolle, Wolfgang; Becher, Jana; Schnabelrauch, Matthias; Reichelt, Senta

2014-06-01

The aim of this work was to investigate the reaction mechanism of electron-beam generated macroporous dextran cryogels by quantum chemical calculation and electron paramagnetic resonance measurements. Electron-beam radiation was used to initiate the cross-linking reaction of methacrylated dextran in semifrozen aqueous solutions. The pore morphology of the resulting cryogels was visualized by scanning electron microscopy. Quantum chemical calculations and electron paramagnetic resonance studies provided information on the most probable reaction pathway and the chain growth radicals. The most probable reaction pathway was a ring opening reaction and the addition of a C-atom to the double-bond of the methacrylated dextran molecule. First detailed quantum chemical calculation on the reaction mechanism of electron-beam initiated cross-linking reaction of methacrylated dextran are presented.

Experimental studies of one-way reaction front barriers in three-dimensional vortex flows

NASA Astrophysics Data System (ADS)

Gannon, Joanie; Doan, Minh; Simons, Jj; Mitchell, Kevin; Solomon, Tom

2017-11-01

We present results of experimental studies of the evolution of the excitable, Ruthenium (Ru)-catalyzed, Belousov-Zhabotinsky (BZ) reaction in a three-dimensional (3D) flow composed of the superposition of horizontal and vertical vortex chains. The reaction fronts are imaged in 3D with a scanning, laser-induced fluorescence technique that takes advantage of the differential fluoresence of the Ruthenium indicated at the front. When the horizontal and vertical vortex chains are lined up, a dominant scroll structure is observed that acts as a one-way barrier blocking fronts propagating across vortex boundaries and into vortex centers. A second, quarter-tube barrier is observed along the edges of the unit cell. When the vortices are shifted relative to each other, tube-like barriers are observed in the interior. All of these barriers are compared with burning invariant manifolds predicted from a 6D set of differential equations describing the evolution of front elements in the flow. Supported by NSF Grants DMR-1361881 and DUE-1317446.

Protein side chain rotational isomerization: A minimum perturbation mapping study

NASA Astrophysics Data System (ADS)

Haydock, Christopher

1993-05-01

A theory of the rotational isomerization of the indole side chain of tryptophan-47 of variant-3 scorpion neurotoxin is presented. The isomerization potential energy, entropic part of the isomerization free energy, isomer probabilities, transition state theory reaction rates, and indole order parameters are calculated from a minimum perturbation mapping over tryptophan-47 χ1×χ2 torsion space. A new method for calculating the fluorescence anisotropy from molecular dynamics simulations is proposed. The method is based on an expansion that separates transition dipole orientation from chromophore dynamics. The minimum perturbation potential energy map is inverted and applied as a bias potential for a 100 ns umbrella sampling simulation. The entropic part of the isomerization free energy as calculated by minimum perturbation mapping and umbrella sampling are in fairly close agreement. Throughout, the approximation is made that two glutamine and three tyrosine side chains neighboring tryptophan-47 are truncated at the Cβ atom. Comparison with the previous combination thermodynamic perturbation and umbrella sampling study suggests that this truncated neighbor side chain approximation leads to at least a qualitatively correct theory of tryptophan-47 rotational isomerization in the wild type variant-3 scorpion neurotoxin. Analysis of van der Waals interactions in a transition state region indicates that for the simulation of barrier crossing trajectories a linear combination of three specially defined dihedral angles will be superior to a simple side chain dihedral reaction coordinate.

Study of the nucleon radiative captures 8Li(n,γ)9Li, 9Be(p,γ)10B, 10Be(n,γ)11Be, 10B(p,γ)11C, and 16O(p,γ)17F at thermal and astrophysical energies

NASA Astrophysics Data System (ADS)

Dubovichenko, Sergey; Dzhazairov-Kakhramanov, Albert

We have studied the neutron-capture reactions 8Li(n,γ)9Li and its role in the primordial nucleosynthesis. The n +8Li →9Li + γ reaction has a significant astrophysical interest because it includes one of the variants of chain of primordial nucleosynthesis processes of the Universe and thermonuclear reactions in type II supernovae. Furthermore, we consider the 9Be(p,γ)10B reaction in the astrophysical energy range in the modified potential cluster model (MPCM) with splitting of orbital states according to Young tableaux and, in some cases, with forbidden states (FS). The reaction 9Be(p,γ)10B plays an important role in primordial and stellar nucleosynthesis of light elements in the p shell. Hydrogen burning in second-generation stars occurs via the proton-proton (pp) chain and CNO cycle, with the 9Be(p,γ)10B reaction serving as an intermediate link between these cycles. Furthermore, the possibility of describing available experimental data for the total reaction cross-sections of neutron radiative capture on 10Be at thermal and astrophysical energies has been shown. This reaction is a part of one of the variants of the chain of primordial nucleosynthesis of the Universe due to which the elements with a mass of A > 11-12 may be formed. The results in the field of study of thermonuclear proton-capture reaction on 10B at ultralow, i.e., astrophysical energies will be presented further. The possibility of description of the experimental data for the astrophysical S-factor of the proton radiative capture on 16O to the ground state (GS) of 17F was considered in the frame of the MPCM with FS and classification of the states according to Young tableaux. It was shown that on the basis of the E1 transitions from the states of p16O scattering to the GS of 17F in the p16O channel generally succeed to explain the value of measured cross-sections at astrophysical energies.

Ufd2p synthesizes branched ubiquitin chains to promote the degradation of substrates modified with atypical chains

PubMed Central

Liu, Chao; Liu, Weixiao; Ye, Yihong; Li, Wei

2017-01-01

Ubiquitination of a subset of proteins by ubiquitin chain elongation factors (E4), represented by Ufd2p in Saccharomyces cerevisiae, is a pivotal regulator for many biological processes. However, the mechanism of Ufd2p-mediated ubiquitination is largely unclear. Here, we show that Ufd2p catalyses K48-linked multi-monoubiquitination on K29-linked ubiquitin chains assembled by the ubiquitin ligase (Ufd4p), resulting in branched ubiquitin chains. This reaction depends on the interaction of K29-linked ubiquitin chains with two N-terminal loops of Ufd2p. Only following the addition of K48-linked ubiquitin to substrates modified with K29-linked ubiquitin chains, can the substrates be escorted to the proteasome for degradation. We demonstrate that this ubiquitin chain linkage switching reaction is essential for ERAD, oleic acid and acid pH resistance in yeast. Thus, our results suggest that Ufd2p functions by switching ubiquitin chain linkages to allow the degradation of proteins modified with a ubiquitin linkage, which is normally not targeted to the proteasome. PMID:28165462

Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

Identification of Brucella spp. by using the polymerase chain reaction.

PubMed Central

Herman, L; De Ridder, H

1992-01-01

The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

Detection of Listeria monocytogenes by using the polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bessesen, M.T.; Luo, Q.; Blaser, M.J.

1990-09-01

A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

PubMed

Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

2012-07-09

Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

9 CFR 145.33 - Terminology and classification; flocks and products.

Code of Federal Regulations, 2010 CFR

2010-01-01

.... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

Atomistic Model for the Polyamide Formation from β-Lactam Catalyzed by Candida Antarctica Lipase B

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baum, Iris; Elsasser, Brigitta M.; Schwab, Leendert

2011-04-01

Candida antarctica lipase B (CALB) is an established biocatalyst for a variety of transesterification, amidation, and polymerization reactions. In contrast to polyesters, polyamides are not yet generally accessible via enzymatic polymerization. In this regard, an enzyme-catalyzed ring-opening polymerization of {beta}-lactam (2-azetidinone) using CALB is the first example of an enzymatic polyamide formation yielding unbranched poly({beta}-alanine), nylon 3. The performance of this polymerization, however, is poor, considering the maximum chain length of 18 monomer units with an average length of 8, and the molecular basis of the reaction so far is not understood. We have employed molecular modeling techniques using dockingmore » tools, molecular dynamics, and QM/MM procedures to gain insight into the mechanistic details of the various reaction steps involved. As a result, we propose a catalytic cycle for the oligomerization of {beta}-lactam that rationalizes the activation of the monomer, the chain elongation by additional {beta}-lactam molecules, and the termination of the polymer chain. In addition, the processes leading to a premature chain termination are studied. Particularly, the QM/MM calculation enables an atomistic description of all eight steps involved in the catalytic cycle, which features an in situ-generated {beta}-alanine as the elongating monomer and which is compatible with the experimental findings.« less

[Pea (Pisum sativum) genes, participating in symbiosis with nitrogen-fixing bacteria. III. Study of the structure of the ENOD12 early nodulin gene for various types of peas using the polymerase chain reaction (PCR)].

PubMed

Kozik, A V; Matvienko, M A; Men', A E; Zalenskiĭ, A O; Tikhonovich, I A

1992-01-01

We have determined the length of early noduline gene ENOD12 in various varieties and lines of pea (Pisum sativum) using the polymerase chain reaction (PCR). It was demonstrated that promoter regions of ENOD12A and ENOD12B genes in line 2150 (Afghanistan) are longer than these in variety "Feltham first". The disparity is 14 bp. When studying these genes in 7 different lines and varieties of pea it was found that ENOD12A gene is more variable in size than the ENOD12B gene. We showed the possibility to analyze the heritage of ENOD12 gene's alleles by using the PCR method.

Transformation of soybean Gy3 gene into Artemisaarenaria mediated by corona discharge

NASA Astrophysics Data System (ADS)

Chao, Lu-meng; Na, Ri; Xue, Dan; Xu, Yongze; Liu, Teng

2013-03-01

In order to improve the protein content of desert plant, a method of genetic transformation mediated by corona discharge was established. Artemisia seeds were processed in corona electric field for 120 min at 12 kV, and then soaked in 0.1 SSC media that contained Soybean Gy3 gene DNA to incubate for 12 h at 26 °C. Finally the seeds were inoculated on the differentiation medium. Polymerase Chain Reaction (PCR) and Reverse Transcription Polymerase Chain Reaction (RT-PCR) detection showed that the Soybean Gy3 gene had been successfully introduced into genomic DNA of the regenerated plants of Artemisaarenaria. The study provided a new way for corona discharge in plant genetic modification.

Immediate hypersensitivity to moxifloxacin with tolerance to ciprofloxacin: report of three cases and review of the literature.

PubMed

Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth

2010-04-01

To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.

No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

PubMed

D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

2006-10-01

Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

Prevalence of Sexually Transmitted Diseases in Asymptomatic Renal Transplant Recipients.

PubMed

Sarier, Mehmet; Sepin Ozen, Nevgun; Guler, Hicran; Duman, Ibrahim; Yüksel, Yücel; Tekin, Sabri; Yavuz, Asuman Havva; Yucetin, Levent; Erdogan Yilmaz, Mine

2018-04-04

Sexually transmitted diseases, which may be asymptomatic, have the potential to cause serious health problems in renal transplant recipients. The aim of this study was to determine the prevalence of sexually transmitted diseases in sexually active asymptomatic renal transplant patients by using real-time multiplex polymerase chain reaction assays. This prospective controlled study was conducted between November 2016 and January 2017 in our hospital. Our study group included 80 consecutive, sexually active asymptomatic patients (40 men and 40 women) who had undergone renal transplant in our hospital and who presented to our outpatient clinic for routine follow-up. We also included a control group of 80 consecutive, sexually active nontransplant patients (40 men and 40 women). All patient samples were tested for Gardnerella vaginalis and obligate anaerobes (Prevotella bivia, Porphyromonas species), Candida species, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma species, Trichomonas vaginalis, Neisseria gonorrhoeae, Chlamydia trachomatis, herpes simplex virus 1 and 2, and Cytomegalovirus by real-time multiplex polymerase chain reaction. The prevalences of infection with Gardnerella vaginalis and obligate anaerobes (P = .043), Ureaplasma species (P = .02), and Cytomegalovirus (P = .016) were found to be significantly higher in the study group versus the control group. However, there was no difference between the 2 groups regarding the prevalence of Mycoplasma infection (P = .70). Sexually transmitted diseases may occur more frequently in sexually active asymptomatic renal transplant recipients than in nontransplanted individuals. Real-time multiplex polymerase chain reaction analysis may be a suitable method for determining these pathogens.

Simultaneous detection of hemagglutinin and neuraminidase genes of novel influenza A (H7N9) by duplex real-time reverse transcription polymerase chain reaction.

PubMed

Li, Yan; Wu, Tao; Qi, Xian; Ge, Yiyue; Guo, Xiling; Wu, Bin; Yu, Huiyan; Zhu, Yefei; Shi, Zhiyang; Wang, Hua; Cui, Lunbiao; Zhou, Minghao

2013-12-01

A novel reassortant influenza A (H7N9) virus emerged recently in China. In this study, a duplex real-time reverse transcription polymerase chain reaction (rRT-PCR) assay was developed for the simultaneous detection of hemagglutinin (HA) and neuraminidase (NA) genes of H7N9 influenza viruses. The sensitivity of the assay was determined to be 10 RNA copies per reaction for both HA and NA genes. No cross-reactivity was observed with other influenza virus subtypes or respiratory tract viruses. One hundred and forty-six clinical and environmental specimens were tested and compared with reference methods and were found to be consistent. The assay is suitable for large-scale screening due to short turnaround times and high specificity, sensitivity, and reproducibility. Copyright © 2013 Elsevier B.V. All rights reserved.

Detection of human Pneumocystis carinii by the polymerase chain reaction.

PubMed

Becker-Hapak, M; Liberator, P; Graves, D

1991-01-01

Oligonucleotide primers were prepared from a clone (B12) which has been shown to be a repetitive sequence in the rat P. carinii genome. Polymerase chain reaction was employed to amplify both rat and human P. carinii DNA. The detection limit of the assay was approximately 600 ng of total nucleic acid. Amplification products from both the rat and human isolates (ca. 780 bp) were characterized by denaturing gradient gel electrophoresis after digestion with Sau3A. No amplification products were obtained when DNA from the following potential pulmonary pathogens were used in identical reactions: Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Mycobacterium avium-intracellulare and cytomegalovirus. In a blind study using the B12 primers, P. carinii DNA was successfully amplified in clinical samples which were positive by direct immunofluorescence assay (IFA) as well as in some specimens not identified by direct IFA.

New polymer systems: Chain extension by dianhydrides

NASA Technical Reports Server (NTRS)

Rhein, R. A.; Ingham, J. D.

1972-01-01

The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.

Polyisobutylene chain end transformations: Block copolymer synthesis and click chemistry functionalizations

NASA Astrophysics Data System (ADS)

Magenau, Andrew Jackson David

The primary objectives of this research were twofold: (1) development of synthetic procedures for combining quasiliving carbocationic polymerization (QLCCP) of isobutylene (IB) and reversible addition fragmentation chain transfer (RAFT) polymerization for block copolymer synthesis; (2) utilization of efficient, robust, and modular chemistries for facile functionalization of polyisobutylene (PIB). In the first study block copolymers consisting of PIB, and either PMMA or PS block segments, were synthesized by a site transformation approach combining living cationic and reversible addition-fragmentation chain transfer (RAFT) polymerizations. The initial PIB block was synthesized via quasiliving cationic polymerization using the TMPCl/TiCl4 initiation system and was subsequently converted into a hydroxylterminated PIB. Site transformation of the hydroxyl-terminated PIB into a macro chain transfer agent (PIB-CTA) was accomplished by N,N'-dicyclohexylcarbodiimide/dimethylaminopyridine-catalyzed esterification with 4-cyano-4-(dodecylsulfanylthiocarbonylsulfanyl)pentanoic acid. In the second study another site transformation approach was developed to synthesize a novel block copolymer, composed of PIB and PNIPAM segments. The PIB block was prepared via quasiliving cationic polymerization and end functionalized by in-situ quenching to yield telechelic halogen-terminated PIB. Azido functionality was obtained by displacement of the terminal halogen through nucleophilic substitution, which was confirmed by both 1H and 13C NMR. Coupling of an alkyne-functional chain transfer agent (CTA) to azido PIB was successfully accomplished through a copper catalyzed click reaction. Structure of the resulting PIB-based macro-CTA was verified with 1H NMR, FTIR, and GPC; whereas coupling reaction kinetics were monitored by real time variable temperature (VT) 1H NMR. In a third study, a click chemistry functionalization procedure was developed based upon the azide-alkyne 1,3-dipolar cycloaddition reaction. 1-(o-Azidoalkyl)pyrrolyl-terminated PIB was successfully synthesized both by substitution of the terminal halide of 1-(o-haloalkyl)pyrrolyl-terminated PIB with sodium azide and by in situ quenching of quasiliving PIB with a 1-(o-azidoalkyl)pyrrole. GPC indicated the absence of coupled PIB under optimized conditions, confirming exclusive mono-substitution on each pyrrole ring. In a fourth study, radical thiol-ene hydrothiolation "Click" chemistry was explored and adapted to easily and rapidly modify exo -olefin PIB with an array of thiol compounds bearing useful functionalities, including primary halogen, primary amine, primary hydroxyl, and carboxylic acid. The thiol-ene "click" procedure was shown to be applicable to both mono and difunctional exo-olefin polyisobutylene. Telechelic mono- and difunctional exo-olefin PIBs were synthesized via quasiliving cationic polymerization followed by quenching with the hindered amine, 1,2,2,6,6-pentamethylpiperidine. Lower reaction temperatures were found to increase exo-olefin conversion to near quantitative amounts. In the fifth study, thiol-terminated polyisobutylene (PIB-SH) was synthesized by reaction of thiourea with alpha,o-bromine-terminated PIB in a three step one-pot procedure. First the alkylisothiouronium salt was produced using a 1:1 (v:v) DMF:heptane cosolvent mixture at 90°C. Hydrolysis of the salt by aqueous base produced thiolate chain ends, which were then acidified to form the desired thiol functional group. An extension of this reaction was performed by a sequential thiol-ene/thiol-yne procedure to produce tetra-hydroxy functionalized PIB. 1H NMR was used to confirm formation of both alkyne and tetrahydroxyl functional species. Further utility of PIB-SH was demonstrated by base catalyzed thiol-isocyanate reactions. A model reaction was conducted with phenyl isocyanate in THF using triethylamine as the catalyst. Last, conversion of PIB-SH directly into a RAFT macro-CTA was accomplished, as shown by 1H NMR, by treatment of PIB-SH with triethylamine in carbon disulfide and subsequent alkylation with 2-bromopropionic acid. (Abstract shortened by UMI.)

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

PubMed Central

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

Real-Time Polymerase Chain Reaction for Detection of Schistosoma DNA in Small-Volume Urine Samples Reflects Focal Distribution of Urogenital Schistosomiasis in Primary School Girls in KwaZulu Natal, South Africa

PubMed Central

Pillay, Pavitra; Taylor, Myra; Zulu, Siphosenkosi G.; Gundersen, Svein G.; Verweij, Jaco J.; Hoekstra, Pytsje; Brienen, Eric A. T.; Kleppa, Elisabeth; Kjetland, Eyrun F.; van Lieshout, Lisette

2014-01-01

Schistosoma haematobium eggs and Schistosoma DNA levels were measured in urine samples from 708 girls recruited from 18 randomly sampled primary schools in South Africa. Microscopic analysis of two 10-mL urine subsamples collected on three consecutive days confirmed high day-to-day variation; 103 (14.5%) girls had positive results at all six examinations, and at least one positive sample was seen in 225 (31.8%) girls. Schistosoma-specific DNA, which was measured in a 200-μL urine subsample by using real-time polymerase chain reaction, was detected in 180 (25.4%) cases, and levels of DNA corresponded significantly with average urine egg excretion. In concordance with microscopic results, polymerase chain reaction results were significantly associated with history of gynecologic symptoms and confirmed highly focal distribution of urogenital schistosomiasis. Parasite-specific DNA detection has a sensitivity comparable to single urine microscopy and could be used as a standardized high-throughput procedure to assess distribution of urogenital schistosomiasis in relatively large study populations by using small sample volumes. PMID:24470560

Sleeve reaction chamber system

DOEpatents

Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

2009-08-25

A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

PubMed

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

USDA-ARS?s Scientific Manuscript database

Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

DOEpatents

Wigner, E.P.; Weinberg, A.M.

1961-01-24

A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

ERIC Educational Resources Information Center

Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

2006-01-01

We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

PubMed

Ragheb, Suzan Mohammed; Jimenez, Luis

Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

PubMed Central

Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

2014-01-01

A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

Expression of TGF-beta1, osteonectin, and BMP-4 in mandibular distraction osteogenesis with compression stimulation: reverse transcriptase-polymerase chain reaction study and biomechanical test.

PubMed

Kim, Uk-Kyu; Park, Seong-Jin; Seong, Wook-Jin; Heo, Jun; Hwang, Dae-Seok; Kim, Yong-Deok; Shin, Sang-Hun; Kim, Gyoo-Cheon

2010-09-01

This study compared the levels of transforming growth factor-beta1 (TGF-beta1), osteonectin, and bone morphogenetic protein-4 (BMP-4) expression in regenerated bone in a rabbit mandible that had undergone conventional distraction osteogenesis (DO) with those in regenerated bone from a modified DO technique with compression stimulation. A total of 42 rabbits were used in this reverse transcriptase-polymerase chain reaction study. In the control group, distraction was performed at 1 mm/day for 8 days. In the experimental group, overdistraction was performed for 10 days, followed by a 3-day latency period and 2 days of compression to achieve the same amount of DO. Three rabbits per subgroup were killed at 0, 5, 13, 20, 27, 34, and 41 days after the initial osteotomy. The levels of TGF-beta1, osteonectin, and BMP-4 in the bone regenerates were measured by reverse transcriptase-polymerase chain reaction. A biomechanical microhardness test was also performed in 8 rabbits as a separate experiment. Reverse transcriptase-polymerase chain reaction revealed a greater level of TGF-beta1 in the experimental group immediately after applying the compression force that continued for 2 weeks. The level then decreased to that of the control group at 3 weeks. The greater level of osteonectin in the experimental group after compression than that in the control group continued for 3 weeks. In the experimental group, the level of BMP-4 increased immediately after compression. However, the level in the control group decreased. The microhardness ratio of distracted bone to normal bone on the cortex was statistically different at 0.47 in the control group and 0.80 in the experimental group (P = .049) at 55 days after osteotomy. The effectiveness of the new DO technique with compression stimulation was confirmed by the gene expression study and the biomechanical test findings. Copyright 2010 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Ab initio study of chain branching reactions involving second generation products in hydrocarbon combustion mechanisms.

PubMed

Davis, Alexander C; Francisco, Joseph S

2012-01-28

sec-Alkyl radicals are key reactive intermediates in the hydrocarbon combustion and atmospheric decomposition mechanisms that are formed by the abstraction of hydrogen from an alkane, or as a second generation product of n-alkyl H-migrations, C-C bond scissions in branched alkyl radicals, or the bimolecular reaction between olefins and n-alkyl radicals. Since alkanes and branched alkanes, which the sec-alkyl radicals are derived from, make up roughly 40-50% of traditional fuels an understanding of their chemistry is essential to improving combustion systems. The present work investigates all H-migration reactions initiated from an sec-alkyl radical that involve the movement of a secondary hydrogen, for the 2-butyl through 4-octyl radicals, using the CBS-Q, G2, and G4 composite methods. The resulting thermodynamic and kinetic parameters are compared to similar reactions in n-alkyl radicals in order to determine underlying trends. Particular attention is paid to the effect of cis/trans and 1,3-diaxial interactions on activation energies and rate coefficients. When combined with our previous work on n-alkyl radical H-migrations, a complete picture of H-migrations in unbranched alkyl radicals is obtained. This full data set suggests that the directionality of the remaining branched chains has a minimal effect on the rate coefficients for all but the largest viable transition states, which is in stark contrast to the differences predicted by the structurally similar dimethylcycloalkanes. In fact the initial location of the secondary radical site has a greater effect on the rate than does the directionality of the remaining alkyl chains. The activation energies for secondary to secondary reactions are much closer to those of the secondary to primary H-migrations. However, the rate coefficients are found to be closer to the corresponding primary to primary reaction values. A significant ramification of these results is that there will be multiple viable reaction pathways for these reactions instead of only one dominant pathway as previously believed.

Lipozyme RM IM-catalyzed acidolysis of Cinnamomum camphora seed oil with oleic acid to produce human milk fat substitutes enriched in medium-chain fatty acids.

PubMed

Zou, Xian-Guo; Hu, Jiang-Ning; Zhao, Man-Li; Zhu, Xue-Mei; Li, Hong-Yan; Liu, Xiao-Ru; Liu, Rong; Deng, Ze-Yuan

2014-10-29

In the present study, a human milk fat substitute (HMFS) enriched in medium-chain fatty acids (MCFAs) was synthesized through acidolysis reaction from Cinnamomum camphora seed oil (CCSO) with oleic acid in a solvent-free system. A commercial immobilized lipase, Lipozyme RM IM, from Rhizomucor miehei, was facilitated as a biocatalyst. Effects of different reaction conditions, including substrate molar ratio, enzyme concentration, reaction temperature, and reaction time were investigated using response surface methodology (RSM) to obtain the optimal oleic acid incorporation. After optimization, results showed that the maximal incorporation of oleic acid into HMFS was 59.68%. Compared with CCSO, medium-chain fatty acids at the sn-2 position of HMFS accounted for >70%, whereas oleic acid was occupied predominantly at the sn-1,3 position (78.69%). Meanwhile, triacylglycerol (TAG) components of OCO (23.93%), CCO (14.94%), LaCO (13.58%), OLaO (12.66%), and OOO (11.13%) were determined as the major TAG species in HMFS. The final optimal reaction conditions were carried out as follows: substrate molar ratio (oleic acid/CCSO), 5:1; enzyme concentration, 12.5% (w/w total reactants); reaction temperature, 60 °C; and reaction time, 28 h. The reusability of Lipozyme RM IM in the acidolysis reaction was also evaluated, and it was found that it could be reused up to 9 times without significant loss of activities. Urea inclusion method was used to separate and purify the synthetic product. As the ratio of HMFS/urea increased to 1:2, the acid value lowered to the minimum. In a scale-up experiment, the contents of TAG and total tocopherols in HMFS (modified CCSO) were 77.28% and 12.27 mg/100 g, respectively. All of the physicochemical indices of purified product were within food standards. Therefore, such a MCFA-enriched HMFS produced by using the acidolysis method might have potential application in the infant formula industry.

Safety of medium-chain triglycerides used as an intraocular tamponading agent in an experimental vitrectomy model rabbit.

PubMed

Auriol, Sylvain; Mahieu, Laurence; Brousset, Pierre; Malecaze, François; Mathis, Véronique

2013-01-01

To evaluate safety of medium-chain triglycerides used as a possible intraocular tamponading agent. A 20-gauge pars plana vitrectomy was performed in the right eye of 28 rabbits. An ophthalmologic examination was performed every week until rabbits were killed. At days 7, 30, 60, and 90, rabbits were killed and the treated eyes were examined macroscopically and prepared for histologic examination. Principal outcome was retinal toxicity evaluated by light and electron microscopy, and secondary outcomes were the presence of medium-chain triglyceride emulsification, inflammatory reactions, and the development of cataract. Histologic examination did not reveal any retinal toxicity. Two cases of moderate emulsification were observed, but in these cases, emulsification was caused by the perioperative injection of the agent and did not increase during the postoperative period. We noted 13 cases of inflammatory reaction in vitreous cavity and no case of inflammatory reaction in anterior chamber. Two eyes developed cataract as a result of perioperative trauma to the lens with the vitreous cutter and not secondary to the presence of medium-chain triglycerides in the vitreous cavity. Medium-chain triglycerides did not induce morphologic evidence of retinal toxicity. The results suggest that medium-chain triglycerides could be a promising alternative intraocular tamponading agent for the treatment of retinal detachments.

Peptidomimetics via copper-catalyzed azide-alkyne cycloadditions.

PubMed

Angell, Yu L; Burgess, Kevin

2007-10-01

This critical review concerns the impact of copper-mediated alkyne-azide cycloadditions on peptidomimetic studies. It discusses how this reaction has been used to insert triazoles into peptide chains, to link peptides to other functionalities (e.g. carbohydrates, polymers, and labels), and as a basis for evolution of less peptidic compounds as pharmaceutical leads. It will be of interest to those studying this click reaction, peptidomimetic secondary structure and function, and to medicinal chemists.

Autocatalytic formation of an iron(IV)-oxo complex via scandium ion-promoted radical chain autoxidation of an iron(II) complex with dioxygen and tetraphenylborate.

PubMed

Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi

2014-06-04

A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.

Entropy driven chain effects on ligation chemistry† †Electronic supplementary information (ESI) available: Synthetic details, applied MHKS parameters, SEC chromatograms of all samples, (HT) NMR data, experimental debonding values, SANS measurements, computational data (energy contributions and geometries in the form of Gaussian archive entries). See DOI: 10.1039/c4sc02908a Click here for additional data file.

PubMed Central

Pahnke, Kai; Brandt, Josef; Gryn'ova, Ganna; Lindner, Peter; Schweins, Ralf; Schmidt, Friedrich Georg

2015-01-01

We report the investigation of fundamental entropic chain effects that enable the tuning of modular ligation chemistry – for example dynamic Diels–Alder (DA) reactions in materials applications – not only classically via the chemistry of the applied reaction sites, but also via the physical and steric properties of the molecules that are being joined. Having a substantial impact on the reaction equilibrium of the reversible ligation chemistry, these effects are important when transferring reactions from small molecule studies to larger or other entropically very dissimilar systems. The effects on the DA equilibrium and thus the temperature dependent degree of debonding (%debond) of different cyclopentadienyl (di-)functional poly(meth-)acrylate backbones (poly(methyl methacrylate), poly(iso-butyl methacrylate), poly(tert-butyl methacrylate), poly(iso-butyl acrylate), poly(n-butyl acrylate), poly(tert-butyl acrylate), poly(methyl acrylate) and poly(isobornyl acrylate)), linked via a difunctional cyanodithioester (CDTE) were examined via high temperature (HT) NMR spectroscopy as well as temperature dependent (TD) SEC measurements. A significant impact of not only chain mass and length with a difference in the degree of debonding of up to 30% for different lengths of macromonomers of the same polymer type but – remarkably – as well the chain stiffness with a difference in bonding degrees of nearly 20% for isomeric poly(butyl acrylates) is found. The results were predicted, reproduced and interpreted via quantum chemical calculations, leading to a better understanding of the underlying entropic principles. PMID:29560194

Interactions between Therapeutic Proteins and Acrylic Acid Leachable.

PubMed

Liu, Dengfeng; Nashed-Samuel, Yasser; Bondarenko, Pavel V; Brems, David N; Ren, Da

2012-01-01

Leachables are chemical compounds that migrate from manufacturing equipment, primary containers and closure systems, and packaging components into biopharmaceutical and pharmaceutical products. Acrylic acid (at concentration around 5 μg/mL) was detected as leachable in syringes from one of the potential vendors (X syringes). In order to evaluate the potential impact of acrylic acid on therapeutic proteins, an IgG 2 molecule was filled into a sterilized X syringe and then incubated at 45 °C for 45 days in a pH 5 acetate buffer. We discovered that acrylic acid can interact with proteins at three different sites: (1) the lysine side chain, (2) the N-terminus, and (3) the histidine side chain, by the Michael reaction. In this report, the direct interactions between acrylic acid leachable and a biopharmaceutical product were demonstrated and the reaction mechanism was proposed. Even thought a small amount (from 0.02% to 0.3%) of protein was found to be modified by acrylic acid, the modified protein can potentially be harmful due to the toxicity of acrylic acid. After being modified by acrylic acid, the properties of the therapeutic protein may change due to charge and hydrophobicity variations. Acrylic acid was detected to migrate from syringes (Vendor X) into a therapeutic protein solution (at a concentration around 5 μg/mL). In this study, we discovered that acrylic acid can modify proteins at three different sites: (1) the lysine side chain, 2) the N-terminus, and 3) the histidine side chain, by the Michael reaction. In this report, the direct interactions between acrylic acid leachable and a biopharmaceutical product were demonstrated and the reaction mechanism was proposed.

Identification of fragile X pre-mutation carriers in the Chinese obstetric population using a robust FMR1 polymerase chain reaction assay: implications for screening and prenatal diagnosis.

PubMed

Cheng, Y Ky; Lin, C Sw; Kwok, Y Ky; Chan, Y M; Lau, T K; Leung, T Y; Choy, K W

2017-04-01

There is significant morbidity associated with fragile X syndrome. Unfortunately, most maternal carriers are clinically silent during their reproductive years. Because of this, many experts have put forward the notion of preconception or prenatal fragile X carrier screening for females. This study aimed to determine the prevalence of fragile X syndrome pre-mutation and asymptomatic full-mutation carriers in a Chinese pregnant population, and the distribution of cytosine-guanine-guanine (CGG) repeat numbers using a robust fragile X mental retardation 1 (FMR1) polymerase chain reaction assay. This was a cross-sectional survey in prospectively recruited pregnant women from a university hospital in Hong Kong. Chinese pregnant women without a family history of fragile X syndrome were recruited between April 2013 and May 2015. A specific FMR1 polymerase chain reaction assay was performed on peripheral blood to determine the CGG repeat number of the FMR1 gene. Prenatal counselling was offered to full-mutation and pre-mutation carriers. In 2650 Chinese pregnant women, two individuals with pre-mutation alleles (0.08%, one in 1325) and one asymptomatic woman with full-mutation (0.04%, one in 2650) alleles were identified. The overall prevalence of pre-mutation and full-mutation alleles was 0.11% (1 in 883). Furthermore, 30 (1.1%) individuals with intermediate alleles were detected. In the 2617 women with normal CGG repeats, the most common CGG repeat allele was 30. The overall prevalence of pre-mutation and asymptomatic full-mutation carriers in the Chinese pregnant population was one in 883, detected by a new FMR1 polymerase chain reaction assay.

Equilibrium Polymerization of Butyl Methacrylate in Bulk and in Nanopore Confinement

NASA Astrophysics Data System (ADS)

Tian, Qian; Simon, Sindee

The equilibrium between monomer and polymer in free radical polymerization can be shifted towards monomer under nanoconfinement. This decrease in ceiling temperature is due to a decrease in the entropy associated with the constrained polymer chains, resulting in a larger negative change in entropy of reaction. Here, we investigate the equilibrium polymerization of butyl methacrylate (BMA) in bulk and in nanopore confinement with differential scanning calorimetry (DSC) using di-tert-butyl peroxide (DTBP) as initiator. This system has several advantages compare to the previously studied system of methyl methacrylate (MMA) initiated with 2,2'-azo-bis-isobutyronitrile (AIBN), namely, a reduced rate of reaction, higher boiling point of monomer, and higher initiator utilization temperature range, all of which facilitate the study of the reaction at high temperatures near the ceiling temperature. Interestingly, for BMA, there is no change in limiting conversion between material reacted in bulk and that in controlled pore glass having pore diameters of 7.5 and 50 nm. This unexpected result may be due to the greater flexibility of the PBMA chains compared to PMMA, suggesting that in the BMA/PBMA system, the degree of confinement is relatively low. Future studies will continue to investigate how the entropy change on reaction is affected by confinement.

Terminal alkenes as versatile chemical reporter groups for metabolic oligosaccharide engineering.

PubMed

Späte, Anne-Katrin; Schart, Verena F; Schöllkopf, Sophie; Niederwieser, Andrea; Wittmann, Valentin

2014-12-08

The Diels-Alder reaction with inverse electron demand (DAinv reaction) of 1,2,4,5-tetrazines with electron rich or strained alkenes was proven to be a bioorthogonal ligation reaction that proceeds fast and with high yields. An important application of the DAinv reaction is metabolic oligosaccharide engineering (MOE) which allows the visualization of glycoconjugates in living cells. In this approach, a sugar derivative bearing a chemical reporter group is metabolically incorporated into cellular glycoconjugates and subsequently derivatized with a probe by means of a bioorthogonal ligation reaction. Here, we investigated a series of new mannosamine and glucosamine derivatives with carbamate-linked side chains of varying length terminated by alkene groups and their suitability for labeling cell-surface glycans. Kinetic investigations showed that the reactivity of the alkenes in DAinv reactions increases with growing chain length. When applied to MOE, one of the compounds, peracetylated N-butenyloxycarbonylmannosamine, was especially well suited for labeling cell-surface glycans. Obviously, the length of its side chain represents the optimal balance between incorporation efficiency and speed of the labeling reaction. Sialidase treatment of the cells before the bioorthogonal labeling reaction showed that this sugar derivative is attached to the glycans in form of the corresponding sialic acid derivative and not epimerized to another hexosamine derivative to a considerable extent. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Micro-droplet Digital Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Technologies Provide Highly Sensitive and Accurate Detection of Zika Virus.

PubMed

Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei

2018-06-01

The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8  copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4  copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1  copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.

Short relaxation times but long transient times in both simple and complex reaction networks

PubMed Central

Henry, Adrien; Martin, Olivier C.

2016-01-01

When relaxation towards an equilibrium or steady state is exponential at large times, one usually considers that the associated relaxation time τ, i.e. the inverse of the decay rate, is the longest characteristic time in the system. However, that need not be true, other times such as the lifetime of an infinitesimal perturbation can be much longer. In the present work, we demonstrate that this paradoxical property can arise even in quite simple systems such as a linear chain of reactions obeying mass action (MA) kinetics. By mathematical analysis of simple reaction networks, we pin-point the reason why the standard relaxation time does not provide relevant information on the potentially long transient times of typical infinitesimal perturbations. Overall, we consider four characteristic times and study their behaviour in both simple linear chains and in more complex reaction networks taken from the publicly available database ‘Biomodels’. In all these systems, whether involving MA rates, Michaelis–Menten reversible kinetics, or phenomenological laws for reaction rates, we find that the characteristic times corresponding to lifetimes of tracers and of concentration perturbations can be significantly longer than τ. PMID:27411726

Studies on long chain cis- and trans-acyl-CoA esters and Acyl-CoA dehydrogenase from rat heart mitochondria.

PubMed

Korsrud, G O; Conacher, H B; Jarvis, G A; Beare-Rogers, J L

1977-02-01

The beta-oxidation of long chain fatty acids was investigated in a preparation of rat heart mitochondria. The acyl-CoA esters of the cis and trans isomers of delta9-hexadecenoic, delta9-octadecenoic, delta11-eicosenoic, and delta13-docosenoic acids were prepared. Rates of the acyl-CoA reaction were determined with an extract from rat heart mitochondria. The apparent Michaelis constant (Km) and maximum velocity (Vmax) were calculated for each substrate. In general, apparent Vmax values decreased with increasing chain length of the monoenoic substrates. Reduced activity of acyl-CoA dehydrogenase with long chain acyl-CoA esters could have contributed to accumulation of lipids in hearts of rats fed diets containing long chain fatty acids.

Space-to-Ground: Genes in Space: 04/13/2018

NASA Image and Video Library

2018-04-12

Can the Polymerase Chain Reaction be used to study DNA alterations on the International Space Station? NASA's Space to Ground is your weekly update on what's happening aboard the International Space Station.

EPA Scientists Develop Research Methods for Studying Mold Fact Sheet

EPA Pesticide Factsheets

In 2002, U.S. Environmental Protection Agency researchers developed a DNA-based Mold Specific Quantitative Polymerase Chain Reaction method (MSQPCR) for identifying and quantifying over 100 common molds and fungi.

Method for polymer synthesis in a reaction well

DOEpatents

Brennan, Thomas M.

1998-01-01

A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

Method for polymer synthesis in a reaction well

DOEpatents

Brennan, T.M.

1998-09-29

A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

Nuclear Data Sheets for A = 222

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, S.; Tuli, J.; Jain,A.K.

The ENSDF evaluation for A=222 mass chain (1996El01) has been updated on the basis of the experimental results, since September 1995 (literature cutoff date in 1996El01), from various reaction and decay studies for all nuclides in A=222 mass chain (Z=84 to 92). A new nuclide ({sup 222}Po) has since been observed. In addition, new measurements have been reported in Rn, Th and Ra nuclides. The results obtained from various theoretical studies are given as comments. The updated level and decay schemes, and experimental decay and reaction data on which they are based, are summarized and presented for all the nuclidesmore » with mass number A=222. The adopted values of level energies, level spins and parities are given, and {gamma}-ray energies, intensities, as well as other nuclear properties are presented.« less

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

PubMed Central

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

Treesearch

David E. Schreiber; Karen J. Garner; James M. Slavicek

1997-01-01

Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

Copolymer Synthesis and Characterization by Post-Polymerization Modification

NASA Astrophysics Data System (ADS)

Galvin, Casey James

This PhD thesis examines the physical behavior of surface-grafted polymer assemblies (SGPAs) derived from post-polymerization modification (PPM) reactions in aqueous and vapor enriched environments, and offers an alternative method of creating SGPAs using a PPM approach. SGPAs comprise typically polymer chains grafted covalently to solid substrates. These assemblies show promise in a number of applications and technologies due to the stability imparted by the covalent graft and ability to modify interfacial properties and stability. SGPAs also offer a set of rich physics to explore in fundamental investigations as a result of confining macromolecules to a solid substrate. PPM reactions (also called polymer analogous reactions) apply small molecule organic chemistry reactions to the repeat units of polymer chains in order to generate new chemistries. By applying a PPM strategy to SGPAs, a wide variety of functional groups can be introduced into a small number of well-studied and well-behaved model polymer systems. This approach offers the advantage of holding constant other properties of the SGPA (e.g., molecular weight, MW, and grafting density, sigma) to isolate the effect of chemistry on physical behavior. Using a combination of PPM and fabrication methods that facilitate the formation of SPGAs with position-dependent gradual variation of sigma on flat impenetrable substrate, the influence of polymer chemistry and sigma is examined on the stability of weak polyelectrolyte brushes in aqueous environments at different pH levels. Degrafting of polymer chains in SGPAs exhibits a complex dependence on side chain chemistry, sigma, pH and the charge fraction (alpha) within the brush. Results of these experiments support a proposed mechanism of degrafting, wherein extension of the grafted chains away from the substrate generates tension along the polymer backbone, which activates the grafting chemistry for hydrolysis. The implications of these findings are important in developing technologies that use SGPAs in aqueous environments, and point to a need for potential alternative grafting chemistries. The behavior of SGPAs in vapor environments remains an underexplored phenomenon. By changing systematically the chemistry of SGPAs derived from a parent sample, the influence of side chain functional groups on the swelling of weak and strong polyelectrolyte brushes in the presence of water, methanol and ethanol vapors is explored. The extent of swelling and solvent uptake depends strongly on the chemistry in the polymer side chain and of the solvent. Despite bearing a permanent electrostatic charge in the side chain, the strong polyelectrolyte brushes exhibit no behavior typical of polyelectrolytes in water due to no dissociation of the counterion. Of particular interest is the behavior in humid environments of an SGPA bearing a zwitterionic group in its side chain, which results in exposure of electrostatic charges without counterions. Using substrates bearing the aforementioned sigma gradient of polymeric grafts, evidence of inter- and intramolecular complex formation is presented. Finally, a method of developing SGPAs by polymerizing bulk polymer chains through surface-grafted monomers (SGMs) is described. The SGMs are incorporated onto a solid substrate using the same PPM reaction employed in the degrafting and vapor swelling experiments, highlighting the versatility of PPM. The thickness of these SGPAs is correlated to the bulk polymer chains MW, suggesting this technique can be used in existing industrial bulk polymerization processes.

Facile preparation of cobaltocenium-containing polyelectrolyte via click chemistry and RAFT polymerization.

PubMed

Yan, Yi; Zhang, Jiuyang; Qiao, Yali; Tang, Chuanbing

2014-01-01

A facile method to prepare cationic cobaltocenium-containing polyelectrolyte is reported. Cobaltocenium monomer with methacrylate is synthesized by copper-catalyzed azide-alkyne cycloaddition (CuAAC) reaction between 2-azidoethyl methacrylate and ethynylcobaltocenium hexafluorophosphate. Further controlled polymerization is achieved by reversible addition-fragmentation chain transfer polymerization (RAFT) by using cumyl dithiobenzoate (CDB) as a chain transfer agent. Kinetic study demonstrates the controlled/living process of polymerization. The obtained side-chain cobaltocenium-containing polymer is a metal-containing polyelectrolyte that shows characteristic redox behavior of cobaltocenium. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Violence and vulnerability of female migrants in drop houses in Arizona: the predictable outcome of a chain reaction of violence.

PubMed

Simmons, William Paul; Menjívar, Cecilia; Téllez, Michelle

2015-05-01

This qualitative research study examines the experiences of immigrant women crossing the U.S./Mexico border and the proliferation of "drop houses" in Arizona as a new phenomenon, one that is often marked by kidnappings and sexual assault. Little research has been published on the violence women face on their journey, and the drop houses have almost completely escaped scholarly analysis. We argue that the drop houses must be seen as a consequence of a "state of emergency" declared by policy makers that led to changes in U.S. national and local immigration policies that fueled what we call a "chain reaction of violence." © The Author(s) 2015.

Prediction of Chain Propagation Rate Constants of Polymerization Reactions in Aqueous NIPAM/BIS and VCL/BIS Systems.

PubMed

Kröger, Leif C; Kopp, Wassja A; Leonhard, Kai

2017-04-06

Microgels have a wide range of possible applications and are therefore studied with increasing interest. Nonetheless, the microgel synthesis process and some of the resulting properties of the microgels, such as the cross-linker distribution within the microgels, are not yet fully understood. An in-depth understanding of the synthesis process is crucial for designing tailored microgels with desired properties. In this work, rate constants and reaction enthalpies of chain propagation reactions in aqueous N-isopropylacrylamide/N,N'-methylenebisacrylamide and aqueous N-vinylcaprolactam/N,N'-methylenebisacrylamide systems are calculated to identify the possible sources of an inhomogeneous cross-linker distribution in the resulting microgels. Gas-phase reaction rate constants are calculated from B2PLYPD3/aug-cc-pVTZ energies and B3LYPD3/tzvp geometries and frequencies. Then, solvation effects based on COSMO-RS are incorporated into the rate constants to obtain the desired liquid-phase reaction rate constants. The rate constants agree with experiments within a factor of 2-10, and the reaction enthalpies deviate less than 5 kJ/mol. Further, the effect of rate constants on the microgel growth process is analyzed, and it is shown that differences in the magnitude of the reaction rate constants are a source of an inhomogeneous cross-linker distribution within the resulting microgel.

Synthesis, Characterization and Application of Thermoresponsive Polyhydroxyalkanoate-graft-Poly(N-isopropylacrylamide).

PubMed

Ma, Yi-Ming; Wei, Dai-Xu; Yao, Hui; Wu, Lin-Ping; Chen, Guo-Qiang

2016-08-08

A thermoresponsive graft copolymer polyhydroxyalkanoate-g-poly(N-isopropylacrylamide) or short as PHA-g-PNIPAm, was successfully synthesized via a three-step reaction. First, PNIPAm oligomer with a trithiocarbonate-based chain transfer agent (CTA), short as PNIPAm-CTA, with designed polymerization degree was synthesized via reversible addition-fragmentation chain transfer (RAFT) polymerization. Subsequently, the PNIPAm-CTA was treated with n-butylamine for aminolysis in order to obtain a pendant thiol group at the end of the chain (PNIPAm-SH). Finally, the PNIPAm-SH was grafted onto unsaturated P(3HDD-co-3H10U), a random copolymer of 3-hydroxydodecanoate (3HDD) and 3-hydroxy-10-undecylenate (3H10U), via a thiol-ene click reaction. Enhanced hydrophilicity and thermoresponsive property of the resulted PHA-g-PNIPAm were confirmed by water contact angle studies. The biocompatibility of PHA-g-PNIPAm was comparable to poly-3-hydroxybutyrate (PHB). The graft copolymer PHA-g-PNIPAm based on biopolyester PHA could be a promising material for biomedical applications.

Peroxy radical measurements with NCAR's chemical amplifier

NASA Technical Reports Server (NTRS)

Cantrell, Christopher; Shetter, Richard; Calvert, Jack G.

1994-01-01

The present NCAR instrument for HO2/RO2 measurements has been described previously. It is based on the reactions involving HO2, RO2, and HO radicals with CO and NO. Since (HO2) + (RO2) + (HO) is much greater than (HO) for most atmospheres, it is useful as a peroxy radical detector. Operation of the instrument depends on the creation of a chemical chain reaction which is initiated as HO2 and RO2 radicals in ambient air encounter added NO gas; this forms an NO2 molecule and an HO or RO radical: HO2(RO2) + NO yields HO(RO) + NO2. RO radicals react relatively efficiently with O2 to form an HO2 radical, and subsequently an HO-radical, by reaction with NO. CO gas added to the reaction chamber during part of the operating cycle, recycles the HO to HO2; HO + CO (+O2) yields HO2 + CO2. The reaction sequence may form several hundred NO2 molecules per HO2 (RO2) originally present, before chain termination occurs. The added CO is replaced by N2 addition periodically so that the chain reaction is suppressed, and a 'blank' signal resulting from NO2, O3 and possibly other NO2-forming species (non-chain processes) in ambient air is recorded. The difference between the signal with and without CO is proportional to the peroxy radical concentration. The NO2 produced is monitored using a sensitive luminol chemiluminescence detector system. In the NCAR instrument the length of the amplification chain is determined using a stable source of HO2 radicals (H2O2 thermal decomposition); the ratio of the signal seen with CO present to that with N2 present gives the sensitivity of the instrument to HO2 (molecules of NO2 formed/peroxy radical). The instrument is automated to carry out in hourly repeated cycles: (1) chain length determination; (2) NO2 calibration; and (3) linearity check on the response of signals. One minute averages of signals are normally recorded. The sensitivity of the instrument to detect peroxy radicals is in the pptv range. The present instrument has operated continuously (24 hr/day) in the field studies which extended over a period of several weeks. The major advantages of this instrument are as follows: (1) its relative simplicity; (2) low power requirements; and (3) its rapid response to all types of peroxy radicals--HO2, CH3O2 and the higher alkyl and acyl peroxy radicals; however not all RO2 species generate HO2 radicals with perfect efficiency and hence have somewhat lower response/molecule than HO2 radicals.

Synthesis of structured lipids by lipase-catalyzed interesterification of triacetin with camellia oil methyl esters and preliminary evaluation of their plasma lipid-lowering effect in mice.

PubMed

Cao, Yu; Qi, Suijian; Zhang, Yang; Wang, Xiaoning; Yang, Bo; Wang, Yonghua

2013-03-25

Structured lipids (SLCTs triacylglycerols with short- and long-chain acyl residues) were synthesized by interesterification of triacetin and fatty acid methyl esters (FAMEs) from camellia oil, followed by molecular distillation for purification. Different commercial immobilized lipases (Lipozyme RM IM and Novozyme 435), the substrate molar ratios of FAMEs to triacetin, the reaction temperatures and the lipase amounts were studied for their efficiency in producing SLCTs. Results showed that Novozyme 435 was more suitable for this reaction system. Moreover, the optimal reaction conditions for the highest conversion of FAMEs and the highest LLS-TAGs (triacylglycerols with one short- and two long-chain acyl residues) yields were achieved at a molar ratio of FAMEs to triacetin of 3:1, 50 °C of reaction temperature and a lipase amount of 4% (w/v). Scale-up was conducted based on the optimized reaction conditions. Results showed that after 24 h of reaction , the conversion rate of FAMEs was 82.4% and the rate of disubstituted triacetin was 52.4 mol%. The final product yield rate was 94.6%. The effects of the synthesized SLCTs on the plasma lipid level of fasting mice were also studied. The SLCTs could effectively lessen the total triacylglycerol levels in plasma compared to the triacylglycerol group in fasting NIH mice. It suggested that this type of structured lipid might be beneficial for human health, especially for the prevention of obesity.

Selective Transformation of β-Lactam Antibiotics by Peroxymonosulfate: Reaction Kinetics and Nonradical Mechanism.

PubMed

Chen, Jiabin; Fang, Cong; Xia, Wenjun; Huang, Tianyin; Huang, Ching-Hua

2018-02-06

While the β-lactam antibiotics are known to be susceptible to oxidative degradation by sulfate radical (SO 4 •- ), here we report that peroxymonosulfate (PMS) exhibits specific high reactivity toward β-lactam antibiotics without SO 4 •- generation for the first time. Apparent second-order reaction constants (k 2,app ) were determined for the reaction of PMS with three penicillins, five cephalosporins, two carbapenems, and several structurally related chemicals. The pH-dependency of k 2,app could be well modeled based on species-specific reactions. On the basis of reaction kinetics, stoichiometry, and structure-activity assessment, the thioether sulfur, on the six- or five-membered rings (penicillins and cephalosporins) and the side chain (carbapenems), was the main reaction site for PMS oxidation. Cephalosporins were more reactive toward PMS than penicillins and carbapenems, and the presence of a phenylglycine side chain significantly enhanced cephalosporins' reactivity toward PMS. Product analysis indicated oxidation of β-lactam antibiotics to two stereoisomeric sulfoxides. A radical scavenging study and electron paramagnetic resonance (EPR) technique confirmed lack of involvement of radical species (e.g., SO 4 •- ). Thus, the PMS-induced oxidation of β-lactam antibiotics was proposed to proceed through a nonradical mechanism involving direct two-electron transfer along with the heterolytic cleavage of the PMS peroxide bond. The new findings of this study are important for elimination of β-lactam antibiotic contamination, because PMS exhibits specific high reactivity and suffers less interference from the water matrix than the radical process.

An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

PubMed Central

Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

2005-01-01

Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

Investigation of Thermochemistry Associated with the Carbon–Carbon Coupling Reactions of Furan and Furfural Using ab Initio Methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Cong; Assary, Rajeev S.; Curtiss, Larry A.

2014-06-26

Upgrading of furan and small oxygenates obtained from the decomposition of cellulosic materials via formation of carbon-carbon bonds is critical to effective conversion of biomass to liquid transportation fuels. Simulation-driven molecular level understanding of carbon-carbon bond formation is required to design efficient catalysts and processes. Accurate quantum chemical methods are utilized here to predict the reaction energetics for conversion of furan (C4H4O) to C5-C8 ethers and the transformation of furfural (C5H6O2) to C13-C26 alkanes. Furan, can be coupled with various C1 to C4 lower molecular weight carbohydrates obtained from the pyrolysis via Diels-Alder type reactions in the gas phase tomore » produce C5-C8 cyclic ethers. The computed reaction barriers for these reactions (~25 kcal/mol) are lower than the cellulose activation or decomposition reactions (~50 kcal/mol). Cycloaddition of C5-C8 cyclo-ethers with furans can also occur in the gas phase, and the computed activation energy is similar to that of the first Diels-Alder reaction. Furfural, obtained from biomass, can be coupled with aldehydes or ketones with α-hydrogen atoms to form longer chain aldol products and these aldol products can undergo vapor phase hydrocycloaddition (activation barrier of ~20 kcal/mol) to form the precursors of C26 cyclic hydrocarbons. These thermochemical studies provide the basis for further vapor phase catalytic studies required for upgrading of furans/furfurals to longer chain hydrocarbons.« less

A Bullet-Block Experiment that Explains the Chain Fountain

NASA Astrophysics Data System (ADS)

Pantaleone, J.; Smith, R.

2018-05-01

It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.

Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico.

PubMed

Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M

1993-01-01

A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

Kinetics and mechanism of electron transfer reaction of single and double chain surfactant cobalt(III) complex by Fe2+ ions in liposome (dipalmitoylphosphotidylcholine) vesicles: effects of phase transition

NASA Astrophysics Data System (ADS)

Nagaraj, Karuppiah; Senthil Murugan, Krishnan; Thangamuniyandi, Pilavadi

2015-05-01

In this study, we report the kinetics of reduction reactions of single and double chain surfactant cobalt(III) complexes of octahedral geometry, cis-[Co(en)2(4AMP)(DA)](ClO4)3 and cis-[Co(dmp)2(C12H25NH2)2](ClO4)3 (en = ethylenediamine, dmp = 1,3-diaminopropane, 4AMP = 4-aminopropane, C12H25NH2 = dodecylamine) by Fe2+ ion in dipalmitoylphosphotidylcholine (DPPC) vesicles at different temperatures under pseudo first-order conditions. The kinetics of these reactions is followed by spectrophotometry method. The reactions are found to be second order and the electron transfer is postulated as outer sphere. The remarkable findings in the present investigation are that, below the phase transition temperature of DPPC, the rate decreases with an increase in the concentration of DPPC, while above the phase transition temperature the rate increases with an increase in the concentration of DPPC. The main driving force for this phenomenon is considered to be the intervesicular hydrophobic interaction between vesicles surface and hydrophobic part of the surfactant complexes. Besides, comparing the values of rate constants of these outer-sphere electron transfer reactions in the absence and in the presence of DPPC, the rate constant values in the presence of DPPC are always found to be greater than in the absence of DPPC. This is ascribed to the double hydrophobic fatty acid chain in the DPPC that gives the molecule an overall tubular shape due to the intervesicular hydrophobic interaction between vesicles surface and hydrophobic part of the surfactant complexes more suitable for vesicle aggregation which facilitates lower activation energy, and consequently higher rate is observed in the presence of DPPC. The activation parameters (ΔS# and ΔH#) of the reactions at different temperatures have been calculated which corroborate the kinetics of the reaction.

Radiolysis of N-acetyl amino acids as model compounds for radiation degradation of polypeptides

NASA Astrophysics Data System (ADS)

Wayne Garrett, R.; Hill, David J. T.; Ho, Sook-Ying; O'Donnell, James H.; O'Sullivan, Paul W.; Pomery, Peter J.

Radiation chemical yields of (i) the volatile radiolysis products and (ii) the trapped free radicals from the y-radiolysis of the N-acetyl derivatives of glycine, L-valine, L-phenylalanine and L-tyrosine in the polycrystalline state have been determined at room temperature (303 K). Carbon dioxide was found to be the major molecular product for all these compounds with G(CO 2) varying from 0.36 for N-acetyl-L-tyrosine to 8 for N-acetyl-L-valine. There was evidence for some scission of the N-C α bond, indicated by the production of acetamide and the corresponding aliphatic acid, but the determination reaction was found to be of much lesser importance than the decarboxylation reaction. A protective effect of the aromatic ring in N-acetyl-L-phenylalanine and in N-acetyl-L-tyrosine was indicated by the lower yields of volatile products for these compounds. The yields of trapped free radicals were found to vary with the nature of the amino acid side chain, increasing with chain length and chain branching. The radical yields were decreased by incorporation of an aromatic moiety in the side chain, this effect being greater for the tyrosyl side chain than for the phenyl side chain. The G(R·) values showed a good correlation with G(CO 2) indicating that a common reaction may be involved in radical production and carbon dioxide formation.

Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

EPA Science Inventory

The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

Highly efficient preparation of selectively isotope cluster-labeled long chain fatty acids via two consecutive C(sp3)-C(sp3) cross-coupling reactions.

PubMed

Lethu, Sébastien; Matsuoka, Shigeru; Murata, Michio

2014-02-07

An efficient synthesis involving two copper-catalyzed alkyl-alkyl coupling reactions has been designed to easily access doubly isotope-labeled fatty acids. Such NMR- and IR-active compounds were obtained in excellent overall yields and will be further used for determining the conformation of an alkyl chain of lipidic biomolecules upon interaction with proteins.

Development and characterization of a synthetic DNA, NUversa, to be used as a standard in quantitative polymerase chain reactions for molecular pneumococcal serotyping.

PubMed

Sakai, Fuminori; Sonaty, Griffin; Watson, David; Klugman, Keith P; Vidal, Jorge E

2017-09-15

Identification of Streptococcus pneumoniae and its more than 90 serotypes is routinely conducted by culture and Quellung reactions. Quantitative polymerase chain reactions (qPCRs) have been developed for molecular detection, including a pan-pneumococcus lytA assay, and assays targeting 79 serotypes. Reactions require genomic DNA from every target to prepare standards, which can be time consuming. In this study, we have developed a synthetic DNA molecule as a surrogate for genomic DNA and present new single-plex qPCR reactions to increase molecular detection to 94 pneumococcal serotypes. Specificity of these new reactions was confirmed with a limit of detection between 2 and 20 genome equivalents/reaction. A synthetic DNA (NUversa, ∼8.2 kb) was then engineered to contain all available qPCR targets for serotyping and lytA. NUversa was cloned into pUC57-Amp-modified to generate pNUversa (∼10.2 kb). Standards prepared from pNUversa and NUversa were compared against standards made out of genomic DNA. Linearity [NUversa (R2 > 0.982); pNUversa (R2 > 0.991)] and efficiency of qPCR reactions were similar to those utilizing chromosomal DNA (R2 > 0.981). Quantification with plasmid pNUversa was affected, however, whereas quantification with synthetic NUversa was comparable to that of genomic DNA. Therefore, NUversa may be utilized as DNA standard in single-plex assays of the currently known 94 pneumococcal serotypes. © FEMS 2017.

Is the Reaction of C3N(-) with C2H2 a Possible Process for Chain Elongation in Titan's Ionosphere?

PubMed

Lindén, Fredrik; Alcaraz, Christian; Ascenzi, Daniela; Guillemin, Jean-Claude; Koch, Leopold; Lopes, Allan; Polášek, Miroslav; Romanzin, Claire; Žabka, Jan; Zymak, Illia; Geppert, Wolf D

2016-07-14

The reaction of C3N(-) with acetylene was studied using three different experimental setups, a triple quadrupole mass spectrometer (Trento), a tandem quadrupole mass spectrometer (Prague), and the "CERISES" guided ion beam apparatus at Orsay. The process is of astrophysical interest because it can function as a chain elongation mechanism to produce larger anions that have been detected in Titan's ionosphere by the Cassini Plasma Spectrometer. Three major products of primary processes, C2H(-), CN(-), and C5N(-), have been identified, whereby the production of the cyanide anion is probably partly due to collisional induced dissociation. The formations of all these products show considerable reaction thresholds and also display comparatively small cross sections. Also, no strong signals of anionic products for collision energies lower than 1 eV have been observed. Ab initio calculations have been performed to identify possible pathways leading to the observed products of the title reaction and to elucidate the thermodynamics of these processes. Although the productions of CN(-) and C5N(-) are exoergic, all reaction pathways have considerable barriers. Overall, the results of these computations are in agreement with the observed reaction thresholds. Due to the existence of considerable reaction energy barriers and the small observed cross sections, the title reaction is not very likely to play a major role in the buildup of large anions in cold environments like the interstellar medium or planetary and satellite ionospheres.

Polymer-based microfluidic chips for isothermal amplification of nucleic acids

NASA Astrophysics Data System (ADS)

Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

2017-11-01

Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

Polymerase chain reaction with phase change as intrinsic thermal control

NASA Astrophysics Data System (ADS)

Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

2013-04-01

This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

Photochemical reaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen) with basic amino acids and dipeptides.

PubMed

Suzuki, Tadashi; Shinoda, Mio; Osanai, Yohei; Isozaki, Tasuku

2013-08-22

Photoreaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen, KP) with basic amino acids (histidine, lysine, and arginine) and dipeptides (carnosine and anserine) including a histidine moiety in phosphate buffer solution (pH 7.4) has been investigated with transient absorption spectroscopy. With UV irradiation KP(-) gave rise to a carbanion through a decarboxylation reaction, and the carbanion easily abstracted a proton from the surrounding molecule to yield a 3-ethylbenzophenone ketyl biradical (EBPH). The dipeptides as well as the basic amino acids were found to accelerate the proton transfer reaction whereas alanine and glycine had no effect on the reaction, revealing that these amino acids having a protonated side chain act as a proton donor. The formation quantum yield of EBPH was estimated to be fairly large by means of an actinometrical method with benzophenone, and the bimolecular reaction rate constant for the proton transfer between the carbanion and the protonated basic amino acids or the protonated dipeptides was successfully determined. It has become apparent that the bimolecular reaction rate constant for the proton transfer depended on the acid dissociation constant for the side chain of the amino acids for the first time. This reaction mechanism was interpreted by difference of the heat of reaction for each basic amino acid based on the thermodynamical consideration. These results strongly suggest that the side chain of the basic amino acid residue in protein should play an important role for photochemistry of KP in vivo.

FACTORS AFFECTING THE CHAIN LENGTH OF GROUP A STREPTOCOCCI

PubMed Central

Ekstedt, Richard D.; Stollerman, Gene H.

1960-01-01

Group A streptococci which grew in long chains in the presence of homologous anti-M antibody were split into their original length by the addition of an excess of homologous M protein to the culture. The chain-splitting reaction showed temperature and pH optima (37°C., 7.5) and was completely inhibited at 0°C. or by heat-killing the long chains at 56°C. prior to the addition of M protein. Addition of sublethal doses of HgCl2, or of penicillin, inhibited the chain-splitting reaction. Pneumococci behaved in entirely comparable fashion to streptococci in similar experiments. Virulent strains of streptococci formed the shortest chains when broth media was enriched with serum. The chain-shortening effect of serum enrichment of the media was most apparent with encapsulated strains and under cultural conditions that favored capsule formation. Loss of capsules by mutation or by unfavorable growth conditions resulted in increase in chain length. The activity of the chain-splitting mechanism seemed to be independent of M protein, however, since encapsulated M-negative variants also formed very short chain in serum-enriched media. The physical presence of the capsule was not essential for chain shortening since enzymatic removal of the capsule with hyaluronidase during growth did not affect chain length. These results strongly suggest that chain-splitting of streptococci and pneumococci occurs by an active metabolic mechanism, presumably enzymatic, which is inhibited by the union of surface antigens with specific antibody. PMID:13726267

Assessing the influence of side-chain and main-chain aromatic benzyltrimethyl ammonium on anion exchange membranes.

PubMed

Li, Xiuhua; Nie, Guanghui; Tao, Jinxiong; Wu, Wenjun; Wang, Liuchan; Liao, Shijun

2014-05-28

3,3'-Di(4″-methyl-phenyl)-4,4'-difluorodiphenyl sulfone (DMPDFPS), a new monomer with two pendent benzyl groups, was easily prepared by Suzuki coupling reaction in high yield. A series of side-chain type ionomers (PAES-Qs) containing pendant side-chain benzyltrimethylammonium groups, which linked to the backbone by alkaline resisting conjugated C-C bonds, were synthesized via polycondensation, bromination, followed by quaternization and alkalization. To assess the influence of side-chain and main-chain aromatic benzyltrimethylammonium on anion exchange membranes (AEMs), the main-chain type ionomers (MPAES-Qs) with the same backbone were synthesized following the similar procedure. GPC and (1)H NMR results indicate that the bromination shows no reaction selectivity of polymer configurations and ionizations of the side-chain type polymers display higher conversions than that of the main-chain type ones do. These two kinds of AEMs were evaluated in terms of ion exchange capacity (IEC), water uptake, swelling ratio, λ, volumetric ion exchange capacity (IECVwet), hydroxide conductivity, mechanical and thermal properties, and chemical stability, respectively. The side-chain type structure endows AEMs with lower water uptake, swelling ratio and λ, higher IECVwet, much higher hydroxide conductivity, more robust dimensional stability, mechanical and thermal properties, and higher stability in hot alkaline solution. The side-chain type cationic groups containing molecular configurations have the distinction of being practical AEMs and membrane electrode assemblies of AEMFCs.

Next-Generation in Situ Hybridization Chain Reaction: Higher Gain, Lower Cost, Greater Durability

PubMed Central

2014-01-01

Hybridization chain reaction (HCR) provides multiplexed, isothermal, enzyme-free, molecular signal amplification in diverse settings. Within intact vertebrate embryos, where signal-to-background is at a premium, HCR in situ amplification enables simultaneous mapping of multiple target mRNAs, addressing a longstanding challenge in the biological sciences. With this approach, RNA probes complementary to mRNA targets trigger chain reactions in which metastable fluorophore-labeled RNA hairpins self-assemble into tethered fluorescent amplification polymers. The properties of HCR lead to straightforward multiplexing, deep sample penetration, high signal-to-background, and sharp subcellular signal localization within fixed whole-mount zebrafish embryos, a standard model system for the study of vertebrate development. However, RNA reagents are expensive and vulnerable to enzymatic degradation. Moreover, the stringent hybridization conditions used to destabilize nonspecific hairpin binding also reduce the energetic driving force for HCR polymerization, creating a trade-off between minimization of background and maximization of signal. Here, we eliminate this trade-off by demonstrating that low background levels can be achieved using permissive in situ amplification conditions (0% formamide, room temperature) and engineer next-generation DNA HCR amplifiers that maximize the free energy benefit per polymerization step while preserving the kinetic trapping property that underlies conditional polymerization, dramatically increasing signal gain, reducing reagent cost, and improving reagent durability. PMID:24712299

Infectious agent screening in canine blood donors in the United Kingdom.

PubMed

Crawford, K; Walton, J; Lewis, D; Tasker, S; Warman, S M

2013-08-01

Transfusion of blood products is an important component of veterinary emergency medicine. Donors must be carefully selected to minimise risk of transmission of blood-borne infectious agents. This study was devised to assess the prevalence of such agents in healthy, non-travelled UK dogs screened as prospective donors. Ethylenediaminetetraacetic acid blood samples from dogs donating blood between August 2007 and January 2012 were screened by polymerase chain reaction for haemotropic mycoplasmas, Bartonella, Babesia, Leishmania, Ehrlichia and Anaplasma spp. Dogs with positive or inconclusive results underwent repeat polymerase chain reaction testing. Four of 262 dogs had positive or inconclusive results at initial screening. Repeat polymerase chain reaction testing in each dog was negative, and none of the dogs developed clinical signs of disease. The positive results on initial screening may have represented false positives from sample contamination or amplification of non-target DNA. It is also possible that dogs were infected at initial sampling but successfully cleared infection before repeat testing. The low number of positive results obtained suggests that prevalence of these agents in a population of healthy UK dogs is low and that use of blood products is unlikely to represent a significant risk of transmission of these diseases. © 2013 British Small Animal Veterinary Association.

Optimization of lipase-catalyzed synthesis of ginsenoside Rb1 esters using response surface methodology.

PubMed

Hu, Jiang-Ning; Lee, Jeung-Hee; Zhu, Xue-Mei; Shin, Jung-Ah; Adhikari, Prakash; Kim, Jae-Kyung; Lee, Ki-Teak

2008-11-26

In the lipase (Novozyme 435)-catalyzed synthesis of ginsenoside Rb1 esters, different acyl donors were found to affect not only the degree of conversion but also the regioselectivity. The reaction of acyl donors with short carbon chain was more effective, showing higher conversion than those with long carbon chain. Among the three solvent systems, the reaction in tert-amyl alcohol showed the highest conversion rate, while the reaction in the mixed solvent of t-BuOH and pyridine (1:1) had the lowest conversion rate. To allow the increase of GRb1 lipophilicity, we decided to further study the optimal condition of synthesis of GRb1 with vinyl decanoate with 10 carbon chain fatty acids in tert-amyl alcohol. Response surface methodology (RSM) was employed to optimize the synthesis condition. From the ridge analysis with maximum responses, the maximum GRb1 conversion was predicted to be 61.51% in a combination of factors (40.2 h, 52.95 degrees C, substrate mole ratio 275.57, and enzyme amount 39.81 mg/mL). Further, the adequacy of the predicted model was examined by additional independent experiments at the predicted maximum synthesis conditions. Results showed that the RSM was effective to optimize a combination of factors for lipase-catalyzed synthesis of ginsenoside Rb1 with vinyl decanoate.

Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

PubMed

Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

2015-04-01

Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

Intact carbohydrate structures as part of the melanoidin skeleton.

PubMed

Cämmerer, Bettina; Jalyschko, Walentina; Kroh, Lothar W

2002-03-27

Model melanoidins from monomeric, oligomeric, and polymeric carbohydrates, and amino acids formed under aqueous as well as water-free reaction conditions, were submitted to acidic catalyzed hydrolysis. Their degradation products were detected qualitatively and quantitatively by HPTLC and HPLC-DAD. A considerable amount of monomer carbohydrates from hydrolysis of model melanoidins formed under water-free reaction conditions was detected. It can be seen clearly that the amount of carbohydrates released increased with increasing degree of polymerization of the carbohydrates used as starting material. In comparison, the hydrolysis of melanoidins formed in aqueous condition resulted in only a small glucose release. It seems that in the Maillard reaction under water-free conditions, a significant amount of di- and oligomer carbohydrates were incorporated into the melanoidin skeleton as complete oligomer with intact glycosidic bond, forming side chains at the melanoidin skeleton. Additional side chains could be formed by transglycosylation reactions. With increasing water content, hydrothermolytic as well as retro-aldol reactions of the starting carbonyl components became significant, and therefore the possibility of forming side chains decreased. The results are consistent with the postulated melanoidin structure being built up mainly from sugar degradation products, probably branched via amino compounds.

The Gaseous Explosive Reaction : the Effect of Pressure on the Rate of Propagation of the Reaction Zone and upon the Rate of Molecular Transformation

NASA Technical Reports Server (NTRS)

Stevens, F W

1932-01-01

This study of gaseous explosive reaction has brought out a number of important fundamental characteristics of the explosive reaction indicating that the basal processes of the transformation are much simpler and corresponds more closely to the general laws and principles of ordinary transformations than is usually supposed. The report calls attention to the point that the rate of molecular transformation within the zone was found in all cases to be proportional to pressure, that the transformation within the zone is the result of binary impacts. This result is of unusual interest in the case of the reaction of heavy hydrocarbon fuels and the reaction mechanism proposed by the recent kinetic theory of chain reactions.

Hybrid RTM process: Monitoring and processing of composites based on reactive thermoplastic systems

NASA Astrophysics Data System (ADS)

Dkier, Mohamed; Lamnawar, Khalid; Maazouz, Abderrahim

2017-10-01

In this work, hybrid process coupling "Reactive Extrusion" and "Resin Transfer Molding" machine (T-ERTM) equipped with an instrumented mold was designed and developed. Polyamides model matrix according to two kinds of polymerizations were studied as well anionic and chain extension reactions. For the former, different ratios of catalyst and activator were investigated. For the latter, various formulations of prepolymer with chain extender (CA) were studied at different stoichiometry ratios and temperatures. Since that both reaction kinetics are very fast to be monitored at short times by usual technics, the chemo-rheological evolutions were firstly studied ex-situ by coupling rheology with FTIR and dielectric spectroscopy (DRS). Secondly, the T-ERTM process with an "instrumented mold" was developed with specific dielectric sensors in order to in-situ track viscosity and reaction evolution. The in-situ results corroborate the ex-situ ones aforementioned. Overall, a processing window was obtained for each reactive system to ensure a good preform impregnation for the manufacturing of complex and continuous glass fiber-reinforced parts. Herein, the Time-Temperature-Transformation-equivalent diagrams were established to obtain Thermoplastic composites with tailored mechanical and physical properties.

Detection of Brucella spp. in milk from seronegative cows by real-time polymerase chain reaction in the region of Batna, Algeria

PubMed Central

Sabrina, Rabehi; Mossadak, Hamdi Taha; Bakir, Mamache; Asma, Meghezzi; Khaoula, Boushaba

2018-01-01

Aim: The aim of this study was to detect Brucella spp. DNA in milk samples collected from seronegative cows using the real-time polymerase chain reaction (PCR) assay for diagnosis of brucellosis in seronegative dairy cows to prevent transmission of disease to humans and to reduce economic losses in animal production. Materials and Methods: In this study, 65 milk samples were investigated for the detection of Brucella spp. The detection of the IS711 gene in all samples was done by real-time PCR assay by comparative cycle threshold method. Results: The results show that of the 65 DNA samples tested, 2 (3.08%) were positive for Brucella infection. The mean cyclic threshold values of IS711 real-time PCR test were 37.97 and 40.48, indicating a positive reaction. Conclusion: The results of the present study indicated that the real-time PCR appears to offer several advantages over serological tests. For this reason, the real-time PCR should be validated on representative numbers of Brucella-infected and free samples before being implemented in routine diagnosis in human and animal brucellosis for controlling this disease. PMID:29657430

Biodiesel production from triolein and short chain alcohols through biocatalysis.

PubMed

Salis, Andrea; Pinna, Marcella; Monduzzi, Maura; Solinas, Vincenzo

2005-09-29

Oleic acid alkyl esters (biodiesel) were synthesised by biocatalysis in solvent-free conditions. Different commercial immobilised lipases, namely Candida antarctica B, Rizhomucor miehei, and Pseudomonas cepacia, were tested towards the reaction between triolein and butanol to produce butyl oleate. Pseudomonas cepacia lipase resulted to be the most active enzyme reaching 100% of conversion after 6h. Different operative conditions such as reaction temperature, water activity, and reagent stoichiometric ratio were investigated and optimised. These conditions were then used to investigate the effect of linear and branched short chain alcohols. Methanol and 2-butanol were the worst alcohols: the former, probably, due to its low miscibility with the oil and the latter because secondary alcohols usually are less reactive than primary alcohols. Conversely, linear and branched primary alcohols with short alkyl chains (C(2)--C(4)) showed high reaction rate and conversion. A mixture of linear and branched short chain alcohols that mimics the residual of ethanol distillation (fusel oil) was successfully used for oleic acid ester synthesis. These compounds are important in biodiesel mixtures since they improve low temperature properties.

METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM

DOEpatents

Fermi, E.; Leverett, M.C.

1957-11-12

This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.

MAMMALIAN DNA IN PCR REAGENTS

EPA Science Inventory

Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high- cycle PCR amplification t...

Polymerase chain reaction: A molecular diagnostic tool in periodontology

PubMed Central

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

Polymerase chain reaction: A molecular diagnostic tool in periodontology.

PubMed

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

The Role of the Side Chain on the Performance of N-type Conjugated Polymers in Aqueous Electrolytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giovannitti, Alexander; Maria, Iuliana P.; Hanifi, David

Here, we report a design strategy that allows the preparation of solution processable n-type materials from low boiling point solvents for organic electrochemical transistors (OECTs). The polymer backbone is based on NDI-T2 copolymers where a branched alkyl side chain is gradually exchanged for a linear ethylene glycol-based side chain. A series of random copolymers was prepared with glycol side chain percentages of 0, 10, 25, 50, 75, 90, and 100 with respect to the alkyl side chains. These were characterized to study the influence of the polar side chains on interaction with aqueous electrolytes, their electrochemical redox reactions, and performancemore » in OECTs when operated in aqueous electrolytes. We observed that glycol side chain percentages of >50% are required to achieve volumetric charging, while lower glycol chain percentages show a mixed operation with high required voltages to allow for bulk charging of the organic semiconductor. A strong dependence of the electron mobility on the fraction of glycol chains was found for copolymers based on NDI-T2, with a significant drop as alkyl side chains are replaced by glycol side chains.« less

The Role of the Side Chain on the Performance of N-type Conjugated Polymers in Aqueous Electrolytes.

PubMed

Giovannitti, Alexander; Maria, Iuliana P; Hanifi, David; Donahue, Mary J; Bryant, Daniel; Barth, Katrina J; Makdah, Beatrice E; Savva, Achilleas; Moia, Davide; Zetek, Matyáš; Barnes, Piers R F; Reid, Obadiah G; Inal, Sahika; Rumbles, Garry; Malliaras, George G; Nelson, Jenny; Rivnay, Jonathan; McCulloch, Iain

2018-05-08

We report a design strategy that allows the preparation of solution processable n-type materials from low boiling point solvents for organic electrochemical transistors (OECTs). The polymer backbone is based on NDI-T2 copolymers where a branched alkyl side chain is gradually exchanged for a linear ethylene glycol-based side chain. A series of random copolymers was prepared with glycol side chain percentages of 0, 10, 25, 50, 75, 90, and 100 with respect to the alkyl side chains. These were characterized to study the influence of the polar side chains on interaction with aqueous electrolytes, their electrochemical redox reactions, and performance in OECTs when operated in aqueous electrolytes. We observed that glycol side chain percentages of >50% are required to achieve volumetric charging, while lower glycol chain percentages show a mixed operation with high required voltages to allow for bulk charging of the organic semiconductor. A strong dependence of the electron mobility on the fraction of glycol chains was found for copolymers based on NDI-T2, with a significant drop as alkyl side chains are replaced by glycol side chains.

The Role of the Side Chain on the Performance of N-type Conjugated Polymers in Aqueous Electrolytes

DOE PAGES

Giovannitti, Alexander; Maria, Iuliana P.; Hanifi, David; ...

2018-04-24

Here, we report a design strategy that allows the preparation of solution processable n-type materials from low boiling point solvents for organic electrochemical transistors (OECTs). The polymer backbone is based on NDI-T2 copolymers where a branched alkyl side chain is gradually exchanged for a linear ethylene glycol-based side chain. A series of random copolymers was prepared with glycol side chain percentages of 0, 10, 25, 50, 75, 90, and 100 with respect to the alkyl side chains. These were characterized to study the influence of the polar side chains on interaction with aqueous electrolytes, their electrochemical redox reactions, and performancemore » in OECTs when operated in aqueous electrolytes. We observed that glycol side chain percentages of >50% are required to achieve volumetric charging, while lower glycol chain percentages show a mixed operation with high required voltages to allow for bulk charging of the organic semiconductor. A strong dependence of the electron mobility on the fraction of glycol chains was found for copolymers based on NDI-T2, with a significant drop as alkyl side chains are replaced by glycol side chains.« less

Characterization of milled solid residue from cypress liquefaction in sub- and super ethanol.

PubMed

Liu, Hua-Min; Liu, Yu-Lan

2014-01-01

Cypress liquefaction in sub- and super ethanol was carried out in an autoclave at various temperatures. Milled solid residue (MSR) was isolated from solid residue remaining from the liquefaction process, and its chemical characteristics was comparatively investigated with milled wood lignin (MWL) of cypress by sugar analysis, elemental analysis, FT-IR analysis, gel permeation chromatography, and NMR analysis. Results showed that there were two reactions (de-polymerization and re-polymerization) during the cypress liquefaction in sub- and super ethanol and the re-polymerization reactions were the main reaction at 220-260°C. Considering the stability of side-chain, the stability of lignin side-chain in cypress during liquefaction process in ethanol could be sequenced as follows: β-5>β-β'>β-O-4'. The MSR were mainly from the decomposition and re-polymerization of lignin. This study suggests that characterization of MSR provides a promising method to investigate the mechanisms of cypress liquefaction in ethanol. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

DD genotype of ace gene I/D polymorphism is associated in a Turkish study population with osteoarthritis.

PubMed

Bayram, Banu; Sayın, Emrah; Güneş, Hasan Veysi; Değirmenci, Irfan; Türkoğlu, Züleyha; Doganer, Fulya; Coşan, Didem Turgut

2011-03-01

This study was conducted in Turkish osteoarthritis patients to determine the frequency of I/D polymorphism genotypes of angiotensin converting enzyme gene, and to examine the role of this polymorphism in osteoarthritis development. Genomic DNA obtained from 200 persons (135 patients with osteoarthritis and 65 healthy controls) was used in the study. DNA was multiplied by polymerase chain reaction using I and D allele-specific primers. Polymerase chain reaction products were assessed with CCD camera by being exposed to 2% agarose gel electrophoresis. There was statistically significant difference between the groups with respect to genotype distribution (P < 0.001). The D allele frequency was indicated as 69% and I allele was as 31% in the patients, whereas it was 55-45% in the control group. Consequently, in this study, we may assert that ACE gene I/D polymorphism DD genotype determination is significant criteria for identifying patients who are likely to develop osteoarthritis in east population of Turkey.

In Situ X-ray Absorption Spectroscopy Studies of Discharge Reactions in a Thick Cathode of a Lithium Sulfur Battery

DOE PAGES

Wujcik, Kevin H.; Wang, Dunyang Rita; Pascal, Tod A.; ...

2016-12-01

Lithium sulfur (Li-S) batteries are well known for their high theoretical specific capacities, but are plagued with scientific obstacles that make practical implementation of the technology impossible. The success of Li-S batteries will likely necessitate the use of thick sulfur cathodes that enable high specific energy densities. However, little is known about the fundamental reaction mechanisms and chemical processes that take place in thick cathodes, as most research has focused on studying thinner cathodes that enable high performance. In this study, in situ X-ray absorption spectroscopy at the sulfur K-edge is used to examine the back of a 115 μmmore » thick Li-S cathode during discharge. Our results show that in such systems, where electrochemical reactions between sulfur and lithium are likely to proceed preferentially toward the front of the cathode, lithium polysulfide dianions formed in this region diffuse to the back of the cathode during discharge. We show that high conversion of elemental sulfur is achieved by chemical reactions between elemental sulfur and polysulfide dianions of intermediate chain length (Li 2S x, 4 ≤ x ≤ 6). Our work suggests that controlling the formation and diffusion of intermediate chain length polysulfide dianions is crucial for insuring full utilization of thick sulfur cathodes.« less

Maillard reaction versus other nonenzymatic modifications in neurodegenerative processes.

PubMed

Pamplona, Reinald; Ilieva, Ekaterina; Ayala, Victoria; Bellmunt, Maria Josep; Cacabelos, Daniel; Dalfo, Esther; Ferrer, Isidre; Portero-Otin, Manuel

2008-04-01

Nonenzymatic protein modifications are generated from direct oxidation of amino acid side chains and from reaction of the nucleophilic side chains of specific amino acids with reactive carbonyl species. These reactions give rise to specific markers that have been analyzed in different neurodegenerative diseases sharing protein aggregation, such as Alzheimer's disease, Pick's disease, Parkinson's disease, dementia with Lewy bodies, Creutzfeldt-Jakob disease, and amyotrophic lateral sclerosis. Collectively, available data demonstrate that oxidative stress homeostasis, mitochondrial function, and energy metabolism are key factors in determining the disease-specific pattern of protein molecular damage. In addition, these findings suggest the lack of a "gold marker of oxidative stress," and, consequently, they strengthen the need for a molecular dissection of the nonenzymatic reactions underlying neurodegenerative processes.

Intramolecular Benzoin Reaction Catalyzed by Benzaldehyde Lyase from Pseudomonas Fluorescens Biovar I.

PubMed

Hernández, Karel; Parella, Teodor; Petrillo, Giovanna; Usón, Isabel; Wandtke, Claudia M; Joglar, Jesús; Bujons, Jordi; Clapés, Pere

2017-05-02

Intramolecular benzoin reactions catalyzed by benzaldehyde lyase from Pseudomonas fluorescens biovar I (BAL) are reported. The structure of the substrates envisaged for this reaction consists of two benzaldehyde derivatives linked by an alkyl chain. The structural requirements needed to achieve the intramolecular carbon-carbon bond reaction catalyzed by BAL were established. Thus, a linker consisting of a linear alkyl chain of three carbon atoms connected through ether-type bonds to the 2 and 2' positions of two benzaldehyde moieties, which could be substituted with either Cl, Br, or OCH 3 at either the 3 and 3' or 5 and 5' positions, were suitable substrates for BAL. Reactions with 61-84 % yields of the intramolecular product and ee values between 64 and 98 %, were achieved. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

PubMed

Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

2013-08-01

Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

PubMed Central

Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

2006-01-01

Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

PubMed

Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

2016-01-01

This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.

Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

PubMed

Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

2018-04-25

In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

METHOD OF OPERATING NUCLEAR REACTORS

DOEpatents

Untermyer, S.

1958-10-14

A method is presented for obtaining enhanced utilization of natural uranium in heavy water moderated nuclear reactors by charging the reactor with an equal number of fuel elements formed of natural uranium and of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction. The reactor is operated until the rate of burnup of plutonium equals its rate of production, the fuel elements are processed to recover plutonium, the depleted uranium is discarded, and the remaining uranium is formed into fuel elements. These fuel elements are charged into a reactor along with an equal number of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction, and reuse of the uranium is continued as aforesaid until it wlll no longer support a chain reaction when combined with an equal quantity of natural uranium.

Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

PubMed

Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

2001-03-01

A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

Initiator and Photocatalyst-Free Visible Light Induced One-Pot Reaction: Concurrent RAFT Polymerization and CuAAC Click Reaction.

PubMed

Wang, Jie; Wang, Xinbo; Xue, Wentao; Chen, Gaojian; Zhang, Weidong; Zhu, Xiulin

2016-05-01

A new, visible light-catalyzed, one-pot and one-step reaction is successfully employed to design well-controlled side-chain functionalized polymers, by the combination of ambient temperature revisible addtion-fragmentation chain transfer (RAFT) polymerization and click chemistry. Polymerizations are well controlled in a living way under the irradiation of visible light-emitting diode (LED) light without photocatalyst and initiator, using the trithiocarbonate agent as iniferter (initiator-transfer agent-terminator) agent at ambient temperature. Fourier transfer infrared spectroscopy (FT-IR), NMR, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) data confirm the successful one-pot reaction. Compared to the reported zero-valent metal-catalyzed one-pot reaction, the polymerization rate is much faster than that of the click reaction, and the visible light-catalyzed one-pot reaction can be freely and easily regulated by turning on and off the light. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Polymerase chain reaction identification of three members of the Anopheles sundaicus (Diptera: Culicidae) complex, malaria vectors in Southeast Asia.

PubMed

Dusfour, Isabelle; Blondeau, Johanna; Harbach, Ralph E; Vythilingham, Indra; Baimai, Visut; Trung, Ho D; Sochanta, Tho; Bangs, Michael J; Manguin, Sylvie

2007-09-01

Anopheles sundaicus s.l., a major malaria vector taxon, occurs primarily along coastal areas and on islands in Southeast Asia. Our previous studies using cytochrome oxidase I, cytochrome-b, and internal transcribed spacer 2 markers discriminated three allopatric species: An. sundaicus s.s. in northern Borneo, An. epiroticus in Southeast Asia, and An. sundaicus E on Sumatra and Java, Indonesia. Morphological comparisons of three developmental stages did not reveal unique diagnostic characters that could reliably distinguish the three species. Therefore, we developed a multiplex polymerase chain reaction (PCR) assay based on two mitochondrial DNA markers to unambiguously identify them. This PCR was tested on 374 specimens from 24 different geographical populations, expanding our knowledge of the distribution of these species.

Investigating the nature of palladium chain-walking in the enantioselective redox-relay Heck reaction of alkenyl alcohols.

PubMed

Hilton, Margaret J; Xu, Li-Ping; Norrby, Per-Ola; Wu, Yun-Dong; Wiest, Olaf; Sigman, Matthew S

2014-12-19

The mechanism of the redox-relay Heck reaction was investigated using deuterium-labeled substrates. Results support a pathway through a low energy palladium-alkyl intermediate that immediately precedes product formation, ruling out a tautomerization mechanism. DFT calculations of the relevant transition structures at the M06/LAN2DZ+f/6-31+G* level of theory show that the former pathway is favored by 5.8 kcal/mol. Palladium chain-walking toward the alcohol, following successive β-hydride eliminations and migratory insertions, is also supported in this study. The stereochemistry of deuterium labels is determined, lending support that the catalyst remains bound to the substrate during the relay process and that both cis- and trans-alkenes form from β-hydride elimination.

Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flores, J.; Sears, J.; Schael, I.P.

1990-08-01

We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated frommore » field studies.« less

Inhibition of photophosphorylation and electron transport chain in thylakoids by lasiodiplodin, a natural product from Botryosphaeria rhodina.

PubMed

Veiga, Thiago A M; Silva, Sebastião C; Francisco, Archundia-Camacho; Filho, Edson R; Vieira, Paulo C; Fernandes, João B; Silva, Maria F G F; Müller, Manfred W; Lotina-Hennsen, Blas

2007-05-16

Four natural products were isolated from the fungus Botryosphaeria rhodina, and their effects on photosynthesis were tested. Only lasiodiplodin (1) inhibited ATP synthesis and electron flow from water to methylviologen; therefore, it acts as a Hill reaction inhibitor in freshly lysed spinach thylakoids. Photosystem I and II and partial reactions as well as ATPase were measured in the presence of 1. Three new different sites of 1 interaction and inhibition were found: one at CF1, the second in the water-splitting enzyme, and the third at the electron-transfer path between P680 and QA; these targets are different from that of the synthetic herbicides present. Electron transport chain inhibition by 1 was corroborated by fluorescence induction kinetics studies.

Susceptibility of Culicoides variipennis sonorensis to infection by polymerase chain reaction-detectable bluetongue virus in cattle blood.

PubMed

Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F

1996-05-01

Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.

Clinical characteristics of children with viral single- and co-infections and a petechial rash.

PubMed

Schneider, Henriette; Adams, Ortwin; Weiss, Christel; Merz, Ulrich; Schroten, Horst; Tenenbaum, Tobias

2013-05-01

Children with petechial rash are more likely to undergo invasive diagnostics, to be treated with antibiotics for potential bacterial infection and to be hospitalized. However, viruses have also been associated with petechial rash. Nonetheless, a systematic analysis of viral infections with modern available techniques as quantitative real-time polymerase chain reaction in the context of petechial rash is lacking. The purpose of this pediatric study was to prospectively uncover viral pathogens that may promote the emergence of petechiae and to analyze the correlation with the clinical characteristics and course. We conducted a prospective study in children (0 to 18 years) presenting with petechiae and signs or symptoms of infection at the emergency department between November 2009 and March 2012. In nasopharyngeal aspirates the following viruses were analyzed by quantitative real-time polymerase chain reaction: cytomegalovirus, Epstein-Barr virus, parvovirus B19, influenza A and B, parainfluenza viruses, human respiratory syncytial virus A and B, human metapneumovirus, rhinovirus, enterovirus, adenovirus, human coronavirus OC43, 229E, NL63 and human bocavirus. A viral pathogen was identified in 67% of the analyzed 58 cases with petechial rash. Virus positive patients showed a significantly higher incidence of lower respiratory tract infections. Forty-one percent were viral coinfections, which were significantly younger than virus negative patients, had a higher leukocyte count and were hospitalized for a longer time. A petechial rash is frequently associated viral single- and coinfections and can rapidly be identified via quantitative real-time polymerase chain reaction.

Using dual-polarization interferometry to study surface-initiated DNA hybridization chain reactions in real time.

PubMed

Huang, Fujian; Xu, Pingping; Liang, Haojun

2014-01-15

In this study we used dual-polarization interferometry to investigate DNA hybridization chain reactions (HCRs) at solid-liquid interfaces. We monitored the effects of variations in mass, thickness, and density of the immobilized initiator on the subsequent HCRs at various salt concentrations. At low salt concentrations, the single-stranded DNA (ssDNA) initiator was attached uniformly to the chip surface. At high salt concentrations, it lay on the surface at the onset of the immobilization process, but the approaching ssDNA forced the pre-immobilized ssDNA strands to extend into solution as a result of increased electrostatic repulsion between the pre-adsorbed and approaching ssDNA chains. Injection of a mixture of H1 and H2 increased the mass and thickness of the films initially, but thereafter the thickness decreased. These changes indicate that the long double-stranded DNA that formed lay on the surface, rather than extended into the solution, thereby suppressing the subsequent initiation activity of the released single-strand parts of H1 and H2. Increasing the salt concentration increased the HCR efficiency and reaction rate. The HCR efficiency of the initiator ssDNA immobilized on its 5' end was higher than that immobilized on its 3' end, suggesting that the released single-strand parts of H1 and H2 close to the chip surface decreased the initiation activity relative to those of the ones extending into solution. © 2013 Elsevier B.V. All rights reserved.

Free energy landscapes of short peptide chains using adaptively biased molecular dynamics

NASA Astrophysics Data System (ADS)

Karpusenka, Vadzim; Babin, Volodymyr; Roland, Christopher; Sagui, Celeste

2009-03-01

We present the results of a computational study of the free energy landscapes of short polypeptide chains, as a function of several reaction coordinates meant to distinguish between several known types of helices. The free energy landscapes were calculated using the recently developed adaptively biased molecular dynamics method followed up with equilibrium ``umbrella correction'' runs. Specific polypeptides investigated include small chains of pure and mixed alanine, glutamate, leucine, lysine and methionine (all amino acids with strong helix-forming propensities), as well as glycine, proline(having a low helix forming propensities), tyrosine, serine and arginine. Our results are consistent with the existing experimental and other theoretical evidence.

An evaluation of microbial profile in halitosis with tongue coating using PCR (polymerase chain reaction)- a clinical and microbiological study.

PubMed

Kamaraj R, Dinesh; Bhushan, Kala S; K L, Vandana

2014-01-01

Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load.

T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

PubMed

Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

2012-01-01

Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

Tested Demonstrations.

ERIC Educational Resources Information Center

Gilbert, George L., Ed.

1983-01-01

Free radical chlorination of methane is used in organic chemistry to introduce free radical/chain reactions. In spite of its common occurrence, demonstrations of the reaction are uncommon. Therefore, such a demonstration is provided, including background information, preparation of reactants/reaction vessel, introduction of reactants, irradiation,…

SWIMMING ASSOCIATED ILLNESS AND RAPID MEASURES OF WATER QUALITY AT A GULF BEACH

EPA Science Inventory

Studies at Great Lakes beaches have provided evidence that faster ways of measuring the fecal indicator bacteria (FIB) Enterococcus using quantitative polymerase chain reaction (qPCR) are predictive of swimming associated illness. In 2005 we conducted an epidemiology study to eva...

[First attempts of detecting fetal cells in the maternal circulation].

PubMed

Nagy, Gyula Richárd; Bán, Zoltán; Sipos, Ferenc; Fent, János; Oroszné Nagy, Judit; Beke, Artúr; Furész, József; Papp, Zoltán

2004-10-31

In prenatal diagnosis there is great interest for noninvasive diagnostic methods. Authors report their first results in detecting fetal cells in the maternal circulation during pregnancy. The aim of the study was to detect fetal gender from maternal peripheral blood samples during pregnancy. Authors have analysed fetal nucleated red blood cells. In 12 cases after a double density Percoll gradient separation they labelled the surface antigens of the cells with anti-glycophorin-A and anti-CD45 fluorescent antibodies, did an intracellular staining of the epsilon haemoglobin chain, and analysed the cells with flow cytometry. The CD45 negative/glycophorin-A positive/epsilon-haemoglobin chain positive cells were considered as fetal cells. Having the results, in another 13 cases magnetic activated cell sorting with CD71 antibody were used as an enrichment step. Authors made an intracellular staining of the epsilon haemoglobin chain, the positive cells were isolated by micromanipulation, and analysed by single cell fluorescent polymerase chain reaction. Primers for the amelogenin gene were used to detect fetal gender. Only the Percoll enrichment step itself is not enough for using the samples for diagnostic molecular-biologic examinations, a following enrichment step is needed. For this the authors used magnetic activated cell sorting with CD71 antibody. With the help of this enrichment step, after the intracellular staining of the epsilon haemoglobin chain the direct micromanipulator isolation of the epsilon haemoglobin chain positive cells could be done. After analysing single cells by fluorescent polymerase chain reaction, in 8 out of the 11 comparable cases the results were similar to those, what was found during the genetic amniocentesis. In 2 cases from this 8, genetic amniocentesis proved Klinefelter syndrome, which they could also confirm with the examination of fetal cells in the maternal circulation. The results of the study suggest that the method described above can be useful in prenatal genetic diagnosis, and improving it could be useful to detect other genetic abnormalities (chromosomal abnormalities, single gene disorders) as well.

Significance of two distinct types of tryptophan synthase beta chain in Bacteria, Archaea and higher plants.

PubMed

Xie, Gary; Forst, Christian; Bonner, Carol; Jensen, Roy A

2002-01-01

Tryptophan synthase consists of two subunits, alpha and beta. Two distinct subgroups of beta chain exist. The major group (TrpEb_1) includes the well-studied beta chain of Salmonella typhimurium. The minor group of beta chain (TrpEb_2) is most frequently found in the Archaea. Most of the amino-acid residues important for catalysis are highly conserved between both TrpE subfamilies. Conserved amino-acid residues of TrpEb_1 that make allosteric contact with the TrpEa subunit (the alpha chain) are absent in TrpEb_2. Representatives of Archaea, Bacteria and higher plants all exist that possess both TrpEb_1 and TrpEb_2. In those prokaryotes where two trpEb genes coexist, one is usually trpEb_1 and is adjacent to trpEa, whereas the second is trpEb_2 and is usually unlinked with other tryptophan-pathway genes. TrpEb_1 is nearly always partnered with TrpEa in the tryptophan synthase reaction. However, by default at least six lineages of the Archaea are likely to use TrpEb_2 as the functional beta chain, as TrpEb_1 is absent. The six lineages show a distinctive divergence within the overall TrpEa phylogenetic tree, consistent with the lack of selection for amino-acid residues in TrpEa that are otherwise conserved for interfacing with TrpEb_1. We suggest that the standalone function of TrpEb_2 might be to catalyze the serine deaminase reaction, an established catalytic capability of tryptophan synthase beta chains. A coincident finding of interest is that the Archaea seem to use the citramalate pathway, rather than threonine deaminase (IlvA), to initiate the pathway of isoleucine biosynthesis.

Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.

PubMed

Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C

2012-09-27

We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.

Large enhancement in the heterogeneous oxidation rate of organic aerosols by hydroxyl radicals in the presence of nitric oxide

DOE PAGES

Richards-Henderson, Nicole K.; Goldstein, Allen H.; Wilson, Kevin R.

2015-10-27

In this paper we report an unexpectedly large acceleration in the effective heterogeneous OH reaction rate in the presence of NO. This 10–50 fold acceleration originates from free radical chain reactions, propagated by alkoxy radicals that form inside the aerosol by the reaction of NO with peroxy radicals, which do not appear to produce chain terminating products (e.g., alkyl nitrates), unlike gas phase mechanisms. Lastly, a kinetic model, constrained by experiments, suggests that in polluted regions heterogeneous oxidation plays a much more prominent role in the daily chemical evolution of organic aerosol than previously believed.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

PubMed

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

2014-04-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

PubMed Central

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

2014-01-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

PubMed

Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

2011-11-01

The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

Spark Plasma Sintering for Nanostructured Smart Materials

DTIC Science & Technology

2009-03-02

polyester) with excess isocyanate to form a prepolymer , followed by the addition of a short chain diol that acts as a chain extender to link the... prepolymers together. Due to the thermodynamic imicisibility of segments of PU, phase separation into a flexible soft segment (long chain diol) and a...other reactions of the isocyanate groups with the other functional groups in the chain. [Hepburn, 1992] However, during the initial prepolymer

Kinetics and Quantitative Structure—Activity Relationship Study on the Degradation Reaction from Perfluorooctanoic Acid to Trifluoroacetic Acid

PubMed Central

Gong, Chen; Sun, Xiaomin; Zhang, Chenxi; Zhang, Xue; Niu, Junfeng

2014-01-01

Investigation of the degradation kinetics of perfluorooctanoic acid (PFOA) has been carried out to calculate rate constants of the main elementary reactions using the multichannel Rice-Ramsperger-Kassel-Marcus theory and canonical variational transition state theory with small-curvature tunneling correction over a temperature range of 200~500 K. The Arrhenius equations of rate constants of elementary reactions are fitted. The decarboxylation is role step in the degradation mechanism of PFOA. For the perfluorinated carboxylic acids from perfluorooctanoic acid to trifluoroacetic acid, the quantitative structure–activity relationship of the decarboxylation was analyzed with the genetic function approximation method and the structure–activity model was constructed. The main parameters governing rate constants of the decarboxylation reaction from the eight-carbon chain to the two-carbon chain were obtained. As the structure–activity model shows, the bond length and energy of C1–C2 (RC1–C2 and EC1–C2) are positively correlated to rate constants, while the volume (V), the energy difference between EHOMO and ELUMO (ΔE), and the net atomic charges on atom C2 (QC2) are negatively correlated. PMID:25196516

Effects of a Protic Ionic Liquid on the Reaction Pathway during Non-Aqueous Sol–Gel Synthesis of Silica: A Raman Spectroscopic Investigation

PubMed Central

Martinelli, Anna

2014-01-01

The reaction pathway during the formation of silica via a two-component “non-aqueou” sol-gel synthesis is studied by in situ time-resolved Raman spectroscopy. This synthetic route is followed with and without the addition of the protic ionic liquid 1-ethylimidazolium bis(trifluoromethanesulfonyl)imide (C2HImTFSI) in order to investigate its effect on the reaction pathway. We demonstrate that Raman spectroscopy is suitable to discriminate between different silica intermediates, which are produced and consumed at different rates with respect to the point of gelation. We find that half-way to gelation monomers and shorter chains are the most abundant silica species, while the formation of silica rings strongly correlates to the sol-to-gel transition. Thus, curling up of linear chains is here proposed as a plausible mechanism for the formation of small rings. These in turn act as nucleation sites for the condensation of larger rings and thus the formation of the open and polymeric silica network. We find that the protic ionic liquid does not change the reaction pathway per se, but accelerates the cyclization process, intermediated by the faster inclusion of monomeric species. PMID:24743891

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weinstein, J.; Bielski, H.J.

The rates of reaction of HO/sub 2/ and O/sub 2//sup -/ with hydrogen peroxide, known as the Haber--Weiss reactions, were studied by /sup 60/Co ..gamma.. radiolysis as a function of pH at 23.5/sup 0/C. The numerical values for the two rate constants, k/sub HO/sub 2/+H/sub 2/O/sub 2// = (0.50 +- 0.09) M/sup -1/ s/sup -1/ and k/sub O/sub 2/-+H/sub 2/O/sub 2// = (0.13 +- 0.07) M/sup -1/ s/sup -1/, were computed from molecular oxygen yields which result from the radiation-induced chain decomposition of aqueous hydrogen peroxide solutions. The experimental results are consistent with a chain mechanism which takes into accountmore » the dissociation of HO/sub 2/ in equilibrium O/sub 2//sup -/ + H/sup +/ (pK = 4.7) and the competition between the Haber--Weiss reactions (HO/sub 2/ + H/sub 2/O/sub 2/ and O/sub 2//sup -/ + H/sub 2/O/sub 2/) and the recombination reactions of the superoxide and perhydroxyl radicals (HO/sub 2/ + HO/sub 2/ and HO/sub 2/ + O/sub 2//sup -/).« less

A Model for the Interfacial Kinetics of Phospholipase D Activity on Long-Chain Lipids

DTIC Science & Technology

2013-07-01

we extend this model to account for the interaction between PLD and its reaction product, phosphatidic acid (PA), which is a long-chain lipid and... phosphatidic acid , and lecithin/ phosphatidic acid fixed monolayers: a Langmuit film balance study. J. Colloid Interface Sci. 79:319–338. 55. Morris, A...Dennis. 1988. Kinetic analysis of the Ca2þ-dependent, membrane-bound, macrophage phospholipase A2 and the effects of arachidonic acid . J. Biol. Chem. 263

A search for microorganisms producing medium-chain alkanes from aldehydes.

PubMed

Ito, Masakazu; Kambe, Hiromi; Kishino, Shigenobu; Muramatsu, Masayoshi; Ogawa, Jun

2018-01-01

Microorganisms with medium-chain alkane-producing activity are promising for the bio-production of drop-in fuel. In this study, we screened for microorganisms producing tridecane from tetradecanal. The activity of aldehyde decarbonylation was found in a wide range of microbes. In particular, the genus Klebsiella in the Enterobacteriaceae family was found to have a high ability to produce alkanes from aldehydes via enzyme catalyzed reaction. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

PubMed

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Summary of Research/Publications

NASA Technical Reports Server (NTRS)

1997-01-01

Summary of research/publications include:(1) Comment on broadening of water microwave lines by collisions with helium atoms; (2) Calculations of ion-molecule deuterium fractionation reactions involving HD; (3) Ab initio predictions on the rotational spectra of carbon-chain carbene molecules; (4) Theoretical IR spectra of ionized naphthalene; (5) Improved collisional excitation rates for interstellar water; (6) Calculations on the competition between association and reaction for C3H+ + H2; (7) Theoretical infrared spectra of some model polycyclic aromatic hydrocarbons: effect of ionization; (8) Calculations concerning interstellar isomeric abundance ratios for C3H and C3H2; (9) New calculations on the ion-molecule processes C2H2+ + H2 C2H3+ + H and C2H2+ + H2 C2H4+; (10) Anisotropic rigid rotor potential energy function for H2O-H2; (11) A correlated ab initio study of linear carbon-chain radicals CnH (n=2-7); (12) Ab initio characterization of MgCCH, MgCCH+, and MgC2 and pathways to their formation in the interstellar medium; (13) Why HOC+ is detectable in interstellar clouds: The rate of the reaction between HOC+ and H2; (14) A correlated ab initio study of the X 2A 1 and A 2E states of MgCH3; (15) On the stability of interstellar carbon clusters: The rate of the reaction between C3 and O; and (16) The rate of the reaction between CN and C2H2 at interstellar temperatures.

The biomechanical and perceptual influence of chain resistance on the performance of the olympic clean.

PubMed

Berning, Joseph M; Coker, Cheryl A; Briggs, Doug

2008-03-01

Proponents of chain training suggest that using chains hung from the ends of barbells rather than using conventional barbells alone enhances strength, power, and neuromuscular adaptations. The purpose of this study was to determine whether a conventional barbell with chains compared to a conventional barbell without chains would affect the performance of an Olympic Clean. The subjects were also asked regarding their perception of how chains affected their lifting. Four male and 3 female competitive weightlifters who used chains as part of their training participated in the study. The testing protocol compared the subjects' lifting 80% and 85% of their 1 repetition maximum (1RM) using conventional barbells and their lifting 80% and 85% of their 1RM using chains (75% conventional barbells + 5% chains and 80% conventional barbells + 5% chains, respectively). Video analysis evaluated the bar's vertical displacement and velocity and the rate of force production. Vertical ground reaction forces for the first-pull, unweighting, and second-pull phases of the lift were evaluated by using a force plate. After testing, the subjects completed a 2-item questionnaire asking individual perception of the effects of the chains. The results showed no significant difference for condition for any of the variables examined. In contrast, all subjects perceived that the chains required a greater effort. In conclusion, the results indicated that the addition of chains provided no greater value over lifting conventional barbells alone in the performance of the Olympic Clean, although the subjects perceived the chains to have a positive effect.

Quantitation of Human Papillomavirus DNA in Plasma of Oropharyngeal Carcinoma Patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cao Hongbin; Banh, Alice; Kwok, Shirley

Purpose: To determine whether human papillomavirus (HPV) DNA can be detected in the plasma of patients with HPV-positive oropharyngeal carcinoma (OPC) and to monitor its temporal change during radiotherapy. Methods and Materials: We used polymerase chain reaction to detect HPV DNA in the culture media of HPV-positive SCC90 and VU147T cells and the plasma of SCC90 and HeLa tumor-bearing mice, non-tumor-bearing controls, and those with HPV-negative tumors. We used real-time quantitative polymerase chain reaction to quantify the plasma HPV DNA in 40 HPV-positive OPC, 24 HPV-negative head-and-neck cancer patients and 10 non-cancer volunteers. The tumor HPV status was confirmed bymore » p16{sup INK4a} staining and HPV16/18 polymerase chain reaction or HPV in situ hybridization. A total of 14 patients had serial plasma samples for HPV DNA quantification during radiotherapy. Results: HPV DNA was detectable in the plasma samples of SCC90- and HeLa-bearing mice but not in the controls. It was detected in 65% of the pretreatment plasma samples from HPV-positive OPC patients using E6/7 quantitative polymerase chain reaction. None of the HPV-negative head-and-neck cancer patients or non-cancer controls had detectable HPV DNA. The pretreatment plasma HPV DNA copy number correlated significantly with the nodal metabolic tumor volume (assessed using {sup 18}F-deoxyglucose positron emission tomography). The serial measurements in 14 patients showed a rapid decline in HPV DNA that had become undetectable at radiotherapy completion. In 3 patients, the HPV DNA level had increased to a discernable level at metastasis. Conclusions: Xenograft studies indicated that plasma HPV DNA is released from HPV-positive tumors. Circulating HPV DNA was detectable in most HPV-positive OPC patients. Thus, plasma HPV DNA might be a valuable tool for identifying relapse.« less

No implication of Simian virus 40 in pathogenesis of malignant pleural mesothelioma in Slovenia.

PubMed

Hmeljak, Julija; Kern, Izidor; Cör, Andrej

2010-01-01

Malignant mesothelioma is predominantly caused by asbestos exposure, although the association of Simian virus 40 in its pathogenesis is currently still under debate. Simian virus 40, a DNA rhesus monkey virus with oncogenic properties, accidentally contaminated early batches of polio vaccine in the 1960s. In the 1990s, viral sequences and proteins were discovered in several human tumors, which triggered research to find a link between Simian virus 40 and human cancers, especially malignant mesothelioma. The aim of our study was to establish an effective laboratory procedure for Simian virus 40 detection and to investigate the presence of Simian virus 40 DNA and small t antigen in mesothelioma samples from Slovenian patients. Paraffin-embedded malignant pleural mesothelioma specimens from 103 Slovenian patients were collected and used for total DNA isolation and real-time polymerase chain reaction for Simian virus 40 small t and large T DNA analysis. Special attention was devoted to primer design, good laboratory practice and polymerase chain reaction contamination prevention. Polymerase chain reaction products were sequenced and BLAST aligned. One 5 microm thick paraffin section from each patient's tissue block was stained with hematoxylin and eosin for histological typing and one for immunohistochemical detection of Simian virus 40 small t antigen using a monoclonal antibody against Simian virus 40 (Pab280). SV40-expressing Wi-38 cells were used as positive control in both PCR and immunohistochemistry. In real-time polymerase chain reaction analyses, only 4 samples gave products with primer pairs amplifying small t antigen and were inconsistent and poorly reproducible. BLAST alignment showed no homology with any deposited SV40 sequences. No immunopositive staining for SV40 small t antigen was found in any of the samples. We found no evidence of SV40 presence in tissue samples from 103 Slovenian patients with malignant pleural mesothelioma. Asbestos exposure remains the main risk factor for malignant pleural mesothelioma in Slovenia.

Methanol Cannon Demonstrations Revisited.

ERIC Educational Resources Information Center

Dolson, David A.; And Others

1995-01-01

Describes two variations on the traditional methanol cannon demonstration. The first variation is a chain reaction using real metal chains. The second example involves using easily available components to produce sequential explosions that can be musical in nature. (AIM)

ANIMAL DNA IN PCR REAGENTS PLAGUES ANCIENT DNA RESEARCH

EPA Science Inventory

Ancient DNA analysis is becoming widespread. These studies use polymerase chain reaction (PCR) to amplify minute quantities of heavily damaged template. Unusual steps are taken to achieve the sensitivity necessary to detect ancient DNA, including high-cycle PCR amplification targ...

Synthesis of Programmable Main-chain Liquid-crystalline Elastomers Using a Two-stage Thiol-acrylate Reaction.

PubMed

Saed, Mohand O; Torbati, Amir H; Nair, Devatha P; Yakacki, Christopher M

2016-01-19

This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addition reaction. Strain-to-failure and glass transition behavior were investigated as a function of crosslinking monomer, pentaerythritol tetrakis(3-mercaptopropionate) (PETMP). An example non-stoichiometric system of 15 mol% PETMP thiol groups and an excess of 15 mol% acrylate groups was used to demonstrate the robust nature of the material. The LCE formed an aligned and transparent monodomain when stretched, with a maximum failure strain over 600%. Stretched LCE samples were able to demonstrate both stress-driven thermal actuation when held under a constant bias stress or the shape-memory effect when stretched and unloaded. A permanently programmed monodomain was achieved via a second-stage photopolymerization reaction of the excess acrylate groups when the sample was in the stretched state. LCE samples were photo-cured and programmed at 100%, 200%, 300%, and 400% strain, with all samples demonstrating over 90% shape fixity when unloaded. The magnitude of total stress-free actuation increased from 35% to 115% with increased programming strain. Overall, the two-stage TAMAP methodology is presented as a powerful tool to prepare main-chain LCE systems and explore structure-property-performance relationships in these fascinating stimuli-sensitive materials.

Kinematic Analysis of Four Plyometric Push-Up Variations

PubMed Central

MOORE, LAURA H.; TANKOVICH, MICHAEL J.; RIEMANN, BRYAN L.; DAVIES, GEORGE J.

2012-01-01

Plyometric research in the upper extremity is limited, with the effects of open-chain plyometric exercises being studied most. Kinematic and ground reaction force data concerning closed-chain upper extremity plyometrics has yet to be examined. Twenty-one recreationally active male subjects performed four variations of plyometric push-ups in a counterbalanced order. These included box drop push-ups from 3.8 cm, 7.6 cm, 11.4 cm heights, and clap push-ups. Kinematics of the trunk, dominant extremity and both hands were collected to examine peak flight, elbow flexion at ground contact, elbow displacement, and hand separation. Additionally peak vertical ground reaction force was measured under the dominant extremity. The 11.4 cm and clap push-ups had significantly higher peak flight than the other variations (P<.001). At ground contact, the elbow was in significantly greater flexion for the 3.8 cm and clap push-up compared to the other variations (P<.001). The clap push-up had significantly more elbow displacement than the other variations (P<.001) while hand separation was not significantly different between variations (P=.129). Peak vertical ground reaction force was significantly greater for the clap push-ups than for all other variations (P< .001). Despite similar flight heights between the 11.4 cm and clap push-ups, the greater peak vertical ground reaction force and elbow displacement of the clap push-ups indicates the clap push-up is the most intense of the variations examined. Understanding the kinematic variables involved will aid in the creation of a closed chain upper-extremity plyometric progression. PMID:27182390

Markov chain aggregation and its applications to combinatorial reaction networks.

PubMed

Ganguly, Arnab; Petrov, Tatjana; Koeppl, Heinz

2014-09-01

We consider a continuous-time Markov chain (CTMC) whose state space is partitioned into aggregates, and each aggregate is assigned a probability measure. A sufficient condition for defining a CTMC over the aggregates is presented as a variant of weak lumpability, which also characterizes that the measure over the original process can be recovered from that of the aggregated one. We show how the applicability of de-aggregation depends on the initial distribution. The application section is devoted to illustrate how the developed theory aids in reducing CTMC models of biochemical systems particularly in connection to protein-protein interactions. We assume that the model is written by a biologist in form of site-graph-rewrite rules. Site-graph-rewrite rules compactly express that, often, only a local context of a protein (instead of a full molecular species) needs to be in a certain configuration in order to trigger a reaction event. This observation leads to suitable aggregate Markov chains with smaller state spaces, thereby providing sufficient reduction in computational complexity. This is further exemplified in two case studies: simple unbounded polymerization and early EGFR/insulin crosstalk.

Controlled grafting of comb copolymer brushes on poly(tetrafluoroethylene) films by surface-initiated living radical polymerizations.

PubMed

Yu, W H; Kang, E T; Neoh, K G

2005-01-04

Surface modification of poly(tetrafluoroethylene) (PTFE) films by well-defined comb copolymer brushes was carried out. Peroxide initiators were generated directly on the PTFE film surface via radio frequency Ar plasma pretreatment, followed by air exposure. Poly(glycidyl methacrylate) (PGMA) brushes were first prepared by surface-initiated reversible addition-fragmentation chain transfer polymerization from the peroxide initiators on the PTFE surface in the presence of a chain transfer agent. Kinetics study revealed a linear increase in the graft concentration of PGMA with the reaction time, indicating that the chain growth from the surface was consistent with a "controlled" or "living" process. alpha-Bromoester moieties were attached to the grafted PGMA by reaction of the epoxide groups with 2-bromo-2-methylpropionic acid. The comb copolymer brushes were subsequently prepared via surface-initiated atom transfer radical polymerization of two hydrophilic vinyl monomers, including poly(ethylene glycol) methyl ether methacrylate and sodium salt of 4-styrenesulfonic acid. The chemical composition of the modified PTFE surfaces was characterized by X-ray photoelectron spectroscopy.

Unraveling reaction pathways and specifying reaction kinetics for complex systems.

PubMed

Vinu, R; Broadbelt, Linda J

2012-01-01

Many natural and industrial processes involve a complex set of competing reactions that include several different species. Detailed kinetic modeling of such systems can shed light on the important pathways involved in various transformations and therefore can be used to optimize the process conditions for the desired product composition and properties. This review focuses on elucidating the various components involved in modeling the kinetics of pyrolysis and oxidation of polymers. The elementary free radical steps that constitute the chain reaction mechanism of gas-phase/nonpolar liquid-phase processes are outlined. Specification of the rate coefficients of the various reaction families, which is central to the theme of kinetics, is described. Construction of the reaction network on the basis of the types of end groups and reactive moieties in a polymer chain is discussed. Modeling frameworks based on the method of moments and kinetic Monte Carlo are evaluated using illustrations. Finally, the prospects and challenges in modeling biomass conversion are addressed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wujcik, Kevin H.; Wang, Dunyang Rita; Pascal, Tod A.

Lithium sulfur (Li-S) batteries are well known for their high theoretical specific capacities, but are plagued with scientific obstacles that make practical implementation of the technology impossible. The success of Li-S batteries will likely necessitate the use of thick sulfur cathodes that enable high specific energy densities. However, little is known about the fundamental reaction mechanisms and chemical processes that take place in thick cathodes, as most research has focused on studying thinner cathodes that enable high performance. In this study, in situ X-ray absorption spectroscopy at the sulfur K-edge is used to examine the back of a 115 μmmore » thick Li-S cathode during discharge. Our results show that in such systems, where electrochemical reactions between sulfur and lithium are likely to proceed preferentially toward the front of the cathode, lithium polysulfide dianions formed in this region diffuse to the back of the cathode during discharge. We show that high conversion of elemental sulfur is achieved by chemical reactions between elemental sulfur and polysulfide dianions of intermediate chain length (Li 2S x, 4 ≤ x ≤ 6). Our work suggests that controlling the formation and diffusion of intermediate chain length polysulfide dianions is crucial for insuring full utilization of thick sulfur cathodes.« less

Mechanism of Air Oxidation of the Fragrance Terpene Geraniol.

PubMed

Bäcktorp, Carina; Hagvall, Lina; Börje, Anna; Karlberg, Ann-Therese; Norrby, Per-Ola; Nyman, Gunnar

2008-01-01

The fragrance terpene geraniol autoxidizes upon air exposure and forms a mixture of oxidation products, some of which are skin sensitizers. Reactions of geraniol with O2 have been studied with DFT (B3LYP) and the computational results compared to experimentally observed product ratios. The oxidation is initiated by hydrogen abstraction, forming an allylic radical which combines with an O2 molecule to yield an intermediate peroxyl radical. In the subsequent step, geraniol differs from previously studied cases, in which the radical chain reaction is propagated through intermolecular hydrogen abstraction. The hydroxy-substituted allylic peroxyl radical prefers an intramolecular rearrangement, producing observable aldehydes and the hydroperoxyl radical, which in turn can propagate the radical reaction. Secondary oxidation products like epoxides and formates were also considered, and plausible reaction pathways for formation are proposed.

Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

PubMed

Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

2014-09-01

The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

Single cell digital polymerase chain reaction on self-priming compartmentalization chip

PubMed Central

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267

Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

PubMed Central

Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

2015-01-01

This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

PubMed

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.

Predicting gaseous reaction rates of short chain chlorinated paraffins with ·OH: overcoming the difficulty in experimental determination.

PubMed

Li, Chao; Xie, Hong-Bin; Chen, Jingwen; Yang, Xianhai; Zhang, Yifei; Qiao, Xianliang

2014-12-02

Short chain chlorinated paraffins (SCCPs) are under evaluation for inclusion in the Stockholm Convention on persistent organic pollutants. However, information on their reaction rate constants with gaseous ·OH (kOH) is unavailable, limiting the evaluation of their persistence in the atmosphere. Experimental determination of kOH is confined by the unavailability of authentic chemical standards for some SCCP congeners. In this study, we evaluated and selected density functional theory (DFT) methods to predict kOH of SCCPs, by comparing the experimental kOH values of six polychlorinated alkanes (PCAs) with those calculated by the different theoretical methods. We found that the M06-2X/6-311+G(3df,2pd)//B3LYP/6-311 +G(d,p) method is time-effective and can be used to predict kOH of PCAs. Moreover, based on the calculated kOH of nine SCCPs and available experimental kOH values of 22 PCAs with low carbon chain, a quantitative structure-activity relationship (QSAR) model was developed. The molecular structural characteristics determining the ·OH reaction rate were discussed. logkOH was found to negatively correlate with the percentage of chlorine substitutions (Cl%). The DFT calculation method and the QSAR model are important alternatives to the conventional experimental determination of kOH for SCCPs, and are prospective in predicting their persistence in the atmosphere.

Efficient enzymatic synthesis and dual-colour fluorescent labelling of DNA probes using long chain azido-dUTP and BCN dyes

PubMed Central

Ren, Xiaomei; El-Sagheer, Afaf H.; Brown, Tom

2016-01-01

A sterically undemanding azide analogue of dTTP (AHP dUTP) with an alkyl chain and ethynyl attachment to the nucleobase was designed and incorporated into DNA by primer extension, reverse transcription and polymerase chain reaction (PCR). An azide-modified 523 bp PCR amplicon with all 335 thymidines replaced by AHP dU was shown to be a perfect copy of the template from which it was amplified. Replacement of thymidine with AHP dU increases duplex stability, accounting in part for the high incorporation efficiency of the azide-modified triphosphate. Single-stranded azide-labelled DNA was conveniently prepared from PCR products by λ-exonuclease digestion and streptavidin magnetic bead isolation. Efficient fluorescent labelling of single and double-stranded DNA was carried out using dyes functionalized with bicyclo[6.1.0]non-4-yne (BCN) via the strain-promoted alkyne-azide cycloaddition (SPAAC) reaction. This revealed that the degree of labelling must be carefully controlled to achieve optimum fluorescence and avoid fluorescence quenching. Dual-coloured probes were obtained in a single tube fluorescent labelling reaction; and varying the ratios of the two dyes provides a simple method to prepare DNA probes with unique fluorescent signatures. AHP dUTP is a versatile clickable nucleotide with potentially wide applications in biology and nanotechnology including single molecule studies and synthesis of modified aptamer libraries via SELEX. PMID:26819406

The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

PubMed

Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

2002-03-01

Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

Identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in Mexico.

PubMed

Ortega, Ariadna Flores; Martínez-Castañeda, José Simón; Bautista-Gómez, Linda G; Muñoz, Raúl Fajardo; Hernández, Israel Quijano

This is the first report on circulating canine rotavirus in Mexico. Fifty samples from dogs with gastroenteritis were analyzed used polymerase chain reaction and reverse transcription polymerase chain reaction in order to identify parvovirus and rotavirus, respectively; 7% of dogs were infected with rotavirus exclusively, while 14% were co-infected with both rotavirus and parvovirus; clinical signs in co-infected dogs were more severe. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

PubMed

Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

2016-01-01

American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

Phenylalanine 445 within oxidosqualene-lanosterol cyclase from Saccharomyces cerevisiae influences C-Ring cyclization and deprotonation reactions.

PubMed

Wu, Tung-Kung; Liu, Yuan-Ting; Chiu, Feng-Hsuan; Chang, Cheng-Hsiang

2006-10-12

[reaction: see text] We describe the Saccharomyces cerevisiae oxidosqualene-lanosterol cyclase Phe445 site-saturated mutants that generate truncated tricyclic and altered deprotonation product profiles. Among these mutants, only polar side-chain group substitutions genetically complemented yeast viability and produced spatially related product diversity, supporting the Johnson model that cation-pi interactions between a carbocationic intermediate and an enzyme can be replaced by an electrostatic or polar side chain to stabilize the cationic intermediate, but with product differentiation.

Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

PubMed

Law, Dennis K S; Tsang, Raymond S W

2013-05-01

A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

Tuberculous otitis media: a resurgence?

PubMed

Kameswaran, M; Natarajan, K; Parthiban, M; Krishnan, P V; Raghunandhan, S

2017-09-01

Tuberculosis is a global health problem that is especially prevalent in developing countries such as India. Recently, atypical presentation has become more common and a high index of suspicion is essential. This study analysed the various presenting symptoms and signs of tuberculous otitis media and the role of diagnostic tests, with the aim of formulating criteria for the diagnosis. A total of 502 patients underwent tympanomastoidectomy over a two-year period. Microbiological and histopathological examinations and polymerase chain reaction analysis of tissue taken during tympanomastoidectomy were performed. A total of 25 patients (5 per cent) were diagnosed with tuberculous otitis media. Severe mixed hearing loss, facial palsy, labyrinthine fistula, post-aural fistula, perichondritis and extradural abscess were noted. There seems to be a resurgence in tuberculous otitis media in India. Microbiological, histopathological and polymerase chain reaction tests for tuberculosis are helpful for its diagnosis.

Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

PubMed

Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

2008-12-01

One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

High-throughput amplification of mature microRNAs in uncharacterized animal models using polyadenylated RNA and stem-loop reverse transcription polymerase chain reaction.

PubMed

Biggar, Kyle K; Wu, Cheng-Wei; Storey, Kenneth B

2014-10-01

This study makes a significant advancement on a microRNA amplification technique previously used for expression analysis and sequencing in animal models without annotated mature microRNA sequences. As research progresses into the post-genomic era of microRNA prediction and analysis, the need for a rapid and cost-effective method for microRNA amplification is critical to facilitate wide-scale analysis of microRNA expression. To facilitate this requirement, we have reoptimized the design of amplification primers and introduced a polyadenylation step to allow amplification of all mature microRNAs from a single RNA sample. Importantly, this method retains the ability to sequence reverse transcription polymerase chain reaction (RT-PCR) products, validating microRNA-specific amplification. Copyright © 2014 Elsevier Inc. All rights reserved.

Experimental Studies of Light-Ion Nuclear Reactions Using Low-Energy RI Beams

NASA Astrophysics Data System (ADS)

Yamaguchi, H.; Kahl, D.; Hayakawa, S.; Sakaguchi, Y.; Abe, K.; Shimuzu, H.; Wakabayashi, Y.; Hashimoto, T.; Cherubini, S.; Gulino, M.; Spitaleri, C.; Rapisarda, G. G.; La Cognata, M.; Lamia, L.; Romano, S.; Kubono, S.; Iwasa, N.; Teranishi, T.; Kawabata, T.; Kwon, Y. K.; Binh, D. N.; Khiem, L. H.; Duy, N. N.; Kato, S.; Komatsubara, T.; Coc, A.; de Sereville, N.; Hammache, F.; Kiss, G.; Bishop, S.

CRIB (CNS Radio-Isotope Beam separator) is a low-energy RI beam separator of Center for Nuclear Study (CNS), the University of Tokyo. Studies on nuclear astrophysics, nuclear structure, and other interests have been performed using the RI beams at CRIB, forming international collaborations. A striking method to study astrophyiscal reactions involving radioactive nuclei is the thick-target method in inverse kinematics. Several astrophysical alpha-induced reactions have been be studied with that method at CRIB. A recent example is on the α resonant scattering with a radioactive 7Be beam. This study is related to the astrophysical 7Be(α , γ ) reactions, important at hot p-p chain and ν p-process in supernovae. There have been measurements based on several indirect methods, such as the asymptotic normalization coefficient (ANC) and Trojan horse method (THM). The first THM measurement using an RI beam has been performed at CRIB, to study the 18F(p, α )15O reaction at astrophysical energies via the three body reaction 2H(18F, α 15O)n. The 18F(p, α )15O reaction rate is crucial to understand the 511-keV γ -ray production in nova explosion phenomena, and we successfully evaluated the reaction cross section at novae temperature and below experimentally for the first time.

ELECTRON SPIN RESONANCE STUDIES ON PEROXIDE RADICALS IN IRRADIATED POLYPROPYLENE (in German)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fischer, H.; Hellwege, K.-H.; Neudoerfl, P.

1963-06-01

Peroxide radicals are formed by oxidation of carbon radicals in irradiated isotactic polypropylene. An interpretation of their ESR spectra is given. The recombination of the peroxide radicals follows a chain reaction mechanism, which is derived from the reversibility of formation of peroxide radicals, the time dependence of their concentration, and from the oxygen consumption of samples containing peroxide radicals. The reactions are discussed in view of the radiation induced oxidative degradation of polypropylene. (auth)

{sup 110,116}Cd({alpha},{alpha}){sup 110,116}Cd elastic scattering and systematic investigation of elastic {alpha} scattering cross sections along the Z=48 isotopic and N=62 isotonic chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kiss, G. G.; Fueloep, Zs.; Gyuerky, Gy.

2011-06-15

The elastic scattering cross sections for the reactions {sup 110,116}Cd({alpha},{alpha}){sup 110,116}Cd at energies above and below the Coulomb barrier are presented to provide a sensitive test for the {alpha}-nucleus optical potential parameter sets. Additional constraints for the optical potential are taken from the analysis of elastic scattering excitation functions at backward angles which are available in literature. Moreover, the variation of the elastic {alpha} scattering cross sections along the Z=48 isotopic and N=62 isotonic chain is investigated by the study of the ratios of the {sup 106,110,116}Cd({alpha},{alpha}){sup 106,110,116}Cd scattering cross sections at E{sub cm{approx_equal}}15.6and18.8 MeV and the ratio of themore » {sup 110}Cd({alpha},{alpha}){sup 110}Cd and {sup 112}Sn({alpha},{alpha}){sup 112}Sn reaction cross sections at E{sub cm{approx_equal}}18.8 MeV, respectively. These ratios are sensitive probes for the {alpha}-nucleus optical potential parametrizations. The potentials under study are a basic prerequisite for the prediction of {alpha}-induced reaction cross sections (e.g., for the calculation of stellar reaction rates in the astrophysical p or {gamma} process).« less

Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes

NASA Astrophysics Data System (ADS)

Denisov, E. T.; Shestakov, A. F.

2018-05-01

Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

MHC Class I Chain-Related Gene A Polymorphisms and Linkage Disequilibrium with HLA-B and HLA-C Alleles in Ocular Toxoplasmosis.

PubMed

Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos

2015-01-01

This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05-4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22-0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population.

MHC Class I Chain-Related Gene A Polymorphisms and Linkage Disequilibrium with HLA-B and HLA-C Alleles in Ocular Toxoplasmosis

PubMed Central

Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos

2015-01-01

This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05–4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22–0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population. PMID:26672749

Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

PubMed

Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

2009-01-01

A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

Cerebral Toxoplasmosis Diagnosed by Nested-polymerase Chain Reaction in a Patient with Rheumatoid Arthritis.

PubMed

Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki

2018-05-15

A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.

Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

PubMed Central

Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

2004-01-01

A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

Synthesis of surface-anchored DNA-polymer bioconjugates using reversible addition-fragmentation chain transfer polymerization.

PubMed

He, Peng; He, Lin

2009-07-13

We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.

Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.

PubMed

Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W

2007-04-01

Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.

Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

PubMed

Bridge, Julia A

2017-01-01

The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

PubMed Central

Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

2014-01-01

Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. Materials and Methods: The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. Result: The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. Conclusion: The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load. PMID:24596791

Role of Rhodobacter sphaeroides photosynthetic reaction center residue M214 in the composition, absorbance properties, and conformations of H(A) and B(A) cofactors.

PubMed

Saer, Rafael G; Hardjasa, Amelia; Rosell, Federico I; Mauk, A Grant; Murphy, Michael E P; Beatty, J Thomas

2013-04-02

In the native reaction center (RC) of Rhodobacter sphaeroides, the side chain of (M)L214 projects orthogonally toward the plane and into the center of the A branch bacteriopheophytin (BPhe) macrocycle. The possibility that this side chain is responsible for the dechelation of the central Mg(2+) of bacteriochlorophyll (BChl) was investigated by replacement of (M)214 with residues possessing small, nonpolar side chains that can neither coordinate nor block access to the central metal ion. The (M)L214 side chain was also replaced with Cys, Gln, and Asn to evaluate further the requirements for assembly of the RC with BChl in the HA pocket. Photoheterotrophic growth studies showed no difference in growth rates of the (M)214 nonpolar mutants at a low light intensity, but the growth of the amide-containing mutants was impaired. The absorbance spectra of purified RCs indicated that although absorbance changes are associated with the nonpolar mutations, the nonpolar mutant RC pigment compositions are the same as in the wild-type protein. Crystal structures of the (M)L214G, (M)L214A, and (M)L214N mutants were determined (determined to 2.2-2.85 Å resolution), confirming the presence of BPhe in the HA pocket and revealing alternative conformations of the phytyl tail of the accessory BChl in the BA site of these nonpolar mutants. Our results demonstrate that (i) BChl is converted to BPhe in a manner independent of the aliphatic side chain length of nonpolar residues replacing (M)214, (ii) BChl replaces BPhe if residue (M)214 has an amide-bearing side chain, (iii) (M)214 side chains containing sulfur are not sufficient to bind BChl in the HA pocket, and (iv) the (M)214 side chain influences the conformation of the phytyl tail of the BA BChl.

Reaction pathways of propene pyrolysis.

PubMed

Qu, Yena; Su, Kehe; Wang, Xin; Liu, Yan; Zeng, Qingfeng; Cheng, Laifei; Zhang, Litong

2010-05-01

The gas-phase reaction pathways in preparing pyrolytic carbon with propene pyrolysis have been investigated in detail with a total number of 110 transition states and 50 intermediates. The structure of the species was determined with density functional theory at B3PW91/6-311G(d,p) level. The transition states and their linked intermediates were confirmed with frequency and the intrinsic reaction coordinates analyses. The elementary reactions were explored in the pathways of both direct and the radical attacking decompositions. The energy barriers and the reaction energies were determined with accurate model chemistry method at G3(MP2) level after an examination of the nondynamic electronic correlations. The heat capacities and entropies were obtained with statistical thermodynamics. The Gibbs free energies at 298.15 K for all the reaction steps were reported. Those at any temperature can be developed with classical thermodynamics by using the fitted (as a function of temperature) heat capacities. It was found that the most favorable paths are mainly in the radical attacking chain reactions. The chain was proposed with 26 reaction steps including two steps of the initialization of the chain to produce H and CH(3) radicals. For a typical temperature (1200 K) adopted in the experiments, the highest energy barriers were found in the production of C(3) to be 203.4 and 193.7 kJ/mol. The highest energy barriers for the production of C(2) and C were found 174.1 and 181.4 kJ/mol, respectively. These results are comparable with the most recent experimental observation of the apparent activation energy 201.9 +/- 0.6 or 137 +/- 25 kJ/mol. Copyright 2010 Wiley Periodicals, Inc.

Vanadium accelerates polymerase chain reaction and expands the applicability of forensic DNA testing.

PubMed

Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko

2013-05-01

Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Chemical construction and structural permutation of neurotoxic natural product, antillatoxin: importance of the three-dimensional structure of the bulky side chain

PubMed Central

INOUE, Masayuki

2014-01-01

Antillatoxin 1 is a unique natural product that displays potent neurotoxic and neuritogenic activities through activation of voltage-gated sodium channels. The peptidic macrocycle of 1 was attached to a side chain with an exceptionally high degree of methylation. In this review, we discuss the total synthesis and biological evaluation of 1 and its analogues. First we describe an efficient synthetic route to 1. This strategy enabled the unified preparation of nine side chain analogues. Structure-activity relationship studies of these analogues revealed that subtle side chain modification leads to dramatic changes in activity, and detailed structural analyses indicated the importance of the overall size and three dimensional shape of the side chain. Based on these data, we designed and synthesized a photoresponsive analogue, proving that the activity of 1 was modulated via a photochemical reaction. The knowledge accumulated through these studies will be useful for the rational design of new tailor-made molecules to control the function and behavior of ion channels. PMID:24522155

Two methods for construction of internal amplification controls for the detection of Escherichia coli O157 by polymerase chain reaction.

PubMed

Abdulmawjood, A; Roth, S; Bülte, M

2002-10-01

For the detection of food born bacteria by polymerase chain reaction (PCR) in food products, an internal amplification control (IAC) is required in order to prevent false negative results that might be caused by PCR inhibitors. In the present study, two IACs were constructed using two different methods. These IACs were designed in a way that the same primer pair can be used to amplify the target DNA and coamplify the IAC. The first IAC with a size of approximately 200 bp was constructed by deleting a part of the amplicon of the original target DNA (500 bp) between the two primer sites to produce an IAC smaller than the target DNA. The second IAC with a size of approximately 600 bp was synthesized in a one step PCR reaction. The primers used in this reaction possessed 5' over-hanging ends, which were identical to the primers used in the diagnostic reaction, whereas their 3' ends were complementary to the (pUC19) predetermined DNA sequence of defined length and sequence. The concentration of IACs appeared to be critical. Too much IAC DNA template would out-compete the target DNA template, thus giving a false negative result. However the use of an optimal IAC concentration increased the reliability of the PCR assays and appeared to be useful for food diagnostics.

Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

PubMed

Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

2016-08-01

On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.

Reverse transcriptase polymerase chain reaction on fine needle aspirates for rapid detection of translocations in synovial sarcoma.

PubMed

Nilsson, G; Wang, M; Wejde, J; Kanter, L; Karlén, J; Tani, E; Kreicbergs, A; Larsson, O

1998-01-01

To evaluate the utilization of fine needle aspiration (FNA) biopsy to obtain material for reverse-transcriptase polymerase chain reaction (RT-PCR) in the detection of the t(X;18)(p11.2;q11.2) translocation in synovial sarcomas. We applied RT-PCR to detection of synovial sarcoma fusion gene transcripts on fine needle aspirates. Five clinical samples were first analyzed: one was a tumor previously diagnosed as malignant hemangiopericytoma, one was a poorly defined tumor, and three were suspected synovial sarcomas. FNA material was transferred directly to the RT-PCR reaction tube without RNA extraction. The t(X;18) translocation could be detected on the limited amount of material that FNA provides. In each of the cases studied the representivity of the tumor samples was confirmed microscopically. Our protocol permits analysis directly on representative samples without extraction of RNA. The results imply that RT-PCR offers reliable detection of sarcoma fusion gene transcripts on fine needle aspirates. The procedure, apart from being applicable to outpatients, is rapid and sensitive.

Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

PubMed

Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

1999-08-02

Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

Pentynyl dextran as a support matrix for immobilization of serine protease subtilisin Carlsberg and its use for transesterification of N-acetyl-L-phenylalanine ethyl ester in organic media.

PubMed

Tahir, Muhammad Nazir; Cho, Eunae; Mischnick, Petra; Lee, Jae Yung; Yu, Jae-Hyuk; Jung, Seunho

2014-04-01

In this study, serine protease (subtilisin Carlsberg) was immobilized on pentynyl dextran (PyD, O-alkynyl ether of dextran, 1) and used for the transesterification of N-acetyl-L-phenylalanine ethyl ester (2) with different aliphatic (1-propanol, 1-butanol, 1-pentanol, 1-hexanol) and aromatic (benzyl alcohol, 2-phenyl ethanol, 4-phenyl-1-butanol) alcohols in tetrahydrofuran (THF). The effect of carbon chain length in aliphatic and aromatic alcohols on initial and average transesterification rate, transesterification activity of immobilized enzyme and yield of the reaction under selected reaction conditions was investigated. The transesterification reactivity of the enzyme and yield of the reaction increased as the chain length of the alcohols decreased. Furthermore, almost no change in yield was observed when the immobilized enzyme was repeatedly used for selected alcohols over six cycles. Intrinsic fluorescence analysis showed that the catalytic activity of the immobilized enzyme in THF was maintained due to retention of the tertiary structure of the enzyme after immobilization on PyD (1).

Development and use of a real-time polymerase chain reaction assay for the detection of Ophidiomyces ophiodiicola in snakes.

PubMed

Allender, Matthew C; Bunick, David; Dzhaman, Elena; Burrus, Lucienne; Maddox, Carol

2015-03-01

Fungal pathogens threatening the conservation of wildlife are becoming increasingly common. Since 2008, free-ranging snakes across North America have been experiencing a marked increase in the prevalence of snake fungal disease associated with Ophidiomyces ophiodiicola. Diagnosis has historically relied on histology, microbiology, and conventional polymerase chain reaction (PCR). More sensitive methods are needed to adequately characterize the epidemiology. The current study describes the development of a real-time PCR (qPCR) assay for detecting a segment of the internal transcribed spacer 1 region between the 18S and 5.8S ribosomal RNA gene. The assay was able to detect as few as 1.05 × 10(1) gene copies per reaction. An additional 4 positive cases were detected when comparing a conventional PCR (n = 3) and the qPCR (n = 7) when used on swab samples from 47 eastern massasauga rattlesnakes. The newly developed assay is a sensitive and specific tool for surveillance and monitoring in the conservation of free-ranging snakes. © 2015 The Author(s).

ε-Poly-l-Lysine Peptide Chain Length Regulated by the Linkers Connecting the Transmembrane Domains of ε-Poly-l-Lysine Synthetase

PubMed Central

Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime

2014-01-01

ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. PMID:24907331

Correlation between quantitative PCR and Culture-Based methods for measuring Enterococcus spp. over various temporal scales at three California marine beaches

EPA Science Inventory

Several studies have examined how fecal indicator bacteria (FIB) measurements compare between quantitative polymerase chain reaction (QPCR) and the culture methods it is intended to replace. Here we extend those studies by examining the stability of that relationship within a be...

[Kinetics of catalytic wet air oxidation of phenol in trickle bed reactor].

PubMed

Li, Guang-ming; Zhao, Jian-fu; Wang, Hua; Zhao, Xiu-hua; Zhou, Yang-yuan

2004-05-01

By using a trickle bed reactor which was designed by the authors, the catalytic wet air oxidation reaction of phenol on CuO/gamma-Al2O3 catalyst was studied. The results showed that in mild operation conditions (at temperature of 180 degrees C, pressure of 3 MPa, liquid feed rate of 1.668 L x h(-1) and oxygen feed rate of 160 L x h(-1)), the removal of phenol can be over 90%. The curve of phenol conversion is similar to "S" like autocatalytic reaction, and is accordance with chain reaction of free radical. The kinetic model of pseudo homogenous reactor fits the catalytic wet air oxidation reaction of phenol. The effects of initial concentration of phenol, liquid feed rate and temperature for reaction also were investigated.

Experimental Study of Serpentinization Reactions

NASA Technical Reports Server (NTRS)

Cohen, B. A.; Brearley, A. J.; Ganguly, J.; Liermann, H.-P.; Keil, K.

2004-01-01

Current carbonaceous chondrite parent-body thermal models [1-3] produce scenarios that are inconsistent with constraints on aqueous alteration conditions based on meteorite mineralogical evidence, such as phase stability relationships within the meteorite matrix minerals [4] and isotope equilibration arguments [5, 6]. This discrepancy arises principally because of the thermal runaway effect produced by silicate hydration reactions (here loosely called serpentinization, as the principal products are serpentine minerals), which are so exothermic as to produce more than enough heat to melt more ice and provide a self-sustaining chain reaction. One possible way to dissipate the heat of reaction is to use a very small parent body [e.g., 2] or possibly a rubble pile model. Another possibility is to release this heat more slowly, which depends on the alteration reaction path and kinetics.

Gene Polymorphism Studies in a Teaching Laboratory

ERIC Educational Resources Information Center

Shultz, Jeffry

2009-01-01

I present a laboratory procedure for illustrating transcription, post-transcriptional modification, gene conservation, and comparative genetics for use in undergraduate biology education. Students are individually assigned genes in a targeted biochemical pathway, for which they design and test polymerase chain reaction (PCR) primers. In this…

Detection of Porphyromonas endodontalis in infected root canals by 16S rRNA gene-directed polymerase chain reaction.

PubMed

Machado de Oliveira, J C; Siqueira, J F; Alves, G B; Hirata, R; Andrade, A F

2000-12-01

Porphyromonas endodontalis has been isolated from the endodontic infections mainly in symptomatic teeth. This study evaluated the occurrence of P. endodontalis in both symptomatic and asymptomatic endodontic infections using 16S rRNA gene-directed polymerase chain reaction. P. endodontalis was detected in 39.5% of the cases (17 of 43 teeth). It was present in 4 of the 6 cases with acute periradicular abscess (66.7%) and in 13 of the 37 other cases (35.1%). The presence of P. endodontalis was associated with an asymptomatic periradicular lesion in 6 cases (25%) and in 10 teeth with tenderness to percussion (52.6%). P. endodontalis was also found in one asymptomatic case without evidence of periradicular pathosis. Our results indicated that, although P. endodontalis is commonly detected in symptomatic cases, it can be present in asymptomatic root canal infections. Further studies should determine if this bacterial species is really an important endodontopathogen.

Actinomyces israelii in radicular cysts: a molecular study.

PubMed

Gomes, Nathália Rodrigues; Diniz, Marina Gonçalves; Pereira, Thais Dos Santos Fontes; Estrela, Carlos; de Macedo Farias, Luiz; de Andrade, Bruno Augusto Benevenuto; Gomes, Carolina Cavaliéri; Gomez, Ricardo Santiago

2017-05-01

To investigate whether the microscopic filamentous aggregates observed in radicular cysts are associated with the molecular identification of Actinomyces israelii. Moreover, to verify whether this bacterium can be detected in radicular cyst specimens not presenting aggregates. Microscopic colonies suggestive of Actinomyces were found in 8 out of 279 radicular cyst samples (case group). The case and control groups (n = 12; samples without filamentous colonies) were submitted to the semi-nested polymerase chain reaction to test the presence of A israelii. DNA sequencing was performed to validate polymerase chain reaction results. Two and 3 samples in the case and control groups, respectively, did not present a functional genomic DNA template and were excluded from the study. A israelii was identified in all samples of the case group and in 3 out of 9 samples of the control group. Although A israelii is more commonly identified in radicular cysts presenting filamentous aggregates, it also appears to be detected in radicular cysts without this microscopic finding. Copyright © 2017 Elsevier Inc. All rights reserved.

The Collaborative Ocular Tuberculosis Study (COTS)-1 Report 3: Polymerase Chain Reaction in the Diagnosis and Management of Tubercular Uveitis: Global Trends.

PubMed

Agarwal, Aniruddha; Agrawal, Rupesh; Gunasekaran, Dinesh Visva; Raje, Dhananjay; Gupta, Bhaskar; Aggarwal, Kanika; Murthy, Somasheila L; Westcott, Mark; Chee, Soon Phaik; Mccluskey, Peter; Su Ling, Ho; Teoh, Stephen; Cimino, Luca; Biswas, Jyotirmay; Narain, Shishir; Agarwal, Manisha; Mahendradas, Padmamalini; Khairallah, Moncef; Jones, Nicholas; Tugal-Tutkun, Ilknur; Babu, Kalpana; Basu, Soumayava; Carreño, Ester; Lee, Richard; Al-Dhibi, Hassan; Bodaghi, Bahram; Invernizzi, Alessandro; Goldstein, Debra A; Herbort, Carl P; Barisani-Asenbauer, Talin; González-López, Julio J; Androudi, Sofia; Bansal, Reema; Moharana, Bruttendu; Mahajan, Sarakshi; Esposti, Simona; Tasiopoulou, Anastasia; Nadarajah, Sengal; Agarwal, Mamta; Abraham, Sharanya; Vala, Ruchi; Singh, Ramandeep; Sharma, Aman; Sharma, Kusum; Zierhut, Manfred; Kon, Onn Min; Cunningham, Emmett; Nguyen, Quan Dong; Pavesio, Carlos; Gupta, Vishali

2017-12-20

To analyze the role of polymerase chain reaction (PCR) of ocular fluids in management of tubercular (TB) anterior, intermediate, posterior, and panuveitis. In Collaborative Ocular Tuberculosis Study (COTS)-1 (25 centers, n = 962), patients with TB-related uveitis were included. 59 patients undergoing PCR of intraocular fluids (18 females; 53 Asian Indians) were included. 59 (6.13%) of COTS-1 underwent PCR analysis. PCR was positive for Mycobacterium TB in 33 patients (23 males; all Asian Indians). 26 patients were PCR negative (18 males). Eight patients with negative PCR had systemic TB. Anti-TB therapy was given in 18 negative and 31 PCR cases. At 1-year follow-up, five patients with positive PCR (15.15%) and three with negative PCR (11.54%) had persistence/worsening of inflammation. Data from COTS-1 suggest that PCR is not commonly done for diagnosing intraocular TB and positive/negative results may not influence management or treatment outcomes in the real world scenario.

Presence of Legionellaceae in warm water supplies and typing of strains by polymerase chain reaction.

PubMed Central

Zietz, B.; Wiese, J.; Brengelmann, F.; Dunkelberg, H.

2001-01-01

Outbreaks of Legionnaire's disease present a public health challenge especially because fatal outcomes still remain frequent. The aim of this study was to describe the abundance and epidemiology of Legionellaceae in the human-made environment. Water was sampled from hot-water taps in private and public buildings across the area of Göttingen, Germany, including distant suburbs. Following isolation, we used polymerase chain reaction in order to generate strain specific banding profiles of legionella isolates. In total, 70 buildings were examined. Of these 18 (26%) had the bacterium in at least one water sample. Legionella pneumophila serogroups 1, 4, 5 and 6 could be identified in the water samples. Most of the buildings were colonized solely by one distinct strain, as proven by PCR. In three cases equal patterns were found in separate buildings. There were two buildings in this study where isolates with different serogroups were found at the same time. PMID:11293675

Recent Direct Reaction Experimental Studies with Radioactive Tin Beams

DOE PAGES

Jones, K. L.; Ahn, S.; Allmond, J. M.; ...

2015-01-01

Direct reaction techniques are powerful tools to study the single-particle nature of nuclei. Performing direct reactions on short-lived nuclei requires radioactive ion beams produced either via fragmentation or the Isotope Separation OnLine (ISOL) method. Some of the most interesting regions to study with direct reactions are close to the magic numbers where changes in shell structure can be tracked. These changes can impact the final abundances of explosive nucleosynthesis. The structure of the chain of tin isotopes is strongly influenced by the Z = 50 proton shell closure, as well as the neutron shell closures lying in the neutron-rich, Nmore » = 82, and neutron-deficient, N = 50, regions. Here, we present two examples of direct reactions on exotic tin isotopes. The first uses a one-neutron transfer reaction and a low-energy reaccelerated ISOL beam to study states in Sn-131 from across the N = 82 shell closure. The second example utilizes a one-neutron knockout reaction on fragmentation beams of neutron-deficient Sn- 106,108Sn. In conclusion, In both cases, measurements of γ rays in coincidence with charged particles proved to be invaluable.« less

Chain Rule Approach for Calculating the Time-Derivative of Flux

DOE Office of Scientific and Technical Information (OSTI.GOV)

Langenbrunner, James R.; Booker, Jane M.

The reaction history (gamma-flux observable) is mathematically studied by using the chain rule for taking the total-time derivatives. That is, the total time-derivative of flux is written as the product of the ion temperature derivative with respect to time and the derivative of the flux with respect to ion temperature. Some equations are derived using the further simplification that the fusion reactivity is a parametrized function of ion temperature, T. Deuterium-tritium (D-T) fusion is used as the application with reactivity calculations from three established reactivity parametrizations.

Marine biofouling resistance of polyurethane with biodegradation and hydrolyzation.

PubMed

Xu, Wentao; Ma, Chunfeng; Ma, Jielin; Gan, Tiansheng; Zhang, Guangzhao

2014-03-26

We have prepared polyurethane with poly(ε-caprolactone) (PCL) as the segments of the main chain and poly(triisopropylsilyl acrylate) (PTIPSA) as the side chains by a combination of radical polymerization and a condensation reaction. Quartz crystal microbalance with dissipation studies show that polyurethane can degrade in the presence of enzyme and the degradation rate decreases with the PTIPSA content. Our studies also demonstrate that polyurethane is able to hydrolyze in artificial seawater and the hydrolysis rate increases as the PTIPSA content increases. Moreover, hydrolysis leads to a hydrophilic surface that is favorable to reduction of the frictional drag under dynamic conditions. Marine field tests reveal that polyurethane has good antifouling ability because polyurethane with a biodegradable PCL main chain and hydrolyzable PTIPSA side chains can form a self-renewal surface. Polyurethane was also used to carry and release a relatively environmentally friendly antifoulant, and the combined system exhibits a much higher antifouling performance even in a static marine environment.

Detecting Service Chains and Feature Interactions in Sensor-Driven Home Network Services

PubMed Central

Inada, Takuya; Igaki, Hiroshi; Ikegami, Kosuke; Matsumoto, Shinsuke; Nakamura, Masahide; Kusumoto, Shinji

2012-01-01

Sensor-driven services often cause chain reactions, since one service may generate an environmental impact that automatically triggers another service. We first propose a framework that can formalize and detect such service chains based on ECA (event, condition, action) rules. Although the service chain can be a major source of feature interactions, not all service chains lead to harmful interactions. Therefore, we then propose a method that identifies feature interactions within the service chains. Specifically, we characterize the degree of deviation of every service chain by evaluating the gap between expected and actual service states. An experimental evaluation demonstrates that the proposed method successfully detects 11 service chains and 6 feature interactions within 7 practical sensor-driven services. PMID:23012499

An enzyme-free flow cytometric bead assay for the sensitive detection of microRNAs based on click nucleic acid ligation-mediated signal amplification.

PubMed

Qi, Yan; Qiu, Liying; Fan, Wenjiao; Liu, Chenghui; Li, Zhengping

2017-08-07

A versatile flow cytometric bead assay (FCBA) coupled with a completely enzyme-free signal amplification mechanism is developed for the sensitive detection of microRNAs (miRNAs). This new strategy integrates click chemistry-mediated ligation chain reaction (CLCR) with hybridization chain reaction (HCR) for enzyme-free signal amplification on magnetic beads (MBs), and a flow cytometer for the robust fluorescence readout of the MBs. Firstly, target miRNA can initiate CLCR on the surface of MBs based on the click chemical ligation between dibenzocyclooctyne (DBCO)- and azide-modified single-stranded DNA (ssDNA) probes, and the amount of ligated ssDNA sequences on the MBs will be proportional to the dosage of target miRNA. Afterward, each of the ligated ssDNA products can trigger a cascade chain reaction of hybridization events between two alternating fluorophore-tagged hairpin probes, resulting in another signal amplification pathway with an amplified accumulation of fluorophores on the MBs. Finally, the fluorophore-anchored MBs are directly and rapidly analyzed by using a flow cytometer without any separation or elution processes. Herein, the click nucleic acid ligation only occurs on the surface of MBs, so the nonspecific ligations are greatly inhibited compared with that of ligation reaction performed in homogeneous solution. Furthermore, the signal amplification by CLCR-HCR is highly efficient but totally enzyme-free, which may overcome the potential drawbacks of conventional enzyme-catalyzed signal amplification protocols and lead to a high sensitivity. The CLCR-HCR-based FCBA has pushed the detection limit of let-7a miRNA down to the femtomolar (fM) level, showing great potential in miRNA-related biological studies and disease diagnosis.

The effect of Pd ensemble structure on the O2 dissociation and CO oxidation mechanisms on Au—Pd(100) surface alloys

NASA Astrophysics Data System (ADS)

Oǧuz, Ismail-Can; Mineva, Tzonka; Guesmi, Hazar

2018-01-01

The reactivity of various Pd ensembles on the Au—Pd(100) alloy catalyst toward CO oxidation was investigated by using density functional theory (DFT). This study was prompted by the search for efficient catalysts operating at low temperature for the CO oxidation reaction that is of primary environmental importance. To this aim, we considered Pd modified Au(100) surfaces including Pd monomers, Pd dimers, second neighboring Pd atoms, and Pd chains in a comparative study of the minimum energy reaction pathways. The effect of dispersion interactions was included in the calculations of the O2 dissociation reaction pathway by using the DFT-D3 scheme. The addition of the dispersion interaction strongly improves the adsorption ability of O2 on the Au—Pd surface but does not affect the activation energy barriers of the Transitions States (TSs). As for O2 to dissociate, it is imperative that the TS has lower activation energy than the O2 desorption energy. DFT-D3 is found to favor, in some cases, O2 dissociation on configurations being identified from uncorrected DFT calculations as inactive. This is the case of the second neighboring Pd configuration for which uncorrected DFT predicts positive Gibbs free energy (ΔG) of the O2 adsorption, therefore an endergonic reaction. With the addition of D3 correction, ΔG becomes negative that reveals a spontaneous O2 adsorption. Among the investigated Au—Pd (100) ensembles, the Pd chain dissociates most easily O2 and highly stabilizes the dissociated O atoms; however, it has an inferior reactivity toward CO oxidation and CO2 formation. Indeed, CO strongly adsorbs on the palladium bridge sites and therefore poisoning the surface Pd chain. By contrast, the second neighboring Pd configuration that shows somewhat lower ability to dissociate O2 turns out to be more reactive in the CO2 formation step. These results evidence the complex effect of Pd ensembles on the CO oxidation reaction. Associative CO oxidation proceeds with high energy barriers on all the considered Pd ensembles and should be excluded, in agreement with experimental observations.

[The development and implementation of polymerase chain reaction to detect in real-time operation mode yersinia pestis in field material].

PubMed

Afanas'ev, M V; Chipanin, E V; Shestakov, V E; Denisov, A V; Fomina, L A; Ostiak, A S; Balakhonov, S V

2013-03-01

The article presents the results of development and practical implementation of system of polymerase chain reaction testing in real-time operation mode to detect agent of plague infield material. In laboratory conditions the system demonstrated good results and hence it was applied in conditions of field laboratory of epidemiologic team during planned epizootologic examination of Gorno-Altaisk hot spot of plague. The sampling consisted of more than 1400 objects. It was demonstrated that high sensitivity and specificity is immanent to proposed system. The adaptation of the system to the real time amplifier "Smart Cycler" (Cephid, USA) having some specific technical characteristics makes it possible to consider the proposed test-system as an effective sensitive and precise instrument for screening studies in the process of regular epizootologic examinations of hot spots of plague.

Detection of human papillomaviruses type 16, 18 and 33 in bronchial aspirates of lung carcinoma patients by polymerase chain reaction: a study of 84 cases in Croatia.

PubMed

Branica, Bozica Vrabec; Smojver-Jezek, Silvana; Juros, Zrinka; Grgić, Sandra; Srpak, Nives; Mitrecić, Dinko; Gajović, Srećko

2010-03-01

Besides its well-known role in cervical carcinoma, HPV is also suggested to be involved in lung cancer development. A number of authors have been investigating the presence of HPV in histological materials. We used routine bronchial aspirates from 84 patients with lung carcinoma for DNA extraction and then performed polymerase chain reaction for high-risk HPV types 16, 18 and 33. The results were compared to those obtained from buccal and eyelid mucosa. Only three patients were positive for HPV in bronchial aspirates: one for HPV 16 type, one for HPV 18 type, and one for HPV 33. Our data indicated the low prevalence of HPV in patients with lung carcinomas in Croatia, therefore it seems unlikely that HPV contributes to the development of lung carcinomas in this region.

Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

PubMed Central

Narihiro, Takashi; Sekiguchi, Yuji

2011-01-01

Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction

PubMed Central

Dong, X. Y.; Li, W. H.; Zhu, J. L.; Liu, W. J.; Zhao, M. Q.; Luo, Y. W.; Chen, J. D.

2015-01-01

Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171

Mycobacterium avium restriction fragment length polymorphism-IS IS1245 and the simple double repetitive element polymerase chain reaction typing method to screen genetic diversity in Brazilian strains.

PubMed

Sequeira, Patrícia Carvalho de; Fonseca, Leila de Souza; Silva, Marlei Gomes da; Saad, Maria Helena Féres

2005-11-01

Simple double repetitive element polymerase chain reaction (MaDRE-PCR) and Pvu II-IS1245 restriction fragment length polymorphism (RFLP) typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 AIDS inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

USGS Publications Warehouse

Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

2010-01-01

A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

Effective characterization of Salmonella Enteritidis by most probable number (MPN) followed by multiplex polymerase chain reaction (PCR) methods.

PubMed

Zappelini, Lincohn; Martone-Rocha, Solange; Dropa, Milena; Matté, Maria Helena; Tiba, Monique Ribeiro; Breternitz, Bruna Suellen; Razzolini, Maria Tereza Pepe

2017-02-01

Nontyphoidal Salmonella (NTS) is a relevant pathogen involved in gastroenteritis outbreaks worldwide. In this study, we determined the capacity to combine the most probable number (MPN) and multiplex polymerase chain reaction (PCR) methods to characterize the most important Salmonella serotypes in raw sewage. A total of 499 isolates were recovered from 27 raw sewage samples and screened using two previously described multiplex PCR methods. From those, 123 isolates were selected based on PCR banding pattern-identical or similar to Salmonella Enteritidis and Salmonella Typhimurium-and submitted to conventional serotyping. Results showed that both PCR assays correctly serotyped Salmonella Enteritidis, however, they presented ambiguous results for Salmonella Typhimurium identification. These data highlight that MPN and multiplex PCR can be useful methods to describe microbial quality in raw sewage and suggest two new PCR patterns for Salmonella Enteritidis identification.

The possibility of a new resonance of three-body linear chain structure in the reaction 12C+16O at Ec.mapprox-33.5MeV

NASA Astrophysics Data System (ADS)

Kong, Xiangjing; P, L. Li; J, J. Kolata; A, Morsad; L, Goetting; R, A. Kryger; S, Dixit; R, Tighe; W, Chune

1990-05-01

There is a peak in the excitation function of total cross section of low energy α-particles in the reaction 12C+16O at Ec.m approx33.5MeV. The experimental distribution of α-particle emitted event has been obtained. The result of theoretical calculation roughly agrees with experimental data, gives an orientation where three-body resonances can be expected, and the information on internal structure of three-body linear chain molecule.

Frankfurt Medical Department Activity (FMEDDAC) OB/GYN Clinic Study

DTIC Science & Technology

1993-08-01

ideas took hold and flourished in post-World War II Japan ( Arikan , 1990). The Japanese institutionalized the following chain FMEDDAC OB-GYN 8 reaction...be required for most organizations. FMEDDAC OB-GYN 69 References Arikan , V.L. (1991). Total quality management - Applications to nursing service

Bismuth(III) trifluoromethanesulfonate catalyzed ring opening reaction of mono epoxy oleochemicals to form keto and diketo derivatives

USDA-ARS?s Scientific Manuscript database

Using a catalytic system, methyl oleate is transformed into long chain keto and diketo derivatives via an epoxide route. Methyl 9(10)-oxooctadecanoate and methyl 9,10-dioxooctadecanoate were made by a ring opening reaction of epoxidized methyl oleate using bismuth triflate catalyst. Lower reaction t...

Direct RNA detection without nucleic acid purification and PCR: Combining sandwich hybridization with signal amplification based on branched hybridization chain reaction.

PubMed

Xu, Yao; Zheng, Zhi

2016-05-15

We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.

Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

PubMed

Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

2008-03-01

Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

Problem-Solving Test: Pyrosequencing

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2013-01-01

Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

[The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

PubMed

D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

1993-01-01

The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

PubMed Central

Atherton, Richard; Bhavnani, Darlene; Calvopiña, Manuel; Vicuña, Yosselin; Cevallos, William; Eisenberg, Joseph

2013-01-01

The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay) were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh) gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61%) were classified as assemblage B (26 as BIII and 16 as BIV), 22 (32%) as assemblage A (3 as AI and 19 as AII) and five (7%) as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A. PMID:23827993

Identification of Echinococcus granulosus strains using polymerase chain reaction-restriction fragment length polymorphism amongst livestock in Moroto district, Uganda.

PubMed

Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah

2016-07-29

A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.

Esterification of fatty acids using nylon-immobilized lipase in n-hexane: kinetic parameters and chain-length effects.

PubMed

Zaidi, A; Gainer, J L; Carta, G; Mrani, A; Kadiri, T; Belarbi, Y; Mir, A

2002-02-28

The esterification of long-chain fatty acids in n-hexane catalyzed by nylon-immobilized lipase from Candida rugosa has been investigated. Butyl oleate (22 carbon atoms), oleyl butyrate (22 carbon atoms) and oleyl oleate (36 carbon atoms) were produced at maximum reaction rates of approximately equal to 60 mmol h(-1) g(-1) immobilized enzyme when the substrates were present in equimolar proportions at an initial concentration of 0.6 mol l(-1). The observed kinetic behavior of all the esterification reactions is found to follow a ping-pong bi-bi mechanism with competitive inhibition by both substrates. The effect of the chain-length of the fatty acids and the alcohols could be correlated to some mechanistic models, in accordance with the calculated kinetic parameters.

Reaction-mediated entropic effect on phase separation in a binary polymer system

NASA Astrophysics Data System (ADS)

Sun, Shujun; Guo, Miaocai; Yi, Xiaosu; Zhang, Zuoguang

2017-10-01

We present a computer simulation to study the phase separation behavior induced by polymerization in a binary system comprising polymer chains and reactive monomers. We examined the influence of interaction parameter between components and monomer concentration on the reaction-induced phase separation. The simulation results demonstrate that increasing interaction parameter (enthalpic effect) would accelerate phase separation, while entropic effect plays a key role in the process of phase separation. Furthermore, scanning electron microscopy observations illustrate identical morphologies as found in theoretical simulation. This study may enrich our comprehension of phase separation in polymer mixture.

Oxidative versus Non-oxidative Decarboxylation of Amino Acids: Conditions for the Preferential Formation of Either Strecker Aldehydes or Amines in Amino Acid/Lipid-Derived Reactive Carbonyl Model Systems.

PubMed

Zamora, Rosario; León, M Mercedes; Hidalgo, Francisco J

2015-09-16

Comparative formation of both 2-phenylethylamine and phenylacetaldehyde as a consequence of phenylalanine degradation by carbonyl compounds was studied in an attempt to understand if the amine/aldehyde ratio can be changed as a function of reaction conditions. The assayed carbonyl compounds were selected because of the presence in the chain of both electron-donating and electron-withdrawing groups and included alkenals, alkadienals, epoxyalkenals, oxoalkenals, and hydroxyalkenals as well as lipid hydroperoxides. The obtained results showed that the 2-phenylethylamine/phenylacetaldehyde ratio depended upon both the carbonyls and the reaction conditions. Thus, it can be increased using electron-donating groups in the chain of the carbonyl compound, small amounts of carbonyl compound, low oxygen content, increasing the pH, or increasing the temperature at pH 6. Opposed conditions (use of electron-withdrawing groups in the chain of the carbonyl compound, large amounts of carbonyl compound, high oxygen contents, low pH values, and increasing temperatures at low pH values) would decrease the 2-phenylethylamine/phenylacetaldehyde ratio, and the formation of aldehydes over amines in amino acid degradations would be favored.

Expression and Functional Properties of an Anti-Triazophos High-Affinity Single-Chain Variable Fragment Antibody with Specific Lambda Light Chain

PubMed Central

Liu, Rui; Liang, Xiao; Xiang, Dandan; Guo, Yirong; Liu, Yihua; Zhu, Guonian

2016-01-01

Triazophos is a widely used organophosphorous insecticide that has potentially adverse effects to organisms. In the present study, a high-affinity single-chain variable fragment (scFv) antibody with specific lambda light chain was developed for residue monitoring. First, the specific variable regions were correctly amplified from a hybridoma cell line 8C10 that secreted monoclonal antibody (mAb) against triazophos. The regions were then assembled as scFv via splicing by overlap extension polymerase chain reaction. Subsequently, the recombinant anti-triazophos scFv-8C10 was successfully expressed in Escherichia coli strain HB2151 in soluble form, purified through immobilized metal ion affinity chromatography, and verified via Western blot and peptide mass fingerprinting analyses. Afterward, an indirect competitive enzyme-linked immunosorbent assay was established based on the purified anti-triazophos scFv-8C10 antibody. The assay exhibited properties similar to those based on the parent mAb, with a high sensitivity (IC50 of 1.73 ng/mL) to triazophos and no cross reaction for other organophosphorus pesticides; it was reliable in detecting triazophos residues in spiked water samples. Moreover, kinetic measurement using a surface plasmon resonance biosensor indicated that the purified scFv-8C10 antibody had a high affinity of 1.8 × 10−10 M and exhibited good binding stability. Results indicated that the recombinant high-affinity scFv-8C10 antibody was an effective detection material that would be promising for monitoring triazophos residues in environment samples. PMID:27338340

Amyloid fibril formation by the chain B subunit of monellin occurs by a nucleation-dependent polymerization mechanism.

PubMed

Sabareesan, A T; Udgaonkar, Jayant B

2014-02-25

Proteins possessing very different structures, or even no structure, form amyloid fibrils that are very similar in internal structure. This suggests that the mechanisms by which amyloid fibrils form might be very similar, irrespective of whether the fibrils are associated with disease or with normal cellular function, or even if they have no physiological importance. In this context, it is important to have a model protein system whose amyloid fibril formation is robust in its reproducibility, which can reveal the fundamentals of the amyloid fibril reaction that may be applicable to all proteins. In this study, the aggregation mechanism of amyloid fibril formation by chain B of the heterodimeric protein monellin has been elucidated in detail. It is shown that the aggregation reaction meets all the stringent kinetic criteria of a homogeneous nucleation-dependent polymerization mechanism, which is valid over a wide range of protein concentrations. Quantitative analyses of the kinetic data using one approach based on features of the entire kinetic curve, and another based on only the initial rate of aggregation, indicate that the thermodynamic nucleus is a dimer. Spherical oligomers are observed by atomic force microscopy to form transiently early during fibril formation but are off-pathway to the direct fibril formation pathway. It is shown that amyloid fibril formation can be prevented by the addition of chain A of monellin at early stages of chain B aggregation: the two free chains combine to form native monellin, which leads to the dissociation of early aggregates.

Human papillomavirus type 2 associated with pyogenic granuloma in patients without clinical evidence of warts.

PubMed

Vázquez-Martínez, Osvaldo T; González-Betancourt, Anajulia; Barboza-Cerda, María Carmen; González-González, Sergio E; Lugo-Trampe, Ángel; Welsh, Oliverio; Rojas-Martínez, Augusto; Martínez-Rodríguez, Herminia G; Ocampo-Candiani, Jorge; Ortiz-López, Rocío

2016-07-01

Pyogenic granuloma is a non-neoplastic lesion that frequently occurs in the skin and mucous membranes of children and pregnant women. The anatomical sites of pyogenic granulomas overlap with those of wart infections caused by the human papillomavirus (HPV). This study assessed the presence of HPV DNA in pyogenic granuloma samples by polymerase chain reaction. Eighteen pyogenic granuloma biopsies from patients without a clinical history or evidence of verruca in the studied area were tested for the presence of the HPV genome. The presence of HPV DNA was screened by three independent polymerase chain reaction reactions using standard consensus primer sets targeted to the L1 or E1 consensus regions of HPV genome. The HPV DNA-positive samples were genotyped using methodologies enabling the identification of up to 30 HPVs, including oncogenic, nononcogenic, and cutaneous viral types. The HPV DNA was detected in 44.4% (eight of 18) of the samples, with HPV-2 being the only type in the eight HPV DNA-positive samples. Contamination with HPV-2 sequences throughout the entire process was reliably eliminated. This report is the first to suggest an association between HPV-2 and pyogenic granuloma. This relationship is similar to that observed between HPV-2 and nongenital warts. © 2015 The International Society of Dermatology.

[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

PubMed

Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

2015-01-01

Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

Role of F357 as an Oxygen Gate in the Oxidative Half-Reaction of Choline Oxidase.

PubMed

Salvi, Francesca; Rodriguez, Isela; Hamelberg, Donald; Gadda, Giovanni

2016-03-15

Choline oxidase from Arthrobacter globiformis catalyzes the oxidation of choline to glycine betaine by using oxygen as an electron acceptor. A partially rate limiting isomerization of the reduced wild-type enzyme during the reaction with oxygen was previously detected using solvent viscosity effects. In this study, we hypothesized that the side chains of M62 and F357, located at the entrance to the active site of choline oxidase, may be related to the slow isomerization detected. We engineered a double-variant enzyme M62A/F357A. The kinetic characterization of the double-variant enzyme showed a lack of the isomerization detected in wild-type choline oxidase, and a lack of saturation with an oxygen concentration as high as 1 mM, while most other kinetic parameters were similar to those of wild-type choline oxidase. The kinetic characterization of the single-variant enzymes established that only the side chain of F357 plays a role in the isomerization of choline oxidase in the oxidative half-reaction. Molecular dynamics studies suggest that the slow isomerization related to F357 is possibly due to the participation of the phenyl ring in a newly proposed gating mechanism for a narrow tunnel, assumed to regulate the access of oxygen to the reduced cofactor.

Prevalence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using multiplex polymerase chain reaction

PubMed Central

Latha, C.; Anu, C. J.; Ajaykumar, V. J.; Sunil, B.

2017-01-01

Aim: The objective of the study was to investigate the occurrence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using the multiplex polymerase chain reaction (PCR) method. Materials and Methods: The assay combined an enrichment step in tryptic soy broth with yeast extract formulated for the simultaneous growth of target pathogens, DNA isolation and multiplex PCR. A total of 1134 samples including beef (n=349), chicken (n=325), pork (n=310), chevon (n=50), and meat products (n=100) were collected from different parts of Kerala, India. All the samples were subjected to multiplex PCR analysis and culture-based detection for the four pathogens in parallel. Results: Overall occurrence of L. monocytogenes was 0.08 % by cultural method. However, no L. monocytogenes was obtained by multiplex PCR method. Yersinia enterocolitica was obtained from beef and pork samples. A high prevalence of S. aureus (46.7%) was found in all types of meat samples tested. None of the samples was positive for S. Typhimurium. Conclusion: Multiplex PCR assay used in this study can detect more than one pathogen simultaneously by amplifying more than one target gene in a single reaction, which can save time and labor cost. PMID:28919685

Determining the thickness of aliphatic alcohol monolayers covalently attached to silicon oxide surfaces using angle-resolved X-ray photoelectron spectroscopy

NASA Astrophysics Data System (ADS)

Lee, Austin W. H.; Kim, Dongho; Gates, Byron D.

2018-04-01

The thickness of alcohol based monolayers on silicon oxide surfaces were investigated using angle-resolved X-ray photoelectron spectroscopy (ARXPS). Advantages of using alcohols as building blocks for the formation of monolayers include their widespread availability, ease of handling, and stability against side reactions. Recent progress in microwave assisted reactions demonstrated the ease of forming uniform monolayers with alcohol based reagents. The studies shown herein provide a detailed investigation of the thickness of monolayers prepared from a series of aliphatic alcohols of different chain lengths. Monolayers of 1-butanol, 1-hexanol, 1-octanol, 1-decanol, and 1-dodecanol were each successfully formed through microwave assisted reactions and characterized by ARXPS techniques. The thickness of these monolayers consistently increased by ∼1.0 Å for every additional methylene (CH2) within the hydrocarbon chain of the reagents. Tilt angles of the molecules covalently attached to silicon oxide surfaces were estimated to be ∼35° for each type of reagent. These results were consistent with the observations reported for thiol based or silane based monolayers on either gold or silicon oxide surfaces, respectively. The results of this study also suggest that the alcohol based monolayers are uniform at a molecular level.

Steroid hydroxylation by basidiomycete peroxygenases: a combined experimental and computational study.

PubMed

Babot, Esteban D; Del Río, José C; Cañellas, Marina; Sancho, Ferran; Lucas, Fátima; Guallar, Víctor; Kalum, Lisbeth; Lund, Henrik; Gröbe, Glenn; Scheibner, Katrin; Ullrich, René; Hofrichter, Martin; Martínez, Angel T; Gutiérrez, Ana

2015-06-15

The goal of this study is the selective oxyfunctionalization of steroids under mild and environmentally friendly conditions using fungal enzymes. With this purpose, peroxygenases from three basidiomycete species were tested for the hydroxylation of a variety of steroidal compounds, using H2O2 as the only cosubstrate. Two of them are wild-type enzymes from Agrocybe aegerita and Marasmius rotula, and the third one is a recombinant enzyme from Coprinopsis cinerea. The enzymatic reactions on free and esterified sterols, steroid hydrocarbons, and ketones were monitored by gas chromatography, and the products were identified by mass spectrometry. Hydroxylation at the side chain over the steroidal rings was preferred, with the 25-hydroxyderivatives predominating. Interestingly, antiviral and other biological activities of 25-hydroxycholesterol have been reported recently (M. Blanc et al., Immunity 38:106-118, 2013, http://dx.doi.org/10.1016/j.immuni.2012.11.004). However, hydroxylation in the ring moiety and terminal hydroxylation at the side chain also was observed in some steroids, the former favored by the absence of oxygenated groups at C-3 and by the presence of conjugated double bonds in the rings. To understand the yield and selectivity differences between the different steroids, a computational study was performed using Protein Energy Landscape Exploration (PELE) software for dynamic ligand diffusion. These simulations showed that the active-site geometry and hydrophobicity favors the entrance of the steroid side chain, while the entrance of the ring is energetically penalized. Also, a direct correlation between the conversion rate and the side chain entrance ratio could be established that explains the various reaction yields observed. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Steroid Hydroxylation by Basidiomycete Peroxygenases: a Combined Experimental and Computational Study

PubMed Central

Babot, Esteban D.; del Río, José C.; Cañellas, Marina; Sancho, Ferran; Lucas, Fátima; Guallar, Víctor; Kalum, Lisbeth; Lund, Henrik; Gröbe, Glenn; Scheibner, Katrin; Ullrich, René; Hofrichter, Martin; Martínez, Angel T.

2015-01-01

The goal of this study is the selective oxyfunctionalization of steroids under mild and environmentally friendly conditions using fungal enzymes. With this purpose, peroxygenases from three basidiomycete species were tested for the hydroxylation of a variety of steroidal compounds, using H2O2 as the only cosubstrate. Two of them are wild-type enzymes from Agrocybe aegerita and Marasmius rotula, and the third one is a recombinant enzyme from Coprinopsis cinerea. The enzymatic reactions on free and esterified sterols, steroid hydrocarbons, and ketones were monitored by gas chromatography, and the products were identified by mass spectrometry. Hydroxylation at the side chain over the steroidal rings was preferred, with the 25-hydroxyderivatives predominating. Interestingly, antiviral and other biological activities of 25-hydroxycholesterol have been reported recently (M. Blanc et al., Immunity 38:106–118, 2013, http://dx.doi.org/10.1016/j.immuni.2012.11.004). However, hydroxylation in the ring moiety and terminal hydroxylation at the side chain also was observed in some steroids, the former favored by the absence of oxygenated groups at C-3 and by the presence of conjugated double bonds in the rings. To understand the yield and selectivity differences between the different steroids, a computational study was performed using Protein Energy Landscape Exploration (PELE) software for dynamic ligand diffusion. These simulations showed that the active-site geometry and hydrophobicity favors the entrance of the steroid side chain, while the entrance of the ring is energetically penalized. Also, a direct correlation between the conversion rate and the side chain entrance ratio could be established that explains the various reaction yields observed. PMID:25862224

Apparatus and method for polymer synthesis using arrays

DOEpatents

Brennan, Thomas M.

1995-01-01

A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24) , and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31) , downstream from the nozzles (22) , sweeps the common chamber ( 31 ) of toxic fumes emitted by the reagents. Each reaction well (26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.

Apparatus and method for polymer synthesis using arrays

DOEpatents

Brennan, Thomas M.

1996-01-01

A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24), and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31), downstream from the nozzles (22), sweeps the common chamber (31) of toxic fumes emitted by the reagents. Each reaction well ( 26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82 ) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.

New polymer systems: Chain extension by dianhydrides

NASA Technical Reports Server (NTRS)

Rhein, R. A.; Ingham, J. D.

1974-01-01

Three anhydrides provide effective chain extension of hydroxy-terminated polyalkylene oxides and polybutadienes. Novel feature of these anhydride reactants is that they are difunctional as anhydrides, but they are tetrafunctional if conditions are selected that lead to total esterification or reaction of all carboxyl groups.

Structure-property relationships in a series of diglycerol tetraether model lipids and their lyotropic assemblies: the effect of branching topology and chirality.

PubMed

Markowski, Thomas; Drescher, Simon; Meister, Annette; Blume, Alfred; Dobner, Bodo

2014-06-14

Three novel diglycerol tetraether lipids with one membrane-spanning chain have been synthesized. These lipids contain only two or four racemic methyl branches at selected positions of the hydrophobic chains in contrast to natural lipids from archaebacterial membranes with an isoprenoid substitution pattern. The insertion of the methyl moieties was realized starting from either (RS)-citronellyl bromide or the inexpensive methyl malonic acid ethyl ester. For chain elongation the Cu-catalysed Grignard coupling reaction was used. The preparation of diglycerol tetraethers was either performed by condensing suitable blocked monoglycerol diethers by Grubbs metathesis or by reaction of the transmembrane C32-chain with blocked glycerols followed by further alkylation steps. Finally, we could show that the resulting lipids can form closed lipid vesicles comparable to the optically pure counterparts. Therefore, these much simpler lipids compared to the natural lipids from archaebacterial membranes are also suitable for preparation of stable tailored liposomes.

RICIN-inhibitor design. Final report, 15 April 1993-14 April 1996

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schramm, V.L.

1996-05-01

The purpose of this proposal was to provide information which will permit the design of transition state inhibitors for ricin A-chain. The original goals were to solve the transition state structure based on kinetic isotope effects. Substrates were synthesized and the conditions for assays optimized to provide catalytic rates at least 1000 fold greater than those published prior to this work. Reliable assay methods have been established to permit routine assays for ricin A-chain. Substrate analogues for N-ribohydrolase reactions have been designed to establish whether the reaction involves leaving-group activation or oxycarbonium ion formation. Based on these results, leaving groupmore » activation is a major contributor and oxycarbonium-ion formation is a secondary contribution in the mechanism of catalysis by ricin A-chain. Using this information, the first submicromolar inhibitor of ricin A-chain has been synthesized, tested and kinetically characterized. The development of powerful inhibitors will be a direct extrapolation of these results.« less

ε-Poly-L-lysine peptide chain length regulated by the linkers connecting the transmembrane domains of ε-Poly-L-lysine synthetase.

PubMed

Hamano, Yoshimitsu; Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime

2014-08-01

ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Polyphosphate kinase: demonstration that short chain polyphosphate serves as a primer for the enzymatic synthesis of polyphosphate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robinson, N.A.; Wood, H.G.

1986-05-01

Polyphosphate (poly(P)) kinase, isolated from Propionibacterium shermanii, catalyzes the following reaction: poly(P/sub n/) + ATPin equilibriumpoly(P/sub n+1/) + ADP. The authors have purified this enzyme to 90% homogeneity and have shown it to be composed of 2-3 identical subunits of M/sub r/ 80,000. Investigation of the reaction mechanism by product analysis has revealed that the elongation phase is processive whereby successive elongation occurs without release of intermediate sizes until very long chains are formed. The initiation phase of synthesis has been investigated using (/sup 32/P) poly(P) primer of chain length 11-60. It is incorporated into long chain poly(P) and themore » /sup 32/P has been shown, by use of poly(P) glucokinase, to be localized at the end of the molecule. Calculation of average chain length based upon the incorporation of /sup 32/P, however, yields a value approx.3 fold higher than the value calculated by another method using poly(P) glucokinase. This result indicates that initiation of poly(P) synthesis occurs by at least one other route which does not involve short chain poly(P) primers. The effect of temperature and concentration of poly(P) primer upon the average chain length of poly(P) synthesized was also investigated. A general trend was observed in which the chain length of the synthesized poly(P) decreased as either temperature or concentration or primer was increased.« less

[THE COMPARATIVE ANALYSIS OF EFFECTIVENESS OF QUICK TESTS IN DIAGNOSTIC OF INFLUENZA AND RESPIRATORY SYNCYTIAL VIRAL INFECTION IN CHILDREN].

PubMed

Petrova, E R; Sukhovetskaia, V P; Pisareva, M M; Maiorova, V G; Sverlova, M V; Danilenko, D M; Petrova, P A; Krivitskaia, V Z; Sominina, A A

2015-11-01

The analysis was implemented concerning diagnostic parameters of commercial quick tests (immune chromatographic tests BinaxNOW Influenza A&B and BinaxNow RSV Alere, Scarborough Inc., USA) under detection of antigens of influenza virus A and respiratory syncytial virus in clinical materials. The polymerase chain reaction in real-time and isolation ofviruses in cell cultures. The analysis of naso-pharyngeal smears from 116 children demonstrated that sensitivity and specifcity of detection of influenza virus A using device mariPOC in comparison with polymerase chain reaction made up to 93.8% and 99.0% correspondingly at total concordance of results of both techniques as 98.3%. At diagnosing of respiratory syncytial virus using device mariPOC parameters made up to 77.3%, 98.9% and 862% as compared with polymerase chain reaction. The sensitivity, specificity and total concordance of results of immune chromatographic tests BinaxNOW in comparison ofpolymerase chain reaction made up to 86.7%, 100% and 96.2% correspondingly at detection of influenza virus A and 80.9%, 97.4% and 91.6% correspondingly at detection of respiratory syncytial virus. In comparison with isolation technique in cell cultures sensitivity of system mariPOC and immune chromatographic tests proved to be in 1.3-1.4 times higher at detection of influenza virus A and in 1.7-2 times higher in case of isolation of respiratory syncytial virus. There is no statistically significant differences between diagnostic parameters received for mariPOC and immune chromatographic tests at diagnosing influenza virus A and respiratory syncytial viral infection.

Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

PubMed Central

Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

2010-01-01

Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

PubMed

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

2008-09-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

Genomic DNA-based absolute quantification of gene expression in Vitis

USDA-ARS?s Scientific Manuscript database

Many studies in which gene expression is quantified by polymerase chain reaction represent the expression of a gene of interest (GOI) relative to that of a reference gene (RG). Relative expression is founded on the assumptions that RG expression is stable across samples, treatments, organs, etc., an...

Reactivation of chickenpox contracted in infancy.

PubMed Central

Terada, K; Kawano, S; Hiraga, Y; Morita, T

1995-01-01

Varicella zoster virus DNA in mononuclear cells was studied by the polymerase chain reaction to obtain virological evidence of reactivation in the children who had contracted chickenpox in infancy. The results appear to explain why chickenpox in infancy is a risk factor for herpes zoster in immunocompetent children. PMID:7574864

Identifying Dust Emission "Hot Spots" in the Southern Plains Region of New Mexico, Oklahoma and Texas : Effect of Blowing Dust on Highway

DOT National Transportation Integrated Search

2017-12-30

Windblown dust poses a significant hazard to highway safety. Dust contributes to chain-reaction traffic accidents every year in the southwestern US, however, no known studies have specifically investigated this issue in New Mexico, Oklahoma, and Texa...

Results of the 2009 ASBVd survey of avocado accessions in the national germplasm collection in Florida

USDA-ARS?s Scientific Manuscript database

The presence of Avocado Sunblotch Viroid (ASBVd) infection among the avocado (Persea americana Mill.) accessions in the National Germplasm Repository at Miami (NGR-Mia) was established in previous studies. An ASBVd specific reverse transcription-polymerase chain reaction (RT-PCR) protocol was used t...

Open Markov Processes and Reaction Networks

ERIC Educational Resources Information Center

Swistock Pollard, Blake Stephen

2017-01-01

We begin by defining the concept of "open" Markov processes, which are continuous-time Markov chains where probability can flow in and out through certain "boundary" states. We study open Markov processes which in the absence of such boundary flows admit equilibrium states satisfying detailed balance, meaning that the net flow…

Sequestration of dyes from artificially prepared textile effluent using RSM-CCD optimized hybrid backbone based adsorbent-kinetic and equilibrium studies.

PubMed

Sukriti; Sharma, Jitender; Chadha, Amritpal Singh; Pruthi, Vaishali; Anand, Prerna; Bhatia, Jaspreet; Kaith, B S

2017-04-01

Present work reports the synthesis of semi-Interpenetrating Network Polymer (semi-IPN) using Gelatin-Gum xanthan hybrid backbone and polyvinyl alcohol in presence of l-tartaric acid and ammonium persulphate as the crosslinker-initiator system. Reaction parameters were optimized with Response Surface Methodology (RSM) in order to maximize the percent gel fraction of the synthesized sample. Polyvinyl alcohol, l-Tartaric acid, ammonium persulphate, reaction temperature, time and pH of the reaction medium were found to make an impact on the percentage gel fraction obtained. Incorporation of polyvinyl alcohol chains onto hybrid backbone and crosslinking between the different polymer chains were confirmed through techniques like FTIR, SEM-EDX and XRD. Semi-IPN was found to be very efficient in the removal of cationic dyes rhodamine-B (70%) and auramine-O (63%) from a mixture with an adsorbent dose of 700 mg, initial concentration of rhodamine-B 6 mgL -1 and auramine-O 26 mgL -1 , at an time interval of 22-25 h and 30 °C temp. Further to determine the nature of adsorption Langmuir and Freundlich adsorption isotherm models were studied and it was found that Langmuir adsorption isotherm was the best fit model for the removal of mixture of dyes. Kinetic studies for the sorption of dyes favored the reaction mechanism to occur via a pseudo second order pathway with R 2 value about 0.99. Copyright © 2017 Elsevier Ltd. All rights reserved.

Indirect studies on astrophysical reactions at the low-energy RI beam separator CRIB

NASA Astrophysics Data System (ADS)

Yamaguchi, H.; Kahl, D.; Hayakawa, S.; Yang, L.; Shimizu, H.; Sakaguchi, Y.; Abe, K.; Wakabayashi, Y.; Hashimoto, T.; Nakao, T.; Kubono, S.; Suhara, T.; Iwasa, N.; Kim, A.; Kim, D. H.; Cha, S. M.; Kwag, M. S.; Lee, J. H.; Lee, E. J.; Chae, K. Y.; Imai, N.; Kitamura, N.; Lee, P.; Moon, J. Y.; Lee, K. B.; Akers, C.; Jung, H. S.; Duy, N. N.; Khiem, L. H.; Lee, C. S.; Cherubini, S.; Gulino, M.; Spitaleri, C.; Rapisarda, G. G.; Cognata, M. La; Lamia, L.; Romano, S.; Coc, A.; de Sereville, N.; Hammache, F.; Kiss, G.; Bishop, S.; Teranishi, T.; Kawabata, T.; Kwon, Y. K.; Binh, D. N.

2018-04-01

Studies on nuclear astrophysics, nuclear structure, and other interests have been performed using the radioactive-isotope (RI) beams at the low-energy RI beam separator CRIB, operated by Center for Nuclear Study (CNS), the University of Tokyo. A type of measurement to study astophysical reactions at CRIB is by the elastic resonant scattering with the thick-target method in inverse kinematics. An example is the α resonant scattering with 7Be beam, related to the astrophysical 7Be(α,γ) reactions, which is relevant in the hot p-p chain and νp-process in supernovae. Other α resonant scattering measurements with 30S, 10Be, 15O, and 18Ne beams have been performed at CRIB, using the thick-target method. There have also been measurements based on other experimental methods. The first Trojan horse method (THM) measurement using an RI beam has been performed at CRIB, to study the 18F(p, α)15O reaction at astrophysical energies via the three body reaction 2H(18F, α15O)n. The 18F(p, α)15O reaction rate is crucial to understand the 511-keV γ-ray production in nova explosion phenomena, and we successfully evaluated the reaction cross section at novae temperature and below experimentally for the first time.

LETTER TO THE EDITOR: Single-species reactions on a random catalytic chain

NASA Astrophysics Data System (ADS)

Oshanin, G.; Burlatsky, S. F.

2002-11-01

We present an exact solution for a catalytically activated annihilation A + A → 0 reaction taking place on a one-dimensional chain in which some segments (placed at random, with mean concentration p) possess special, catalytic properties. An annihilation reaction takes place as soon as any two A particles land from the reservoir onto two vacant sites at the extremities of the catalytic segment, or when any A particle lands onto a vacant site on a catalytic segment while the site at the other extremity of this segment is already occupied by another A particle. We find that the disorder-average pressure P(quen) per site of such a chain is given by P(quen) = P(Lan) + β-1F, where P(Lan) = β-1 ln(1 + z) is the Langmuir adsorption pressure, (z being the activity and β-1 the temperature), while β-1F is the reaction-induced contribution, which can be expressed, under appropriate change of notation, as the Lyapunov exponent for the product of 2 × 2 random matrices, obtained exactly by Derrida and Hilhorst (1983 J. Phys. A: Math. Gen. 16 2641). Explicit asymptotic formulae for the particle mean density and the compressibility are also presented.

Molecular Machine Powered Surface Programmatic Chain Reaction for Highly Sensitive Electrochemical Detection of Protein.

PubMed

Zhu, Jing; Gan, Haiying; Wu, Jie; Ju, Huangxian

2018-04-17

A bipedal molecular machine powered surface programmatic chain reaction was designed for electrochemical signal amplification and highly sensitive electrochemical detection of protein. The bipedal molecular machine was built through aptamer-target specific recognition for the binding of one target protein with two DNA probes, which hybridized with surface-tethered hairpin DNA 1 (H1) via proximity effect to expose the prelocked toehold domain of H1 for the hybridization of ferrocene-labeled hairpin DNA 2 (H2-Fc). The toehold-mediated strand displacement reaction brought the electrochemical signal molecule Fc close to the electrode and meanwhile released the bipedal molecular machine to traverse the sensing surface by the surface programmatic chain reaction. Eventually, a large number of duplex structures of H1-H2 with ferrocene groups facing to the electrode were formed on the sensor surface to generate an amplified electrochemical signal. Using thrombin as a model target, this method showed a linear detection range from 2 pM to 20 nM with a detection limit of 0.76 pM. The proposed detection strategy was enzyme-free and allowed highly sensitive and selective detection of a variety of protein targets by using corresponding DNA-based affinity probes, showing potential application in bioanalysis.

Reaction Paths and Chemical Activation Reactions of 2-Methyl-5-Furanyl Radical with 3O2.

PubMed

Hudzik, Jason M; Bozzelli, Joseph W

2017-10-05

Interest in high-energy substituted furans has been increasing due to their occurrence in biofuel production and their versatility in conversion to other useful products. Methylfurans are the simplest substituted furans and understanding their reaction pathways, thermochemical properties, including intermediate species stability, and chemical kinetics would aid in the study of larger furans. Furan ring C-H bonds have been shown to be extremely strong, approximately 120 kcal mol -1 , due in part to the placement of the oxygen atom and aromatic-like resonance, both within the ring. The thermochemistry and kinetics of the oxidation of 2-methyfuran radical at position 5 of the furan ring, 2-methyl-5-furanyl radical (2MF5j), is analyzed. The resulting chemically activated species, 2MF5OOj radical, has a well depth of 51 kcal mol -1 below the 2MF5j + O 2 reactants; this is 4-5 kcal mol -1 deeper than that of phenyl and vinyl radical plus O 2 , with both of these reactions known to undergo chain branching. Important, low-energy reaction pathways include chain branching dissociations, intramolecular abstractions, group transfers, and radical oxygen additions. Enthalpies of formation, entropies, and heat capacities for the stable molecules, radicals, and transition-state species are analyzed using computational methods. Calculated ΔH ° f 298 values were determined using an isodesmic work reaction from the CBS-QB3 composite method. Elementary rate parameters are from saddle point transition-state structures and compared to variational transition-state analysis for the barrierless reactions. Temperature- and pressure-dependent rate constants which are calculated using QRRK and master equation analysis is used for falloff and stabilization.

New synthesis of maleic anhydride modified polyolefins and their applications

NASA Astrophysics Data System (ADS)

Lu, Bing

Maleic anhydride (MA) modified polyolefins are the most useful commercial functional polyolefins. The current technology of producing MA modified polyolefins, mainly free radical modification, usually results in low MA graft contents, extensive side reactions, and poor control of graft structures. In this thesis, we show a new synthetic route for preparing MA modified polyolefins with excellent control of polymer structures and MA concentrations. The synthesis is based on the "reactive" polyolefin copolymers, i.e. polyolefins containing p-methylstyrene or alkylborane groups. The p-methylstyrene copolymers lead to selectively grafting reactions on the p-methyl groups, greatly reducing the side reactions on the polyolefin backbone. The MA graft content was proportional to the concentration of p-methylstyrene. In the borane approach, under controlled selective oxidation, the alkylborane containing PP polymers formed the "stable" polymeric radical in situ which initiated the graft-from reaction. By varying the monomer concentrations of MA and styrene, reaction time and temperature, a broad range of MA modified PP polymers were prepared from a single MA terminated or grafted PP to a very long SMA segment blocked or grafted PP, and there is no detectable side reaction on the PP backbone. MA modified polyolefins were investigated in the applications of glass fiber reinforced PP, elastomer toughened Nylon, and polyolefin/Nylon blends. The MA modified polyolefin compatibilizers showed the significant improved mechanical properties and morphology of the blends. The effectiveness of compatibilization depends on the MA concentration, molecular weight of the polyolefin segments, the structure of the compatibilizers, and the composition of the blend. By amidation or imidation reaction of MA modified PP with amine terminated PP, long chain branched PP polymers were also prepared. The results of IR, GPC, intrinsic viscosity and DSC studies clearly indicate the formation of long chain branched PP.

Hybrid quantum chemical studies for the methanol formation reaction assisted by the proton transfer mechanism in supercritical water: CH3Cl+nH2O-->CH3OH+HCl+(n-1)H2O

NASA Astrophysics Data System (ADS)

Hori, T.; Takahashi, H.; Nitta, T.

2003-10-01

The proton transfer along the chain of hydrogen bonds is involved in many chemical reactions in aqueous solution and known to play a decisive role. We have performed the hybrid quantum chemical simulations for the methanol formation reaction catalyzed by the proton transfer mechanism [CH3Cl+nH2O→CH3OH+HCl+(n-1)H2O, n=3] in supercritical water (SCW) to investigate the role of water solvent on the reaction. In the simulation, the electronic state of the chemically active solutes (CH3Cl+3H2O) has been determined quantum mechanically, while the static water solvent has been represented by a classical model. The activation free energy for the water-catalytic reaction in SCW has been found to be 9.6 kcal/mol, which is much lower than that in the gas phase (29.2 kcal/mol). The fractional charge analysis has revealed that the notable charge separation in the solute complex takes place at the transition state (TS) and the resulting huge dipole gives rise to the considerable stabilization of the TS as compared to the reactant. It has been shown that the reaction assisted by the proton transfer mechanism is energetically much favored than the ionic SN2 reaction (CH3Cl+OH-→CH3OH+Cl-, 18.8 kcal/mol). The present calculations suggest that the proton migrations through the chain of hydrogen bonds can be regarded as a probable candidate responsible for the anomalous reactivities observed in SCW.

Differentiation of human-induced pluripotent stem cells into insulin-producing clusters.

PubMed

Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad

2015-02-01

In diabetes mellitus type 1, beta cells are mostly destroyed; while in diabetes mellitus type 2, beta cells are reduced by 40% to 60%. We hope that soon, stem cells can be used in diabetes therapy via pancreatic beta cell replacement. Induced pluripotent stem cells are a kind of stem cell taken from an adult somatic cell by "stimulating" certain genes. These induced pluripotent stem cells may be a promising source of cell therapy. This study sought to produce isletlike clusters of insulin-producing cells taken from induced pluripotent stem cells. A human-induced pluripotent stem cell line was induced into isletlike clusters via a 4-step protocol, by adding insulin, transferrin, and selenium (ITS), N2, B27, fibroblast growth factor, and nicotinamide. During differentiation, expression of pancreatic β-cell genes was evaluated by reverse transcriptase-polymerase chain reaction; the morphologic changes of induced pluripotent stem cells toward isletlike clusters were observed by a light microscope. Dithizone staining was used to stain these isletlike clusters. Insulin produced by these clusters was evaluated by radio immunosorbent assay, and the secretion capacity was analyzed with a glucose challenge test. Differentiation was evaluated by analyzing the morphology, dithizone staining, real-time quantitative polymerase chain reaction, and immunocytochemistry. Gene expression of insulin, glucagon, PDX1, NGN3, PAX4, PAX6, NKX6.1, KIR6.2, and GLUT2 were documented by analyzing real-time quantitative polymerase chain reaction. Dithizone-stained cellular clusters were observed after 23 days. The isletlike clusters significantly produced insulin. The isletlike clusters could increase insulin secretion after a glucose challenge test. This work provides a model for studying the differentiation of human-induced pluripotent stem cells to insulin-producing cells.

Development of polymerase chain reaction-based diagnostic tests for detection of Malsoor virus & adenovirus isolated from Rousettus species of bats in Maharashtra, India.

PubMed

Shete, Anita M; Yadav, Pragya; Kumar, Vimal; Nikam, Tushar; Mehershahi, Kurosh; Kokate, Prasad; Patil, Deepak; Mourya, Devendra T

2017-01-01

Bats are recognized as important reservoirs for emerging infectious disease and some unknown viral diseases. Two novel viruses, Malsoor virus (family Bunyaviridae, genus, Phlebovirus) and a novel adenovirus (AdV) (family, Adenoviridae genus, Mastadenovirus), were identified from Rousettus bats in the Maharashtra State of India. This study was done to develop and optimize real time reverse transcription - polymerase chain reaction (RT-PCR) assays for Malsoor virus and real time and nested PCR for adenovirus from Rousettus bats. For rapid and accurate screening of Malsoor virus and adenovirus a nested polymerase chain reaction and TaqMan-based real-time PCR were developed. Highly conserved region of nucleoprotein gene of phleboviruses and polymerase gene sequence from the Indian bat AdV isolate polyprotein gene were selected respectively for diagnostic assay development of Malsoor virus and AdV. Sensitivity and specificity of assays were calculated and optimized assays were used to screen bat samples. Molecular diagnostic assays were developed for screening of Malsoor virus and AdV and those were found to be specific. Based on the experiments performed with different parameters, nested PCR was found to be more sensitive than real-time PCR; however, for rapid screening, real-time PCR can be used and further nested PCR can be used for final confirmation or in those laboratories where real-time facility/expertise is not existing. This study reports the development and optimization of nested RT-PCR and a TaqMan-based real-time PCR for Malsoor virus and AdV. The diagnostic assays can be used for rapid detection of these novel viruses to understand their prevalence among bat population.

Expression of Connexin 43 in Synovial Tissue of Patients With Rheumatoid Arthritis

PubMed Central

MATSUKI, Tomohiro; TSUCHIDA, Shinji; TERAUCHI, Ryu; ODA, Ryo; FUJIWARA, Hiroyoshi; MAZDA, Osam; KUBO, Toshikazu

2016-01-01

Objectives This study aims to identify the distribution and expression level of connexin 43 (Cx43) in synovial tissue in patients with rheumatoid arthritis (RA). Patients and methods The expression of Cx43 in synovial tissue from eight patients with RA (2 males, 6 females; mean age 59.5±2.7 years; range 52 to 71 years), five patients with osteoarthritis (2 males, 3 females; mean age 68.4±2.7 years; range 61 to 81 years), and one normal female subject (mean age 61 year) was analyzed by quantitative reverse transcriptase polymerase chain reaction and immunohistochemistry of tissue sections. Induction of Cx43 following stimulation of human RA synovial fibroblasts with tumor necrosis factor-alpha (TNF-a) cultures was examined by quantitative reverse transcriptase polymerase chain reaction. The effect of small interfering ribonucleic acid targeting Cx43 (siCx43) on the expression of TNF-a and interleukin-6 was examined using quantitative reverse transcriptase polymerase chain reaction and enzyme-linked immunosorbent assays. Results Connexin 43 was highly expressed in RA synovial tissue, which also expressed TNF-a, but was expressed lower in osteoarthritis and normal synovial tissue. Expression of Cx43 was markedly up-regulated in RA synovial fibroblasts after stimulation with TNF-a. The over-expression of pro- inflammatory cytokines was suppressed by transfection of siCx43. Conclusion This study shows that Cx43 is expressed in RA synovial tissue and that its expression is induced by stimulation with TNF-a. The expression of the pro-inflammatory cytokines was inhibited by transfection of siCx43. Cx43 may be a novel marker of inflammation in RA synovial tissue. PMID:29900991

First report of Toxoplasma gondii sporulated oocysts and Giardia duodenalis in commercial green-lipped mussels (Perna canaliculus) in New Zealand.

PubMed

Coupe, Alicia; Howe, Laryssa; Burrows, Elizabeth; Sine, Abigail; Pita, Anthony; Velathanthiri, Niluka; Vallée, Emilie; Hayman, David; Shapiro, Karen; Roe, Wendi D

2018-05-01

Pollution of marine ecosystems with the protozoan parasites Toxoplasma gondii, Cryptosporidium spp. and Giardia duodenalis can be studied using bivalve shellfish as biosentinels. Although evidence suggests that these parasites are present in New Zealand coastal waters, the extent of protozoal pollution has not been investigated. This study used optimised molecular methods to detect the presence of Cryptosporidium spp., G. duodenalis and T. gondii in commercially sourced green-lipped mussel (Perna canaliculus), an endemic species found throughout coastal New Zealand. A nested polymerase chain reaction was validated for detection of T. gondii DNA and applied to 104 commercially sourced mussels. Thirteen mussels were positive for T. gondii DNA with an estimated true prevalence of 16.4% using Bayesian statistics, and the presence of T. gondii in mussels was significantly associated with collection during the summer compared with that in the winter (P = 0.003). Consumption of contaminated shellfish may also pose a health risk for humans and marine wildlife. As only sporulated T. gondii oocysts can be infectious, a reverse transcriptase-polymerase chain reaction was used to confirm presence of a sporozoite-specific marker (SporoSAG), detected in four mussels. G. duodenalis assemblage B, known to be pathogenic in humans, was also discovered in 1% mussels, tested by polymerase chain reaction (n = 90). Cryptosporidium spp. was not detected in the sampled mussel haemolymph. Results suggest that New Zealand may have high levels of coastal contamination with T. gondii, particularly in summer months, and that naturally exposed mussels can ingest and retain sporulated oocysts, further establishing shellfish consumption as a health concern.

Thermally multiplexed polymerase chain reaction.

PubMed

Phaneuf, Christopher R; Pak, Nikita; Saunders, D Curtis; Holst, Gregory L; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L; Jerris, Robert; Forest, Craig R

2015-07-01

Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously-each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel.

Molecular diagnostics of periodontitis.

PubMed

Korona-Głowniak, Izabela; Siwiec, Radosław; Berger, Marcin; Malm, Anna; Szymańska, Jolanta

2017-01-28

The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host's health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization) come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR), real-time polymerase chain reaction (real-time PCR), 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), as well as terminal restriction fragment length polymorphism (TRFLP) and next generation sequencing (NGS). The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.

Direct and quantitative detection of HIV-1 RNA in human plasma with a branched DNA signal amplification assay.

PubMed

Urdea, M S; Wilber, J C; Yeghiazarian, T; Todd, J A; Kern, D G; Fong, S J; Besemer, D; Hoo, B; Sheridan, P J; Kokka, R

1993-11-01

To determine the relative effect of sample matrix on the quantitation of HIV RNA in plasma. Two HIV-positive specimens were diluted into five and 10 different HIV-negative plasma samples, respectively. Branched DNA signal amplification technology and reverse-transcriptase polymerase chain reaction were used to measure the viral load. In one sample the viral load by polymerase chain reaction ranged from undetectable to 1.9 x 10(5) copies/ml, and the branched DNA results ranged from 2.6 x 10(4) to 4.2 x 10(4) HIV RNA equivalent/ml. In the other sample the corresponding figures were 6.3 x 10(4) to 5.5 x 10(5) copies/ml and 5.7 x 10(4) to 7.5 x 10(4) HIV RNA equivalents/ml. In contrast to reverse-transcriptase polymerase chain reaction the branched DNA signal amplification assay does not require a separate extraction step or enzymatic amplification of the target. Therefore this measurement is less affected by the sample matrix and the signal generated is directly proportional to the viral load.

Identifying of meat species using polymerase chain reaction (PCR)

NASA Astrophysics Data System (ADS)

Foong, Chow Ming; Sani, Norrakiah Abdullah

2013-11-01

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

Using the rate of bacterial clearance determined by real-time polymerase chain reaction as a timely surrogate marker to evaluate the appropriateness of antibiotic usage in critical patients with Acinetobacter baumannii bacteremia.

PubMed

Chuang, Yu-Chung; Chang, Shan-Chwen; Wang, Wei-Kung

2012-08-01

Bacteremia caused by Acinetobacter baumannii is becoming more frequent among critically ill patients, and has been associated with high mortality and prolonged hospital stay. Multidrug resistance and delay in blood culture have been shown to be significant barriers to appropriate antibiotic treatment. Quantitative polymerase chain reaction assays were recently used to monitor bacterial loads; we hypothesized that the rate of bacterial clearance determined by quantitative polymerase chain reaction can be used as a timely surrogate marker to evaluate the appropriateness of antibiotic usage. Prospective observational study. University hospital and research laboratory. Patients with culture-proven A. baumannii bacteremia in the intensive care units were prospectively enrolled from April 2008 to February 2009. Plasmid Oxa-51/pCRII-TOPO, which contained a 431-bp fragment of the A. baumannii-specific Oxa-51 gene in a pCRII-TOPO vector, was used as the standard. Sequential bacterial DNA loads in the blood were measured by a quantitative polymerase chain reaction assay. We enrolled 51 patients with A. baumannii bacteremia, and examined 318 sequential whole blood samples. The initial mean bacterial load was 2.15 log copies/mL, and the rate of bacterial clearance was 0.088 log copies/mL/day. Multivariate linear regression using the generalized estimation equation approach revealed that the use of immunosuppressants was an independent predictor for slower bacterial clearance (coefficient, 1.116; p<.001), and appropriate antibiotic usage was an independent predictor for more rapid bacterial clearance (coefficient, -0.995; p<.001). Patients with a slower rate of bacterial clearance experienced higher in-hospital mortality (odds ratio, 2.323; p=.04) Immunosuppression and appropriate antibiotic usage were independent factors affecting the rate of clearance of A. baumannii bacteremia in critical patients. These findings highlight the importance of appropriate antibiotic usage and development of effective antibiotics against A. baumannii in an era of emerging antibiotic resistance. The rate of bacterial clearance could serve as a timely surrogate marker for evaluating the appropriateness of antibiotics.

Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections.

PubMed

Siqueira, José F; Rôças, Isabela N

2003-08-01

Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and persistent endodontic infections. This strengthens the assumption that this bacterial species is an endodontic pathogen associated with different forms of periradicular diseases. In contrast, A radicidentis was only occasionally detected in the patients examined. The role played by this species in endodontic infections remains to be clarified.

Numerical Study of Pressure Influence on Methane-Oxygen Laminar Counterflow Diffusion Flames

NASA Astrophysics Data System (ADS)

Iino, Kimio; Akamatsu, Fumiteru; Katsuki, Masashi

We carried out numerical studies on methane/oxygen diffusion flames of counter-flow configuration to elucidate the influence of pressure on flame structure, heat release rate and reaction mechanisms. The chemistry in gas-phase was based on GRI-Mech 3.0 database. The thickness of diffusion flame became thinner with increasing strain rate a , with its characteristic flame thickness varying inversely with √a, especially its relation became significant with increasing pressure. Flame temperature increased with increasing pressure. Enhanced H2O production reactions, especially chain terminal reactions for H2O production, were found to be important in determining the flame temperature at high pressures. The small reduction in the flame temperature with increasing strain rate at high pressures, compared to the atmospheric pressure, is caused by the capacitor effect of product dissociation. From QRPDs, the third body dependent reactions were enhanced in high pressure conditions, hence C2 pathway was enhanced.

Study on ultrasonic assisted mechanism of ring opening polymerization of octamethylcyclotetrasiloxane (D4)

NASA Astrophysics Data System (ADS)

Ling, Huaxu; Yu, Xiaoxiang; Wang, Shifan; Wang, Xiaohui; Dong, Liming

2018-06-01

In this study, the linear high molecular weight polydimethylsiloxanes(PDMS) were synthesized by ultrasonic-assisted bulk ring-opening polymerization method, with D4 as the raw material, hexamethyldisilane(HMDS) as the capping agent and concentrated sulfuric acid as the catalyst. The mechanism of ring-opening polymerization assisted by ultrasound is discussed in detail, through the ultrasonic time, ultrasonic intensity and reaction temperature and other factors. The results showed that D4 ring-opening polymerization and PDMS depolymerization was a pair of reversible equilibrium reaction. Due to the influence of steric hindrance and viscosity, the ultrasonic action appears as the driving effect of D4 ring opening at the initial reaction, and the chain exchange or depolymerization of PDMS at the end of the reaction. Therefore, ultrasonic irradiation is believed to facilitate the rapid synthesis of high molecular weight PDMS at high monomer concentrations.

Prevalence of human immunodeficiency virus type 1 p24 antigen in U.S. blood donors--an assessment of the efficacy of testing in donor screening. The HIV-Antigen Study Group.

PubMed

Alter, H J; Epstein, J S; Swenson, S G; VanRaden, M J; Ward, J W; Kaslow, R A; Menitove, J E; Klein, H G; Sandler, S G; Sayers, M H

1990-11-08

We performed a multicenter study in 1989 to determine whether screening whole-blood donors for human immunodeficiency virus type 1 (HIV-1) p24 antigen would improve transfusion safety by identifying carriers of the virus who are seronegative for HIV-1 antibody. More than 500,000 donations were tested at 13 U.S. blood centers with test kits from two manufacturers. Units found repeatedly reactive were retested in a central laboratory; if the results were positive, they were confirmed by a neutralization assay. A subgroup of units was also tested for HIV-1 by the polymerase chain reaction. Selected donors confirmed or not confirmed as having p24 antigen were contacted for follow-up interviews to identify risk factors and undergo retesting for HIV-1 markers. Positive tests for p24 antigen were confirmed by neutralization in five donors (0.001 percent of all donations tested), all of whom were also positive for HIV-1 antibody and HIV-1 by polymerase chain reaction. Three of the antigen-positive donors had other markers of infectious disease that would have resulted in the exclusion of their blood; two had risk factors for HIV-1 that should have led to self-exclusion. Of 220 blood units with repeatedly reactive p24 antigen whose presence could not be confirmed by neutralization (0.04 percent of the donations studied), none were positive for HIV-1 antibody, HIV-1 by polymerase chain reaction (120 units tested), or virus culture (76 units tested)--attesting to the specificity of confirmatory neutralization. The finding that no donation studied was positive for p24 antigen and negative for HIV-1 antibody suggests that screening donors for p24 antigen with tests of the current level of sensitivity would not add substantially to the safety of the U.S. blood supply.

Precision synthesis of functional materials via RAFT polymerization and click-type chemical reactions

NASA Astrophysics Data System (ADS)

Flores, Joel Diez

2011-12-01

The need to tailor polymeric architectures with specific physico-chemical properties via the simplest, cleanest, and most efficient synthetic route possible has become the ultimate goal in polymer synthesis. Recent progress in macromolecular science, such as the discoveries of controlled/"living" free radical polymerization (CRP) methods, has brought about synthetic capabilities to prepare (co)polymers with advanced topologies, predetermined molecular weights, narrow molecular weight distributions, and precisely located functional groups. In addition, the establishment of click chemistry has redefined the selected few highly efficient chemical reactions that become highly useful in post-polymerization modification strategies. Hence, the ability to make well-defined topologies afforded by controlled polymerization techniques and the facile incorporation of functionalities along the chain via click-type reactions have yielded complex architectures, allowing the investigation of physical phenomena which otherwise could not be studied with systems prepared via conventional methods. The overarching theme of the research work described in this dissertation is the fusion of the excellent attributes of reversible addition-fragmentation chain transfer (RAFT) polymerization method, which is one of the CRP techniques, and click-type chemical reactions in the precision of synthesis of advanced functional materials. Chapter IV is divided into three sections. In Section I, the direct RAFT homopolymerization of 2-(acryloyloxy)ethyl isocyanate (AOI) and subsequent post-polymerization modifications are described. The polymerization conditions were optimized in terms of the choice of RAFT chain transfer agent (CTA), polymerization temperature and the reaction medium. Direct RAFT polymerization of AOI requires a neutral CTA, and relatively low reaction temperature to yield AOI homopolymers with low polydispersities. Efficient side-chain functionalization of PAOI homopolymers was achieved via reaction with model amine, thiol and alcohol compounds yielding urea, thiourethane and urethane derivatives, respectively. Reactions with amines and thiols (in the presence of base) were rapid, quantitative and efficient. However, the reaction with alcohols catalyzed by dibutyltin dilaurate (DBTDL) was relatively slow but proceeded to completion. Selective reaction pathways for the addition of difunctional ethanolamine and mercaptoethanol were also investigated. A related strategy is described in Section II wherein a hydroxyl-containing diblock copolymer precursor was transformed into a library of functional copolymers via two sequential post-polymerization modification reactions. A diblock copolymer scaffold, poly[(N,N-dimethylacrylamide)-b-( N-(2-hydroxyethyl)acrylamide] (PDMA-b-PHEA) was first prepared. The hydroxyl groups of the HEA block were then reacted with 2-(acryloyloxy)ethylisocyanate (AOI) and allylisocyanate (AI) resulting in acrylate- and allyl-functionalized copolymer precursors, respectively. The efficiencies of Michael-type and free radical thiol addition reactions were investigated using selected thiols having alkyl, aryl, hydroxyl, carboxylic acid, amine and amino acid functionalities. The steps of RAFT polymerization, isocyanate-hydroxyl coupling and thiol-ene addition are accomplished under mild conditions, thus offering facile and modular routes to synthesize functional copolymers. The synthesis and solution studies of pH- and salt-responsive triblock copolymer are described in Section III. This system is capable of forming self-locked micellar structures which may be controlled by changing solution pH as well as ionic strength. A triblock copolymer containing a permanently hydrophilic poly(N,N-dimethylacrylamide) (PDMA) outer block, a salt-sensitive zwitterionic poly(3[2-(N-methylacrylamido)ethyl dimethylammonio]propanesulfonate) (PMAEDAPS) middle block and a pH-responsive 3-acrylamido-3-methylbutanoic acid (PAMBA) core block was synthesized using aqueous RAFT polymerization. A facile formation of "self-locking" shell cross-linked micelles is achieved by changing solution pH and salt concentration. The reversible "self-locking" is attained from the interactions of zwitterionic groups in the middle block that constitutes the shell of the micelles. The structure slowly dissociates into unimers in 2-3 days at pH above the pKa of the PAMBA block.

A Technical Approach to Marking Explosives, Propellants, and Precursor Chemicals

DTIC Science & Technology

1998-08-01

polymerase chain reaction (PCR) methods whereby small strands are cut and analyzed under specified temperature mediated enzymatic /molecular reactions (4...such as these are often overlooked. Several other companies have been investigating other methods including immunoassay techniques, microencapsulated

Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

PubMed

Brzezinski, Jennifer L

2006-01-01

The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

Bi-parentally inherited species-specific markers identify hybridization between rainbow trout and cutthroat trout subspecies

USGS Publications Warehouse

Ostberg, C.O.; Rodriguez, R.J.

2004-01-01

Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.

Flow-through polymerase chain reaction inside a seamless 3D helical microreactor fabricated utilizing a silicone tube and a paraffin mold.

PubMed

Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon

2015-03-07

We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).

[Identification of human pathogenic variola and monkeypox viruses by real-time polymerase chain reaction].

PubMed

Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N

2009-01-01

A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.

Molecular implementation of molecular shift register memories

NASA Technical Reports Server (NTRS)

Beratan, David N. (Inventor); Onuchic, Jose N. (Inventor)

1991-01-01

An electronic shift register memory (20) at the molecular level is described. The memory elements are based on a chain of electron transfer molecules (22) and the information is shifted by photoinduced (26) electron transfer reactions. Thus, multi-step sequences of charge transfer reactions are used to move charge with high efficiency down a molecular chain. The device integrates compositions of the invention onto a VLSI substrate (36), providing an example of a molecular electronic device which may be fabricated. Three energy level schemes, molecular implementation of these schemes, optical excitation strategies, charge amplification strategies, and error correction strategies are described.

Identification of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) by using polymerase chain reaction amplification and restriction analysis of the mitochondrial cytochrome b gene.

PubMed

Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R

1998-04-01

Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.

Target effects in isobaric yield ratio differences between projectile fragmentation reactions

NASA Astrophysics Data System (ADS)

Ma, Chun-Wang; Zhang, Yan-Li; Qiao, Chun-Yuan; Wang, Shan-Shan

2015-01-01

Background: The isobaric yield ratio difference (IBD) between reactions is know to be sensitive to the density difference between projectiles in heavy-ion collisions around the Fermi energy. Purpose: The target effects in the isobaric yield ratio (IYR) and the IBD results have been studied. Methods: The amount of isotopes in the 140 A MeV 48 ,40Ca +181Ta /9Be and 58 ,64Ni +181Ta /9Be reactions have been previously measured with high accuracy. The IYR and IBD results have been obtained from these reactions to study the effects of the light 9Be and heavy 181Ta targets. A ratio (rΔ μ) between the IBD results for the reactions with Ta and Be targets is defined to quantitatively show the target dependence of the IBD results. Results The IYRs for reactions with symmetric projectiles are more easily affected than those for reactions with neutron-rich projectiles. The IBD results are suppressed by using the 181Ta target to different degrees. Conclusions: The IYR and IBD results are influenced by the target used. The IBD for the I =1 isobaric chain is suggested as a probe to study the difference between the neutron and proton densities of the reaction systems.

Silicone derivatives for contact lenses: functionalization, chemical characterization, and cell compatibility assessment.

PubMed

Migonney, V; Lacroix, M D; Ratner, B D; Jozefowicz, M

1995-01-01

Epoxy ring-opening functionalization of polymers at random sites along chains with various chemical groups has been demonstrated. The reaction is performed in an aqueous solution under mild conditions in order to minimize degradation of the macromolecular chains. Silicone lenses made of copolymers with epoxy side chains were functionalized with 4-hydroxybutyric acid, sodium salt. The carboxylated silicone derivatives were characterized by ESCA and radiotracers. A mean value of 30% reaction yield was concluded, based upon data from both methods; nevertheless, the latter can be improved up to 50% or more if the conditions of preparation of the epoxydized silicone lenses are optimized. Derivatized silicones were coated in the wells of culture plates to evaluate the cell compatibility of these new polymers with a fibroblast cell line (McCoy's). No cellular toxicity was observed.

Donor-π-Acceptor Polymer with Alternating Triarylborane and Triphenylamine Moieties.

PubMed

Li, Haiyan; Jäkle, Frieder

2010-05-12

A luminescent main chain donor-π-acceptor-type polymer (4) was prepared via organometallic polycondensation reaction followed by post modification. With both electron-rich amine and electron-deficient borane moieties embedded in the main chain, 4 exhibits an interesting ambipolar character: it can be reduced and oxidized electrochemically at moderate potentials and shows a strong solvatochromic effect in the emission spectra. Complexation studies show that 4 selectively binds to fluoride and cyanide; quantitative titration with cyanide reveals a two-step binding process. Copyright © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Estimates of production and structure of nuclei with Z = 119

NASA Astrophysics Data System (ADS)

Adamian, G. G.; Antonenko, N. V.; Lenske, H.

2018-02-01

The comparative analysis of the hot fusion reactions 50Ti +247-249Bk and 51V +246-248Cm for synthesis of element 119 is made with the dinuclear system model and the prediction of nuclear properties of the microscopic-macroscopic approach, where the closed proton shell at Z ≥ 120 is expected. The quasiparticle structures of nuclei in the α-decay chain of 295119 and a possible spread of alpha energies are studied. The calculated values of Qα are compared with available experimental data. The termination of the α-decay chain of 295119 is revealed.

A structural and mechanistic study of π-clamp-mediated cysteine perfluoroarylation.

PubMed

Dai, Peng; Williams, Jonathan K; Zhang, Chi; Welborn, Matthew; Shepherd, James J; Zhu, Tianyu; Van Voorhis, Troy; Hong, Mei; Pentelute, Bradley L

2017-08-11

Natural enzymes use local environments to tune the reactivity of amino acid side chains. In searching for small peptides with similar properties, we discovered a four-residue π-clamp motif (Phe-Cys-Pro-Phe) for regio- and chemoselective arylation of cysteine in ribosomally produced proteins. Here we report mutational, computational, and structural findings directed toward elucidating the molecular factors that drive π-clamp-mediated arylation. We show the significance of a trans conformation prolyl amide bond for the π-clamp reactivity. The π-clamp cysteine arylation reaction enthalpy of activation (ΔH ‡ ) is significantly lower than a non-π-clamp cysteine. Solid-state NMR chemical shifts indicate the prolyl amide bond in the π-clamp motif adopts a 1:1 ratio of the cis and trans conformation, while in the reaction product Pro3 was exclusively in trans. In two structural models of the perfluoroarylated product, distinct interactions at 4.7 Å between Phe1 side chain and perfluoroaryl electrophile moiety are observed. Further, solution 19 F NMR and isothermal titration calorimetry measurements suggest interactions between hydrophobic side chains in a π-clamp mutant and the perfluoroaryl probe. These studies led us to design a π-clamp mutant with an 85-fold rate enhancement. These findings will guide us toward the discovery of small reactive peptides to facilitate abiotic chemistry in water.

Highly efficient reversible addition-fragmentation chain-transfer polymerization in ethanol/water via flow chemistry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ye, Piaoran; Cao, Peng -Fei; Su, Zhe

Here, utilization of a flow reactor under high pressure allows highly efficient polymer synthesis via reversible addition–fragmentation chain-transfer (RAFT) polymerization in an aqueous system. Compared with the batch reaction, the flow reactor allows the RAFT polymerization to be performed in a high-efficiency manner at the same temperature. The adjustable pressure of the system allows further elevation of the reaction temperature and hence faster polymerization. Other reaction parameters, such as flow rate and initiator concentration, were also well studied to tune the monomer conversion and the molar mass dispersity (Ð) of the obtained polymers. Gel permeation chromatography, nuclear magnetic resonance (NMR),more » and Fourier transform infrared spectroscopies (FTIR) were utilized to monitor the polymerization process. With the initiator concentration of 0.15 mmol L –1, polymerization of poly(ethylene glycol) methyl ethermethacrylate with monomer conversion of 52% at 100 °C under 73 bar can be achieved within 40 min with narrow molar mass dispersity (D) Ð (<1.25). The strategy developed here provides a method to produce well-defined polymers via RAFT polymerization with high efficiency in a continuous manner.« less

Impact of Polymer Electrolyte Membrane Degradation Products on Oxygen Reduction Reaction Activity for Platinum Electrocatalysts

DOE PAGES

Christ, J. M.; Neyerlin, K. C.; Wang, H.; ...

2014-10-30

The impact of model membrane degradation compounds on the relevant electrochemical parameters for the oxygen reduction reaction (i.e. electrochemical surface area and catalytic activity), was studied for both polycrystalline Pt and carbon supported Pt electrocatalysts. Model compounds, representing previously published, experimentally determined polymer electrolyte membrane degradation products, were in the form of perfluorinated organic acids that contained combinations of carboxylic and/or sulfonic acid functionality. Perfluorinated carboxylic acids of carbon chain length C1 – C6 were found to have an impact on electrochemical surface area (ECA). The longest chain length acid also hindered the observed oxygen reduction reaction (ORR) performance, resultingmore » in a 17% loss in kinetic current (determined at 0.9 V). Model compounds containing sulfonic acid functional groups alone did not show an effect on Pt ECA or ORR activity. Lastly, greater than a 44% loss in ORR activity at 0.9V was observed for diacid model compounds DA-Naf (perfluoro(2-methyl-3-oxa-5-sulfonic pentanoic) acid) and DA-3M (perfluoro(4-sulfonic butanoic) acid), which contained both sulfonic and carboxylic acid functionalities.« less

Development of new microsatellite loci and multiplex reactions for muskellunge (Esox masquinongy)

USGS Publications Warehouse

Sloss, Brian L.; Franckowiak, R.P.; Murphy, E.L.

2008-01-01

The muskellunge (Esox masquinongy) is a valued fisheries species throughout its native range. Numerous studies have documented performance and phenotypic differences among muskellunge populations, but genetic markers for assessment have been lacking. We characterized 14 microsatellite loci and developed five multiplex polymerase chain reactions. Successful amplification of northern pike (Esox lucius) was observed for seven loci. These microsatellites will be useful for analysing population structure, performance characteristics of propagated strains, and helping to develop and monitor hatchery management guidelines for muskellunge. ?? 2008 Blackwell Publishing Ltd.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lebrilla, C.B.; Schulze, C.; Schwarz, H.

The gas-phase reaction of bare Fe/sup +/ atoms with linear alkyl nitriles generates end-on complexes which, depending on geometrical constraints, specifically interact with remote C-H bonds. Based on chain length effect studies and the investigation of labeled precursors, a mechanism is suggested which accounts for the chemospecificity observed for the loss of H/sub 2/ and C/sub 2/H/sub 4/ from RCN/Fe/sup +/ complexes. This mechanism does not follow the analogous reaction of Fe/sup +/ with alkenes and alkynes but involves an initial C-H insertion of the remote CH bonds followed by a C-C insertion.

Chromophore absorbance change quantification in tissue during low-level light therapy

NASA Astrophysics Data System (ADS)

Huynh, Daniel; Chung, Christine; Qian, Li; Lilge, Lothar

2012-03-01

Low Level Light Therapy (LLLT) has been implicated to stimulate tissue, promoting healing and reducing pain. One of the potential pathways stimulated by LLLT relates to the electron transport chain, where photon quantum energy can induce a change in the biochemical reactions within the cell. The aim of this study is to assess the feasibility to exploit light additionally as a diagnostic tool to determine tissue physiological states, particularly in quantifying the changes in redox states of Cytochrome C as a result of induced LLLT biochemical reactions.

Diagnostic devices for isothermal nucleic acid amplification.

PubMed

Chang, Chia-Chen; Chen, Chien-Cheng; Wei, Shih-Chung; Lu, Hui-Hsin; Liang, Yang-Hung; Lin, Chii-Wann

2012-01-01

Since the development of the polymerase chain reaction (PCR) technique, genomic information has been retrievable from lesser amounts of DNA than previously possible. PCR-based amplifications require high-precision instruments to perform temperature cycling reactions; further, they are cumbersome for routine clinical use. However, the use of isothermal approaches can eliminate many complications associated with thermocycling. The application of diagnostic devices for isothermal DNA amplification has recently been studied extensively. In this paper, we describe the basic concepts of several isothermal amplification approaches and review recent progress in diagnostic device development.

Diagnostic Devices for Isothermal Nucleic Acid Amplification

PubMed Central

Chang, Chia-Chen; Chen, Chien-Cheng; Wei, Shih-Chung; Lu, Hui-Hsin; Liang, Yang-Hung; Lin, Chii-Wann

2012-01-01

Since the development of the polymerase chain reaction (PCR) technique, genomic information has been retrievable from lesser amounts of DNA than previously possible. PCR-based amplifications require high-precision instruments to perform temperature cycling reactions; further, they are cumbersome for routine clinical use. However, the use of isothermal approaches can eliminate many complications associated with thermocycling. The application of diagnostic devices for isothermal DNA amplification has recently been studied extensively. In this paper, we describe the basic concepts of several isothermal amplification approaches and review recent progress in diagnostic device development. PMID:22969402

Experimental study of electrochemical fluorination of trichloroethylene

NASA Technical Reports Server (NTRS)

Polisena, C.; Liu, C. C.; Savinell, R. F.

1982-01-01

The electrochemical fluorination of trichloroethylene in anhydrous hydrogen fluoride at 0 C and at constant cell potential was investigated. A microprocessor-aided electrochemical fluorination reactor system that yields highly reproducible results was utilized. The following major two-carbon-chain products were observed: CHCl2-CCl2F, CHCl2-CClF2, CHClF-CCl2F, and CCl2F-CClF2. The first step in the reaction sequence was determined to be fluorine addition to the double bond, followed by replacement of first hydrogen and then chlorine by fluorine. Polymerization reactions yielded higher molecular weight or possible ring-type chlorofluorohydrocarbons. A comparison of the reaction products of electrochemical and chemical fluorinations of trichloroethylene is also discussed.

A Case-control Study on the Relationship between Mycoplasma genitalium Infection in Women with Normal Pregnancy and Spontaneous Abortion using Polymerase Chain Reaction.

PubMed

Ramazanzadeh, Rashid; Khodabandehloo, Mazaher; Farhadifar, Fariba; Rouhi, Samaneh; Ahmadi, Amjad; Menbari, Shaho; Fallahi, Fariba; Mirnejad, Reza

2016-10-01

Mycoplasma genitalium infections are suggested as causes of a number of pathological outcomes in pregnant women. The aim of this study was to evaluate the frequency of M. genitalium infections among pregnant women and its association with spontaneous abortion. In this case-control study we included 109 women with spontaneous abortion with a gestational age of 10-20 weeks (patients), and 109 women with normal pregnancy with a gestational age of 20-37 weeks (controls) in Sanandaj, Iran. Using specific primers and extracted DNA from endocervical swabs, a polymerase chain reaction was conducted for the detection of M. genitalium infection in both groups. The frequency of M. genitalium infection in patient and control groups was one (0.91%) and three (2.75%), respectively. In both control and patient groups using Fisher test, no association between mycoplasma infection and spontaneous abortion was seen. M. genitalium may be positive in the genital tract of some pregnant women but was not associated with spontaneous abortion. Further powerful studies with larger sample sizes are needed for the determination of a possible role of M. genitalium in pregnancy outcomes and spontaneous abortion.

Experimental study of precisely selected evaporation chains in the decay of excited 25Mg

NASA Astrophysics Data System (ADS)

Camaiani, A.; Casini, G.; Morelli, L.; Barlini, S.; Piantelli, S.; Baiocco, G.; Bini, M.; Bruno, M.; Buccola, A.; Cinausero, M.; Cicerchia, M.; D'Agostino, M.; Degelier, M.; Fabris, D.; Frosin, C.; Gramegna, F.; Gulminelli, F.; Mantovani, G.; Marchi, T.; Olmi, A.; Ottanelli, P.; Pasquali, G.; Pastore, G.; Valdré, S.; Verde, G.

2018-04-01

The reaction 12C+13C at 95 MeV bombarding energy is studied using the Garfield + Ring Counter apparatus located at the INFN Laboratori Nazionali di Legnaro. In this paper we want to investigate the de-excitation of 25Mg aiming both at a new stringent test of the statistical description of nuclear decay and a direct comparison with the decay of the system 24Mg formed through 12C+12C reactions previously studied. Thanks to the large acceptance of the detector and to its good fragment identification capabilities, we could apply stringent selections on fusion-evaporation events, requiring their completeness in charge. The main decay features of the evaporation residues and of the emitted light particles are overall well described by a pure statistical model; however, as for the case of the previously studied 24Mg, we observed some deviations in the branching ratios, in particular for those chains involving only the evaporation of α particles. From this point of view the behavior of the 24Mg and 25Mg decay cases appear to be rather similar. An attempt to obtain a full mass balance even without neutron detection is also discussed.

Novel odd/even effect of alkylene chain length on the photopolymerizability of organogelators.

PubMed

Aoki, Ken'ichi; Kudo, Masabumi; Tamaoki, Nobuyuki

2004-10-28

[reaction: see text] Starting from diactylene diacarboxylic acids, we have synthesized a series of photopolymerizable organogelators that possess simple amide structures, different alkylene chain lengths, and either optically active or racemic 3,7-dimethyl-1-octylamine units. The alkylene chain length of these compounds exhibits a prominent odd/even effect with respect to the photopolymerization in the gel state and is accompanied by a stereostructural effect on the gelation ability.

Multi angle laser light scattering evaluation of field exposed thermoplastic photovoltaic encapsulant materials

DOE PAGES

Kempe, Michael D.; Miller, David C.; Wohlgemuth, John H.; ...

2016-01-08

As creep of polymeric materials is potentially a safety concern for photovoltaic modules, the potential for module creep has become a significant topic of discussion in the development of IEC 61730 and IEC 61215. To investigate the possibility of creep, modules were constructed, using several thermoplastic encapsulant materials, into thin-film mock modules and deployed in Mesa, Arizona. The materials examined included poly(ethylene)-co-vinyl acetate (EVA, including formulations both cross-linked and with no curing agent), polyethylene/polyoctene copolymer (PO), poly(dimethylsiloxane) (PDMS), polyvinyl butyral (PVB), and thermoplastic polyurethane (TPU). The absence of creep in this experiment is attributable to several factors of which themore » most notable one was the unexpected cross-linking of an EVA formulation without a cross-linking agent. It was also found that some materials experienced both chain scission and cross-linking reactions, sometimes with a significant dependence on location within a module. The TPU and EVA samples were found to degrade with cross-linking reactions dominating over chain scission. In contrast, the PO materials degraded with chain scission dominating over cross-linking reactions. Furthermore, we found no significant indications that viscous creep is likely to occur in fielded modules capable of passing the qualification tests, we note that one should consider how a polymer degrades, chain scission or cross-linking, in assessing the suitability of a thermoplastic polymer in terrestrial photovoltaic applications.« less

Kinetic studies on the oxidation of oxyhemoglobin by biologically active iron thiosemicarbazone complexes: relevance to iron-chelator-induced methemoglobinemia.

PubMed

Basha, Maram T; Rodríguez, Carlos; Richardson, Des R; Martínez, Manuel; Bernhardt, Paul V

2014-03-01

The oxidation of oxyhemoglobin to methemoglobin has been found to be facilitated by low molecular weight iron(III) thiosemicarbazone complexes. This deleterious reaction, which produces hemoglobin protein units unable to bind dioxygen and occurs during the administration of iron chelators such as the well-known 3-aminopyridine-2-pyridinecarbaldehyde thiosemicarbazone (3-AP; Triapine), has been observed in the reaction with Fe(III) complexes of some members of the 3-AP structurally-related thiosemicarbazone ligands derived from di-2-pyridyl ketone (HDpxxT series). We have studied the kinetics of this oxidation reaction in vitro using human hemoglobin and found that the reaction proceeds with two distinct time-resolved steps. These have been associated with sequential oxidation of the two different oxyheme cofactors in the α and β protein chains. Unexpected steric and hydrogen-bonding effects on the Fe(III) complexes appear to be the responsible for the observed differences in the reaction rate across the series of HDpxxT ligand complexes used in this study.

Optimal Conditions for the Asymmetric Polymerase Chain Reaction for Detecting Food Pathogenic Bacteria Using a Personal SPR Sensor.

PubMed

Nagai, Haruka; Tomioka, Kanji; Okumura, Shiro

2018-06-26

We have been developing quick and simple system for detecting food-poisoning bacteria using a combination of an asymmetric PCR and a portable surface plasmon resonance (SPR) sensor. The system would be suitable for point-of-care detection of food-poisoning bacteria in the field of food industry. In this study, we established a novel method for quantifying the amplified forward (F) and reverse (R) chains of Staphylococcus aureus separately by high-performance liquid chromatography (HPLC). The concentration of single-stranded DNA amplicon excessively amplified, which is crucial for the system, could be calculated as the difference between those of the F- and R-chains. For the R-chain, a correction based on the F-chain concentration in the sample was used to obtain a more accurate value, because the determination of the R-chain concentration was affected by that of the coexisting F-chain. The concentration values were also determined by fluorescence imaging for electrophoresis gels of amplicons with FITC- or Cy5-conjugated primers, and they were in good agreement with the values by the HPLC. The measured concentration of the single-strand F-chain correlated well with the value of the SPR response against the probe that was a complementary sequence of the F-chain, immobilized on the sensor chip of the SPR sensor.

Shock tube measurements of specific reaction rates in branched chain CH4-CO-O2 system

NASA Technical Reports Server (NTRS)

Brabbs, T. A.; Brokaw, R. S.

1974-01-01

Rate constants of two elementary bimolecular reactions involved in the oxidation of methane were determined by monitoring the exponential growth of CO flame band emission behind incident shocks in three suitably chosen gas mixtures.

Structural modulation of silver complexes and their distinctive catalytic properties.

PubMed

Zhao, Yue; Chen, Kai; Fan, Jian; Okamura, Taka-aki; Lu, Yi; Luo, Li; Sun, Wei-Yin

2014-02-07

A family of silver(I) complexes, [Ag2(L)2(OOCCF3)2] (1), [Ag(L)0.5(OOCCF3)] (2), [Ag(L)2](OOCCF3)(H2O)2 (3), was obtained by reactions of 4,4'-di(2-oxazolinyl)biphenyl (L) and AgOOCCF3 in different reaction media. Compound 1 has a 1D chain structure with alternative connections between the Ag(I) and L ligand. When the crystal nucleation inductor, pyrazine, was added into the reaction system, complex 2 was isolated with no pyrazine observed in its structure. In 2, the 1D inorganic chains formed by Ag(I) cations and OOCCF3(-) anions were connected by the L ligand to produce a 2D network. When a different inductor, imidazole, was added into the reaction system, 3 with (4,4) topology was synthesized, and again no imidazole was found in 3. When 1-3 were used as catalysts for cycloaddition reactions between imino esters and methyl acrylate, 3 affords the highest yield, in which the particular size of the channels in 3 led to its selective catalytic performance.

Connecting the "Hot Fusion Island" to the Nuclear Mainland: Search for 283,284,285Fl Decay Chains

NASA Astrophysics Data System (ADS)

Rykaczewski, K. P.; Utyonkov, V. K.; Brewer, N. T.; Grzywacz, R. K.; Miernik, K.; Roberto, J. B.; Oganessian, Yu. Ts.; Polyakov, A. N.; Tsyganov, Yu. S.; Voinov, A. A.; Abdullin, F. Sh.; Dmitriev, S. N.; Itkis, M. G.; Sabelnikov, A. V.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Subbotin, V. G.; Sukhov, A. M.; Vostokin, G. K.; Hamilton, J. H.; Henderson, R. A.; Stoyer, M. A.

The program of studies on superheavy nuclei to identify new isotopes anchoring the decay chains from the Hot Fusion Island to the Nuclear Mainland has been started at the Dubna Gas Filled Recoil Separator (DGFRS, JINR Dubna) in collaboration between Russia, US and Poland. These studies are performed with new detection and digital data acquisition system developed at ORNL (Oak Ridge) and UT (Knoxville). The evidence for fast fission of the new isotope 284Fl is presented. The low cross section for the 3n channel of 239Pu + 48Ca reaction is attributed to lower than expected fission barriers in 287-284Fl.

Versatile fusion source integrator AFSI for fast ion and neutron studies in fusion devices

NASA Astrophysics Data System (ADS)

Sirén, Paula; Varje, Jari; Äkäslompolo, Simppa; Asunta, Otto; Giroud, Carine; Kurki-Suonio, Taina; Weisen, Henri; JET Contributors, The

2018-01-01

ASCOT Fusion Source Integrator AFSI, an efficient tool for calculating fusion reaction rates and characterizing the fusion products, based on arbitrary reactant distributions, has been developed and is reported in this paper. Calculation of reactor-relevant D-D, D-T and D-3He fusion reactions has been implemented based on the Bosch-Hale fusion cross sections. The reactions can be calculated between arbitrary particle populations, including Maxwellian thermal particles and minority energetic particles. Reaction rate profiles, energy spectra and full 4D phase space distributions can be calculated for the non-isotropic reaction products. The code is especially suitable for integrated modelling in self-consistent plasma physics simulations as well as in the Serpent neutronics calculation chain. Validation of the model has been performed for neutron measurements at the JET tokamak and the code has been applied to predictive simulations in ITER.

Photoisomerization of alfa calcidol by a sensitized quantum chain reaction.

PubMed

Estruch, Gastón A; Aramendía, Pedro F

2012-01-01

The production of vitamin D3 is a pharmaceutically relevant process, producing high added-value products. Precursors are extracts from vegetal origin but bearing mainly an E geometry in the 5,6 double bond. The synthesis of vitamin D3 (5-E-α-calcidol) with the correct Z stereochemistry in the 5,6 double bond from the E isomer using anthracene and triethylamine (TEA) as the sensitizer system was studied from the kinetic and mechanistic point of view. The sensitized isomerization of E-calcidol by irradiation of anthracene takes place only in deoxygenated solution and yields the Z isomer in ca 5% yield in the photostationary state. When TEA is added to the system, the E-Z reaction is not inhibited by oxygen any more, the quantum yield of photoisomerization to the Z isomer grows linearly with the concentration of E-calcidol, while conversions higher than 95% to the Z isomer are reached in the photostationary state and E-Z quantum yields as high as 45 at [E-calcidol] = 25 mM are reached. If TEA is replaced by 1,4-diazabicyclo[2.2.2]octane, the reaction rate drops to one-third at the same amine concentration. The observations can be explained by a quantum chain reaction mechanism. The high conversion achieved eliminates the need of isomer separation. © 2011 Wiley Periodicals, Inc. Photochemistry and Photobiology © 2011 The American Society of Photobiology.

Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

PubMed

Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2014-09-09

Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

Is the 'Bromine Explosion' generated from the reaction BrO HO2 alone?

NASA Astrophysics Data System (ADS)

Behnke, Wolfgang; Zetzsch, Cornelius

2010-05-01

We observed bromine explosions (a fast production of atomic Br and Cl under tropospheric conditions) in various smog chamber experiments in Teflon bags at room temperature at a relative humidity of about 80% in the presence of NaCl/NaBr-aerosol, simulated sunlight and ozone (200 - 400 ppb). Time profiles of ozone and hydrocarbons (HCs: n-butane, 2,2-dimethylbutane, tetramethylbutane and toluene, initially about 2 ppb each) were monitored to determine concentrations and source strengths of OH radicals, atomic Cl and Br and the corresponding time profiles of BrCl and Br2 as their photolytic precursors. The number and size of aerosols are measured as well as their chemical composition (Br-, Cl- and oxalic acid). Full records of raw data from the smog chamber runs are available at www.eurochamp.org for potential users. Chemical box model calculations deliver concentrations of various intermediates, such as aldehydes, HO2 and RO2 radicals and the inorganic halogen compounds ClO, BrO, HOCl and HOBr, where HOBr from O3 + Br- => BrO- + O2 in the aqueous/adsorbed phase induces the following gas-phase/ heterogeneous chain reaction Br + O3 => BrO + O2(1) BrO + HO2 => HOBr + O2(2a) HOBr + (Aerosol) => HOBrad(3) Surface-adsorbed HOBr reacts with Br- or Cl- to produce Br2 or BrCl, both of which are released and photolysed. Formation of Br2 should prevail up to Cl-/Br- -ratios of about 104 (Fickert, S., J.W. Adams, J.N. Crowley, J. Geophys. Res., D104, 23719-23727, 1999). A maximum of this ratio is reached about 30 minutes after the beginning and decreases during the next hours - probably by reaction of Br2 with oxalate and absorption of HBr, formed from the reaction of Br with aldehydes. Parallel to chain reaction (1)-(3) a chain reaction replacing Br by Cl seems possible but can not be realized, since the main sink of atomic Cl is its reaction with hydrocarbons - leading to chain termination - in contrast to atomic Br (ratio of rates: kCl[O3]/kCl[HC] ~ 0.1; kBr[O3]/kBr[toluene] ~ 100). Formation of aldehydes (R-CHO) interferes with the chain reaction (1) - (3) markedly, since kBr[O3] ≈kBr[R-CHO]. The chain reaction is limited by availability of ozone (degradation of HCs by atomic Cl stops completely with vanishing ozone), of HO2 (HCs are required to form HO2) and of aerosol. The central question is: will sufficient HO2 be formed from degradation of HCs to explain the magnitude of the formed Br2 and BrCl in our experiments? We found that the formation of HO2 should be by a factor of 2-4 larger to explain the formation of Br2 and BrCl. Which other sources for the formation of HOBr besides reaction (2a) are then available? The rate of CH3O2with BrO is 25% of that with HO2 (Enami, S.; Yamanaka, T.; Nakayama, T.; Hashimoto, S.; Kawasaki, M.; Shallcross, D.E.; Nakano, Y.; Ishiwata, T., J. Phys. Chem. A, 11, 3342 - 3348, 2007), suggesting that other RO2 radicals must contribute. In our model calculations we use this rate constant for all RO2 radicals to obtain reasonable agreement between the produced HOBr and the formed BrCl and Br2 necessary for our experimental degradation results. So reaction scheme (1) - (3) should be completed by: BrO + RO2 => HOBr + products (2b) The German Science Foundation (DFG) supported this research in unit 783 (HALOPROC).

Application of multiplex PCR, pulsed-field gel electrophoresis (PFGE), and BOX-PCR for molecular analysis of enterococci

USDA-ARS?s Scientific Manuscript database

The objective of the study was to use band-based molecular methods including BOX-PCR (Polymerase Chain Reaction) and Pulsed-Field Gel Electrophoresis (PFGE) to determine if genetically related enterococci were found among different stores, food types, or years. Enterococci were also characterized f...

Bacterial biodiversity from an anaerobic up flow bioreactor with ANAMMOX activity inoculated with swine sludge

USDA-ARS?s Scientific Manuscript database

The present study aimed to identify organisms with ANAMMOX activity in a reactor maintained in a laboratory. Molecular methods as fluorescence in situ hybridization (FISH), polymerase chain reaction (PCR) and cloning of 16S-rDNA genes probing for Planctomycetes were performed. Seventeen clones were ...

Evaluation of reference genes for expression studies in ash (Fraxinus spp.)

Treesearch

Loren Rivera-Vega; Praveen Mamidala; Jennifer L. Koch; Mary E. Mason; Omprakash Mittapalli

2012-01-01

Ash (Fraxinus spp.) is a dominant tree species in North America, in both managed and natural landscapes. However, due to the rapid invasion by the emerald ash borer (Agrilus planipennis), an exotic invasive insect pest, millions of North American ash trees have been killed. Real-time quantitative polymerase chain reaction (RTq-PCR...

Market surveillance on non-halal additives incorporated in surimi based products using polymerase chain reaction (PCR)-southern hybridization analysis

NASA Astrophysics Data System (ADS)

Aravindran, S.; Sahilah, A. M.; Aminah, A.

2014-09-01

Halal surveillance on halal ingredients incorporated in surimi based products were studied using polymerase chain reaction (PCR)-southern hybridization on chip analysis. The primers used in this technique were targeted on mitochondria DNA (mtDNA) of cytochrome b (cyt b) gene sequence which able to differentiate 7 type (beef, chicken, duck, goat, buffalo, lamb and pork) of species on a single chip. 17 (n = 17*3) different brands of surimi-based product were purchased randomly from Selangor local market in January 2013. Of 17 brands, 3 (n = 3*3) brands were positive for chicken DNA, 1 (n = 1*3) brand was positive for goat DNA, and the remainder 13 brands (n = 13*3) have no DNA species detected. The sensitivity of PCR-southern hybridization primers to detect each meat species was 0.1 ng. In the present study, it is evidence that PCR-Southern Hybridization analysis offered a reliable result due to its highly specific and sensitive properties in detecting non-halal additive such as plasma protein incorporation in surimi-based product.

Enhanced detection rate of typhoid fever among clinically suspected patients in a tertiary referral hospital in Dhaka, Bangladesh using nested polymerase chain reaction technology.

PubMed

Khan, S; Miah, M R; Khatun, S

2015-12-01

A nested polymerase chain reaction (PCR) specific for Salmonella enterica subspecies enteric serovar Typhi was used for the detection of the pathogen, in blood. This study was done during the period of March 2013 to February 2014. A total of 80 clinically suspected cases of typhoid fever were included in the study. Blood was collected from all participating individuals. Nested PCR targeting the flagellin gene (fliC) of Salmonella Typhi & blood culture were done for each of the cases. The positivity rate of PCR & blood culture was 70%& 20% respectively. The positivity rate of PCR was significantly higher than blood culture (P< 0.05). With the nested PCR, S. Typhi DNAs were detected from blood specimens of 67.2% (43/64) patients among the suspected typhoid fever cases on the basis of clinical features but with negative cultures. We conclude that the PCR technique could be used as a novel diagnostic method of typhoid fever, particularly in culture-negative cases in an endemic country like Bangladesh.

Pilot study of the utility and acceptability of tampon sampling for the diagnosis of Neisseria gonorrhoeae and Chlamydia trachomatis infections by duplex realtime polymerase chain reaction in United Kingdom sex workers.

PubMed

Kimmitt, P T; Tabrizi, S N; Crosatti, M; Garland, S M; Schober, P C; Rajakumar, K; Chapman, C A

2010-04-01

We aimed to evaluate the acceptability of self-collected tampon samples for the screening of female sex workers for sexually transmitted infections. We recruited 65 sex workers, and 63 agreed to provide tampon samples. The tampon samples were processed by realtime polymerase chain reaction (PCR) targeting Neisseria gonorrhoeae and Chlamydia trachomatis. Urethral and endocervical swabs were also obtained from 61 of 63 participants and tested using culture (N. gonorrhoeae) and the BD ProbeTec strand displacement amplification (SDA) (C. trachomatis) assay. Tampon sampling was preferred by 95% of the women and all favoured being tested away from genitourinary medicine clinics; the most common reasons cited were avoidance of embarrassment (40%) and convenience (30%). Besides near-universal acceptability of tampon sampling, the tampon sampling-PCR approach described in this study appeared to have enhanced sensitivity compared with conventional testing, suggesting the possibility of a residual hidden burden of N. gonorrhoeae and/or C. trachomatis genital infections in UK female sex workers.

Human metapneumovirus-associated hospital admissions over five consecutive epidemic seasons: evidence for alternating circulation of different genotypes.

PubMed

Apostoli, Paola; Zicari, Sonia; Lo Presti, Alessandra; Ciccozzi, Massimo; Ciotti, Marco; Caruso, Arnaldo; Fiorentini, Simona

2012-03-01

Human metapneumovirus (hMPV) is a pathogen of the respiratory tract with a worldwide distribution. The purpose of this study was to identify hMPV as the cause of acute respiratory diseases in children admitted at Spedali Civili, a public hospital in Brescia, Italy. Eight hundred forty-six nasopharyngeal aspirate samples negative for the presence of other common respiratory viruses were tested for the presence of hMPV RNA by reverse transcription-polymerase chain reaction. Of the 846 samples, 79 (9.3%) were positive for hMPV. Polymerase chain reaction products, obtained by amplification of the partial nucleotide sequence of gene F, were sequenced and compared with sequences deposited in GenBank. All four hMPV subtypes were identified, including the proposed subtype A2 sublineages "A" and "B". In successive epidemic seasons, large outbreaks of hMPV alternated with small outbreaks in a biannual pattern. This local study provides further evidence that hMPV infection should be considered as a reason for hospital admission for acute respiratory disease in children. Copyright © 2012 Wiley Periodicals, Inc.

Quantification of concentrated Chinese medicine granules by quantitative polymerase chain reaction.

PubMed

Lo, Yat-Tung; Shaw, Pang-Chui

2017-10-25

Determination of the amount of constituent in a multi-herb product is important for quality control. In concentrated Chinese medicine granules (CCMG), no dregs are left after dissolution of the CCMG. This study is the first to examine the feasibility of using quantitative polymerase chain reaction (qPCR) to find the amount of CCMG in solution form. DNA was extracted from Hirudo and Zaocys CCMG mixed at different ratios and amplified in qPCR using species-specific primers. The threshold cycle (C T ) obtained was compared with the respective standard curves. Results showed that reproducible quantification results could be obtained (1) for 5-50mg CCMG using a modified DNA extraction protocol, (2) amongst DNA extracted from the same batch of CCMG and (3) amongst different batches of CCMG from the same company. This study demonstrated the constitute amount of CCMG in a mixture could be determined using qPCR. This work has extended the application of DNA techniques for the quantification of herbal products and this approach may be developed for quality assurance in the CCMG industry. Copyright © 2017 Elsevier B.V. All rights reserved.

Methylation pattern of IFNG in periapical granulomas and radicular cysts.

PubMed

Campos, Kelma; Gomes, Carolina Cavaliéri; de Fátima Correia-Silva, Jeane; Farias, Lucyana Conceição; Fonseca-Silva, Thiago; Bernardes, Vanessa Fátima; Pereira, Cláudia Maria; Gomez, Ricardo Santiago

2013-04-01

Interferon-γ plays an important role in the pathogenesis of periapical lesions, and the methylation of IFNG has been associated with transcriptional inactivation. The purpose of the present study was to investigate IFNG promoter methylation in association with gene transcription and protein levels in periapical granulomas and radicular cysts. Methylation-specific polymerase chain reaction was used to assess the DNA methylation pattern of the IFNG gene in 16 periapical granulomas and 13 radicular cyst samples. The transcription levels of IFNG mRNA were verified by quantitative real-time polymerase chain reaction, and protein expression was evaluated by immunohistochemistry. All the periapical lesion samples exhibited partial or total methylation of the IFNG gene. In addition, an increased methylation profile was found in radicular cysts compared with periapical granulomas. Increased IFNG mRNA expression was observed in the partially methylated periapical lesion samples relative to the samples that were completely methylated. The present study provides the first evidence of the possible impact of IFNG methylation on IFNG transcription in periapical lesions. Copyright © 2013 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

Recurrent uveitis in horses: vitreal examinations with ultrastructural detection of leptospires.

PubMed

Brandes, K; Wollanke, B; Niedermaier, G; Brem, S; Gerhards, H

2007-06-01

This study documents the examination of 17 horses (both sexes, 3-18 years old) suffering from spontaneous equine recurrent uveitis (ERU). Vitreal samples obtained by pars plana vitrectomy were examined macroscopically and ultrastructurally, and in most cases also by cultural examination, by microscopic agglutination test (MAT) and by polymerase chain reaction. In 24% (4/17) of the animals, ultrastructural examination by electron microscopy revealed intact leptospiral bacteria in the vitreous. The leptospires were detected freely in the vitreous and also incorporated by a phagocyte. They were surrounded by a rim of proteinaceous material which was reduced around a phagocytosed leptospira. Ninety-four per cent (16/17) of the vitreal samples presented significant antibody levels in the MAT, mostly against leptospiral serovar Grippotyphosa. Seventy-five per cent (9/12) of bacterial culture examinations were positive for leptospira. Polymerase chain reaction was positive in all (16/16) examinations performed. Our findings support previous reports suggesting that leptospires play an important role in the pathogenesis of ERU. Interestingly, this study found leptospires after secondary and later acute episodes. A persistent leptospiral infection is therefore suggested as the cause of ERU.

Development of an immunomagnetic separation-polymerase chain reaction (IMS-PCR) assay specific for Enterocytozoon bieneusi in water samples.

PubMed

Sorel, N; Guillot, E; Thellier, M; Accoceberry, I; Datry, A; Mesnard-Rouiller, L; Miégeville, M

2003-01-01

Microsporidia have become widely recognized as important human pathogens. Among Microsporidia, Enterocytozoon bieneusi is responsible for severe gastrointestinal disease. To date, no current therapy has been proven effective. Their mode of transmission and environmental occurrence are poorly documented because of the lack of detection methods that are both species-specific and sensitive. In this study, we developed a sensitive and specific molecular method to detect E. bieneusi spores in water samples. The molecular assay combined immunomagnetic separation (IMS) and polymerase chain reaction (PCR) amplification to detect E. bieneusi spores. A comparison was made of IMS magnetic beads coated with two different monoclonal antibodies, one specific for the Encephalitozoon genus that cross-reacts with E. bieneusi and the other specific only for the E. bieneusi species itself. Immunotech beads coated with the antibody specific for E. bieneusi were found to be the most effective combination. The highly specific IMS-PCR assay developed in this study provides a rapid and sensitive means of screening water samples for the presence of E. bieneusi spores.

Evaluation of immunomagnetic separation for the detection of Salmonella in surface waters by polymerase chain reaction.

PubMed

Hsu, Chao-Yu; Hsu, Bing-Mu; Chang, Tien-Yu; Hsu, Tsui-Kang; Shen, Shu-Min; Chiu, Yi-Chou; Wang, Hung-Jen; Ji, Wen-Tsai; Fan, Cheng-Wei; Chen, Jyh-Larng

2014-09-19

Salmonella spp. is associated with fecal pollution and capable of surviving for long periods in aquatic environments. Instead of the traditional, time-consuming biochemical detection, polymerase chain reaction (PCR) allows rapid identification of Salmonella directly concentrated from water samples. However, prevalence of Salmonella may be underestimated because of the vulnerability of PCR to various environmental chemicals like humic acid, compounded by the fact that various DNA polymerases have different susceptibility to humic acid. Because immunomagnetic separation (IMS) theoretically could isolate Salmonella from other microbes and facilitate removal of aquatic PCR inhibitors of different sizes, this study aims to compare the efficiency of conventional PCR combined with immunomagnetic separation (IMS) for Salmonella detection within a moderately polluted watershed. In our study, the positive rate was increased from 17.6% to 47% with nearly ten-fold improvement in the detection limit. These results suggest the sensitivity of Salmonella detection could be enhanced by IMS, particularly in low quality surface waters. Due to its effects on clearance of aquatic pollutants, IMS may be suitable for most DNA polymerases for Salmonella detection.

Production of medium chain fatty acid rich mustard oil using packed bed bioreactor.

PubMed

Sengupta, Avery; Roy, Susmita; Mukherjee, Sohini; Ghosh, Mahua

2015-01-01

A comparative study was done on the production of different medium chain fatty acid (MCFA) rich mustard oil using a stirred tank batchreactor (STBR) and packed bed bio reactor (PBBR) using three commercially available immobilised lipases viz. Thermomyces lanuginosus, Candida antarctica and Rhizomucor meihe. Three different MCFAs capric, caprylic and lauric acids were incorporated in the mustard oil. Reaction parameters, such as substrate molar ratio, reaction temperature and enzyme concentration were standardized in the STBR and maintained in the PBBR. To provide equal time of residence between the substrate and enzyme in both the reactors for the same amount of substrates, the substrate flow rate in the PBBR was maintainedat 0.27 ml/min. Gas liquid chromatography was used to monitor the incorporation of MCFA in mustard oil. The study showed that the PBBR was more efficient than the STBR in the synthesis of structured lipids with less migration of acyl groups. The physico-chemical parameters of the product along with fatty acid composition in all positions and sn-2 positions were also determined.

Synthesis and characterisation of new types of side chain cholesteryl polymers.

PubMed

Wang, Bin; Du, Haiyan; Zhang, Junhua

2011-01-01

A series of cholesterol derivatives have been synthesised via the alkylation reaction of the 3-hydroxyl group with the aliphatic bromide compounds with different chain lengths, namely 3β-alkyloxy-cholesterol. The double bond between the C5 and C6 positions in these cholesterol derivatives was oxidised into epoxy, followed by an epoxy-ring-opening reaction with the treatment with acrylic acid, resulting in a series of 3β-alkyloxy-5α-hydroxy-6β-acryloyloxycholesterol, C(n)OCh (n=1, 2, 4, 6, 8, 10, 12), The acrylate group is connected to the C6 position, which is confirmed by the single crystal structure analysis. The corresponding polymers, PC(n)OCh, were prepared via free radical polymerisation. The structure of monomers and the resulting polymers were characterised with nuclear magnetic resonance (NMR), Fourier transform infrared spectroscopy (FT-IR) and gel permeation chromatography (GPC). The thermal properties of PC(n)OCh were studied using differential scanning calorimetry (DSC) and thermogravimetric analysis (TGA). To determine the secondary structure of polymers, circular dichroism (CD) spectra were performed. It was found that not all monomers produce high-molecular-weight polymers because of steric hindrance. However, all polymers have a helical structure, which can be enhanced by increasing the alkoxy chain length. In addition, increasing the alkoxy chain length decreases the glass transition temperature and increases the decomposition temperature of the polymers. Copyright © 2010 Elsevier Inc. All rights reserved.

Expression and function of CD8 alpha/beta chains on rat and human mast cells.

PubMed

Kim, Mi-Sun; Kim, Sung-Hoon; Lee, Hye-Jung; Kim, Hyung-Min

2004-03-01

The expression and functional role of CD8 glycoprotein, a marker of cytotoxic/suppressor T lymphocytes and NK cells, were not studied on freshly isolated connective tissue type rat peritoneal mast cells, a rat mucosal type mast cell line (RBL 2H3), or human mast cell line (HMC-1). We used the reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analysis, immunohistochemistry and enzyme-linked immunosorbent assay. RT-PCR and Western blot analysis identified the presence of CD8 alpha/beta chains on the mast cells, and immunohistochemistry confirmed CD8alpha expression on rat or human mast cells. Functional studies demonstrated that stimulation of CD8 alpha/beta chains on rat mast cells induced the secretion of tumor necrosis factor-alpha (TNF-alpha) and interleukin-6 (IL-6), which are regarded as important mediators during infection. However, co-stimulation with stem cell factor had no effect on CD8-induced mediator secretion. Our findings demonstrate novel biological roles of CD8 molecules in mast cells.

On the complex •OH/•O--induced free radical chemistry of arylalkylamines with special emphasis on the contribution of the alkylamine side chain.

PubMed

Szabó, László; Mile, Viktória; Tóth, Tünde; Balogh, György T; Földes, Tamás; Takács, Erzsébet; Wojnárovits, László

2017-02-01

A full account of the • OH-induced free radical chemistry of an arylalkylamine is given taking all the possible reaction pathways quantitatively into consideration. Such knowledge is indispensable when the alkylamine side chain plays a crucial role in biological activity. The fundamental reactions are investigated on the model compound N-methyl-3-phenypropylamine (MPPA), and extended to its biologically active analog, to the antidepressant fluoxetine (FLX). Pulse radiolysis techniques were applied including redox titration and transient spectral analysis supplemented with DFT calculations. The contribution of the amine moiety to the free radical-induced oxidation mechanism appeared to be appreciable. • O - was used to observe hydrogen atom abstraction events at pH 14 giving rise to the strongly reducing α-aminoalkyl radicals (∼38% of the radical yield) and to benzyl (∼4%), β-aminoalkyl (∼24%), and aminyl radicals (∼31%) of MPPA. One-electron transfer was also observed yielding aminium radicals with low efficiency (∼3%). In the • OH-induced oxidation protonated α-aminoalkyl (∼49%), β-aminoalkyl (∼27%), benzyl radicals (∼4%), and aminium radicals (∼5%) are initially generated on the side chain of MPPA at pH 6, whereas hydroxycyclohexadienyl radicals (∼15%) were also produced. These initial events are followed by complex protonation-deprotonation reactions establishing acid-base equilibria; however, these processes are limited by the transient nature of the radicals and the kinetics of the ongoing reactions. The contribution of the radicals from the side chain alkylamine substituent of FLX totals up to ∼54% of the initially available oxidant yield.

Graphite grain-size spectrum and molecules from core-collapse supernovae

NASA Astrophysics Data System (ADS)

Clayton, Donald D.; Meyer, Bradley S.

2018-01-01

Our goal is to compute the abundances of carbon atomic complexes that emerge from the C + O cores of core-collapse supernovae. We utilize our chemical reaction network in which every atomic step of growth employs a quantum-mechanically guided reaction rate. This tool follows step-by-step the growth of linear carbon chain molecules from C atoms in the oxygen-rich C + O cores. We postulate that once linear chain molecules reach a sufficiently large size, they isomerize to ringed molecules, which serve as seeds for graphite grain growth. We demonstrate our technique for merging the molecular reaction network with a parallel program that can follow 1017 steps of C addition onto the rare seed species. Due to radioactivity within the C + O core, abundant ambient oxygen is unable to convert C to CO, except to a limited degree that actually facilitates carbon molecular ejecta. But oxygen severely minimizes the linear-carbon-chain abundances. Despite the tiny abundances of these linear-carbon-chain molecules, they can give rise to a small abundance of ringed-carbon molecules that serve as the nucleations on which graphite grain growth builds. We expand the C + O-core gas adiabatically from 6000 K for 109 s when reactions have essentially stopped. These adiabatic tracks emulate the actual expansions of the supernova cores. Using a standard model of 1056 atoms of C + O core ejecta having O/C = 3, we calculate standard ejection yields of graphite grains of all sizes produced, of the CO molecular abundance, of the abundances of linear-carbon molecules, and of Buckminsterfullerene. None of these except CO was expected from the C + O cores just a few years past.

The role of acyl carrier protein isoforms from Cuphea lanceolata seeds in the de-novo biosynthesis of medium-chain fatty acids.

PubMed

Schütt, B S; Brummel, M; Schuch, R; Spener, F

1998-06-01

To investigate the role of acyl carrier protein (ACP) in determining the fate of the acyl moieties linked to it in the course of de-novo fatty acid biosynthesis in higher plants, we carried out in vitro experiments to reconstitute the fatty acid synthase (FAS) reaction in extracts of spinach (Spinacia oleracea L.) leaves, rape (Brassica napus L.) seeds and Cuphea lanceolata Ait. seeds. The action of two major C. lanceolata ACP isoforms (ACP 1 and ACP 2) compared to ACP from Escherichia coli was monitored by saponification of the corresponding FAS products with subsequent analysis of the liberated fatty acids by high-performance liquid chromatography. In a second approach the preference of the medium-chain acyl-ACP-specific thioesterase (EC 3.1.2.14) of C. lanceolata seeds for the hydrolysis of acyl-ACPs prepared from the three ACP types was investigated. Both ACP isoforms from C. lanceolata seeds supported the synthesis of medium-chain fatty acids in a reconstituted FAS reaction of spinach leaf extracts. Compared to the isoform ACP 1, ACP 2 was more effective in supporting the synthesis of such fatty acids in the FAS reaction of rape seed extracts and caused a higher accumulation of FAS products in all experiments. No preference of the medium-chain thioesterase for one specific ACP isoform was observed. The results indicate that the presence of ACP 2 is essential for the synthesis of decanoic acid in C. lanceolata seeds, and its expression in the phase of accumulation of high levels of this fatty acid provides an additional and highly efficient cofactor for stimulating the FAS reaction.

A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

PubMed Central

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

2008-01-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880

Chemical stability of insulin. 4. Mechanisms and kinetics of chemical transformations in pharmaceutical formulation.

PubMed

Brange, J

1992-01-01

Insulin decomposes by a multitude of chemical reactions [1-3]. It deamidates at two different residues by entirely different mechanisms. In acid, deamidation at AsnA21 is intramolecularly catalyzed by the protonated C-terminal, whereas above pH 6 an intermediate imide formation at residue AsnB3 leads to isoAsp and Asp derivatives. The imide formation requires a large rotation around the alpha-carbon/peptide carbonyl carbon bond at B3, corresponding to a 10 A movement of the B-chain N-terminal. The main determinant for the rate of B3 deamidation, as well as for the ratio between the two products formed, is the local conformational structure, which is highly influenced by various excipients and the physical state of the insulin. An amazing thermolysin-like, autoproteolytic cleavage of the A-chain takes place in rhombohedral insulin crystals, mediated by a concerted catalytic action by several, inter-hexameric functional groups and Zn2+. Intermolecular, covalent cross-linking of insulin molecules occurs via several mechanisms. The most prominent type of mechanism is aminolysis by the N-terminals, leading to isopeptide linkages with the A-chain side-chain amides of residues GlnA15, AsnA18 and AsnA21. The same type of reaction also leads to covalent cross-linking of the N-terminal in protamine with insulin. Disulfide exchange reactions, initiated by lysis of the A7-B7 disulfide bridge, lead mainly to formation of covalent oligo- and polymers. Activation energy (Ea) for the neutral deamidation and the aminolysis reactions was found to be 80 and 119 KJ/mol, respectively.

The growth of carbon chains in IRC +10216 mapped with ALMA⋆

PubMed Central

Agúndez, M.; Cernicharo, J.; Quintana-Lacaci, G.; Castro-Carrizo, A.; Velilla Prieto, L.; Marcelino, N.; Guélin, M.; Joblin, C.; Martín-Gago, J. A.; Gottlieb, C. A.; Patel, N. A.; McCarthy, M. C.

2017-01-01

Linear carbon chains are common in various types of astronomical molecular sources. Possible formation mechanisms involve both bottom-up and top-down routes. We have carried out a combined observational and modeling study of the formation of carbon chains in the C-star envelope IRC +10216, where the polymerization of acetylene and hydrogen cyanide induced by ultraviolet photons can drive the formation of linear carbon chains of increasing length. We have used ALMA to map the emission of λ 3 mm rotational lines of the hydrocarbon radicals C2H, C4H, and C6H, and the CN-containing species CN, C3N, HC3N, and HC5N with an angular resolution of ~1″. The spatial distribution of all these species is a hollow, 5-10″ wide, spherical shell located at a radius of 10-20″ from the star, with no appreciable emission close to the star. Our observations resolve the broad shell of carbon chains into thinner sub-shells which are 1-2″ wide and not fully concentric, indicating that the mass loss process has been discontinuous and not fully isotropic. The radial distributions of the species mapped reveal subtle differences: while the hydrocarbon radicals have very similar radial distributions, the CN-containing species show more diverse distributions, with HC3N appearing earlier in the expansion and the radical CN extending later than the rest of the species. The observed morphology can be rationalized by a chemical model in which the growth of polyynes is mainly produced by rapid gas-phase chemical reactions of C2H and C4H radicals with unsaturated hydrocarbons, while cyanopolyynes are mainly formed from polyynes in gas-phase reactions with CN and C3N radicals. PMID:28469283

Formation of pyroglutamic acid from N-terminal glutamic acid in immunoglobulin gamma antibodies.

PubMed

Chelius, Dirk; Jing, Kay; Lueras, Alexis; Rehder, Douglas S; Dillon, Thomas M; Vizel, Alona; Rajan, Rahul S; Li, Tiansheng; Treuheit, Michael J; Bondarenko, Pavel V

2006-04-01

The status of the N-terminus of proteins is important for amino acid sequencing by Edman degradation, protein identification by shotgun and top-down techniques, and to uncover biological functions, which may be associated with modifications. In this study, we investigated the pyroglutamic acid formation from N-terminal glutamic acid residues in recombinant monoclonal antibodies. Almost half the antibodies reported in the literature contain a glutamic acid residue at the N-terminus of the light or the heavy chain. Our reversed-phase high-performance liquid chromatography-mass spectrometry method could separate the pyroglutamic acid-containing light chains from the native light chains of reduced and alkylated recombinant monoclonal antibodies. Tryptic peptide mapping and tandem mass spectrometry of the reduced and alkylated proteins was used for the identification of the pyroglutamic acid. We identified the formation of pyroglutamic acid from N-terminal glutamic acid in the heavy chains and light chains of several antibodies, indicating that this nonenzymatic reaction does occur very commonly and can be detected after a few weeks of incubation at 37 and 45 degrees C. The rate of this reaction was measured in several aqueous buffers with different pH values, showing minimal formation of pyroglutamic acid at pH 6.2 and increased formation of pyroglutamic acid at pH 4 and pH 8. The half-life of the N-terminal glutamic acid was approximately 9 months in a pH 4.1 buffer at 45 degrees C. To our knowledge, we showed for the first time that glutamic acid residues located at the N-terminus of proteins undergo pyroglutamic acid formation in vitro.

Synthesis, crystal structure, and electrical and magnetic properties of BaMo{sub 6}Te{sub 6}: A novel reduced molybdenum telluride containing infinite chains of trans-face shared Mo{sub 6} octahedra

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gall, Philippe; Guizouarn, Thierry; Potel, Michel

Powder samples and single crystals of the new ternary compound BaMo{sub 6}Te{sub 6} were obtained by solid state reaction. The structure was determined by single-crystal X-ray diffraction. BaMo{sub 6}Te{sub 6} crystallizes in the hexagonal space group P6{sub 3}/m (No. 176) with unit-cell parameters a=9.3941(2) Å, c=4.5848(1) Å and Z=1. Full-matrix least-squares refinement on F{sup 2} using 452 independent reflections for 17 refinable parameters resulted in R1=0.0208 and wR2=0.0539. The structure consists of one-dimensional infinite chains of trans-face shared Mo{sub 6} octahedra capped by Se atoms. These chains that are running along the c axis are separated from each other bymore » nine-coordinate Ba atoms. Resistivity measurements on a single crystal indicated that the BaMo{sub 6}Te{sub 6} compound is metallic down to 160 K and semiconductor below. Magnetic susceptibility measurements showed that BaMo{sub 6}Te{sub 6} is weakly diamagnetic with no anomaly at the metal–semiconductor transition. - Graphical abstract: We present here the synthesis, the crystal structure, and the electrical and magnetic properties of the new compound BaMo{sub 6}Te{sub 6} containing infinite chains of trans-face shared Mo{sub 6} octahedra. - Highlights: • BaMo{sub 6}Te{sub 6} contains infinite chains of trans-face-sharing Mo{sub 6} octahedra |Mo{sub 6/2}|{sub ∞}{sup 1}. • Synthesis by solid state reaction. • Single-crystal X-ray study. • Continuous metal–nonmetal transition. • Anderson localization.« less

Selections from 2017: Discoveries in Titan's Atmosphere

NASA Astrophysics Data System (ADS)

Kohler, Susanna

2017-12-01

Editors note:In these last two weeks of 2017, well be looking at a few selections that we havent yet discussed on AAS Nova from among the most-downloaded paperspublished in AAS journals this year. The usual posting schedule will resume in January.Carbon Chain Anions and the Growth of Complex Organic Molecules in Titans IonospherePublished July2017Main takeaway:Graphic depicting some of the chemical reactions taking place in Titans atmosphere, leading to the generation of organic haze particles. [ESA]In a recently published study led by Ravi Desai (University College London), scientists used data from the Cassini mission to identify negatively charged molecules known as carbon chain anions in the atmosphere of Saturns largest moon, Titan.Why its interesting:Carbon chain anions are the building blocks ofmore complex molecules, and Titans thick nitrogen and methane atmosphere mightmimic the atmosphere of earlyEarth. This first unambiguous detection of carbon chain anions in a planet-like atmosphere might therefore teach us about the conditions and chemical reactions that eventually led to the development of life on Earth. And ifwe can use Titan to learn about how complex molecules grow from these anion chains, we may be able to identify auniversal pathway towards the ingredients for life.What weve learned so far:Cassini measured fewer and fewer lower-mass anions the deeper in Titans ionosphere that it looked and at the same time,an increase in the number of precursors to larger aerosol molecules further down. This tradeoff strongly suggests that the anions are indeed involved in building up the more complex molecules, seeding their eventual growth into the complex organic haze of Titans lower atmosphere.CitationR. T. Desai et al 2017 ApJL 844 L18. doi:10.3847/2041-8213/aa7851

No association between catechol-O-methyltransferase polymorphisms and neurotic disorders among mainland Chinese university students.

PubMed

Kou, Changgui; Meng, Xiangfei; Xie, Bing; Shi, Jieping; Yu, Qiong; Yu, Yaqin; D'Arcy, Carl

2012-07-30

This study investigates the genetic association between catechol-O-methyltransferase (COMT) gene polymorphisms and neurotic disorders. Data were derived from a case-control association study of 255 undergraduates affected by neurotic disorders and 269 matched healthy undergraduate controls. The polymorphisms of eight tag single nucleotide polymorphisms (SNPs) on the COMT gene were tested using polymerase chain reaction (PCR)-based Ligase Detection Reaction (PCR-LDR). The eight tag SNPs on the COMT gene assessed were not associated with neurotic disorders. Our finding suggests that the COMT gene may not be a susceptibility gene for neurotic disorders. Copyright © 2012 Elsevier Ltd. All rights reserved.

Sustained high-throughput polymerase chain reaction diagnostics during the European epidemic of Bluetongue virus serotype 8.

PubMed

van Rijn, Piet A; Heutink, René G; Boonstra, Jan; Kramps, Hans A; van Gennip, René G P

2012-05-01

A real-time reverse transcription polymerase chain reaction assay (PCR test) based on genome segment 10 of Bluetongue virus (BTV) was developed. The PCR test consists of robotized viral RNA isolation from blood samples and an all-in-one method including initial denaturation of genomic double-stranded RNA, reverse transcription polymerase chain reaction (RT-PCR), and real-time detection and analysis. Reference strains of the 24 recognized BTV serotypes, isolates from different years, and geographic origins were detected. Other orbiviruses such as African horse sickness virus, Epizootic hemorrhagic disease virus, and Equine encephalosis virus were not detected. Experimentally infected animals were PCR positive from 2 days postinoculation, which was earlier than fever, other clinical signs, or seroconversion. The diagnostic sensitivity and specificity were very close to or even 100%. The PCR test played a key role in the detection of BTV serotype 8 in August 2006 in The Netherlands. The outbreak in a completely naive ruminant population allowed for further evaluation of the PCR test with field samples. In 2006, the correlation between enzyme-linked immunosorbent assay and PCR results was estimated to be 95%. In the following years, the PCR test was used for diagnosis of diseased animals, for testing of healthy animals for trade purposes, and for detection of BTV RNA in different species of the insect vector, Culicoides. In the autumn of 2008, BTV serotype 6 unexpectedly emerged in northwest Europe and was also detected with the PCR test developed in the current study. The performance in routine use over 5 years has been recorded and evaluated.

COLD-PCR Technologies in the Area of Personalized Medicine: Methodology and Applications.

PubMed

Mauger, Florence; How-Kit, Alexandre; Tost, Jörg

2017-06-01

Somatic mutations bear great promise for use as biomarkers for personalized medicine, but are often present only in low abundance in biological material and are therefore difficult to detect. Many assays for mutation analysis in cancer-related genes (hotspots) have been developed to improve diagnosis, prognosis, prediction of drug resistance, and monitoring of the response to treatment. Two major approaches have been developed: mutation-specific amplification methods and methods that enrich and detect mutations without prior knowledge on the exact location and identity of the mutation. CO-amplification at Lower Denaturation temperature Polymerase Chain Reaction (COLD-PCR) methods such as full-, fast-, ice- (improved and complete enrichment), enhanced-ice, and temperature-tolerant COLD-PCR make use of a critical temperature in the polymerase chain reaction to selectively denature wild-type-mutant heteroduplexes, allowing the enrichment of rare mutations. Mutations can subsequently be identified using a variety of laboratory technologies such as high-resolution melting, digital polymerase chain reaction, pyrosequencing, Sanger sequencing, or next-generation sequencing. COLD-PCR methods are sensitive, specific, and accurate if appropriately optimized and have a short time to results. A large variety of clinical samples (tumor DNA, circulating cell-free DNA, circulating cell-free fetal DNA, and circulating tumor cells) have been studied using COLD-PCR in many different applications including the detection of genetic changes in cancer and infectious diseases, non-invasive prenatal diagnosis, detection of microorganisms, or DNA methylation analysis. In this review, we describe in detail the different COLD-PCR approaches, highlighting their specificities, advantages, and inconveniences and demonstrating their use in different fields of biological and biomedical research.

Long-time behavior and Turing instability induced by cross-diffusion in a three species food chain model with a Holling type-II functional response.

PubMed

Haile, Dawit; Xie, Zhifu

2015-09-01

In this paper, we study a strongly coupled reaction-diffusion system describing three interacting species in a food chain model, where the third species preys on the second one and simultaneously the second species preys on the first one. An intra-species competition b2 among the second predator is introduced to the food chain model. This parameter produces some very interesting result in linear stability and Turing instability. We first show that the unique positive equilibrium solution is locally asymptotically stable for the corresponding ODE system when the intra-species competition exists among the second predator. The positive equilibrium solution remains linearly stable for the reaction diffusion system without cross diffusion, hence it does not belong to the classical Turing instability scheme. But it becomes linearly unstable only when cross-diffusion also plays a role in the reaction-diffusion system, hence the instability is driven solely from the effect of cross diffusion. Our results also exhibit some interesting combining effects of cross-diffusion, intra-species competitions and inter-species interactions. Numerically, we conduct a one parameter analysis which illustrate how the interactions change the existence of stable equilibrium, limit cycle, and chaos. Some interesting dynamical phenomena occur when we perform analysis of interactions in terms of self-production of prey and intra-species competition of the middle predator. By numerical simulations, it illustrates the existence of nonuniform steady solutions and new patterns such as spot patterns, strip patterns and fluctuations due to the diffusion and cross diffusion in two-dimension. Published by Elsevier Inc.

Sensitivity, specificity and comparison of three commercially available immunological tests in the diagnosis of Cryptosporidium species in animals.

PubMed

Danišová, Olga; Halánová, Monika; Valenčáková, Alexandra; Luptáková, Lenka

The study was conducted to compare the specificity of immunological diagnostic methods used for the diagnosis of Cryptosporidium species capable of causing life-threatening infection in both immunosuppressed and immunocompetent patients. For the detection of Cryptosporidium species in 79 animals with diarrhoea, we used three Copro-antigen tests: RIDASCREEN ® Cryptosporidium test, Cryptosporidium 2nd Generation (ELISA) and RIDA ® QUICK Cryptosporidium. For immunoassays we used positive and negative samples detected by means of polymerase chain reaction and validated by sequencing and nested polymerase chain reaction to confirm the presence six different species of Cryptosporidium species. Prevalence of cryptosporidiosis in the entire group determined by enzyme immunoassay, enzyme linked immunosorbent assay, immuno-chromatographic test and polymerase chain reaction was 34.17%, 27.84%, 6.33% and 27.84%, respectively. Sensitivity of animal samples with enzyme immunoassay, enzyme linked immunosorbent assay, and immuno-chromatographic test was 63.6%, 40.9% and 22.7%, resp., when questionable samples were considered positive, whereas specificity of enzyme immunoassay, enzyme linked immunosorbent assay and immuno-chromatographic test was 75.9%, 78.9% and 100%, respectively. Positive predictive values and negative predictive values were different for all the tests. These differences results are controversial and therefore reliability and reproducibility of immunoassays as the only diagnostic method is questionable. The use of various Cryptosporidium species in diagnosis based on immunological testing and different results obtained by individual tests indicate potential differences in Copro-antigens produced by individual Cryptosporidium species. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Supercoil Formation During DNA Melting

NASA Astrophysics Data System (ADS)

Sayar, Mehmet; Avsaroglu, Baris; Kabakcioglu, Alkan

2009-03-01

Supercoil formation plays a key role in determining the structure-function relationship in DNA. Biological and technological processes, such as protein synthesis, polymerase chain reaction, and microarrays relys on separation of the two strands in DNA, which is coupled to the unwinding of the supercoiled structure. This problem has been studied theoretically via Peyrard-Bishop and Poland-Scheraga type models, which include a simple representation of the DNA structural properties. In recent years, computational models, which provide a more realtistic representaion of DNA molecule, have been used to study the melting behavior of short DNA chains. Here, we will present a new coarse-grained model of DNA which is capable of simulating sufficiently long DNA chains for studying the supercoil formation during melting, without sacrificing the local structural properties. Our coarse-grained model successfully reproduces the local geometry of the DNA molecule, such as the 3'-5' directionality, major-minor groove structure, and the helical pitch. We will present our initial results on the dynamics of supercoiling during DNA melting.

Enhanced DNA Sensing via Catalytic Aggregation of Gold Nanoparticles

PubMed Central

Huttanus, Herbert M.; Graugnard, Elton; Yurke, Bernard; Knowlton, William B.; Kuang, Wan; Hughes, William L.; Lee, Jeunghoon

2014-01-01

A catalytic colorimetric detection scheme that incorporates a DNA-based hybridization chain reaction into gold nanoparticles was designed and tested. While direct aggregation forms an inter-particle linkage from only ones target DNA strand, the catalytic aggregation forms multiple linkages from a single target DNA strand. Gold nanoparticles were functionalized with thiol-modified DNA strands capable of undergoing hybridization chain reactions. The changes in their absorption spectra were measured at different times and target concentrations and compared against direct aggregation. Catalytic aggregation showed a multifold increase in sensitivity at low target concentrations when compared to direct aggregation. Gel electrophoresis was performed to compare DNA hybridization reactions in catalytic and direct aggregation schemes, and the product formation was confirmed in the catalytic aggregation scheme at low levels of target concentrations. The catalytic aggregation scheme also showed high target specificity. This application of a DNA reaction network to gold nanoparticle-based colorimetric detection enables highly-sensitive, field-deployable, colorimetric readout systems capable of detecting a variety of biomolecules. PMID:23891867

Regeneration of cello-oligomers via selective depolymerization of cellulose fibers derived from printed paper wastes.

PubMed

Voon, Lee Ken; Pang, Suh Cem; Chin, Suk Fun

2016-05-20

Cellulose extracted from printed paper wastes were selectively depolymerized under controlled conditions into cello-oligomers of controllable chain lengths via dissolution in an ionic liquid, 1-allyl-3-methylimidazolium chloride (AMIMCl), and in the presence of an acid catalyst, Amberlyst 15DRY. The depolymerization process was optimized against reaction temperature, concentration of acid catalyst, and reaction time. Despite rapid initial depolymerization process, the rate of cellulose depolymerization slowed down gradually upon prolonged reaction time, with 75.0 wt% yield of regenerated cello-oligomers (mean Viscosimetric Degree of Polymerization value of 81) obtained after 40 min. The depolymerization of cellulose fibers at 80 °C appeared to proceed via a second-order kinetic reaction with respect to the catalyst concentration of 0.23 mmol H3O(+). As such, the cellulose depolymerization process could afford some degree of control on the degree of polymerization or chain lengths of cello-oligomers formed. Copyright © 2016 Elsevier Ltd. All rights reserved.

Efficient Homodifunctional Bimolecular Ring-Closure Method for Cyclic Polymers by Combining RAFT and Self-Accelerating Click Reaction.

PubMed

Qu, Lin; Sun, Peng; Wu, Ying; Zhang, Ke; Liu, Zhengping

2017-08-01

An efficient metal-free homodifunctional bimolecular ring-closure method is developed for the formation of cyclic polymers by combining reversible addition-fragmentation chain transfer (RAFT) polymerization and self-accelerating click reaction. In this approach, α,ω-homodifunctional linear polymers with azide terminals are prepared by RAFT polymerization and postmodification of polymer chain end groups. By virtue of sym-dibenzo-1,5-cyclooctadiene-3,7-diyne (DBA) as small linkers, well-defined cyclic polymers are then prepared using the self-accelerating double strain-promoted azide-alkyne click (DSPAAC) reaction to ring-close the azide end-functionalized homodifunctional linear polymer precursors. Due to the self-accelerating property of DSPAAC ring-closing reaction, this novel method eliminates the requirement of equimolar amounts of telechelic polymers and small linkers in traditional bimolecular ring-closure methods. It facilitates this method to efficiently and conveniently produce varied pure cyclic polymers by employing an excess molar amount of DBA small linkers. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Toluene nitration in irradiated nitric acid and nitrite solutions

NASA Astrophysics Data System (ADS)

Elias, Gracy; Mincher, Bruce J.; Mezyk, Stephen P.; Muller, Jim; Martin, Leigh R.

2011-04-01

The kinetics, mechanisms, and stable products produced for the nitration of aryl alkyl mild ortho-para director toluene in irradiated nitric acid and neutral nitrite solutions were investigated using γ and pulse radiolysis. Electron pulse radiolysis was used to determine the bimolecular rate constants for the reaction of toluene with different transient species produced by irradiation. HPLC with UV detection, GC-MS and LC-MS, were used to assess the stable reaction products. Free-radical based nitration reaction products were found in irradiated acidic and neutral media. In 6.0 M HNO3, ring substitution, side chain substitution, and oxidation, produced different nitrated toluene products. For ring substitution, nitrogen oxide radicals were added mainly to cyclohexadienyl radicals, whereas for side chain substitution, these radicals were added to the carbon-centered benzyl radical produced by H-atom abstraction. In neutral nitrite solutions, radiolytically-induced ring nitration products approached a statistically random distribution, suggesting a direct free-radical reaction involving addition of the rad NO2 radical.

Manipulation of prenylation reactions by structure-based engineering of bacterial indolactam prenyltransferases

NASA Astrophysics Data System (ADS)

Mori, Takahiro; Zhang, Lihan; Awakawa, Takayoshi; Hoshino, Shotaro; Okada, Masahiro; Morita, Hiroyuki; Abe, Ikuro

2016-03-01

Prenylation reactions play crucial roles in controlling the activities of biomolecules. Bacterial prenyltransferases, TleC from Streptomyces blastmyceticus and MpnD from Marinactinospora thermotolerans, catalyse the `reverse' prenylation of (-)-indolactam V at the C-7 position of the indole ring with geranyl pyrophosphate or dimethylallyl pyrophosphate, to produce lyngbyatoxin or pendolmycin, respectively. Using in vitro analyses, here we show that both TleC and MpnD exhibit relaxed substrate specificities and accept various chain lengths (C5-C25) of the prenyl donors. Comparisons of the crystal structures and their ternary complexes with (-)-indolactam V and dimethylallyl S-thiophosphate revealed the intimate structural details of the enzyme-catalysed `reverse' prenylation reactions and identified the active-site residues governing the selection of the substrates. Furthermore, structure-based enzyme engineering successfully altered the preference for the prenyl chain length of the substrates, as well as the regio- and stereo-selectivities of the prenylation reactions, to produce a series of unnatural novel indolactams.

Effects of macromolecular crowding on biochemical reaction equilibria: a molecular thermodynamic perspective.

PubMed

Hu, Zhongqiao; Jiang, Jianwen; Rajagopalan, Raj

2007-09-01

A molecular thermodynamic model is developed to investigate the effects of macromolecular crowding on biochemical reactions. Three types of reactions, representing protein folding/conformational isomerization, coagulation/coalescence, and polymerization/association, are considered. The reactants, products, and crowders are modeled as coarse-grained spherical particles or as polymer chains, interacting through hard-sphere interactions with or without nonbonded square-well interactions, and the effects of crowder size and chain length as well as product size are examined. The results predicted by this model are consistent with experimentally observed crowding effects based on preferential binding or preferential exclusion of the crowders. Although simple hard-core excluded-volume arguments do in general predict the qualitative aspects of the crowding effects, the results show that other intermolecular interactions can substantially alter the extent of enhancement or reduction of the equilibrium and can even change the direction of the shift. An advantage of the approach presented here is that competing reactions can be incorporated within the model.

Low temperature (550-700 K) oxidation pathways of cyclic ketones: Dominance of HO 2-elimination channels yielding conjugated cyclic coproducts

DOE PAGES

Scheer, Adam M.; Welz, Oliver; Vasu, Subith S.; ...

2015-04-13

The low-temperature oxidation of three cyclic ketones, cyclopentanone (CPO; C 5H 8O), cyclohexanone (CHO; C 6H 10 O), and 2-methyl-cyclopentanone (2-Me-CPO; CH 3–C 5H7 O), is studied between 550 and 700 K and at 4 or 8 Torr total pressure. Initial fuel radicals R are formedvia fast H-abstraction from the ketones by laser-photolytically generated chlorine atoms. Intermediates and products from the subsequent reactions of these radicals in the presence of excess O 2 are probed with time and isomeric resolution using multiplexed photoionization mass spectrometry with tunable synchrotron ionizing radiation. For CPO and CHO the dominant product channel in themore » R + O 2 reactions is chain-terminating HO 2-elimination yielding the conjugated cyclic coproducts 2-cyclopentenone and 2-cyclohexenone, respectively. Results on oxidation of 2-Me-CPO also show a dominant contribution from HO 2-elimination. Moreover, the photoionization spectrum of the co-product suggests formation of 2-methyl-2-cyclopentenone and/or 2-cyclohexenone, resulting from a rapid Dowd–Beckwith rearrangement, preceding addition to O 2, of the initial (2-oxocyclopentyl)methyl radical to 3-oxocyclohexyl. Cyclic ethers, markers for hydroperoxyalkyl radicals (QOOH), key intermediates in chain-propagating and chain-branching low-temperature combustion pathways, are only minor products. The interpretation of the experimental results is supported by stationary point calculations on the potential energy surfaces of the associated R + O 2 reactions at the CBS-QB3 level. Furthermore, the calculations indicate that HO 2-elimination channels are energetically favored and product formation via QOOH is disfavored. Lastly, the prominence of chain-terminating pathways linked with HO 2 formation in low-temperature oxidation of cyclic ketones suggests little low-temperature reactivity of these species as fuels in internal combustion engines.« less

Low temperature (550-700 K) oxidation pathways of cyclic ketones: Dominance of HO 2-elimination channels yielding conjugated cyclic coproducts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Scheer, Adam M.; Welz, Oliver; Vasu, Subith S.

The low-temperature oxidation of three cyclic ketones, cyclopentanone (CPO; C 5H 8O), cyclohexanone (CHO; C 6H 10 O), and 2-methyl-cyclopentanone (2-Me-CPO; CH 3–C 5H7 O), is studied between 550 and 700 K and at 4 or 8 Torr total pressure. Initial fuel radicals R are formedvia fast H-abstraction from the ketones by laser-photolytically generated chlorine atoms. Intermediates and products from the subsequent reactions of these radicals in the presence of excess O 2 are probed with time and isomeric resolution using multiplexed photoionization mass spectrometry with tunable synchrotron ionizing radiation. For CPO and CHO the dominant product channel in themore » R + O 2 reactions is chain-terminating HO 2-elimination yielding the conjugated cyclic coproducts 2-cyclopentenone and 2-cyclohexenone, respectively. Results on oxidation of 2-Me-CPO also show a dominant contribution from HO 2-elimination. Moreover, the photoionization spectrum of the co-product suggests formation of 2-methyl-2-cyclopentenone and/or 2-cyclohexenone, resulting from a rapid Dowd–Beckwith rearrangement, preceding addition to O 2, of the initial (2-oxocyclopentyl)methyl radical to 3-oxocyclohexyl. Cyclic ethers, markers for hydroperoxyalkyl radicals (QOOH), key intermediates in chain-propagating and chain-branching low-temperature combustion pathways, are only minor products. The interpretation of the experimental results is supported by stationary point calculations on the potential energy surfaces of the associated R + O 2 reactions at the CBS-QB3 level. Furthermore, the calculations indicate that HO 2-elimination channels are energetically favored and product formation via QOOH is disfavored. Lastly, the prominence of chain-terminating pathways linked with HO 2 formation in low-temperature oxidation of cyclic ketones suggests little low-temperature reactivity of these species as fuels in internal combustion engines.« less

Nuclear Physical Uncertainties in Modeling X-Ray Bursts

NASA Astrophysics Data System (ADS)

Regis, Eric; Amthor, A. Matthew

2017-09-01

Type I x-ray bursts occur when a neutron star accretes material from the surface of another star in a compact binary star system. For certain accretion rates and material compositions, much of the nuclear material is burned in short, explosive bursts. Using a one-dimensional stellar model, Kepler, and a comprehensive nuclear reaction rate library, ReacLib, we have simulated chains of type I x-ray bursts. Unfortunately, there are large remaining uncertainties in the nuclear reaction rates involved, since many of the isotopes reacting are unstable and have not yet been studied experimentally. Some individual reactions, when varied within their estimated uncertainty, alter the light curves dramatically. This limits our ability to understand the structure of the neutron star. Previous studies have looked at the effects of individual reaction rate uncertainties. We have applied a Monte Carlo method ``-simultaneously varying a set of reaction rates'' -in order to probe the expected uncertainty in x-ray burst behaviour due to the total uncertainty in all nuclear reaction rates. Furthermore, we aim to discover any nonlinear effects due to the coupling between different reaction rates. Early results show clear non-linear effects. This research was made possible by NSF-DUE Grant 1317446, BUScholars Program.

[Kinetics of the order-disorder transition in the system of two interacting macromolecules (computer simulation)].

PubMed

Taran, Iu A; Cihpev, K K; Stroganov, L B

1977-01-01

Kinetics of the model reaction between oligomeric planar lattice-model chains has been studied by Monte--Carlo method. Simulation of the chain's motion was performing using rules of Verdier--Stockmayer. The length of chains has been varied from 8 to 24 beads. The probabilities of breaking of a contact between two chains was given by w=exp(--U); the formation of an adjacent contact was controlled by mobility of chains. The probability of the formation of any isolated contact was given by w0=exp(--U0). Kinetic curves were obtained for mean number of contacts Z(t) with different initial conditions and U, U0 values. The estimation of mean rates of formation-breaking of contacts (V+ and V-) and their dependences on the time, U and U0 have been obtained. Rate constants for the formation-breaking of a contact (k+ and k-) were estimated as well as the distribution for k+/- over states of the binary complex. The calculations were made for the case of homopolymers, intrachain interactions were omitted.

Development of a rapid and sensitive one-step reverse transcription-nested polymerase chain reaction in a single tube using the droplet-polymerase chain reaction machine.

PubMed

Yamaguchi, Akemi; Matsuda, Kazuyuki; Sueki, Akane; Taira, Chiaki; Uehara, Masayuki; Saito, Yasunori; Honda, Takayuki

2015-08-25

Reverse transcription (RT)-nested polymerase chain reaction (PCR) is a time-consuming procedure because it has several handling steps and is associated with the risk of cross-contamination during each step. Therefore, a rapid and sensitive one-step RT-nested PCR was developed that could be performed in a single tube using a droplet-PCR machine. The K562 BCR-ABL mRNA-positive cell line as well as bone marrow aspirates from 5 patients with chronic myelogenous leukemia (CML) and 5 controls without CML were used. We evaluated one-step RT-nested PCR using the droplet-PCR machine. One-step RT-nested PCR performed in a single tube using the droplet-PCR machine enabled the detection of BCR-ABL mRNA within 40min, which was 10(3)-fold superior to conventional RT nested PCR using three steps in separate tubes. The sensitivity of the one-step RT-nested PCR was 0.001%, with sample reactivity comparable to that of the conventional assay. One-step RT-nested PCR was developed using the droplet-PCR machine, which enabled all reactions to be performed in a single tube accurately and rapidly and with high sensitivity. This one-step RT-nested PCR may be applicable to a wide spectrum of genetic tests in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.

Mass Chain Evaluation for A=95

DOE Office of Scientific and Technical Information (OSTI.GOV)

Basu, S.K.; Sonzogni, A.; Basu, Swapan Kr.

2011-08-01

A full evaluation of the mass chain A = 95 has been done in the ENSDF format taking into account all the available data until June 2009. Excited states populated by in-beam nuclear reactions and by radioactive decay have been considered. The 'evp' editor, developed at the NNDC, has been used for the evaluation. This mass chain was last evaluated in 1993. Many new and improved data were reported since then. A total of 13 nuclei have been evaluated.

E2-EPF UCP Possesses E3 Ubiquitin Ligase Activity via Its Cysteine 118 Residue.

PubMed

Lim, Jung Hwa; Shin, Hee Won; Chung, Kyung-Sook; Kim, Nam-Soon; Kim, Ju Hee; Jung, Hong-Ryul; Im, Dong-Soo; Jung, Cho-Rok

Here, we show that E2-EPF ubiquitin carrier protein (UCP) elongated E3-independent polyubiquitin chains on the lysine residues of von Hippel-Lindau protein (pVHL) and its own lysine residues both in vitro and in vivo. The initiation of the ubiquitin reaction depended on not only Lys11 linkage but also the Lys6, Lys48 and Lys63 residues of ubiquitin, which were involved in polyubiquitin chain formation on UCP itself. UCP self-association occurred through the UBC domain, which also contributed to the interaction with pVHL. The polyubiquitin chains appeared on the N-terminus of UCP in vivo, which indicated that the N-terminus of UCP contains target lysines for polyubiquitination. The Lys76 residue of UCP was the most critical site for auto-ubiquitination, whereas the polyubiquitin chain formation on pVHL occurred on all three of its lysines (Lys159, Lys171 and Lys196). A UCP mutant in which Cys118 was changed to alanine (UCPC118A) did not form a polyubiquitin chain but did strongly accumulate mono- and di-ubiquitin via auto-ubiquitination. Polyubiquitin chain formation required the coordination of Cys95 and Cys118 between two interacting molecules. The mechanism of the polyubiquitin chain reaction of UCP may involve the transfer of ubiquitin from Cys95 to Cys118 by trans-thiolation, with polyubiquitin chains forming at Cys118 by reversible thioester bonding. The polyubiquitin chains are then moved to the lysine residues of the substrate by irreversible isopeptide bonding. During the elongation of the ubiquitin chain, an active Cys118 residue is required in both parts of UCP, namely, the catalytic enzyme and the substrate. In conclusion, UCP possesses not only E2 ubiquitin conjugating enzyme activity but also E3 ubiquitin ligase activity, and Cys118 is critical for polyubiquitin chain formation.

E2-EPF UCP Possesses E3 Ubiquitin Ligase Activity via Its Cysteine 118 Residue

PubMed Central

Lim, Jung Hwa; Shin, Hee Won; Chung, Kyung-Sook; Kim, Nam-Soon; Kim, Ju Hee; Jung, Hong-Ryul; Im, Dong-Soo; Jung, Cho-Rok

2016-01-01

Here, we show that E2-EPF ubiquitin carrier protein (UCP) elongated E3-independent polyubiquitin chains on the lysine residues of von Hippel-Lindau protein (pVHL) and its own lysine residues both in vitro and in vivo. The initiation of the ubiquitin reaction depended on not only Lys11 linkage but also the Lys6, Lys48 and Lys63 residues of ubiquitin, which were involved in polyubiquitin chain formation on UCP itself. UCP self-association occurred through the UBC domain, which also contributed to the interaction with pVHL. The polyubiquitin chains appeared on the N-terminus of UCP in vivo, which indicated that the N-terminus of UCP contains target lysines for polyubiquitination. The Lys76 residue of UCP was the most critical site for auto-ubiquitination, whereas the polyubiquitin chain formation on pVHL occurred on all three of its lysines (Lys159, Lys171 and Lys196). A UCP mutant in which Cys118 was changed to alanine (UCPC118A) did not form a polyubiquitin chain but did strongly accumulate mono- and di-ubiquitin via auto-ubiquitination. Polyubiquitin chain formation required the coordination of Cys95 and Cys118 between two interacting molecules. The mechanism of the polyubiquitin chain reaction of UCP may involve the transfer of ubiquitin from Cys95 to Cys118 by trans-thiolation, with polyubiquitin chains forming at Cys118 by reversible thioester bonding. The polyubiquitin chains are then moved to the lysine residues of the substrate by irreversible isopeptide bonding. During the elongation of the ubiquitin chain, an active Cys118 residue is required in both parts of UCP, namely, the catalytic enzyme and the substrate. In conclusion, UCP possesses not only E2 ubiquitin conjugating enzyme activity but also E3 ubiquitin ligase activity, and Cys118 is critical for polyubiquitin chain formation. PMID:27685940

Effect of Heterogeneous Chemical Reactions on the Köhler Activation of Aqueous Organic Aerosols.

PubMed

Djikaev, Yuri S; Ruckenstein, Eli

2018-05-03

We study some thermodynamic aspects of the activation of aqueous organic aerosols into cloud droplets considering the aerosols to consist of liquid solution of water and hydrophilic and hydrophobic organic compounds, taking into account the presence of reactive species in the air. The hydrophobic (surfactant) organic molecules on the surface of such an aerosol can be processed by chemical reactions with some atmospheric species; this affects the hygroscopicity of the aerosol and hence its ability to become a cloud droplet either via nucleation or via Köhler activation. The most probable pathway of such processing involves atmospheric hydroxyl radicals that abstract hydrogen atoms from hydrophobic organic molecules located on the aerosol surface (first step), the resulting radicals being quickly oxidized by ubiquitous atmospheric oxygen molecules to produce surface-bound peroxyl radicals (second step). These two reactions play a crucial role in the enhancement of the Köhler activation of the aerosol and its evolution into a cloud droplet. Taking them and a third reaction (next in the multistep chain of relevant heterogeneous reactions) into account, one can derive an explicit expression for the free energy of formation of a four-component aqueous droplet on a ternary aqueous organic aerosol as a function of four independent variables of state of a droplet. The results of numerical calculations suggest that the formation of cloud droplets on such (aqueous hydrophilic/hydrophobic organic) aerosols is most likely to occur as a Köhler activation-like process rather than via nucleation. The model allows one to determine the threshold parameters of the system necessary for the Köhler activation of such aerosols, which are predicted to be very sensitive to the equilibrium constant of the chain of three heterogeneous reactions involved in the chemical aging of aerosols.

Salt Effect Accelerates Site-Selective Cysteine Bioconjugation

PubMed Central

2016-01-01

Highly efficient and selective chemical reactions are desired. For small molecule chemistry, the reaction rate can be varied by changing the concentration, temperature, and solvent used. In contrast for large biomolecules, the reaction rate is difficult to modify by adjusting these variables because stringent biocompatible reaction conditions are required. Here we show that adding salts can change the rate constant over 4 orders of magnitude for an arylation bioconjugation reaction between a cysteine residue within a four-residue sequence (π-clamp) and a perfluoroaryl electrophile. Biocompatible ammonium sulfate significantly enhances the reaction rate without influencing the site-specificity of π-clamp mediated arylation, enabling the fast synthesis of two site-specific antibody–drug conjugates that selectively kill HER2-positive breast cancer cells. Computational and structure–reactivity studies indicate that salts may tune the reaction rate through modulating the interactions between the π-clamp hydrophobic side chains and the electrophile. On the basis of this understanding, the salt effect is extended to other bioconjugation chemistry, and a new regioselective alkylation reaction at π-clamp cysteine is developed. PMID:27725962

A study on the prevalence of dog erythrocyte antigen 1.1 and detection of canine Babesia by polymerase chain reaction from apparently healthy dogs in a selected rural community in Zimbabwe.

PubMed

Dhliwayo, Solomon; Makonese, Tariro A; Whittall, Belinda; Chikerema, Silvester M; Pfukenyi, Davies M; Tivapasi, Musavenga T

2016-10-26

A study was carried out to determine the prevalence of blood group antigen dog erythrocyte antigen (DEA) 1.1 in mixed breed dogs in rural Chinamhora, Zimbabwe. DEA 1.1 is clinically the most important canine blood group as it is the most antigenic blood type; hence, DEA 1.1 antibodies are capable of causing acute haemolytic, potentially life-threatening transfusion reactions. In this study, blood samples were collected from 100 dogs in Chinamhora, and blood typing was carried out using standardised DEA 1.1 typing strips with monoclonal anti-DEA 1.1 antibodies (Alvedia® LAB DEA 1.1 test kits). Polymerase chain reaction for detecting Babesia spp. antigen was carried out on 58 of the samples. Of the 100 dogs, 78% were DEA 1.1 positive and 22% were DEA 1.1 negative. A significantly (p = 0.02) higher proportion of females (90.5%) were DEA 1.1 positive than males (69.0%). The probability of sensitisation of recipient dogs following first-time transfusion of untyped or unmatched blood was 17.2%, and an approximately 3% (2.95%) probability of an acute haemolytic reaction following a second incompatible transfusion was found. Babesia spp. antigen was found in 6.9% of the samples. No significant relationship (χ2 = 0.56, p = 0.45) was found between DEA 1.1 positivity and Babesia spp. antigen presence. Despite a low probability of haemolysis after a second incompatibility transfusion, the risk remains present and should not be ignored. Hence, where possible, blood typing for DEA 1.1 is recommended. A survey of DEA 3, 4, 5 and 7 in various breeds is also recommended.

Autoignition of hydrogen in shear flows

NASA Astrophysics Data System (ADS)

Kalbhor, Abhijit; Chaudhuri, Swetaprovo; Chitilappilly, Lazar

2018-05-01

In this paper, we compare the autoignition characteristics of laminar, nitrogen-diluted hydrogen jets in two different oxidizer flow configurations: (a) co-flowing heated air and (b) wake of heated air, using two-dimensional numerical simulations coupled with detailed chemical kinetics. In both cases, autoignition is observed to initiate at locations with low scalar dissipation rates and high HO2 depletion rates. It is found that the induction stage prior to autoignition is primarily dominated by chemical kinetics and diffusion while the improved scalar mixing imparted by the large-scale flow structures controls the ignition progress in later stages. We further investigate the ignition transience and its connection with mixing by varying the initial wake conditions and fuel jet to oxidizer velocity ratios. These studies reveal that the autoignition delay times are independent of initial wake flow conditions. However, with increased jet velocity ratios, the later stages of ignition are accelerated, mainly due to enhanced mixing facilitated by the higher scalar dissipation rates. Furthermore, the sensitivity studies for the jet in wake configuration show a significant reduction in ignition delay even for about 0.14% (by volume) hydrogen dilution in the oxidizer. In addition, the detailed autoignition chemistry and the relative roles of certain radical species in the initiation of the autoignition process in these non-premixed jets are investigated by tracking the evolution of important chain reactions using a Lagrangian particle tracking approach. The reaction H2 + O2 ↔ HO2 + H is recognized to be the dominant chain initiation reaction that provides H radicals essential for the progress of subsequent elementary reactions during the pre-ignition stage.

The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis.

PubMed

Hermes, Fatemah A; Cronan, John E

2013-10-01

The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

Improved properties of recycled polypropylene by introducing the long chain branched structure through reactive extrusion.

PubMed

Li, Yingchun; Jia, Shuai; Du, Shuanli; Wang, Yafei; Lv, Lida; Zhang, Jianbin

2018-06-01

An approach originated from preparing long chain branched polypropylene (PP) was applied to modify the properties of recycled PP that involved reactive extrusion to introduce a branched chain structure onto recycled PP under the assistance of chemical reaction between maleic anhydride (MAH) monomer and glycidyl methacrylate (GMA) grafts. The results from Fourier transformed infrared spectroscopy (FTIR) indicated the reaction took place during melt mixing, and the intensity of ester increased with increasing amount of MAH. Several rheological plots including complex viscosity, storage modulus, loss modulus, loss tangent and Cole-Cole plot were used to investigate the rheological properties of recycled PP and modified PP with MAH, which indicated an additional longer relaxation time that was not shown in recycled PP. The effects of branched structure on melting and crystallization behaviors were also investigated, demonstrating the branched chains acted as nucleating agent. Moreover, the branched structure of modified samples gave rise to enhance mechanical properties, especially, the higher impact strength compared with recycled PP. Copyright © 2018 Elsevier Ltd. All rights reserved.

Digital PCR Quantitation of Muscle Mitochondrial DNA: Age, Fiber Type, and Mutation-Induced Changes.

PubMed

Herbst, Allen; Widjaja, Kevin; Nguy, Beatrice; Lushaj, Entela B; Moore, Timothy M; Hevener, Andrea L; McKenzie, Debbie; Aiken, Judd M; Wanagat, Jonathan

2017-10-01

Definitive quantitation of mitochondrial DNA (mtDNA) and mtDNA deletion mutation abundances would help clarify the role of mtDNA instability in aging. To more accurately quantify mtDNA, we applied the emerging technique of digital polymerase chain reaction to individual muscle fibers and muscle homogenates from aged rodents. Individual fiber mtDNA content correlated with fiber type and decreased with age. We adapted a digital polymerase chain reaction deletion assay that was accurate in mixing experiments to a mutation frequency of 0.03% and quantitated an age-induced increase in deletion frequency from rat muscle homogenates. Importantly, the deletion frequency measured in muscle homogenates strongly correlated with electron transport chain-deficient fiber abundance determined by histochemical analyses. These data clarify the temporal accumulation of mtDNA deletions that lead to electron chain-deficient fibers, a process culminating in muscle fiber loss. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.