Sample records for chain reaction testing

  1. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  2. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  3. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  4. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

  5. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  6. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  7. 9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

  8. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

    PubMed

    Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

    2015-01-01

    Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

  9. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  10. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    PubMed

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  11. Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

    PubMed

    Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

    2018-04-25

    In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

  12. Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

    PubMed

    Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

    2013-08-01

    Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

  13. Problem-Solving Test: Pyrosequencing

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2013-01-01

    Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…

  14. Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

    PubMed

    Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

    2012-12-01

    Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  15. [THE COMPARATIVE ANALYSIS OF EFFECTIVENESS OF QUICK TESTS IN DIAGNOSTIC OF INFLUENZA AND RESPIRATORY SYNCYTIAL VIRAL INFECTION IN CHILDREN].

    PubMed

    Petrova, E R; Sukhovetskaia, V P; Pisareva, M M; Maiorova, V G; Sverlova, M V; Danilenko, D M; Petrova, P A; Krivitskaia, V Z; Sominina, A A

    2015-11-01

    The analysis was implemented concerning diagnostic parameters of commercial quick tests (immune chromatographic tests BinaxNOW Influenza A&B and BinaxNow RSV Alere, Scarborough Inc., USA) under detection of antigens of influenza virus A and respiratory syncytial virus in clinical materials. The polymerase chain reaction in real-time and isolation ofviruses in cell cultures. The analysis of naso-pharyngeal smears from 116 children demonstrated that sensitivity and specifcity of detection of influenza virus A using device mariPOC in comparison with polymerase chain reaction made up to 93.8% and 99.0% correspondingly at total concordance of results of both techniques as 98.3%. At diagnosing of respiratory syncytial virus using device mariPOC parameters made up to 77.3%, 98.9% and 862% as compared with polymerase chain reaction. The sensitivity, specificity and total concordance of results of immune chromatographic tests BinaxNOW in comparison ofpolymerase chain reaction made up to 86.7%, 100% and 96.2% correspondingly at detection of influenza virus A and 80.9%, 97.4% and 91.6% correspondingly at detection of respiratory syncytial virus. In comparison with isolation technique in cell cultures sensitivity of system mariPOC and immune chromatographic tests proved to be in 1.3-1.4 times higher at detection of influenza virus A and in 1.7-2 times higher in case of isolation of respiratory syncytial virus. There is no statistically significant differences between diagnostic parameters received for mariPOC and immune chromatographic tests at diagnosing influenza virus A and respiratory syncytial viral infection.

  16. Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

    PubMed

    Bridge, Julia A

    2017-01-01

    The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

  17. Tested Demonstrations.

    ERIC Educational Resources Information Center

    Gilbert, George L., Ed.

    1983-01-01

    Free radical chlorination of methane is used in organic chemistry to introduce free radical/chain reactions. In spite of its common occurrence, demonstrations of the reaction are uncommon. Therefore, such a demonstration is provided, including background information, preparation of reactants/reaction vessel, introduction of reactants, irradiation,…

  18. An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.

    PubMed

    Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján

    2016-02-20

    In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Immediate hypersensitivity to moxifloxacin with tolerance to ciprofloxacin: report of three cases and review of the literature.

    PubMed

    Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth

    2010-04-01

    To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.

  20. Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

    PubMed Central

    Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

    2015-01-01

    Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

  1. Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

    PubMed

    Chen, Y T; Mercer, G O; Chen, Y

    1993-11-01

    Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

  2. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

    PubMed

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

    2014-03-01

    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

  3. Polymer-based microfluidic chips for isothermal amplification of nucleic acids

    NASA Astrophysics Data System (ADS)

    Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

    2017-11-01

    Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

  4. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

    PubMed

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

    2014-04-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

  5. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

    PubMed Central

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

    2014-01-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

  6. Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

    USDA-ARS?s Scientific Manuscript database

    The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

  7. Amplification of ST50 gene using dry-reagent-based polymerase chain reaction for the detection of Salmonella typhi.

    PubMed

    Aziah, Ismail; Ravichandran, Manickam; Ismail, Asma

    2007-12-01

    Conventional polymerase chain reaction (PCR) testing requires many pipetting steps and has to be transported and stored in cold chain. To overcome these limitations, we designed a ready-to-use PCR test for Salmonella typhi using PCR reagents, primers against the ST50 gene of S. typhi, a built-in internal amplification control (IAC), and gel loading dye mixed and freeze-dried in a single tube. The 2-step dry-reagent-based assay was used to amplify a 1238-bp target gene and an 810-bp IAC gene from 73 BACTEC blood culture broths (33 true positives for S. typhi and 40 true negatives for non-S. typhi). The sensitivity, specificity, positive predictive value, and negative predictive value of the PCR assay were 87.9%, 100%, 100%, and 90.9%, respectively. We suggest that this rapid 2-step PCR test could be used for the rapid diagnosis of typhoid fever.

  8. Sensitivity, specificity and comparison of three commercially available immunological tests in the diagnosis of Cryptosporidium species in animals.

    PubMed

    Danišová, Olga; Halánová, Monika; Valenčáková, Alexandra; Luptáková, Lenka

    The study was conducted to compare the specificity of immunological diagnostic methods used for the diagnosis of Cryptosporidium species capable of causing life-threatening infection in both immunosuppressed and immunocompetent patients. For the detection of Cryptosporidium species in 79 animals with diarrhoea, we used three Copro-antigen tests: RIDASCREEN ® Cryptosporidium test, Cryptosporidium 2nd Generation (ELISA) and RIDA ® QUICK Cryptosporidium. For immunoassays we used positive and negative samples detected by means of polymerase chain reaction and validated by sequencing and nested polymerase chain reaction to confirm the presence six different species of Cryptosporidium species. Prevalence of cryptosporidiosis in the entire group determined by enzyme immunoassay, enzyme linked immunosorbent assay, immuno-chromatographic test and polymerase chain reaction was 34.17%, 27.84%, 6.33% and 27.84%, respectively. Sensitivity of animal samples with enzyme immunoassay, enzyme linked immunosorbent assay, and immuno-chromatographic test was 63.6%, 40.9% and 22.7%, resp., when questionable samples were considered positive, whereas specificity of enzyme immunoassay, enzyme linked immunosorbent assay and immuno-chromatographic test was 75.9%, 78.9% and 100%, respectively. Positive predictive values and negative predictive values were different for all the tests. These differences results are controversial and therefore reliability and reproducibility of immunoassays as the only diagnostic method is questionable. The use of various Cryptosporidium species in diagnosis based on immunological testing and different results obtained by individual tests indicate potential differences in Copro-antigens produced by individual Cryptosporidium species. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  9. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

  10. Blood grouping based on PCR methods and agarose gel electrophoresis.

    PubMed

    Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

    2015-01-01

    The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

  11. 9 CFR 145.14 - Testing.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... immunosorbent assay test (ELISA), or the rapid serum test for all poultry; and the stained antigen, rapid whole... test or enzyme-labeled immunosorbent assay test (ELISA), or blood from birds that react on the stained... enzyme-linked immunosorbent assay (ELISA) test,3 a polymerase chain reaction (PCR)-based test, or a...

  12. 9 CFR 145.14 - Testing.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... immunosorbent assay test (ELISA), or the rapid serum test for all poultry; and the stained antigen, rapid whole... test or enzyme-labeled immunosorbent assay test (ELISA), or blood from birds that react on the stained... enzyme-linked immunosorbent assay (ELISA) test,3 a polymerase chain reaction (PCR)-based test, or a...

  13. 9 CFR 145.14 - Testing.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... immunosorbent assay test (ELISA), or the rapid serum test for all poultry; and the stained antigen, rapid whole... test or enzyme-labeled immunosorbent assay test (ELISA), or blood from birds that react on the stained... enzyme-linked immunosorbent assay (ELISA) test,3 a polymerase chain reaction (PCR)-based test, or a...

  14. THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST

    PubMed Central

    Keil, Harry; Wasserman, David; Dawson, Charles R.

    1944-01-01

    1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415

  15. THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST.

    PubMed

    Keil, H; Wasserman, D; Dawson, C R

    1944-10-01

    1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.

  16. Detection of coliform bacteria and Escherichia coli by multiplex polymerase chain reaction: comparison with defined substrate and plating methods for water quality monitoring.

    PubMed Central

    Bej, A K; McCarty, S C; Atlas, R M

    1991-01-01

    Multiplex polymerase chain reaction (PCR) and gene probe detection of target lacZ and uidA genes were used to detect total coliform bacteria and Escherichia coli, respectively, for determining water quality. In tests of environmental water samples, the lacZ PCR method gave results statistically equivalent to those of the plate count and defined substrate methods accepted by the U.S. Environmental Protection Agency for water quality monitoring and the uidA PCR method was more sensitive than 4-methylumbelliferyl-beta-D-glucuronide-based defined substrate tests for specific detection of E. coli. Images PMID:1768116

  17. Infectious agent screening in canine blood donors in the United Kingdom.

    PubMed

    Crawford, K; Walton, J; Lewis, D; Tasker, S; Warman, S M

    2013-08-01

    Transfusion of blood products is an important component of veterinary emergency medicine. Donors must be carefully selected to minimise risk of transmission of blood-borne infectious agents. This study was devised to assess the prevalence of such agents in healthy, non-travelled UK dogs screened as prospective donors. Ethylenediaminetetraacetic acid blood samples from dogs donating blood between August 2007 and January 2012 were screened by polymerase chain reaction for haemotropic mycoplasmas, Bartonella, Babesia, Leishmania, Ehrlichia and Anaplasma spp. Dogs with positive or inconclusive results underwent repeat polymerase chain reaction testing. Four of 262 dogs had positive or inconclusive results at initial screening. Repeat polymerase chain reaction testing in each dog was negative, and none of the dogs developed clinical signs of disease. The positive results on initial screening may have represented false positives from sample contamination or amplification of non-target DNA. It is also possible that dogs were infected at initial sampling but successfully cleared infection before repeat testing. The low number of positive results obtained suggests that prevalence of these agents in a population of healthy UK dogs is low and that use of blood products is unlikely to represent a significant risk of transmission of these diseases. © 2013 British Small Animal Veterinary Association.

  18. Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

    PubMed

    Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

    2014-01-01

    Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  19. Sustained high-throughput polymerase chain reaction diagnostics during the European epidemic of Bluetongue virus serotype 8.

    PubMed

    van Rijn, Piet A; Heutink, René G; Boonstra, Jan; Kramps, Hans A; van Gennip, René G P

    2012-05-01

    A real-time reverse transcription polymerase chain reaction assay (PCR test) based on genome segment 10 of Bluetongue virus (BTV) was developed. The PCR test consists of robotized viral RNA isolation from blood samples and an all-in-one method including initial denaturation of genomic double-stranded RNA, reverse transcription polymerase chain reaction (RT-PCR), and real-time detection and analysis. Reference strains of the 24 recognized BTV serotypes, isolates from different years, and geographic origins were detected. Other orbiviruses such as African horse sickness virus, Epizootic hemorrhagic disease virus, and Equine encephalosis virus were not detected. Experimentally infected animals were PCR positive from 2 days postinoculation, which was earlier than fever, other clinical signs, or seroconversion. The diagnostic sensitivity and specificity were very close to or even 100%. The PCR test played a key role in the detection of BTV serotype 8 in August 2006 in The Netherlands. The outbreak in a completely naive ruminant population allowed for further evaluation of the PCR test with field samples. In 2006, the correlation between enzyme-linked immunosorbent assay and PCR results was estimated to be 95%. In the following years, the PCR test was used for diagnosis of diseased animals, for testing of healthy animals for trade purposes, and for detection of BTV RNA in different species of the insect vector, Culicoides. In the autumn of 2008, BTV serotype 6 unexpectedly emerged in northwest Europe and was also detected with the PCR test developed in the current study. The performance in routine use over 5 years has been recorded and evaluated.

  20. Screening test recommendations for methicillin-resistant Staphylococcus aureus surveillance practices: A cost-minimization analysis.

    PubMed

    Whittington, Melanie D; Curtis, Donna J; Atherly, Adam J; Bradley, Cathy J; Lindrooth, Richard C; Campbell, Jonathan D

    2017-07-01

    To mitigate methicillin-resistant Staphylococcus aureus (MRSA) infections, intensive care units (ICUs) conduct surveillance through screening patients upon admission followed by adhering to isolation precautions. Two surveillance approaches commonly implemented are universal preemptive isolation and targeted isolation of only MRSA-positive patients. Decision analysis was used to calculate the total cost of universal preemptive isolation and targeted isolation. The screening test used as part of the surveillance practice was varied to identify which screening test minimized inappropriate and total costs. A probabilistic sensitivity analysis was conducted to evaluate the range of total costs resulting from variation in inputs. The total cost of the universal preemptive isolation surveillance practice was minimized when a polymerase chain reaction screening test was used ($82.51 per patient). Costs were $207.60 more per patient when a conventional culture was used due to the longer turnaround time and thus higher isolation costs. The total cost of the targeted isolation surveillance practice was minimized when chromogenic agar 24-hour testing was used ($8.54 per patient). Costs were $22.41 more per patient when polymerase chain reaction was used. For ICUs that preemptively isolate all patients, the use of a polymerase chain reaction screening test is recommended because it can minimize total costs by reducing inappropriate isolation costs. For ICUs that only isolate MRSA-positive patients, the use of chromogenic agar 24-hour testing is recommended to minimize total costs. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  1. Analytical validation of a real-time reverse transcription polymerase chain reaction test for Pan-American lineage H7 subtype Avian influenza viruses

    USGS Publications Warehouse

    Spackman, Erica; Ip, Hon S.; Suarez, D.L.; Slemons, R.D.; Stallknecht, D.E.

    2008-01-01

    A real-time reverse transcription polymerase chain reaction test for the identification of the H7 subtype in North American Avian influenza viruses (AIVs) was first reported in 2002; however, recent AIV surveillance efforts in wild birds and H7 outbreaks in poultry demonstrated that the 2002 test did not detect all H7 AIVs present in North and South America. Therefore, a new test, the 2008 Pan-American H7 test, was developed by using recently available H7 nucleotide sequences. The analytical specificity of the new assay was characterized with an RNA panel composed of 19 H7 viruses from around the world and RNA from all hemagglutinin subtypes except H16. Specificity for North and South American lineage H7 viruses was observed. Assay limits of detection were determined to be between 103 and 104 gene copies per reaction with in vitro transcribed RNA, and 100.0 and 10 0.8 50% egg infectious doses per reaction. The 2008 Pan-American H7 test also was shown to perform similarly to the 2002 test with specimens from chickens experimentally exposed to A/Chicken/BritishColumbia/314514-2/04 H7N3 highly pathogenic AIV. Furthermore, the 2008 test was able to detect 100% (n = 27) of the H7 AIV isolates recovered from North American wild birds in a 2006-2007 sample set (none of which were detected by the 2002 H7 test).

  2. Pooling Cervical Swabs and Testing by Ligase Chain Reaction Are Accurate and Cost-Saving Strategies for Diagnosis of Chlamydia trachomatis

    PubMed Central

    Kapala, J.; Copes, D.; Sproston, A.; Patel, J.; Jang, D.; Petrich, A.; Mahony, J.; Biers, K.; Chernesky, M.

    2000-01-01

    Specimen pooling to achieve efficiency when testing urine specimens for Chlamydia trachomatis nucleic acids has been suggested. We pooled endocervical swabs from 1,288 women and also tested individual swabs by ligase chain reaction (LCR). Out of 53 positive specimens, pools of 4 or 8 specimens missed two positives, providing 96.2% accuracy compared to individual test results. Dilution and positive-control spiking experiments showed that negative specimens with inhibitors of LCR in the pool reduced the signal. Conversely, two extra positives, detected only through pooling, were negative by individual testing but became positive after storage, suggesting that fresh positive specimens with labile inhibitors may be positive in a pool because of dilution of inhibitors. For this population of women with a 4% prevalence of C. trachomatis infection, substantial savings in cost of reagents (55 to 63%) and technologist time (50 to 63%) made pooling strategies a desirable alternative to individual testing. PMID:10878029

  3. Biodiesel production from triolein and short chain alcohols through biocatalysis.

    PubMed

    Salis, Andrea; Pinna, Marcella; Monduzzi, Maura; Solinas, Vincenzo

    2005-09-29

    Oleic acid alkyl esters (biodiesel) were synthesised by biocatalysis in solvent-free conditions. Different commercial immobilised lipases, namely Candida antarctica B, Rizhomucor miehei, and Pseudomonas cepacia, were tested towards the reaction between triolein and butanol to produce butyl oleate. Pseudomonas cepacia lipase resulted to be the most active enzyme reaching 100% of conversion after 6h. Different operative conditions such as reaction temperature, water activity, and reagent stoichiometric ratio were investigated and optimised. These conditions were then used to investigate the effect of linear and branched short chain alcohols. Methanol and 2-butanol were the worst alcohols: the former, probably, due to its low miscibility with the oil and the latter because secondary alcohols usually are less reactive than primary alcohols. Conversely, linear and branched primary alcohols with short alkyl chains (C(2)--C(4)) showed high reaction rate and conversion. A mixture of linear and branched short chain alcohols that mimics the residual of ethanol distillation (fusel oil) was successfully used for oleic acid ester synthesis. These compounds are important in biodiesel mixtures since they improve low temperature properties.

  4. Simple model of inhibition of chain-branching combustion processes

    NASA Astrophysics Data System (ADS)

    Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.

    2017-11-01

    A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.

  5. Vanadium accelerates polymerase chain reaction and expands the applicability of forensic DNA testing.

    PubMed

    Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko

    2013-05-01

    Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  6. Chain-reaction crash in traffic flow controlled by taillights

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-02-01

    We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.

  7. Bi-parentally inherited species-specific markers identify hybridization between rainbow trout and cutthroat trout subspecies

    USGS Publications Warehouse

    Ostberg, C.O.; Rodriguez, R.J.

    2004-01-01

    Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.

  8. [Identification of human pathogenic variola and monkeypox viruses by real-time polymerase chain reaction].

    PubMed

    Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N

    2009-01-01

    A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.

  9. Polymerase chain reaction technology as analytical tool in agricultural biotechnology.

    PubMed

    Lipp, Markus; Shillito, Raymond; Giroux, Randal; Spiegelhalter, Frank; Charlton, Stacy; Pinero, David; Song, Ping

    2005-01-01

    The agricultural biotechnology industry applies polymerase chain reaction (PCR) technology at numerous points in product development. Commodity and food companies as well as third-party diagnostic testing companies also rely on PCR technology for a number of purposes. The primary use of the technology is to verify the presence or absence of genetically modified (GM) material in a product or to quantify the amount of GM material present in a product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains. The document highlights the many areas to which attention must be paid in order to produce reliable test results. These include sample preparation, method validation, choice of appropriate reference materials, and biological and instrumental sources of error. The article also discusses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  10. ONR Far East Scientific Information Bulletin

    DTIC Science & Technology

    1990-09-01

    In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by

  11. A chain reaction approach to modelling gene pathways.

    PubMed

    Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

    2012-08-01

    BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By applying it to microarray data, the chain reaction model computed a set of reaction rates to examine the effects of three polyphenols (EGCG, genistein, and resveratrol) on gene expression in this pathway during puberty. We first performed statistical analysis to test the time factor on the estrogen synthesis pathway. Global tests were used to evaluate an overall gene expression change during puberty for each experimental group. Then, a chain reaction model was employed to simulate the estrogen synthesis pathway. Specifically, the model computed the reaction rates in a set of ordinary differential equations to describe interactions between genes in the pathway (A reaction rate K of A to B represents gene A will induce gene B per unit at a rate of K; we give details in the "method" section). Since disparate changes of gene expression may cause numerical error problems in solving these differential equations, we used an implicit scheme to address this issue. We first applied the chain reaction model to obtain the reaction rates for the control group. A sensitivity study was conducted to evaluate how well the model fits to the control group data at Day 50. Results showed a small bias and mean square error. These observations indicated the model is robust to low random noises and has a good fit for the control group. Then the chain reaction model derived from the control group data was used to predict gene expression at Day 50 for the three polyphenol groups. If these nutrients affect the estrogen synthesis pathways during puberty, we expect discrepancy between observed and expected expressions. Results indicated some genes had large differences in the EGCG (e.g., Hsd3b and Sts) and the resveratrol (e.g., Hsd3b and Hrmt12) groups. CONCLUSIONS: In the present study, we have presented (I) experimental studies of the effect of nutrient diets on the gene expression changes in a selected estrogen synthesis pathway. This experiment is valuable because it allows us to examine how the nutrient-containing diets regulate gene expression in the estrogen synthesis pathway during puberty; (II) global tests to assess an overall association of this particular pathway with time factor by utilizing generalized linear models to analyze microarray data; and (III) a chain reaction model to simulate the pathway. This is a novel application because we are able to translate the gene pathway into the chemical reactions in which each reaction channel describes gene-gene relationship in the pathway. In the chain reaction model, the implicit scheme is employed to efficiently solve the differential equations. Data analysis results show the proposed model is capable of predicting gene expression changes and demonstrating the effect of nutrient-containing diets on gene expression changes in the pathway. One of the objectives of this study is to explore and develop a numerical approach for simulating the gene expression change so that it can be applied and calibrated when the data of more time slices are available, and thus can be used to interpolate the expression change at a desired time point without conducting expensive experiments for a large amount of time points. Hence, we are not claiming this is either essential or the most efficient way for simulating this problem, rather a mathematical/numerical approach that can model the expression change of a large set of genes of a complex pathway. In addition, we understand the limitation of this experiment and realize that it is still far from being a complete model of predicting nutrient-gene interactions. The reason is that in the present model, the reaction rates were estimated based on available data at two time points; hence, the gene expression change is dependent upon the reaction rates and a linear function of the gene expressions. More data sets containing gene expression at various time slices are needed in order to improve the present model so that a non-linear variation of gene expression changes at different time can be predicted.

  12. Effect of perception irregularity on chain-reaction crash in low visibility

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-06-01

    We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.

  13. Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources.

    PubMed

    Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

    2017-01-01

    Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli . PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources.

  14. Chain-reaction crash on a highway in high visibility

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2016-05-01

    We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

  15. Hydrolysis of the amorphous cellulose in cotton-based paper.

    PubMed

    Stephens, Catherine H; Whitmore, Paul M; Morris, Hannah R; Bier, Mark E

    2008-04-01

    Hydrolysis of cellulose in Whatman no. 42 cotton-based paper was studied using gel permeation chromatography (GPC), electrospray ionization-mass spectrometry (ESI-MS), and uniaxial tensile testing to understand the course and kinetics of the reaction. GPC results suggested that scission reactions passed through three stages. Additionally, the evolution of soluble oligomers in the ESI-MS data and the steady course of strength loss showed that the hydrolysis reaction occurred at a constant rate. These findings are explained with a more detailed description of the cellulose hydrolysis, which includes multiple chain scissions on amorphous segments. The breaks occur with increasing frequency near the ends of amorphous segments, where chains protrude from crystalline domains. Oligomers unattached to crystalline domains are eventually created. Late-stage reactions near the ends of amorphous segments produce a kinetic behavior that falsely suggests that hydrolysis had ceased. Monte Carlo simulations of cellulose degradation corroborated the experimental findings.

  16. Effect of vehicular size on chain-reaction crash

    NASA Astrophysics Data System (ADS)

    Nagatani, Takashi

    2015-11-01

    We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

  17. Kinetic aspects of chain growth in Fischer-Tropsch synthesis.

    PubMed

    Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M

    2017-04-28

    Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.

  18. Prevalence of human immunodeficiency virus type 1 p24 antigen in U.S. blood donors--an assessment of the efficacy of testing in donor screening. The HIV-Antigen Study Group.

    PubMed

    Alter, H J; Epstein, J S; Swenson, S G; VanRaden, M J; Ward, J W; Kaslow, R A; Menitove, J E; Klein, H G; Sandler, S G; Sayers, M H

    1990-11-08

    We performed a multicenter study in 1989 to determine whether screening whole-blood donors for human immunodeficiency virus type 1 (HIV-1) p24 antigen would improve transfusion safety by identifying carriers of the virus who are seronegative for HIV-1 antibody. More than 500,000 donations were tested at 13 U.S. blood centers with test kits from two manufacturers. Units found repeatedly reactive were retested in a central laboratory; if the results were positive, they were confirmed by a neutralization assay. A subgroup of units was also tested for HIV-1 by the polymerase chain reaction. Selected donors confirmed or not confirmed as having p24 antigen were contacted for follow-up interviews to identify risk factors and undergo retesting for HIV-1 markers. Positive tests for p24 antigen were confirmed by neutralization in five donors (0.001 percent of all donations tested), all of whom were also positive for HIV-1 antibody and HIV-1 by polymerase chain reaction. Three of the antigen-positive donors had other markers of infectious disease that would have resulted in the exclusion of their blood; two had risk factors for HIV-1 that should have led to self-exclusion. Of 220 blood units with repeatedly reactive p24 antigen whose presence could not be confirmed by neutralization (0.04 percent of the donations studied), none were positive for HIV-1 antibody, HIV-1 by polymerase chain reaction (120 units tested), or virus culture (76 units tested)--attesting to the specificity of confirmatory neutralization. The finding that no donation studied was positive for p24 antigen and negative for HIV-1 antibody suggests that screening donors for p24 antigen with tests of the current level of sensitivity would not add substantially to the safety of the U.S. blood supply.

  19. Diagnosis of feline leukaemia virus infection by semi-quantitative real-time polymerase chain reaction.

    PubMed

    Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine

    2007-02-01

    In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.

  20. Large pathogenic expansions in the SCA2 and SCA7 genes can be detected by fluorescent repeat-primed polymerase chain reaction assay.

    PubMed

    Cagnoli, Claudia; Stevanin, Giovanni; Michielotto, Chiara; Gerbino Promis, Giovanni; Brussino, Alessandro; Pappi, Patrizia; Durr, Alexandra; Dragone, Elisa; Viemont, Michelle; Gellera, Cinzia; Brice, Alexis; Migone, Nicola; Brusco, Alfredo

    2006-02-01

    Large expansions in the SCA2 and SCA7 genes (>100 CAG repeats) have been associated with juvenile and infantile forms of cerebellar ataxias that cannot be detected using standard polymerase chain reaction (PCR). Here, we describe a successful application of the fluorescent short tandem repeat-primed PCR method for accurate identification of these expanded repeats. The test is robust, reliable, and inexpensive and can be used to screen large series of patients, although it cannot give a precise evaluation of the size of the expansion. This test may be of practical value in prenatal diagnoses offered to affected or pre-symptomatic at-risk parents, in which a very large expansion inherited from one of the parents can be missed in the fetus by standard PCR.

  1. Large Pathogenic Expansions in the SCA2 and SCA7 Genes Can Be Detected by Fluorescent Repeat-Primed Polymerase Chain Reaction Assay

    PubMed Central

    Cagnoli, Claudia; Stevanin, Giovanni; Michielotto, Chiara; Gerbino Promis, Giovanni; Brussino, Alessandro; Pappi, Patrizia; Durr, Alexandra; Dragone, Elisa; Viemont, Michelle; Gellera, Cinzia; Brice, Alexis; Migone, Nicola; Brusco, Alfredo

    2006-01-01

    Large expansions in the SCA2 and SCA7 genes (>100 CAG repeats) have been associated with juvenile and infantile forms of cerebellar ataxias that cannot be detected using standard polymerase chain reaction (PCR). Here, we describe a successful application of the fluorescent short tandem repeat-primed PCR method for accurate identification of these expanded repeats. The test is robust, reliable, and inexpensive and can be used to screen large series of patients, although it cannot give a precise evaluation of the size of the expansion. This test may be of practical value in prenatal diagnoses offered to affected or pre-symptomatic at-risk parents, in which a very large expansion inherited from one of the parents can be missed in the fetus by standard PCR. PMID:16436644

  2. Tuberculous otitis media: a resurgence?

    PubMed

    Kameswaran, M; Natarajan, K; Parthiban, M; Krishnan, P V; Raghunandhan, S

    2017-09-01

    Tuberculosis is a global health problem that is especially prevalent in developing countries such as India. Recently, atypical presentation has become more common and a high index of suspicion is essential. This study analysed the various presenting symptoms and signs of tuberculous otitis media and the role of diagnostic tests, with the aim of formulating criteria for the diagnosis. A total of 502 patients underwent tympanomastoidectomy over a two-year period. Microbiological and histopathological examinations and polymerase chain reaction analysis of tissue taken during tympanomastoidectomy were performed. A total of 25 patients (5 per cent) were diagnosed with tuberculous otitis media. Severe mixed hearing loss, facial palsy, labyrinthine fistula, post-aural fistula, perichondritis and extradural abscess were noted. There seems to be a resurgence in tuberculous otitis media in India. Microbiological, histopathological and polymerase chain reaction tests for tuberculosis are helpful for its diagnosis.

  3. Development of the polymerase chain reaction for diagnosis of chancroid.

    PubMed Central

    Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R

    1993-01-01

    The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959

  4. Absence of giant blood Marseille-like virus DNA detection by polymerase chain reaction in plasma from healthy US blood donors and serum from multiply transfused patients from Cameroon.

    PubMed

    Phan, Tung Gia; Desnues, Christelle; Switzer, William M; Djoko, Cyrille F; Schneider, Bradley S; Deng, Xutao; Delwart, Eric

    2015-06-01

    A new Marseilleviridae virus family member, giant blood Marseille-like (GBM) virus, was recently reported in persons from France in the serum of an infant with adenitis, in the blood of 4% of healthy blood donors, and in 9% of multiply transfused thalassemia patients. These results suggested the presence of a nucleocytoplasmic large DNA virus potentially transmissible by blood product transfusion. To investigate this possibility we tested the plasma from 113 US blood donors and 74 multiply transfused Cameroon patients for GBM viral DNA using highly sensitive polymerase chain reaction (PCR) assays. GBM DNA was not detected by nested PCR in any of these 187 human specimens. Further testing is required to confirm the occurrence of human GBM virus infections. © 2015 AABB.

  5. RICIN-inhibitor design. Final report, 15 April 1993-14 April 1996

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schramm, V.L.

    1996-05-01

    The purpose of this proposal was to provide information which will permit the design of transition state inhibitors for ricin A-chain. The original goals were to solve the transition state structure based on kinetic isotope effects. Substrates were synthesized and the conditions for assays optimized to provide catalytic rates at least 1000 fold greater than those published prior to this work. Reliable assay methods have been established to permit routine assays for ricin A-chain. Substrate analogues for N-ribohydrolase reactions have been designed to establish whether the reaction involves leaving-group activation or oxycarbonium ion formation. Based on these results, leaving groupmore » activation is a major contributor and oxycarbonium-ion formation is a secondary contribution in the mechanism of catalysis by ricin A-chain. Using this information, the first submicromolar inhibitor of ricin A-chain has been synthesized, tested and kinetically characterized. The development of powerful inhibitors will be a direct extrapolation of these results.« less

  6. Susceptibility Testing by Polymerase Chain Reaction DNA Quantitation: A Method to Measure Drug Resistance of Human Immunodeficiency Virus Type 1 Isolates

    NASA Astrophysics Data System (ADS)

    Eron, Joseph J.; Gorczyca, Paul; Kaplan, Joan C.; D'Aquila, Richard T.

    1992-04-01

    Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing rapidly and directly measures nucleoside sensitivity of human immunodeficiency virus type 1 (HIV-1) isolates. PCR is used to quantitate the amount of HIV-1 DNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of HIV-1 DNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. The results of PDQ susceptibility testing of 2- or 3-day cultures are supported by assays measuring HIV-1 p24 antigen production in supernatants of 7- or 10-day cultures. DNA sequence analyses to identify mutations in the reverse transcriptase gene that cause resistance to 3'-azido-3'-deoxythymidine also support the PDQ results. With the PDQ method, both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells. PDQ susceptibility testing should facilitate epidemiologic studies of the clinical significance of drug-resistant HIV-1 isolates.

  7. Optimizing Virus Identification in Critically Ill Children Suspected of Having an Acute Severe Viral Infection.

    PubMed

    Randolph, Adrienne G; Agan, Anna A; Flanagan, Ryan F; Meece, Jennifer K; Fitzgerald, Julie C; Loftis, Laura L; Truemper, Edward J; Li, Simon; Ferdinands, Jill M

    2016-04-01

    Multiplex rapid viral tests and nasopharyngeal flocked swabs are increasingly used for viral testing in PICUs. This study aimed at evaluating how the sampling site and the type of diagnostic test influence test results in children with suspected severe viral infection. Prospective cohort study. PICUs at 21 tertiary pediatric referral centers in the United States. During the 2010-2011 and 2011-2012 influenza seasons, we enrolled children (6 mo to 17 yr old) who were suspected to have severe viral infection. We collected samples by using a standardized protocol for nasopharyngeal aspirate and nasopharyngeal flocked swabs in nonintubated patients and for endotracheal tube aspirate and nasopharyngeal flocked swabs in intubated patients. Viral testing included a single reverse transcription-polymerase chain reaction influenza test and the GenMark Respiratory Viral Panel (20 viruses). We enrolled 90 endotracheally intubated and 133 nonintubated children. We identified influenza in 45 patients with reverse transcription-polymerase chain reaction testing; the multiplex panel was falsely negative for influenza in two patients (4.4%). Six patients (13.3%) had not been diagnosed with influenza in the PICU. Non-influenza viruses were identified in 172 of 223 children (77.1%). In nonintubated children, the same virus was identified by nasopharyngeal flocked swabs and nasopharyngeal aspirate in 133 of 183 paired samples (72.7%), with +nasopharyngeal aspirate/-nasopharyngeal flocked swabs in 32 of 183 paired samples (17.4%). In intubated children, the same virus was identified by nasopharyngeal flocked swabs and endotracheal tube aspirate in 67 of 94 paired samples (71.3%), with +nasopharyngeal flocked swabs/- endotracheal tube aspirate in 22 of 94 paired samples (23.4%). Most discrepancies were either adenovirus or rhinovirus in both groups. Standardized specimen collection and sensitive diagnostic testing with a reverse transcription-polymerase chain reaction increased the identification of influenza in critically ill children. For most pathogenic viruses identified, results from nasopharyngeal flocked swabs agreed with those from nasopharyngeal or endotracheal aspirates.

  8. Multisite analytic performance studies of a real-time polymerase chain reaction assay for the detection of BRAF V600E mutations in formalin-fixed, paraffin-embedded tissue specimens of malignant melanoma.

    PubMed

    Anderson, Steven; Bloom, Kenneth J; Vallera, Dino U; Rueschoff, Josef; Meldrum, Cliff; Schilling, Robert; Kovach, Barbara; Lee, Ju Ruey-Jiuan; Ochoa, Pam; Langland, Rachel; Halait, Harkanwal; Lawrence, H Jeffrey; Dugan, Michael C

    2012-11-01

    A polymerase chain reaction-based companion diagnostic (cobas 4800 BRAF V600 Mutation Test) was recently approved by the US Food and Drug Administration to select patients with BRAF-mutant metastatic melanoma for treatment with the BRAF inhibitor vemurafenib. (1) To compare the analytic performance of the cobas test to Sanger sequencing by using screening specimens from phase II and phase III trials of vemurafenib, and (2) to assess the reproducibility of the cobas test at different testing sites. Specimens from 477 patients were used to determine positive and negative percent agreements between the cobas test and Sanger sequencing for detecting V600E (1799T>A) mutations. Specimens were evaluated with a massively parallel pyrosequencing method (454) to resolve discordances between polymerase chain reaction and Sanger results. Reproducibility of the cobas test was assessed at 3 sites by using 3 reagent lots and an 8-member panel of melanoma samples. A valid cobas result was obtained for all eligible patients. Sanger sequencing had a failure rate of 9.2% (44 of 477). For the remaining 433 specimens, positive percent agreement was 96.4% (215 of 223) and negative percent agreement, 80% (168 of 210). Among 42 cobas mutation-positive/Sanger V600E-negative specimens, 17 were V600E positive and 24 were V600K positive by 454. The cobas test detected 70% of V600K mutations. In the reproducibility study, a correct interpretation was made for 100% of wild-type specimens and specimens with greater than 5% mutant alleles; V600E mutations were detected in 90% of specimens with less than 5% mutant alleles. The cobas test (1) had a lower assay failure rate than that of Sanger, (2) was more sensitive in detecting V600E mutations, (3) detected most V600K mutations, and (4) was highly reproducible.

  9. Testing for Genetically Modified Foods Using PCR

    ERIC Educational Resources Information Center

    Taylor, Ann; Sajan, Samin

    2005-01-01

    The polymerase chain reaction (PCR) is a Nobel Prize-winning technique that amplifies a specific segment of DNA and is commonly used to test for the presence of genetic modifications. Students use PCR to test corn meal and corn-muffin mixes for the presence of a promoter commonly used in genetically modified foods, the cauliflower mosaic virus 35S…

  10. Detection of Brucella spp. in milk from seronegative cows by real-time polymerase chain reaction in the region of Batna, Algeria

    PubMed Central

    Sabrina, Rabehi; Mossadak, Hamdi Taha; Bakir, Mamache; Asma, Meghezzi; Khaoula, Boushaba

    2018-01-01

    Aim: The aim of this study was to detect Brucella spp. DNA in milk samples collected from seronegative cows using the real-time polymerase chain reaction (PCR) assay for diagnosis of brucellosis in seronegative dairy cows to prevent transmission of disease to humans and to reduce economic losses in animal production. Materials and Methods: In this study, 65 milk samples were investigated for the detection of Brucella spp. The detection of the IS711 gene in all samples was done by real-time PCR assay by comparative cycle threshold method. Results: The results show that of the 65 DNA samples tested, 2 (3.08%) were positive for Brucella infection. The mean cyclic threshold values of IS711 real-time PCR test were 37.97 and 40.48, indicating a positive reaction. Conclusion: The results of the present study indicated that the real-time PCR appears to offer several advantages over serological tests. For this reason, the real-time PCR should be validated on representative numbers of Brucella-infected and free samples before being implemented in routine diagnosis in human and animal brucellosis for controlling this disease. PMID:29657430

  11. Recombinase Polymerase Amplification Compared to Real-Time Polymerase Chain Reaction Test for the Detection of Fasciola hepatica in Human Stool

    PubMed Central

    Cabada, Miguel M.; Malaga, Jose L.; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A.; Naeger, Patrick A.; Rogers, Hayley K.; Maharsi, Safa; Mbaka, Maryann; White, A. Clinton

    2017-01-01

    Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)–based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization. PMID:27821691

  12. Fermi, Szilard and Trinity

    ERIC Educational Resources Information Center

    Anderson, Herbert L.

    1974-01-01

    The final installment of the author's recollections of his work with physicists Enrico Fermi, Leo Szilard and others in developing the first controlled nuclear chain reaction and in preparing the test explosion of the first atomic bomb. (GS)

  13. Application and Comparative Evaluation of Fluorescent Antibody, Immunohistochemistry and Reverse Transcription Polymerase Chain Reaction Tests for the Detection of Rabies Virus Antigen or Nucleic Acid in Brain Samples of Animals Suspected of Rabies in India.

    PubMed

    Prabhu, K Nithin; Isloor, Shrikrishna; Veeresh, B Hanchinal; Rathnamma, Doddamane; Sharada, R; Das, Lekshmi J; Satyanarayana, M L; Hegde, Nagendra R; Rahman, Sira Abdul

    2018-02-28

    Accurate and early diagnosis of animal rabies is critical for undertaking public health measures. Whereas the direct fluorescent antibody (DFA) technique is the recommended test, the more convenient, direct rapid immunochemistry test (dRIT), as well as the more sensitive, reverse transcription polymerase chain reaction (RT-PCR), have recently been employed for the laboratory diagnosis of rabies. We compared the three methods on brain samples from domestic (dog, cat, cattle, buffalo, horse, pig and goat) and wild (leopard, wolf and jackal) animals from various parts of India. Of the 257 samples tested, 167 were positive by all the three tests; in addition, 35 of the 36 decomposed samples were positive by RT-PCR. This is the first study in which such large number of animal samples have been subjected to the three tests simultaneously. The results confirm 100% corroboration between DFA and dRIT, buttress the applicability of dRIT in the simple and rapid diagnosis of rabies in animals, and reaffirm the suitability of RT-PCR for samples unfit for testing either by DFA or dRIT.

  14. Combined in vivo and in vitro approach for the characterization of penicillin-specific polyclonal lymphocyte reactivity: tolerance tests with safe penicillins instead of challenge with culprit drugs.

    PubMed

    Sachs, B; Al Masaoudi, T; Merk, H F; Erdmann, S

    2004-10-01

    Amino-penicillins are a major cause of delayed-type reactions to penicillins. The aim of this study was to establish a diagnostic approach for the characterization of the individual penicillin-specific polyclonal lymphocyte reactivity in order to detect side chain-specific sensitization to amino-penicillins. Patients can then be advised to undergo a tolerance test with safe penicillins instead of provocation with culprit penicillins for confirmation of penicillin allergy. We investigated penicillin-specific polyclonal lymphocyte reactivity in nine patients with delayed-type reactions to amino-penicillins by a combined in vivo (patch, prick and intracutaneous tests with delayed readings) and in vitro (lymphocyte transformation test, LTT) approach. A combination of LTT and skin tests improved the sensitivity for the characterization of penicillin-specific polyclonal lymphocyte reactivity and allowed the detection of three different patterns of lymphocyte reactivity. Four patients showed a side chain-specific sensitization to amino-penicillins in vivo and in vitro and were advised to undergo tolerance tests with safe penicillins. Two patients agreed and were exposed to parenteral benzyl-penicillin and oral phenoxymethyl-penicillin which they tolerated without complications. These data suggest that a combined in vivo and in vitro approach is helpful for the detection of side chain-specific sensitization to amino-penicillins. Patients with such sensitization are very likely to tolerate safe penicillins, thereby expanding their therapeutic options when antibiotic treatment is required.

  15. A Comparative Analysis of Polymerase Chain Reaction and Direct Fluorescent Antibody Test for Diagnosis of Genital Herpes.

    PubMed

    Patwardhan, Vrushali; Bhalla, Preena; Rawat, Deepti; Garg, Vijay Kumar; Sardana, Kabir; Sethi, Sumit

    2017-01-01

    To compare laboratory tests that can simultaneously detect and type herpes simplex virus (HSV) directly from the genital ulcer specimens in clinically suspected cases of genital herpes. A study was conducted over 10 months and 44 adult male and female patients clinically suspected with genital herpes were recruited. Genital ulcer swab specimens were subjected to glycoprotein-G gene-based conventional polymerase chain reaction (PCR) and commercially available direct fluorescent antibody (DFA) test and the results were compared. PCR for HSV was positive in 82% (36/44) cases. DFA was positive in 68.2% (30/44) cases. There was 100% agreement between HSV types detected by DFA and PCR. The strength of agreement between the results was better in primary genital herpes than recurrent cases. PCR was found to be better in the detection of HSV in recurrent genital herpes patients. It is a better modality, especially when genital herpes clinically presents with ulcerative or crusted lesions, and is also a cheaper alternative as compared to DFA.

  16. Interobserver variability and feasibility of polymerase chain reaction-based assay in distinguishing ischemic colitis from Clostridium difficile colitis in endoscopic mucosal biopsies.

    PubMed

    Wiland, Homer O; Procop, Gary W; Goldblum, John R; Tuohy, Marion; Rybicki, Lisa; Patil, Deepa T

    2013-06-01

    Polymerase chain reaction (PCR)-based assays using stool samples are currently the most effective method of detecting Clostridium difficile. This study examines the feasibility of this assay using mucosal biopsy samples and evaluates the interobserver reproducibility in diagnosing and distinguishing ischemic colitis from C difficile colitis. Thirty-eight biopsy specimens were reviewed and classified by 3 observers into C difficile and ischemic colitis. The findings were correlated with clinical data. PCR was performed on 34 cases using BD GeneOhm C difficile assay. The histologic interobserver agreement was excellent (κ= 0.86) and the agreement between histologic and clinical diagnosis was good (κ = 0.84). All 19 ischemic colitis cases tested negative (100% specificity) and 3 of 15 cases of C difficile colitis tested positive (20% sensitivity). C difficile colitis can be reliably distinguished from ischemic colitis using histologic criteria. The C difficile PCR test on endoscopic biopsy specimens has excellent specificity but limited sensitivity.

  17. Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

    PubMed Central

    Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

    2006-01-01

    Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

  18. A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

    PubMed

    Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

    2016-12-01

    To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

  19. Press Releases | Argonne National Laboratory

    Science.gov Websites

    Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

  20. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    USGS Publications Warehouse

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  1. Gonorrhoea of the sigmoid neovagina in a male-to-female transgender.

    PubMed

    van der Sluis, Wouter B; Bouman, Mark-Bram; Gijs, Luk; van Bodegraven, Adriaan A

    2015-07-01

    A 33-year-old male-to-female transgender consulted our outpatient clinic with perneovaginal bleeding during and following coitus. Four years before, she underwent a total laparoscopic sigmoid neovaginoplasty. Physical, histological and endoscopic examination revealed neither focus of active bleeding nor signs of active inflammation. A polymerase chain reaction test performed on a neovaginal swab showed gonococcal infection. Treatment consisted of 500 mg intramuscular ceftriaxone. Three weeks later, our patient reported resolution of symptoms, consistent with eradication of the infection demonstrated by a follow-up neovaginal swab polymerase chain reaction. To our knowledge, this is the first case report of gonococcal infection of the sigmoid neovagina. © The Author(s) 2014.

  2. [The development and implementation of polymerase chain reaction to detect in real-time operation mode yersinia pestis in field material].

    PubMed

    Afanas'ev, M V; Chipanin, E V; Shestakov, V E; Denisov, A V; Fomina, L A; Ostiak, A S; Balakhonov, S V

    2013-03-01

    The article presents the results of development and practical implementation of system of polymerase chain reaction testing in real-time operation mode to detect agent of plague infield material. In laboratory conditions the system demonstrated good results and hence it was applied in conditions of field laboratory of epidemiologic team during planned epizootologic examination of Gorno-Altaisk hot spot of plague. The sampling consisted of more than 1400 objects. It was demonstrated that high sensitivity and specificity is immanent to proposed system. The adaptation of the system to the real time amplifier "Smart Cycler" (Cephid, USA) having some specific technical characteristics makes it possible to consider the proposed test-system as an effective sensitive and precise instrument for screening studies in the process of regular epizootologic examinations of hot spots of plague.

  3. Successful treatment of toxoplasmic encephalitis diagnosed early by polymerase chain reaction after allogeneic hematopoietic stem cell transplantation: two case reports and review of the literature.

    PubMed

    Miyagi, T; Itonaga, H; Aosai, F; Taguchi, J; Norose, K; Mochizuki, K; Fujii, H; Furumoto, A; Ohama, M; Karimata, K; Yamanoha, A; Taniguchi, H; Sato, S; Taira, N; Moriuchi, Y; Fukushima, T; Masuzaki, H; Miyazaki, Y

    2015-08-01

    Toxoplasmic encephalitis represents a rare, but often fatal infection after allogeneic hematopoietic stem cell transplantation. Polymerase chain reaction (PCR)-based preemptive therapy is considered promising for this disease, but is not routinely applied, especially in low seroprevalence countries including Japan. We encountered 2 cases of toxoplasmic encephalitis after transplantation that were successfully treated. The diagnosis of toxoplasmic encephalitis in these cases was confirmed by PCR testing when neurological symptoms were observed. Both patients received pyrimethamine and sulfadiazine treatments within 2 weeks of the development of neurological symptoms, and remained free of recurrence for 32 and 12 months. These results emphasized the importance of the PCR test and immediate treatment after diagnosis for the management of toxoplasmic encephalitis. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation.

    PubMed

    Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum

    2014-08-01

    A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method.

    PubMed

    Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

    2015-05-27

    This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method.

  6. Single cell digital polymerase chain reaction on self-priming compartmentalization chip

    PubMed Central

    Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

    2017-01-01

    Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267

  7. Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

    PubMed

    Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

    2017-01-01

    Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.

  8. 9 CFR 147.52 - Approved tests.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... for use. The cooperating laboratories must perform the assay exactly as stated in the supplied instructions. Each laboratory must test a panel of at least 25 known positive clinical samples supplied by the...) H7L4S3. (3) DuPont Qualicon BAX Polymerase Chain Reaction (PCR)-based assay for Salmonella, DuPont...

  9. 9 CFR 147.52 - Approved tests.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... for use. The cooperating laboratories must perform the assay exactly as stated in the supplied instructions. Each laboratory must test a panel of at least 25 known positive clinical samples supplied by the...) H7L4S3. (3) DuPont Qualicon BAX Polymerase Chain Reaction (PCR)-based assay for Salmonella, DuPont...

  10. Using urinary leucocyte esterase tests as an indicator of infection with gonorrhoea or chlamydia in asymptomatic males in a primary health care setting.

    PubMed

    Rahman, Md Saifur; Beever, Warwick; Skov, Steven; Boffa, John

    2014-02-01

    To evaluate a leucocyte esterase test as a predictor of gonorrhoea or chlamydia in asymptomatic Aboriginal males at the Central Australian Aboriginal Congress Male Clinic (Ingkintja), first-void urine samples and clinical information were collected from consecutive asymptomatic males presenting to the Ingkintja in Alice Springs between March 2008 and December 2009. Urine was tested immediately with a leucocyte esterase test dipstick and then by polymerase chain reaction for gonorrhoea and chlamydia. Among the 292 specimens from asymptomatic males, 15.4% were positive for gonorrhoea or chlamydia. In this group, compared with polymerase chain reaction result for gonorrhoea or chlamydia, leucocyte esterase test alone and in combination with age ≤35 years showed sensitivities of 66.7% and 60%, specificities of 90.7% and 94.7%, positive predictive values of 56.6% and 67.5%, negative predictive values of 93.7% and 92.8% and the area under receiver operating characteristics curve values of 0.79 and 0.85, respectively. Leucocyte esterase tests can reasonably be used as a basis for immediate empirical treatment for gonorrhoea or chlamydia in asymptomatic central Australian Aboriginal men under 35 years of age.

  11. Clinical value of whole-blood interferon-gamma assay in patients with suspected pulmonary tuberculosis and AFB smear- and polymerase chain reaction-negative bronchial aspirates.

    PubMed

    Lee, Jaehee; Lee, Shin Yup; Yoo, Seung Soo; Cha, Seung Ick; Won, Dong Il; Park, Jae Yong; Lee, Won-Kil; Kim, Chang Ho

    2012-07-01

    Combining a polymerase chain reaction (PCR) test with bronchoscopy is frequently performed to allow a rapid diagnosis of smear-negative pulmonary tuberculosis (PTB). However, limited data are available concerning clinical judgment in patients with suspected PTB and AFB smear- and PCR-negative bronchial aspirates (BA). The present study evaluated the usefulness of whole-blood QuantiFERON-TB Gold In-Tube (QFT) testing in these patients. Of 166 patients with suspected PTB who had undergone bronchoscopy because of smear-negative sputum or inadequate sputum production, 93 (56%) were diagnosed with culture-positive PTB. Seventy-four patients were either AFB smear- or PCR-positive. In the 75 patients whose BA AFB smear and PCR results were both negative, 19 were finally diagnosed with PTB by culture. The QFT test had a negative predictive value of 91% for PTB. The QFT test may be useful for excluding PTB in patients with suspected PTB whose BA AFB smear and PCR results are both negative. Copyright © 2012 Elsevier Inc. All rights reserved.

  12. Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources

    PubMed Central

    Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam

    2017-01-01

    Background: Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Materials and Methods: Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Results: Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli. PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. Conclusion: The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources. PMID:29142893

  13. Expression of TGF-beta1, osteonectin, and BMP-4 in mandibular distraction osteogenesis with compression stimulation: reverse transcriptase-polymerase chain reaction study and biomechanical test.

    PubMed

    Kim, Uk-Kyu; Park, Seong-Jin; Seong, Wook-Jin; Heo, Jun; Hwang, Dae-Seok; Kim, Yong-Deok; Shin, Sang-Hun; Kim, Gyoo-Cheon

    2010-09-01

    This study compared the levels of transforming growth factor-beta1 (TGF-beta1), osteonectin, and bone morphogenetic protein-4 (BMP-4) expression in regenerated bone in a rabbit mandible that had undergone conventional distraction osteogenesis (DO) with those in regenerated bone from a modified DO technique with compression stimulation. A total of 42 rabbits were used in this reverse transcriptase-polymerase chain reaction study. In the control group, distraction was performed at 1 mm/day for 8 days. In the experimental group, overdistraction was performed for 10 days, followed by a 3-day latency period and 2 days of compression to achieve the same amount of DO. Three rabbits per subgroup were killed at 0, 5, 13, 20, 27, 34, and 41 days after the initial osteotomy. The levels of TGF-beta1, osteonectin, and BMP-4 in the bone regenerates were measured by reverse transcriptase-polymerase chain reaction. A biomechanical microhardness test was also performed in 8 rabbits as a separate experiment. Reverse transcriptase-polymerase chain reaction revealed a greater level of TGF-beta1 in the experimental group immediately after applying the compression force that continued for 2 weeks. The level then decreased to that of the control group at 3 weeks. The greater level of osteonectin in the experimental group after compression than that in the control group continued for 3 weeks. In the experimental group, the level of BMP-4 increased immediately after compression. However, the level in the control group decreased. The microhardness ratio of distracted bone to normal bone on the cortex was statistically different at 0.47 in the control group and 0.80 in the experimental group (P = .049) at 55 days after osteotomy. The effectiveness of the new DO technique with compression stimulation was confirmed by the gene expression study and the biomechanical test findings. Copyright 2010 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

  14. Enhanced DNA Sensing via Catalytic Aggregation of Gold Nanoparticles

    PubMed Central

    Huttanus, Herbert M.; Graugnard, Elton; Yurke, Bernard; Knowlton, William B.; Kuang, Wan; Hughes, William L.; Lee, Jeunghoon

    2014-01-01

    A catalytic colorimetric detection scheme that incorporates a DNA-based hybridization chain reaction into gold nanoparticles was designed and tested. While direct aggregation forms an inter-particle linkage from only ones target DNA strand, the catalytic aggregation forms multiple linkages from a single target DNA strand. Gold nanoparticles were functionalized with thiol-modified DNA strands capable of undergoing hybridization chain reactions. The changes in their absorption spectra were measured at different times and target concentrations and compared against direct aggregation. Catalytic aggregation showed a multifold increase in sensitivity at low target concentrations when compared to direct aggregation. Gel electrophoresis was performed to compare DNA hybridization reactions in catalytic and direct aggregation schemes, and the product formation was confirmed in the catalytic aggregation scheme at low levels of target concentrations. The catalytic aggregation scheme also showed high target specificity. This application of a DNA reaction network to gold nanoparticle-based colorimetric detection enables highly-sensitive, field-deployable, colorimetric readout systems capable of detecting a variety of biomolecules. PMID:23891867

  15. Introduction to Polymer Chemistry.

    ERIC Educational Resources Information Center

    Harris, Frank W.

    1981-01-01

    Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

  16. Development of a nested polymerase chain reaction for amplification of a sequence of the p57 gene of Renibacterium salmoninarum that provides a highly sensitive method for detection of the bacterium in salmonid kidney

    USGS Publications Warehouse

    Chase, D.M.; Pascho, R.J.

    1998-01-01

    Nucleic acid-based assays have shown promise for diagnosing Renibacterium salmoninarum in tissues and body fluids of salmonids. DeVelopment of a nested polymerase chain reaction (PCR) method to detect a 320 bp DNA segment of the gene encoding the p57 protein of R. salmoninarum is described. Whereas a conventional PCR for a 383 bp segment of the p57 gene reliably detected 1000 R. salmoninarum cells per reaction in kidney tissue, the nested PCR detected as few as 10 R. salmoninarum per reaction in kidney tissue. Two DNA extraction methods for the nested PCR were compared and the correlation between replicate samples was generally higher in samples extracted by the QIAamp system compared with those extracted by the phenol/chloroform method. The specificity of the nested PCR was confirmed by testing DNA extracts of common bacterial fish pathogens and a panel of bacterial species reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA) and the fluorescent antibody test (FAT) for R. salmoninarum. Kidney samples from 74 naturally infected chinook Salmon were examined by the nested PCR, the ELISA, and the FAT, and the detected prevalences of R. salmoninarum were 61, 47, and 43%, respectively.

  17. Polymerization as a Model Chain Reaction

    ERIC Educational Resources Information Center

    Morton, Maurice

    1973-01-01

    Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

  18. Simultaneous detection of hemagglutinin and neuraminidase genes of novel influenza A (H7N9) by duplex real-time reverse transcription polymerase chain reaction.

    PubMed

    Li, Yan; Wu, Tao; Qi, Xian; Ge, Yiyue; Guo, Xiling; Wu, Bin; Yu, Huiyan; Zhu, Yefei; Shi, Zhiyang; Wang, Hua; Cui, Lunbiao; Zhou, Minghao

    2013-12-01

    A novel reassortant influenza A (H7N9) virus emerged recently in China. In this study, a duplex real-time reverse transcription polymerase chain reaction (rRT-PCR) assay was developed for the simultaneous detection of hemagglutinin (HA) and neuraminidase (NA) genes of H7N9 influenza viruses. The sensitivity of the assay was determined to be 10 RNA copies per reaction for both HA and NA genes. No cross-reactivity was observed with other influenza virus subtypes or respiratory tract viruses. One hundred and forty-six clinical and environmental specimens were tested and compared with reference methods and were found to be consistent. The assay is suitable for large-scale screening due to short turnaround times and high specificity, sensitivity, and reproducibility. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Polymerase chain displacement reaction.

    PubMed

    Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

    2013-02-01

    Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.

  20. Point-of-care testing system enabling 30 min detection of influenza genes.

    PubMed

    Abe, Tomoteru; Segawa, Yuji; Watanabe, Hidetoshi; Yotoriyama, Tasuku; Kai, Shinichi; Yasuda, Akio; Shimizu, Norio; Tojo, Naoko

    2011-03-21

    We developed a portable and easy-to-use nucleic acid amplification test (NAT) system for use in point-of-care testing (POCT). The system shows sensitivity that is sufficiently higher than that of the currently available rapid diagnostic kit and is comparable to that of real-time reverse transcription polymerase chain reaction (RT-PCR) for influenza testing. This journal is © The Royal Society of Chemistry 2011

  1. Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

    DOE R&D Accomplishments Database

    Weinberg, Alvin M.; Noderer, L. C.

    1951-05-15

    The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

  2. A Blood-based Test for the Detection of ROS1 and RET Fusion Transcripts from Circulating Ribonucleic Acid Using Digital Polymerase Chain Reaction

    PubMed Central

    Mellert, Hestia S.; Alexander, Kristin E.; Jackson, Leisa P.; Pestano, Gary A.

    2018-01-01

    We have developed novel methods for the isolation and characterization of tumor-derived circulating ribonucleic acid (cRNA) for blood-based liquid biopsy. Robust detection of cRNA recovered from blood represents a solution to a critical unmet need in clinical diagnostics. The test begins with the collection of whole blood into blood collection tubes containing preservatives that stabilize cRNA. Cell-free, exosomal, and platelet-associated RNA is isolated from plasma in this test system. The cRNA is reverse transcribed to complementary DNA (cDNA) and amplified using digital polymerase chain reaction (dPCR). Samples are evaluated for both the target biomarker as well as a control gene. Test validation included limit of detection, accuracy, and robustness studies with analytic samples. The method developed as a result of these studies reproducibly detect multiple fusion variants for ROS1 (C-Ros proto-oncogene 1; 8 variants) and RET (rearranged during transfection proto-oncogene; 8 variants). The sample processing workflow has been optimized so that test results can consistently be generated within 72 hours of sample receipt. PMID:29683453

  3. Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins

    NASA Astrophysics Data System (ADS)

    Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John

    2017-01-01

    DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.

  4. Drug skin tests in cutaneous adverse drug reactions to pristinamycin: 29 cases with a study of cross-reactions between synergistins.

    PubMed

    Barbaud, A; Trechot, P; Weber-Muller, F; Ulrich, G; Commun, N; Schmutz, J L

    2004-01-01

    The present study was made to determine the value of drug skin tests in patients with cutaneous adverse drug reactions (CADRs) due to a synergistin (pristinamycin) and to determine the frequency of cross-reactions between synergistins. 29 patients were referred during the onset of the CADR due to pristinamycin: 18 with maculopapular rash, 9 erythrodermas, 1 angioedema and 1 Stevens-Johnson syndrome. They all had patch tests with pristinamycin and, in most cases, with other synergistins [virginiamycin and dalfopristin-quinupristin (DQ)], prick tests (10 cases) and intradermal tests (IDT) (5 cases). Skin tests with synergistins were positive in 27 cases, patch tests with pristinamycin in 20/29 cases (69%), prick tests with pristinamycin in 3/9 cases on immediate (1 case) or on delayed (2 cases) readings, and IDT with DQ in 4/5 cases. Cross-reactions between synergistins occurred in 9/22 with virginiamycin and in 7/8 cases with DQ. Skin tests with synergistins are useful in investigating CADR due to pristinamycin. Synergistins are composed of 2 chains (1 depsipeptide and 1 macrocyclic lactone) with many structural analogies between all synergistins. According to the chemical structures and our results, it seems advisable to avoid all synergistins in patients with CADR due to pristinamycin.

  5. Evaluation of primer and probe mismatches in sensitivity of select RRT-PCR tests for avian influenza

    USDA-ARS?s Scientific Manuscript database

    The recent outbreak of pH1N1 in animals highlighted an imperfection of the matrix real-time reverse transcriptase-polymerase chain reaction (RRT-PCR) that has become the primary screening test for avian and swine influenza viruses. Four mismatches in one primer resulted in an important loss of sens...

  6. Emilio Segrè and Spontaneous Fission

    Science.gov Websites

    fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

  7. [Applying competitive polymerase chain reaction to the detection of hepatitis B virus DNA].

    PubMed

    Wang, Ling; Yang, Peng; Li, Shuang-qing; Xu, Shu-hui; Cao, Gui-qun; Zhang, Fa-qiang; Zhang, Mei-xia; Chen, Qing-ying; Xia, Qing-jie; Liu, Kai; Tang, Fang; Zhang, Yuan-zheng

    2004-11-01

    To reduce the rate of accidental false negative result in the HBV DNA PCR test on clinical serum samples. A competitive polymerase chain reaction (C-PCR) was used to decrease the false negative ratio. In the C-PCR, a constructed inner control DNA was added for co-amplification with the HBV target DNA. In a 20 microl C-PCR system, about 60 to 200 copies of inner control DNA could give apparent co-amplification signal band after electrophoresis on a 2% agarose gel. Five of 120 samples of clinical serum (4.2%) could not be amplified. C-PCR has the advantage of yielding information on false negative in the HBV DNA PCR assay of clinical serum samples.

  8. Use of polymerase chain reaction technique to confirm VecTest screening results in Plasmodium falciparum and Plasmodium vivax VK 210 laboratory-infected Anopheles stephensi mosquitoes.

    PubMed

    Santos-Ciminera, Patricia D; Acheé, Nicole L; Quinnan, Gerald V; Roberts, Donald R

    2004-09-01

    We evaluated polymerase chain reaction (PCR) to confirm immunoassays for malaria parasites in mosquito pools after a failure to detect malaria with PCR during an outbreak in which pools tested positive using VecTest and enzyme-linked immunosorbent assay (ELISA). We combined VecTest, ELISA, and PCR to detect Plasmodium falciparum and Plasmodium vivax VK 210. Each mosquito pool, prepared in triplicate, consisted of 1 exposed Anopheles stephensi and up to 9 unfed mosquitoes. The results of VecTest and ELISA were concordant. DNA from a subset of the pools, 1 representative of each ratio of infected to uninfected mosquitoes, was extracted and used as template in PCR. All P. vivax pools were PCR positive but some needed additional processing for removal of apparent inhibitors before positive results were obtained. One of the pools selected for P. falciparum was negative by PCR, probably because of losses or contamination during DNA extraction; 2 remaining pools at this ratio were PCR positive. Testing pools by VecTest, ELISA, and PCR is feasible, and PCR is useful for confirmation of immunoassays. An additional step might be needed to remove potential inhibitors from pools prior to PCR.

  9. Nested polymerase chain reaction on blood clots for gene encoding 56 kDa antigen and serology for the diagnosis of scrub typhus.

    PubMed

    Prakash, J A J; Kavitha, M L; Mathai, E

    2011-01-01

    Scrub typhus is a zoonotic illness endemic in the Asia-Pacific region. Early diagnosis and appropriate management contribute significantly to preventing adverse outcomes including mortality. Serology is widely used for diagnosing scrub typhus. Recent reports suggest that polymerase chain reaction (PCR) could be a rapid and reliable alternative. This study assessed the utility of these tests for scrub typhus diagnosis. Nested PCR to detect the 56 kDa antigen gene of O. tsutsugamushi was performed on blood clots from 87 individuals with clinically suspected scrub typhus. Weil-Felix test and scrub typhus IgM ELISA were performed on serum samples from the same patients. As a gold standard reference test was not available, latent class analysis (LCA) was used to assess the performance of the three tests. The LCA analysis showed the sensitivity of Weil-Felix test, IgM ELISA and PCR to be 59%, 100% and 58% respectively. The specificity of ELISA was only 73%, whereas those of the Weil-Felix test and PCR were 94% and 100% respectively. Nested PCR using blood clots while specific, lacked sensitivity as compared to IgM ELISA. In resource-poor settings Weil-Felix test still remains valuable despite its moderate sensitivity.

  10. Chain Reaction Polymerization.

    ERIC Educational Resources Information Center

    McGrath, James E.

    1981-01-01

    The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

  11. Characterizing Chain Processes in Visible Light Photoredox Catalysis

    PubMed Central

    Cismesia, Megan A.

    2015-01-01

    The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708

  12. Direct urine polymerase chain reaction for chlamydia and gonorrhoea: a simple means of bringing high-throughput rapid testing to remote settings?

    PubMed

    Rahimi, Frashta; Goire, Namraj; Guy, Rebecca; Kaldor, John M; Ward, James; Nissen, Michael D; Sloots, Theo P; Whiley, David M

    2013-08-01

    Background Rapid point-of-care tests (POCTs) for chlamydia (Chlamydia trachomatis) and gonorrhoea (Neisseria gonorrhoeae) have the potential to confer health benefits in certain populations even at moderate sensitivities; however, suitable POCTs for these organisms are currently lacking. In this study, we investigated the use of direct urine polymerase chain reaction (PCR), with the view of implementing a simplified PCR strategy for high-throughput chlamydia and gonorrhoea screening in remote settings. Briefly, a simple dilution of the urine was performed before adding it directly to a real-time PCR reaction. The method was evaluated using 134 stored urine specimens that had been submitted for chlamydia and gonorrhoea testing and had been tested using a commercial C. trachomatis and N. gonorrhoeae PCR method. These included samples that were PCR-positive for chlamydia (n=87), gonorrhoea (n=16) or both (n=2). Direct urine testing was conducted using previously described in-house real-time PCR methods for C. trachomatis and N. gonorrhoeae as well as for recognised N.gonorrhoeae antimicrobial resistance mechanisms. The overall sensitivities and specificities of the direct urine PCR were 78% and 100% for chlamydia, and 83% and 100% for gonorrhoea. N.gonorrhoeae penicillin and quinolone resistance mechanisms were characterised in 14 of the 18 N. gonorrhoeae-positive samples. The results of this study show that the simplified PCR strategy may be a feasible approach for rapid screening and improving chlamydia and gonorrhoea treatment in remote settings.

  13. Automated Extraction of Formalin-Fixed, Paraffin-Embedded Tissue for High-Risk Human Papillomavirus Testing of Head and Neck Squamous Cell Carcinomas Using the Roche Cobas 4800 System.

    PubMed

    Kerr, Darcy A; Sweeney, Brenda; Arpin, Ronald N; Ring, Melissa; Pitman, Martha B; Wilbur, David C; Faquin, William C

    2016-08-01

    -Testing for high-risk human papillomavirus (HR-HPV) in head and neck squamous cell carcinomas (HNSCCs) is important for both prognostication and clinical management. Several testing platforms are available for HR-HPV; however, effective alternative automated approaches are needed. -To assess the performance of the automated Roche cobas 4800 HPV real-time polymerase chain reaction-based system on formalin-fixed, paraffin-embedded HNSCC specimens and compare results with standard methods of in situ hybridization (ISH) and p16 immunohistochemistry. -Formalin-fixed, paraffin-embedded samples of HNSCC were collected from archival specimens in the Department of Pathology, Massachusetts General Hospital (Boston), and prepared using the automated system by deparaffinization and dehydration followed by tissue lysis. Samples were integrated into routine cervical cytology testing runs by cobas. Corresponding formalin-fixed, paraffin-embedded samples were evaluated for HR-HPV by ISH and p16 by immunohistochemistry. Discrepant cases were adjudicated by polymerase chain reaction. -Sixty-two HNSCC samples were analyzed using the automated cobas system, ISH, and immunohistochemistry. Fifty-two percent (n = 32 of 62) of formalin-fixed, paraffin-embedded tumors were positive for HR-HPV by cobas. Eighty-eight percent (n = 28 of 32) of cases were the HPV 16 subtype and 12% (n = 4 of 32) were other HR-HPV subtypes. Corresponding testing with ISH was concordant in 92% (n = 57 of 62) of cases. Compared with the adjudication polymerase chain reaction standard, there were 3 false-positive cases by cobas. -Concordance in HNSCC HR-HPV status between cobas and ISH was more than 90%. The cobas demonstrated a sensitivity of 100% and a specificity of 91% for detection of HR-HPV. Advantages favoring cobas include its automation, cost efficiency, objective results, and ease of performance.

  14. Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

    PubMed Central

    Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

    2010-01-01

    Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

  15. Multi angle laser light scattering evaluation of field exposed thermoplastic photovoltaic encapsulant materials

    DOE PAGES

    Kempe, Michael D.; Miller, David C.; Wohlgemuth, John H.; ...

    2016-01-08

    As creep of polymeric materials is potentially a safety concern for photovoltaic modules, the potential for module creep has become a significant topic of discussion in the development of IEC 61730 and IEC 61215. To investigate the possibility of creep, modules were constructed, using several thermoplastic encapsulant materials, into thin-film mock modules and deployed in Mesa, Arizona. The materials examined included poly(ethylene)-co-vinyl acetate (EVA, including formulations both cross-linked and with no curing agent), polyethylene/polyoctene copolymer (PO), poly(dimethylsiloxane) (PDMS), polyvinyl butyral (PVB), and thermoplastic polyurethane (TPU). The absence of creep in this experiment is attributable to several factors of which themore » most notable one was the unexpected cross-linking of an EVA formulation without a cross-linking agent. It was also found that some materials experienced both chain scission and cross-linking reactions, sometimes with a significant dependence on location within a module. The TPU and EVA samples were found to degrade with cross-linking reactions dominating over chain scission. In contrast, the PO materials degraded with chain scission dominating over cross-linking reactions. Furthermore, we found no significant indications that viscous creep is likely to occur in fielded modules capable of passing the qualification tests, we note that one should consider how a polymer degrades, chain scission or cross-linking, in assessing the suitability of a thermoplastic polymer in terrestrial photovoltaic applications.« less

  16. [Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

    PubMed

    Iván, Kristóf; Maráz, Anna

    2015-12-20

    Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

  17. Granulomatous herpes simplex encephalitis in an infant with multicystic encephalopathy: a distinct clinicopathologic entity?

    PubMed

    Schutz, Peter W; Fauth, Clarissa T; Al-Rawahi, Ghada N; Pugash, Denise; White, Valerie A; Stockler, Sylvia; Dunham, Christopher P

    2014-04-01

    Herpes simplex virus encephalitis can manifest as a range of clinical presentations including classic adult, neonatal, and biphasic chronic-granulomatous herpes encephalitis. We report an infant with granulomatous herpes simplex virus type 2 encephalitis with a subacute course and multicystic encephalopathy. A 2-month-old girl presented with lethargy and hypothermia. Computed tomography scan of the head showed multicystic encephalopathy and calcifications. Cerebrospinal fluid analysis by polymerase chain reaction testing for herpes simplex virus 1 and 2, enterovirus, and cytomegalovirus was negative. Normal cerebrospinal fluid interferon-α levels argued against Aicardi-Goutières syndrome. The patient died 2 weeks after presentation. At autopsy, multicystic encephalopathy was confirmed with bilateral gliosis, granulomatous inflammation with multinucleated giant cells, and calcifications. Bilateral healing necrotizing retinitis suggested a viral etiology, but retina and brain were free of viral inclusions and immunohistochemically negative for herpes simplex virus-2 and cytomegalovirus. However, polymerase chain reaction analysis showed herpes simplex virus-2 DNA in four cerebral paraffin blocks. Subsequent repeat testing of the initial cerebrospinal fluid sample using a different polymerase chain reaction assay was weakly positive for herpes simplex virus-2 DNA. Granulomatous herpes simplex virus encephalitis in infants can present with subacute course and result in multicystic encephalopathy with mineralization and minimal cerebrospinal fluid herpes simplex virus DNA load. Infectious etiologies should be carefully investigated in the differential diagnosis of multicystic encephalopathy with mineralization, in particular if multinucleated giant cells are present. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

    2016-09-15

    It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

  19. Detection of Genetically Modified Food: Has Your Food Been Genetically Modified?

    ERIC Educational Resources Information Center

    Brandner, Diana L.

    2002-01-01

    Explains the benefits and risks of genetically-modified foods and describes methods for genetically modifying food. Presents a laboratory experiment using a polymerase chain reaction (PCR) test to detect foreign DNA in genetically-modified food. (Contains 18 references.) (YDS)

  20. Detection of Strawberry Viruses in Egypt

    USDA-ARS?s Scientific Manuscript database

    As part of a USAID-MERC funded project, ‘Disease-indexing and mass propagation of superior strawberry cultivars’, an effort was made to evaluate the virus status of strawberries in Egypt. Diagnostic reverse transcription-polymerase chain reaction (RT-PCR) tests for Strawberry mottle, Strawberry cri...

  1. Prevalence and risk factors for Campylobacter spp., Salmonella spp., Coxiella burnetii, and Newcastle disease virus in feral pigeons (Columba livia) in public areas of Montreal, Canada

    PubMed Central

    Gabriele-Rivet, Vanessa; Fairbrother, Julie-Hélène; Tremblay, Donald; Harel, Josée; Côté, Nathalie; Arsenault, Julie

    2016-01-01

    Feral pigeons (Columbia livia) can harbor a range of zoonotic pathogens. A transversal study was undertaken to estimate the prevalence of feral pigeons infected by various pathogens in public areas in Montreal, Quebec. Cloacal swabs from captured birds were cultured for Salmonella spp. and Campylobacter spp. and tested by real-time polymerase chain reaction (RT-PCR) for the detection of Coxiella burnetii. An oropharyngeal swab was also submitted to real-time reverse-transcription polymerase chain reaction (RRT-PCR) for the detection of Newcastle disease virus. Among the 187 pigeons tested from 10 public areas, 9.1% (95% CI: 3.0 to 15.2) were positive for Campylobacter spp. with all strains identified as Campylobacter jejuni. The Campylobacter status of birds was not associated with individual characteristics of birds, with the exception of body score. None of the pigeons tested positive for the other pathogens. Direct or indirect contacts with feral pigeons may constitute a potential risk for Campylobacter infection in humans. PMID:26733736

  2. Pilot study of the utility and acceptability of tampon sampling for the diagnosis of Neisseria gonorrhoeae and Chlamydia trachomatis infections by duplex realtime polymerase chain reaction in United Kingdom sex workers.

    PubMed

    Kimmitt, P T; Tabrizi, S N; Crosatti, M; Garland, S M; Schober, P C; Rajakumar, K; Chapman, C A

    2010-04-01

    We aimed to evaluate the acceptability of self-collected tampon samples for the screening of female sex workers for sexually transmitted infections. We recruited 65 sex workers, and 63 agreed to provide tampon samples. The tampon samples were processed by realtime polymerase chain reaction (PCR) targeting Neisseria gonorrhoeae and Chlamydia trachomatis. Urethral and endocervical swabs were also obtained from 61 of 63 participants and tested using culture (N. gonorrhoeae) and the BD ProbeTec strand displacement amplification (SDA) (C. trachomatis) assay. Tampon sampling was preferred by 95% of the women and all favoured being tested away from genitourinary medicine clinics; the most common reasons cited were avoidance of embarrassment (40%) and convenience (30%). Besides near-universal acceptability of tampon sampling, the tampon sampling-PCR approach described in this study appeared to have enhanced sensitivity compared with conventional testing, suggesting the possibility of a residual hidden burden of N. gonorrhoeae and/or C. trachomatis genital infections in UK female sex workers.

  3. Using Reference Quantitative Polymerase Chain Reaction to Assess the Clinical Performance of the Paracheck-Pf® Rapid Diagnostic Test in a Field Setting in Uganda.

    PubMed

    Mitran, Catherine J; Mbonye, Anthony K; Hawkes, Michael; Yanow, Stephanie K

    2018-06-04

    Malaria rapid diagnostic tests (RDTs) are widely used in clinical and surveillance settings. However, the performance of most RDTs has not been characterized at parasite densities below detection by microscopy. We present findings from Uganda, where RDT results from 491 participants with suspected malaria were correlated with quantitative polymerase chain reaction (qPCR)-defined parasitemia. Compared with qPCR, the sensitivity and specificity of the RDT for Plasmodium falciparum mono-infections were 76% (95% confidence interval [CI]: 68-83%) and 95% (95% CI: 92-97%), respectively. The sensitivity of the RDT at parasite densities between 0.2 and 200 parasites/μL was surprisingly high (87%, 95% CI: 74-94%). The high sensitivity of the RDT is likely because of histidine-rich protein 2 from submicroscopic infections, gametocytes, or sequestered parasites. These findings underscore the importance of evaluating different RDTs in field studies against qPCR reference testing to better define the sensitivity and specificity, particularly at low parasite densities.

  4. Performance of the Directigen EZ Flu A+B rapid influenza diagnostic test to detect pandemic influenza A/H1N1 2009.

    PubMed

    Boyanton, Bobby L; Almradi, Amro; Mehta, Tejal; Robinson-Dunn, Barbara

    2014-04-01

    The Directigen EZ Flu A+B rapid influenza diagnostic test, as compared to real-time reverse transcriptase polymerase chain reaction, demonstrated suboptimal performance to detect pandemic influenza A/H1N1 2009. Age- and viral load-stratified test sensitivity ranged from 33.3 to 84.6% and 0 to 100%, respectively. © 2013.

  5. Comprehensive Nuclear-Test-Ban Treaty: Background and Current Developments

    DTIC Science & Technology

    2013-06-10

    subcritical; that is, no critical mass is formed and no self-sustaining nuclear chain reaction can occur; thus, there is no nuclear explosion.”211 SCEs...45 The National Academy of Sciences Study and Its Critics ...the future, but there are no plans to do so.”8 Critics expressed concern about the implications of these policies for testing and new weapons

  6. A simple and rapid DNA extraction method for Chlamydia trachomatis detection from urogenital swabs.

    PubMed

    Butzler, Matthew A; Reed, Jennifer L; McFall, Sally M

    2017-11-01

    A highly sensitive and specific Chlamydia trachomatis (CT) diagnostic test was developed by combining filtration isolation of nucleic acid (FINA) extraction with quantitative polymerase chain reaction including an internal control to identify test inhibition. A pilot study of 40 clinical specimens yielded 100% sensitivity and specificity. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

    PubMed

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

    2016-06-01

    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.

  8. Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

    PubMed

    Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

    2017-05-17

    Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

  9. Development of a rapid and sensitive one-step reverse transcription-nested polymerase chain reaction in a single tube using the droplet-polymerase chain reaction machine.

    PubMed

    Yamaguchi, Akemi; Matsuda, Kazuyuki; Sueki, Akane; Taira, Chiaki; Uehara, Masayuki; Saito, Yasunori; Honda, Takayuki

    2015-08-25

    Reverse transcription (RT)-nested polymerase chain reaction (PCR) is a time-consuming procedure because it has several handling steps and is associated with the risk of cross-contamination during each step. Therefore, a rapid and sensitive one-step RT-nested PCR was developed that could be performed in a single tube using a droplet-PCR machine. The K562 BCR-ABL mRNA-positive cell line as well as bone marrow aspirates from 5 patients with chronic myelogenous leukemia (CML) and 5 controls without CML were used. We evaluated one-step RT-nested PCR using the droplet-PCR machine. One-step RT-nested PCR performed in a single tube using the droplet-PCR machine enabled the detection of BCR-ABL mRNA within 40min, which was 10(3)-fold superior to conventional RT nested PCR using three steps in separate tubes. The sensitivity of the one-step RT-nested PCR was 0.001%, with sample reactivity comparable to that of the conventional assay. One-step RT-nested PCR was developed using the droplet-PCR machine, which enabled all reactions to be performed in a single tube accurately and rapidly and with high sensitivity. This one-step RT-nested PCR may be applicable to a wide spectrum of genetic tests in clinical laboratories. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. CHARACTERIZATION OF SEVEN POLYMORPHIC MICROSATELLITE LOCI IN THE COMMON LOON (GAVIA IMMER)

    EPA Science Inventory

    We describe polymerase chain reaction (PCR) primers and conditions to amplify seven microsatellite DNA loci isolated from the Common Loon (Gavia immer). The PCR primers were tested on 83 individuals from ten locations in North America, including breeding, migration stopover, and...

  11. Gene Polymorphism Studies in a Teaching Laboratory

    ERIC Educational Resources Information Center

    Shultz, Jeffry

    2009-01-01

    I present a laboratory procedure for illustrating transcription, post-transcriptional modification, gene conservation, and comparative genetics for use in undergraduate biology education. Students are individually assigned genes in a targeted biochemical pathway, for which they design and test polymerase chain reaction (PCR) primers. In this…

  12. Demise of Polymerase Chain Reaction/Electrospray Ionization-Mass Spectrometry as an Infectious Diseases Diagnostic Tool.

    PubMed

    Özenci, Volkan; Patel, Robin; Ullberg, Måns; Strålin, Kristoffer

    2018-01-18

    Although there are several US Food and Drug Administration (FDA)-approved/cleared molecular microbiology diagnostics for direct analysis of patient samples, all are single target or panel-based tests. There is no FDA-approved/cleared diagnostic for broad microbial detection. Polymerase chain reaction (PCR)/electrospray ionization-mass spectrometry (PCR/ESI-MS), commercialized as the IRIDICA system (Abbott) and formerly PLEX-ID, had been under development for over a decade and had become CE-marked and commercially available in Europe in 2014. Capable of detecting a large number of microorganisms, it was under review at the FDA when, in April 2017, Abbott discontinued it. This turn of events represents not only the loss of a potential diagnostic tool for infectious diseases but may be a harbinger of similar situations with other emerging and expensive microbial diagnostics, especially genomic tests. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

  13. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

    USGS Publications Warehouse

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.

    2006-01-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  14. The biomechanical and perceptual influence of chain resistance on the performance of the olympic clean.

    PubMed

    Berning, Joseph M; Coker, Cheryl A; Briggs, Doug

    2008-03-01

    Proponents of chain training suggest that using chains hung from the ends of barbells rather than using conventional barbells alone enhances strength, power, and neuromuscular adaptations. The purpose of this study was to determine whether a conventional barbell with chains compared to a conventional barbell without chains would affect the performance of an Olympic Clean. The subjects were also asked regarding their perception of how chains affected their lifting. Four male and 3 female competitive weightlifters who used chains as part of their training participated in the study. The testing protocol compared the subjects' lifting 80% and 85% of their 1 repetition maximum (1RM) using conventional barbells and their lifting 80% and 85% of their 1RM using chains (75% conventional barbells + 5% chains and 80% conventional barbells + 5% chains, respectively). Video analysis evaluated the bar's vertical displacement and velocity and the rate of force production. Vertical ground reaction forces for the first-pull, unweighting, and second-pull phases of the lift were evaluated by using a force plate. After testing, the subjects completed a 2-item questionnaire asking individual perception of the effects of the chains. The results showed no significant difference for condition for any of the variables examined. In contrast, all subjects perceived that the chains required a greater effort. In conclusion, the results indicated that the addition of chains provided no greater value over lifting conventional barbells alone in the performance of the Olympic Clean, although the subjects perceived the chains to have a positive effect.

  15. The use of acid phosphatase test papers for DNA profiling.

    PubMed

    Reshef, A; Barash, M; Gallili, N; Michael, A; Brauner, P

    2005-01-01

    The acid phosphatase (AP) test is a routine assay used to screen casework items for the possible presence of semen. This colour test is carried out on filter paper which is retained after testing. Two-year-old AP test papers were found to contain sufficient DNA for short tandem repeat (STR) profiling. Prior to polymerase chain reaction (PCR) amplification, the DNA was preferentially separated into sperm depleted and sperm enriched cell fractions. The implication of these findings for past and present cases is discussed.

  16. Polymerase chain reaction assay for the detection of Helicobacter pylori in gastric biopsy specimens: comparison with culture, rapid urease test, and histopathological tests.

    PubMed Central

    Fabre, R; Sobhani, I; Laurent-Puig, P; Hedef, N; Yazigi, N; Vissuzaine, C; Rodde, I; Potet, F; Mignon, M; Etienne, J P

    1994-01-01

    Ulcer recurrence is probably related to residual Helicobacter pylori (H pylori). Histological examination and culture are considered to be the most specific tests. CLO test is a rapid but less specific test, which is usually used as an alternative test to culture. The aim of this study was to investigate the efficiency of a simplified polymerase chain reaction (PCR) assay as a procedure for the diagnosis of gastric H pylori infection of patients. Biopsy specimens were obtained from antral mucosa of 58 patients at endoscopy and submitted to four tests for detection of H pylori. The bacteria were found in 53%, 43%, 48%, and 50% of patients according to the results of PCR, CLO test, culture, and histological examination. Twenty three patients had both negative histology and negative culture and PCR was negative in all of these. Thirteen patients were not classified because only histology or culture was positive and 10 of these had a positive PCR test. When the diagnosis of H pylori was established by agreement with both histology and culture or three positive tests out of four, 29 patients were H pylori positive (28 having had three positive tests and one displaying positive histology and culture), and 26 were negative, and three undetermined. PCR proved the most sensitive and specific test. These results suggest the simplified PCR assay may be a valuable test for the detection of H pylori. Images p906-a PMID:8063217

  17. Polymerase chain reaction identification of three members of the Anopheles sundaicus (Diptera: Culicidae) complex, malaria vectors in Southeast Asia.

    PubMed

    Dusfour, Isabelle; Blondeau, Johanna; Harbach, Ralph E; Vythilingham, Indra; Baimai, Visut; Trung, Ho D; Sochanta, Tho; Bangs, Michael J; Manguin, Sylvie

    2007-09-01

    Anopheles sundaicus s.l., a major malaria vector taxon, occurs primarily along coastal areas and on islands in Southeast Asia. Our previous studies using cytochrome oxidase I, cytochrome-b, and internal transcribed spacer 2 markers discriminated three allopatric species: An. sundaicus s.s. in northern Borneo, An. epiroticus in Southeast Asia, and An. sundaicus E on Sumatra and Java, Indonesia. Morphological comparisons of three developmental stages did not reveal unique diagnostic characters that could reliably distinguish the three species. Therefore, we developed a multiplex polymerase chain reaction (PCR) assay based on two mitochondrial DNA markers to unambiguously identify them. This PCR was tested on 374 specimens from 24 different geographical populations, expanding our knowledge of the distribution of these species.

  18. Inhibition of photophosphorylation and electron transport chain in thylakoids by lasiodiplodin, a natural product from Botryosphaeria rhodina.

    PubMed

    Veiga, Thiago A M; Silva, Sebastião C; Francisco, Archundia-Camacho; Filho, Edson R; Vieira, Paulo C; Fernandes, João B; Silva, Maria F G F; Müller, Manfred W; Lotina-Hennsen, Blas

    2007-05-16

    Four natural products were isolated from the fungus Botryosphaeria rhodina, and their effects on photosynthesis were tested. Only lasiodiplodin (1) inhibited ATP synthesis and electron flow from water to methylviologen; therefore, it acts as a Hill reaction inhibitor in freshly lysed spinach thylakoids. Photosystem I and II and partial reactions as well as ATPase were measured in the presence of 1. Three new different sites of 1 interaction and inhibition were found: one at CF1, the second in the water-splitting enzyme, and the third at the electron-transfer path between P680 and QA; these targets are different from that of the synthetic herbicides present. Electron transport chain inhibition by 1 was corroborated by fluorescence induction kinetics studies.

  19. Exploring the limits of ultrafast polymerase chain reaction using liquid for thermal heat exchange: A proof of principle

    NASA Astrophysics Data System (ADS)

    Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel

    2010-12-01

    Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA/RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification.

  20. Heterocyclic alpha-alkylidene cyclopentenones obtained via a Pauson-Khand reaction of amino acid derived allenynes. A scope and limitation study directed toward the preparation of a tricyclic pyrrole library.

    PubMed

    Brummond, Kay M; Curran, Dennis P; Mitasev, Branko; Fischer, Stefan

    2005-03-04

    The synthesis of a novel class of tricyclic pyrroles has been accomplished by using a Pauson-Khand/Stetter/Paal-Knorr reaction sequence. Full details of the Pauson-Khand reaction of amino acid tethered allenynes 4a-e and 9a-d are disclosed. The study of this reaction led to the discovery of an unprecedented substituent effect on the diastereoselectivity of the Mo(CO)6 mediated allenic Pauson-Khand reaction. It was found that amino acid tethered allenynes with aromatic side chains afford alpha-alkylidene cyclopentenones with the opposite diastereoselectivity compared to those with aliphatic side chains. This effect has been attributed to complexation of the metal mediator to the aromatic ring in the substrate. Furthermore, an isomerization of one of the diastereomers of the alpha-alkylidene cyclopentenones was encountered, leading to eventual decomposition. The stable diastereomers were found to react well in the Stetter reaction leading to 1,4-diketones that were converted to pyrroles. The observation that the first generation of 2-alkyl-substituted pyrroles was unstable led to a second generation of 2-carboxamide pyrroles with sufficient stability for biological tests which are in progress.

  1. Peroxy radical detection by chemical amplification (PERCA)

    NASA Technical Reports Server (NTRS)

    Stedman, D. H.

    1986-01-01

    Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.

  2. Genomic screening for blood-borne viruses in transfusion settings.

    PubMed

    Allain, J P

    2000-02-01

    The residual risk of post-transfusion human immunodeficiency virus (HIV) infection is low but slightly higher for hepatitis B virus (HBV) and hepatitis C virus (HCV), the main reason being viraemia during the window period preceding antibody or antigen detection by enzyme immunoassays. Immunosilent-infected individuals and carriers of distant viral variants also play an unquantifiable role. Multiple techniques, e.g. reverse transcription-polymerase chain reaction (RT-PCR), PCR, ligase-chain reaction, nucleic acid sequence-based amplification (NASBA) and transcription-mediated amplification (TMA) have been developed to amplify and detect viral genomes as single or multiplex assays. Equipment providing various degrees of automation has been adapted to these techniques. Applying nucleic acid amplification techniques (NAT) to blood screening, two main approaches have been advocated: plasma pool and single-donation testing. Pool testing presents the advantage of lower cost and readily available equipment although it is prone to false negative and positive reactions. The time required to identify infected donations is incompatible with blood component release, and may lead to product waste. Single-unit testing, although appealing, is not yet fully automated and potentially very costly unless a systematic multiplex approach is taken. Although technically feasible, NAT applied to the blood supply needs to be clinically evaluated and its cost efficiency assessed in the general public health context. However, pool NAT is currently implemented in continental Europe and the USA.

  3. Commercial enzyme-linked immunosorbent assay versuspolymerase chain reaction for the diagnosis of chronic Chagas disease: a systematic review and meta-analysis.

    PubMed

    Brasil, Pedro Emmanuel Alvarenga Americano do; Castro, Rodolfo; Castro, Liane de

    2016-01-01

    Chronic Chagas disease diagnosis relies on laboratory tests due to its clinical characteristics. The aim of this research was to review commercial enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR) diagnostic test performance. Performance of commercial ELISA or PCR for the diagnosis of chronic Chagas disease were systematically searched in PubMed, Scopus, Embase, ISI Web, and LILACS through the bibliography from 1980-2014 and by contact with the manufacturers. The risk of bias was assessed with QUADAS-2. Heterogeneity was estimated with the I2 statistic. Accuracies provided by the manufacturers usually overestimate the accuracy provided by academia. The risk of bias is high in most tests and in most QUADAS dimensions. Heterogeneity is high in either sensitivity, specificity, or both. The evidence regarding commercial ELISA and ELISA-rec sensitivity and specificity indicates that there is overestimation. The current recommendation to use two simultaneous serological tests can be supported by the risk of bias analysis and the amount of heterogeneity but not by the observed accuracies. The usefulness of PCR tests are debatable and health care providers should not order them on a routine basis. PCR may be used in selected cases due to its potential to detect seronegative subjects.

  4. Randomized controlled clinical trial evaluating multiplex polymerase chain reaction for pathogen identification and therapy adaptation in critical care patients with pulmonary or abdominal sepsis.

    PubMed

    Tafelski, Sascha; Nachtigall, Irit; Adam, Thomas; Bereswill, Stefan; Faust, Jana; Tamarkin, Andrey; Trefzer, Tanja; Deja, Maria; Idelevich, Evgeny A; Wernecke, Klaus-Dieter; Becker, Karsten; Spies, Claudia

    2015-06-01

    To determine whether a multiplex polymerase chain reaction (PCR)-based test could reduce the time required for initial pathogen identification in patients in an intensive care unit (ICU) setting. This double-blind, parallel-group randomized controlled trial** enrolled adults with suspected pulmonary or abdominal sepsis caused by an unknown pathogen. Both the intervention and control groups underwent the standard blood culture (BC) testing, but additional pathogen identification, based on the results of a LightCycler® SeptiFast PCR test, were provided in the intervention group. The study enrolled 37 patients in the control group and 41 in the intervention group. Baseline clinical and demographic characteristics were similar in both groups. The PCR-based test identified a pathogen in 10 out of 41 (24.4%) patients in the intervention group, with a mean duration from sampling to providing the information to the ICU of 15.9 h. In the control group, BC results were available after a significantly longer period (38.1 h). The LightCycler® SeptiFast PCR test demonstrated a significant reduction in the time required for initial pathogen identification, compared with standard BC. © The Author(s) 2015 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  5. Commercial enzyme-linked immunosorbent assay versus polymerase chain reaction for the diagnosis of chronic Chagas disease: a systematic review and meta-analysis

    PubMed Central

    do Brasil, Pedro Emmanuel Alvarenga Americano; Castro, Rodolfo; de Castro, Liane

    2016-01-01

    Chronic Chagas disease diagnosis relies on laboratory tests due to its clinical characteristics. The aim of this research was to review commercial enzyme-linked immunosorbent assay (ELISA) and polymerase chain reaction (PCR) diagnostic test performance. Performance of commercial ELISA or PCR for the diagnosis of chronic Chagas disease were systematically searched in PubMed, Scopus, Embase, ISI Web, and LILACS through the bibliography from 1980-2014 and by contact with the manufacturers. The risk of bias was assessed with QUADAS-2. Heterogeneity was estimated with the I2 statistic. Accuracies provided by the manufacturers usually overestimate the accuracy provided by academia. The risk of bias is high in most tests and in most QUADAS dimensions. Heterogeneity is high in either sensitivity, specificity, or both. The evidence regarding commercial ELISA and ELISA-rec sensitivity and specificity indicates that there is overestimation. The current recommendation to use two simultaneous serological tests can be supported by the risk of bias analysis and the amount of heterogeneity but not by the observed accuracies. The usefulness of PCR tests are debatable and health care providers should not order them on a routine basis. PCR may be used in selected cases due to its potential to detect seronegative subjects. PMID:26814640

  6. Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

    PubMed

    Spackman, Erica; Suarez, David L

    2005-01-01

    Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

  7. New Performance Metrics for Quantitative Polymerase Chain Reaction-Based Microbial Source Tracking Methods

    EPA Science Inventory

    Binary sensitivity and specificity metrics are not adequate to describe the performance of quantitative microbial source tracking methods because the estimates depend on the amount of material tested and limit of detection. We introduce a new framework to compare the performance ...

  8. Identification and validation of biomarkers of IgV(H) mutation status in chronic lymphocytic leukemia using microfluidics quantitative real-time polymerase chain reaction technology.

    PubMed

    Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R

    2007-09-01

    To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.

  9. Tangled nonlinear driven chain reactions of all optical singularities

    NASA Astrophysics Data System (ADS)

    Vasil'ev, V. I.; Soskin, M. S.

    2012-03-01

    Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

  10. The application of uniplex, duplex, and multiplex PCR for the absence of specified microorganism testing of pharmaceutical excipients and drug products.

    PubMed

    Ragheb, Suzan M; Yassin, Aymen S; Amin, Magdy A

    2012-01-01

    Notable progress has been made in methods that encourage the use of polymerase chain reaction (PCR) as a rapid and accurate tool in microbiological testing of pharmaceuticals. In this study, the detection of the four main specified microorganisms according to the pharmacopeial recommendations, Salmonella spp, Escherichia coli, Pseudomonas aeruginosa, and Staphylococcus aureus, was optimized in different pharmaceutical dosage forms and raw materials. Uniplex PCR was performed for the detection of each microorganism individually targeting the conserved region in each bacterial genome. Further optimizations were done to perform duplex and multiplex PCR assays considering relative concentrations of competitor primers used in the reaction. The uniplex PCR amplicons were successfully sequenced, confirming the conservation of used primers. Other validation parameters such as specificity, sensitivity, and robustness were examined closely. The method provides a high-throughput screening method to test different pharmaceutical preparations for specified microorganisms for the detection of microbiological contamination. Strict regulations govern the production of pharmaceutical products whether they are sterile or nonsterile. Certain official tests are carried out in microbiology testing laboratory in any pharmaceutical production facility to ensure the pharmaceuticals microbiological quality according to the standard pharmacopeial recommendations. Nonsterile products must be free of specified microorganisms that are used as a check for their quality. Topical preparations must be free of Pseudomonas aeruginosa and Staphylococcus aureus, and oral preparations must be free of Salmonella spp and Escherichia coli. Conventional microbiological methods are time-consuming, labor-intensive, and require long incubation times, resulting in delaying the release of the products. In this study, we tested and validated a polymerase chain reaction identification approach to detect indicator bacteria in pharmaceutical preparations. The method depends on amplification of certain conserved genes located in the four specified bacteria. The method is optimized to be carried out individually or collectively to detect all indicator bacteria in a single reaction in different forms of pharmaceutical products.

  11. Eight-Year Review of Bordetella pertussis Testing Reveals Seasonal Pattern in the United States.

    PubMed

    Bhatti, Micah M; Rucinski, Stefanea L; Schwab, Jeramy J; Cole, Nicolynn C; Gebrehiwot, Senait A; Patel, Robin

    2017-03-01

    Review of Bordetella pertussis polymerase chain reaction testing from 2007 through 2014 revealed a yearly spike in positivity rates during the summer throughout the United States. Paradoxically, the highest test volumes occurred outside of this time frame, which provides an opportunity for improved test utilization. © The Author 2015. Published by Oxford University Press on behalf of the Pediatric Infectious Diseases Society. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  12. I See Your Smart Phone and Raise You Smart Bacteria

    Science.gov Websites

    understanding how bacteria sense their nearest neighbors (including pathogens), a DTRA CB/JSTO-funded research ;wild type" E. coli was tested via reverse transcription quantitative polymerase chain reactions Director of Research, Dale Ormond, kicks off #MATHCOUNTS #NationalCompetition2018 Countdown Round

  13. Checking of individuality by DNA profiling.

    PubMed

    Brdicka, R; Nürnberg, P

    1993-08-25

    A review of methods of DNA analysis used in forensic medicine for identification, paternity testing, etc. is provided. Among other techniques, DNA fingerprinting using different probes and polymerase chain reaction-based techniques such as amplified sequence polymorphisms and minisatellite variant repeat mapping are thoroughly described and both theoretical and practical aspects are discussed.

  14. [Evaluation of the ELISA method for cholera toxin determination in Vibrio cholerae cultures].

    PubMed

    González-Bonilla, C; Gutiérrez-Cogco, L; Moguel-Pech, L; Villanueva-Zamudio, A

    1994-01-01

    ELISA test was evaluated in 503 cultures of Vibrio cholerae O1 y 303 Non-O1. The cultures were isolated from sewage from different states of México between june 1991 and october 1992. The sensitivity was 100% and specificity was 96%. Only 12 strains of V. cholerae Non-O1 were positive for CT toxin. When these cultures were confirmed by polymerase chain reaction (PCR) for cholera toxin, the results were negative. ELISA test is a good alternative to be used for toxin production in cultures of V. cholerae, it needs confirmation only with O1 negative and Non-O1 positive reactions.

  15. The influence of photocatalytic interior paints on indoor air quality

    NASA Astrophysics Data System (ADS)

    Auvinen, Joonas; Wirtanen, Leif

    2008-06-01

    A clean indoor air is important for the well-being and health of people. Lately, new photocatalytic paints have been launched on the market, which are claimed to have air-purifying effects. Photocatalysis initiates radical reactions. Radicals are formed when a photocatalyst (e.g. TiO2) is subjected to radiation. Typical radicals are the hydroxyl radical (radOH) and the superoxide radical (radO2-). Radicals cause chain reactions, which degrade and decompose organic compounds. The end products of these chain reactions are water and carbon dioxide, if the reactions are fully completed (mineralization). If mineralization does not take place, then a great number of side products can be formed, whose properties are not well understood. The side products of photocatalytic reactions can be permanent and stabile. The decomposition of indoor air impurities on the surface of photocatalytic paints is not obvious. The ability of photocatalytic indoor paints to reduce chemical indoor air impurities is the key issue of this study. Six different paints with different binder systems, such as lime, polyorganic siloxane, silica sol-gel and organic binders, were examined. The experiments were divided into three topics: degradation of an organic binder, photocatalytic decomposition of formaldehyde, and a volatile organic compound (VOC) mixture consisting of five different indoor air VOCs. All tests were carried out in an environmental test chamber under dynamic conditions. The test results indicate that many indoor pollutants are generated under normal- and UVA-light. Typical compounds formed include formaldehyde, acetone, acetaldehyde, etc. A clear decrease of formaldehyde or the VOC mixture concentration was not observed. All possibly generated compounds could not be collected or analyzed in this research project, but the measurements show that photocatalytic reactions do not generate only carbon dioxide and water. Photocatalytic decomposition of indoor air impurities can, however, produce many side products, which may be stabile and harmful.

  16. Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

    PubMed

    Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

    2018-06-01

    Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

  17. Topological dynamics of optical singularities in speckle-fields induced by photorefractive scattering in a LiNbO{sub 3} : Fe crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vasil'ev, Vasilii I; Soskin, M S

    2013-02-28

    A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less

  18. A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

    PubMed

    Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

    2014-01-01

    A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  19. A Two-Step Lyssavirus Real-Time Polymerase Chain Reaction Using Degenerate Primers with Superior Sensitivity to the Fluorescent Antigen Test

    PubMed Central

    Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael

    2014-01-01

    A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible. PMID:24822188

  20. Detecting Malaria Hotspots: A Comparison of Rapid Diagnostic Test, Microscopy, and Polymerase Chain Reaction

    PubMed Central

    Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip

    2017-01-01

    Abstract Background Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. Methods We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Results Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Conclusion Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. PMID:28973672

  1. Development of two real-time polymerase chain reaction assays to detect Actinobacillus pleuropneumoniae serovars 1-9-11 and serovar 2.

    PubMed

    Marois-Créhan, Corinne; Lacouture, Sonia; Jacques, Mario; Fittipaldi, Nahuel; Kobisch, Marylène; Gottschalk, Marcelo

    2014-01-01

    Two real-time, or quantitative, polymerase chain reaction (qPCR) assays were developed to detect Actinobacillus pleuropneumoniae serovars 1-9-11 (highly related serovars with similar virulence potential) and serovar 2, respectively. The specificity of these assays was verified on a collection of 294 strains, which included all 16 reference A. pleuropneumoniae strains (including serovars 5a and 5b), 263 A. pleuropneumoniae field strains isolated between 1992 and 2009 in different countries, and 15 bacterial strains other than A. pleuropneumoniae. The detection levels of both qPCR tests were evaluated using 10-fold dilutions of chromosomal DNA from reference strains of A. pleuropneumoniae serovars 1 and 2, and the detection limit for both assays was 50 fg per assay. The analytical sensitivities of the qPCR tests were also estimated by using pure cultures and tonsils experimentally spiked with A. pleuropneumoniae. The detection threshold was 2.5 × 10(4) colony forming units (CFU)/ml and 2.9 × 10(5) CFU/0.1 g of tonsil, respectively, for both assays. These specific and sensitive tests can be used for the serotyping of A. pleuropneumoniae in diagnostic laboratories to control porcine pleuropneumonia.

  2. Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

    PubMed

    Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

    2011-05-01

    A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

  3. A novel polymerase chain reaction (PCR) - denaturing gradient gel electrophoresis (DGGE) for the identification of Micrococcaceae strains involved in meat fermentations. Its application to naturally fermented Italian sausages.

    PubMed

    Cocolin, L; Manzano, M; Aggio, D; Cantoni, C; Comi, G

    2001-05-01

    A new molecular method consisting of polymerase chain reaction (PCR) amplification and denaturing gradient gel electrophoresis (DGGE) of a small fragment from the 16S rRNA gene identified the Micrococcaceae strains isolated from natural fermented Italian sausages. Lactic acid bacteria, total aerobic mesophilic flora, Enterobacteriaceae and faecal enterococci were also monitored. Micrococcaceaea control strains from international collections were used to optimise the method and 90 strains, isolated from fermented sausages, were identified by biochemical tests and PCR-DGGE. No differences were observed between the methods used. The results reported in this paper prove that Staphylococcus xylosus is the main bacterium involved in fermented sausage production, representing, from the tenth day of ripening, the only Micrococcaceaea species isolated.

  4. Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing

    PubMed Central

    White, P. Lewis; Wingard, John R.; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F.; Slavin, Monica A.; Barnes, Rosemary A.; Pappas, Peter G.; Donnelly, J. Peter

    2015-01-01

    Background. Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. Methods. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. Results. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%–88.0% and 75.0%–94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. Conclusions. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. PMID:26113653

  5. Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing.

    PubMed

    White, P Lewis; Wingard, John R; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F; Slavin, Monica A; Barnes, Rosemary A; Pappas, Peter G; Donnelly, J Peter

    2015-10-15

    Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%-88.0% and 75.0%-94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

  6. Assessing the cost of implementing the 2011 Society of Obstetricians and Gynecologists of Canada and Canadian College of Medical Genetics practice guidelines on the detection of fetal aneuploidies.

    PubMed

    Lilley, Margaret; Hume, Stacey; Karpoff, Nina; Maire, Georges; Taylor, Sherry; Tomaszewski, Robert; Yoshimoto, Maisa; Christian, Susan

    2017-09-01

    The Society of Obstetricians and Gynecologists of Canada and the Canadian College of Medical Genetics published guidelines, in 2011, recommending replacement of karyotype with quantitative fluorescent polymerase chain reaction when prenatal testing is performed because of an increased risk of a common aneuploidy. This study's objective is to perform a cost analysis following the implementation of quantitative fluorescent polymerase chain reaction as a stand-alone test. A total of 658 samples were received between 1 April 2014 and 31 August 2015: 576 amniocentesis samples and 82 chorionic villi sampling. A chromosome abnormality was identified in 14% (93/658) of the prenatal samples tested. The implementation of the 2011 Society of Obstetricians and Gynecologists of Canada and the Canadian College of Medical Genetics guidelines in Edmonton and Northern Alberta resulted in a cost savings of $46 295.80. The replacement of karyotype with chromosomal microarray for some indications would be associated with additional costs. The implementation of new test methods may provide cost savings or added costs. Cost analysis is important to consider during the implementation of new guidelines or technologies. © 2017 John Wiley & Sons, Ltd. © 2017 John Wiley & Sons, Ltd.

  7. Hypersensitivity reactions to penicillins: studies in a group of patients with negative benzylpenicillin G skin test.

    PubMed

    Qiao, H-L; Li, Z; Yang, J; Tian, X; Gao, N; Jia, L-J

    2009-06-01

    Although skin tests are usually employed to evaluate current penicillin allergy status, a negative result does not exclude hypersensitivity. There is a need for accurate in vitro tests to exclude hypersensitivity. A radioallergosorbent test (RAST) is a potentially good supplementary approach, but there is little information on the suitability of this method to diagnose penicillin hypersensitivity in subjects with a negative skin test to benzylpenicillin. A total of 133 patients with a negative skin test to benzylpenicillin G (PG) and all of whom developed allergic reactions to PG were studied. RAST was used to detect eight kinds of specific IgE antibodies to penicillins in serum, which included four kinds of major and minor antigenic determinants to four penicillin drugs. The combination sites for the specific IgE antibodies were studied by RAST inhibition test. The rate of positive reactions for the specific IgE antibodies was 59.40% (79/133). Of the eight kinds of antigenic determinants, the positive rates for specific IgE against the major and minor determinants were 39.10% (52) and 42.86% (57) respectively. Of the four drugs, positive cases only to PG were 10 (7.5%), were significantly fewer than the cross-reacting positive cases (36) to PG (P < 0.01). In the RAST inhibition studies all drugs exhibited good inhibitory potencies, and in some instances the side-chain of the penicillins could induce specific responses with a variable degree of cross-reactivity among the different penicillins. Radioallergosorbent test is a good complementary test in persons who are skin-test negative with PG, and the sensitivity of RAST increases with increasing specificity of IgE antibodies to be detected. 6-APA and the groups, making part of the different side-chains on penicillins, all contributed to the cross-reactivity.

  8. Acetylene chain reaction on hydrogenated boron nitride monolayers: a density functional theory study.

    PubMed

    Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru

    2017-11-28

    Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.

  9. Perioperative Anaphylaxis Including Kounis Syndrome due to Selective Cefazolin Allergy.

    PubMed

    Mota, Inês; Gaspar, Ângela; Morais-Almeida, Mário

    2018-06-18

    Perioperative use of cefazolin has been associated with severe allergic reactions, and patients are usually labelled as allergic to penicillin afterwards. The aim of our study was to describe a group of patients with immediate reactions to cefazolin, with proven selective hypersensitivity reactions. Systematic review of all patients followed at our drug centre with cefazolin-related reactions, between January 2012 and December 2016. All patients were investigated according to the European Network for Drug Allergy (ENDA) recommendations through skin testing (major and minor penicillin determinants, penicillin, amoxicillin, cefazolin, cefuroxime and ceftriaxone) and oral challenges tests. We included 7 patients (median age 40 years) with perioperative anaphylactic reactions immediately after cefazolin injection, 4 with hypotension and 1 with Kounis syndrome (KS) type I. The presence of a selective IgE-mediated hypersensitivity through positive skin tests to cefazoline has been proven in all patients. Two patients experienced systemic reactions during skin testing. All patients were successfully challenged with amoxicillin, and they tolerated cefuroxime. Cefazolin can be responsible for immediate severe allergic reactions in perioperative setting, including KS. Allergological workup is essential for an accurate diagnosis and to explore cross-reactivity between cefazolin and other beta-lactams. Our experience confirmed that patients with IgE-mediated hypersensitivity reactions to cefazolin can tolerate other beta-lactams. This selective pattern of clinical reactivity may be explained by its particular chemical structure, whose R1 side-chain is different from other beta-lactams. © 2018 S. Karger AG, Basel.

  10. Supplement to Theory of Neutron Chain Reactions

    DOE R&D Accomplishments Database

    Weinberg, Alvin M.; Noderer, L. C.

    1952-05-26

    General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

  11. FlindersTechnology Associates (FTA) filter paper-based DNA extraction with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii from respiratory specimens of immunocompromised patients.

    PubMed

    Nuchprayoon, Surang; Saksirisampant, Wilai; Jaijakul, Siraya; Nuchprayoon, Issarang

    2007-01-01

    We evaluated the diagnostic value of Flinders Technology Associates (FTA) filter paper together with polymerase chain reaction (PCR) for detection of Pneumocystis jirovecii (carinii) from induced sputum (IS) and bronchoalveolar lavage fluid (BALF) samples. The study involved 162 patients with clinical diagnosis of pneumocystis pneumonia (PcP) of human immunodeficiency virus/acquired immune deficiency syndrome (HIV/AIDS) patients and other immunocompromised patients. P. jirovecii cysts or trophozoites were detected in IS and BALF by cytological method. The mitochondrial 5S ribosomal ribonucleic acid (rRNA) gene of P. jirovecii was amplified from these samples by using FTA filters together with a one-step PCR method (FTA-PCR). With the FTA-PCR method, the sensitivity and specificity of the test compared to microscopic examination were 67% and 90% for IS, while they were 67% and 91% for BALF, respectively. The sensitivity and specificity of the FTA-PCR test was also comparable to PCR with the conventional deoxyribonucleic acid (DNA) extraction method. We concluded that FTA-PCR is useful to detect P. jirovecii in noninvasive IS.

  12. Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis.

    PubMed

    Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao

    2013-11-27

    The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.

  13. Five years' experience of classical swine fever polymerase chain reaction ring trials in France.

    PubMed

    Po, F; Le Dimna, M; Le Potier, M F

    2011-12-01

    Since 2004, the French National Reference Laboratory for classical swine fever (CSF) has conducted an annual proficiency test (PT) to evaluate the ability of local veterinary laboratories to perform real-time polymerase chain reaction (PCR) for CSF virus. The results of five years of testing (2004-2008) are described here. The PT was conducted under blind conditions on 20 samples. The same batch of samples was used for all five years. The number of laboratories that analysed the samples increased from four in 2004 to 13 in 2008. The results of the PT showed the following: cross-contamination between samples and deficiencies in RNA preparation can occur even in experienced laboratories; sample homogeneity should be checked carefully before selection; samples stored at-80 degrees C for several years remain stable; and poor shipment conditions do not damage the samples with regard to detection of CSF virus genome. These results will enable redesign of the panel to improve the overall quality of the PT, which will encourage laboratories to check and improve their PCR procedures and expertise. This is an excellent way to determine laboratory performance.

  14. Development and accuracy of quantitative real-time polymerase chain reaction assays for detection and quantification of enterotoxigenic Escherichia coli (ETEC) heat labile and heat stable toxin genes in travelers' diarrhea samples.

    PubMed

    Youmans, Bonnie P; Ajami, Nadim J; Jiang, Zhi-Dong; Petrosino, Joseph F; DuPont, Herbert L; Highlander, Sarah K

    2014-01-01

    Enterotoxigenic Escherichia coli (ETEC), the leading bacterial pathogen of travelers' diarrhea, is routinely detected by an established DNA hybridization protocol that is neither sensitive nor quantitative. Quantitative real-time polymerase chain reaction (qPCR) assays that detect the ETEC toxin genes eltA, sta1, and sta2 in clinical stool samples were developed and tested using donor stool inoculated with known quantities of ETEC bacteria. The sensitivity of the qPCR assays is 89%, compared with 22% for the DNA hybridization assay, and the limits of detection are 10,000-fold lower than the DNA hybridization assays performed in parallel. Ninety-three clinical stool samples, previously characterized by DNA hybridization, were tested using the new ETEC qPCR assays. Discordant toxin profiles were observed for 22 samples, notably, four samples originally typed as ETEC negative were ETEC positive. The qPCR assays are unique in their sensitivity and ability to quantify the three toxin genes in clinical stool samples.

  15. Development of a diagnostic real-time polymerase chain reaction assay for the detection of invasive Haemophilus influenzae in clinical samples.

    PubMed

    Meyler, Kenneth L; Meehan, Mary; Bennett, Desiree; Cunney, Robert; Cafferkey, Mary

    2012-12-01

    Since the introduction of the Haemophilus influenzae serotype b vaccine, invasive H. influenzae disease has become dominated by nontypeable (NT) strains. Several widely used molecular diagnostic methods have been shown to lack sensitivity or specificity in the detection of some of these strains. Novel real-time assays targeting the fucK, licA, and ompP2 genes were developed and evaluated. The fucK assay detected all strains of H. influenzae tested (n = 116) and had an analytical sensitivity of 10 genome copies/polymerase chain reaction (PCR). This assay detected both serotype b and NT H. influenzae in 12 previously positive specimens (culture and/or bexA PCR) and also detected H. influenzae in a further 5 of 883 culture-negative blood and cerebrospinal fluid (CSF) samples. The fucK assay has excellent potential as a diagnostic test for detection of typeable and nontypeable strains of invasive H. influenzae in clinical samples of blood and CSF. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Detection of tet(M) and tet(O) using the polymerase chain reaction in bacteria isolated from patients with periodontal disease.

    PubMed

    Olsvik, B; Olsen, I; Tenover, F C

    1995-04-01

    The polymerase chain reaction was used to examine 114 tetracycline-resistant anaerobic and facultative anaerobic bacterial isolates from patients with periodontal disease for the tet(M) and tet(O) genes. A 740-base-pair fragment of the tet(M) gene was amplified from 84 of 114 isolates, and a 519-base-pair fragment of the tet(O) gene was amplified from 13 streptococcal isolates. Six of 7 tetracycline-resistant isolates of Veillonella spp. and tetracycline-resistant isolates of Eubacterium spp. (n = 3), Eubacterium saburreum (n = 1), Streptococcus intermedius (n = 5) and Gemella morbillorum (n = 2) all harbored the tet(M) gene. The tet(M) and tet(O) negative as well as selected positive isolates were tested for the tet(K) and tet(L) genes using DNA probes. All isolates of Staphylococcus spp. (n = 11) hybridized with the tet(K) probe. None of the isolates tested hybridized with the probe for tet(L). This is the first report of the tet(M) gene in the facultative bacterium G. morbillorum and in E. saburreum.

  17. An investigation of genital ulcers in Jackson, Mississippi, with use of a multiplex polymerase chain reaction assay: high prevalence of chancroid and human immunodeficiency virus infection.

    PubMed

    Mertz, K J; Weiss, J B; Webb, R M; Levine, W C; Lewis, J S; Orle, K A; Totten, P A; Overbaugh, J; Morse, S A; Currier, M M; Fishbein, M; St Louis, M E

    1998-10-01

    In 1994, an apparent outbreak of atypical genital ulcers was noted by clinicians at the sexually transmitted disease clinic in Jackson, Mississippi. Of 143 patients with ulcers tested with a multiplex polymerase chain reaction (PCR) assay, 56 (39%) were positive for Haemophilus ducreyi, 44 (31%) for herpes simplex virus, and 27 (19%) for Treponema pallidum; 12 (8%) were positive for > 1 organism. Of 136 patients tested for human immunodeficiency virus (HIV) by serology, 14 (10%) were HIV-seropositive, compared with none of 200 patients without ulcers (P < .001). HIV-1 DNA was detected by PCR in ulcers of 6 (50%) of 12 HIV-positive patients. Multivariate analysis indicated that men with chancroid were significantly more likely than male patients without ulcers to report sex with a crack cocaine user, exchange of money or drugs for sex, and multiple sex partners. The strong association between genital ulcers and HIV infection in this population highlights the urgency of preventing genital ulcers in the southern United States.

  18. Loop-mediated isothermal PCR (LAMP) for the diagnosis of falciparum malaria.

    PubMed

    Paris, Daniel H; Imwong, Mallika; Faiz, Abul M; Hasan, Mahtabuddin; Yunus, Emran Bin; Silamut, Kamolrat; Lee, Sue J; Day, Nicholas P J; Dondorp, Arjen M

    2007-11-01

    A recently described loop-mediated isothermal polymerase chain reaction (LAMP) for molecular detection of Plasmodium falciparum was compared with microscopy, PfHRP2-based rapid diagnostic test (RDT), and nested polymerase chain reaction (PCR) as the "gold standard" in 115 Bangladeshi in-patients with fever. DNA extraction for LAMP was conducted by conventional methods or simple heating of the sample; test results were either assessed visually or by gel electrophoresis. Conventional DNA extraction followed by gel electrophoresis had the highest agreement with the reference method (81.7%, kappa = 0.64), with a sensitivity (95% CI) of 76.1% (68.3-83.9%), comparable to RDT and microscopy, but a specificity of 89.6% (84.0-95.2%) compared with 100% for RDT and microscopy. DNA extraction by heat treatment deteriorated specificity to unacceptable levels. LAMP enables molecular diagnosis of falciparum malaria in settings with limited technical resources but will need further optimization. The results are in contrast with a higher accuracy reported in an earlier study comparing LAMP with a non-validated PCR method.

  19. In-house polymerase chain reaction for affordable and sustainable Chlamydia trachomatis detection in Trinidad and Tobago.

    PubMed

    Rampersad, Joanne; Wang, Xiaohui; Gayadeen, Helen; Ramsewak, Samuel; Ammons, David

    2007-11-01

    To provide a preliminary assessment of in-house polymerase chain reaction (PCR) as an alternative to the more costly commercial test for detection of asymptomatic infection by Chlamydia trachomatis and to provide much needed demographic data on infection indicators within the Trinidad and Tobago public health care system. An inexpensive in-house nested-PCR with an Internal Amplification Control was used to detect C. trachomatis and Neisseria gonorrhoeae in urine samples collected from 273 apparently healthy, pregnant women from March-September 2004 in Trinidad, West Indies. Demographic information on participants was collected and subjected to statistical analyses. C. trachomatis was detected in 57/273 (21%) samples, of which 5 (2%) were also positive for N. gonorrhoeae. Infection correlated well with certain demographic parameters, with the highest incidence of C. trachomatis infection found among pregnant women that were single or of African descent. Given the lack of commercial tests in Trinidad, in-house PCR is an inexpensive alternative that can be used to detect asymptomatic infections of C. trachomatis and to provide demographic information needed for interventions by the public health care system.

  20. Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

    PubMed

    Zhou, Yu; Pearson, John E; Auerbach, Anthony

    2005-12-01

    We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

  1. Accuracy of polimerase chain reaction for the diagnosis of pleural tuberculosis.

    PubMed

    Trajman, Anete; da Silva Santos Kleiz de Oliveira, Elen Fabricia; Bastos, Mayara Lisboa; Belo Neto, Epaminondas; Silva, Edgar Manoel; da Silva Lourenço, Maria Cristina; Kritski, Afrânio; Oliveira, Martha Maria

    2014-06-01

    Polymerase chain reaction (PCR)-based techniques to detect Mycobacterium tuberculosis DNA in respiratory specimens have been increasingly used to diagnose pulmonary tuberculosis. Their use in non-respiratory specimens to diagnose extrapulmonary tuberculosis is, however, controversial. In this study, we estimated the accuracy of three in-country commercialized PCR-based diagnostic techniques in pleural fluid samples for the diagnosis of pleural tuberculosis. Patients underwent thoracenthesis for diagnosis purposes; pleural fluid aliquots were frozen and subsequently submitted to two real time PCR tests (COBAS(®)TAQMAN(®)MTB and Xpert(®)MTB/Rif) and one conventional PCR test (Detect-TB(®)). Two different reference standards were considered: probable tuberculosis (based on clinical grounds) and confirmed tuberculosis (bacteriologically or histologically). Ninety-three patients were included, of whom 65 with pleural tuberculosis, 35 of them confirmed. Sensitivities were 29% for COBAS(®)TAQMAN(®)MTB, 3% for Xpert(®)MTB/Rif and 3% for Detect-TB(®); specificities were 86%, 100% and 97% respectively, considering confirmed tuberculosis. Considering all cases, sensitivities were 16%, 3% and 2%, and specificities, 86%, 100%, and 97%. Compared to the 95% sensitivity of adenosine deaminase, the most sensitive test for pleural tuberculosis, the sensitivities of the three PCR-based tests were very low. We conclude that at present, there is no major place for such tests in routine clinical use. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. The structure and outcomes of a HIV postexposure prophylaxis program in a high HIV prevalence setup in western Kenya.

    PubMed

    Siika, Abraham M; Nyandiko, Winston M; Mwangi, Ann; Waxman, Michael; Sidle, John E; Kimaiyo, Sylvester N; Wools-Kaloustian, Kara

    2009-05-01

    In 2001, HIV postexposure prophylaxis (PEP) was initiated in western Kenya. Design, implementation, and evolution of the PEP program are described. Patient data were analyzed for reasons, time to initiation, and PEP outcome. Occupational PEP was initiated first followed by nonoccupational PEP (nPEP). Antiretroviral regimens were based upon national PEP guidelines, affordability and availability, and prevailing HIV prevalence. Emerging side effects data and cost improvements influenced regimen changes. Between November 2001 and December 2006, 446 patients sought PEP. Occupational exposure: 91 patients: 51 males; 72 accepted HIV testing; 48 of 52 source patients were HIV infected; median exposure-PEP time 3 hours (range: 0.3-96 hours). Of 72 HIV-negative patients receiving PEP, 3 discontinued, 69 completed, and 23 performed post-PEP HIV RNA polymerase chain reaction (all negative). Eleven follow-up HIV enzyme-linked immunosorbent assay tests have all turned negative. Nonoccupational exposure: 355 patients; 285 females; 90 children; 300 accepted HIV testing; median exposure-nPEP time 19 hours (range: 1-672 hours). Of 296 HIV-negative patients on nPEP, 1 died, 15 discontinued, 104 are on record having completed PEP, and 129 returned for 6-week HIV RNA polymerase chain reaction (1 patient tested positive). Eighty-seven follow-up HIV enzyme-linked immunosorbent assay tests have all turned negative. It is feasible to provide PEP and nPEP in resource-constrained settings.

  3. Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

    PubMed

    Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

    2017-11-01

    Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

  4. Analysis of cytomegalovirus (CMV) viremia using the pp65 antigenemia assay, the amplicor CMV test, and a semi-quantitative polymerase chain reaction test after allogeneic marrow transplantation.

    PubMed

    Ksouri, H; Eljed, H; Greco, A; Lakhal, A; Torjman, L; Abdelkefi, A; Ben Othmen, T; Ladeb, S; Slim, A; Zouari, B; Abdeladhim, A; Ben Hassen, A

    2007-03-01

    A pp65 antigenemia assay for polymorphonuclear leukocytes (PMNLs) (CINAkit Rapid Antigenemia), and a qualitative polymerase chain reaction (PCR) test for plasma 'PCR-P qual' (Amplicor cytomegalovirus [CMV] test) were performed for 126 samples (blood and plasma) obtained from 18 bone marrow transplant patients, over a 9-month surveillance period. Among those samples, 92 were assayed with a semi-quantitative PCR test for PMNLs 'PCR-L quant.' The number of samples with a positive CMV test for antigenemia and PCR-P qual assays was 20.63% and 12.7%, respectively, whereas the PCR-L quant assay was positive in 48 of the 92 samples assayed (52.17%). The rates of concordance of the results of PCR-P qual and antigenemia, PCR-P qual and PCR-L quant, antigenemia and PCR-L quant were 92%, 65.2% and 66.8%, respectively. The analysis of the results for the 92 specimens tested by all 3 methods showed a rate of concordance of 63% among all methods. Good agreement (kappa=0.72) was found only between pp65 Ag and PCR-P qual assays. Clinical disease correlates with an antigenemia high viral load. Three patients had CMV disease despite preemptive therapy, and all of them had graft-versus-host-disease (GVHD). PMNLs-based assays are more efficient in monitoring CMV reactivation, but for high-risk patients with GVHD, more sensitive assays (real-time PCR) must be done.

  5. Long-chain amine-templated synthesis of gallium sulfide and gallium selenide nanotubes

    NASA Astrophysics Data System (ADS)

    Seral-Ascaso, A.; Metel, S.; Pokle, A.; Backes, C.; Zhang, C. J.; Nerl, H. C.; Rode, K.; Berner, N. C.; Downing, C.; McEvoy, N.; Muñoz, E.; Harvey, A.; Gholamvand, Z.; Duesberg, G. S.; Coleman, J. N.; Nicolosi, V.

    2016-06-01

    We describe the soft chemistry synthesis of amine-templated gallium chalcogenide nanotubes through the reaction of gallium(iii) acetylacetonate and the chalcogen (sulfur, selenium) using a mixture of long-chain amines (hexadecylamine and dodecylamine) as a solvent. Beyond their role as solvent, the amines also act as a template, directing the growth of discrete units with a one-dimensional multilayer tubular nanostructure. These new materials, which broaden the family of amine-stabilized gallium chalcogenides, can be tentatively classified as direct large band gap semiconductors. Their preliminary performance as active material for electrodes in lithium ion batteries has also been tested, demonstrating great potential in energy storage field even without optimization.We describe the soft chemistry synthesis of amine-templated gallium chalcogenide nanotubes through the reaction of gallium(iii) acetylacetonate and the chalcogen (sulfur, selenium) using a mixture of long-chain amines (hexadecylamine and dodecylamine) as a solvent. Beyond their role as solvent, the amines also act as a template, directing the growth of discrete units with a one-dimensional multilayer tubular nanostructure. These new materials, which broaden the family of amine-stabilized gallium chalcogenides, can be tentatively classified as direct large band gap semiconductors. Their preliminary performance as active material for electrodes in lithium ion batteries has also been tested, demonstrating great potential in energy storage field even without optimization. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr01663d

  6. Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

    PubMed

    Umamaheswari, A; Venkateswarlu, K

    2004-06-01

    Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

  7. Differentiation of human-induced pluripotent stem cells into insulin-producing clusters.

    PubMed

    Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad

    2015-02-01

    In diabetes mellitus type 1, beta cells are mostly destroyed; while in diabetes mellitus type 2, beta cells are reduced by 40% to 60%. We hope that soon, stem cells can be used in diabetes therapy via pancreatic beta cell replacement. Induced pluripotent stem cells are a kind of stem cell taken from an adult somatic cell by "stimulating" certain genes. These induced pluripotent stem cells may be a promising source of cell therapy. This study sought to produce isletlike clusters of insulin-producing cells taken from induced pluripotent stem cells. A human-induced pluripotent stem cell line was induced into isletlike clusters via a 4-step protocol, by adding insulin, transferrin, and selenium (ITS), N2, B27, fibroblast growth factor, and nicotinamide. During differentiation, expression of pancreatic β-cell genes was evaluated by reverse transcriptase-polymerase chain reaction; the morphologic changes of induced pluripotent stem cells toward isletlike clusters were observed by a light microscope. Dithizone staining was used to stain these isletlike clusters. Insulin produced by these clusters was evaluated by radio immunosorbent assay, and the secretion capacity was analyzed with a glucose challenge test. Differentiation was evaluated by analyzing the morphology, dithizone staining, real-time quantitative polymerase chain reaction, and immunocytochemistry. Gene expression of insulin, glucagon, PDX1, NGN3, PAX4, PAX6, NKX6.1, KIR6.2, and GLUT2 were documented by analyzing real-time quantitative polymerase chain reaction. Dithizone-stained cellular clusters were observed after 23 days. The isletlike clusters significantly produced insulin. The isletlike clusters could increase insulin secretion after a glucose challenge test. This work provides a model for studying the differentiation of human-induced pluripotent stem cells to insulin-producing cells.

  8. A Degradome-Based Polymerase Chain Reaction to Resolve the Potential of Environmental Samples for 2,4-Dichlorophenol Biodegradation.

    PubMed

    Ibrahim, Eslam S; Kashef, Mona T; Essam, Tamer M; Ramadan, Mohammed A

    2017-12-01

    A clean way to overcome environmental pollution is biodegradation. In this perspective, at the intersection of biodegradation and metagenomics, the degradome is defined as the totality of genes related to the biodegradation of a certain compound. It includes the genetic elements from both culturable and uncultured microorganisms. The possibility of assessing the biodegradation potential of an environmental samples, using a degradome-based polymerase chain reaction, was explored. 2,4-Dichlorophenol (2,4-DCP) was chosen as a model and the use of tfdB gene as a biodegradation marker was confirmed by bioinformatics study of TfdB protein. Five primer pairs were designed for the detection of different tfdB gene families. A total of 16 environmental samples were collected from Egyptian agricultural soils and wastewaters and tested for the presence of 2,4-DCP. The biodegradation capacity of 2,4-DCP was determined, for all isolated consortia, to reach up to 350 mg/l. Metagenomic DNA was extracted directly from the soil samples while successive 2,4-DCP-degrading microbial communities were enriched, with increasing concentrations of 2,4-DCP, then their DNA was extracted. The extracted DNA was tested for the distribution of the tfdB gene using a degradome-based polymerase chain reaction. tfdB-1 and tfdB-2 were detected in 5 and 9 samples, respectively. However, the co-existence of both genes was detected only in five samples. All tfdB positive samples were capable of 2,4-DCP degradation. The developed approach of assessing the potential of different environments for degrading 2,4-DCP was successfully measured in terms of accuracy (81.25%) and specificity (100%).

  9. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  10. Comprehensive Nuclear-Test-Ban Treaty: Issues and Arguments

    DTIC Science & Technology

    2008-02-28

    is the point at which this chain reaction occurs; a “ critical mass ” is the amount of fissile material just enough to support criticality . The...amount of material for a critical mass depends on many factors, such as shape, density, impurities that absorb neutrons, and use of material to reflect...the years. Hydronuclear experiments were conducted during the 1958-1961 nuclear test moratorium. They initially used less than a critical mass of

  11. Aspergillus vertebral osteomyelitis in chronic leukocyte leukemia patient diagnosed by a novel panfungal polymerase chain reaction method.

    PubMed

    Dayan, Lior; Sprecher, Hannah; Hananni, Amos; Rosenbaum, Hana; Milloul, Victor; Oren, Ilana

    2007-01-01

    Vertebral osteomyelitis and disciitis caused by Aspergillus spp is a rare event. Early diagnosis and early antifungal therapy are critical in improving the prognosis for these patients. The diagnosis of invasive fungal infections is, in many cases, not straightforward and requires invasive procedures so that histological examination and culture can be performed. Furthermore, current traditional microbiological tests (ie, cultures and stains) lack the sensitivity for diagnosis of invasive aspergillosis. To present a case of vertebral osteomyelitis caused by Aspergillus spp diagnosed using a novel polymerase chain reaction (PCR) assay. Case report. Aspergillus DNA was detected in DNA extracted from the necrotic bone tissue by using a "panfungal" PCR novel method. Treatment with voriconazole was started based on the diagnosis. Using this novel technique enabled us to diagnose accurately an unusual bone pathogen that requires a unique treatment.

  12. Integrating DNA strand displacement circuitry to the nonlinear hybridization chain reaction.

    PubMed

    Zhang, Zhuo; Fan, Tsz Wing; Hsing, I-Ming

    2017-02-23

    Programmable and modular attributes of DNA molecules allow one to develop versatile sensing platforms that can be operated isothermally and enzyme-free. In this work, we present an approach to integrate upstream DNA strand displacement circuits that can be turned on by a sequence-specific microRNA analyte with a downstream nonlinear hybridization chain reaction for a cascading hyperbranched nucleic acid assembly. This system provides a two-step amplification strategy for highly sensitive detection of the miRNA analyte, conducive for multiplexed detection. Multiple miRNA analytes were tested with our integrated circuitry using the same downstream signal amplification setting, showing the decoupling of nonlinear self-assembly with the analyte sequence. Compared with the reported methods, our signal amplification approach provides an additional control module for higher-order DNA self-assembly and could be developed into a promising platform for the detection of critical nucleic-acid based biomarkers.

  13. A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction

    NASA Astrophysics Data System (ADS)

    Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng

    2016-08-01

    In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples.

  14. Recombinase polymerase amplification: Emergence as a critical molecular technology for rapid, low-resource diagnostics.

    PubMed

    James, Ameh; Macdonald, Joanne

    2015-01-01

    Isothermal molecular diagnostics are bridging the technology gap between traditional diagnostics and polymerase chain reaction-based methods. These new techniques enable timely and accurate testing, especially in settings where there is a lack of infrastructure to support polymerase chain reaction facilities. Despite this, there is a significant lack of uptake of these technologies in developing countries where they are highly needed. Among these novel isothermal technologies, recombinase polymerase amplification (RPA) holds particular potential for use in developing countries. This rapid nucleic acid amplification approach is fast, highly sensitive and specific, and amenable to countries with a high burden of infectious diseases. Implementation of RPA technology in developing countries is critically required to assess limitations and potentials of the diagnosis of infectious disease, and may help identify impediments that prevent adoption of new molecular technologies in low resource- and low skill settings. This review focuses on approaching diagnosis of infectious disease with RPA.

  15. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    USGS Publications Warehouse

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  16. Recombinase polymerase amplification-based assay to diagnose Giardia in stool samples.

    PubMed

    Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

    2015-03-01

    Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. © The American Society of Tropical Medicine and Hygiene.

  17. Recombinase Polymerase Amplification-Based Assay to Diagnose Giardia in Stool Samples

    PubMed Central

    Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

    2015-01-01

    Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. PMID:25510713

  18. Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples

    PubMed Central

    Pérez, Lester J.; de Arce, Heidy Díaz

    2009-01-01

    Aujeszky’s disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved viral gD gene fragment. PCR products of the expected size were obtained from PRV strains. Non-specific reactions were not observed when a related herpesvirus, other porcine DNA genome viruses and uninfected cells were used to assess PCR. The analytical sensitivity of the test was estimated to be 1.34 TCID50/ 50 uL. The analysis of tissue homogenate samples from naturally infected animals proved the potential usefulness of the method for a rapid disease diagnosis from field cases. A rapid, sensitive and specific PCR-based diagnostic assay to detect pseudorabies virus in clinical samples is provided. PMID:24031383

  19. Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico.

    PubMed

    Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M

    1993-01-01

    A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

  20. Using newly developed multiplex polymerase chain reaction and melting curve analysis for detection and discrimination of β-lactamases in Escherichia coli isolates from intensive care patients.

    PubMed

    Chromá, Magdaléna; Hricová, Kristýna; Kolář, Milan; Sauer, Pavel; Koukalová, Dagmar

    2011-11-01

    A total of 78 bacterial strains with known β-lactamases were used to optimize a rapid detection system consisting of multiplex polymerase chain reaction and melting curve analysis to amplify and identify blaTEM, blaSHV, and blaCTX-M genes in a single reaction. Additionally, to evaluate the applicability of this method, 32 clinical isolates of Escherichia coli displaying an extended-spectrum β-lactamase phenotype from patients hospitalized at intensive care units were tested. Results were analyzed by the Rotor-Gene operating software and Rotor-Gene ScreenClust HRM Software. The individual melting curves differed by a temperature shift or curve shape, according to the presence of β-lactamase genes. With the use of this method and direct sequencing, blaCTX-M-15-like was identified as the most prevalent β-lactamase gene. In conclusion, this novel detection system seems to be a suitable tool for rapid detection of present β-lactamase genes and their characterization. Copyright © 2011 Elsevier Inc. All rights reserved.

  1. The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

    PubMed

    Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

    2006-07-01

    We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

  2. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    PubMed

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Parvovirus B19 Infection in Children With Arterial Ischemic Stroke.

    PubMed

    Fullerton, Heather J; Luna, Jorge M; Wintermark, Max; Hills, Nancy K; Tokarz, Rafal; Li, Ying; Glaser, Carol; DeVeber, Gabrielle A; Lipkin, W Ian; Elkind, Mitchell S V

    2017-10-01

    Case-control studies suggest that acute infection transiently increases the risk of childhood arterial ischemic stroke. We hypothesized that an unbiased pathogen discovery approach utilizing MassTag-polymerase chain reaction would identify pathogens in the blood of childhood arterial ischemic stroke cases. The multicenter international VIPS study (Vascular Effects of Infection in Pediatric Stroke) enrolled arterial ischemic stroke cases, and stroke-free controls, aged 29 days through 18 years. Parental interview included questions on recent infections. In this pilot study, we used MassTag-polymerase chain reaction to test the plasma of the first 161 cases and 34 controls enrolled for a panel of 28 common bacterial and viral pathogens. Pathogen DNA was detected in no controls and 14 cases (8.7%): parvovirus B19 (n=10), herpesvirus 6 (n=2), adenovirus (n=1), and rhinovirus 6C (n=1). Parvovirus B19 infection was confirmed by serologies in all 10; infection was subclinical in 8. Four cases with parvovirus B19 had underlying congenital heart disease, whereas another 5 had a distinct arteriopathy involving a long-segment stenosis of the distal internal carotid and proximal middle cerebral arteries. Using MassTag-polymerase chain reaction, we detected parvovirus B19-a virus known to infect erythrocytes and endothelial cells-in some cases of childhood arterial ischemic stroke. This approach can generate new, testable hypotheses about childhood stroke pathogenesis. © 2017 American Heart Association, Inc.

  4. Combined subtraction hybridization and polymerase chain reaction amplification procedure for isolation of strain-specific Rhizobium DNA sequences.

    PubMed Central

    Bjourson, A J; Stone, C E; Cooper, J E

    1992-01-01

    A novel subtraction hybridization procedure, incorporating a combination of four separation strategies, was developed to isolate unique DNA sequences from a strain of Rhizobium leguminosarum bv. trifolii. Sau3A-digested DNA from this strain, i.e., the probe strain, was ligated to a linker and hybridized in solution with an excess of pooled subtracter DNA from seven other strains of the same biovar which had been restricted, ligated to a different, biotinylated, subtracter-specific linker, and amplified by polymerase chain reaction to incorporate dUTP. Subtracter DNA and subtracter-probe hybrids were removed by phenol-chloroform extraction of a streptavidin-biotin-DNA complex. NENSORB chromatography of the sequences remaining in the aqueous layer captured biotinylated subtracter DNA which may have escaped removal by phenol-chloroform treatment. Any traces of contaminating subtracter DNA were removed by digestion with uracil DNA glycosylase. Finally, remaining sequences were amplified by polymerase chain reaction with a probe strain-specific primer, labelled with 32P, and tested for specificity in dot blot hybridizations against total genomic target DNA from each strain in the subtracter pool. Two rounds of subtraction-amplification were sufficient to remove cross-hybridizing sequences and to give a probe which hybridized only with homologous target DNA. The method is applicable to the isolation of DNA and RNA sequences from both procaryotic and eucaryotic cells. Images PMID:1637166

  5. Impact of Enteroviral Polymerase Chain Reaction Testing on Length of Stay for Infants 60 Days Old or Younger.

    PubMed

    Aronson, Paul L; Lyons, Todd W; Cruz, Andrea T; Freedman, Stephen B; Okada, Pamela J; Fleming, Alesia H; Arms, Joseph L; Thompson, Amy D; Schmidt, Suzanne M; Louie, Jeffrey; Alfonzo, Michael J; Monuteaux, Michael C; Nigrovic, Lise E

    2017-10-01

    To determine the impact of a cerebrospinal fluid enterovirus polymerase chain reaction (PCR) test performance on hospital length of stay (LOS) in a large multicenter cohort of infants undergoing evaluation for central nervous system infection. We performed a planned secondary analysis of a retrospective cohort of hospitalized infants ≤60 days of age who had a cerebrospinal fluid culture obtained at 1 of 18 participating centers (2005-2013). After adjustment for patient age and study year as well as clustering by hospital center, we compared LOS for infants who had an enterovirus PCR test performed vs not performed and among those tested, for infants with a positive vs negative test result. Of 19 953 hospitalized infants, 4444 (22.3%) had an enterovirus PCR test performed and 945 (21.3% of tested infants) had positive test results. Hospital LOS was similar for infants who had an enterovirus PCR test performed compared with infants who did not (incident rate ratio 0.98 hours; 95% CI 0.89-1.06). However, infants PCR positive for enterovirus had a 38% shorter LOS than infants PCR negative for enterovirus (incident rate ratio 0.62 hours; 95% CI 0.57-0.68). No infant with a positive enterovirus PCR test had bacterial meningitis (0%; 95% CI 0-0.4). Although enterovirus PCR testing was not associated with a reduction in LOS, infants with a positive enterovirus PCR test had a one-third shorter LOS compared with infants with a negative enterovirus PCR test. Focused enterovirus PCR test use could increase the impact on LOS for infants undergoing cerebrospinal fluid evaluation. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. NASBA: A detection and amplification system uniquely suited for RNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sooknanan, R.; Malek, L.T.

    1995-06-01

    The invention of PCR (polymerase chain reaction) has revolutionized our ability to amplify and manipulate a nucleic acid sequence in vitro. The commercial rewards of this revolution have driven the development of other nuclei acid amplification and detection methodologies. This has created an alphabet soup of technologies that use different amplification methods, including NASBA (nucleic acid sequence-based amplification), LCR (ligase chain reaction), SDA (strand displacement amplification), QBR (Q-beta replicase), CPR (cycling probe reaction), and bDNA (branched DNA). Despite the differences in their processes, these amplification systems can be separated into two broad categories based on how they achieve their goal:more » sequence-based amplification systems, such as PCR, NASBA, and SDA, amplify a target nucleic acid sequence. Signal-based amplification systems, such as LCR, QBR, CPR and bDNA, amplify or alter a signal from a detection reaction that is target-dependent. While the various methods have relative strengths and weaknesses, only NASBA offers the unique ability to homogeneously amplify an RNA analyte in the presence of homologous genomic DNA under isothermal conditions. Since the detection of RNA sequences almost invariably measures biological activity, it is an excellent prognostic indicator of activities as diverse as virus production, gene expression, and cell viability. The isothermal nature of the reaction makes NASBA especially suitable for large-scale manual screening. These features extend NASBA`s application range from research to commercial diagnostic applications. Field test kits are presently under development for human diagnostics as well as the burgeoning fields of food and environmental diagnostic testing. These developments suggest future integration of NASBA into robotic workstations for high-throughput screening as well. 17 refs., 1 tab.« less

  7. Systematic development of reduced reaction mechanisms for dynamic modeling

    NASA Technical Reports Server (NTRS)

    Frenklach, M.; Kailasanath, K.; Oran, E. S.

    1986-01-01

    A method for systematically developing a reduced chemical reaction mechanism for dynamic modeling of chemically reactive flows is presented. The method is based on the postulate that if a reduced reaction mechanism faithfully describes the time evolution of both thermal and chain reaction processes characteristic of a more complete mechanism, then the reduced mechanism will describe the chemical processes in a chemically reacting flow with approximately the same degree of accuracy. Here this postulate is tested by producing a series of mechanisms of reduced accuracy, which are derived from a full detailed mechanism for methane-oxygen combustion. These mechanisms were then tested in a series of reactive flow calculations in which a large-amplitude sinusoidal perturbation is applied to a system that is initially quiescent and whose temperature is high enough to start ignition processes. Comparison of the results for systems with and without convective flow show that this approach produces reduced mechanisms that are useful for calculations of explosions and detonations. Extensions and applicability to flames are discussed.

  8. Hb Molfetta [beta126(H4)Val-->Leu, GTG-->CTG]: a new, silent, neutral beta chain variant found in an Italian woman.

    PubMed

    Qualtieri, Antonio; Le, Pera Maria; Pedace, Vera; Magariello, Angela; Brancati, Carlo

    2002-02-01

    We have identified a new neutral hemoglobin variant in a pregnant Italian woman, that resulted from a GTG-->CTG replacement at codon 126 of the beta chain, corresponding to a Val-->Leu amino acid change at position beta126(H4). Thermal and isopropanol stability tests were normal and there were no abnormal clinical features. Routine electrophoretic and ion exchange chromatographic methods for hemoglobin separation failed to show this variant, but reversed phase high performance liquid chromatography revealed an abnormal peak eluting near the normal beta chain. No abnormal tryptic peptide was revealed on the high performance liquid chromatographic elution pattern of the total globin digest. The mutation was determined at the DNA level by amplification of the three beta exons by polymerase chain reaction and direct sequencing of one exon that showed an abnormal migration on single strand conformational polymorphism analysis.

  9. The fate of Helicobacter pylori phagocytized by Acanthamoeba polyphaga demonstrated by fluorescent in situ hybridization and quantitative polymerization chain reaction tests

    EPA Science Inventory

    Helicobacter pylori able to express green fluorescent protein, as well as an ATCC strain, and a clinical isolate of this pathogen were evaluated for their ability to survive predation by Acanthamoeba polyphaga. Ingestion was evaluated by microscopic observation of the GFP-H. pyl...

  10. Novel Parvovirus and Related Variant in Human Plasma

    PubMed Central

    Fryer, Jacqueline F.; Kapoor, Amit; Minor, Philip D.; Delwart, Eric

    2006-01-01

    We report a novel parvovirus (PARV4) and related variants in pooled human plasma used in the manufacture of plasma-derived medical products. Viral DNA was detected by using highly selective polymerase chain reaction assays; 5% of pools tested positive, and amounts of DNA ranged from <500 copies/mL to >106 copies/mL plasma. PMID:16494735

  11. Development of a reverse transcription polymerase chain reaction method for yellow fever virus detection.

    PubMed

    Méndez, María C; Domingo, Cristina; Tenorio, Antonio; Pardo, Lissethe C; Rey, Gloria J; Méndez, Jairo A

    2013-09-01

    Yellow fever is considered a re-emerging disease and is endemic in tropical regions of Africa and South America. At present, there are no standardized or commercialized kits available for yellow fever virus detection. Therefore, diagnosis must be made by time-consuming routine techniques, and sometimes, the virus or its proteins are not detected. Furthermore, co-circulation with other flaviviruses, including dengue virus, increases the difficulty of diagnosis. To develop a specific reverse transcriptase-polymerase chain reaction (RT-PCR) and nested PCR-based assay to improve the detection and diagnosis of yellow fever virus using both serum and fresh tissue samples. RT-PCR primers were designed to amplify a short fragment of all yellow fever virus genotypes reported. A second set of primers was used in a nested PCR to increase sensitivity. Thirty-three clinical samples were tested with the standardized reaction. The expected amplicon was obtained in 25 out of 33 samples analyzed using this approach, and 2 more samples tested positive after a subsequent nested PCR approach. This improved technique not only ensures the specific detection of a wide range of yellow fever virus genotypes but also may increase the sensitivity of detection by introducing a second round of amplification, allowing a rapid differential diagnosis between dengue and yellow fever infection, which is required for effective surveillance and opportune epidemiologic measures.

  12. Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.

    PubMed

    Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava

    2018-05-01

    Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. Chemical Action of Halogenated Agents in Fire Extinguishing

    NASA Technical Reports Server (NTRS)

    Belles, Frank E.

    1955-01-01

    The action of halogenated agents in preventing flame propagation in fuel-air mixtures in laboratory tests is discussed in terms of a possible chemical mechanism. The mechanism chosen is that of chain-breaking reactions between agent and active particles (hydrogen and oxygen atoms and hydroxyl radicsls). Data from the literature on the flammability peaks of n-heptane agent-air mixtures are treated. Ratings of agent effectiveness in terms of the fuel equivalent of the agent, based on both fuel and agent concentrations at the peak, are proposed as preferable to ratings in terms of agent concentration alone. These fuel-equivalent ratings are roughly correlated by reactivities assigned to halogen and hydrogen atoms in the agent molecules. It is concluded that the presence of hydrogen in agent need not reduce its fire-fighting ability, provided there is enough halogen to make the agent nonflammable. A method is presented for estimating from quenching-distance data a rate constant for the reaction of agent with active particles. A quantitative result is obtained for methyl bromide. This rate constant predicts the observed peak concentration of methyl bromide quite well. However, more data are needed to prove the validity of the method. The assumption that hal.ogenatedagents act mainly by chain-bresking reactions with active particles is consistent with the experimental facts and should help guide the selection of agents for further tests.

  14. Development of a reverse transcription quantitative polymerase chain reaction-based assay for broad coverage detection of African and Asian Zika virus lineages.

    PubMed

    Yang, Yang; Wong, Gary; Ye, Baoguo; Li, Shihua; Li, Shanqin; Zheng, Haixia; Wang, Qiang; Liang, Mifang; Gao, George F; Liu, Lei; Liu, Yingxia; Bi, Yuhai

    2017-06-01

    The Zika virus (ZIKV) is an arbovirus that has spread rapidly worldwide within recent times. There is accumulating evidence that associates ZIKV infections with Guillain-Barré Syndrome (GBS) and microcephaly in humans. The ZIKV is genetically diverse and can be separated into Asian and African lineages. A rapid, sensitive, and specific assay is needed for the detection of ZIKV across various pandemic regions. So far, the available primers and probes do not cover the genetic diversity and geographic distribution of all ZIKV strains. To this end, we have developed a one-step quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay based on conserved sequences in the ZIKV envelope (E) gene. The detection limit of the assay was determined to be five RNA transcript copies and 2.94 × 10 -3 50% tissue culture infectious doses (TCID 50 ) of live ZIKV per reaction. The assay was highly specific and able to detect five different ZIKV strains covering the Asian and African lineages without nonspecific amplification, when tested against other flaviviruses. The assay was also successful in testing for ZIKV in clinical samples. Our assay represents an improvement over the current methods available for the detection ZIKV and would be valuable as a diagnostic tool in various pandemic regions.

  15. Comparison of nonstructural protein-1 antigen detection by rapid and enzyme-linked immunosorbent assay test and its correlation with polymerase chain reaction for early diagnosis of dengue

    PubMed Central

    Gaikwad, Seema; Sawant, Sandhya S.; Shastri, Jayanthi S.

    2017-01-01

    INTRODUCTION: Early diagnosis of dengue is important for appropriate clinical management and vector control. Different serological tests based on the principle of immunochromatography and enzyme-linked immunosorbent assay (ELISA) are commonly used for detection of antigen and antibodies of dengue virus. The performance of these tests depends on the sensitivity and specificity. Hence, the study was undertaken to compare nonstructural protein-1 (NS1) antigen detection by rapid and ELISA with real-time polymerase chain reaction (RT-PCR) for diagnosis of dengue. MATERIALS AND METHODS: Prospective laboratory study was carried out on sera samples (n = 200) from clinically suspected cases of dengue. The sera samples were subjected for NS1 antigen detection test by rapid test, NS1 ELISA, and RT-PCR. The results of rapid and ELISA tests were compared with real Time PCR. RESULTS: The sensitivity, specificity, positive, and negative predictive value of rapid dengue NS1 antigen test were 81.5%, 66.7%, 78.2%, and 71.1%, respectively whereas that of NS1 ELISA were 89.9%, 100%, 100%, and 94%, respectively. Concordance of Rapid NS1 and NS1 ELISA with PCR was 75.5% and 94%. DISCUSSION AND CONCLUSION: NS1 antigen ELISA can be implemented in diagnostic laboratories for diagnosis of dengue in the acute phase of illness. The test also has great potential value for use in epidemic situations, as it could facilitate the early screening of patients and limit disease expansion. PMID:28706387

  16. [Development of a diagnostic test system for early non-invasive detection of prostate cancer based on PCA3 mRNA levels in urine sediment using quantitative reverse tanscription polymerase chain reaction (qRT-PCR)].

    PubMed

    Pavlov, K A; Shkoporov, A N; Khokhlova, E V; Korchagina, A A; Sidorenkov, A V; Grigor'ev, M É; Pushkar', D Iu; Chekhonin, V P

    2013-01-01

    The wide introduction of prostatic specific antigen (PSA) determination into clinical practice has resulted in a larger number of prostate biopsies, while the lower age threshold for PSA has led to a larger number of unnecessary prostate biopsies. Hence, there is a need for new biomarkers that can detect prostate cancer. PCA3 is a noncoding messenger ribonucleic acid (mRNA) that is expressed exclusively in prostate cells. The aim of the study has been to develop a diagnostic test system for early non-invasive detection of prostate cancer based on PCA3 mRNA levels in urine sediment using quantitative reverse transcription polymerase chain reaction (qRT-PCR). As part of the study, a laboratory diagnostic test system prototype has been designed, an application methodology has been developed and specificity and sensitivity data of the method has been assessed. The diagnostic system has demonstrated its ability to detect significantly elevated levels of PCA 3/KLK 3 in samples from prostate cancer (PCa) patients compared with those from healthy men. The findings have shown relatively high diagnostic sensitivity, specificity and negative-predictive values for an early non-invasive screening of prostate cancer

  17. A simple nucleic acid hybridization/latex agglutination assay for the rapid detection of polymerase chain reaction amplicons.

    PubMed

    Vollenhofer-Schrumpf, Sabine; Buresch, Ronald; Schinkinger, Manfred

    2007-03-01

    We have developed a new method for the detection of nucleic acid hybridization, based on a simple latex agglutination test that can be evaluated by the unaided eye. Nucleic acid, e.g., a polymerase chain reaction (PCR) product, is denatured and incubated with polystyrene beads carrying covalently bound complementary oligonucleotide sequences. Hybridization of the nucleic acids leads to aggregation of the latex particles, thereby verifying the presence of target sequence. The test is performed at room temperature, and results are available within 10 min. As a proof of principle, the hybridization/latex agglutination assay was applied to the detection of purified PCR fragments either specific for Salmonella spp. or a synthetic sequence, and to the detection of Salmonella enterica in artificially contaminated chicken samples. A few nanograms of purified PCR fragments were detectable. In artificially contaminated chicken samples, 3 colony-forming units (cfu)/25 g were detected in one of three replicates, and 30 cfu/25 g were detected in both of two replicates when samples for PCR were taken directly from primary enrichment, demonstrating the practical applicability of this test system. Even multiplex detection might be achievable. This novel kind of assay could be useful for a range of applications where hybridization of nucleic acids, e.g., PCR fragments, is to be detected.

  18. Standardisation of polymerase chain reaction for the detection of Salmonella typhi in typhoid fever.

    PubMed Central

    Chaudhry, R; Laxmi, B V; Nisar, N; Ray, K; Kumar, D

    1997-01-01

    To improve the diagnosis of Salmonella typhi infection, a polymerase chain reaction (PCR) assay was developed for the amplification of the dH flagellin gene of S typhi. Primers were designed from dH flagellin gene sequence which will give an amplification product of 486 base pairs. In tests to study the specificity of the assay, no amplification was seen in non-salmonella strains or salmonella strains with flagellar gene other than "d". Sensitivity tests determined that 28 pg of S typhi target DNA or 3 x 10(2) target bacteria could be detected by the PCR assay. Subsequently, the PCR technique was used for detection of S typhi in blood or clot cultures from 84 patients clinically suspected of having typhoid fever, and from 20 healthy control subjects. Twenty five of 84 samples from clinically suspected cases were positive by PCR; four of which were culture negative. No amplification was seen in samples from patients who were culture positive for organisms other than S typhi or from controls. The time taken for each sample for PCR analysis was less than 48 hours compared with three to five days for blood or clot culture. PCR appeared to be a promising diagnostic test for typhoid fever. Images PMID:9215131

  19. Detecting Malaria Hotspots: A Comparison of Rapid Diagnostic Test, Microscopy, and Polymerase Chain Reaction.

    PubMed

    Mogeni, Polycarp; Williams, Thomas N; Omedo, Irene; Kimani, Domtila; Ngoi, Joyce M; Mwacharo, Jedida; Morter, Richard; Nyundo, Christopher; Wambua, Juliana; Nyangweso, George; Kapulu, Melissa; Fegan, Gregory; Bejon, Philip

    2017-11-27

    Malaria control strategies need to respond to geographical hotspots of transmission. Detection of hotspots depends on the sensitivity of the diagnostic tool used. We conducted cross-sectional surveys in 3 sites within Kilifi County, Kenya, that had variable transmission intensities. Rapid diagnostic test (RDT), microscopy, and polymerase chain reaction (PCR) were used to detect asymptomatic parasitemia, and hotspots were detected using the spatial scan statistic. Eight thousand five hundred eighty-one study participants were surveyed in 3 sites. There were statistically significant malaria hotspots by RDT, microscopy, and PCR for all sites except by microscopy in 1 low transmission site. Pooled data analysis of hotspots by PCR overlapped with hotspots by microscopy at a moderate setting but not at 2 lower transmission settings. However, variations in degree of overlap were noted when data were analyzed by year. Hotspots by RDT were predictive of PCR/microscopy at the moderate setting, but not at the 2 low transmission settings. We observed long-term stability of hotspots by PCR and microscopy but not RDT. Malaria control programs may consider PCR testing to guide asymptomatic malaria hotspot detection once the prevalence of infection falls. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.

  20. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  1. Bat white-nose syndrome: A real-time TaqMan polymerase chain reaction test targeting the intergenic spacer region of Geomyces destructans

    Treesearch

    Laura K Muller; Jeffrey M. Lorch; Daniel L. Lindner; Michael O' Connor; Andrea Gargas; David S. Blehert

    2013-01-01

    The fungus Geomyces destructans is the causative agent of white-nose syndrome (WNS), a disease that has killed millions of North American hibernating bats. We describe a real-time TaqMan PCR test that detects DNA from G. destructans by targeting a portion of the multicopy intergenic spacer region of the rRNA gene complex. The...

  2. Comparison of the membrane-filtration fluorescent antibody test, the enzyme-linked immunosorbent assay, and the polymerase chain reaction to detect Renibacterium salmoninarum in salmon ovarian fluid

    USGS Publications Warehouse

    Pascho, Ronald J.; Chase, Dorothy M.; McKibben, Constance L.

    1998-01-01

    Ovarian fluid samples from naturally infected chinook salmon (Oncorhynchus tshawytscha) were examined for the presence of Renibacterium salmoninarum by the membrane-filtration fluorescent antibody test (MF-FAT), an antigen capture enzyme-linked immunosorbent assay (ELISA), and a nested polymerase chain reaction (PCR). On the basis of the MF-FAT, 64% (66/103) samples contained detectable levels of R. salmoninarum cells. Among the positive fish, the R. salmoninarum concentrations ranged from 25 cells/ml to 4.3 × 109cells/ml. A soluble antigenic fraction of R. salmoninarum was detected in 39% of the fish (40/103) by the ELISA. The ELISA is considered one of the most sensitive detection methods for bacterial kidney disease in tissues, yet it did not detect R. salmoninarum antigen consistently at bacterial cell concentrations below about 1.3 × 104cells/ml according to the MF-FAT counts. When total DNA was extracted and tested in a nested PCR designed to amplify a 320-base-pair region of the gene encoding a soluble 57-kD protein of R. salmoninarum, 100% of the 100 samples tested were positive. The results provided strong evidence that R. salmoninarum may be present in ovarian fluids thought to be free of the bacterium on the basis of standard diagnostic methods.

  3. Human parvovirus B19 infection in a renal transplant recipient: a case report

    PubMed Central

    2013-01-01

    Background Parvovirus B19 presents tropism for human erythroid progenitor cells, causing chronic anemia in organ transplant recipients, due to their suppressed humoral and cellular responses. Diagnosis may be achieved through serological tests for detection of anti-B19 antibodies. However, renal transplant recipients are not routinely tested for parvovirus B19 infection, since there is scanty data or consensus on screening for B19 infection, as well as for treatment or preventive management of transplanted patients. Case presentation Herein we report a kidney transplant recipient, who was unresponsive to treatment of severe anemia, and presented hypocellular hematopoietic marrow, megaloblastosis and hypoplasia of erythroid lineage with larger cells with clear nuclei chromatin and eosinophilic nuclear inclusions. This patient was seropositive for Epstein-Barr and Cytomegalovirus infections and negative for anti-parvovirus B19 IgM and IgG antibodies, although symptoms were suggestive of parvoviruses infection. A qualitative polymerase chain reaction testing for B19 in serum sample revealed positive results for B19 virus DNA. Conclusion This case report suggests that the diagnostic process for parvovirus B19 in renal transplant recipients should include a polymerase chain reaction assay to detect B19-DNA, since specific serological tests may be unreliable given their impaired humoral responses. These results also indicate the importance of considering parvovirus B19 infection in the differential diagnosis of persistent anemia in transplanted patients. PMID:23343210

  4. A serotype-specific polymerase chain reaction for identification of Pasteurella multocida serotype 1

    USGS Publications Warehouse

    Rocke, T.E.; Smith, S.R.; Miyamoto, A.; Shadduck, D.J.

    2002-01-01

    A serotype-specific polymerase chain reaction (PCR) assay was developed for detection and identification of Pasteurella multocida serotype 1, the causative agent of avian cholera in wild waterfowl. Arbitrarily primed PCR was used to detect DNA fragments that distinguish serotype 1 from the other 15 serotypes of P. multocida (with the exception of serotype 14). Oligonucleotide primers were constructed from these sequences, and a PCR assay was optimized and evaluated. PCR reactions consistently resulted in amplification products with reference strains 1 and 14 and all other serotype 1 strains tested, with cell numbers as low as 2.3 cells/ml. No amplification products were produced with other P. multocida serotypes or any other bacterial species tested. To compare the sensitivity and further test the specificity of this PCR assay with traditional culturing and serotyping techniques, tissue samples from 84 Pekin ducks inoculated with field strains of P. multocida and 54 wild lesser snow geese collected during an avian cholera outbreak were provided by other investigators working on avian cholera. PCR was as sensitive (58/64) as routine isolation (52/64) in detecting and identifying P. multocida serotype 1 from the livers of inoculated Pekins that became sick or died from avian cholera. No product was amplified from tissues of 20 other Pekin ducks that received serotypes other than type 1 (serotype 3, 12 × 3, or 10) or 12 control birds. Of the 54 snow geese necropsied and tested for P. multocida, our PCR detected and identified the bacteria from 44 compared with 45 by direct isolation. The serotype-specific PCR we developed was much faster and less labor intensive than traditional culturing and serotyping procedures and could result in diagnosis of serotype 1 pasteurellosis within 24 hr of specimen submission.

  5. Application of the BAX for screening/genus Listeria polymerase chain reaction system for monitoring Listeria species in cold-smoked fish and in the smoked fish processing environment.

    PubMed

    Norton, D M; McCamey, M; Boor, K J; Wiedmann, M

    2000-03-01

    The cold-smoked fish industry was used as a model for the development of a system for monitoring Listeria spp. in foods and in the food processing environment. A total of 214 samples including raw fish, fish during the cold-smoking process, finished product, and environmental samples were collected from three processing facilities over two visits to each facility. Samples were screened for Listeria spp. using the BAX for Screening/genus Listeria polymerase chain reaction system (PCR) and by culture. Listeria spp., confirmed by the API Listeria test strip or by a PCR assay targeting the L. monocytogenes hlyA gene, were isolated from a total of 89 (41.6%) samples. Of these, 80 samples also tested positive for Listeria spp. using the BAX system. Specifically, 42 (55.3%) environmental samples (n = 76), 11 (25.6%) raw materials samples (n = 43), 20 (35.1%) samples from fish in various stages of processing (n = 57), and 7 (18.4%) finished product samples (n = 38) tested positive for Listeria spp. using the BAX system. Five (4.0%) of the 125 culture-negative samples yielded BAX system-positive results. Listeria isolates from each of nine culture-positive/BAX system-negative samples yielded a positive reaction when tested in pure culture by the BAX system, suggesting that our false-negative results were likely due to the presence of low Listeria numbers in the initial enrichment as opposed to nonreacting isolates. The employment of alternative enrichment protocols, such as the two-step enrichment recommended by the manufacturer, may increase the sensitivity of the assay.

  6. The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

    2013-06-28

    Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

  7. Control and reduction of peak temperature in self-curing resins.

    PubMed

    Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A

    2009-07-01

    INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.

  8. Modeling competitive substitution in a polyelectrolyte complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu

    2015-12-28

    We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less

  9. A Complementary Isothermal Amplification Method to the U.S. EPA Quantitative Polymerase Chain Reaction Approach for the Detection of Enterococci in Environmental Waters

    PubMed Central

    2017-01-01

    We report a novel molecular assay, based on helicase-dependent amplification (HDA), for the detection of enterococci as markers for fecal pollution in water. This isothermal assay targets the same Enterococcus 23S rRNA gene region as the existing quantitative polymerase chain reaction (qPCR) assays of U.S. Environmental Protection Agency Methods 1611 and 1609 but can be entirely performed on a simple heating block. The developed Enterococcus HDA assay successfully discriminated 15 enterococcal from 15 non-enterococcal reference strains and reliably detected 48 environmental isolates of enterococci. The limit of detection was 25 target copies per reaction, only 3 times higher than that of qPCR. The applicability of the assay was tested on 30 environmental water sample DNA extracts, simulating a gradient of fecal pollution. Despite the isothermal nature of the reaction, the HDA results were consistent with those of the qPCR reference. Given this performance, we conclude that the developed Enterococcus HDA assay has great potential as a qualitative molecular screening method for resource-limited settings when combined with compatible up- and downstream processes. This amplification strategy can pave the way for developing a new generation of rapid, low-cost, and field-deployable molecular diagnostic tools for water quality monitoring. PMID:28541661

  10. Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

    PubMed

    Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

    2011-03-14

    Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Development, Evaluation, and Integration of a Quantitative Reverse-Transcription Polymerase Chain Reaction Diagnostic Test for Ebola Virus on a Molecular Diagnostics Platform

    PubMed Central

    Cnops, Lieselotte; Van den Eede, Peter; Pettitt, James; Heyndrickx, Leo; De Smet, Birgit; Coppens, Sandra; Andries, Ilse; Pattery, Theresa; Van Hove, Luc; Meersseman, Geert; Van Den Herrewegen, Sari; Vergauwe, Nicolas; Thijs, Rein; Jahrling, Peter B.; Nauwelaers, David; Ariën, Kevin K.

    2016-01-01

    Background. The 2013–2016 Ebola epidemic in West Africa resulted in accelerated development of rapid diagnostic tests for emergency outbreak preparedness. We describe the development and evaluation of the Idylla™ prototype Ebola virus test, a fully automated sample-to-result molecular diagnostic test for rapid detection of Zaire ebolavirus (EBOV) and Sudan ebolavirus (SUDV). Methods. The Idylla™ prototype Ebola virus test can simultaneously detect EBOV and SUDV in 200 µL of whole blood. The sample is directly added to a disposable cartridge containing all reagents for sample preparation, RNA extraction, and amplification by reverse-transcription polymerase chain reaction analysis. The performance was evaluated with a variety of sample types, including synthetic constructs and whole blood samples from healthy volunteers spiked with viral RNA, inactivated virus, and infectious virus. Results. The 95% limits of detection for EBOV and SUDV were 465 plaque-forming units (PFU)/mL (1010 copies/mL) and 324 PFU/mL (8204 copies/mL), respectively. In silico and in vitro analyses demonstrated 100% correct reactivity for EBOV and SUDV and no cross-reactivity with relevant pathogens. The diagnostic sensitivity was 97.4% (for EBOV) and 91.7% (for SUDV), the specificity was 100%, and the diagnostic accuracy was 95.9%. Conclusions. The Idylla™ prototype Ebola virus test is a fast, safe, easy-to-use, and near-patient test that meets the performance criteria to detect EBOV in patients with suspected Ebola. PMID:27247341

  12. Recommendations for Methicillin-Resistant Staphylococcus aureus Prevention in Adult ICUs: A Cost-Effectiveness Analysis.

    PubMed

    Whittington, Melanie D; Atherly, Adam J; Curtis, Donna J; Lindrooth, Richard C; Bradley, Cathy J; Campbell, Jonathan D

    2017-08-01

    Patients in the ICU are at the greatest risk of contracting healthcare-associated infections like methicillin-resistant Staphylococcus aureus. This study calculates the cost-effectiveness of methicillin-resistant S aureus prevention strategies and recommends specific strategies based on screening test implementation. A cost-effectiveness analysis using a Markov model from the hospital perspective was conducted to determine if the implementation costs of methicillin-resistant S aureus prevention strategies are justified by associated reductions in methicillin-resistant S aureus infections and improvements in quality-adjusted life years. Univariate and probabilistic sensitivity analyses determined the influence of input variation on the cost-effectiveness. ICU. Hypothetical cohort of adults admitted to the ICU. Three prevention strategies were evaluated, including universal decolonization, targeted decolonization, and screening and isolation. Because prevention strategies have a screening component, the screening test in the model was varied to reflect commonly used screening test categories, including conventional culture, chromogenic agar, and polymerase chain reaction. Universal and targeted decolonization are less costly and more effective than screening and isolation. This is consistent for all screening tests. When compared with targeted decolonization, universal decolonization is cost-saving to cost-effective, with maximum cost savings occurring when a hospital uses more expensive screening tests like polymerase chain reaction. Results were robust to sensitivity analyses. As compared with screening and isolation, the current standard practice in ICUs, targeted decolonization, and universal decolonization are less costly and more effective. This supports updating the standard practice to a decolonization approach.

  13. Silicon-based sleeve devices for chemical reactions

    DOEpatents

    Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

    1996-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  14. Silicon-based sleeve devices for chemical reactions

    DOEpatents

    Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

    1996-12-31

    A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

  15. Substrate Shuttling Between Active Sites of Uroporphyrinogen Decarboxylase in Not Required to Generate Coproporphyrinogen

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Phillips, J.; Warby, C; Whitby, F

    2009-01-01

    Uroporphyrinogen decarboxylase (URO-D; EC 4.1.1.37), the fifth enzyme of the heme biosynthetic pathway, is required for the production of heme, vitamin B12, siroheme, and chlorophyll precursors. URO-D catalyzes the sequential decarboxylation of four acetate side chains in the pyrrole groups of uroporphyrinogen to produce coproporphyrinogen. URO-D is a stable homodimer, with the active-site clefts of the two subunits adjacent to each other. It has been hypothesized that the two catalytic centers interact functionally, perhaps by shuttling of reaction intermediates between subunits. We tested this hypothesis by construction of a single-chain protein (single-chain URO-D) in which the two subunits were connectedmore » by a flexible linker. The crystal structure of this protein was shown to be superimposable with wild-type activity and to have comparable catalytic activity. Mutations that impaired one or the other of the two active sites of single-chain URO-D resulted in approximately half of wild-type activity. The distributions of reaction intermediates were the same for mutant and wild-type sequences and were unaltered in a competition experiment using I and III isomer substrates. These observations indicate that communication between active sites is not required for enzyme function and suggest that the dimeric structure of URO-D is required to achieve conformational stability and to create a large active-site cleft.« less

  16. Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

    PubMed

    Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

    2016-10-01

    The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

    PubMed

    Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

    2002-07-01

    Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

  18. Organic reactions mediated by electrochemically generated ArS+.

    PubMed

    Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi

    2011-04-21

    Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.

  19. Magnetism in (Semi)Conducting Macrocycles of pi conjugated Polymers

    DTIC Science & Technology

    2016-12-09

    wise and avoiding a break in the continuity of the macrocycle. As a first criterion we tested the continuity of the electron orbitals over the...magnesium chloride) and post polymerization functionalization by a Sonogashira coupling reaction is required (scheme 2). Scheme 2: Synthetic...Sonogashira post - polymerization chain end functionalization and B isotopic model of the different population present in the final batch

  20. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... for Mycoplasma gallisepticum and M. synoviae. (a) DNA isolation. Isolate DNA from 1 mL of eluate from... supernatant DNA to a nuclease-free tube. Estimate the DNA concentration and purity by spectrophotometric... primer (50 μM), 1 μl Forward primer (50 μM). (2) Perform DNA amplification in a Perkin-Elmer 9600...

  1. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... for Mycoplasma gallisepticum and M. synoviae. (a) DNA isolation. Isolate DNA from 1 mL of eluate from... supernatant DNA to a nuclease-free tube. Estimate the DNA concentration and purity by spectrophotometric... primer (50 μM), 1 μl Forward primer (50 μM). (2) Perform DNA amplification in a Perkin-Elmer 9600...

  2. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... for Mycoplasma gallisepticum and M. synoviae. (a) DNA isolation. Isolate DNA from 1 mL of eluate from... supernatant DNA to a nuclease-free tube. Estimate the DNA concentration and purity by spectrophotometric... primer (50 μM), 1 μl Forward primer (50 μM). (2) Perform DNA amplification in a Perkin-Elmer 9600...

  3. Detection of the aerolysin gene in Aeromonas hydrophila by the polymerase chain reaction.

    PubMed Central

    Pollard, D R; Johnson, W M; Lior, H; Tyler, S D; Rozee, K R

    1990-01-01

    Synthetic oligonucleotide primers were used in a polymerase chain reaction (PCR) technique to detect the gene for aerolysin in strains of Aeromonas hydrophila and to screen for identical genes in A. caviae, A. sobria, and A. veronii isolated from patients with diarrheal disease. Primers targeted a 209-bp fragment of the aer gene coding for the beta-hemolysin and detected template DNA only in the PCR using nucleic acid (NA) from hemolytic strains of A. hydrophila which were also cytotoxic to Vero and CHO cells and enterotoxic in suckling-mouse assays. PCR amplification of NA from hemolytic A. sobria or nonhemolytic A. hydrophila and A. caviae strains was consistently negative. Primer specificity was determined in the PCR by using NA extracted from 56 strains of bacteria, including hemolytic Escherichia coli and Listeria monocytogenes as well as several recognized enteric pathogens defined in terms of their toxigenicity. The detection limit for the aerolysin gene by PCR amplification was 1 ng of total NA. The PCR clearly identified aerolysin-producing strains of A. hydrophila and may have application as a species-specific virulence test because other hemolytic Aeromonas species tested were negative. Images PMID:2254423

  4. Development of a peptide nucleic acid polymerase chain reaction clamping assay for semiquantitative evaluation of genetically modified organism content in food.

    PubMed

    Peano, C; Lesignoli, F; Gulli, M; Corradini, R; Samson, M C; Marchelli, R; Marmiroli, N

    2005-09-15

    In the present study a peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping method was developed and applied to the detection of genetically modified organisms (GMO), to test PCR products for band identity and to obtain a semiquantitative evaluation of GMO content. The minimal concentration of PNA necessary to block the PCR was determined by comparing PCRs containing a constant amount of DNA in the presence of increasing concentration of target-specific PNA. The lowest PNA concentration at which specific inhibition took place, by the inhibition of primer extension and/or steric hindrance, was the most efficient condition. Optimization of PCR clamping by PNA was observed by testing five different PNAs with a minimum of 13 bp to a maximum of 15 bp, designed on the target sequence of Roundup Ready soybean. The results obtained on the DNA extracted from Roundup Ready soybean standard flour were verified also on DNA extracted from standard flours of maize GA21, Bt176, Bt11, and MON810. A correlation between the PNA concentration necessary for inducing PCR clamping and the percentage of the GMO target sequence in the sample was found.

  5. Microwave or autoclave treatments destroy the infectivity of infectious bronchitis virus and avian pneumovirus but allow detection by reverse transcriptase-polymerase chain reaction.

    PubMed

    Elhafi, G; Naylor, C J; Savage, C E; Jones, R C

    2004-06-01

    A method is described for enabling safe transit of denatured virus samples for polymerase chain reaction (PCR) identification without the risk of unwanted viable viruses. Cotton swabs dipped in avian infectious bronchitis virus (IBV) or avian pneumovirus (APV) were allowed to dry. Newcastle disease virus and avian influenza viruses were used as controls. Autoclaving and microwave treatment for as little as 20 sec destroyed the infectivity of all four viruses. However, both IBV and APV could be detected by reverse transcriptase (RT)-PCR after autoclaving and as long as 5 min microwave treatment (Newcastle disease virus and avian influenza viruses were not tested). Double microwave treatment of IBV and APV with an interval of 2 to 7 days between was tested. After the second treatment, RT-PCR products were readily detected in all samples. Swabs from the tracheas and cloacas of chicks infected with IBV shown to contain infectious virus were microwaved. Swabs from both sources were positive by RT-PCR. Microwave treatment appears to be a satisfactory method of inactivating virus while preserving nucleic acid for PCR identification.

  6. Comparison between ICT and PCR for diagnosis of Chlamydia trachomatis.

    PubMed

    Khan, E R; Hossain, M A; Paul, S K; Mahmud, C; Hasan, M M; Rahman, M M; Nahar, K; Kubayashi, N

    2012-04-01

    Chlamydia trachomatis is an obligate intracellular gram-negative bacterium which is the most prevalent cause of bacterial sexually transmitted infections (STI). The present study was carried to diagnose genital Chlamydia trachomatis infection among women of reproductive age, attending Mymensingh Medical College Hospital, during July 2009 to June 2010 by Immunochromatographic test (ICT) and Polymerase chain reaction (PCR). A total of 70 females were included in this study. Out of 70 cases 56 were symptomatic and 14 asymptomatic. Endocervical swabs were collected from each of the cases and examined by Immunochromatographic test (ICT) for antigen detection and Polymerase chain reaction (PCR) for detection of endogenous plasmid-based nucleic acid. A total 29(41.4%) of the cases were found positive for C. trachomatis either by ICT or PCR. Of the 56 symptomatic cases, 19(33.9%) were found ICT positive and 17(30.4%) were PCR positive. Among 14 asymptomatic females, 2(14.3%) were ICT positive and none were PCR positive. Though PCR is highly sensitive but a total of twelve cases were found ICT positive but PCR negative. It may be due to presence of plasmid deficient strain of C trachomatis which could be amplified by ompA based (Chromosomal gene) multiplex PCR.

  7. Selection of suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using quantitative real-time polymerase chain reaction.

    PubMed

    Zornhagen, K W; Kristensen, A T; Hansen, A E; Oxboel, J; Kjaer, A

    2015-12-01

    Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours. The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm was used to analyse the most suitable reference genes. Eight potential reference genes were excluded from this final analysis because of their dissociation curves. β-Glucuronidase (GUSB) and proteasome subunit, beta type, 6 (PSMB6) were most stably expressed with an M value of 0.154 and a CV of 0.053 describing their average stability. We suggest that choice of reference genes should be based on specific testing in every new experimental set-up. © 2014 John Wiley & Sons Ltd.

  8. Removing systematic errors in interionic potentials of mean force computed in molecular simulations using reaction-field-based electrostatics

    PubMed Central

    Baumketner, Andrij

    2009-01-01

    The performance of reaction-field methods to treat electrostatic interactions is tested in simulations of ions solvated in water. The potential of mean force between sodium chloride pair of ions and between side chains of lysine and aspartate are computed using umbrella sampling and molecular dynamics simulations. It is found that in comparison with lattice sum calculations, the charge-group-based approaches to reaction-field treatments produce a large error in the association energy of the ions that exhibits strong systematic dependence on the size of the simulation box. The atom-based implementation of the reaction field is seen to (i) improve the overall quality of the potential of mean force and (ii) remove the dependence on the size of the simulation box. It is suggested that the atom-based truncation be used in reaction-field simulations of mixed media. PMID:19292522

  9. Surfactant-controlled polymerization of semiconductor clusters to quantum dots through competing step-growth and living chain-growth mechanisms.

    PubMed

    Evans, Christopher M; Love, Alyssa M; Weiss, Emily A

    2012-10-17

    This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.

  10. Kinetics of Chemical Reactions in Flames

    NASA Technical Reports Server (NTRS)

    Zeldovich, Y.; Semenov, N.

    1946-01-01

    In part I of the paper the theory of flame propagation is developed along the lines followed by Frank-Kamenetsky and one of the writers. The development of chain processes in flames is considered. A basis is given for the application of the method of stationary concentrations to reactions in flames; reactions with branching chains are analyzed. The case of a diffusion coefficient different from the coefficient of temperature conductivity is considered.

  11. Diagnostic efficacy of microscopy, rapid diagnostic test and polymerase chain reaction for malaria using bayesian latent class analysis.

    PubMed

    Saha, Sreemanti; Narang, Rahul; Deshmukh, Pradeep; Pote, Kiran; Anvikar, Anup; Narang, Pratibha

    2017-01-01

    The diagnostic techniques for malaria are undergoing a change depending on the availability of newer diagnostics and annual parasite index of infection in a particular area. At the country level, guidelines are available for selection of diagnostic tests; however, at the local level, this decision is made based on malaria situation in the area. The tests are evaluated against the gold standard, and if that standard has limitations, it becomes difficult to compare other available tests. Bayesian latent class analysis computes its internal standard rather than using the conventional gold standard and helps comparison of various tests including the conventional gold standard. In a cross-sectional study conducted in a tertiary care hospital setting, we have evaluated smear microscopy, rapid diagnostic test (RDT), and polymerase chain reaction (PCR) for diagnosis of malaria using Bayesian latent class analysis. We found the magnitude of malaria to be 17.7% (95% confidence interval: 12.5%-23.9%) among the study subjects. In the present study, the sensitivity of microscopy was 63%, but it had very high specificity (99.4%). Sensitivity and specificity of RDT and PCR were high with RDT having a marginally higher sensitivity (94% vs. 90%) and specificity (99% vs. 95%). On comparison of likelihood ratios (LRs), RDT had the highest LR for positive test result (175) and the lowest LR for negative test result (0.058) among the three tests. In settings like ours conventional smear microscopy may be replaced with RDT and as we move toward elimination and facilities become available PCR may be roped into detect cases with lower parasitaemia.

  12. Radical chemistry of artemisinin

    NASA Astrophysics Data System (ADS)

    Denisov, Evgenii T.; Solodova, S. L.; Denisova, Taisa G.

    2010-12-01

    The review summarizes physicochemical characteristics of the natural sesquiterpene peroxide artemisinin. The kinetic schemes of transformations of artemisinin radicals under anaerobic conditions are presented and analyzed. The sequence of radical reactions of artemisinin in the presence of oxygen is considered in detail. Special emphasis is given to the intramolecular chain oxidation resulting in the transformation of artemisinin into polyatomic hydroperoxide. The kinetic characteristics of elementary reaction steps involving alkyl, alkoxyl, and peroxyl radicals generated from artemisinin are discussed. The results of testing of artemisinin and its derivatives for the antimalarial activity and the scheme of the biochemical synthesis of artemisinin in nature are considered.

  13. [Efficiency and specificity of the KAT-test for rapid diagnosis of falciparum malaria].

    PubMed

    Cong, Le Dinh; Sergiev, V P; Rabinovich, S A; Nhah, Doan Hanh; Huong, Nguyen Van; Morozov, E N; Kukina, I V; Thinh, Ta Thi; Maksakovskaia, E V; Dao, Le Minh; Chalyĭ, V F; To, Dang Thi; Fandeev, V A; Hoa, Ngo Viet; Due, Nguyen Thi

    2002-01-01

    A new rapid KAT Quick Malaria test for the diagnosis of falciparum malaria, which is based on the detection of a monoclonal antibody-antigen complex of malaria parasites, has been worked out by the KAT Medical CC in South Africa. The efficiency and specificity of the KAT test were compared with those of the microscopic method and with the ICT test for rapid diagnosis of P. falciparum and P. vivax. The polymerase chain reaction was used as a control test. Testing for malaria was performed on 98 blood samples from feverish patients in Vietnam and Tadjikistan and among the persons who had returned to Moscow from endemic regions. The efficiency of the KAT test for falciparum-malaria was found to be 100% versus 90.5% with ICT. The absence of cross-reactions with P. vivax and the presence of pseudopositive results of the KAT test for fever cases of non-malaria origin indicate its high specificity. There was no correlation between the rate of test line colouring and the level of parasitemia. The KAT test yielded positive results only when gametocytes were found in blood specimens.

  14. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    USDA-ARS?s Scientific Manuscript database

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  15. [Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

    PubMed

    Wang, F; Zhang, Y Q; Ding, J; Yu, L X

    2017-10-18

    To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

  16. Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

    PubMed

    Igarashi, T; Yamamoto, A; Goto, N

    1996-10-01

    Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

  17. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    PubMed

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  18. Structure–Function Studies of Hydrophobic Residues That Clamp a Basic Glutamate Side Chain during Catalysis by Triosephosphate Isomerase

    PubMed Central

    2016-01-01

    Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328

  19. Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates.

    PubMed

    Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M

    2013-03-28

    This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

  20. Prevalence of Sexually Transmitted Diseases in Asymptomatic Renal Transplant Recipients.

    PubMed

    Sarier, Mehmet; Sepin Ozen, Nevgun; Guler, Hicran; Duman, Ibrahim; Yüksel, Yücel; Tekin, Sabri; Yavuz, Asuman Havva; Yucetin, Levent; Erdogan Yilmaz, Mine

    2018-04-04

    Sexually transmitted diseases, which may be asymptomatic, have the potential to cause serious health problems in renal transplant recipients. The aim of this study was to determine the prevalence of sexually transmitted diseases in sexually active asymptomatic renal transplant patients by using real-time multiplex polymerase chain reaction assays. This prospective controlled study was conducted between November 2016 and January 2017 in our hospital. Our study group included 80 consecutive, sexually active asymptomatic patients (40 men and 40 women) who had undergone renal transplant in our hospital and who presented to our outpatient clinic for routine follow-up. We also included a control group of 80 consecutive, sexually active nontransplant patients (40 men and 40 women). All patient samples were tested for Gardnerella vaginalis and obligate anaerobes (Prevotella bivia, Porphyromonas species), Candida species, Mycoplasma hominis, Mycoplasma genitalium, Ureaplasma species, Trichomonas vaginalis, Neisseria gonorrhoeae, Chlamydia trachomatis, herpes simplex virus 1 and 2, and Cytomegalovirus by real-time multiplex polymerase chain reaction. The prevalences of infection with Gardnerella vaginalis and obligate anaerobes (P = .043), Ureaplasma species (P = .02), and Cytomegalovirus (P = .016) were found to be significantly higher in the study group versus the control group. However, there was no difference between the 2 groups regarding the prevalence of Mycoplasma infection (P = .70). Sexually transmitted diseases may occur more frequently in sexually active asymptomatic renal transplant recipients than in nontransplanted individuals. Real-time multiplex polymerase chain reaction analysis may be a suitable method for determining these pathogens.

  1. Molecular testing for familial hypercholesterolaemia-associated mutations in a UK-based cohort: development of an NGS-based method and comparison with multiplex polymerase chain reaction and oligonucleotide arrays.

    PubMed

    Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K

    2016-11-01

    Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.

  2. A Model of Risk Analysis in Analytical Methodology for Biopharmaceutical Quality Control.

    PubMed

    Andrade, Cleyton Lage; Herrera, Miguel Angel De La O; Lemes, Elezer Monte Blanco

    2018-01-01

    One key quality control parameter for biopharmaceutical products is the analysis of residual cellular DNA. To determine small amounts of DNA (around 100 pg) that may be in a biologically derived drug substance, an analytical method should be sensitive, robust, reliable, and accurate. In principle, three techniques have the ability to measure residual cellular DNA: radioactive dot-blot, a type of hybridization; threshold analysis; and quantitative polymerase chain reaction. Quality risk management is a systematic process for evaluating, controlling, and reporting of risks that may affects method capabilities and supports a scientific and practical approach to decision making. This paper evaluates, by quality risk management, an alternative approach to assessing the performance risks associated with quality control methods used with biopharmaceuticals, using the tool hazard analysis and critical control points. This tool provides the possibility to find the steps in an analytical procedure with higher impact on method performance. By applying these principles to DNA analysis methods, we conclude that the radioactive dot-blot assay has the largest number of critical control points, followed by quantitative polymerase chain reaction, and threshold analysis. From the analysis of hazards (i.e., points of method failure) and the associated method procedure critical control points, we conclude that the analytical methodology with the lowest risk for performance failure for residual cellular DNA testing is quantitative polymerase chain reaction. LAY ABSTRACT: In order to mitigate the risk of adverse events by residual cellular DNA that is not completely cleared from downstream production processes, regulatory agencies have required the industry to guarantee a very low level of DNA in biologically derived pharmaceutical products. The technique historically used was radioactive blot hybridization. However, the technique is a challenging method to implement in a quality control laboratory: It is laborious, time consuming, semi-quantitative, and requires a radioisotope. Along with dot-blot hybridization, two alternatives techniques were evaluated: threshold analysis and quantitative polymerase chain reaction. Quality risk management tools were applied to compare the techniques, taking into account the uncertainties, the possibility of circumstances or future events, and their effects upon method performance. By illustrating the application of these tools with DNA methods, we provide an example of how they can be used to support a scientific and practical approach to decision making and can assess and manage method performance risk using such tools. This paper discusses, considering the principles of quality risk management, an additional approach to the development and selection of analytical quality control methods using the risk analysis tool hazard analysis and critical control points. This tool provides the possibility to find the method procedural steps with higher impact on method reliability (called critical control points). Our model concluded that the radioactive dot-blot assay has the larger number of critical control points, followed by quantitative polymerase chain reaction and threshold analysis. Quantitative polymerase chain reaction is shown to be the better alternative analytical methodology in residual cellular DNA analysis. © PDA, Inc. 2018.

  3. Microfabricated electrochemiluminescence cell for chemical reaction detection

    DOEpatents

    Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

    2003-01-01

    A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  4. Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions

    NASA Astrophysics Data System (ADS)

    Zlokazov, V. B.; Utyonkov, V. K.

    2017-07-01

    The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.

  5. A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

    NASA Astrophysics Data System (ADS)

    Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua

    2017-08-01

    Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.

  6. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  7. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  8. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    EPA Science Inventory

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  9. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    USDA-ARS?s Scientific Manuscript database

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  10. Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

    PubMed

    Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

    2005-03-01

    We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

  11. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  12. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  13. Label-Free Fluorescent DNA Dendrimers for microRNA Detection Based On Nonlinear Hybridization Chain Reaction-Mediated Multiple G-Quadruplex with Low Background Signal.

    PubMed

    Xue, Qingwang; Liu, Chunxue; Li, Xia; Dai, Li; Wang, Huaisheng

    2018-04-18

    Various fluorescent sensing systems for miRNA detection have been developed, but they mostly contain enzymatic amplification reactions and label procedures. The strict reaction conditions of tool enzymes and the high cost of labeling limit their potential applications, especially in complex biological matrices. Here, we have addressed the difficult problems and report a strategy for label-free fluorescent DNA dendrimers based on enzyme-free nonlinear hybridization chain reaction (HCR)-mediated multiple G-quadruplex for simple, sensitive, and selective detection of miRNAs with low-background signal. In the strategy, a split G-quadruplex (3:1) sequence is ingeniously designed at both ends of two double-stranded DNAs, which is exploited as building blocks for nonlinear HCR assembly, thereby acquiring a low background signal. A hairpin switch probe (HSP) was employed as recognition and transduction element. Upon sensing the target miRNA, the nonlinear HCR assembly of two blocks (blocks-A and blocks-B) was initiated with the help of two single-stranded DNA assistants, resulting in chain-branching growth of DNA dendrimers with multiple G-quadruplex incorporation. With the zinc(II)-protoporphyrin IX (ZnPPIX) selectively intercalated into the multiple G-quadruplexes, fluorescent DNA dendrimers were obtained, leading to an exponential fluorescence intensity increase. Benefiting from excellent performances of nonlinear HCR and low background signal, this strategy possesses the characteristics of a simplified reaction operation process, as well as high sensitivity. Moreover, the proposed fluorescent sensing strategy also shows preferable selectivity, and can be implemented without modified DNA blocks. Importantly, the strategy has also been tested for miRNA quantification with high confidence in breast cancer cells. Thus, this proposed strategy for label-free fluorescent DNA dendrimers based on a nonlinear HCR-mediated multiple G-quadruplex will be turned into an alternative approach for simple, sensitive, and selective miRNA quantification.

  14. Fracture Behavior in Nylon 6 Fibers. Ph.D. Thesis

    NASA Technical Reports Server (NTRS)

    Lloyd, B. A.

    1972-01-01

    Electron paramagnetic resonance (EPR) techniques are used to determine the number of free radicals produced during deformation leading to fracture of nylon 6 fibers. A reaction rate molecular model is proposed to explain some of the deformation and bond rupture behavior leading to fracture. High-strength polymer fibers are assumed to consist of a sandwich structure of disordered and ordered regions along the fiber axis. In the disordered or critical flaw regions, tie chains connecting the ordered or crystalline block regions are assumed to have a statistical distribution in length. These chains are, therefore, subjected to different stresses. The effective length distribution was determined by EPR. The probability of bond rupture was assumed to be controlled by reaction-rate theory with a stress-aided activation energy and behavior of various loadings determined by numerical techniques. The model is successfully correlated with experimental stress, strain, and bond rupture results for creep, constant rate loadings, cyclic stress, stress relaxation and step strain tests at room temperature.

  15. Actinomyces israelii in radicular cysts: a molecular study.

    PubMed

    Gomes, Nathália Rodrigues; Diniz, Marina Gonçalves; Pereira, Thais Dos Santos Fontes; Estrela, Carlos; de Macedo Farias, Luiz; de Andrade, Bruno Augusto Benevenuto; Gomes, Carolina Cavaliéri; Gomez, Ricardo Santiago

    2017-05-01

    To investigate whether the microscopic filamentous aggregates observed in radicular cysts are associated with the molecular identification of Actinomyces israelii. Moreover, to verify whether this bacterium can be detected in radicular cyst specimens not presenting aggregates. Microscopic colonies suggestive of Actinomyces were found in 8 out of 279 radicular cyst samples (case group). The case and control groups (n = 12; samples without filamentous colonies) were submitted to the semi-nested polymerase chain reaction to test the presence of A israelii. DNA sequencing was performed to validate polymerase chain reaction results. Two and 3 samples in the case and control groups, respectively, did not present a functional genomic DNA template and were excluded from the study. A israelii was identified in all samples of the case group and in 3 out of 9 samples of the control group. Although A israelii is more commonly identified in radicular cysts presenting filamentous aggregates, it also appears to be detected in radicular cysts without this microscopic finding. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis

    PubMed Central

    Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y.; Whelen, A. Christian; Calimlim, Precilia S.; Sciulli, Rebecca H.; Honda, Stacey A. A.; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M.; da Silva, Alexandre J.

    2016-01-01

    Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. PMID:26526920

  17. Evidence of simian retrovirus type D by polymerase chain reaction.

    PubMed

    Hwa, Christian Z R; Tsai, Sheung Pun; Yee, JoAnn L; Van Rompay, Koen K; Roberts, Jeffrey A

    2017-06-01

    Over the past few years, there have been reports of finding Simian retrovirus type D (SRV) in macaque colonies where some animals were characterized as antibody positive but virus negative raising questions about how SRV was transmitted or whether there is a variant strain detected by antibody but not polymerase chain reaction (PCR) in current use. We developed a three-round nested PCR assay using degenerate primers targeting the pol gene to detect for SRV serotypes 1-5 and applied this newly validated PCR assay to test macaque DNA samples collected in China from 2010 to 2015. Using the nested PCR assay validated in this study, we found 0.15% of the samples archived on FTA ® cards were positive. The source of SRV infection identified within domestic colonies might have originated from imported macaques. The multiplex nested PCR assay developed here may supplement the current assays for SRV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

    PubMed

    Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

    2009-10-01

    Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

  19. [Usefulness of conventional polymerase chain reaction for the detection of Mycoplasma hominis, Ureaplasma spp. and Trichomonas vaginalis in female outpatient's genital samples].

    PubMed

    Alarcón, Gonzalo; Barraza, Gabriela; Vera, Andrea; Wozniak, Aniela; García, Patricia

    2016-02-01

    Trichomonas vaginalis, Mycoplasma hominis and Ureaplasma spp. are microorganisms responsible for genitourinary and pregnancy pathologies. Nucleic acid amplification methods have shown several advantages, but have not been widely studied for the detection of these microorganisms. To implement a conventional polymerase chain reaction (PCR) for the detection of the microorganisms and to compare its results versus the methods currently used at our laboratory. 91 available samples were processed by PCR, culture (M. hominis y Ureaplasma spp.) and wet mount (T vaginalis). Results were compared and statistically analyzed by kappa agreement test. 85, 80 and 87 samples resulted in agreement for the detection of M. hominis, Ureaplasma spp. y T. vaginalis, respectively. For M. hominis and Ureaplasma spp., agreement was substantial, whereas for T. vaginalis it was moderate, however, for the latter, PCR detected more cases than wet mount. We recommend the implementation of PCR for detection of T. vaginalis whereas culture kit is still a useful method for the other microorganisms.

  20. Polymerase chain reaction for detection of Leptospira spp. in clinical samples.

    PubMed Central

    Mérien, F; Amouriaux, P; Perolat, P; Baranton, G; Saint Girons, I

    1992-01-01

    A sensitive assay for Leptospira spp., the causative agent of leptospirosis, was developed on the basis of the polymerase chain reaction (PCR). A 331-bp sequence from the Leptospira interrogans serovar canicola rrs (16S) gene was amplified, and the PCR products were analyzed by DNA-DNA hybridization by using a 289-bp fragment internal to the amplified DNA. Specific PCR products also were obtained with DNA from the closely related nonpathogenic Leptospira biflexa but not with DNA from other spirochetes, such as Borrelia burgdorferi, Borrelia hermsii, Treponema denticola, Treponema pallidum, Spirochaeta aurantia, or more distant organisms such as Escherichia coli, Staphylococcus aureus, Mycobacterium tuberculosis, and Proteus mirabilis. The assay was able to detect as few as 10 bacteria. Leptospira DNA was detected in urine from experimentally infected mice. In addition, the test was found to be suitable for diagnosing leptospirosis in humans. Cerebrospinal fluid and urine from patients with leptospirosis were positive, whereas samples from control uninfected patients were negative. Images PMID:1400983

  1. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

    PubMed

    Kalendar, Ruslan; Lee, David; Schulman, Alan H

    2011-08-01

    The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

  2. Identification of 29 Rat Genetic Markers by Arbitrarily Primed Polymerase Chain Reaction

    PubMed Central

    Canzian, Federico; Toyota, Minoru; Hosoya, Yoko; Sugimura, Takashi; Nagao, Minako

    1996-01-01

    The number of genetic markers for the rat is still limited, in spite of its wide use in cancer research. To facilitate accurate mapping of both established and novel rat genetic markers, we constructed a linkage map by genotyping 105 F2 rats from ACI/N (ACI) and BUF/Nac (BUF) crosses. This map consists of 120 genetic markers that had been previously reported, mainly by two research groups, but had not been integrated. To find new genetic markers, the arbitrarily primed polymerase chain reaction (AP‐PCR) was applied to detect polymorphic bands between ACI and BUF rats. After testing 56 single primers and 12 combinations of primers, we found 36 bands produced by 16 single primers and two combinations to be reliably polymorphic between ACI and BUF rats. The 36 bands were typed in the 105 F2 rats, and 29 of them could be linkage‐mapped. AP‐PCR is thus useful to detect new genetic markers in laboratory strains of rats. PMID:8698613

  3. Detection of the reemerging agent Burkholderia mallei in a recent outbreak of glanders in the United Arab Emirates by a newly developed fliP-based polymerase chain reaction assay.

    PubMed

    Scholz, Holger C; Joseph, Marina; Tomaso, Herbert; Al Dahouk, Sascha; Witte, Angela; Kinne, Joerg; Hagen, Ralph M; Wernery, Renate; Wernery, Ulrich; Neubauer, Heinrich

    2006-04-01

    A polymerase chain reaction (PCR) assay targeting the flagellin P (fliP)-I S407A genomic region of Burkholderia mallei was developed for the specific detection of this organism in pure cultures and clinical samples from a recent outbreak of equine glanders. Primers deduced from the known fliP-IS407A sequence of B. mallei American Type Culture Collection (ATCC) 23344(T) allowed the specific amplification of a 989-bp fragment from each of the 20 B. mallei strains investigated, whereas other closely related organisms tested negative. The detection limit of the assay was 10 fg for purified DNA of B. mallei ATCC 23344(T). B. mallei DNA was also amplified from various tissues of horses with a generalized B. mallei infection. The developed PCR assay can be used as a simple and rapid tool for the specific and sensitive detection of B. mallei in clinical samples.

  4. Development of a polymerase chain reaction assay for the specific identification of Burkholderia mallei and differentiation from Burkholderia pseudomallei and other closely related Burkholderiaceae.

    PubMed

    Ulrich, Ricky L; Ulrich, Melanie P; Schell, Mark A; Kim, H Stanley; DeShazer, David

    2006-05-01

    Burkholderia mallei and Burkholderia pseudomallei, the etiologic agents responsible for glanders and melioidosis, respectively, are genetically and phenotypically similar and are category B biothreat agents. We used an in silico approach to compare the B. mallei ATCC 23344 and B. pseudomallei K96243 genomes to identify nucleotide sequences unique to B. mallei. Five distinct B. mallei DNA sequences and/or genes were identified and evaluated for polymerase chain reaction (PCR) assay development. Genomic DNAs from a collection of 31 B. mallei and 34 B. pseudomallei isolates, obtained from various geographic, clinical, and environmental sources over a 70-year period, were tested with PCR primers targeted for each of the B. mallei ATCC 23344-specific nucleotide sequences. Of the 5 chromosomal targets analyzed, only PCR primers designed to bimA(Bm) were specific for B. mallei. These primers were used to develop a rapid PCR assay for the definitive identification of B. mallei and differentiation from all other bacteria.

  5. Review of Detection of Brucella sp. by Polymerase Chain Reaction

    PubMed Central

    Yu, Wei Ling; Nielsen, Klaus

    2010-01-01

    Here we present a review of most of the currently used polymerase chain reaction (PCR)-based methods for identification of Brucella bacteria in biological samples. We focused in particular on methods using single-pair primers, multiplex primers, real-time PCRs, PCRs for marine Brucella, and PCRs for molecular biotyping. These methods are becoming very important tools for the identification of Brucella, at the species level and recently also at the biovar level. These techniques require minimum biological containment and can provide results in a very short time. In addition, genetic fingerprinting of isolates aid in epidemiological studies of the disease and its control. PCR-based methods are more useful and practical than conventional methods used to identify Brucella spp., and new methods for Brucella spp identification and typing are still being developed. However, the sensitivity, specificity, and issues of quality control and quality assurance using these methods must be fully validated on clinical samples before PCR can be used in routine laboratory testing for brucellosis. PMID:20718083

  6. Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR

    PubMed Central

    Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao

    2012-01-01

    AIM: To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. METHODS: Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. RESULTS: cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. CONCLUSION: The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well. PMID:22294830

  7. Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR.

    PubMed

    Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao

    2012-01-21

    To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well.

  8. Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

    PubMed Central

    deWit, D; Wootton, M; Allan, B; Steyn, L

    1993-01-01

    A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

  9. West Nile virus in overwintering Culex mosquitoes, New York City, 2000.

    PubMed Central

    Nasci, R. S.; Savage, H. M.; White, D. J.; Miller, J. R.; Cropp, B. C.; Godsey, M. S.; Kerst, A. J.; Bennett, P.; Gottfried, K.; Lanciotti, R. S.

    2001-01-01

    After the 1999 West Nile (WN) encephalitis outbreak in New York, 2,300 overwintering adult mosquitoes were tested for WN virus by cell culture and reverse transcriptase-polymerase chain reaction. WN viral RNA and live virus were found in pools of Culex mosquitoes. Persistence in overwintering Cx. pipiens may be important in the maintenance of WN virus in the northeastern United States. PMID:11585542

  10. Anaplasma phagocytophilum infection (granulocytic anaplasmosis) in a dog from Vancouver Island

    PubMed Central

    2005-01-01

    Abstract A 7-year-old Labrador retriever had nonspecific clinical signs that included lethargy, malaise, and difficult ambulation. The dog was native to Vancouver Island, British Columbia, and had never left this area. Morulae were identified in polymorphonuclear cells. Serologic studies and polymerase chain reaction (PCR) testing confirmed canine anaplasmosis caused by Anaplasma phagocytophilum. The dog recovered after treatment with tetracycline. PMID:16231653

  11. LENGTH-HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION: OPTIMAL SAMPLE SIZE AND HOLDING CONDITIONS

    EPA Science Inventory

    The use of coliform plate count data to assess stream sanitary and ecological condition is limited by the need to store samples at 4oC and analyze them within a 24-hour period. We are testing LH-PCR as an alternative tool to assess the bacterial load of streams, offering a cost ...

  12. Acid-fast Smear and Histopathology Results Provide Guidance for the Appropriate Use of Broad-Range Polymerase Chain Reaction and Sequencing for Mycobacteria.

    PubMed

    Miller, Kennon; Harrington, Susan M; Procop, Gary W

    2015-08-01

    New molecular diagnostic tests are attractive because of the potential they hold for improving diagnostics in microbiology. The value of these tests, which is often assumed, should be investigated to determine the best use of these potentially powerful tools. To investigate the usefulness of broad-range polymerase chain reaction (PCR), followed by sequencing, in mycobacterial infections. We reviewed the test performance of acid-fast bacilli (AFB) PCR and traditional diagnostic methods (histopathology, AFB smear, and culture). We assessed the diagnostic effect and cost of the unrestricted ordering of broad-range PCR for the detection and identification of mycobacteria in clinical specimens. The AFB PCR was less sensitive than culture and histopathology and was less specific than culture, AFB smear, and histopathology. During 18 months, $93 063 was spent on 183 patient specimens for broad-range PCR and DNA sequencing for mycobacteria to confirm one culture-proven Mycobacterium tuberculosis infection that was also known to be positive by AFB smear and histopathology. In this cohort, there was a false-negative AFB PCR for M tuberculosis and a false-positive AFB PCR for Mycobacterium lentiflavum . Testing of AFB smear-negative specimens from patients without an inflammatory response supportive of a mycobacterial infection is costly and has not been proven to improve patient care. Traditional diagnostics (histopathology, AFB smear, and culture) should remain the primary methods for the detection of mycobacteria in clinical specimens.

  13. Microfabricated sleeve devices for chemical reactions

    DOEpatents

    Northrup, M. Allen

    2003-01-01

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  14. Performance of polymerase chain reaction for the diagnosis of cystic echinococcosis using serum, urine, and cyst fluid samples

    PubMed Central

    Chaya, DR; Parija, Subhash Chandra

    2014-01-01

    Introduction: Cystic echinococcosis (CE) is a chronic zoonosis which presents with variable clinical manifestations. Currently the diagnosis of this disease is based on radiological findings and serological tests which lack specificity. Although antigen detection from the cyst fluid is the most specific, it is seldom done due to the complications involved. Detecting the presence of Echinococcus granulosus specific deoxyribonucleic acid (DNA) by the polymerase chain reaction (PCR) could provide a definitive diagnosis of CE. Materials and Methods: An in-house PCR assay was devised to detect E. granulosus specific DNA in serum, urine and hydatid cyst fluid. The ability of the PCR to detect E. granulosus in the above mentioned samples were observed in comparison with other antigen and antibody detection tests. Results: Serum samples from surgically confirmed patients of CE with ruptured cysts contained the corresponding DNA while the in the majority of cases who had an intact cyst had no DNA of E. granulosus in their serum. DNA of E. granulosus was not found to be excreted in urine. PCR performed equal to antigen detection ELISA while testing hydatid cyst fluid samples. Conclusions: Serum and urine might not serve as useful samples for the molecular diagnosis of cystic echinococcosis. However, PCR can be useful on serum samples to detect ruptured hydatid cysts and on hydatid cyst fluid to confirm the parasitic diagnosis. PMID:24754027

  15. Performance of polymerase chain reaction for the diagnosis of cystic echinococcosis using serum, urine, and cyst fluid samples.

    PubMed

    Chaya, Dr; Parija, Subhash Chandra

    2014-01-01

    Cystic echinococcosis (CE) is a chronic zoonosis which presents with variable clinical manifestations. Currently the diagnosis of this disease is based on radiological findings and serological tests which lack specificity. Although antigen detection from the cyst fluid is the most specific, it is seldom done due to the complications involved. Detecting the presence of Echinococcus granulosus specific deoxyribonucleic acid (DNA) by the polymerase chain reaction (PCR) could provide a definitive diagnosis of CE. An in-house PCR assay was devised to detect E. granulosus specific DNA in serum, urine and hydatid cyst fluid. The ability of the PCR to detect E. granulosus in the above mentioned samples were observed in comparison with other antigen and antibody detection tests. Serum samples from surgically confirmed patients of CE with ruptured cysts contained the corresponding DNA while the in the majority of cases who had an intact cyst had no DNA of E. granulosus in their serum. DNA of E. granulosus was not found to be excreted in urine. PCR performed equal to antigen detection ELISA while testing hydatid cyst fluid samples. Serum and urine might not serve as useful samples for the molecular diagnosis of cystic echinococcosis. However, PCR can be useful on serum samples to detect ruptured hydatid cysts and on hydatid cyst fluid to confirm the parasitic diagnosis.

  16. Development of hydrolysis probe-based real-time PCR for identification of virulent gene targets of Burkholderia pseudomallei and B. mallei--a retrospective study on archival cases of service members with melioidosis and glanders.

    PubMed

    Zhang, Binxue; Wear, Douglas J; Kim, H S; Weina, Peter; Stojadinovic, Alexander; Izadjoo, Mina

    2012-02-01

    Burkholderia pseudomallei and B. mallei are two highly pathogenic bacteria responsible for melioidosis and glanders, respectively. Our laboratory developed hydrolysis probe-based real-time polymerase chain reaction assays targeting type three secretion system (TTS) and transposase family protein (TFP) of B. pseudomallei and B. malli, respectively. The assays were validated for target specificity, amplification sensitivity, and reproducibility. A bacterial DNA panel, composed of B. pseudomallei (13 strains), B. mallei (11 strains), Burkholderia species close neighbors (5 strains), and other bacterial species (17 strains), was prepared for specificity testing. Reference DNAs from B. pseudomallei and B. mallei bacterial cultures were used as controls for amplification, limit of detection, and reproducibility testing. The two TaqMan assays, Bp-TTS 1 and Bm-TFP, were optimized and applied in a retrospective study of archived cases from the Armed Forces Institute of Pathology. We tested 10 formalin-fixed paraffin-embedded blocks originally from autopsy specimens of patients who died of melioidosis or glanders during or after overseas tours in 1960s. Polymerase chain reaction results confirmed that DNA samples from formalin-fixed paraffin-embedded blocks of eight patients with melioidosis were positive for Bp-TTS 1 target and two patients with glanders were positive for Bm-TFP target.

  17. Biofiltration of gasoline and diesel aliphatic hydrocarbons.

    PubMed

    Halecky, Martin; Rousova, Jana; Paca, Jan; Kozliak, Evguenii; Seames, Wayne; Jones, Kim

    2015-02-01

    The ability of a biofilm to switch between the mixtures of mostly aromatic and aliphatic hydrocarbons was investigated to assess biofiltration efficiency and potential substrate interactions. A switch from gasoline, which consisted of both aliphatic and aromatic hydrocarbons, to a mixture of volatile diesel n-alkanes resulted in a significant increase in biofiltration efficiency, despite the lack of readily biodegradable aromatic hydrocarbons in the diesel mixture. This improved biofilter performance was shown to be the result of the presence of larger size (C₉-C(12)) linear alkanes in diesel, which turned out to be more degradable than their shorter-chain (C₆-C₈) homologues in gasoline. The evidence obtained from both biofiltration-based and independent microbiological tests indicated that the rate was limited by biochemical reactions, with the inhibition of shorter chain alkane biodegradation by their larger size homologues as corroborated by a significant substrate specialization along the biofilter bed. These observations were explained by the lack of specific enzymes designed for the oxidation of short-chain alkanes as opposed to their longer carbon chain homologues.

  18. Marine biofouling resistance of polyurethane with biodegradation and hydrolyzation.

    PubMed

    Xu, Wentao; Ma, Chunfeng; Ma, Jielin; Gan, Tiansheng; Zhang, Guangzhao

    2014-03-26

    We have prepared polyurethane with poly(ε-caprolactone) (PCL) as the segments of the main chain and poly(triisopropylsilyl acrylate) (PTIPSA) as the side chains by a combination of radical polymerization and a condensation reaction. Quartz crystal microbalance with dissipation studies show that polyurethane can degrade in the presence of enzyme and the degradation rate decreases with the PTIPSA content. Our studies also demonstrate that polyurethane is able to hydrolyze in artificial seawater and the hydrolysis rate increases as the PTIPSA content increases. Moreover, hydrolysis leads to a hydrophilic surface that is favorable to reduction of the frictional drag under dynamic conditions. Marine field tests reveal that polyurethane has good antifouling ability because polyurethane with a biodegradable PCL main chain and hydrolyzable PTIPSA side chains can form a self-renewal surface. Polyurethane was also used to carry and release a relatively environmentally friendly antifoulant, and the combined system exhibits a much higher antifouling performance even in a static marine environment.

  19. In vitro Fab display: a cell-free system for IgG discovery

    PubMed Central

    Stafford, Ryan L.; Matsumoto, Marissa L.; Yin, Gang; Cai, Qi; Fung, Juan Jose; Stephenson, Heather; Gill, Avinash; You, Monica; Lin, Shwu-Hwa; Wang, Willie D.; Masikat, Mary Rose; Li, Xiaofan; Penta, Kalyani; Steiner, Alex R.; Baliga, Ramesh; Murray, Christopher J.; Thanos, Christopher D.; Hallam, Trevor J.; Sato, Aaron K.

    2014-01-01

    Selection technologies such as ribosome display enable the rapid discovery of novel antibody fragments entirely in vitro. It has been assumed that the open nature of the cell-free reactions used in these technologies limits selections to single-chain protein fragments. We present a simple approach for the selection of multi-chain proteins, such as antibody Fab fragments, using ribosome display. Specifically, we show that a two-chain trastuzumab (Herceptin) Fab domain can be displayed in a format which tethers either the heavy or light chain to the ribosome while retaining functional antigen binding. Then, we constructed synthetic Fab HC and LC libraries and performed test selections against carcinoembryonic antigen (CEA) and vascular endothelial growth factor (VEGF). The Fab selection output was reformatted into full-length immunoglobulin Gs (IgGs) and directly expressed at high levels in an optimized cell-free system for immediate screening, purification and characterization. Several novel IgGs were identified using this cell-free platform that bind to purified CEA, CEA positive cells and VEGF. PMID:24586053

  20. Enzymatic preparation of structured oils containing short-chain fatty acids.

    PubMed

    Kanda, Ayato; Namiki, Fusako; Hara, Setsuko

    2010-01-01

    Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.

  1. An ab initio molecular dynamics and density functional theory study of the formation of phosphate chains from metathiophosphates.

    PubMed

    Mosey, Nicholas J; Woo, Tom K

    2006-09-04

    The reactions that occur between metathiophosphate (MTP) molecules are identified and examined through ab initio molecular dynamics simulations and static quantum chemical calculations at the density functional level of theory. The simulations show that certain types of MTPs can react to yield phosphate chains, while others only dimerize. These differences are rationalized in terms of reaction energies and the electronic structures of these molecules. In the reaction leading to the formation of phosphate chains, the reactive center, a tri-coordinate phosphorus atom, is continually regenerated. A polymerization mechanism linking MTPs to phosphate chains is developed on the basis of these results. This information sheds light on the underlying processes that may be responsible for the formation of phosphates under high-temperature conditions and may prove useful in the development of protocols for the rational synthesis of complex phosphate structures.

  2. DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

    EPA Science Inventory

    The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

  3. 29 CFR 1910.155 - Scope, application and definitions applicable to this subpart.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... by inhibiting the chemical chain reaction of fuel and oxygen. It is also known as...F3) which is a medium for extinguishing fires by inhibiting the chemical chain reaction of fuel and..., odorless, electrically nonconductive inert gas (chemical formula CO2) that is a medium for extinguishing...

  4. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    ERIC Educational Resources Information Center

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  5. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  6. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    USDA-ARS?s Scientific Manuscript database

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  7. Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.

    PubMed

    Borkar, Santosh Ramdas; Aidhen, Indrapal Singh

    2017-04-18

    Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.

  8. Multi-scale modeling of diffusion-controlled reactions in polymers: renormalisation of reactivity parameters.

    PubMed

    Everaers, Ralf; Rosa, Angelo

    2012-01-07

    The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.

  9. Detection of feline herpes virus 1 via polymerase chain reaction and immunohistochemistry in cats with ulcerative facial dermatitis, eosinophilic granuloma complex reaction patterns and mosquito bite hypersensitivity.

    PubMed

    Persico, Paola; Roccabianca, Paola; Corona, Antonio; Vercelli, Antonella; Cornegliani, Luisa

    2011-12-01

    Ulcerative dermatitis caused by feline herpes virus 1 (FHV-1) is an uncommon disease characterized by cutaneous ulcers secondary to epidermal, adnexal and dermal necrosis. Differential diagnoses for FHV-1 lesions include, but are not limited to, mosquito bite hypersensitivity and eosinophilic granuloma complex. Histopathological diagnosis of FHV-1 dermatitis is based on the detection of the intranuclear inclusion bodies. In cases where intranuclear inclusions are missing but clinical and histological findings are compatible with FHV-1 dermatitis, immunohistochemistry (IHC) and PCRs have been used. In this retrospective study, we evaluated the presence of FHV-1 by IHC and PCR in skin biopsies and compared the results of the two tests. Sixty-four skin biopsy specimens from cats with compatible lesions were reviewed and tested via PCR and IHC for evidence of FHV-1. Polymerase chain reaction was positive in 12 of 64 biopsies; PCR and IHC were positive only in two of 64 biopsies, and these cases were considered true positive cases. The higher number of PCR-positive cases was possibly attributed to amplification of viral DNA from a live attenuated vaccination, but a previous FHV-1 infection with subsequent amplification of latently inserted FHV-1 could not be excluded. If clinical signs and histopathology suggest FHV-1 infection in the absence of typical inclusion bodies, IHC is the preferred diagnostic test; PCR may be useful for initial screening, but due to false positives is not sufficient for a definitive diagnosis. © 2011 The Authors. Veterinary Dermatology. © 2011 ESVD and ACVD.

  10. Faster and economical screening for vancomycin-resistant enterococci by sequential use of chromogenic agar and real-time polymerase chain reaction.

    PubMed

    Tan, Thean Yen; Jiang, Boran; Ng, Lily Siew Yong

    2017-08-01

    Screening for vancomycin-resistant enterococci (VRE) by culture takes days to generate results, while polymerase chain reaction (PCR) testing directly from clinical specimens lacks specificity. The aims of this study were to develop a real-time PCR to detect and identify Enterococcus faecium, Enterococcus faecalis, and vanA and vanB genes, and to evaluate the impact of this PCR on test-reporting times when performing it directly from suspect VRE isolates present on screening chromogenic media. The tetraplex PCR primers were designed to amplify E. faecium, E. faecalis, and vanA and vanB genes, with melt-curve analysis of PCR products. Following analytical and clinical validation of the molecular assay, PCR testing was performed for target colonies present on VRE chromogenic media. PCR results were evaluated against conventional phenotypic identification and susceptibility testing, with the time to result being monitored for both modalities. A total of 519 colonies from clinical specimens were tested concurrently by real-time PCR and phenotypic methods. In all, 223 isolates were identified with phenotypic vancomycin resistance (vanA, n = 108; vanB, n = 105; non-vanA/vanB = 10), with complete agreement between PCR and phenotypic testing for vancomycin-resistant E. faecium and E. faecalis. The majority (88.6%) of PCR results were reported, on average, 24.8 hours earlier than those of phenotypic testing, with 68% reduction in total costs. The use of culture on selective media, followed by direct colony PCR confirmation allows faster and economical VRE screening. Copyright © 2015. Published by Elsevier B.V.

  11. Development, Evaluation, and Integration of a Quantitative Reverse-Transcription Polymerase Chain Reaction Diagnostic Test for Ebola Virus on a Molecular Diagnostics Platform.

    PubMed

    Cnops, Lieselotte; Van den Eede, Peter; Pettitt, James; Heyndrickx, Leo; De Smet, Birgit; Coppens, Sandra; Andries, Ilse; Pattery, Theresa; Van Hove, Luc; Meersseman, Geert; Van Den Herrewegen, Sari; Vergauwe, Nicolas; Thijs, Rein; Jahrling, Peter B; Nauwelaers, David; Ariën, Kevin K

    2016-10-15

     The 2013-2016 Ebola epidemic in West Africa resulted in accelerated development of rapid diagnostic tests for emergency outbreak preparedness. We describe the development and evaluation of the Idylla™ prototype Ebola virus test, a fully automated sample-to-result molecular diagnostic test for rapid detection of Zaire ebolavirus (EBOV) and Sudan ebolavirus (SUDV).  The Idylla™ prototype Ebola virus test can simultaneously detect EBOV and SUDV in 200 µL of whole blood. The sample is directly added to a disposable cartridge containing all reagents for sample preparation, RNA extraction, and amplification by reverse-transcription polymerase chain reaction analysis. The performance was evaluated with a variety of sample types, including synthetic constructs and whole blood samples from healthy volunteers spiked with viral RNA, inactivated virus, and infectious virus.  The 95% limits of detection for EBOV and SUDV were 465 plaque-forming units (PFU)/mL (1010 copies/mL) and 324 PFU/mL (8204 copies/mL), respectively. In silico and in vitro analyses demonstrated 100% correct reactivity for EBOV and SUDV and no cross-reactivity with relevant pathogens. The diagnostic sensitivity was 97.4% (for EBOV) and 91.7% (for SUDV), the specificity was 100%, and the diagnostic accuracy was 95.9%.  The Idylla™ prototype Ebola virus test is a fast, safe, easy-to-use, and near-patient test that meets the performance criteria to detect EBOV in patients with suspected Ebola. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  12. Development of a dry-reagent mix-based polymerase chain reaction as a novel tool for the identification of Acinetobacter species and its comparison with conventional polymerase chain reaction

    PubMed Central

    Kulkarni, Raghavendra D.; Mishra, Mukti Nath; Mohanraj, Jeevanandam; Chandrasekhar, Arun; Ajantha, G. S.; Kulkani, Sheetal; Bhat, Shama

    2018-01-01

    BACKGROUND: Nosocomial infections are often caused by multidrug-resistant bacteria and the incidence is increasing. Acinetobacter, a Gram-negative bacillus, is commonly associated with the use of intravascular catheterization and airway intubation. Polymerase chain reaction (PCR) for identification of Acinetobacter baumannii from samples has been standardized that use conventional wet-reagent mix. We have designed and optimized a dry-reagent mix for identification of Acinetobacter species by PCR. The dry-reagent mix can be stored at room temperature, has less chances of contamination, and thus can be used at point-of-care diagnosis. AIM AND OBJECTIVE: The present work was focused on comparing the sensitivity and specificity of dry-reagent PCR mix over conventional wet-reagent PCR mix for identification of Acinetobacter species. MATERIALS AND METHODS: Conventional wet-reagent mix based and dry-reagent mix based PCR were carried out for the DNA isolated from Acinetobacter species. The latter was also applied directly on bacterial growth without prior DNA extraction process. Equal numbers of bacterial isolates other than Acinetobacter species were also subjected to identification by the same protocols for determining the sensitivity and specificity of the test. RESULTS: The Acinetobacter species showed amplification of the target rpoB gene and the band was observed at 397 bp. The dry-reagent PCR mix results matched completely with the conventional wet-reagent PCR mix assay. All the non-Acinetobacter isolates were negative for the PCR. This indicates that the test is highly specific. The dry-reagent mix also contained an enzyme resistant to PCR inhibitors and capable of amplifying DNA directly from cells. CONCLUSION: Performance of dry-reagent PCR mix without the need for DNA extraction and preparation of a PCR mix proved to be more sensitive and reduce the handling error, minimizes the time, manual work, and skilled labor. PMID:29403209

  13. Temperature control apparatus

    DOEpatents

    Northrup, M. Allen

    2003-08-05

    A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

  14. Report of data on children with non-typhi Salmonella gastroenteritis in a three-year period.

    PubMed

    Küçük, Öznur; Biçer, Suat; Ugraş, Meltem; Çöl, Defne; Giray, Tuba; Çiler Erdag, Gülay; Gürol, Yeşim; Yilmaz, Gülden; Yalvaç, Zerrin; Vitrinel, Ayça; Kaspar, Çigdem

    2016-09-01

    The purpose of this study was to evaluate the clinical and laboratory data of children with acute gastroenteritis caused by non-typhoid Salmonella spp. infections. Clinical (demographic data, symptoms and findings) and laboratory data (stool microscopy, rapid antigen tests, culture, multiplex polymerase chain reaction and blood test results) of children with acute gastroenteritis caused by non-typhoid Salmonella spp. between January 2010 and October 2012 were evaluated. Differences between the groups for categorical variables were estimated with a chi-square or Fisher exact test; for continuous variables with two independent samples a t test was used. P values < 0.05 were considered statistically significant. Sixty-seven children, 39 (58.2%) males and 28 (41.8%) females aged between 1 - 16 years (mean ± SD: 4.64 ± 2.91), were diagnosed with acute bacterial gastroenteritis caused by non-typhoid Salmonella spp. The main serotypes are Salmonella enteritidis (85%) and Salmonella typhimurium (7.5%). The presenting symptoms were diarrhoea (95.5%), fever (61.1%), vomiting (34.3%), abdominal pain (32.8%), loss of appetite (7.4%) and malaise (7.4%). Fever and dehydration (moderate and/or severe) were detected in 11 (16.4%) patients. The mean leukocyte count was 10.930/μL [95% confidence interval (CI), SD: ± 5.710/μL], neutrophil count was 7.880/μL (95% CI, SD: ± 4.960/μL), CRP was 64.16 mg/L (95% CI, SD: ± 76.24 mg/L), and erythrocyte sedimentation rate was 34.72 mm/hour (95% CI, SD: ± 13.64 mm/h). Stool microscopy was positive for leukocytes in 18 patients (26.8%). The definitive diagnosis was made with positive stool culture (n = 65) and/or PCR test (n = 4). Viral antigen positivity was detected in 10 patients (14.9%), evaluated as viral co-infection and false positive results. Antibiotic therapy and hospitalization were required in 26 (38.8%) and 23 (34.3%) patients, respectively. Salmonella carriage was detected in one patient (1.5%). Bloody diarrhoea, leukocytes in stool with an increased erythrocyte sedimentation rate and a CRP level without overt leukocytosis may indicate Salmonella infection. Viral antigens may cause false positive results in fast antigen tests in cases where clinical and laboratory findings indicate bacterial aetiology. Stool culture is a reference method in diagnosis whereas some agents may be detected via molecular techniques (polymerase chain reaction) in spite of negative culture. Multiplex polymerase chain reaction may be used to detect Salmonella spp. and may reveal false positivity for viruses as well as the detection of other bacteria.

  15. {sup 110,116}Cd({alpha},{alpha}){sup 110,116}Cd elastic scattering and systematic investigation of elastic {alpha} scattering cross sections along the Z=48 isotopic and N=62 isotonic chains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kiss, G. G.; Fueloep, Zs.; Gyuerky, Gy.

    2011-06-15

    The elastic scattering cross sections for the reactions {sup 110,116}Cd({alpha},{alpha}){sup 110,116}Cd at energies above and below the Coulomb barrier are presented to provide a sensitive test for the {alpha}-nucleus optical potential parameter sets. Additional constraints for the optical potential are taken from the analysis of elastic scattering excitation functions at backward angles which are available in literature. Moreover, the variation of the elastic {alpha} scattering cross sections along the Z=48 isotopic and N=62 isotonic chain is investigated by the study of the ratios of the {sup 106,110,116}Cd({alpha},{alpha}){sup 106,110,116}Cd scattering cross sections at E{sub cm{approx_equal}}15.6and18.8 MeV and the ratio of themore » {sup 110}Cd({alpha},{alpha}){sup 110}Cd and {sup 112}Sn({alpha},{alpha}){sup 112}Sn reaction cross sections at E{sub cm{approx_equal}}18.8 MeV, respectively. These ratios are sensitive probes for the {alpha}-nucleus optical potential parametrizations. The potentials under study are a basic prerequisite for the prediction of {alpha}-induced reaction cross sections (e.g., for the calculation of stellar reaction rates in the astrophysical p or {gamma} process).« less

  16. Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

    PubMed

    Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

    2014-09-09

    Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

  17. Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

    PubMed

    Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

    2013-09-15

    We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Multiplex polymerase chain reaction test for the diagnosis of acute viral hepatitis A.

    PubMed

    Heo, Nae-Yun; Lim, Young-Suk; An, Jihyun; Ko, Sun-Young; Oh, Heung-Bum

    2012-12-01

    The early diagnosis of acute hepatitis A (AHA) is hindered because serum IgM against hepatitis A virus (HAV) can yield false-negative results during the window period. This study evaluated the diagnostic accuracy of a polymerase chain reaction (PCR) kit for HAV RNA for the diagnosis of AHA. Samples were collected from 136 patients with acute severe hepatitis at their admission to Asan Medical Center between June 2010 and July 2010. Samples were analyzed for serum IgM anti-HAV using an immunoassay test and for qualitative HAV RNA using the Magicplex HepaTrio PCR test kit. The diagnostic accuracies of these methods were tested on the basis of clinical and laboratory diagnoses of AHA. The concordance rate and kappa value between IgM anti-HAV and HAV RNA PCR were 88.2% and 0.707, respectively. For the diagnosis of AHA, the sensitivity and specificity of IgM anti-HAV were 90.7% and 100%, respectively, when an "equivocal" result was regarded as positive; and 79.1% and 100%, respectively, when an "equivocal" result was regarded as negative. The sensitivity and specificity of HAV RNA PCR were 81.4% and 100%, respectively. All four patients with negative IgM anti-HAV and positive HAV RNA PCR results and all four patients with equivocal IgM anti-HAV RNA and positive HAV RNA PCR results were eventually diagnosed with AHA. The qualitative HAV RNA PCR test has an equivalent diagnostic accuracy for AHA compared to IgM anti-HAV and may be more sensitive during the window period.

  19. Human papillomavirus DNA testing as an adjunct to cytology in cervical screening programs.

    PubMed

    Lörincz, Attila T; Richart, Ralph M

    2003-08-01

    Our objective was to review current large studies of human papillomavirus (HPV) DNA testing as an adjunct to the Papanicolaou test for cervical cancer screening programs. We analyzed 10 large screening studies that used the Hybrid Capture 2 test and 3 studies that used the polymerase chain reaction test in a manner that enabled reliable estimates of accuracy for detecting or predicting high-grade cervical intraepithelial neoplasia (CIN). Most studies allowed comparison of HPV DNA and Papanicolaou testing and estimates of the performance of Papanicolaou and HPV DNA as combined tests. The studies were selected on the basis of a sufficient number of cases of high-grade CIN and cancer to provide meaningful statistical values. Investigators had to demonstrate the ability to generate reasonably reliable Hybrid Capture 2 or polymerase chain reaction data that were either minimally biased by nature of study design or that permitted analytical techniques for addressing issues of study bias to be applied. Studies had to provide data for the calculation of test sensitivity, specificity, predictive values, odds ratios, relative risks, confidence intervals, and other relevant measures. Final data were abstracted directly from published articles or estimated from descriptive statistics presented in the articles. In some studies, new analyses were performed from raw data supplied by the principal investigators. We concluded that HPV DNA testing was a more sensitive indicator for prevalent high-grade CIN than either conventional or liquid cytology. A combination of HPV DNA and Papanicolaou testing had almost 100% sensitivity and negative predictive value. The specificity of the combined tests was slightly lower than the specificity of the Papanicolaou test alone, but this decrease could potentially be offset by greater protection from neoplastic progression and cost savings available from extended screening intervals. One "double-negative" HPV DNA and Papanicolaou test indicated better prognostic assurance against risk of future CIN 3 than 3 subsequent negative conventional Papanicolaou tests and may safely allow 3-year screening intervals for such low-risk women.

  20. Leprosy: a review of laboratory and therapeutic aspects - Part 2*

    PubMed Central

    Lastória, Joel Carlos; de Abreu, Marilda Aparecida Milanez Morgado

    2014-01-01

    Leprosy is a chronic infectious condition caused by Mycobacterium leprae(M. leprae). It is endemic in many regions of the world and a public health problem in Brazil. Additionally, it presents a wide spectrum of clinical manifestations, which are dependent on the interaction between M. leprae and host, and are related to the degree of immunity to the bacillus. The diagnosis of this disease is a clinical one. However, in some situations laboratory exams are necessary to confirm the diagnosis of leprosy or classify its clinical form. This article aims to update dermatologists on leprosy, through a review of complementary laboratory techniques that can be employed for the diagnosis of leprosy, including Mitsuda intradermal reaction, skin smear microscopy, histopathology, serology, immunohistochemistry, polymerase chain reaction, imaging tests, electromyography, and blood tests. It also aims to explain standard multidrug therapy regimens, the treatment of reactions and resistant cases, immunotherapy with bacillus Calmette-Guérin (BCG) vaccine and chemoprophylaxis. PMID:24937811

  1. An improved reaction path optimization method using a chain of conformations

    NASA Astrophysics Data System (ADS)

    Asada, Toshio; Sawada, Nozomi; Nishikawa, Takuya; Koseki, Shiro

    2018-05-01

    The efficient fast path optimization (FPO) method is proposed to optimize the reaction paths on energy surfaces by using chains of conformations. No artificial spring force is used in the FPO method to ensure the equal spacing of adjacent conformations. The FPO method is applied to optimize the reaction path on two model potential surfaces. The use of this method enabled the optimization of the reaction paths with a drastically reduced number of optimization cycles for both potentials. It was also successfully utilized to define the MEP of the isomerization of the glycine molecule in water by FPO method.

  2. Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions

    NASA Astrophysics Data System (ADS)

    Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.

    2018-05-01

    It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

  3. Cephalosporin and penicillin cross-reactivity in patients allergic to penicillins.

    PubMed

    Liu, X-D; Gao, N; Qiao, H-L

    2011-03-01

    Bata-lactam antibiotics are the most commonly used antibiotics which usually cause serious IgE-mediated allergic reactions. Of all bata-lactam antibiotics, penicillins have so far been the best-studied, but the studies of cephalosporins and their cross-reactivity with penicillins are rare. We sought to evaluate the IgE response in vitro and estimate cross-reactivity between penicillins and cephalosporins in patients allergic to penicillins. We studied 87 control subjects and 420 subjects allergic to penicillins. Radioallergosorbent test (RAST) was performed to detect eight types of specific-penicillin IgE and eleven types of specific-cephalosporin IgE. The cross-reactivity and different molecules recognition by IgE were studied with a radioallergosorbent inhibition test. Of 420 patients allergic to penicillins, 95 patients (22.62%) showed specific-cephalosporin IgE positive, 73 patients (17.38%) showed IgEs positive to both penicillins and cephalosporins. In specific-penicillin IgE positive group, the positive rate of specific-cephalosporin IgE was significantly higher than in specific-penicillin IgE negative group (27.14% vs. 14.57%, p < 0.01). In urticaria group, the positive rate of specific-cephalosporin IgE was significantly higher than in other symptoms group (30.65% vs. 8.11%, p < 0.05). The analysis of drugs which have the same or similar side-chains showed that benzylpenicillanyl-IgE (BPA-IgE), ampicillanyl-IgE (APA-IgE), amoxicillanyl-IgE (AXA-IgE) were respectively related to cephalothanyl-IgE (CLA-IgE), cephalexanyl-IgE (CEXA-IgE), cephalexanyl-IgE (CEXA-IgE)in sera of penicillin-allergic patients we studied, and compared with patients who had negative amoxicillin-IgE, the positive rates of specific-ampicillin IgE and specific-cephalexin IgE were significantly higher in patients who had positive amoxicillin-IgE (14.43% vs. 3.72%, 14.00% vs. 2.96%, p < 0.01). Radioallergosorbent test and radioallergosorbent inhibition test confirmed that both nuclear structure and R1 side-chain contribute to IgE recognition. There exists cross-reactivity between cephalosporins and penicillins; patients allergic to several penicillins are more likely to develop allergic reaction to cephalosporins; due to sensitization to the similar structural characteristics (nuclear and R1 side-chain), penicillin-allergic patients may develop cross-allergic reactions with not only first-generation but also third-generation cephalosporins.

  4. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

  5. Higher risk of cytomegalovirus reactivation in human immunodeficiency virus-1-infected patients homozygous for MICA5.1.

    PubMed

    Moenkemeyer, Maren; Heiken, Hans; Schmidt, Reinhold E; Witte, Torsten

    2009-03-01

    Infection with cytomegalovirus (CMV) induces surface expression of major histocompatibility complex (MHC)-class-I-chain-related A (MICA), a ligand for NKG2D. This leads to improved recognition and elimination of infected cells by natural killer (NK) as well as CD8+ T cells. The MICA5.1 allele codes for a truncated protein. This study was performed to test whether impaired expression of a functional MICA protein would influence the susceptibility to severe CMV reactivation in immunocompromised individuals. In this study, the frequency of MICA5.1 was assessed by polymerase chain reaction in 230 Caucasian human immunodeficiency virus (HIV)-1-infected patients and in 219 healthy controls. Patients co-infected with hepatitis C virus (HCV) and GB virus-C served as controls. MICA5.1 allele was analyzed by polymerase chain reaction. Association of MICA5.1 homozygosity and risk of CMV reactivation was calculated by Pearson chi2 test. Comparison of patients with and without a history of CMV disease manifestation revealed that homozygous MICA5.1 genotype was present in a significantly higher frequency in patients with CMV reactivation (33%) than in those without (16%; p 0.032; odds ratio 0.330). The percentage was similar in HIV-1-infected patients and healthy controls. Furthermore, there was no difference in the frequency of MICA5.1 with respect to infection with HCV and GB virus-C. Our study provides the first in vivo demonstration of an association between homozygous MICA5.1 genotype and susceptibility to CMV reactivation in immunocompromised individuals.

  6. No association between catechol-O-methyltransferase polymorphisms and neurotic disorders among mainland Chinese university students.

    PubMed

    Kou, Changgui; Meng, Xiangfei; Xie, Bing; Shi, Jieping; Yu, Qiong; Yu, Yaqin; D'Arcy, Carl

    2012-07-30

    This study investigates the genetic association between catechol-O-methyltransferase (COMT) gene polymorphisms and neurotic disorders. Data were derived from a case-control association study of 255 undergraduates affected by neurotic disorders and 269 matched healthy undergraduate controls. The polymorphisms of eight tag single nucleotide polymorphisms (SNPs) on the COMT gene were tested using polymerase chain reaction (PCR)-based Ligase Detection Reaction (PCR-LDR). The eight tag SNPs on the COMT gene assessed were not associated with neurotic disorders. Our finding suggests that the COMT gene may not be a susceptibility gene for neurotic disorders. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Acute generalized exanthematous pustulosis to amoxicillin associated with parvovirus B19 reactivation.

    PubMed

    Calistru, Ana Maria; Lisboa, Carmen; Cunha, Ana Paula; Bettencourt, Herberto; Azevedo, Filomena

    2012-09-01

    We report the case of a 22-year-old male patient with 2 episodes, 4 months apart, of acute generalized exanthematous pustulosis (AGEP) associated with oral intake of amoxicillin and simultaneous reactivation of parvovirus B19 infection proven by positive polymerase chain reaction test in the skin fragment and blood sample and elevation of the IgG antibodies titer. To our knowledge, this is the first report of AGEP resulting from the interaction between drug hypersensitivity and the reactivation of parvovirus B19. A combination of an immunological reaction to the drug and virus infection could be responsible for the clinical picture.

  8. Ufd2p synthesizes branched ubiquitin chains to promote the degradation of substrates modified with atypical chains

    PubMed Central

    Liu, Chao; Liu, Weixiao; Ye, Yihong; Li, Wei

    2017-01-01

    Ubiquitination of a subset of proteins by ubiquitin chain elongation factors (E4), represented by Ufd2p in Saccharomyces cerevisiae, is a pivotal regulator for many biological processes. However, the mechanism of Ufd2p-mediated ubiquitination is largely unclear. Here, we show that Ufd2p catalyses K48-linked multi-monoubiquitination on K29-linked ubiquitin chains assembled by the ubiquitin ligase (Ufd4p), resulting in branched ubiquitin chains. This reaction depends on the interaction of K29-linked ubiquitin chains with two N-terminal loops of Ufd2p. Only following the addition of K48-linked ubiquitin to substrates modified with K29-linked ubiquitin chains, can the substrates be escorted to the proteasome for degradation. We demonstrate that this ubiquitin chain linkage switching reaction is essential for ERAD, oleic acid and acid pH resistance in yeast. Thus, our results suggest that Ufd2p functions by switching ubiquitin chain linkages to allow the degradation of proteins modified with a ubiquitin linkage, which is normally not targeted to the proteasome. PMID:28165462

  9. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  10. Identification of Brucella spp. by using the polymerase chain reaction.

    PubMed Central

    Herman, L; De Ridder, H

    1992-01-01

    The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

  11. Detection of Listeria monocytogenes by using the polymerase chain reaction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  12. Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

    PubMed

    Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

    2012-07-09

    Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. 9 CFR 145.33 - Terminology and classification; flocks and products.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    .... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

  14. Parallel and automated library synthesis of 2-long alkyl chain benzoazoles and azole[4,5-b]pyridines under microwave irradiation.

    PubMed

    Martínez-Palou, Rafael; Zepeda, L Gerardo; Höpfl, Herbert; Montoya, Ascensión; Guzmán-Lucero, Diego J; Guzmán, Javier

    2005-01-01

    A versatile route to 40-membered library of 2-long alkyl chain substituted benzoazoles (1 and 2) and azole[4,5-b]pyridines (3 and 4) via microwave-assisted combinatorial synthesis was developed. The reactions were carried out in both monomode and multimode microwave oven. With the latter, all reactions were performed in high-throughput experimental settings consisting of an 8 x 5 combinatorial library designed to synthesize 40 compounds. Each step, from the addition of reagents to the recovery of final products, was automated. The microwave-assisted N-long chain alkylation reactions of 2-alkyl-1H-benzimidazole (1) and 2-alkyl-1H-benzimidazole[4,5-b] pyridines (3) were also studied.

  15. PubMed Central

    Perreault, C

    1981-01-01

    Human leukocyte antigens (HLA) are transmembrane bicatenar glycoproteins; their heavy chain is coded by chromosome 6 and carries allotypic determinants. These molecules are present in nearly every cell, tissue and biologic fluid. Their congenital absence from fibroblasts is associated with progeria, while their absence from lymphocytes is associated with immunodeficiency. HLA antigens are usually studied microlymphocytotoxicity tests. The numerous cross-reactions encountered make the interpretation of results quite difficult. To clearly understand these reactions a complex-complex model is mandatory. The antigen, the HLA molecule, is complex since it carries many antigenic determinants; some of them are private ("subtypic"), while others are public ("subtypic"). Anti-HLA antibodies are also complex since they are heterogeneous, reacting with variable affinity with different antigenic determinants. The in vitro cross-reactions represent a partial explanation for varying cross-immunogenicity in vivo. PMID:7008927

  16. Development of a Novel and Rapid Fully Automated Genetic Testing System.

    PubMed

    Uehara, Masayuki

    2016-01-01

    We have developed a rapid genetic testing system integrating nucleic acid extraction, purification, amplification, and detection in a single cartridge. The system performs real-time polymerase chain reaction (PCR) after nucleic acid purification in a fully automated manner. RNase P, a housekeeping gene, was purified from human nasal epithelial cells using silica-coated magnetic beads and subjected to real-time PCR using a novel droplet-real-time-PCR machine. The process was completed within 13 min. This system will be widely applicable for research and diagnostic uses.

  17. [A pseudo-outbreak of pharyngeal gonorrhoea related to a false-positive PCR-result].

    PubMed

    Verzijl, A; Berretty, P J M; Erceg, A; Krekels, G A M; Van den Brule, A J C; Boel, C H E

    2007-03-24

    Nucleic acid amplification tests, including the polymerase chain reaction (PCR), are sensitive and specific tests that are often used for diagnosing sexually transmitted diseases (STDs). A pseudo-outbreak of pharyngeal gonorrhoea in a group of prostitutes turned out to have been caused by false-positive test results due to commensal oropharyngeal Neisseria species. Specific molecular tests may yield erroneous results. When the results of an STD study have major consequences at a legal or social level, it is advisable, in consultation with a medical microbiologist, to take a sample for culture or to carry out a second molecular test aimed at a different part of the bacterial genome.

  18. The Recent Emergence of Clostridium difficile Infection in Romanian Hospitals is Associated with a High Prevalence of Polymerase Chain Reaction Ribotype 027.

    PubMed

    Popescu, Gabriel Adrian; Serban, Roxana; Pistol, Adriana; Niculcea, Andreea; Preda, Andreea; Lemeni, Daniela; Macovei, Ioana Sabina; Tălăpan, Daniela; Rafila, Alexandru; Florea, Dragoş

    2018-03-15

    To investigate the epidemiology of Clostridium difficile infection in Romanian hospitals. A survey was conducted at nine hospitals throughout Romania between November 2013 and February 2014. The survey identified 393 patients with Clostridium difficile infection. The median age was 67 years (range: 2-94 years); 56% of patients were aged >65 years. The mean prevalence of Clostridium difficile infection was 5.2 cases per 10.000 patient-days. The highest prevalences were 24.9 and 20 per 10.000 patient-days in hospitals specializing in gastroenterology and infectious diseases, respectively. Clostridium difficile infections were health care-associated in 70.5% patients and community-acquired in 10.2%. The origin was not determined in 19.3%. Clostridium difficile infection was severe in 12.3% of patients, and the in-hospital all-cause mortality was 8.8%. Polymerase chain reaction ribotype 027 had the highest prevalence in all participating hospitals and represented 82.6% of the total ribotyped isolates. The minimum inhibitory concentration of moxifloxacin was >4 μg/mL for 59 of 80 tested isolates (73.8%). Of 59 isolates, 54 were highly resistant to moxifloxacin (minimum inhibitory concentration ≥32 μg/mL), and the majority were polymerase chain reaction ribotype 027 (p<0.0001). The ribotype 027 was the predominant cause of Clostridium difficile infections in Romania. In some specialized hospitals, the prevalence of Clostridium difficile infection was higher than the European mean prevalence, and this demonstrates the need for strict adherence to infection control programs.

  19. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    NASA Astrophysics Data System (ADS)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  20. Molecular screening by polymerase chain reaction detects panleukopenia virus DNA in formalin-fixed hearts from cats with idiopathic cardiomyopathy and myocarditis.

    PubMed

    Meurs, K M; Fox, P R; Magnon, A L; Liu, S; Towbin, J A

    2000-01-01

    Viral myocarditis has been suggested as an etiology for cardiomyopathy in several mammalian species. Myocarditis and idiopathic cardiomyopathy have been reported in the domestic cat, although a viral etiology has not been demonstrated. Because of the continuing interest in the potential relationship between viral myocarditis and cardiomyopathy, we evaluated hearts from cats with spontaneous, idiopathic cardiomyopathy for viral genomic material within myocytes by polymerase chain reaction, and for the presence of myocarditis by light microscopy. Thirty-one (31) formalin-fixed hearts from domestic cats who died of idiopathic cardiomyopathy were randomly selected from pathology archives. Seventeen (17) formalin-fixed hearts from healthy cats were similarly selected as normal controls. The polymerase chain reaction (PCR) was used to evaluate myocardial tissue for the presence of viral genome from feline panleukopenia virus, herpes virus, calici virus, and corona virus. Hearts were examined using light microscopy for histologic evidence of myocarditis according to the Dallas criteria. Panleukopenia virus was identified by PCR in 10 of 31 cats with cardiomyopathy but in none of the controls. Neither cardiomyopathic or control cats tested positive by PCR for herpes virus, calici virus, and corona virus. Myocarditis was detected by histologic examination in 18 of 31 cardiomyopathic cats and in none of 17 control cats. Myocarditis and or feline panleukopenia virus genome was detected in felines with idiopathic hypertrophic, dilated, and restrictive cardiomyopathy, suggesting a possible role of viral infection and inflammation in the pathogenesis of cardiomyopathy in this species.

  1. Tested Studies for Laboratory Teaching. Proceedings of the Workshop/Conference of the Association for Biology Laboratory Education (ABLE) (15th, Toronto, Ontario, Canada, June 8-12, 1993). Volume 15.

    ERIC Educational Resources Information Center

    Goldman, Corey A., Ed.

    The focus of the Association for Biology Laboratory Education (ABLE) is to improve the undergraduate biology laboratory experience by promoting the development and dissemination of interesting, innovative, and reliable laboratory exercises. This proceedings volume contains 18 papers: "Human DNA Fingerprinting by Polymerase Chain Reaction" (M. V.…

  2. Pooled nucleic acid testing to identify antiretroviral treatment failure during HIV infection.

    PubMed

    May, Susanne; Gamst, Anthony; Haubrich, Richard; Benson, Constance; Smith, Davey M

    2010-02-01

    Pooling strategies have been used to reduce the costs of polymerase chain reaction-based screening for acute HIV infection in populations in which the prevalence of acute infection is low (less than 1%). Only limited research has been done for conditions in which the prevalence of screening positivity is higher (greater than 1%). We present data on a variety of pooling strategies that incorporate the use of polymerase chain reaction-based quantitative measures to monitor for virologic failure among HIV-infected patients receiving antiretroviral therapy. For a prevalence of virologic failure between 1% and 25%, we demonstrate relative efficiency and accuracy of various strategies. These results could be used to choose the best strategy based on the requirements of individual laboratory and clinical settings such as required turnaround time of results and availability of resources. Virologic monitoring during antiretroviral therapy is not currently being performed in many resource-constrained settings largely because of costs. The presented pooling strategies may be used to significantly reduce the cost compared with individual testing, make such monitoring feasible, and limit the development and transmission of HIV drug resistance in resource-constrained settings. They may also be used to design efficient pooling strategies for other settings with quantitative screening measures.

  3. Concordance of polymerase chain reaction with human immunodeficiency virus antibody detection.

    PubMed

    Horsburgh, C R; Ou, C Y; Jason, J; Holmberg, S D; Lifson, A R; Moore, J L; Ward, J W; Seage, G R; Mayer, K H; Evatt, B L

    1990-08-01

    To evaluate the correlation of detection of human immunodeficiency virus (HIV) by polymerase chain reaction (PCR) with detection of HIV antibody, 271 simultaneous serum and peripheral blood mononuclear cell samples were examined from 242 persons whose activities placed them at increased risk for HIV infection: 142 from homosexual men, 86 from hemophilic men, and 43 from heterosexual partners of HIV-infected persons. PCR was performed using the gag region primer pair SK38/39 and the env region primer pairs SK68/69 and CO71/72. Amplified HIV DNA was detected using specific oligomer probes. Of 63 HIV antibody-positive samples, 58 (92%) had HIV DNA by PCR. Of 208 HIV antibody-negative samples, 7 (3.4%) had HIV DNA by PCR. On follow-up, 4 of the latter persons were seropositive when next tested; 2 were well and antibody- and PCR-negative; 1 had died of a stroke before retesting. Thus, PCR detects HIV in most antibody-positive persons; detection is increased by use of multiple primer pairs. PCR-positive antibody-negative specimens may indicate HIV infection in which antibody has not yet developed or may be false-positive PCR results. When PCR is discordant with HIV antibody, testing of additional specimens and clinical follow-up are necessary to assess HIV infection status.

  4. Variability in assays used for detection of lentiviral infection in bobcats (Lynx rufus), pumas (Puma concolor), and ocelots (Leopardus pardalis)

    USGS Publications Warehouse

    Franklin, S.P.; Troyer, J.L.; TerWee, J.A.; Lyren, L.M.; Kays, R.W.; Riley, S.P.D.; Boyce, W.M.; Crooks, K.R.; VandeWoude, S.

    2007-01-01

    Although lentiviruses similar to feline immunodeficiency virus (FIV) are known to infect numerous felid species, the relative utility of assays used for detecting lentiviral infection has not been compared for many of these hosts. We tested bobcats (Lynx rufus), pumas (Felis concolor), and ocelots (Leopardus pardalis) for exposure to lentivirus using five different assays: puma lentivirus (PLV), African lion lentivirus (LLV), and domestic cat FIV-based immunoblots, a commercially available enzyme-linked immunosorbent assay (ELISA) kit, and nested polymerase chain reaction (PCR). Puma lentivirus immunoblots identified more seropositive individuals than the other antibody-detection assays. The commercial ELISA provided a fair ability to recognize seropositive samples when compared with PLV immunoblot for screening bobcats and ocelots, but not pumas. Polymerase chain reaction identified fewer positive samples than PLV immunoblot for all three species. Immunoblot results were equivalent whether the sample tested was serum, plasma, or whole blood. The results from this study and previous investigations suggest that the PLV immunoblot has the greatest ability to detect reactive samples when screening wild felids of North America and is unlikely to produce false positive results. However, the commercial ELISA kit may provide ap adequate alternative for screening of some species and is more easily adapted to field conditions. ?? Wildlife Disease Association 2007.

  5. Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

    PubMed

    Amendola, R

    1994-11-01

    The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

  6. Head and Neck Squamous Cell Carcinomas Do Not Express EGFRvIII

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Melchers, Lieuwe J., E-mail: l.j.melchers@umcg.nl; Department of Pathology, University Medical Center Groningen, University of Groningen, Groningen; Clausen, Martijn J.A.M.

    2014-10-01

    Purpose: To assess the prevalence of EGFRvIII, a specific variant of EGFR (epidermal growth factor receptor), in 3 well-defined cohorts of head and neck squamous cell carcinoma (HNSCC). Methods and Materials: Immunohistochemistry for the specific detection of EGFRvIII using the L8A4 antibody was optimized on formalin-fixed, paraffin-embedded tissue using glioblastoma tissue. It was compared with EGFR and EGFRvIII RNA expression using a specific reverse transcription–polymerase chain reaction also optimized for formalin-fixed, paraffin-embedded tissue. Tissue microarrays including 531 HNSCCs of various stages with complete clinicopathologic and follow-up data were tested for the presence of EGFRvIII. Results: None of the 531 casesmore » showed EGFRvIII protein expression. Using an immunohistochemistry protocol reported by others revealed cytoplasmic staining in 8% of cases. Reverse transcription–polymerase chain reaction for the EGFRvIII transcript of the 28 highest cytoplasmic staining cases, as well as 69 negative cases, did not show expression in any of the tested cases, suggesting aspecific staining by a nonoptimal protocol. Conclusions: The EGFRvIII mutation is not present in HNSCC. Therefore, EGFRvIII does not influence treatment response in HNSCC and is not a usable clinical prognostic marker.« less

  7. Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems.

    PubMed

    Ximenes, Camila; Brandão, Eduardo; Oliveira, Paula; Rocha, Abraham; Rego, Tamisa; Medeiros, Rafael; Aguiar-Santos, Ana; Ferraz, João; Reis, Christian; Araujo, Paulo; Carvalho, Luiz; Melo, Fabio L

    2014-12-01

    The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

  8. Evidence of West Nile virus infection in Nepal.

    PubMed

    Rutvisuttinunt, Wiriya; Chinnawirotpisan, Piyawan; Klungthong, Chonticha; Shrestha, Sanjaya Kumar; Thapa, Amod Bahadur; Pant, Arjun; Yingst, Samuel L; Yoon, In-Kyu; Fernandez, Stefan; Pavlin, Julie A

    2014-11-27

    Acute febrile illness is common among those seeking medical care and is frequently treated empirically with the underlying illness remaining undiagnosed in resource-poor countries. A febrile illness study was conducted 2009-2010 to identify known and unknown pathogens circulating in Nepal. Study methods included diagnostic testing and preliminary ELISA screening of acute and convalescent samples for diseases both known and unknown to be circulating in Nepal, including West Nile virus (WNV). The molecular assays including Polymerase Chain Reaction (PCR), Sanger sequencing and ultra deep sequencing on MiSeq Illumina Platform were conducted to further confirm the presence of WNV. The study enrolled 2,046 patients presenting undifferentiated febrile illness with unknown etiology. Sera from 14 out of 2,046 patients were tested positive for west nile virus (WNV) by nested Reverse Transcription-Polymerase Chain Reaction (RT-PCR). Only two out of 14 cases were confirmed for the presence of WNV by sequencing and identified as WNV lineage 1 phylogentically. The two patients were adult males with fever and no neurological symptoms from Kathmandu and Bharatpur, Nepal. Two out of 2,046 serum samples contained fragments of WNV genome resembling WNV lineage 1, which is evidence of the continued spread of WNV which should be considered a possible illness cause in Nepal.

  9. A survey for selected avian viral pathogens in backyard chicken farms in Finland.

    PubMed

    Pohjola, L; Tammiranta, N; Ek-Kommonen, C; Soveri, T; Hänninen, M L; Fredriksson Ahomaa, M; Huovilainen, A

    2017-04-01

    Backyard poultry are regaining popularity in Europe and increased interest in the health and management of non-commercial farms has resulted. Furthermore, commercial poultry farm owners have become concerned about the risk represented by contagious avian diseases that nearby backyard poultry could transmit. Fifty-one voluntary backyard chicken farms were visited between October 2012 and January 2013. Blood samples and individual cloacal swabs were collected from 457 chickens. In 44 farms (86%), one or more of the tested chickens had antibodies against avian encephalomyelitis and chicken infectious anaemia viruses, 24 farms (47%) had chickens seropositive for infectious bronchitis virus, 10 farms (20%) had chickens seropositive for infectious bursal disease virus, six farms (12%) had chickens seropositive for infectious laryngotracheitis virus and two farms (5.4%) had chickens seropositive for avian influenza virus. No farms had chickens seropositive for Newcastle disease virus. Of the 51 farms, five (10%) had chickens positive for coronavirus reverse transcription polymerase chain reaction. A phylogenetic analysis showed that all backyard chicken coronaviruses collected were QX type infectious bronchitis viruses. All chickens tested for avian influenza and Newcastle disease viruses using real time reverse transcription polymerase chain reaction were negative. To our knowledge, there is no evidence to date to suggest that these diseases would have been transmitted between commercial and non-commercial flocks.

  10. Enzyme-Linked Immunosorbent Assay Testing of Shoots Grown In Vitro and the Use of Immunocapture-Reverse Transcription-Polymerase Chain Reaction Improve the Detection of Prunus necrotic ringspot virus in Rose.

    PubMed

    Moury, B; Cardin, L; Onesto, J P; Candresse, T; Poupet, A

    2000-05-01

    We developed and evaluated two different methods to improve the detection of the most prevalent virus of rose in Europe, Prunus necrotic ring-spot virus (PNRSV). Immunocapture-reverse transcription-polymerase chain reaction was estimated to be about 100 times more sensitive than double-antibody sandwich-enzyme-linked immunosorbent assay (DAS-ELISA) and showed an equivalent specificity. Based on the observation that PNRSV multiplies actively in young growing tissues (axillary shoots and cuttings), an in vitro culture method allowing rapid (about 15 days) and homogeneous development of dormant axillary buds with high virus titers was standardized. ELISA tests of these young shoots showed, in some cases, a 10(4) to 10(5) increase in sensitivity in comparison to adjacent leaf tissues from the rose mother plants. Between 21 and 98% (depending on the season) more samples were identified as positive by using ELISA on samples from shoot tips grown in vitro rather than on leaves collected directly from the PNRSV-infected mother plants. This simple method of growing shoot tips in vitro improved the confidence in the detection of PNRSV and eliminated problems in sampling appropriate tissues.

  11. Potential testing of reprocessing procedures by real-time polymerase chain reaction: A multicenter study of colonoscopy devices.

    PubMed

    Valeriani, Federica; Agodi, Antonella; Casini, Beatrice; Cristina, Maria Luisa; D'Errico, Marcello Mario; Gianfranceschi, Gianluca; Liguori, Giorgio; Liguori, Renato; Mucci, Nicolina; Mura, Ida; Pasquarella, Cesira; Piana, Andrea; Sotgiu, Giovanni; Privitera, Gaetano; Protano, Carmela; Quattrocchi, Annalisa; Ripabelli, Giancarlo; Rossini, Angelo; Spagnolo, Anna Maria; Tamburro, Manuela; Tardivo, Stefano; Veronesi, Licia; Vitali, Matteo; Romano Spica, Vincenzo

    2018-02-01

    Reprocessing of endoscopes is key to preventing cross-infection after colonoscopy. Culture-based methods are recommended for monitoring, but alternative and rapid approaches are needed to improve surveillance and reduce turnover times. A molecular strategy based on detection of residual traces from gut microbiota was developed and tested using a multicenter survey. A simplified sampling and DNA extraction protocol using nylon-tipped flocked swabs was optimized. A multiplex real-time polymerase chain reaction (PCR) test was developed that targeted 6 bacteria genes that were amplified in 3 mixes. The method was validated by interlaboratory tests involving 5 reference laboratories. Colonoscopy devices (n = 111) were sampled in 10 Italian hospitals. Culture-based microbiology and metagenomic tests were performed to verify PCR data. The sampling method was easily applied in all 10 endoscopy units and the optimized DNA extraction and amplification protocol was successfully performed by all of the involved laboratories. This PCR-based method allowed identification of both contaminated (n = 59) and fully reprocessed endoscopes (n = 52) with high sensibility (98%) and specificity (98%), within 3-4 hours, in contrast to the 24-72 hours needed for a classic microbiology test. Results were confirmed by next-generation sequencing and classic microbiology. A novel approach for monitoring reprocessing of colonoscopy devices was developed and successfully applied in a multicenter survey. The general principle of tracing biological fluids through microflora DNA amplification was successfully applied and may represent a promising approach for hospital hygiene. Copyright © 2018 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  12. Diagnosis of EML4-ALK Translocation With FISH, Immunohistochemistry, and Real-time Polymerase Chain Reaction in Patients With Non-Small Cell Lung Cancer.

    PubMed

    Cruz-Rico, Graciela; Avilés-Salas, Alejandro; Segura-González, Manuel; Espinosa-García, Ana María; Ramírez-Tirado, Laura Alejandra; Morales-Oyarvide, Vicente; Rojas-Marín, Carlos; Cardona, Andrés-Felipe; Arrieta, Oscar

    2017-12-01

    To assess anaplastic lymphoma kinase (ALK) rearrangement detection with immunohistochemistry (IHC) and real-time polymerase chain reaction (RT-qPCR) in comparison with fluorescence in situ hybridization (FISH). Tumor tissue samples from 230 patients with advanced non-small cell lung cancer (NSCLC) were analyzed by FISH to detect ALK rearrangements. Additional IHC tests using 5A4 clone and RT-qPCR (variants 1 to 5) were performed in 63 and 48 patients, respectively. Thirteen percent of FISH tests were not evaluable. From the remaining tests (n=200), 18 (9.0%) were ALK positive (ALK). ALK patients were significantly younger at the time of diagnosis (below 55 y, 14.3% vs. 5.5%, P=0.035), were light smokers (tobacco index <10, 12.6% vs. 4.1%, P=0.049), and presented adenocarcinoma with a mucinous component (30.8 vs. 8.0%, P=0.007). When comparing FISH with IHC using a cutoff of 1+ or 2+, and only 2+ staining intensity, the sensitivity, specificity, negative predictive value, and positive predictive value were as follows: 83.3%, 100.0%, 93.75%, and 100.0%; and 55.6%, 100.0%, 84.9%, and 100.0%, respectively. For RT-qPCR, these results were 55.6, 100, 90.7, and 100.0%, respectively. Our results suggest that RT-qPCR is an inadequate initial test for detecting ALK-positive lung cancer. IHC is highly useful as an initial screening test for ALK rearrangement detection in NSCLC. These results contribute to the medical literature on the establishment of IHC as a standard diagnostic test for ALK rearrangements in NSCLC.

  13. KRAS mutation testing in borderline ovarian tumors and low-grade ovarian carcinomas with a rapid, fully integrated molecular diagnostic system.

    PubMed

    Sadlecki, Pawel; Antosik, Paulina; Grzanka, Dariusz; Grabiec, Marek; Walentowicz-Sadlecka, Malgorzata

    2017-10-01

    Epithelial ovarian neoplasms are a heterogeneous group of tumors, including various malignancies with distinct clinicopathologic and molecular features. Mutations in BRAF and KRAS genes are the most frequent genetic aberrations found in low-grade serous ovarian carcinomas and serous and mucinous borderline tumors. Implementation of targeted therapeutic strategies requires access to highly specific and highly sensitive diagnostic tests for rapid determination of mutation status. One candidate for such test is fully integrated, real-time polymerase chain reaction-based Idylla™ system for quick and simple detection of KRAS mutations in formaldehyde fixed-paraffin embedded tumor samples. The primary aim of this study was to verify whether fully integrated real-time polymerase chain reaction-based Idylla system may be useful in determination of KRAS mutation status in patients with borderline ovarian tumors and low-grade ovarian carcinomas. The study included tissue specimens from 37 patients with histopathologically verified ovarian masses, operated on at the Department of Obstetrics and Gynecology, Nicolaus Copernicus University Collegium Medicum in Bydgoszcz (Poland) between January 2009 and June 2012. Based on histopathological examination of surgical specimens, 30 lesions were classified as low-grade ovarian carcinomas and 7 as borderline ovarian tumors. Seven patients examined with Idylla KRAS Mutation Test tested positive for KRAS mutation. No statistically significant association was found between the incidence of KRAS mutations and histopathological type of ovarian tumors. Mean survival of the study subjects was 48.51 months (range 3-60 months). Presence of KRAS mutation did not exert a significant effect on the duration of survival in our series. Our findings suggest that Idylla KRAS Mutation Test may be a useful tool for rapid detection of KRAS mutations in ovarian tumor tissue.

  14. No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

    PubMed

    D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

    2006-10-01

    Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

  15. Detection of human papillomaviruses by polymerase chain reaction and ligation reaction on universal microarray.

    PubMed

    Ritari, Jarmo; Hultman, Jenni; Fingerroos, Rita; Tarkkanen, Jussi; Pullat, Janne; Paulin, Lars; Kivi, Niina; Auvinen, Petri; Auvinen, Eeva

    2012-01-01

    Sensitive and specific detection of human papillomaviruses (HPV) in cervical samples is a useful tool for the early diagnosis of epithelial neoplasia and anogenital lesions. Recent studies support the feasibility of HPV DNA testing instead of cytology (Pap smear) as a primary test in population screening for cervical cancer. This is likely to be an option in the near future in many countries, and it would increase the efficiency of screening for cervical abnormalities. We present here a microarray test for the detection and typing of 15 most important high-risk HPV types and two low risk types. The method is based on type specific multiplex PCR amplification of the L1 viral genomic region followed by ligation detection reaction where two specific ssDNA probes, one containing a fluorescent label and the other a flanking ZipCode sequence, are joined by enzymatic ligation in the presence of the correct HPV PCR product. Human beta-globin is amplified in the same reaction to control for sample quality and adequacy. The genotyping capacity of our approach was evaluated against Linear Array test using cervical samples collected in transport medium. Altogether 14 out of 15 valid samples (93%) gave concordant results between our test and Linear Array. One sample was HPV56 positive in our test and high-risk positive in Hybrid Capture 2 but remained negative in Linear Array. The preliminary results suggest that our test has accurate multiple HPV genotyping capability with the additional advantages of generic detection format, and potential for high-throughput screening.

  16. New polymer systems: Chain extension by dianhydrides

    NASA Technical Reports Server (NTRS)

    Rhein, R. A.; Ingham, J. D.

    1972-01-01

    The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.

  17. A serotype-specific polymerase chain reaction for identification of Pasteurella multocida serotype 1

    USGS Publications Warehouse

    Rocke, Tonie E.; Smith, Susan R.; Miyamoto, Amy; Shadduck, Daniel J.

    2002-01-01

    A serotype-specific polymerase chain reaction (PCR) assay was developed for detection and identification of Pasteurella multocida serotype 1, the causative agent of avian cholera in wild waterfowl. Arbitrarily primed PCR was used to detect DNA fragments that distinguish serotype 1 from the other 15 serotypes of P. multocida (with the exception of serotype 14). Oligonucleotide primers were constructed from these sequences, and a PCR assay was optimized and evaluated. PCR reactions consistently resulted in amplification products with reference strains 1 and 14 and all other serotype 1 strains tested, with cell numbers as low as 2.3 cells/ml. No amplification products were produced with other P. multocida serotypes or any other bacterial species tested. To compare the sensitivity and further test the specificity of this PCR assay with traditional culturing and serotyping techniques, tissue samples from 84 Pekin ducks inoculated with field strains of P. multocida and 54 wild lesser snow geese collected during an avian cholera outbreak were provided by other investigators working on avian cholera. PCR was as sensitive (58/64) as routine isolation (52/64) in detecting and identifying P. multocida serotype 1 from the livers of inoculated Pekins that became sick or died from avian cholera. No product was amplified from tissues of 20 other Pekin ducks that received serotypes other than type 1 (serotype 3, 12 × 3, or 10) or 12 control birds. Of the 54 snow geese necropsied and tested for P. multocida, our PCR detected and identified the bacteria from 44 compared with 45 by direct isolation. The serotype-specific PCR we developed was much faster and less labor intensive than traditional culturing and serotyping procedures and could result in diagnosis of serotype 1 pasteurellosis within 24 hr of specimen submission.

  18. Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

    PubMed

    Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

    2014-07-24

    This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

  19. Sleeve reaction chamber system

    DOEpatents

    Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

    2009-08-25

    A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

  20. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    PubMed

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  1. Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

    USDA-ARS?s Scientific Manuscript database

    Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

  2. MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

    DOEpatents

    Wigner, E.P.; Weinberg, A.M.

    1961-01-24

    A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

  3. DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

    EPA Science Inventory

    This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

  4. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  5. Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

    PubMed

    Adewale, B; Mafe, M A; Oyerinde, J P O

    2005-01-01

    Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

  6. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    PubMed

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

  7. [The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

    PubMed

    Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

    2014-04-01

    The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

  8. Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

    PubMed Central

    Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

    2014-01-01

    A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

  9. Multiplex polymerase chain reaction assay for the differential detection of trichothecene- and fumonisin-producing species of Fusarium in cornmeal.

    PubMed

    Bluhm, B H; Flaherty, J E; Cousin, M A; Woloshuk, C P

    2002-12-01

    The genus Fusarium comprises a diverse group of fungi including several species that produce mycotoxins in food commodities. In this study, a multiplex polymerase chain reaction (PCR) assay was developed for the group-specific detection of fumonisin-producing and trichothecene-producing species of Fusarium. Primers for genus-level recognition of Fusarium spp. were designed from the internal transcribed spacer regions (ITS1 and ITS2) of rDNA. Primers for group-specific detection were designed from the TRI6 gene involved in trichothecene biosynthesis and the FUM5 gene involved in fumonisin biosynthesis. Primer specificity was determined by testing for cross-reactivity against purified genomic DNA from 43 fungal species representing 14 genera, including 9 Aspergillus spp., 9 Fusarium spp., and 10 Penicillium spp. With purified genomic DNA as a template, genus-specific recognition was observed at 10 pg per reaction; group-specific recognition occurred at 100 pg of template per reaction for the trichothecene producer Fusarium graminearum and at 1 ng of template per reaction for the fumonisin producer Fusarium verticillioides. For the application of the PCR assay, a protocol was developed to isolate fungal DNA from cornmeal. The detection of F. graminearum and its differentiation from F. verticillioides were accomplished prior to visible fungal growth at <10(5) CFU/g of cornmeal. This level of detection is comparable to those of other methods such as enzyme-linked immunosorbent assay, and the assay described here can be used in the food industry's effort to monitor quality and safety.

  10. Safety of medium-chain triglycerides used as an intraocular tamponading agent in an experimental vitrectomy model rabbit.

    PubMed

    Auriol, Sylvain; Mahieu, Laurence; Brousset, Pierre; Malecaze, François; Mathis, Véronique

    2013-01-01

    To evaluate safety of medium-chain triglycerides used as a possible intraocular tamponading agent. A 20-gauge pars plana vitrectomy was performed in the right eye of 28 rabbits. An ophthalmologic examination was performed every week until rabbits were killed. At days 7, 30, 60, and 90, rabbits were killed and the treated eyes were examined macroscopically and prepared for histologic examination. Principal outcome was retinal toxicity evaluated by light and electron microscopy, and secondary outcomes were the presence of medium-chain triglyceride emulsification, inflammatory reactions, and the development of cataract. Histologic examination did not reveal any retinal toxicity. Two cases of moderate emulsification were observed, but in these cases, emulsification was caused by the perioperative injection of the agent and did not increase during the postoperative period. We noted 13 cases of inflammatory reaction in vitreous cavity and no case of inflammatory reaction in anterior chamber. Two eyes developed cataract as a result of perioperative trauma to the lens with the vitreous cutter and not secondary to the presence of medium-chain triglycerides in the vitreous cavity. Medium-chain triglycerides did not induce morphologic evidence of retinal toxicity. The results suggest that medium-chain triglycerides could be a promising alternative intraocular tamponading agent for the treatment of retinal detachments.

  11. Human papillomavirus type 2 associated with pyogenic granuloma in patients without clinical evidence of warts.

    PubMed

    Vázquez-Martínez, Osvaldo T; González-Betancourt, Anajulia; Barboza-Cerda, María Carmen; González-González, Sergio E; Lugo-Trampe, Ángel; Welsh, Oliverio; Rojas-Martínez, Augusto; Martínez-Rodríguez, Herminia G; Ocampo-Candiani, Jorge; Ortiz-López, Rocío

    2016-07-01

    Pyogenic granuloma is a non-neoplastic lesion that frequently occurs in the skin and mucous membranes of children and pregnant women. The anatomical sites of pyogenic granulomas overlap with those of wart infections caused by the human papillomavirus (HPV). This study assessed the presence of HPV DNA in pyogenic granuloma samples by polymerase chain reaction. Eighteen pyogenic granuloma biopsies from patients without a clinical history or evidence of verruca in the studied area were tested for the presence of the HPV genome. The presence of HPV DNA was screened by three independent polymerase chain reaction reactions using standard consensus primer sets targeted to the L1 or E1 consensus regions of HPV genome. The HPV DNA-positive samples were genotyped using methodologies enabling the identification of up to 30 HPVs, including oncogenic, nononcogenic, and cutaneous viral types. The HPV DNA was detected in 44.4% (eight of 18) of the samples, with HPV-2 being the only type in the eight HPV DNA-positive samples. Contamination with HPV-2 sequences throughout the entire process was reliably eliminated. This report is the first to suggest an association between HPV-2 and pyogenic granuloma. This relationship is similar to that observed between HPV-2 and nongenital warts. © 2015 The International Society of Dermatology.

  12. A novel mechanism for direct real-time polymerase chain reaction that does not require DNA isolation from prokaryotic cells.

    PubMed

    Soejima, Takashi; Xiao, Jin-Zhong; Abe, Fumiaki

    2016-06-23

    Typically, polymerase chain reaction (PCR) is performed after DNA isolation. Real-time PCR (qPCR), also known as direct qPCR in mammalian cells with weak membranes, is a common technique using crude samples subjected to preliminary boiling to elute DNA. However, applying this methodology to prokaryotic cells, which have solid cell walls, in contrast to mammalian cells which immediately burst in water, can result in poor detection. We successfully achieved PCR elongation with the addition of 1.3 cfu of Cronobacter muytjensii to a newly developed direct qPCR master mix without performing any crude DNA extraction (detection limit of 1.6 × 10(0) cfu/ml for the test sample compared with a detection limit of 1.6 × 10(3) cfu/ml primarily for crude (boiling) or classical DNA isolation). We revealed that the chromosomal DNA retained in prokaryotic cells can function as a PCR template, similarly to the mechanism in in situ PCR. Elucidating this reaction mechanism may contribute to the development of an innovative master mix for direct qPCR to detect genes in a single bacterium with solid cell walls and might lead to numerous novel findings in prokaryotic genomics research.

  13. Rapid detection of avian influenza virus a and subtype H5N1 by single step multiplex reverse transcription-polymerase chain reaction.

    PubMed

    Wei, Hui-Ling; Bai, Gui-Rong; Mweene, Aaron S; Zhou, Ying-Chun; Cong, Yan-Long; Pu, Juan; Wang, Shuai; Kida, Hiroshi; Liu, Jin-Hua

    2006-06-01

    Outbreaks of H5N1 highly pathogenic avian influenza (HPAI) virus caused great economic losses to the poultry industry and resulted in human deaths in Thailand and Viet Nam in 2004. Rapid typing and subtyping of H5N1 viruses, especially from clinical specimens, are desirable for taking prompt control measures to prevent the spread of the disease. Here, we developed a set of oligonucleotide primers able to detect, type and subtype H5 and N1 influenza viruses in a single step multiplex reverse transcription-polymerase chain reaction (RT-PCR). RNA was extracted from allantoic fluid or from specimens with guanidinium isothiocyanate reagent. Reverse transcription and PCR were carried out with a mixture of primers specific for influenza viruses of type A, subtype H5 and N1 in a single reaction system under identical conditions. The amplified DNA fragments were analyzed by agarose gel electrophoresis. All the H5N1 viruses tested in the study and the experimental specimens presented three specific bands by the method established here. The results presented here suggest that the method described below is rapid and specific and, therefore, could be valuable in the rapid detection of H5N1 influenza viruses in clinics.

  14. Marzipan: polymerase chain reaction-driven methods for authenticity control.

    PubMed

    Brüning, Philipp; Haase, Ilka; Matissek, Reinhard; Fischer, Markus

    2011-11-23

    According to German food guidelines, almonds are the only oilseed ingredient allowed for the production of marzipan. Persipan is a marzipan surrogate in which the almonds are replaced by apricot or peach kernels. Cross-contamination of marzipan products with persipan may occur if both products are produced using the same production line. Adulterations or dilutions, respectively, of marzipan with other plant-derived products, for example, lupine or pea, have also been found. Almond and apricot plants are closely related. Consequently, classical analytical methods for the identification/differentiation often fail or are not sensitive enough to quantify apricot concentrations below 1%. Polymerase chain reaction (PCR)-based methods have been shown to enable the differentiation of closely related plant species in the past. These methods are characterized by high specificity and low detection limits. Isolation methods were developed and evaluated especially with respect to the matrix marzipan in terms of yield, purity, integrity, and amplificability of the isolated DNA. For the reliable detection of apricot, peach, pea, bean, lupine, soy, cashew, pistachio, and chickpea, qualitative standard and duplex PCR methods were developed and established. The applicability of these methods was tested by cross-reaction studies and analysis of spiked raw pastes. Contaminations at the level of 0.1% could be detected.

  15. Prevalence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using multiplex polymerase chain reaction

    PubMed Central

    Latha, C.; Anu, C. J.; Ajaykumar, V. J.; Sunil, B.

    2017-01-01

    Aim: The objective of the study was to investigate the occurrence of Listeria monocytogenes, Yersinia enterocolitica, Staphylococcus aureus, and Salmonella enterica Typhimurium in meat and meat products using the multiplex polymerase chain reaction (PCR) method. Materials and Methods: The assay combined an enrichment step in tryptic soy broth with yeast extract formulated for the simultaneous growth of target pathogens, DNA isolation and multiplex PCR. A total of 1134 samples including beef (n=349), chicken (n=325), pork (n=310), chevon (n=50), and meat products (n=100) were collected from different parts of Kerala, India. All the samples were subjected to multiplex PCR analysis and culture-based detection for the four pathogens in parallel. Results: Overall occurrence of L. monocytogenes was 0.08 % by cultural method. However, no L. monocytogenes was obtained by multiplex PCR method. Yersinia enterocolitica was obtained from beef and pork samples. A high prevalence of S. aureus (46.7%) was found in all types of meat samples tested. None of the samples was positive for S. Typhimurium. Conclusion: Multiplex PCR assay used in this study can detect more than one pathogen simultaneously by amplifying more than one target gene in a single reaction, which can save time and labor cost. PMID:28919685

  16. Evaluation of a Campylobacter fetus subspecies venerealis real-time quantitative polymerase chain reaction for direct analysis of bovine preputial samples

    PubMed Central

    Chaban, Bonnie; Chu, Shirley; Hendrick, Steven; Waldner, Cheryl; Hill, Janet E.

    2012-01-01

    The detection and subspeciation of Campylobacter fetus subsp. venerealis (CFV) from veterinary samples is important for both clinical and economic reasons. Campylobacter fetus subsp. venerealis is the causative agent of bovine genital campylobacteriosis, a venereal disease that can lead to serious reproductive problems in cattle, and strict international regulations require animals and animal products to be CFV-free for trade. This study evaluated methods reported in the literature for CFV detection and reports the translation of an extensively tested CFV-specific polymerase chain reaction (PCR) primer set; including the VenSF/VenSR primers and a real-time, quantitative PCR (qPCR) platform using SYBR Green chemistry. Three methods of preputial sample preparation for direct qPCR were evaluated and a heat lysis DNA extraction method was shown to allow for CFV detection at the level of approximately one cell equivalent per reaction (or 1.0 × 103 CFU/mL) from prepuce. The optimized sample preparation and qPCR protocols were then used to evaluate 3 western Canadian bull cohorts, which included 377 bulls, for CFV. The qPCR assay detected 11 positive bulls for the CFV-specific parA gene target. DNA sequence data confirmed the identity of the amplified product and revealed that positive samples were comprised of 2 sequence types; one identical to previously reported CFV parA gene sequences and one with a 9% sequence divergence. These results add valuable information towards our understanding of an important CFV subspeciation target and offer a significantly improved format for an internationally recognized PCR test. PMID:23277694

  17. Development of Multiplex Reverse Transcription-Polymerase Chain Reaction for Simultaneous Detection of Influenza A, B and Adenoviruses

    PubMed Central

    Nakhaie, Mohsen; Soleimanjahi, Hoorieh; Mollaie, Hamid Reza; Arabzadeh, Seyed Mohamad Ali

    2018-01-01

    Background and objective: Millions of people in developing countries lose their lives due to acute respiratory infections, such as Influenza A & B and Adeno viruses. Given the importance of rapid identification of the virus, in this study the researchers attempted to design a method that enables detection of influenza A, B, and adenoviruses, quickly and simultaneously. The Multiplex RT PCR method was the preferred method for the detection of influenza A, B, and adenoviruses in clinical specimens because it is rapid, sensitive, specific, and more cost-effective than alternative methods Methods: After collecting samples from patients with respiratory disease, virus genome was extracted, then Monoplex PCR was used on positive samples and Multiplex RT-PCR on clinical specimens. Finally, by comparing the bands of these samples, the type of virus in the clinical samples was determined. Results: Performing Multiplex RT-PCR on 50 samples of respiratory tract led to following results; flu A: 12.5%, fluB: 50%, adeno: 27.5%, negative: 7.5%, and 2.5% contamination. Conclusion: Reverse transcription-multiplex Polymerase Chain Reaction (PCR) technique, a rapid diagnostic tool, has potential for high-throughput testing. This method has a significant advantage, which provides simultaneous amplification of numerous viruses in a single reaction. This study concentrates on multiplex molecular technologies and their clinical application for the detection and quantification of respiratory pathogens. The improvement in diagnostic testing for viral respiratory pathogens effects patient management, and leads to more cost-effective delivery of care. It limits unnecessary antibiotic use and improves clinical management by use of suitable treatment. PMID:29731796

  18. Evaluation of Line Immunoassay to Detect HTLV-1 Infection in an Endemic Area, Southwestern Japan; Comparison with Polymerase Chain Reaction and Western Blot.

    PubMed

    Umeki, Kazumi; Umekita, Kunihiko; Hashikura, Yuuki; Yamamoto, Ikuo; Kubo, Kazuyoshi; Nagatomo, Yasuhiro; Okayama, Akihiko

    2017-02-01

    Human T-lymphotropic virus type 1 (HTLV-1) has been recognized as a cause of adult T-cell leukemia/lymphoma, HTLV-1-associated myelopathy/tropical spastic paraparesis, and HTLV-1-associated uveitis. HTLV-1 infection is normally detected by screening for HTLV-1 antibodies, and positive samples are confirmed by Western blot (WB). However, WB fails to confirm some samples that were positive for HTLV-1 antibodies on screening. Line immunoassay (LIA) is commonly used in Europe and Brazil, but not in Japan. Therefore, we evaluated the performance of LIA as a method of confirming HTLV-1 antibodies using samples in Japan. LIA was compared with polymerase chain reaction (PCR) and WB using 50 negative and 70 positive samples tested by chemiluminescent enzyme immunoassay (CLEIA) in Miyazaki, Japan, an HTLV-1 endemic area. LIA (INNO-LIA HTLVI/II Score) and WB (Problot HTLV-I) were performed according to the manufacturer's instructions. Real-time PCR for HTLV-1 pX region was performed using DNA derived from white blood cells. The samples that tested negative by real-time PCR were further tested by nested PCR. All 50 CLEIA negative samples were determined to be negative by LIA and PCR. Of the 70 positive samples, 66 tested positive by both of LIA and PCR. Three samples tested negative by LIA and PCR, and the remaining sample (PCR negative) showed non-specific staining in LIA and WB. WB showed more indeterminate results than LIA. Gp21 antibody in LIA demonstrated a high ability to discriminate between positive and negative PCR results. Furthermore, the degree of gp21 antibody reaction by LIA showed correlation with HTLV-1 proviral loads (PVLs). Our results indicate that LIA performs well in confirming HTLV-1 seropositivity by showing a low incidence of indeterminate results and good agreement with PCR using samples in Japan, although the number of samples tested was small. In addition, semi-quantitative antibody titer to gp21 correlated well with HTLV-1 PVLs. Further study including larger samples is necessary to determine the positioning of LIA for HTLV-1 detection in Japan.

  19. Neutron-deficient superheavy nuclei obtained in the 240Pu+48Ca reaction

    NASA Astrophysics Data System (ADS)

    Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu. Ts.; Rykaczewski, K. P.; Abdullin, F. Sh.; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu. S.; Voinov, A. A.; Subbotin, V. G.; Sukhov, A. M.; Karpov, A. V.; Popeko, A. G.; Sabel'nikov, A. V.; Svirikhin, A. I.; Vostokin, G. K.; Hamilton, J. H.; Kovrizhnykh, N. D.; Schlattauer, L.; Stoyer, M. A.; Gan, Z.; Huang, W. X.; Ma, L.

    2018-01-01

    We present new results from investigations of the 240Pu+48Ca reaction at a projectile energy of 250 MeV. Three new decay chains of 285Fl were detected with decay properties mostly consistent with those measured in earlier studies. An additional chain was observed where the nuclei may decay through energy levels different from those of the other six chains registered so far. The cross section of the 240Pu(48Ca,3 n )285Fl reaction was measured to be 0 .58-0.33+0.60pb , which is a factor of about 4-5 lower than that measured in the previous experiment at 245 MeV beam energy [V. K. Utyonkov et al., Phys. Rev. C 92, 034609 (2015)., 10.1103/PhysRevC.92.034609], consistent with expectations. The origin of an additional chain consisting of a recoil, α particle, and fission event is analyzed. The assignment of 25 short-lived SF events observed in this experiment is also discussed.

  20. Autocatalytic formation of an iron(IV)-oxo complex via scandium ion-promoted radical chain autoxidation of an iron(II) complex with dioxygen and tetraphenylborate.

    PubMed

    Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi

    2014-06-04

    A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.

  1. Real-time PCR assay for the diagnosis of pleural tuberculosis

    PubMed Central

    Cárdenas Bernal, Ana María; Giraldo-Cadavid, Luis Fernando; Prieto Diago, Enrique; Santander, Sandra Paola

    2017-01-01

    Abstract Introduction: The diagnosis of pleural tuberculosis requires an invasive and time-consuming reference method. Polymerase chain reaction (PCR) is rapid, but validation in pleural tuberculosis is still weak. Objective: To establish the operating characteristics of real-time polymerase chain reaction (RT-PCR) hybridization probes for the diagnosis of pleural tuberculosis. Methods: The validity of the RT-PCR hybridization probes was evaluated compared to a composite reference method by a cross-sectional study at the Hospital Universitario de la Samaritana. 40 adults with lymphocytic pleural effusion were included. Pleural tuberculosis was confirmed (in 9 patients) if the patient had at least one of three tests using the positive reference method: Ziehl-Neelsen or Mycobacterium tuberculosis culture in fluid or pleural tissue, or pleural biopsy with granulomas. Pleural tuberculosis was ruled out (in 31 patients) if all three tests were negative. The operating characteristics of the RT-PCR, using the Mid-P Exact Test, were determined using the OpenEpi 2.3 Software (2009). Results: The RT-PCR hybridization probes showed a sensitivity of 66.7% (95% CI: 33.2%-90.7%) and a specificity of 93.5% (95% CI: 80.3%-98.9%). The PPV was 75.0% (95% CI: 38.8%-95.6%) and a NPV of 90.6% (95% CI: 76.6%-97.6%). Two false positives were found for the test, one with pleural mesothelioma and the other with chronic pleuritis with mesothelial hyperplasia. Conclusions: The RT-PCR hybridization probes had good specificity and acceptable sensitivity, but a negative value cannot rule out pleural tuberculosis. PMID:29021638

  2. Comparison of traditional microbiological culture and 16S polymerase chain reaction analyses for identification of preoperative airway colonization for patients undergoing lung resection.

    PubMed

    Howitt, Samuel H; Blackshaw, Diana; Fontaine, Eustace; Hassan, Ibrahim; Malagon, Ignacio

    2018-04-28

    Preoperative airway colonization is associated with increased risk of postoperative respiratory complications following lung resection. This study compares the rates of preoperative lower respiratory tract colonization identified by traditional culture and novel 16S polymerase chain reaction (PCR) tests. Preoperative sputum and bronchoalveolar lavage (BAL) samples for 49 lung resection patients underwent culture and 16S PCR analyses. Rates of positive test results were determined and relationships between test results and suspected postoperative respiratory tract infection and hospital length of stay (LOS) were investigated. Preoperative BAL cultures were positive for 29 (59.2%) patients (population estimate 95%CI 45.2%-71.8%). 16S PCR tests were positive for 28 (57.1%) patients (population estimate 95%CI 43.3%-70.0%). 17 (34.7%) patients suffered suspected postoperative respiratory tract infection (population estimate 95%CI 22.9%-48.7%). Positive 16S PCR results tended to be associated with longer LOS (median 7.5 days vs 4.0 days for negative, p = 0.08) and increased risk of suspected postoperative respiratory tract infection (46.4% for positive vs 19.0% for negative, p = 0.07). Rates of colonization identified by culture and 16S PCR analyses of BAL samples were similar. Future research should attempt to clarify associations between airway colonization identified by 16S PCR and outcomes. 16S PCR may be useful when stratifying risk of postoperative respiratory complications. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Zika virus RNA polymerase chain reaction on the utility channel of a commercial nucleic acid testing system.

    PubMed

    Boujnan, Mohamed; Duits, Ashley J; Koppelman, Marco H G M

    2018-03-01

    Several countries have implemented safety strategies to reduce the risk of Zika virus (ZIKV) transmission through blood transfusion. These strategies have included nucleic acid amplification testing (NAT) of blood donations. In this study, a new real-time polymerase chain reaction (PCR) assay including internal control for the detection of ZIKV on the cobas omni Utility Channel (UC) on the cobas 6800 system is presented. PCR conditions and primer/probe concentrations were optimized on the LightCycler 480 instrument. Optimized conditions were transferred to the cobas omni UC on the cobas 6800 system. Subsequently, the limit of detection (LOD) in plasma and urine, genotype inclusivity, specificity, cross-reactivity, and clinical sensitivity were determined. The 95% LOD of the ZIKV PCR assay on the cobas 6800 system was 23.0 IU/mL (95% confidence interval [CI], 16.5-37.5) in plasma and 24.5 IU/mL (95% CI, 13.4-92.9) in urine. The assay detected African and Asian lineages of ZIKV. The specificity was 100%. The clinical concordance between the newly developed ZIKV PCR assay and the investigational Roche cobas Zika NAT test was 83% (24/29). We developed a sensitive ZIKV PCR assay on the cobas omni UC on the cobas 6800 system. The assay can be used for large-scale screening of blood donations for ZIKV or for testing of blood donors returning from areas with ZIKV to avoid temporal deferral. This study also demonstrates that the cobas omni UC on the cobas 6800 system can be used for in-house-developed PCR assays. © 2018 AABB.

  4. Terminal alkenes as versatile chemical reporter groups for metabolic oligosaccharide engineering.

    PubMed

    Späte, Anne-Katrin; Schart, Verena F; Schöllkopf, Sophie; Niederwieser, Andrea; Wittmann, Valentin

    2014-12-08

    The Diels-Alder reaction with inverse electron demand (DAinv reaction) of 1,2,4,5-tetrazines with electron rich or strained alkenes was proven to be a bioorthogonal ligation reaction that proceeds fast and with high yields. An important application of the DAinv reaction is metabolic oligosaccharide engineering (MOE) which allows the visualization of glycoconjugates in living cells. In this approach, a sugar derivative bearing a chemical reporter group is metabolically incorporated into cellular glycoconjugates and subsequently derivatized with a probe by means of a bioorthogonal ligation reaction. Here, we investigated a series of new mannosamine and glucosamine derivatives with carbamate-linked side chains of varying length terminated by alkene groups and their suitability for labeling cell-surface glycans. Kinetic investigations showed that the reactivity of the alkenes in DAinv reactions increases with growing chain length. When applied to MOE, one of the compounds, peracetylated N-butenyloxycarbonylmannosamine, was especially well suited for labeling cell-surface glycans. Obviously, the length of its side chain represents the optimal balance between incorporation efficiency and speed of the labeling reaction. Sialidase treatment of the cells before the bioorthogonal labeling reaction showed that this sugar derivative is attached to the glycans in form of the corresponding sialic acid derivative and not epimerized to another hexosamine derivative to a considerable extent. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Accuracy of a rapid real-time polymerase chain reaction assay for diagnosis of group B Streptococcus colonization in a cohort of HIV-infected pregnant women.

    PubMed

    Gouvea, Maria Isabel S; Joao, Esau C; Teixeira, Maria de Lourdes B; Read, Jennifer S; Fracalanzza, Sergio E L; Souza, Claudia T V; Souza, Maria José de; Torres Filho, Helio M; Leite, Cassiana C F; do Brasil, Pedro E A A

    2017-05-01

    There are limited data regarding Xpert performance to detect Group B Streptococcus (GBS) in HIV-infected pregnant women. We evaluated the accuracy of a rapid real-time polymerase chain reaction (PCR) test in a cohort of HIV-infected women. At 35-37 weeks of pregnancy, a pair of combined rectovaginal swabs were collected for two GBS assays in a cohort of sequentially included HIV-infected women in Rio de Janeiro: (1) culture; and (2) real-time PCR assay [GeneXpert GBS (Cepheid, Sunnyvale, CA)]. Using culture as the reference, sensitivity, specificity, positive and negative-likelihood ratios were estimated. From June 2012 to February 2015, 337 pregnant women met inclusion criteria. One woman was later excluded, due to failure to obtain a result in the index test; 336 were included in the analyses. The GBS colonization rate was 19.04%. Sensitivity and specificity of the GeneXpert GBS assay were 85.94% (95% CI: 75.38-92.42) and 94.85% (95% CI: 91.55-96.91), respectively. Positive and negative predictive values were 79.71% (95% CI: 68.78-87.51) and 96.63% (95% CI: 93.72-98.22), respectively. GeneXpert GBS is an acceptable test for the identification of GBS colonization in HIV-infected pregnant women and represents a reasonable option to detect GBS colonization in settings where culture is not feasible.

  6. Using a bayesian latent class model to evaluate the utility of investigating persons with negative polymerase chain reaction results for pertussis.

    PubMed

    Tarr, Gillian A M; Eickhoff, Jens C; Koepke, Ruth; Hopfensperger, Daniel J; Davis, Jeffrey P; Conway, James H

    2013-07-15

    Pertussis remains difficult to control. Imperfect sensitivity of diagnostic tests and lack of specific guidance regarding interpretation of negative test results among patients with compatible symptoms may contribute to its spread. In this study, we examined whether additional pertussis cases could be identified if persons with negative pertussis test results were routinely investigated. We conducted interviews among 250 subjects aged ≤18 years with pertussis polymerase chain reaction (PCR) results reported from 2 reference laboratories in Wisconsin during July-September 2010 to determine whether their illnesses met the Centers for Disease Control and Prevention's clinical case definition (CCD) for pertussis. PCR validity measures were calculated using the CCD as the standard for pertussis disease. Two Bayesian latent class models were used to adjust the validity measures for pertussis detectable by 1) culture alone and 2) culture and/or more sensitive measures such as serology. Among 190 PCR-negative subjects, 54 (28%) had illnesses meeting the CCD. In adjusted analyses, PCR sensitivity and the negative predictive value were 1) 94% and 99% and 2) 43% and 87% in the 2 types of models, respectively. The models suggested that public health follow-up of reported pertussis patients with PCR-negative results leads to the detection of more true pertussis cases than follow-up of PCR-positive persons alone. The results also suggest a need for a more specific pertussis CCD.

  7. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    PubMed Central

    2010-01-01

    Background The hepatitis C virus (HCV) genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR) assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM), at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP)/COBAS TaqMan (CTM) assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection. PMID:20529244

  8. Detection of asymptomatic renal Leptospira infection in abattoir slaughtered cattle in southeastern Georgia, United States

    PubMed Central

    Ilha, Marcia; Woldemeskel, Moges; Berghaus, Roy D; Pence, Mel E

    2014-01-01

    Objectives: Leptospirosis is one of the most widespread zoonotic infectious diseases affecting humans and animals. Several animal species, including cattle, can act as potential asymptomatic carriers facilitating zoonotic transmission of Leptospira. This study was conducted to assess the occurrence of asymptomatic renal Leptospira carriers among cattle slaughtered in southeastern Georgia, United States. Methods: A battery of diagnostic tests, including dark field microscopy, direct fluorescent antibody staining, polymerase chain reaction, and culture, were performed on a set of bovine kidneys (n = 37) collected from an abattoir in southeastern Georgia, United States. Virulence of a field isolate obtained from this study was tested in a hamster experimental model. Results: Motile spirochete-like structures were observed by dark field microscopy in 23 (59%) out of 37 kidney samples tested. In all, 29 samples (78%) were positive by direct fluorescent antibody staining. Only 11 (29.7%) samples by polymerase chain reaction and 3 (8.1%) by culture were positive for Leptospira sp. The isolates obtained by culture were confirmed as Leptospira borgpetersenii. Hamsters experimentally infected with one of the Leptospira field isolates obtained from this study did not show clinical signs but developed renal infection with interstitial nephritis and tubular necrosis. Conclusions: This study confirms that asymptomatic Leptospira renal infection is present among cattle in the region. Our findings underscore the need for future studies to assess the potential environmental contamination and transmission to humans in contact with infected cattle. PMID:26770734

  9. A regional centralized microbiology service in Calgary for the rapid diagnosis of malaria.

    PubMed

    Church, Deirdre L; Lichtenfeld, Angelika; Elsayed, Sameer; Kuhn, Susan; Gregson, Daniel B

    2003-06-01

    A regional centralized laboratory service for the rapid diagnosis of malaria was implemented 3 years ago in May 1999 within the Division of Microbiology, Calgary Laboratory Services. To describe the design and performance of this unique microbiology laboratory service. Blood specimens must arrive at the central laboratory within 2 hours of collection. Thin blood smears are read and reported from suspected acute cases within 1 hour of receipt, 24 hours per day, 7 days a week, by trained and experienced microbiology technologists. All positive malaria smears are reviewed by a medical microbiologist and confirmed by polymerase chain reaction at a reference laboratory. Calgary Laboratory Services provides integrated laboratory services to the Calgary Health Region, an urban area of more than 1 million people. Performance of the service has been continuously monitored by measuring preanalytic and analytic test turnaround times, test accuracy, clinical relevance, and the results of proficiency testing. More than 90% of blood specimens for malaria from community locations have consistently arrived within 2 hours of collection, and hospitals have reached this target within the past year. Although polymerase chain reaction was more sensitive at detecting the presence of malaria, the expert microscopists were as accurate at determining the type of Plasmodium infection. More than 95% of all positive smear results are consistently reported within 2 hours of receipt of a blood specimen. Implementation of a regional centralized microbiology service has improved our ability to make a rapid and accurate diagnosis of malaria in this region.

  10. Quantitative real-time polymerase chain reaction for the verification of genomic imbalances detected by microarray-based comparative genomic hybridization.

    PubMed

    Yu, Shihui; Kielt, Matthew; Stegner, Andrew L; Kibiryeva, Nataliya; Bittel, Douglas C; Cooley, Linda D

    2009-12-01

    The American College of Medical Genetics guidelines for microarray analysis for constitutional cytogenetic abnormalities require abnormal or ambiguous results from microarray-based comparative genomic hybridization (aCGH) analysis be confirmed by an alternative method. We employed quantitative real-time polymerase chain reaction (qPCR) technology using SYBR Green I reagents for confirmation of 93 abnormal aCGH results (50 deletions and 43 duplications) and 54 parental samples. A novel qPCR protocol using DNA sequences coding for X-linked lethal diseases in males for designing reference primers was established. Of the 81 sets of test primers used for confirmation of 93 abnormal copy number variants (CNVs) in 80 patients, 71 sets worked after the initial primer design (88%), 9 sets were redesigned once, and 1 set twice because of poor amplification. Fifty-four parental samples were tested using 33 sets of test primers to follow up 34 CNVs in 30 patients. Nineteen CNVs were confirmed as inherited, 13 were negative in both parents, and 2 were inconclusive due to a negative result in a single parent. The qPCR assessment clarified aCGH results in two cases and corrected a fluorescence in situ hybridization result in one case. Our data illustrate that qPCR methodology using SYBR Green I reagents is accurate, highly sensitive, specific, rapid, and cost-effective for verification of chromosomal imbalances detected by aCGH in the clinical setting.

  11. Detection and quantification of Leptographium wageneri, the cause of black-stain root disease, from bark beetles (Coleoptera: Scolytidae) in North California using regular and real-time PCR

    Treesearch

    Wolfgang Schweigkofler; William J. Otrosina; Sheri L. Smith; Daniel R. Cluck; Kevin Maeda; Kabir G. Peay; Matteo Garbelotto

    2005-01-01

    Black-stain root disease is a threat to conifer forests in western North America. The disease is caused by the ophiostomatoid fungus Leptographium wageneri (W.B. Kendr.) M.J. Wingf., which is associated with a number of bark beetle (Coleoptera: Scolytidae) and weevil species (Coleoptera: Curculionidae). We developed a polymerase chain reaction test...

  12. Human papillomavirus DNA detected in breast milk.

    PubMed

    Sarkola, Marja; Rintala, Marjut; Grénman, Seija; Syrjänen, Stina

    2008-06-01

    Human papillomavirus (HPV) testing of 223 breast milk samples 3 days postpartum was performed with polymerase chain reaction, hybridization, and sequencing. HPV-16-DNA was detected in 4.0% of the samples. HPV carriage in the breast milk was not correlated with mother's oral or cervical HPV-status or the demographic data. Oral HPV-infection of the spouse at month 6 and 12 postpartum was statistically significantly associated with HPV carriage in the breast milk.

  13. An evaluation of a rapid real time polymerase chain reaction assay for detection of group B streptococcus as part of a neonatal group B streptococcus prevention strategy.

    PubMed

    Money, Deborah; Dobson, Simon; Cole, Lesley; Karacabeyli, Eda; Blondel-Hill, Edith; Milner, Ruth; Thomas, Eva

    2008-09-01

    To evaluate the sensitivity, specificity, and feasibility of a rapid real-time polymerase chain reaction (PCR) test for group B streptococcus (GBS) completed during labour, compared with the standard culture test performed at 35 to 37 weeks' gestation. Women presenting to the maternity unit for term vaginal delivery had two vaginal/rectal samples collected. One swab was tested using a rapid PCR method (IDI-Strep B, Infectio Diagnostic [IDI] Inc., Sainte-Foy QC ), and the other was cultured after enrichment (intrapartum culture). Comparisons were made between these results and those of a culture-based screen at 35 to 37 weeks' gestation. Of the 190 women enrolled, 85% had results of the standard screen at 35 to 37 weeks available for comparison. The sensitivity and specificity of the standard 35- to 37-week screen were 84.3% (95% confidence interval [CI], 71.4-93.0) and 93.2% (95% CI 86.5-97.2) respectively, whereas the sensitivity and specificity of the rapid PCR were 90.7% (95% CI 79.7-96.9) and 97.6% (95% CI 93.1-99.5), respectively. The median reporting time for the rapid PCR test was 99 minutes (range 50-255). Results were available more than four hours before delivery in 81% of cases. In this Canadian centre, a rapid PCR test done at the time of labour (IDI-Strep B) demonstrated high sensitivity and specificity, comparable to the 35- to 37-week screen. The time to reporting results was acceptably short, allowing for timely administration of intrapartum prophylactic antibiotics.

  14. Validation of Geno-Sen's Scrub Typhus Real Time Polymerase Chain Reaction Kit by its Comparison with a Serological ELISA Test

    PubMed Central

    Anitharaj, Velmurugan; Stephen, Selvaraj; Pradeep, Jothimani; Pooja, Pratheesh; Preethi, Sridharan

    2017-01-01

    Background: In the recent past, scrub typhus (ST) has been reported from different parts of India, based on Weil-Felix/enzyme-linked immunosorbent assay (ELISA)/indirect immunofluorescence assay (IFA). Molecular tests are applied only by a few researchers. Aims: Evaluation of a new commercial real time polymerase chain reaction (PCR) kit for molecular diagnosis of ST by comparing it with the commonly used IgM ELISA is our aim. Settings and Design: ST has been reported all over India including Puducherry and surrounding Tamil Nadu and identified as endemic for ST. This study was designed to correlate antibody detection by IgM ELISA and Orientia tsutsugamushi DNA in real time PCR. Materials and Methods: ST IgM ELISA (InBios Inc., USA) was carried out for 170 consecutive patients who presented with the symptoms of acute ST during 11 months (November, 2015– September, 2016). All 77 of these patients with IgM ELISA positivity and 49 of 93 IgM ELISA negative patients were subjected to real time PCR (Geno-Sen's ST real time PCR, Himachal Pradesh, India). Statistical Analysis: Statistical analysis for clinical and laboratory results was performed using IBM SPSS Statistics 17 for Windows (SPSS Inc., Chicago, USA). Chi-square test with Yates correction (Fisher's test) was employed for a small number of samples. Results and Conclusion: Among 77 suspected cases of acute ST with IgM ELISA positivity and 49 IgM negative patients, 42 and 7 were positive, respectively, for O. tsutsugamushi 56-kDa type-specific gene in real time PCR kit. Until ST IFA, the gold standard diagnostic test, is properly validated in India, diagnosis of acute ST will depend on both ELISA and quantitative PCR. PMID:28878522

  15. Validation of Geno-Sen's Scrub Typhus Real Time Polymerase Chain Reaction Kit by its Comparison with a Serological ELISA Test.

    PubMed

    Anitharaj, Velmurugan; Stephen, Selvaraj; Pradeep, Jothimani; Pooja, Pratheesh; Preethi, Sridharan

    2017-01-01

    In the recent past, scrub typhus (ST) has been reported from different parts of India, based on Weil-Felix/enzyme-linked immunosorbent assay (ELISA)/indirect immunofluorescence assay (IFA). Molecular tests are applied only by a few researchers. Evaluation of a new commercial real time polymerase chain reaction (PCR) kit for molecular diagnosis of ST by comparing it with the commonly used IgM ELISA is our aim. ST has been reported all over India including Puducherry and surrounding Tamil Nadu and identified as endemic for ST. This study was designed to correlate antibody detection by IgM ELISA and Orientia tsutsugamushi DNA in real time PCR. ST IgM ELISA (InBios Inc., USA) was carried out for 170 consecutive patients who presented with the symptoms of acute ST during 11 months (November, 2015- September, 2016). All 77 of these patients with IgM ELISA positivity and 49 of 93 IgM ELISA negative patients were subjected to real time PCR (Geno-Sen's ST real time PCR, Himachal Pradesh, India). Statistical analysis for clinical and laboratory results was performed using IBM SPSS Statistics 17 for Windows (SPSS Inc., Chicago, USA). Chi-square test with Yates correction (Fisher's test) was employed for a small number of samples. Among 77 suspected cases of acute ST with IgM ELISA positivity and 49 IgM negative patients, 42 and 7 were positive, respectively, for O. tsutsugamushi 56-kDa type-specific gene in real time PCR kit. Until ST IFA, the gold standard diagnostic test, is properly validated in India, diagnosis of acute ST will depend on both ELISA and quantitative PCR.

  16. Babesia microti real-time polymerase chain reaction testing of Connecticut blood donors: potential implications for screening algorithms.

    PubMed

    Johnson, Stephanie T; Van Tassell, Eric R; Tonnetti, Laura; Cable, Ritchard G; Berardi, Victor P; Leiby, David A

    2013-11-01

    Babesia microti, an intraerythrocytic parasite, has been implicated in transfusion transmission. B. microti seroprevalence in Connecticut (CT) blood donors is approximately 1%; however, it is not known what percentage of donors is parasitemic and poses a risk for transmitting infection. Therefore, we determined the prevalence of demonstrable B. microti DNA in donors from a highly endemic area of CT and compared observed rates with concurrent immunofluorescence assay (IFA) testing results. Blood samples from consenting donors in southeastern CT were collected from mid-August through early October 2009 and tested by IFA for immunoglobulin G antibodies and real-time polymerase chain reaction (PCR) for B. microti DNA. IFA specificity was determined using blood donor samples collected in northwestern Vermont (VT), an area nonendemic for Babesia. Of 1002 CT donors, 25 (2.5%) were IFA positive and three (0.3%) were real-time PCR positive. Among the three real-time PCR-positive donors, two were also IFA positive, while one was IFA negative and may represent a window period infection. The two IFA- and real-time PCR-positive donors appeared to subsequently clear infection. The other real-time PCR-positive donor did not provide follow-up samples. Of 1015 VT donors tested by IFA, only one (0.1%) was positive, but may have acquired infection during travel to an endemic area. We prospectively identified several real-time PCR-positive blood donors, including an IFA-negative real-time PCR-positive donor, in an area highly endemic for B. microti. These results suggest the need to include nucleic acid testing in planned mitigation strategies for B. microti. © 2013 American Association of Blood Banks.

  17. Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

    USGS Publications Warehouse

    Taylor, P.W.; Winton, J.R.

    2002-01-01

    Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

  18. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    PubMed

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  19. Method for polymer synthesis in a reaction well

    DOEpatents

    Brennan, Thomas M.

    1998-01-01

    A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

  20. Method for polymer synthesis in a reaction well

    DOEpatents

    Brennan, T.M.

    1998-09-29

    A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

  1. Comparison between two commercially available serological tests and polymerase chain reaction in the diagnosis of Cryptosporidium in animals and diarrhoeic children.

    PubMed

    Helmy, Yosra A; Krücken, Jürgen; Nöckler, Karsten; von Samson-Himmelstjerna, Georg; Zessin, Karl-H

    2014-01-01

    For the detection of Cryptosporidium species in 804 animals and 165 diarrhoeic children (<10 years) in Egypt, two copro-antigen tests, the RIDASCREEN® Cryptosporidium test [enzyme immunoassay (EIA)] and the RIDA®QUICK Cryptosporidium/Giardia Combi [immuno-chromatographic test (ICT)] as well as polymerase chain reaction (PCR) were used. Prevalence of Cryptosporidium was 15.0, 19.5 and 32.3% in animals and 2.4, 6.7 and 49.1% in children using EIA, ICT and PCR, respectively.Using PCR as reference method, animal samples sensitivity (Se) of the EIA was 46.5% when questionable samples were considered positive, whereas specificity (Sp) was 100%. Se of the ICT was 60.4% while Sp was 100%. Positive predictive values (PPVs) for both EIA and ICT test were 100%, and negative predictive values (NPVs) for EIA were 79.7 and 84.1% for ICT. For the children samples, the Se of EIA was 5%, Sp was 100%, PPV was 100% and NPV was 52.2%, while the Se of ICT was 13.6%, Sp was 100%, PPV was 100% and NPV was 54.6%.The Kappa score of agreement between PCR and ICT was 67.4%, 54.1% between PCR and EIA and 84.4% between ICT and EIA. Until the second serial dilution of the EIA and ICT test, 9 × 10(3) oocysts/μl of Cryptosporidia was detected, whereas in PCR, they were detected until the sixth serial dilution. Copro-antigen tests were easy to perform and less time-consuming but less sensitive compared to PCR. They obviously are best applicable for screening and epidemiological studies of large numbers of subjects, for batch specimen processing and in isolated or rural areas where reliable tests like PCR are unfeasible. When in children, a single stool sample is used for the diagnosis of clinical cases; better results can be obtained when non-standardized PCR due low specificity is coupled with copro-antigen tests.

  2. The epidemiology of pertussis in the Australian Capital Territory, 1999 to 2005--epidemics of testing, disease or false positives?

    PubMed

    Wylks, Clare E; Ewald, Ben; Guest, Charles

    2007-12-01

    The increase in pertussis notifications since the 1990s in many countries, including Australia, has been attributed to improved diagnosis. This study aimed to describe the epidemiology of pertussis in the Australian Capital Territory from 1999 to 2005, determine whether the apparent changes could be accounted for by greater recognition and testing, and explore the impact of false positive serology results associated with faulty test kits. The Australian Capital Territory resident notification, laboratory and separation data from 1999 to 2005 were examined and the proportions of positive tests across time periods and age groups compared. Notification rates increased in the years 2000, 2003 and 2005. There was a shift in the age distribution of cases, from children and teenagers in 2000, to teenagers in 2003 and adults in 2005. Testing activity and notification activity were closely related. Comparing the epidemic periods to the preceding inter-epidemic periods, the proportion of positive tests was maintained or increased for all age groups combined and for adults and children (e.g. statistically significant increase from 7.8% to 14.0% in the 2005 epidemic in adults). During each epidemic the proportion of positive tests was statistically significantly higher in the age group with the highest notification activity. Despite similar testing rates in adults in 2003 and 2005, greater disease activity was reported in 2005. Although the numbers were small, polymerase chain reaction and culture positive test results increased in 2003 but not in 2005. The proportion of positive polymerase chain reaction results increased in 2003, providing strong evidence that the apparent epidemic of 2003 was due to a true increase in underlying disease activity. Because of the uncertainty surrounding the timing of the false positive serology results, the study provides weaker support for a true epidemic of pertussis in 2005.

  3. Impact of a rapid respiratory panel test on patient outcomes.

    PubMed

    Rogers, Beverly B; Shankar, Prabhu; Jerris, Robert C; Kotzbauer, David; Anderson, Evan J; Watson, J Renee; O'Brien, Lauren A; Uwindatwa, Francine; McNamara, Kelly; Bost, James E

    2015-05-01

    Evolution of polymerase chain reaction testing for infectious pathogens has occurred concurrent with a focus on value-based medicine. To determine if implementation of the FilmArray rapid respiratory panel (BioFire Diagnostics, Salt Lake City, Utah) (hereafter RRP), with a shorter time to the test result and expanded panel, results in different outcomes for children admitted to the hospital with an acute respiratory tract illness. Patient outcomes were compared before implementation of the RRP (November 1, 2011, to January 31, 2012) versus after implementation of the RRP (November 1, 2012, to January 31, 2013). The study included inpatients 3 months or older with an acute respiratory tract illness, most admitted through the emergency department. Testing before RRP implementation used batched polymerase chain reaction analysis for respiratory syncytial virus and influenza A and B, with additional testing for parainfluenza 1 through 3 in approximately 11% of patients and for human metapneumovirus in less than 1% of patients. The RRP tested for respiratory syncytial virus, influenza A and B, parainfluenza 1 through 4, human metapneumovirus, adenovirus, rhinovirus/enterovirus, and coronavirus NL62. The pre-RRP group had 365 patients, and the post-RRP group had 771 patients. After RRP implementation, the mean time to the test result was shorter (383 minutes versus 1119 minutes, P < .001), and the percentage of patients with a result in the emergency department was greater (51.6% versus 13.4%, P < .001). There was no difference in whether antibiotics were prescribed, but the duration of antibiotic use was shorter after RRP implementation (P = .003) and was dependent on receiving test results within 4 hours. If the test result was positive, the inpatient length of stay (P = .03) and the time in isolation (P = .03) were decreased after RRP implementation compared with before RRP implementation. The RRP decreases the duration of antibiotic use, the length of inpatient stay, and the time in isolation.

  4. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears

    PubMed Central

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. PMID:26556834

  5. Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

    Treesearch

    David E. Schreiber; Karen J. Garner; James M. Slavicek

    1997-01-01

    Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

  6. The Beta-Delayed Proton and Gamma Decay of 27P for Nuclear Astrophysics

    NASA Astrophysics Data System (ADS)

    McCleskey, E.; Banu, A.; McCleskey, M.; Roeder, B.; Saastamoinen, A.; Spiridon, A.; Trache, L.; Tribble, R. E.; Davinson, T.; Doherty, D.; Lotay, G. J.; Wallace, J.; Woods, P. J.

    2013-10-01

    The main creation site of 26Al is currently under debate. The reactions for its creation or destruction are also not completely known. When 26Al is created in novae, the reaction chain is: 24Mg(p,γ)25Al(β + v)25Mg(p,γ)26Al, but this chain can be by-passed by another chain: 25Al(p,γ)26Si(p,γ)27P and it can also be destroyed directly. Another way to by-pass it is through 26mAl(p,γ)27Si* which is dominated by resonant capture. Using the Momentum Achromat Recoil Spectrometer (MARS) at the Texas A&M Cyclotron Institute and inverse kinematics, this destruction reaction was studied by the beta-delayed proton and gamma decay of 27P. Due to selection rules, states populated above the proton threshold in the compound system (27Si*) can decay to 26mAl, which are the states of interest for the capture reaction. James Madison University, VA, USA.

  7. Molecular identification of Mango, Mangifera indica L.var. totupura

    PubMed Central

    Jagarlamudi, Sankar; G, Rosaiah; Kurapati, Ravi Kumar; Pinnamaneni, Rajasekhar

    2011-01-01

    Mango (>Mangifera indica) belonging to Anacardiaceae family is a fruit that grows in tropical regions. It is considered as the King of fruits. The present work was taken up to identify a tool in identifying the mango species at the molecular level. The chloroplast trnL-F region was amplified from extracted total genomic DNA using the polymerase chain reaction (PCR) and sequenced. Sequence of the dominant DGGE band revealed that Mangifera indica in tested leaves was Mangifera indica (100% similarity to the ITS sequences of Mangifera indica). This sequence was deposited in NCBI with the accession no. GQ927757. Abbreviations AFLP - Amplified fragment length polymorphism , cpDNA - Chloroplast DNA, DDGE - Denaturing gradient gel electrophoresis, DNA - Deoxyribo nucleic acid, EDTA - Ethylenediamine tetraacetic acid, HCl - Hydrochloric acid, ISSR - Inter simple sequence repeats, ITS - Internal transcribed spacer, MATAB - Methyl Ammonium Bromide, Na2SO3 - Sodium sulphite, NaCl - Sodium chloride, NCBI - National Centre for Biotechnology Information, PCR - Polymerase chain reaction, PEG - Polyethylene glycol, RAPD - Randomly amplified polymorphic DNA, trnL-F - Transfer RNA genes start codon- termination codon. PMID:21423885

  8. Polymerase chain reaction for screening clinical isolates of corynebacteria for the production of diphtheria toxin.

    PubMed

    Pallen, M J; Hay, A J; Puckey, L H; Efstratiou, A

    1994-04-01

    To assess the performance of the polymerase chain reaction (PCR) when used to screen rapidly large numbers of corynebacteria for toxin production; and to determine the incidence of false positive PCR results with non-toxigenic Corynebacterium diphtheriae isolates. Eighty seven recent British isolates of corynebacteria were assayed by PCR. All isolates were assayed from both blood and tellurite agar within a five day period. Thirty three non-toxigenic isolates of C diphtheriae from six countries were also tested by PCR and by the Elek immunodiffusion assay. There was complete concordance between the results of PCR and traditional methods on the recent British isolates, with one exception: an Elek positive "C ulcerans" isolate, which was PCR positive from tellurite but not from blood agar. One of the thirty three (3%) non-toxigenic isolates of C diphtheriae was PCR positive. These results suggest that PCR compares favourably with traditional methods for the detection of toxigenic corynebacteria and that it represents a powerful new tool in the diagnosis of an old disease.

  9. Polymerase chain reaction for screening clinical isolates of corynebacteria for the production of diphtheria toxin.

    PubMed Central

    Pallen, M J; Hay, A J; Puckey, L H; Efstratiou, A

    1994-01-01

    AIMS--To assess the performance of the polymerase chain reaction (PCR) when used to screen rapidly large numbers of corynebacteria for toxin production; and to determine the incidence of false positive PCR results with non-toxigenic Corynebacterium diphtheriae isolates. METHODS--Eighty seven recent British isolates of corynebacteria were assayed by PCR. All isolates were assayed from both blood and tellurite agar within a five day period. Thirty three non-toxigenic isolates of C diphtheriae from six countries were also tested by PCR and by the Elek immunodiffusion assay. RESULTS--There was complete concordance between the results of PCR and traditional methods on the recent British isolates, with one exception: an Elek positive "C ulcerans" isolate, which was PCR positive from tellurite but not from blood agar. One of the thirty three (3%) non-toxigenic isolates of C diphtheriae was PCR positive. CONCLUSIONS--These results suggest that PCR compares favourably with traditional methods for the detection of toxigenic corynebacteria and that it represents a powerful new tool in the diagnosis of an old disease. Images PMID:8027375

  10. Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis.

    PubMed

    Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J

    2016-01-01

    Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. © The American Society of Tropical Medicine and Hygiene.

  11. Rapid Identification of a Cooling Tower-Associated Legionnaires' Disease Outbreak Supported by Polymerase Chain Reaction Testing of Environmental Samples, New York City, 2014-2015.

    PubMed

    Benowitz, Isaac; Fitzhenry, Robert; Boyd, Christopher; Dickinson, Michelle; Levy, Michael; Lin, Ying; Nazarian, Elizabeth; Ostrowsky, Belinda; Passaretti, Teresa; Rakeman, Jennifer; Saylors, Amy; Shamoonian, Elena; Smith, Terry-Ann; Balter, Sharon

    2018-04-01

    We investigated an outbreak of eight Legionnaires' disease cases among persons living in an urban residential community of 60,000 people. Possible environmental sources included two active cooling towers (air-conditioning units for large buildings) <1 km from patient residences, a market misting system, a community-wide water system used for heating and cooling, and potable water. To support a timely public health response, we used real-time polymerase chain reaction (PCR) to identify Legionella DNA in environmental samples within hours of specimen collection. We detected L. pneumophila serogroup 1 DNA only at a power plant cooling tower, supporting the decision to order remediation before culture results were available. An isolate from a power plant cooling tower sample was indistinguishable from a patient isolate by pulsed-field gel electrophoresis, suggesting the cooling tower was the outbreak source. PCR results were available <1 day after sample collection, and culture results were available as early as 5 days after plating. PCR is a valuable tool for identifying Legionella DNA in environmental samples in outbreak settings.

  12. Human metapneumovirus-associated hospital admissions over five consecutive epidemic seasons: evidence for alternating circulation of different genotypes.

    PubMed

    Apostoli, Paola; Zicari, Sonia; Lo Presti, Alessandra; Ciccozzi, Massimo; Ciotti, Marco; Caruso, Arnaldo; Fiorentini, Simona

    2012-03-01

    Human metapneumovirus (hMPV) is a pathogen of the respiratory tract with a worldwide distribution. The purpose of this study was to identify hMPV as the cause of acute respiratory diseases in children admitted at Spedali Civili, a public hospital in Brescia, Italy. Eight hundred forty-six nasopharyngeal aspirate samples negative for the presence of other common respiratory viruses were tested for the presence of hMPV RNA by reverse transcription-polymerase chain reaction. Of the 846 samples, 79 (9.3%) were positive for hMPV. Polymerase chain reaction products, obtained by amplification of the partial nucleotide sequence of gene F, were sequenced and compared with sequences deposited in GenBank. All four hMPV subtypes were identified, including the proposed subtype A2 sublineages "A" and "B". In successive epidemic seasons, large outbreaks of hMPV alternated with small outbreaks in a biannual pattern. This local study provides further evidence that hMPV infection should be considered as a reason for hospital admission for acute respiratory disease in children. Copyright © 2012 Wiley Periodicals, Inc.

  13. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

    PubMed

    Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

    2017-01-01

    Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  14. Polymerase chain reaction in the detection of tumor cells: new approaches in diagnosis and follow-up of patients with thyroid cancer.

    PubMed

    Bojunga, Jörg; Kusterer, Klaus; Schumm-Draeger, Petra-Maria; Usadel, Klaus-Henning

    2002-12-01

    Thyroid cancers are the most common endocrine malignancies and are being diagnosed with increasing frequency. In addition to other measures, diagnosis is based on fine-needle aspiration cytology examination. Recently, new assays using reverse transcription-polymerase chain reaction (PCR) are being tested to improve sensitivity and specificity of primary diagnosis and detection of recurrent thyroid cancer. In the preoperative diagnosis of thyroid cancer, several tissue- and/or tumor-specific mRNA have been described and in several cases, a higher sensitivity and specificity could be achieved using molecular techniques compared to conventional methods. In the postoperative follow-up of patients with thyroid cancer, conflicting data have been published and the use of PCR techniques revealed several problems of the molecular approach, which are based on some technical as well as biologic limitations. Despite these problems, which are discussed in detail in this review, molecular techniques may nevertheless improve the sensitivity and accuracy of fine-needle aspiration of thyroid nodules, fine-needle aspiration of metastases, and detection of recurrent disease in peripheral blood samples.

  15. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.

  17. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics.

    PubMed

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-20

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  18. Detection and Identification of Psilocybe cubensis DNA Using a Real-Time Polymerase Chain Reaction High Resolution Melt Assay.

    PubMed

    Cowan, Ashley F; Elkins, Kelly M

    2017-12-01

    Psilocybe cubensis, or "magic mushroom," is the most common species of fungus with psychedelic characteristics. Two primer sets were designed to target Psilocybe DNA using web-based software and NBCI gene sequences. DNA was extracted from eighteen samples, including twelve mushroom species, using the Qiagen DNeasy ® Plant Mini Kit. The DNA was amplified by the polymerase chain reaction (PCR) using the primers and a master mix containing either a SYBR ® Green I, Radiant™ Green, or LCGreen Plus ® intercalating dye; amplicon size was determined using agarose gel electrophoresis. The PCR assays were tested for amplifiability, specificity, reproducibility, robustness, sensitivity, and multiplexing with primers that target marijuana. The observed high resolution melt (HRM) temperatures for primer sets 1 and 7 were 78.85 ± 0.31°C and 73.22 ± 0.61°C, respectively, using SYBR ® Green I dye and 81.67 ± 0.06°C and 76.04 ± 0.11°C, respectively, using Radiant™ Green dye. © 2017 American Academy of Forensic Sciences.

  19. Highly sensitive antibody-aptamer sensor for vascular endothelial growth factor based on hybridization chain reaction and pH meter/indicator.

    PubMed

    Xu, Huifeng; Kou, Fangxia; Ye, Hongzhi; Wang, Zongwen; Huang, Suixin; Liu, Xianxiang; Zhu, Xi; Lin, Zhenyu; Chen, Guonan

    2017-12-01

    Vascular endothelial growth factor (VEGF) is a crucial signaling protein for the tumor growth and metastasis, which is also acted as the biomarkers for various diseases. In this research, we fabricate an aptamer-antibody sensor for point-of-care test of VEGF. Firstly, target VEGF is captured by antibody immobilized on the microplate, and then binds with aptamer to form the sandwich structure. Next, with the assist of glucose oxidase (GOx)-functionalized ssDNAs, hybridization chain reaction occurs using the aptamer as the primer. Thus, GOx are greatly gathered on the microplate, which catalyzes the oxidization of glucose, leading to the pH change. As a result, the detect limit at a signal-to-noise was estimated to be 0.5pg/mL of target by pH meter, and 1.6pg/mL of VEGF was able to be distinguished by naked eyes. Meanwhile, this method has been used assay VEGF in the serum with the satisfactory results. Copyright © 2017. Published by Elsevier B.V.

  20. Recurrent uveitis in horses: vitreal examinations with ultrastructural detection of leptospires.

    PubMed

    Brandes, K; Wollanke, B; Niedermaier, G; Brem, S; Gerhards, H

    2007-06-01

    This study documents the examination of 17 horses (both sexes, 3-18 years old) suffering from spontaneous equine recurrent uveitis (ERU). Vitreal samples obtained by pars plana vitrectomy were examined macroscopically and ultrastructurally, and in most cases also by cultural examination, by microscopic agglutination test (MAT) and by polymerase chain reaction. In 24% (4/17) of the animals, ultrastructural examination by electron microscopy revealed intact leptospiral bacteria in the vitreous. The leptospires were detected freely in the vitreous and also incorporated by a phagocyte. They were surrounded by a rim of proteinaceous material which was reduced around a phagocytosed leptospira. Ninety-four per cent (16/17) of the vitreal samples presented significant antibody levels in the MAT, mostly against leptospiral serovar Grippotyphosa. Seventy-five per cent (9/12) of bacterial culture examinations were positive for leptospira. Polymerase chain reaction was positive in all (16/16) examinations performed. Our findings support previous reports suggesting that leptospires play an important role in the pathogenesis of ERU. Interestingly, this study found leptospires after secondary and later acute episodes. A persistent leptospiral infection is therefore suggested as the cause of ERU.

  1. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    NASA Astrophysics Data System (ADS)

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  2. Novel surface-active oligofructose fatty acid mono-esters by enzymatic esterification.

    PubMed

    van Kempen, Silvia E H J; Boeriu, Carmen G; Schols, Henk A; de Waard, Pieter; van der Linden, Erik; Sagis, Leonard M C

    2013-06-01

    This article describes the synthesis of a series of oligofructose monoesters with fatty acids of different chain length (C8, C12, C16 and C18) to obtain food-grade surfactants with a range of amphiphilicity. Reactions were performed in a mixture of DMSO/Bu(t)OH (10/90 v/v) at 60°C and catalysed by immobilised Candida antarctica lipase B. MALDI-TOF-MS analysis showed that the crude reaction products were mixtures of unmodified oligofructose and mostly mono-esters. The conversion into mono-esters increased with the length of the fatty acid chain, reflecting the specificity of the lipase towards more lipophilic substrates. Reverse phase solid phase extraction was used to fractionate the products, which lead to sufficient purity (>93%) of the fatty acid esters for functionality testing. It was shown that derivatives of longer (C16 and C18) fatty acids were more efficient in lowering surface tension and gave a much higher dilatational modulus than derivatives of the shorter (C8 and C12) fatty acids. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

    PubMed

    Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-07-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus surveillance.

  4. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection

    PubMed Central

    Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-01-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus surveillance. PMID:27380028

  5. Detection of Citrus leprosis virus C using specific primers and TaqMan probe in one-step real-time reverse-transcription polymerase chain reaction assays.

    PubMed

    Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H

    2015-11-01

    Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence. Published by Elsevier B.V.

  6. Identification of human antibody fragment clones specific for tetanus toxoid in a bacteriophage. lambda. immunoexpression library

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mullinax, R.L.; Gross, E.A.; Amberg, J.R.

    1990-10-01

    The authors have applied a molecular biology approach to the identification of human monoclonal antibodies. Human peripheral blood lymphocyte mRNA was converted to cDNA and a select subset was amplified by the polymerase chain reaction. These products, containing coding sequences for numerous immunoglobulin heavy- and {kappa} light-chain variable and constant region domains, were inserted into modified bacteriophase {lambda} expression vectors and introduced into Escherichia coli by infection to yield a combinatorial immunoexpression library. Clones with binding activity to tetanus toxoid were identified by filter hybridization with radiolabeled antigen and appeared at a frequency of 0.2{percent} in the library. These humanmore » antigen binding fragments, consisting of a heavy-chain fragment covalently linked to a light chain, displayed high affinity of binding to tetanus toxoid with equilibrium constants in the nanomolar range but did not cross-react with other proteins tested. They estimate that this human immunoexpression library contains 20,000 clones with high affinity and specificity to our chosen antigen.« less

  7. A HIV-1 heterosexual transmission chain in Guangzhou, China: a molecular epidemiological study.

    PubMed

    Han, Zhigang; Leung, Tommy W C; Zhao, Jinkou; Wang, Ming; Fan, Lirui; Li, Kai; Pang, Xinli; Liang, Zhenbo; Lim, Wilina W L; Xu, Huifang

    2009-09-25

    We conducted molecular analyses to confirm four clustering HIV-1 infections (Patient A, B, C & D) in Guangzhou, China. These cases were identified by epidemiological investigation and suspected to acquire the infection through a common heterosexual transmission chain. Env C2V3V4 region, gag p17/p24 junction and partial pol gene of HIV-1 genome from serum specimens of these infected cases were amplified by reverse transcription polymerase chain reaction (RT-PCR) and nucleotide sequenced. Phylogenetic analyses indicated that their viral nucleotide sequences were significantly clustered together (bootstrap value is 99%, 98% and 100% in env, gag and pol tree respectively). Evolutionary distance analysis indicated that their genetic diversities of env, gag and pol genes were significantly lower than non-clustered controls, as measured by unpaired t-test (env gene comparison: p < 0.005; gag gene comparison: p < 0.005; pol gene comparison: p < 0.005). Epidemiological results and molecular analyses consistently illustrated these four cases represented a transmission chain which dispersed in the locality through heterosexual contact involving commercial sex worker.

  8. Expected distributions of root-mean-square positional deviations in proteins.

    PubMed

    Pitera, Jed W

    2014-06-19

    The atom positional root-mean-square deviation (RMSD) is a standard tool for comparing the similarity of two molecular structures. It is used to characterize the quality of biomolecular simulations, to cluster conformations, and as a reaction coordinate for conformational changes. This work presents an approximate analytic form for the expected distribution of RMSD values for a protein or polymer fluctuating about a stable native structure. The mean and maximum of the expected distribution are independent of chain length for long chains and linearly proportional to the average atom positional root-mean-square fluctuations (RMSF). To approximate the RMSD distribution for random-coil or unfolded ensembles, numerical distributions of RMSD were generated for ensembles of self-avoiding and non-self-avoiding random walks. In both cases, for all reference structures tested for chains more than three monomers long, the distributions have a maximum distant from the origin with a power-law dependence on chain length. The purely entropic nature of this result implies that care must be taken when interpreting stable high-RMSD regions of the free-energy landscape as "intermediates" or well-defined stable states.

  9. Self-Assemblies of Single-Walled Carbon Nanotubes through Tunable Tethering of Pyrenes by Dextrin for Rapidly Chiral Sensing

    PubMed Central

    Wei, Wei-Li; Chen, Qiushui; Li, Haifang; Lin, Jin-Ming

    2011-01-01

    Pyrene-modified dextrin (Py-Dex) was synthesized via the Schiff base reaction between reducing end of dextrins and 1-aminopyrene, and then self-assemblies of single-walled carbon nanotubes (SWNTs) were fabricated through the tunable tethering of pyrene to SWNTs by dextrin chains. The Py-Dex-SWNTs assemblies were found to be significantly water-soluble because of the synergistic effect of dextrin chains and pyrene moieties. Py-Dex and Py-Dex-SWNTs were adequately characterized by NMR, UV-vis, fluorescence spectroscopy, Raman spectroscopy, matrix-assisted laser desorption/ionization-time of flight mass spectroscopy, and transmission electron microscopy. The tethering effect of dextrin toward pyrene moieties was clearly revealed and was found to be tunable by adjusting the length of dextrin chains. The fluorescence of pyrene moieties was sufficiently quenched by SWNTs with the support of dextrin chains. Furthermore, the Py-Dex-SWNTs assemblies were used for chiral selective sensing by introducing cyclodextrins as chiral binding sites. The rapid chiral sensing was successfully tested for different enantiomers. PMID:21811502

  10. Infectious optic neuropathies: a clinical update

    PubMed Central

    Kahloun, Rim; Abroug, Nesrine; Ksiaa, Imen; Mahmoud, Anis; Zeghidi, Hatem; Zaouali, Sonia; Khairallah, Moncef

    2015-01-01

    Different forms of optic neuropathy causing visual impairment of varying severity have been reported in association with a wide variety of infectious agents. Proper clinical diagnosis of any of these infectious conditions is based on epidemiological data, history, systemic symptoms and signs, and the pattern of ocular findings. Diagnosis is confirmed by serologic testing and polymerase chain reaction in selected cases. Treatment of infectious optic neuropathies involves the use of specific anti-infectious drugs and corticosteroids to suppress the associated inflammatory reaction. The visual prognosis is generally good, but persistent severe vision loss with optic atrophy can occur. This review presents optic neuropathies caused by specific viral, bacterial, parasitic, and fungal diseases. PMID:28539795

  11. DNA-Templated Polymerization of Side-Chain-Functionalized Peptide Nucleic Acid Aldehydes

    PubMed Central

    Kleiner, Ralph E.; Brudno, Yevgeny; Birnbaum, Michael E.; Liu, David R.

    2009-01-01

    The DNA-templated polymerization of synthetic building blocks provides a potential route to the laboratory evolution of sequence-defined polymers with structures and properties not necessarily limited to those of natural biopolymers. We previously reported the efficient and sequence-specific DNA-templated polymerization of peptide nucleic acid (PNA) aldehydes. Here, we report the enzyme-free, DNA-templated polymerization of side-chain-functionalized PNA tetramer and pentamer aldehydes. We observed that the polymerization of tetramer and pentamer PNA building blocks with a single lysine-based side chain at various positions in the building block could proceed efficiently and sequence-specifically. In addition, DNA-templated polymerization also proceeded efficiently and in a sequence-specific manner with pentamer PNA aldehydes containing two or three lysine side chains in a single building block to generate more densely functionalized polymers. To further our understanding of side-chain compatibility and expand the capabilities of this system, we also examined the polymerization efficiencies of 20 pentamer building blocks each containing one of five different side-chain groups and four different side-chain regio- and stereochemistries. Polymerization reactions were efficient for all five different side-chain groups and for three of the four combinations of side-chain regio- and stereochemistries. Differences in the efficiency and initial rate of polymerization correlate with the apparent melting temperature of each building block, which is dependent on side-chain regio- and stereochemistry, but relatively insensitive to side-chain structure among the substrates tested. Our findings represent a significant step towards the evolution of sequence-defined synthetic polymers and also demonstrate that enzyme-free nucleic acid-templated polymerization can occur efficiently using substrates with a wide range of side-chain structures, functionalization positions within each building block, and functionalization densities. PMID:18341334

  12. A specific transition state for S-peptide combining with folded S-protein and then refolding

    PubMed Central

    Goldberg, Jonathan M.; Baldwin, Robert L.

    1999-01-01

    We measured the folding and unfolding kinetics of mutants for a simple protein folding reaction to characterize the structure of the transition state. Fluorescently labeled S-peptide analogues combine with S-protein to form ribonuclease S analogues: initially, S-peptide is disordered whereas S-protein is folded. The fluorescent probe provides a convenient spectroscopic probe for the reaction. The association rate constant, kon, and the dissociation rate constant, koff, were both determined for two sets of mutants. The dissociation rate constant is measured by adding an excess of unlabeled S-peptide analogue to a labeled complex (RNaseS*). This strategy allows kon and koff to be measured under identical conditions so that microscopic reversibility applies and the transition state is the same for unfolding and refolding. The first set of mutants tests the role of the α-helix in the transition state. Solvent-exposed residues Ala-6 and Gln-11 in the α-helix of native RNaseS were replaced by the helix destabilizing residues glycine or proline. A plot of log kon vs. log Kd for this series of mutants is linear over a very wide range, with a slope of −0.3, indicating that almost all of the molecules fold via a transition state involving the helix. A second set of mutants tests the role of side chains in the transition state. Three side chains were investigated: Phe-8, His-12, and Met-13, which are known to be important for binding S-peptide to S-protein and which also contribute strongly to the stability of RNaseS*. Only the side chain of Phe-8 contributes significantly, however, to the stability of the transition state. The results provide a remarkably clear description of a folding transition state. PMID:10051587

  13. Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen

    NASA Astrophysics Data System (ADS)

    Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.

    2017-12-01

    The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.

  14. Additional chain-branching pathways in the low-temperature oxidation of branched alkanes

    DOE PAGES

    Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; ...

    2015-12-31

    Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C 8H 14O 4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C 8H 16O 5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C 8H 16O 5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O 2 addition, intramolecular isomerization, and OH release; C 8H 14O 4 species are proposed to result from subsequent reactions of C 8H 16O 5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less

  15. An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

    PubMed Central

    Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

    2005-01-01

    Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

  16. Excitation wavelength dependence of excited state intramolecular proton transfer reaction of 4'-N,N-diethylamino-3-hydroxyflavone in room temperature ionic liquids studied by optical Kerr gate fluorescence measurement.

    PubMed

    Suda, Kayo; Terazima, Masahide; Sato, Hirofumi; Kimura, Yoshifumi

    2013-10-17

    Excited state intramolecular proton transfer reactions (ESIPT) of 4'-N,N-diethylamino-3-hydroxyflavone (DEAHF) in ionic liquids have been studied by steady-state and time-resolved fluorescence measurements at different excitation wavelengths. Steady-state measurements show the relative yield of the tautomeric form to the normal form of DEAHF decreases as excitation wavelength is increased from 380 to 450 nm. The decrease in yield is significant in ionic liquids that have cations with long alkyl chains. The extent of the decrease is correlated with the number of carbon atoms in the alkyl chains. Time-resolved fluorescence measurements using optical Kerr gate spectroscopy show that ESIPT rate has a strong excitation wavelength dependence. There is a large difference between the spectra at a 200 ps delay from different excitation wavelengths in each ionic liquid. The difference is pronounced in ionic liquids having a long alkyl chain. The equilibrium constant in the electronic excited state obtained at a 200 ps delay and the average reaction rate are also correlated with the alkyl chain length. Considering the results of the steady-state fluorescence and time-resolved measurements, the excitation wavelength dependence of ESIPT is explained by state selective excitation due to the difference of the solvation, and the number of alkyl chain carbon atoms is found to be a good indicator of the effect of inhomogeneity for this reaction.

  17. A Motif in the Clathrin Heavy Chain Required for the Hsc70/Auxilin Uncoating Reaction

    PubMed Central

    Rapoport, Iris; Boll, Werner; Yu, Anan; Böcking, Till

    2008-01-01

    The 70-kDa heat-shock cognate protein (Hsc70) chaperone is an ATP-dependent “disassembly enzyme” for many subcellular structures, including clathrin-coated vesicles where it functions as an uncoating ATPase. Hsc70, and its cochaperone auxilin together catalyze coat disassembly. Like other members of the Hsp70 chaperone family, it is thought that ATP-bound Hsc70 recognizes the clathrin triskelion through an unfolded exposed hydrophobic segment. The best candidate is the unstructured C terminus (residues 1631–1675) of the heavy chain at the foot of the tripod below the hub, containing the sequence motif QLMLT, closely related to the sequence bound preferentially by the substrate groove of Hsc70 (Fotin et al., 2004b). To test this hypothesis, we generated in insect cells recombinant mammalian triskelions that in vitro form clathrin cages and clathrin/AP-2 coats exactly like those assembled from native clathrin. We show that coats assembled from recombinant clathrin are good substrates for ATP- and auxilin-dependent, Hsc70-catalyzed uncoating. Finally, we show that this uncoating reaction proceeds normally when the coats contain recombinant heavy chains truncated C-terminal to the QLMLT motif, but very inefficiently when the motif is absent. Thus, the QLMLT motif is required for Hsc-70–facilitated uncoating, consistent with the proposal that this sequence is a specific target of the chaperone. PMID:17978091

  18. On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

    NASA Astrophysics Data System (ADS)

    Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

    2015-07-01

    Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

  19. A Bullet-Block Experiment that Explains the Chain Fountain

    NASA Astrophysics Data System (ADS)

    Pantaleone, J.; Smith, R.

    2018-05-01

    It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.

  20. Well-Differentiated Papillary Mesothelioma of the Tunica Vaginalis: A Case Study and Review of the Literature

    PubMed Central

    Acikalin, Arbil; Zeren, Handan; Gonlusen, Gulfılız; Zorludemir, Suzan; Izol, Volkan

    2014-01-01

    Well-differentiated papillary mesothelioma is an uncommon tumor of the testes that usually presents as a hydrocele. Here, we present the case of one patient who did not have a history of asbestos exposure. The tumor was localized in the tunica vaginalis and was composed of three pedunculated masses macroscopically. Microscopically, branching papillary structures with focal coagulative necrosis were present. In addition to immunohistochemistry, simian virus 40 DNA was also tested by polymerase chain reaction. This report presents one case of this rare entity, its clinical and macroscopic features, and follow-up results. PMID:25013421

  1. Genetic traits of avascular necrosis of the femoral head analyzed by array comparative genomic hybridization and real-time polymerase chain reaction.

    PubMed

    Hwang, Jung-Taek; Baik, Seung-Ho; Choi, Jin-Soo; Lee, Kweon-Haeng; Rhee, Seung-Koo

    2011-01-03

    In an attempt to observe the genetic traits of avascular necrosis of the femoral head, we analyzed the genomic alterations in blood samples of 18 patients with avascular necrosis of the femoral head (9 idiopathic and 9 alcoholic cases) using the array comparative genomic hybridization method and real-time polymerase chain reaction. Several candidate genes were identified that may induce avascular necrosis of the femoral head, and we investigated their role in the pathomechanism of osteonecrosis of bone. The frequency of each candidate gene over all the categories of avascular necrosis of the femoral head was also calculated by real-time polymerase chain reaction. The highest frequency specific genes in each category were FLJ40296, CYP27C1, and CTDP1. FLJ40296 and CYP27C1 had the highest frequency (55.6%) in the idiopathic category. FLJ40296 had a high frequency (44.4%) in the alcoholic category, but CYP27C1 had a relatively low frequency (33.3%) in the alcoholic category. However, CTDP1 showed a significantly high frequency (55.6%) in the alcoholic category and a low frequency (22.2%) in the idiopathic category. Although we statistically analyzed the frequency of each gene with Fisher's exact test, we could not prove statistical significance due to the small number of samples. Further studies are needed with larger sample numbers. If the causal genes of avascular necrosis of the femoral head are found, they may be used for early detection, prognosis prediction, and genomic treatment of avascular necrosis of the femoral head in the future. Copyright 2011, SLACK Incorporated.

  2. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

    PubMed Central

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features. PMID:26579116

  3. Development of polymerase chain reaction-based diagnostic tests for detection of Malsoor virus & adenovirus isolated from Rousettus species of bats in Maharashtra, India.

    PubMed

    Shete, Anita M; Yadav, Pragya; Kumar, Vimal; Nikam, Tushar; Mehershahi, Kurosh; Kokate, Prasad; Patil, Deepak; Mourya, Devendra T

    2017-01-01

    Bats are recognized as important reservoirs for emerging infectious disease and some unknown viral diseases. Two novel viruses, Malsoor virus (family Bunyaviridae, genus, Phlebovirus) and a novel adenovirus (AdV) (family, Adenoviridae genus, Mastadenovirus), were identified from Rousettus bats in the Maharashtra State of India. This study was done to develop and optimize real time reverse transcription - polymerase chain reaction (RT-PCR) assays for Malsoor virus and real time and nested PCR for adenovirus from Rousettus bats. For rapid and accurate screening of Malsoor virus and adenovirus a nested polymerase chain reaction and TaqMan-based real-time PCR were developed. Highly conserved region of nucleoprotein gene of phleboviruses and polymerase gene sequence from the Indian bat AdV isolate polyprotein gene were selected respectively for diagnostic assay development of Malsoor virus and AdV. Sensitivity and specificity of assays were calculated and optimized assays were used to screen bat samples. Molecular diagnostic assays were developed for screening of Malsoor virus and AdV and those were found to be specific. Based on the experiments performed with different parameters, nested PCR was found to be more sensitive than real-time PCR; however, for rapid screening, real-time PCR can be used and further nested PCR can be used for final confirmation or in those laboratories where real-time facility/expertise is not existing. This study reports the development and optimization of nested RT-PCR and a TaqMan-based real-time PCR for Malsoor virus and AdV. The diagnostic assays can be used for rapid detection of these novel viruses to understand their prevalence among bat population.

  4. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food.

    PubMed

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

    2015-01-01

    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

  5. First report of Toxoplasma gondii sporulated oocysts and Giardia duodenalis in commercial green-lipped mussels (Perna canaliculus) in New Zealand.

    PubMed

    Coupe, Alicia; Howe, Laryssa; Burrows, Elizabeth; Sine, Abigail; Pita, Anthony; Velathanthiri, Niluka; Vallée, Emilie; Hayman, David; Shapiro, Karen; Roe, Wendi D

    2018-05-01

    Pollution of marine ecosystems with the protozoan parasites Toxoplasma gondii, Cryptosporidium spp. and Giardia duodenalis can be studied using bivalve shellfish as biosentinels. Although evidence suggests that these parasites are present in New Zealand coastal waters, the extent of protozoal pollution has not been investigated. This study used optimised molecular methods to detect the presence of Cryptosporidium spp., G. duodenalis and T. gondii in commercially sourced green-lipped mussel (Perna canaliculus), an endemic species found throughout coastal New Zealand. A nested polymerase chain reaction was validated for detection of T. gondii DNA and applied to 104 commercially sourced mussels. Thirteen mussels were positive for T. gondii DNA with an estimated true prevalence of 16.4% using Bayesian statistics, and the presence of T. gondii in mussels was significantly associated with collection during the summer compared with that in the winter (P = 0.003). Consumption of contaminated shellfish may also pose a health risk for humans and marine wildlife. As only sporulated T. gondii oocysts can be infectious, a reverse transcriptase-polymerase chain reaction was used to confirm presence of a sporozoite-specific marker (SporoSAG), detected in four mussels. G. duodenalis assemblage B, known to be pathogenic in humans, was also discovered in 1% mussels, tested by polymerase chain reaction (n = 90). Cryptosporidium spp. was not detected in the sampled mussel haemolymph. Results suggest that New Zealand may have high levels of coastal contamination with T. gondii, particularly in summer months, and that naturally exposed mussels can ingest and retain sporulated oocysts, further establishing shellfish consumption as a health concern.

  6. HIV RNA testing in the context of nonoccupational postexposure prophylaxis.

    PubMed

    Roland, Michelle E; Elbeik, Tarek A; Kahn, James O; Bamberger, Joshua D; Coates, Thomas J; Krone, Melissa R; Katz, Mitchell H; Busch, Michael P; Martin, Jeffrey N

    2004-08-01

    The specificity and positive predictive value of human immunodeficiency virus (HIV) RNA assays have not been evaluated in the setting of postexposure prophylaxis (PEP). Plasma from subjects enrolled in a nonoccupational PEP study was tested with 2 branched-chain DNA (bDNA) assays, 2 polymerase chain reaction (PCR) assays, and a transcription-mediated amplification (TMA) assay. Assay specificity and positive predictive value were determined for subjects who remained negative for HIV antibody for >or=3 months. In 329 subjects examined, the lowest specificities (90.1%-93.7%) were seen for bDNA testing performed in real time. The highest specificities were seen with batched bDNA version 3.0 (99.1%), standard PCR (99.4%), ultrasensitive PCR (100%), and TMA (99.6%) testing. Only the 2 assays with the highest specificities had positive predictive values >40%. For the bDNA assays, increasing the cutoff point at which a test is called positive (e.g., from 50 copies/mL to 500 copies/mL for version 3.0) increased both specificity and positive predictive values to 100%. The positive predictive value of HIV RNA assays in individuals presenting for PEP is unacceptably low for bDNA-based testing and possibly acceptable for PCR- and TMA-based testing. Routine use of HIV RNA assays in such individuals is not recommended.

  7. LCR testing for gonorrhoea and chlamydia in population surveys and other screenings of low prevalence populations: coping with decreased positive predictive value.

    PubMed

    Zenilman, J M; Miller, W C; Gaydos, C; Rogers, S M; Turner, C F

    2003-04-01

    Nucleic acid amplification tests have facilitated field based STD studies and increased screening activities. However, even with highly specific tests, the positive predictive value (PPV) of such tests may be lower than desirable in low prevalence populations. We estimated PPVs for a single LCR test in a population survey in which positive specimens were retested. The Baltimore STD and Behavior Survey (BSBS) was a population based behavioural survey of adults which included collecting urine specimens to assess the prevalence of gonorrhoea and chlamydial infection. Gonorrhoea and chlamydial infection were diagnosed by ligase chain reaction (LCR). Nearly all positive results were retested by LCR. Because of cost considerations, negative results were not confirmed. Predicted curves for the PPV were calculated for a single testing assuming an LCR test sensitivity of 95%, and test specificities in the range 95.0%-99.9%, for disease prevalences between 1% and 10%. Positive specimens were retested to derive empirical estimates of the PPV of a positive result on a single LCR test. 579 participants age 18-35 provided urine specimens. 20 (3.5%) subjects initially tested positive for chlamydial infection, and 39 (6.7%) tested positive for gonococcal infection. If positive results on the repeat LCR are taken as confirmation of a "true" infection, the observed PPV for the first LCR testing was 89.5% for chlamydial infection and 83.3% for gonorrhoea. This is within the range of theoretical PPVs calculated from the assumed sensitivities and specificities of the LCR assays. Empirical performance of a single LCR testing approximated the theoretically predicted PPV in this field study. This result demonstrates the need to take account of the lower PPVs obtained when such tests are used in field studies or clinical screening of low prevalence populations. Repeat testing of specimens, preferably with a different assay (for example, polymerase chain reaction), and disclosure of the non-trivial potential for false positive test results would seem appropriate in all such studies.

  8. Radiolysis of N-acetyl amino acids as model compounds for radiation degradation of polypeptides

    NASA Astrophysics Data System (ADS)

    Wayne Garrett, R.; Hill, David J. T.; Ho, Sook-Ying; O'Donnell, James H.; O'Sullivan, Paul W.; Pomery, Peter J.

    Radiation chemical yields of (i) the volatile radiolysis products and (ii) the trapped free radicals from the y-radiolysis of the N-acetyl derivatives of glycine, L-valine, L-phenylalanine and L-tyrosine in the polycrystalline state have been determined at room temperature (303 K). Carbon dioxide was found to be the major molecular product for all these compounds with G(CO 2) varying from 0.36 for N-acetyl-L-tyrosine to 8 for N-acetyl-L-valine. There was evidence for some scission of the N-C α bond, indicated by the production of acetamide and the corresponding aliphatic acid, but the determination reaction was found to be of much lesser importance than the decarboxylation reaction. A protective effect of the aromatic ring in N-acetyl-L-phenylalanine and in N-acetyl-L-tyrosine was indicated by the lower yields of volatile products for these compounds. The yields of trapped free radicals were found to vary with the nature of the amino acid side chain, increasing with chain length and chain branching. The radical yields were decreased by incorporation of an aromatic moiety in the side chain, this effect being greater for the tyrosyl side chain than for the phenyl side chain. The G(R·) values showed a good correlation with G(CO 2) indicating that a common reaction may be involved in radical production and carbon dioxide formation.

  9. Automation of laboratory testing for infectious diseases using the polymerase chain reaction-- our past, our present, our future.

    PubMed

    Jungkind, D

    2001-01-01

    While it is an extremely powerful and versatile assay method, polymerase chain reaction (PCR) can be a labor-intensive process. Since the advent of commercial test kits from Roche and the semi-automated microwell Amplicor system, PCR has become an increasingly useful and widespread clinical tool. However, more widespread acceptance of molecular testing will depend upon automation that allows molecular assays to enter the routine clinical laboratory. The forces driving the need for automated PCR are the requirements for diagnosis and treatment of chronic viral diseases, economic pressures to develop more automated and less expensive test procedures similar to those in the clinical chemistry laboratories, and a shortage in many areas of qualified laboratory personnel trained in the types of manual procedures used in past decades. The automated Roche COBAS AMPLICOR system has automated the amplification and detection process. Specimen preparation remains the most labor-intensive part of the PCR testing process, accounting for the majority of the hands-on-time in most of the assays. A new automated specimen preparation system, the COBAS AmpliPrep, was evaluated. The system automatically releases the target nucleic acid, captures the target with specific oligonucleotide probes, which become attached to magnetic beads via a biotin-streptavidin binding reaction. Once attached to the beads, the target is purified and concentrated automatically. Results of 298 qualitative and 57 quantitative samples representing a wide range of virus concentrations analyzed after the COBAS AmpliPrep and manual specimen preparation methods, showed that there was no significant difference in qualitative or quantitative hepatitis C virus (HCV) assay performance, respectively. The AmpliPrep instrument decreased the time required to prepare serum or plasma samples for HCV PCR to under 1 min per sample. This was a decrease of 76% compared to the manual specimen preparation method. Systems that can analyze more samples with higher throughput and that can answer more questions about the nature of the microbes that we can presently only detect and quantitate will be needed in the future.

  10. Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

    EPA Science Inventory

    The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

  11. Highly efficient preparation of selectively isotope cluster-labeled long chain fatty acids via two consecutive C(sp3)-C(sp3) cross-coupling reactions.

    PubMed

    Lethu, Sébastien; Matsuoka, Shigeru; Murata, Michio

    2014-02-07

    An efficient synthesis involving two copper-catalyzed alkyl-alkyl coupling reactions has been designed to easily access doubly isotope-labeled fatty acids. Such NMR- and IR-active compounds were obtained in excellent overall yields and will be further used for determining the conformation of an alkyl chain of lipidic biomolecules upon interaction with proteins.

  12. Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

    USDA-ARS?s Scientific Manuscript database

    This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

  13. Polymerase chain reaction with phase change as intrinsic thermal control

    NASA Astrophysics Data System (ADS)

    Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

    2013-04-01

    This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

  14. Photochemical reaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen) with basic amino acids and dipeptides.

    PubMed

    Suzuki, Tadashi; Shinoda, Mio; Osanai, Yohei; Isozaki, Tasuku

    2013-08-22

    Photoreaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen, KP) with basic amino acids (histidine, lysine, and arginine) and dipeptides (carnosine and anserine) including a histidine moiety in phosphate buffer solution (pH 7.4) has been investigated with transient absorption spectroscopy. With UV irradiation KP(-) gave rise to a carbanion through a decarboxylation reaction, and the carbanion easily abstracted a proton from the surrounding molecule to yield a 3-ethylbenzophenone ketyl biradical (EBPH). The dipeptides as well as the basic amino acids were found to accelerate the proton transfer reaction whereas alanine and glycine had no effect on the reaction, revealing that these amino acids having a protonated side chain act as a proton donor. The formation quantum yield of EBPH was estimated to be fairly large by means of an actinometrical method with benzophenone, and the bimolecular reaction rate constant for the proton transfer between the carbanion and the protonated basic amino acids or the protonated dipeptides was successfully determined. It has become apparent that the bimolecular reaction rate constant for the proton transfer depended on the acid dissociation constant for the side chain of the amino acids for the first time. This reaction mechanism was interpreted by difference of the heat of reaction for each basic amino acid based on the thermodynamical consideration. These results strongly suggest that the side chain of the basic amino acid residue in protein should play an important role for photochemistry of KP in vivo.

  15. FACTORS AFFECTING THE CHAIN LENGTH OF GROUP A STREPTOCOCCI

    PubMed Central

    Ekstedt, Richard D.; Stollerman, Gene H.

    1960-01-01

    Group A streptococci which grew in long chains in the presence of homologous anti-M antibody were split into their original length by the addition of an excess of homologous M protein to the culture. The chain-splitting reaction showed temperature and pH optima (37°C., 7.5) and was completely inhibited at 0°C. or by heat-killing the long chains at 56°C. prior to the addition of M protein. Addition of sublethal doses of HgCl2, or of penicillin, inhibited the chain-splitting reaction. Pneumococci behaved in entirely comparable fashion to streptococci in similar experiments. Virulent strains of streptococci formed the shortest chains when broth media was enriched with serum. The chain-shortening effect of serum enrichment of the media was most apparent with encapsulated strains and under cultural conditions that favored capsule formation. Loss of capsules by mutation or by unfavorable growth conditions resulted in increase in chain length. The activity of the chain-splitting mechanism seemed to be independent of M protein, however, since encapsulated M-negative variants also formed very short chain in serum-enriched media. The physical presence of the capsule was not essential for chain shortening since enzymatic removal of the capsule with hyaluronidase during growth did not affect chain length. These results strongly suggest that chain-splitting of streptococci and pneumococci occurs by an active metabolic mechanism, presumably enzymatic, which is inhibited by the union of surface antigens with specific antibody. PMID:13726267

  16. Assessing the influence of side-chain and main-chain aromatic benzyltrimethyl ammonium on anion exchange membranes.

    PubMed

    Li, Xiuhua; Nie, Guanghui; Tao, Jinxiong; Wu, Wenjun; Wang, Liuchan; Liao, Shijun

    2014-05-28

    3,3'-Di(4″-methyl-phenyl)-4,4'-difluorodiphenyl sulfone (DMPDFPS), a new monomer with two pendent benzyl groups, was easily prepared by Suzuki coupling reaction in high yield. A series of side-chain type ionomers (PAES-Qs) containing pendant side-chain benzyltrimethylammonium groups, which linked to the backbone by alkaline resisting conjugated C-C bonds, were synthesized via polycondensation, bromination, followed by quaternization and alkalization. To assess the influence of side-chain and main-chain aromatic benzyltrimethylammonium on anion exchange membranes (AEMs), the main-chain type ionomers (MPAES-Qs) with the same backbone were synthesized following the similar procedure. GPC and (1)H NMR results indicate that the bromination shows no reaction selectivity of polymer configurations and ionizations of the side-chain type polymers display higher conversions than that of the main-chain type ones do. These two kinds of AEMs were evaluated in terms of ion exchange capacity (IEC), water uptake, swelling ratio, λ, volumetric ion exchange capacity (IECVwet), hydroxide conductivity, mechanical and thermal properties, and chemical stability, respectively. The side-chain type structure endows AEMs with lower water uptake, swelling ratio and λ, higher IECVwet, much higher hydroxide conductivity, more robust dimensional stability, mechanical and thermal properties, and higher stability in hot alkaline solution. The side-chain type cationic groups containing molecular configurations have the distinction of being practical AEMs and membrane electrode assemblies of AEMFCs.

  17. Intact carbohydrate structures as part of the melanoidin skeleton.

    PubMed

    Cämmerer, Bettina; Jalyschko, Walentina; Kroh, Lothar W

    2002-03-27

    Model melanoidins from monomeric, oligomeric, and polymeric carbohydrates, and amino acids formed under aqueous as well as water-free reaction conditions, were submitted to acidic catalyzed hydrolysis. Their degradation products were detected qualitatively and quantitatively by HPTLC and HPLC-DAD. A considerable amount of monomer carbohydrates from hydrolysis of model melanoidins formed under water-free reaction conditions was detected. It can be seen clearly that the amount of carbohydrates released increased with increasing degree of polymerization of the carbohydrates used as starting material. In comparison, the hydrolysis of melanoidins formed in aqueous condition resulted in only a small glucose release. It seems that in the Maillard reaction under water-free conditions, a significant amount of di- and oligomer carbohydrates were incorporated into the melanoidin skeleton as complete oligomer with intact glycosidic bond, forming side chains at the melanoidin skeleton. Additional side chains could be formed by transglycosylation reactions. With increasing water content, hydrothermolytic as well as retro-aldol reactions of the starting carbonyl components became significant, and therefore the possibility of forming side chains decreased. The results are consistent with the postulated melanoidin structure being built up mainly from sugar degradation products, probably branched via amino compounds.

  18. Comprehensive Nuclear-Test-Ban Treaty: Issues and Arguments

    DTIC Science & Technology

    2008-03-12

    further fissions. “ Criticality ” is the point at which this chain reaction occurs; a “ critical mass ” is the amount of fissile material just enough to...support criticality . The amount of material for a critical mass depends on many factors, such as shape, density, impurities that absorb neutrons, and use...less than a critical mass of fissile material; as the amount of this material was stepped up toward criticality from one experiment to the next, some of

  19. Identification of a whitefly species by genomic and behavioral studies

    USGS Publications Warehouse

    Perring, T.M.; Cooper, A.D.; Rodriguez, R.J.; Farrar, C.A.; Bellows, T.S.

    1993-01-01

    An introduced whitefly species, responsible for over a half billion dollars in damage to U.S. agricultural production in 1991, is morphologically indistinguishable from Bemisia tabaci (Gennadius). However, with the use of polymerase chain reaction-based DNA differentiation tests, allozymic frequency analyses, crossing experiments, and mating behavior studies, the introduced whitefly is found to be a distinct species. Recognition of this new species, the silverleaf whitefly, is critical in the search for management options.

  20. Evaluation of Hepatitis B Virus Photoinactivation in Serum and Cellular Blood Components by the Polymerase Chain Reaction.

    DTIC Science & Technology

    1992-08-01

    and there is no test for the disease that has yet to be discovered. This situation occurred with the human immunodeficiency virus (HIV). This virus...antibodies to human immunodeficiency virus I (anti-HIV-1), antibodies to hepatitis C virus (anti-HCV), antibodies to hepatitis B core (anti-HBc) and a...photoinactivation have used model virus systems to measure the effectiveness of the inactivation procedure. These viruses include feline leukemia

  1. Laboratory Processes for Confirmation of Lymphogranuloma Venereum Infection During a 2015 Investigation of a Cluster of Cases in the United States.

    PubMed

    Kersh, Ellen N; Pillay, Allan; de Voux, Alex; Chen, Cheng

    2017-11-01

    In September 2015, the Centers for Disease Control and Prevention were notified of a suspected outbreak investigation of lymphogranuloma venereum (LGV) cases by the Michigan Department of Health and Human Services. The Centers for Disease Control and Prevention offered support with a laboratory-developed polymerase chain reaction test for LGV. This note describes the laboratory workflow and procedures used for the laboratory confirmation of LGV infection.

  2. Determination of Clinical and Demographic Predictors of Laboratory-confirmed Influenza with Subtype Analysis

    DTIC Science & Technology

    2012-06-07

    Advisory Committee on Immunization Practicies (ACIP). vol. 57th edition. Atlanta, GA: MMWR; 2008:1–59. 3. Cox NJ, Subbarao K : Influenza. Lancet 1999...to April 2008. Reverse-transcriptase polymerase chain reaction testing and viral culture for influenza A and B with subtyping were performed on all...REPORT unclassified b . ABSTRACT unclassified c. THIS PAGE unclassified Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18 RESEARCH

  3. Epidemic typhus meningitis in the southwestern United States.

    PubMed

    Massung, R F; Davis, L E; Slater, K; McKechnie, D B; Puerzer, M

    2001-03-15

    A patient residing in New Mexico had murine typhus diagnosed. A novel molecular assay was performed at the Centers for Disease Control and Prevention, and Rickettsia prowazekii, the agent of epidemic typhus, was found, rather than R. typhi. To our knowledge, this is the first reported case of epidemic typhus confirmed by means of polymerase chain reaction--based testing of cerebrospinal fluid, and it introduces a novel assay for the molecular diagnosis of both epidemic and murine typhus.

  4. Detection of hepatitis C virus subtypes 6a, 6n, 6w and mixed infections using a modified multiplex real-time polymerase chain reaction protocol.

    PubMed

    Lee, Yuan-Ming; Chen, Yen-Ju; Lee, Cheng-Ming; Kuo, Lou-Hui; Wong, Wing-Wai; Chen, Yi-Ming Arthur

    2011-12-01

    In the past few years, many new subtypes in hepatitis C virus (HCV) genotype 6 have been identified. The aim of this study was to modify the multiplex real-time polymerase chain reaction (RT-PCR) protocol and use it to determine the HCV subtypes of a group of Taiwanese injection drug users (IDUs). We used 76 serum specimens collected in northern Taiwan in 2008. Multiplex RT-PCR was used for HCV subtyping among those serum samples having anti-HCV antibodies. Twenty cases were randomly selected for comparison with subtyping results from Inno-LiPa II tests and phylogenetic tree analysis using NS5B sequences. Multiplex RT-PCR assays showed that 60.5% (46/76) of IDUs had single HCV infection. Three out of 76 (3.9%) had double HCV infection (1b/6a, 2a/2b and 2b/6a). Besides this, 27.6% (21/76) had no HCV signal. One IDU had subtype 6n and two had subtype 6w infection. Inno-LiPa II tests misclassified all 6n and 6w cases as 1b subtype. Our modified multiplex RT-PCR protocol can be used to support molecular epidemiological studies and laboratory diagnoses of different HCV subtypes including genotype 6. Copyright © 2011. Published by Elsevier B.V.

  5. Use of polymerase chain reaction for the detection of Chlamydia trachomatis in ocular and nasopharyngeal specimens from infants with conjunctivitis.

    PubMed

    Hammerschlag, M R; Roblin, P M; Gelling, M; Tsumura, N; Jule, J E; Kutlin, A

    1997-03-01

    Chlamydia trachomatis is the most common identifiable infectious cause of neonatal conjunctivitis. Nonculture tests including enzyme immunoassays and direct fluorescent antibody tests have been shown to perform well for the diagnosis of chlamydial conjunctivitis with sensitivities and specificities > or = 90%. However, the performance with respiratory specimens has been less than satisfactory. We compared a new, commercially available polymerase chain reaction (PCR) assay, Roche AMPLICOR (Roche Diagnostic Systems, Branchburg, NJ) with culture for the detection of C. trachomatis in conjunctival and nasopharyngeal specimens from infants with conjunctivitis. We also evaluated AMPLICOR for the detection of C. trachomatis in the urine of mothers of positive infants. Ocular and nasopharyngeal specimens from 75 infants with conjunctivitis were obtained for culture and PCR. AMPLICOR was equivalent to culture for eye specimens and more sensitive than culture for nasopharyngeal specimens. The sensitivity, specificity and positive and negative predictive values of PCR compared with culture for conjunctival specimens were 92.3, 100, 100 and 98.4%, respectively. The sensitivity, specificity and positive and negative predictive values for nasopharyngeal specimens were 100, 97.2, 60 and 100%, respectively. We also detected C. trachomatis by PCR in the urine of 12 mothers of culture positive infants. PCR performed comparably to culture for detection of C. trachomatis in conjunctival and nasopharyngeal specimens from infants with conjunctivitis.

  6. Detection of novel strains genetically related to Anaplasma platys in Tunisian one-humped camels (Camelus dromedarius).

    PubMed

    Belkahia, Hanène; Ben Said, Mourad; Sayahi, Lotfi; Alberti, Alberto; Messadi, Lilia

    2015-10-29

    Little information is currently available regarding the presence of Anaplasma species in North African dromedaries. To fill this gap in knowledge, the prevalence, risk factors, and genetic diversity of Anaplasma species were investigated in Tunisian dromedary camels. A total of 226 camels from three different bioclimatic areas were sampled and tested for the presence of Anaplasma species by quantitative polymerase chain reaction (qPCR) and nested polymerase chain reaction (nPCR) assays. Detected Anaplasma strains were characterized by 16S rRNA sequence analysis. Overall infection rate of Anaplasma spp. was 17.7%, and was significantly higher in females. Notably, A. marginale, A. centrale, A. bovis, and A. phagocytophilum were not detected. Animals were severely infested by three tick species belonging to the genus Hyalomma (H. dromedarii, H. impeltatum, and H. excavatum). Alignment, similarity comparison, and phylogenetic analysis of the 16S rRNA sequence variants obtained in this study suggest that Tunisian dromedaries are infected by more than one novel Anaplasma strain genetically related to A. platys. This study reports the presence of novel Anaplasma sp. strains genetically related to A. platys in dromedaries from various bioclimatic areas of Tunisia. Findings raise new concerns about the specificity of the direct and indirect diagnostic tests routinely used to detect different Anaplasma species in ruminants and provide useful molecular information to elucidate the evolutionary history of bacterial species related to A. platys.

  7. Signal-boosted qualitative ultrasensitive p24 antigen assay for diagnosis of subtype C HIV-1 infection in infants under the age of 2 years.

    PubMed

    Zijenah, Lynn S; Tobaiwa, Ocean; Rusakaniko, Simbarashe; Nathoo, Kusum J; Nhembe, Margaret; Matibe, Petronella; Katzenstein, David A

    2005-08-01

    The gold standard for diagnosis of HIV-1 infection in infants under the age of 2 years is DNA or reverse transcriptase polymerase chain reaction. However, these tests are expensive and therefore not available in resource-limited countries. With the increasing availability of antiretroviral drugs for prevention of mother-to-child transmission of HIV and treatment of AIDS in resource-poor countries, there is an urgent need to develop cheaper, alternative, and cost-effective laboratory methods for early diagnosis of infant HIV-1 infection that will be useful in identifying infected infants who may benefit from early cotrimoxazole prophylaxis or commencement of antiretroviral therapy. We evaluated an alternative method, the enzyme-linked immunosorbent assay-based qualitative ultrasensitive p24 antigen assay for diagnosis of subtype C HIV-1 infection in infants under the age of 2 years using DNA polymerase chain reaction as the reference method. The assay showed a sensitivity of 96.7% (95% CI: 93.0-100) for detection of HIV-1 infection among infants 0-18 months of age with a specificity of 96.1% (95% CI: 91.7-100). These evaluated parameters were not statistically different between infants aged 0-6 and 7-18 months. The ultrasensitive p24 antigen assay is a useful diagnostic test for detection of HIV-1 infection among infants aged 0-18 months.

  8. Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter with application of high-processivity polymerase and novel internal amplification controls for rapid and specific detection.

    PubMed

    Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S

    2012-02-01

    Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications. Published by Elsevier Inc.

  9. Development of a polymerase chain reaction assay for the rapid detection of the oral pathogenic bacterium, Selenomonas noxia.

    PubMed

    Cruz, Patricia; Mehretu, Arthuro M; Buttner, Mark P; Trice, Theresa; Howard, Katherine M

    2015-08-14

    In recent studies, periodontal health has been linked to being overweight and/or obese. Among common oral bacteria, Selenomonas noxia has been implicated in converting periodontal health to disease, and Selenomonas species have also been found in gastric ulcers. The objective of this study was to develop and validate a quantitative polymerase chain reaction (qPCR) assay for the specific and rapid detection of S. noxia. Two oligonucleotide primer pairs and one probe were designed and tested to determine optimal amplification signal with three strains of S. noxia. The PCR assay was tested against fourteen non-target organisms, including closely related oral Selenomonads, one phylogenetically closely related bacterium, and two commonly isolated oral bacteria. One of the primer sets was more sensitive at detecting the target organism and was selected for optimization and validation experiments. The designed primers and probe amplified the target organism with 100% specificity. PCR inhibition was observed with an internal positive control, and inhibition was resolved by diluting the DNA extract. The qPCR assay designed in this study can be used to specifically detect S. noxia in the clinical setting and in future research involving the enhanced detection of S. noxia. The assay can also be used in epidemiological studies for understanding the role of S. noxia in disease processes including, but not limited to, oral health and obesity of infectious origin.

  10. METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM

    DOEpatents

    Fermi, E.; Leverett, M.C.

    1957-11-12

    This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.

  11. Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

    NASA Technical Reports Server (NTRS)

    Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

    1998-01-01

    Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

  12. The usefulness of direct agglutination test, enzyme-linked immunosorbent assay and polymerase chain reaction for the detection of Toxoplasma gondii in wild animals.

    PubMed

    Kornacka, Aleksandra; Cybulska, Aleksandra; Bień, Justyna; Goździk, Katarzyna; Moskwa, Bożena

    2016-09-15

    The aim of the study was to compare the usefulness of two antibody-based methods, the direct agglutination test (DAT) and enzyme linked immuosorbent assay (ELISA), with that of the polymerase chain reaction (PCR) for detecting anti-Toxoplasma gondii in samples derived from naturally-infected wild animals. Antibodies against T. gondii were detected in meat juice samples collected from 129 free- living carnivores and omnivores. T. gondii seroprevalence was confirmed in 73,6% of examined samples when DAT and ELISA were used separately, but in only 88,4% samples when both immunological tests were used in parallel. PCR results confirmed the presence of DNA of the parasite in 24 of all the 129 samples. Sixteen samples were classified as positive when all three tests were used. A moderate degree of agreement was found between DAT and ELISA (κ=0.55). However, no agreement was found between the molecular and serological tests: κ=-1.75 for DAT versus PCR; κ=-1.67 ELISA versus PCR. By using both serological tests, antibodies against T. gondii were found in 77.5% of red foxes, 12.5% of badgers, 40% of martens and 8.3% of raccoon dogs. Antibodies against the parasite were detected also in one mink, but not in the sample derived from a polecat. T.gondii DNA was found in the brain tissue of 20 red foxes, three badgers and one raccoon dog. Our studies confirm that ELISA and DAT are suitable and reliable techniques for T. gondii antibody detection in meat juice from wild animals when serum samples are unavailable. Positive results obtained by immunological tests do not always reflect that the host was infected by T. gondii. They indicate only a contact with parasite. PCR should be used to confirm te presence of DNA from T. gondii. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Maillard reaction versus other nonenzymatic modifications in neurodegenerative processes.

    PubMed

    Pamplona, Reinald; Ilieva, Ekaterina; Ayala, Victoria; Bellmunt, Maria Josep; Cacabelos, Daniel; Dalfo, Esther; Ferrer, Isidre; Portero-Otin, Manuel

    2008-04-01

    Nonenzymatic protein modifications are generated from direct oxidation of amino acid side chains and from reaction of the nucleophilic side chains of specific amino acids with reactive carbonyl species. These reactions give rise to specific markers that have been analyzed in different neurodegenerative diseases sharing protein aggregation, such as Alzheimer's disease, Pick's disease, Parkinson's disease, dementia with Lewy bodies, Creutzfeldt-Jakob disease, and amyotrophic lateral sclerosis. Collectively, available data demonstrate that oxidative stress homeostasis, mitochondrial function, and energy metabolism are key factors in determining the disease-specific pattern of protein molecular damage. In addition, these findings suggest the lack of a "gold marker of oxidative stress," and, consequently, they strengthen the need for a molecular dissection of the nonenzymatic reactions underlying neurodegenerative processes.

  14. Intramolecular Benzoin Reaction Catalyzed by Benzaldehyde Lyase from Pseudomonas Fluorescens Biovar I.

    PubMed

    Hernández, Karel; Parella, Teodor; Petrillo, Giovanna; Usón, Isabel; Wandtke, Claudia M; Joglar, Jesús; Bujons, Jordi; Clapés, Pere

    2017-05-02

    Intramolecular benzoin reactions catalyzed by benzaldehyde lyase from Pseudomonas fluorescens biovar I (BAL) are reported. The structure of the substrates envisaged for this reaction consists of two benzaldehyde derivatives linked by an alkyl chain. The structural requirements needed to achieve the intramolecular carbon-carbon bond reaction catalyzed by BAL were established. Thus, a linker consisting of a linear alkyl chain of three carbon atoms connected through ether-type bonds to the 2 and 2' positions of two benzaldehyde moieties, which could be substituted with either Cl, Br, or OCH 3 at either the 3 and 3' or 5 and 5' positions, were suitable substrates for BAL. Reactions with 61-84 % yields of the intramolecular product and ee values between 64 and 98 %, were achieved. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Preemptive Isolation Precautions of Patients at High Risk for Methicillin-Resistant Staphylococcus aureus in Combination With Ultrarapid Polymerase Chain Reaction Screening as an Effective Tool for Infection Control.

    PubMed

    Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael

    2016-12-01

    This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.

  16. Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

    PubMed Central

    Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

    2006-01-01

    Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

  17. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    PubMed

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence. © The American Society of Tropical Medicine and Hygiene.

  18. Synthesis of Side-Chain Oxysterols and their Enantiomers through Cross-Metathesis Reactions of Δ22 Steroids

    PubMed Central

    Brownholland, David P.

    2017-01-01

    A synthetic route that utilizes a cross-metathesis reaction with Δ22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. PMID:28300584

  19. METHOD OF OPERATING NUCLEAR REACTORS

    DOEpatents

    Untermyer, S.

    1958-10-14

    A method is presented for obtaining enhanced utilization of natural uranium in heavy water moderated nuclear reactors by charging the reactor with an equal number of fuel elements formed of natural uranium and of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction. The reactor is operated until the rate of burnup of plutonium equals its rate of production, the fuel elements are processed to recover plutonium, the depleted uranium is discarded, and the remaining uranium is formed into fuel elements. These fuel elements are charged into a reactor along with an equal number of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction, and reuse of the uranium is continued as aforesaid until it wlll no longer support a chain reaction when combined with an equal quantity of natural uranium.

  20. Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

    PubMed

    Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

    1997-09-01

    In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

  1. Analysis of self-oscillating behaviors aimed at the development of a molecular robot with organic acids as fuel

    NASA Astrophysics Data System (ADS)

    Nakazumi, Tomoka; Hara, Yusuke

    2017-09-01

    We studied the transmittance self-oscillation of a polymer chain driven by an organic acid as the fuel. The self-oscillating polymer chain consists of 4-acryloylmorpholine (ACMO) and the Ru catalyst (Ru(bpy)3) of the Belousov-Zhabotinsky (BZ) reaction. The transmittance self-oscillating behavior was affected significantly by the temperature. As the amplitude of the transmittance self-oscillation, which is reflected by the aggregation state, decreased with time, the oscillation period also decreased. This trend indicates that the polymer aggregation affects the rate of the BZ reaction significantly. The activation energy of the self-oscillating value was almost the same in the normal BZ reaction, which does not include Ru(bpy)3 complexes in the polymer chains. In addition, we demonstrated the effect of one BZ substrate (sodium bromate or malonic acid) on the transmittance self-oscillation period.

  2. Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

    PubMed

    Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

    2001-03-01

    A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

  3. Initiator and Photocatalyst-Free Visible Light Induced One-Pot Reaction: Concurrent RAFT Polymerization and CuAAC Click Reaction.

    PubMed

    Wang, Jie; Wang, Xinbo; Xue, Wentao; Chen, Gaojian; Zhang, Weidong; Zhu, Xiulin

    2016-05-01

    A new, visible light-catalyzed, one-pot and one-step reaction is successfully employed to design well-controlled side-chain functionalized polymers, by the combination of ambient temperature revisible addtion-fragmentation chain transfer (RAFT) polymerization and click chemistry. Polymerizations are well controlled in a living way under the irradiation of visible light-emitting diode (LED) light without photocatalyst and initiator, using the trithiocarbonate agent as iniferter (initiator-transfer agent-terminator) agent at ambient temperature. Fourier transfer infrared spectroscopy (FT-IR), NMR, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) data confirm the successful one-pot reaction. Compared to the reported zero-valent metal-catalyzed one-pot reaction, the polymerization rate is much faster than that of the click reaction, and the visible light-catalyzed one-pot reaction can be freely and easily regulated by turning on and off the light. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. [Application of transcription mediated amplification and real-time reverse transcription polymerase chain reaction in detection of human immunodeficiency virus RNA].

    PubMed

    Wu, Daxian; Tao, Shuhui; Liu, Shuiping; Zhou, Jiebin; Tan, Deming; Hou, Zhouhua

    2017-07-28

    To observe the sensitivity of transcription mediated amplification (TMA), and to compare its performance with real-time reverse transcription polymerase chain reaction (real-time RT-PCR) in detecting human immunodeficiency virus RNA (HIV RNA).
 Methods: TMA system was established with TaqMan probes, specific primers, moloney murine leukemia virus (MMLV) reverse transcriptase, T7 RNA polymerase, and reaction substrates. The sensitivity of TMA was evaluated by amplifying a group of 10-fold diluted HIV RNA standards which were transcribed in vitro. A total of 60 plasma of HIV infected patients were measured by TMA and Cobas Amplicor HIV-1 Monitor test to observe the positive rate. The correlation and concordance of the above two technologies were investigated by linear regression and Bland-Altman analysis.
 Results: TMA system was established successfully and HIV RNA transcribed standards at concentration of equal or more than 10 copies/mL could be detected by TMA technology. Among 60 samples of plasma from HIV infected patients, 46 were positively detected and 12 were negatively amplified by both TMA and Cobas reagents; 2 samples were positively tested by Cobas reagent but negatively tested by TMA system. The concordance rate of the two methods was 97.1% and the difference of positive detection rate between the two methods was not statistically significant (P>0.05). Linear regression was used for 46 samples which were positively detected by both TMA and Cobas reagents and showed an excellent correlation between the two reagents (r=0.997, P<0.001). Bland-Altma analysis revealed that the mean different value of HIV RNA levels for denary logarithm was 0.02. Forty-four samples were included in 95% of credibility interval of concordance.
 Conclusion: TMA system has the potential of high sensitivity. TMA and real-time RT-PCR keep an excellent correlation and consistency in detecting HIV RNA.

  5. A multisite assessment of the quantitative capabilities of the Xpert MTB/RIF assay.

    PubMed

    Blakemore, Robert; Nabeta, Pamela; Davidow, Amy L; Vadwai, Viral; Tahirli, Rasim; Munsamy, Vanisha; Nicol, Mark; Jones, Martin; Persing, David H; Hillemann, Doris; Ruesch-Gerdes, Sabine; Leisegang, Felicity; Zamudio, Carlos; Rodrigues, Camilla; Boehme, Catharina C; Perkins, Mark D; Alland, David

    2011-11-01

    The Xpert MTB/RIF is an automated molecular test for Mycobacterium tuberculosis that estimates bacterial burden by measuring the threshold-cycle (Ct) of its M. tuberculosis-specific real-time polymerase chain reaction. Bacterial burden is an important biomarker for disease severity, infection control risk, and response to therapy. Evaluate bacterial load quantitation by Xpert MTB/RIF compared with conventional quantitative methods. Xpert MTB/RIF results were compared with smear-microscopy, semiquantiative solid culture, and time-to-detection in liquid culture for 741 patients and 2,008 samples tested in a multisite clinical trial. An internal control real-time polymerase chain reaction was evaluated for its ability to identify inaccurate quantitative Xpert MTB/RIF results. Assays with an internal control Ct greater than 34 were likely to be inaccurately quantitated; this represented 15% of M. tuberculosis-positive tests. Excluding these, decreasing M. tuberculosis Ct was associated with increasing smear microscopy grade for smears of concentrated sputum pellets (r(s) = -0.77) and directly from sputum (r(s) =-0.71). A Ct cutoff of approximately 27.7 best predicted smear-positive status. The association between M. tuberculosis Ct and time-to-detection in liquid culture (r(s) = 0.68) and semiquantitative colony counts (r(s) = -0.56) was weaker than smear. Tests of paired same-patient sputum showed that high viscosity sputum samples contained ×32 more M. tuberculosis than nonviscous samples. Comparisons between the grade of the acid-fast bacilli smear and Xpert MTB/RIF quantitative data across study sites enabled us to identify a site outlier in microscopy. Xpert MTB/RIF quantitation offers a new, standardized approach to measuring bacterial burden in the sputum of patients with tuberculosis.

  6. A nested polymerase chain reaction for the detection of genomic DNA of Myxobolus cerebralis in rainbow trout Oncorhynchus mykiss.

    PubMed

    Andree, K B; MacConnell, E; Hedrick, R P

    1998-10-08

    A nested polymerase chain reaction (PCR) test was developed to amplify a segment of the 18S rRNA gene from Myxobolus cerebralis, the agent causing whirling disease in salmonid fish. The PCR amplifies a 415 bp amplicon that was identified by dideoxynucleotide terminated sequencing to be identical to the known 18S rDNA sequence of M. cerebralis. There was no amplification of genomic DNA from 4 other myxosporean parasites of salmonid fish from the genus Myxobolus including M. arcticus, M. insidiosus, M. neurobius, and M. squamalis. The efficacy of the PCR test to detect early infections was demonstrated by amplification of the 415 bp fragment from experimentally exposed rainbow trout Oncorhynchus mykiss at 2 h and at 1, 2, and 3 wk postexposure to actinosporean stages (triactinomyxons) of M. cerebralis. In contrast, standard microscopic examinations of stained tissue sections of the same fish used for PCR were less reliable in detecting the presence of the parasite. Additional examinations of fish 5 mo postexposure, after sporogenesis had occurred, found the PCR to be a more reliable indicator of infection than pepsin-trypsin digest (PTD) method, particularly when trout were experimentally exposed to low levels of the infectious stages of the parasite. The PCR was able to amplify to detectable levels the equivalent of a single sporoplasm of M. cerebralis as found in a tissue sample. This test improves the detection of M. cerebralis because it can detect the presence of the parasite: (1) in both hosts, (2) in all known stages of its life cycle, and (3) at lower thresholds than currently used diagnostic methods. Lastly, the PCR test is less susceptible to morphological misidentifications of the spores that can occur with current microscopic procedures.

  7. Development and validation of a Pneumocystis jirovecii real-time polymerase chain reaction assay for diagnosis of Pneumocystis pneumonia

    PubMed Central

    Church, Deirdre L; Ambasta, Anshula; Wilmer, Amanda; Williscroft, Holly; Ritchie, Gordon; Pillai, Dylan R; Champagne, Sylvie; Gregson, Daniel G

    2015-01-01

    BACKGROUND: Pneumocystis jirovecii (PJ), a pathogenic fungus, causes severe interstitial Pneumocystis pneumonia (PCP) among immunocompromised patients. A laboratory-developed real-time polyermase chain reaction (PCR) assay was validated for PJ detection to improve diagnosis of PCP. METHODS: Forty stored bronchoalveolar lavage (BAL) samples (20 known PJ positive [PJ+] and 20 known PJ negative [PJ−]) were initially tested using the molecular assay. Ninety-two sequentially collected BAL samples were then analyzed using an immunofluorescence assay (IFA) and secondarily tested using the PJ real-time PCR assay. Discrepant results were resolved by retesting BAL samples using another real-time PCR assay with a different target. PJ real-time PCR assay performance was compared with the existing gold standard (ie, IFA) and a modified gold standard, in which a true positive was defined as a sample that tested positive in two of three methods in a patient suspected to have PCP. RESULTS: Ninety of 132 (68%) BAL fluid samples were collected from immunocompromised patients. Thirteen of 92 (14%) BALs collected were PJ+ when tested using IFA. A total of 40 BAL samples were PJ+ in the present study including: all IFA positive samples (n=13); all referred PJ+ BAL samples (n=20); and seven additional BAL samples that were IFA negative, but positive using the modified gold standard. Compared with IFA, the PJ real-time PCR had sensitivity, specificity, and positive and negative predictive values of 100%, 91%, 65% and 100%, respectively. Compared with the modified gold standard, PJ real-time PCR had a sensitivity, specificity, and positive and negative predictive values of 100%. CONCLUSION: PJ real-time PCR improved detection of PJ in immunocompromised patients. PMID:26600815

  8. Visible-Light Actinometry and Intermittent Illumination as Convenient Tools to Study Ru(bpy)3Cl2 Mediated Photoredox Transformations

    PubMed Central

    Pitre, Spencer P.; McTiernan, Christopher D.; Vine, Wyatt; DiPucchio, Rebecca; Grenier, Michel; Scaiano, Juan C.

    2015-01-01

    Photoredox catalysis provides many green opportunities for radical-mediated synthetic transformations. However, the determination of the underlying mechanisms has been challenging due to lack of quantitative methods that can be easily implemented in synthetic labs, where this research tends to be centered. We report here on the development, characterization and calibration of a novel actinometer based on the photocatalyst tris(2,2′-bipyridyl)ruthenium(II) chloride (Ru(bpy)3Cl2). By using the same molecule as the photocatalyst and the actinometer, we eliminate problems associated with matching sample spectral distribution, lamp-sample spectral overlap and other problems intrinsic to doing quantitative photochemistry in a laboratory that has little expertise in this area. In order to validate our actinometer system in determining the quantum yield of a Ru(bpy)3Cl2 photosensitized reaction, we test the Ru(bpy)3Cl2 catalyzed oxidation of benzhydrol to benzophenone as a model chain reaction. We also revive the rotating sector method by updating the technique for modern LED technologies and demonstrate how intermittent illumination on the timescale of milliseconds to seconds can help probe a chain reaction, using the benzhydrol to benzophenone oxidation to validate the technique. We envision these methods to have great implications in the field of photoredox catalysis, providing researchers with valuable research tools. PMID:26578341

  9. Polycyclic aromatic hydrocarbons - Primitive pigment systems in the prebiotic environment

    NASA Technical Reports Server (NTRS)

    Deamer, D. W.

    1992-01-01

    The chemical evolution of meteoritic organics in the primitive earth is examined experimentally with attention given to the photochemical effects of hydrocarbon/water mixtures. Also addressed are the generation of amphiphilic products by photochemical reactions and the transduction of light energy into potentially useful forms. Polycyclic aromatic hydrocarbons (PAHs) absorb light and exist in carbonaceous chondrites; PAHs are therefore examined as primitive pigments by means of salt solutions with pyrene, fluoranthene, and pyrene derivatives with hexadecane. The hexadecane undergoes photochemical oxidation and yields long-chain amphiphiles with oxygen supplied by water, and acid pH shifts also occur. PAHs are also tested in lipid bilayer membranes to examine light-energy transduction. Protons are found to accumulate within the membrane-bounded volume to form proton gradients, and this reaction is theorized to be a good model of primitive photochemical reactions that related to the transduction of light energy into useable forms.

  10. T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

    PubMed

    Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

    2012-01-01

    Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

  11. Chain photoreduction of CCl3F in TiO2 suspensions: enhancement induced by O2.

    PubMed

    Winkelmann, Kurt; Calhoun, Robert L; Mills, German

    2006-12-28

    Trichlorofluoromethane (CFC 11) was photoreduced in aqueous suspensions of TiO2 particles containing HCO2- ions and air. Dissolved O2 inhibited the reaction during an induction period that preceded the rapid formation of chloride ions. Reaction rates were higher in systems containing O2 as compared to analogous reactions that occurred in anaerobic suspensions. High photonic efficiencies of Cl- formation (> or =15) were achieved using suspensions with pH > or = 5. As was the case for studies with air-free suspensions, reactions are best described using a photoinitiated chain mechanism that produced CHCl2F and Cl- during the propagation steps. The enhanced yields obtained in the presence of air are attributed to the removal by O2 of electrons trapped in the oxide, which are converted first into H2O2 and then into reducing radicals that participate in the chain process. Enhanced yields of Freon photoreduction were also observed during illumination of air-free suspensions containing hydrogen peroxide, which were interpreted using a similar mechanism.

  12. A Highly Sensitive Diagnostic System for Detecting Dengue Viruses Using the Interaction between a Sulfated Sugar Chain and a Virion.

    PubMed

    Saksono, Budi; Dewi, Beti Ernawati; Nainggolan, Leonardo; Suda, Yasuo

    2015-01-01

    We propose a novel method of detecting trace amounts of dengue virus (DENVs) from serum. Our method is based on the interaction between a sulfated sugar chain and a DENV surface glycoprotein. After capturing DENV with the sulfated sugar chain-immobilized gold nanoparticles (SGNPs), the resulting complex is precipitated and viral RNA content is measured using the reverse-transcription quantitative polymerase chain reaction SYBR Green I (RT-qPCR-Syb) method. Sugar chains that bind to DENVs were identified using the array-type sugar chain immobilized chip (Sugar Chip) and surface plasmon resonance (SPR) imaging. Heparin and low-molecular-weight dextran sulfate were identified as binding partners, and immobilized on gold nanoparticles to prepare 3 types of SGNPs. The capacity of these SGNPs to capture and concentrate trace amounts of DENVs was evaluated in vitro. The SGNP with greatest sensitivity was tested using clinical samples in Indonesia in 2013-2014. As a result, the novel method was able to detect low concentrations of DENVs using only 6 μL of serum, with similar sensitivity to that of a Qiagen RNA extraction kit using 140 μL of serum. In addition, this method allows for multiplex-like identification of serotypes of DENVs. This feature is important for good healthcare management of DENV infection in order to safely diagnose the dangerous, highly contagious disease quickly, with high sensitivity.

  13. Anti-Caries Effects of Dental Adhesives Containing Quaternary Ammonium Methacrylates with Different Chain Lengths

    PubMed Central

    Han, Qi; Li, Bolei; Zhou, Xuedong; Ge, Yang; Wang, Suping; Li, Mingyun; Ren, Biao; Wang, Haohao; Zhang, Keke; Xu, Hockin H. K.; Peng, Xian; Feng, Mingye; Weir, Michael D.; Chen, Yu; Cheng, Lei

    2017-01-01

    The objectives of this study were to investigate the effects of dental adhesives containing quaternary ammonium methacrylates (QAMs) with different alkyl chain lengths (CL) on ecological caries prevention in vitro. Five QAMs were synthesized with a CL = 3, 6, 9, 12, and 16 and incorporated into adhesives. Micro-tensile bond strength and surface charge density were used to measure the physical properties of the adhesives. The proportion change in three-species biofilms consisting of Streptococcus mutans, Streptococcus sanguinis, and Streptococcus gordonii was tested using the TaqMan real-time polymerase chain reaction. Lactic acid assay, MTT [3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay, exopolysaccharide staining, live/dead staining, scanning electron microscopy (SEM), and transverse microradiography (TMR) were performed to study the anti-biofilm and anti-demineralization effects of the dental adhesives. The results showed that incorporating QAMs with different alkyl chain lengths into the adhesives had no obvious effect on the dentin bond strength. The adhesives containing QAMs with a longer alkyl chain developed healthier biofilms. The surface charge density, anti-biofilm, and anti-demineralization effects of the adhesives increased with a CL of the QAMs from 3 to 12, but decreased slightly with a CL from 12 to 16. In conclusion, adhesives containing QAMs with a tailored chain length are promising for preventing secondary caries in an “ecological way”. PMID:28773004

  14. Efficient sampling of reversible cross-linking polymers: Self-assembly of single-chain polymeric nanoparticles

    NASA Astrophysics Data System (ADS)

    Oyarzún, Bernardo; Mognetti, Bortolo Matteo

    2018-03-01

    We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.

  15. Bed material agglomeration during fluidized bed combustion. Technical progress report, 1 July, 1993--30 September, 1993

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brown, R.C.; Dawson, M.R.; Noble, S.D.

    Agglomerates formed in laboratory coal combustion tests were analyzed to determine the chemical and mineral reactions which lead to the cohesion of bed particles. Combustion tests were conducted at 75, 90, 100, and 120% theoretical air values. The test at 75% theoretical air resulted in the formation of bed agglomerates within 30 minutes. Agglomerates which formed at the lower theoretical air values were compared to unagglomerated bed samples by X-ray diffraction analyses. Polished thin sections of the agglomerates were made for optical and scanning electron microscopy. The results of these analyses indicate there were, in a broad sense, two typesmore » of mineralogic reactions which lead to the cohesion of bed particles in the agglomerates. One mechanism of cohesion resulted from the melting of bed particles to form a viscous material which bridged other bed particles. Based on the chemical composition of the glass (which resulted from the melt), this material was probably derived from aluminosilicate minerals in the sand bed or from clays within the coal. Because of the high iron content in these glasses (4 to 5 wt%), it is likely that iron pyrites in the coal were involved in fluxing reactions. In addition, MgO appears to be relatively high in the glasses. It is suspected that Ca-Mg carbonates (dolomite) from the bed sand are also involved in mineralogic reactions with the aluminosilicate melt. The second type of mineralogic reaction appears to be a reaction involving calcium and magnesium with other bed particles and with the aluminosilicate melt to form new mineral phases. Although the composition of these phases is somewhat variable, some resemble single-chain silicates or pyroxenes.« less

  16. Analysis of the antibacterial activity and plaque control benefit of colgate total dentifrice via clinical evaluation and real-time polymerase chain reaction.

    PubMed

    Xu, Tao; Deshmukh, Meenal; Barnes, Virginia Monsul; Trivedi, Harsh M; Du-Thumm, Laurence; Richter, Rose; Cummins, Diane

    2005-01-01

    This study analyzed, from a combined clinical and molecular biologic perspective, the antibacterial and antiplaque efficacy of Colgate Total dentifrice (CTD). A single-blind crossover study design utilized 11 healthy human subjects. After a one-week washout period, subjects donated dental plaque, received a dental prophylaxis, and subsequently brushed with a test product. Twenty-four hours postbrushing, dental plaque was collected and a clinical plaque score determined. Dental plaque was submitted for Real-time Polymerase Chain Reaction (Real-time PCR) analysis. The same procedure was repeated in accordance with a crossover design for the use of the second test product. Following a one-week washout, a plaque donation, prophylaxis, and brushing with the test product ensued for each subject. Twenty-four hours post-brushing, the subjects returned for a plaque score and plaque donation. Twenty-four hours after brushing, dental plaque coverage increased 17.88% +/- 8.27% with CTD, compared to 30.42% +/- 9.97% with Colgate Cavity Protection (CCP; p = 0.005). Real-time PCR found plaque collected 24 hours after brushing with CTD exhibited, on average, fewer representative periodontal pathogens (Fusobacterium nucleatum, Actinobacillus actinomycetemcomitans, Tannerella forsythensis, and Porphyromonas gingivalis) and fewer early colonizers (Actinomyces naeslundii) than plaque collected before brushing, whereas CCP showed a moderate effect on oral bacteria. The study provides clinical and molecular biological evidence to substantiate the antibacterial and plaque control benefits of Colgate Total, and suggests the value of combining a molecular biological method with clinical research to corroborate clinical benefits.

  17. Aphids preserved in propylene glycol can be used for reverse transcription-polymerase chain reaction detection of Potato virus Y.

    PubMed

    Nie, Xianzhou; Pelletier, Yvan; Mason, Nicola; Dilworth, Andrea; Giguère, Marie-Andrée

    2011-08-01

    The effectiveness of propylene glycol on the retention of RNA target of Potato virus Y (PVY), an aphid stylet-borne virus, in Myzus persicae was investigated in comparison to ethanol and liquid nitrogen/-80°C. Reverse transcription-polymerase chain reaction (RT-PCR) was used to detect the PVY targets from the propylene glycol/ethanol/liquid nitrogen preserved single aphids after a 5min acquisition period from infected potato plants. In the liquid nitrogen/-80°C and 70% ethanol treatments, 55.6% and 38.8% aphids tested PVY-positive, respectively. In the 0-75% propylene glycol treatments, 12.2-44.7% aphids tested PVY-positive. The lowest detection rate was in the 0% (positive rate, 15.2%) and the 10% propylene glycol (positive rate, 12.2%). As the propylene glycol concentration increased to 25%, 29.8% aphids tested positive. A high PVY-positive rate was also found in 35-75% propylene glycol treatments at 44.7% (35% propylene glycol), 36.7% (50% propylene glycol) and 34.8% (75% propylene glycol), which is comparable to the rate shown in 70% ethanol. No significant difference in the positive detection rate was observed in aphids preserved in 50% propylene glycol at room temperature for 2, 4 and 10 days. These results demonstrate that propylene glycol at 25-75% can retain PVY targets effectively in aphids for an extended time period, and thus can be used in aphid traps to preserve viruliferous aphids for later RT-PCR detection of PVY. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

  18. Trypanosoma cruzi infection of squirrel monkeys: comparison of blood smear examination, commercial enzyme-linked immunosorbent assay, and polymerase chain reaction analysis as screening tests for evaluation of monkey-related injuries.

    PubMed

    Ndao, M; Kelly, N; Normandin, D; Maclean, J D; Whiteman, A; Kokoskin, E; Arevalo, I; Ward, B J

    2000-12-01

    Wild-caught New World monkeys (NWM) from Central or South America are often infected with Trypanosoma species, including T. cruzi. In humans, T. cruzi causes Chagas' disease. Even in closed monkey colonies, T. cruzi can be propagated by blood-to-blood exposure, sexual activity, and transplacental transmission. Animal handlers and laboratory staff who deal with blood and tissues from infected NWM are at riskfor acquiring Chagas' disease via accidental exposure. We screened 162 blood samples from wild-caught Saimiri sp. monkeys for Trypanosoma species infections by use of blood smear examination, ELISA, and polymerase chain reaction (PCR) analysis. Blood samples from 19 employees with recent history of monkey-associated injuries also were tested. Six percent (10/162) of the monkey samples were T. cruzi positive on the basis of blood smear examination results, 10.4% (17/162) were positive by ELISA results, and 26.5% (43/162) were positive by PCR results. Other organisms identified by PCR analysis included T. rangeli in two animals, Plasmodium spp. in two animals (P. malariae confirmed by PCR results) and microfilariae in one animal (morphologically, Mansonella perstans). Evidence of trypanosome infection was not found in the 19 employee samples on the basis of results of any of the three aforementioned tests. Close attention must be paid to worker safety where wild-caught NWM are used. The PCR analysis has a clear advantage over conventional techniques (ELISA, blood smear) for screening NWM for trypanosome infections during quarantine and after employee injury.

  19. Microfluidics-Based PCR for Fusion Transcript Detection.

    PubMed

    Chen, Hui

    2016-01-01

    The microfluidic technology allows the production of network of submillimeter-size fluidic channels and reservoirs in a variety of material systems. The microfluidic-based polymerase chain reaction (PCR) allows automated multiplexing of multiple samples and multiple assays simultaneously within a network of microfluidic channels and chambers that are co-ordinated in controlled fashion by the valves. The individual PCR reaction is performed in nanoliter volume, which allows testing on samples with limited DNA and RNA. The microfluidics devices are used in various types of PCR such as digital PCR and single molecular emulsion PCR for genotyping, gene expression, and miRNA expression. In this chapter, the use of a microfluidics-based PCR for simultaneous screening of 14 known fusion transcripts in patients with leukemia is described.

  20. Electrically detected displacement assay (EDDA): a practical approach to nucleic acid testing in clinical or medical diagnosis.

    PubMed

    Liepold, P; Kratzmüller, T; Persike, N; Bandilla, M; Hinz, M; Wieder, H; Hillebrandt, H; Ferrer, E; Hartwich, G

    2008-07-01

    This paper introduces the electrically detected displacement assay (EDDA), a electrical biosensor detection principle for applications in medical and clinical diagnosis, and compares the method to currently available microarray technologies in this field. The sensor can be integrated into automated systems of routine diagnosis, but may also be used as a sensor that is directly applied to the polymerase chain reaction (PCR) reaction vessel to detect unlabeled target amplicons within a few minutes. Major aspects of sensor assembly like immobilization procedure, accessibility of the capture probes, and prevention from nonspecific target adsorption, that are a prerequisite for a robust and reliable performance of the sensor, are demonstrated. Additionally, exemplary results from a human papillomavirus assay are presented.

Top