Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

PubMed

Garg, Pankaj

2017-07-01

Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

Development and validation of a novel hydrolysis probe real-time polymerase chain reaction for agamid adenovirus 1 in the central bearded dragon (Pogona vitticeps).

PubMed

Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X

2015-03-01

Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. © 2015 The Author(s).

A de novo transcriptome and valid reference genes for quantitative real-time PCR in Colaphellus bowringi.

PubMed

Tan, Qian-Qian; Zhu, Li; Li, Yi; Liu, Wen; Ma, Wei-Hua; Lei, Chao-Liang; Wang, Xiao-Ping

2015-01-01

The cabbage beetle Colaphellus bowringi Baly is a serious insect pest of crucifers and undergoes reproductive diapause in soil. An understanding of the molecular mechanisms of diapause regulation, insecticide resistance, and other physiological processes is helpful for developing new management strategies for this beetle. However, the lack of genomic information and valid reference genes limits knowledge on the molecular bases of these physiological processes in this species. Using Illumina sequencing, we obtained more than 57 million sequence reads derived from C. bowringi, which were assembled into 39,390 unique sequences. A Clusters of Orthologous Groups classification was obtained for 9,048 of these sequences, covering 25 categories, and 16,951 were assigned to 255 Kyoto Encyclopedia of Genes and Genomes pathways. Eleven candidate reference gene sequences from the transcriptome were then identified through reverse transcriptase polymerase chain reaction. Among these candidate genes, EF1α, ACT1, and RPL19 proved to be the most stable reference genes for different reverse transcriptase quantitative polymerase chain reaction experiments in C. bowringi. Conversely, aTUB and GAPDH were the least stable reference genes. The abundant putative C. bowringi transcript sequences reported enrich the genomic resources of this beetle. Importantly, the larger number of gene sequences and valid reference genes provide a valuable platform for future gene expression studies, especially with regard to exploring the molecular mechanisms of different physiological processes in this species.

Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

PubMed

Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

2013-01-01

A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

Polymerase chain reaction technology as analytical tool in agricultural biotechnology.

PubMed

Lipp, Markus; Shillito, Raymond; Giroux, Randal; Spiegelhalter, Frank; Charlton, Stacy; Pinero, David; Song, Ping

2005-01-01

The agricultural biotechnology industry applies polymerase chain reaction (PCR) technology at numerous points in product development. Commodity and food companies as well as third-party diagnostic testing companies also rely on PCR technology for a number of purposes. The primary use of the technology is to verify the presence or absence of genetically modified (GM) material in a product or to quantify the amount of GM material present in a product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains. The document highlights the many areas to which attention must be paid in order to produce reliable test results. These include sample preparation, method validation, choice of appropriate reference materials, and biological and instrumental sources of error. The article also discusses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter... of high-processivity polymerase with novel internal amplification controls for rapid and specific detection.

USDA-ARS?s Scientific Manuscript database

Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowl...

Targeting Conserved Genes in Penicillium Species.

PubMed

Peterson, Stephen W

2017-01-01

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of dideoxynucleotide-labeled fragments or NGS. The sequences are compared to a database of validated isolates. Identification of species indicates the potential of the fungus to make particular mycotoxins.

Simple model of inhibition of chain-branching combustion processes

NASA Astrophysics Data System (ADS)

Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.

2017-11-01

A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

Chain-reaction crash in traffic flow controlled by taillights

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-02-01

We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.

Validation studies and proficiency testing.

PubMed

Ankilam, Elke; Heinze, Petra; Kay, Simon; Van den Eede, Guy; Popping, Bert

2002-01-01

Genetically modified organisms (GMOs) entered the European food market in 1996. Current legislation demands the labeling of food products if they contain <1% GMO, as assessed for each ingredient of the product. To create confidence in the testing methods and to complement enforcement requirements, there is an urgent need for internationally validated methods, which could serve as reference methods. To date, several methods have been submitted to validation trials at an international level; approaches now exist that can be used in different circumstances and for different food matrixes. Moreover, the requirement for the formal validation of methods is clearly accepted; several national and international bodies are active in organizing studies. Further validation studies, especially on the quantitative polymerase chain reaction methods, need to be performed to cover the rising demand for new extraction methods and other background matrixes, as well as for novel GMO constructs.

ONR Far East Scientific Information Bulletin

DTIC Science & Technology

1990-09-01

In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by

Versatile fusion source integrator AFSI for fast ion and neutron studies in fusion devices

NASA Astrophysics Data System (ADS)

Sirén, Paula; Varje, Jari; Äkäslompolo, Simppa; Asunta, Otto; Giroud, Carine; Kurki-Suonio, Taina; Weisen, Henri; JET Contributors, The

2018-01-01

ASCOT Fusion Source Integrator AFSI, an efficient tool for calculating fusion reaction rates and characterizing the fusion products, based on arbitrary reactant distributions, has been developed and is reported in this paper. Calculation of reactor-relevant D-D, D-T and D-3He fusion reactions has been implemented based on the Bosch-Hale fusion cross sections. The reactions can be calculated between arbitrary particle populations, including Maxwellian thermal particles and minority energetic particles. Reaction rate profiles, energy spectra and full 4D phase space distributions can be calculated for the non-isotropic reaction products. The code is especially suitable for integrated modelling in self-consistent plasma physics simulations as well as in the Serpent neutronics calculation chain. Validation of the model has been performed for neutron measurements at the JET tokamak and the code has been applied to predictive simulations in ITER.

Effect of perception irregularity on chain-reaction crash in low visibility

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-06-01

We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.

Determination of rate constants and branching ratios for TCE degradation by zero-valent iron using a chain decay multispecies model.

PubMed

Hwang, Hyoun-Tae; Jeen, Sung-Wook; Sudicky, Edward A; Illman, Walter A

2015-01-01

The applicability of a newly-developed chain-decay multispecies model (CMM) was validated by obtaining kinetic rate constants and branching ratios along the reaction pathways of trichloroethene (TCE) reduction by zero-valent iron (ZVI) from column experiments. Changes in rate constants and branching ratios for individual reactions for degradation products over time for two columns under different geochemical conditions were examined to provide ranges of those parameters expected over the long-term. As compared to the column receiving deionized water, the column receiving dissolved CaCO3 showed higher mean degradation rates for TCE and all of its degradation products. However, the column experienced faster reactivity loss toward TCE degradation due to precipitation of secondary carbonate minerals, as indicated by a higher value for the ratio of maximum to minimum TCE degradation rate observed over time. From the calculated branching ratios, it was found that TCE and cis-dichloroethene (cis-DCE) were dominantly dechlorinated to chloroacetylene and acetylene, respectively, through reductive elimination for both columns. The CMM model, validated by the column test data in this study, provides a convenient tool to determine simultaneously the critical design parameters for permeable reactive barriers and natural attenuation such as rate constants and branching ratios. Copyright © 2015 Elsevier B.V. All rights reserved.

A screening method for the detection of the 35S promoter and the nopaline synthase terminator in genetically modified organisms in a real-time multiplex polymerase chain reaction using high-resolution melting-curve analysis.

PubMed

Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko

2009-11-01

To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.

Thermodynamics of enzyme-catalyzed esterifications: II. Levulinic acid esterification with short-chain alcohols.

PubMed

Altuntepe, Emrah; Emel'yanenko, Vladimir N; Forster-Rotgers, Maximilian; Sadowski, Gabriele; Verevkin, Sergey P; Held, Christoph

2017-10-01

Levulinic acid was esterified with methanol, ethanol, and 1-butanol with the final goal to predict the maximum yield of these equilibrium-limited reactions as function of medium composition. In a first step, standard reaction data (standard Gibbs energy of reaction Δ R g 0 ) were determined from experimental formation properties. Unexpectedly, these Δ R g 0 values strongly deviated from data obtained with classical group contribution methods that are typically used if experimental standard data is not available. In a second step, reaction equilibrium concentrations obtained from esterification catalyzed by Novozym 435 at 323.15 K were measured, and the corresponding activity coefficients of the reacting agents were predicted with perturbed-chain statistical associating fluid theory (PC-SAFT). The so-obtained thermodynamic activities were used to determine Δ R g 0 at 323.15 K. These results could be used to cross-validate Δ R g 0 from experimental formation data. In a third step, reaction-equilibrium experiments showed that equilibrium position of the reactions under consideration depends strongly on the concentration of water and on the ratio of levulinic acid: alcohol in the initial reaction mixtures. The maximum yield of the esters was calculated using Δ R g 0 data from this work and activity coefficients of the reacting agents predicted with PC-SAFT for varying feed composition of the reaction mixtures. The use of the new Δ R g 0 data combined with PC-SAFT allowed good agreement to the measured yields, while predictions based on Δ R g 0 values obtained with group contribution methods showed high deviations to experimental yields.

Chain-reaction crash on a highway in high visibility

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2016-05-01

We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

Effect of vehicular size on chain-reaction crash

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-11-01

We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

Kinetic aspects of chain growth in Fischer-Tropsch synthesis.

PubMed

Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M

2017-04-28

Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.

An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

ERIC Educational Resources Information Center

Elkins, Kelly M.; Kadunc, Raelynn E.

2012-01-01

In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

PubMed

Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

2008-07-23

A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

Actinomyces israelii in radicular cysts: a molecular study.

PubMed

Gomes, Nathália Rodrigues; Diniz, Marina Gonçalves; Pereira, Thais Dos Santos Fontes; Estrela, Carlos; de Macedo Farias, Luiz; de Andrade, Bruno Augusto Benevenuto; Gomes, Carolina Cavaliéri; Gomez, Ricardo Santiago

2017-05-01

To investigate whether the microscopic filamentous aggregates observed in radicular cysts are associated with the molecular identification of Actinomyces israelii. Moreover, to verify whether this bacterium can be detected in radicular cyst specimens not presenting aggregates. Microscopic colonies suggestive of Actinomyces were found in 8 out of 279 radicular cyst samples (case group). The case and control groups (n = 12; samples without filamentous colonies) were submitted to the semi-nested polymerase chain reaction to test the presence of A israelii. DNA sequencing was performed to validate polymerase chain reaction results. Two and 3 samples in the case and control groups, respectively, did not present a functional genomic DNA template and were excluded from the study. A israelii was identified in all samples of the case group and in 3 out of 9 samples of the control group. Although A israelii is more commonly identified in radicular cysts presenting filamentous aggregates, it also appears to be detected in radicular cysts without this microscopic finding. Copyright © 2017 Elsevier Inc. All rights reserved.

Review of Detection of Brucella sp. by Polymerase Chain Reaction

PubMed Central

Yu, Wei Ling; Nielsen, Klaus

2010-01-01

Here we present a review of most of the currently used polymerase chain reaction (PCR)-based methods for identification of Brucella bacteria in biological samples. We focused in particular on methods using single-pair primers, multiplex primers, real-time PCRs, PCRs for marine Brucella, and PCRs for molecular biotyping. These methods are becoming very important tools for the identification of Brucella, at the species level and recently also at the biovar level. These techniques require minimum biological containment and can provide results in a very short time. In addition, genetic fingerprinting of isolates aid in epidemiological studies of the disease and its control. PCR-based methods are more useful and practical than conventional methods used to identify Brucella spp., and new methods for Brucella spp identification and typing are still being developed. However, the sensitivity, specificity, and issues of quality control and quality assurance using these methods must be fully validated on clinical samples before PCR can be used in routine laboratory testing for brucellosis. PMID:20718083

DNA typing by microbead arrays and PCR-SSP: apparent false-negative or -positive hybridization or amplification signals disclose new HLA-B and -DRB1 alleles.

PubMed

Rahal, M; Kervaire, B; Villard, J; Tiercy, J-M

2008-03-01

Human leukocyte antigen (HLA) typing by polymerase chain reaction-sequence-specific oligonucleotide (PCR-SSO) hybridization on solid phase (microbead assay) or polymerase chain reaction-sequence-specific primers (PCR-SSP) requires interpretation softwares to detect all possible allele combinations. These programs propose allele calls by taking into account false-positive or false-negative signal(s). The laboratory has the option to validate typing results in the presence of strongly cross-reacting or apparent false-negative signals. Alternatively, these seemingly aberrant signals may disclose novel variants. We report here four new HLA-B (B*5620 and B*5716) and HLA-DRB1 alleles (DRB1*110107 and DRB1*1474) that were detected by apparent false-negative or -positive hybridization or amplification patterns, and ultimately resolved by sequencing. To avoid allele misassignments, a comprehensive evaluation of acquired data as documented in a quality assurance system is therefore required to confirm unambiguous typing interpretation.

Clinical inquiries. What test is the best for diagnosing infectious mononucleosis?

PubMed

Bell, Amy Trelease; Fortune, Barbara; Sheeler, Robert

2006-09-01

Tests for antibodies to Epstein-Barr viral capsid antigen or Epstein-Barr nuclear antigen are the most sensitive, are highly specific, and are also the most expensive for diagnosing infectious mononucleosis (strength of recommendation [SOR]: C, based on validating cohort study). Heterophile antibody tests have similar specificity and are cheaper, but are less sensitive in children or in adults during the early days of the illness (SOR: C, based on validating cohort study). The polymerase chain reaction assay for Epstein-Barr virus DNA is more sensitive than the heterophile antibody test in children, is highly specific, but is also expensive (SOR: C, based on validating cohort study). The percentages of atypical lymphocytes and total lymphocytes on a complete blood count provide another specific and moderately sensitive, yet inexpensive, test (SOR: C, based on validating cohort study).

Standardization of a two-step real-time polymerase chain reaction based method for species-specific detection of medically important Aspergillus species.

PubMed

Das, P; Pandey, P; Harishankar, A; Chandy, M; Bhattacharya, S; Chakrabarti, A

2017-01-01

Standardization of Aspergillus polymerase chain reaction (PCR) poses two technical challenges (a) standardization of DNA extraction, (b) optimization of PCR against various medically important Aspergillus species. Many cases of aspergillosis go undiagnosed because of relative insensitivity of conventional diagnostic methods such as microscopy, culture or antigen detection. The present study is an attempt to standardize real-time PCR assay for rapid sensitive and specific detection of Aspergillus DNA in EDTA whole blood. Three nucleic acid extraction protocols were compared and a two-step real-time PCR assay was developed and validated following the recommendations of the European Aspergillus PCR Initiative in our setup. In the first PCR step (pan-Aspergillus PCR), the target was 28S rDNA gene, whereas in the second step, species specific PCR the targets were beta-tubulin (for Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus), gene and calmodulin gene (for Aspergillus niger). Species specific identification of four medically important Aspergillus species, namely, A. fumigatus, A. flavus, A. niger and A. terreus were achieved by this PCR. Specificity of the PCR was tested against 34 different DNA source including bacteria, virus, yeast, other Aspergillus sp., other fungal species and for human DNA and had no false-positive reactions. The analytical sensitivity of the PCR was found to be 102 CFU/ml. The present protocol of two-step real-time PCR assays for genus- and species-specific identification for commonly isolated species in whole blood for diagnosis of invasive Aspergillus infections offers a rapid, sensitive and specific assay option and requires clinical validation at multiple centers.

The high-throughput synthesis and phase characterisation of amphiphiles: a sweet case study.

PubMed

Feast, George C; Hutt, Oliver E; Mulet, Xavier; Conn, Charlotte E; Drummond, Calum J; Savage, G Paul

2014-03-03

A new method for the discovery of amphiphiles by using high-throughput (HT) methods to synthesise and characterise a library of galactose- and glucose-containing amphiphilic compounds is presented. The copper-catalysed azide–alkyne cycloaddition (CuAAC) “click” reaction between azide-tethered simple sugars and alkyne-substituted hydrophobic tails was employed to synthesise a library of compounds with systematic variations in chain length and unsaturation in a 24-vial array format. The liquid–crystalline phase behaviour was characterised in a HT manner by using synchrotron small-angle X-ray scattering (SSAXS). The observed structural variation with respect to chain parameters, including chain length and degree of unsaturation, is discussed, as well as hydration effects and degree of hydrogen bonding between head groups. The validity of our HT screening approach was verified by resynthesising a short-chain glucose amphiphile. A separate phase analysis of this compound confirmed the presence of numerous lyotropic liquid–crystalline phases.

Detection of Brucella spp. in milk from seronegative cows by real-time polymerase chain reaction in the region of Batna, Algeria

PubMed Central

Sabrina, Rabehi; Mossadak, Hamdi Taha; Bakir, Mamache; Asma, Meghezzi; Khaoula, Boushaba

2018-01-01

Aim: The aim of this study was to detect Brucella spp. DNA in milk samples collected from seronegative cows using the real-time polymerase chain reaction (PCR) assay for diagnosis of brucellosis in seronegative dairy cows to prevent transmission of disease to humans and to reduce economic losses in animal production. Materials and Methods: In this study, 65 milk samples were investigated for the detection of Brucella spp. The detection of the IS711 gene in all samples was done by real-time PCR assay by comparative cycle threshold method. Results: The results show that of the 65 DNA samples tested, 2 (3.08%) were positive for Brucella infection. The mean cyclic threshold values of IS711 real-time PCR test were 37.97 and 40.48, indicating a positive reaction. Conclusion: The results of the present study indicated that the real-time PCR appears to offer several advantages over serological tests. For this reason, the real-time PCR should be validated on representative numbers of Brucella-infected and free samples before being implemented in routine diagnosis in human and animal brucellosis for controlling this disease. PMID:29657430

Development and validation of qualitative SYBR®Green real-time PCR for detection and discrimination of Listeria spp. and Listeria monocytogenes.

PubMed

Barbau-Piednoir, Elodie; Botteldoorn, Nadine; Yde, Marc; Mahillon, Jacques; Roosens, Nancy H

2013-05-01

A combination of four qualitative SYBR®Green qPCR screening assays targeting two levels of discrimination: Listeria genus (except Listeria grayi) and Listeria monocytogenes, is presented. These assays have been developed to be run simultaneously using the same polymerase chain reaction (PCR) programme. The paper also proposes a new validation procedure to specifically validate qPCR assays applied to food microbiology according to two guidelines: the ISO 22118 norm and the "Definition of minimum performance requirements for analytical methods of GMO testing". The developed assays target the iap, prs and hlyA genes that belong to or neighbour the virulence cluster of Listeria spp. The selected primers were designed to amplify short fragments (60 to 103 bp) in order to obtain optimal PCR efficiency (between 97 and 107 % efficiency). The limit of detection of the SYBR®Green qPCR assays is two to five copies of target genes per qPCR reaction. These assays are highly accurate (98.08 and 100 % accuracy for the Listeria spp. and L. monocytogenes assays, respectively).

The Abbott RealTime High Risk HPV test is a clinically validated human papillomavirus assay for triage in the referral population and use in primary cervical cancer screening in women 30 years and older: a review of validation studies.

PubMed

Poljak, Mario; Oštrbenk, Anja

2013-01-01

Human papillomavirus (HPV) testing has become an essential part of current clinical practice in the management of cervical cancer and precancerous lesions. We reviewed the most important validation studies of a next-generation real-time polymerase chain reaction-based assay, the RealTime High Risk HPV test (RealTime)(Abbott Molecular, Des Plaines, IL, USA), for triage in referral population settings and for use in primary cervical cancer screening in women 30 years and older published in peer-reviewed journals from 2009 to 2013. RealTime is designed to detect 14 high-risk HPV genotypes with concurrent distinction of HPV-16 and HPV-18 from 12 other HPV genotypes. The test was launched on the European market in January 2009 and is currently used in many laboratories worldwide for routine detection of HPV. We concisely reviewed validation studies of a next-generation real-time polymerase chain reaction (PCR)-based assay: the Abbott RealTime High Risk HPV test. Eight validation studies of RealTime in referral settings showed its consistently high absolute clinical sensitivity for both CIN2+ (range 88.3-100%) and CIN3+ (range 93.0-100%), as well as comparative clinical sensitivity relative to the currently most widely used HPV test: the Qiagen/Digene Hybrid Capture 2 HPV DNA Test (HC2). Due to the significantly different composition of the referral populations, RealTime absolute clinical specificity for CIN2+ and CIN3+ varied greatly across studies, but was comparable relative to HC2. Four validation studies of RealTime performance in cervical cancer screening settings showed its consistently high absolute clinical sensitivity for both CIN2+ and CIN3+, as well as comparative clinical sensitivity and specificity relative to HC2 and GP5+/6+ PCR. RealTime has been extensively evaluated in the last 4 years. RealTime can be considered clinically validated for triage in referral population settings and for use in primary cervical cancer screening in women 30 years and older.

Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

PubMed

Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

2015-01-01

Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

[Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

PubMed

Iván, Kristóf; Maráz, Anna

2015-12-20

Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

Molecular testing for familial hypercholesterolaemia-associated mutations in a UK-based cohort: development of an NGS-based method and comparison with multiplex polymerase chain reaction and oligonucleotide arrays.

PubMed

Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K

2016-11-01

Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter with application of high-processivity polymerase and novel internal amplification controls for rapid and specific detection.

PubMed

Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S

2012-02-01

Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications. Published by Elsevier Inc.

Development of a polymerase chain reaction assay for the rapid detection of the oral pathogenic bacterium, Selenomonas noxia.

PubMed

Cruz, Patricia; Mehretu, Arthuro M; Buttner, Mark P; Trice, Theresa; Howard, Katherine M

2015-08-14

In recent studies, periodontal health has been linked to being overweight and/or obese. Among common oral bacteria, Selenomonas noxia has been implicated in converting periodontal health to disease, and Selenomonas species have also been found in gastric ulcers. The objective of this study was to develop and validate a quantitative polymerase chain reaction (qPCR) assay for the specific and rapid detection of S. noxia. Two oligonucleotide primer pairs and one probe were designed and tested to determine optimal amplification signal with three strains of S. noxia. The PCR assay was tested against fourteen non-target organisms, including closely related oral Selenomonads, one phylogenetically closely related bacterium, and two commonly isolated oral bacteria. One of the primer sets was more sensitive at detecting the target organism and was selected for optimization and validation experiments. The designed primers and probe amplified the target organism with 100% specificity. PCR inhibition was observed with an internal positive control, and inhibition was resolved by diluting the DNA extract. The qPCR assay designed in this study can be used to specifically detect S. noxia in the clinical setting and in future research involving the enhanced detection of S. noxia. The assay can also be used in epidemiological studies for understanding the role of S. noxia in disease processes including, but not limited to, oral health and obesity of infectious origin.

A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

PubMed

Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

2016-12-01

To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

Press Releases | Argonne National Laboratory

Science.gov Websites

Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

Amyloid fibril formation by the chain B subunit of monellin occurs by a nucleation-dependent polymerization mechanism.

PubMed

Sabareesan, A T; Udgaonkar, Jayant B

2014-02-25

Proteins possessing very different structures, or even no structure, form amyloid fibrils that are very similar in internal structure. This suggests that the mechanisms by which amyloid fibrils form might be very similar, irrespective of whether the fibrils are associated with disease or with normal cellular function, or even if they have no physiological importance. In this context, it is important to have a model protein system whose amyloid fibril formation is robust in its reproducibility, which can reveal the fundamentals of the amyloid fibril reaction that may be applicable to all proteins. In this study, the aggregation mechanism of amyloid fibril formation by chain B of the heterodimeric protein monellin has been elucidated in detail. It is shown that the aggregation reaction meets all the stringent kinetic criteria of a homogeneous nucleation-dependent polymerization mechanism, which is valid over a wide range of protein concentrations. Quantitative analyses of the kinetic data using one approach based on features of the entire kinetic curve, and another based on only the initial rate of aggregation, indicate that the thermodynamic nucleus is a dimer. Spherical oligomers are observed by atomic force microscopy to form transiently early during fibril formation but are off-pathway to the direct fibril formation pathway. It is shown that amyloid fibril formation can be prevented by the addition of chain A of monellin at early stages of chain B aggregation: the two free chains combine to form native monellin, which leads to the dissociation of early aggregates.

Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

PubMed

Nadal, Anna; Esteve, Teresa; Pla, Maria

2009-01-01

A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (<1.7% of false classification rate), with limit of detection values of 0.1% for each event, which were also achieved with simulated mixtures at different relative percentages of targets. The assay was further combined with a second multiplex PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary.

Identification and validation of biomarkers of IgV(H) mutation status in chronic lymphocytic leukemia using microfluidics quantitative real-time polymerase chain reaction technology.

PubMed

Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R

2007-09-01

To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.

Introduction to Polymer Chemistry.

ERIC Educational Resources Information Center

Harris, Frank W.

1981-01-01

Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

Detection of Mycoplasma hyopneumoniae by polymerase chain reaction in swine presenting respiratory problems

PubMed Central

Yamaguti, M.; Muller, E.E.; Piffer, A.I.; Kich, J.D.; Klein, C.S.; Kuchiishi, S.S.

2008-01-01

Since Mycoplasma hyopneumoniae isolation in appropriate media is a difficult task and impractical for daily routine diagnostics, Nested-PCR (N-PCR) techniques are currently used to improve the direct diagnostic sensitivity of Swine Enzootic Pneumonia. In a first experiment, this paper describes a N-PCR technique optimization based on three variables: different sampling sites, sample transport media, and DNA extraction methods, using eight pigs. Based on the optimization results, a second experiment was conducted for testing validity using 40 animals. In conclusion, the obtained results of the N-PCR optimization and validation allow us to recommend this test as a routine monitoring diagnostic method for Mycoplasma hyopneumoniae infection in swine herds. PMID:24031248

Polymerization as a Model Chain Reaction

ERIC Educational Resources Information Center

Morton, Maurice

1973-01-01

Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

DOE R&D Accomplishments Database

Weinberg, Alvin M.; Noderer, L. C.

1951-05-15

The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

Validation of Reference Genes in mRNA Expression Analysis Applied to the Study of Asthma.

PubMed

Segundo-Val, Ignacio San; Sanz-Lozano, Catalina S

2016-01-01

The quantitative Polymerase Chain Reaction is the most used technique for the study of gene expression. To correct putative experimental errors of this technique is necessary normalizing the expression results of the gene of interest with the obtained for reference genes. Here, we describe an example of the process to select reference genes. In this particular case, we select reference genes for expression studies in the peripheral blood mononuclear cells of asthmatic patients.

Underbody Blast Models of TBI Caused by Hyper-Acceleration and Secondary Head Impact

DTIC Science & Technology

2015-02-01

or behavioral indices of brain injury . 2.0 Technical Requirements: 2 Fig. 1. Diffusion tensor imaging of water diffusion in the internal capsule...demonstrates relative differences between blast (left) and sham (right) and also the similarities between the two animals in each group. vWF Bcl - 2 Fo ld...C ha ng e -8 -6 -4 - 2 0 2 4 6 8 10 12 ** ** Figure 6. Quantitative real-time polymerase chain reaction (qPCR) validation of vWF and Bcl - 2

The application of uniplex, duplex, and multiplex PCR for the absence of specified microorganism testing of pharmaceutical excipients and drug products.

PubMed

Ragheb, Suzan M; Yassin, Aymen S; Amin, Magdy A

2012-01-01

Notable progress has been made in methods that encourage the use of polymerase chain reaction (PCR) as a rapid and accurate tool in microbiological testing of pharmaceuticals. In this study, the detection of the four main specified microorganisms according to the pharmacopeial recommendations, Salmonella spp, Escherichia coli, Pseudomonas aeruginosa, and Staphylococcus aureus, was optimized in different pharmaceutical dosage forms and raw materials. Uniplex PCR was performed for the detection of each microorganism individually targeting the conserved region in each bacterial genome. Further optimizations were done to perform duplex and multiplex PCR assays considering relative concentrations of competitor primers used in the reaction. The uniplex PCR amplicons were successfully sequenced, confirming the conservation of used primers. Other validation parameters such as specificity, sensitivity, and robustness were examined closely. The method provides a high-throughput screening method to test different pharmaceutical preparations for specified microorganisms for the detection of microbiological contamination. Strict regulations govern the production of pharmaceutical products whether they are sterile or nonsterile. Certain official tests are carried out in microbiology testing laboratory in any pharmaceutical production facility to ensure the pharmaceuticals microbiological quality according to the standard pharmacopeial recommendations. Nonsterile products must be free of specified microorganisms that are used as a check for their quality. Topical preparations must be free of Pseudomonas aeruginosa and Staphylococcus aureus, and oral preparations must be free of Salmonella spp and Escherichia coli. Conventional microbiological methods are time-consuming, labor-intensive, and require long incubation times, resulting in delaying the release of the products. In this study, we tested and validated a polymerase chain reaction identification approach to detect indicator bacteria in pharmaceutical preparations. The method depends on amplification of certain conserved genes located in the four specified bacteria. The method is optimized to be carried out individually or collectively to detect all indicator bacteria in a single reaction in different forms of pharmaceutical products.

Increased efficacy for in-house validation of real-time PCR GMO detection methods.

PubMed

Scholtens, I M J; Kok, E J; Hougs, L; Molenaar, B; Thissen, J T N M; van der Voet, H

2010-03-01

To improve the efficacy of the in-house validation of GMO detection methods (DNA isolation and real-time PCR, polymerase chain reaction), a study was performed to gain insight in the contribution of the different steps of the GMO detection method to the repeatability and in-house reproducibility. In the present study, 19 methods for (GM) soy, maize canola and potato were validated in-house of which 14 on the basis of an 8-day validation scheme using eight different samples and five on the basis of a more concise validation protocol. In this way, data was obtained with respect to the detection limit, accuracy and precision. Also, decision limits were calculated for declaring non-conformance (>0.9%) with 95% reliability. In order to estimate the contribution of the different steps in the GMO analysis to the total variation variance components were estimated using REML (residual maximum likelihood method). From these components, relative standard deviations for repeatability and reproducibility (RSD(r) and RSD(R)) were calculated. The results showed that not only the PCR reaction but also the factors 'DNA isolation' and 'PCR day' are important factors for the total variance and should therefore be included in the in-house validation. It is proposed to use a statistical model to estimate these factors from a large dataset of initial validations so that for similar GMO methods in the future, only the PCR step needs to be validated. The resulting data are discussed in the light of agreed European criteria for qualified GMO detection methods.

Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins

NASA Astrophysics Data System (ADS)

Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John

2017-01-01

DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.

Evaluation of six nucleic acid amplification tests used for diagnosis of Neisseria gonorrhoeae in Russia compared with an international strictly validated real-time porA pseudogene polymerase chain reaction.

PubMed

Shipitsyna, E; Zolotoverkhaya, E; Hjelmevoll, S O; Maximova, A; Savicheva, A; Sokolovsky, E; Skogen, V; Domeika, M; Unemo, M

2009-11-01

In Russia, laboratory diagnosis of gonorrhoea has been mainly based on microscopy only and, in some settings, relatively rare suboptimal culturing. In recent years, Russian developed and manufactured nucleic acid amplification tests (NAAT) have been implemented for routine diagnosis of Neisseria gonorrhoeae. However, these NAATs have never been validated to any international well-recognized diagnostic NAAT. This study aims to evaluate the performance characteristics of six Russian NAATs for N. gonorrhoeae diagnostics. In total, 496 symptomatic patients were included. Five polymerase chain reaction (PCR) assays and one real-time nucleic acid sequence based amplification (NASBA) assay, developed by three Russian companies, were evaluated on urogenital samples, i.e. cervical and first voided urine (FVU) samples from females (n = 319), urethral and FVU samples from males (n = 127), and extragenital samples, i.e. rectal and pharyngeal samples, from 50 additional female patients with suspicion of gonorrhoea. As reference method, an international strictly validated real-time porA pseudogene PCR was applied. The prevalence of N. gonorrhoeae was 2.7% and 16% among the patients providing urogenital and extragenital samples, respectively. The Russian NAATs and the reference method displayed high level of concordance (99.4-100%). The sensitivities, specificities, positive predictive values and negative predictive values of the Russian tests in different specimens were 66.7-100%, 100%, 100%, and 99.4-100%, respectively. Russian N. gonorrhoeae diagnostic NAATs comprise relatively good performance characteristics. However, larger studies are crucial and, beneficially, the Russian assays should also be evaluated to other international highly sensitive and specific, and ideally Food and Drug Administration approved, NAATs such as Aptima Combo 2 (Gen-Probe).

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2014 CFR

2014-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2013 CFR

2013-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2012 CFR

2012-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

Emilio Segrè and Spontaneous Fission

Science.gov Websites

fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

A method for quantitative analysis of standard and high-throughput qPCR expression data based on input sample quantity.

PubMed

Adamski, Mateusz G; Gumann, Patryk; Baird, Alison E

2014-01-01

Over the past decade rapid advances have occurred in the understanding of RNA expression and its regulation. Quantitative polymerase chain reactions (qPCR) have become the gold standard for quantifying gene expression. Microfluidic next generation, high throughput qPCR now permits the detection of transcript copy number in thousands of reactions simultaneously, dramatically increasing the sensitivity over standard qPCR. Here we present a gene expression analysis method applicable to both standard polymerase chain reactions (qPCR) and high throughput qPCR. This technique is adjusted to the input sample quantity (e.g., the number of cells) and is independent of control gene expression. It is efficiency-corrected and with the use of a universal reference sample (commercial complementary DNA (cDNA)) permits the normalization of results between different batches and between different instruments--regardless of potential differences in transcript amplification efficiency. Modifications of the input quantity method include (1) the achievement of absolute quantification and (2) a non-efficiency corrected analysis. When compared to other commonly used algorithms the input quantity method proved to be valid. This method is of particular value for clinical studies of whole blood and circulating leukocytes where cell counts are readily available.

A polymerase chain reaction enzyme immunoassay for diagnosing infection caused by Aspergillus fumigatus.

PubMed Central

Golbang, N; Burnie, J P; Matthews, R C

1999-01-01

AIM: To develop a polymerase chain reaction enzyme immunoassay (PCR-EIA) to measure levels of circulating aspergillus DNA in invasive aspergillosis caused by Aspergillus fumigatus. METHODS: The PCR reaction was based on primers from the 18s rRNA gene. Binding of the product to a streptavidin coated microtitration plate was mediated by a biotinylated capture probe. The product was digoxigenylated during PCR and this was the tag to which antibody was bound in the subsequent EIA. RESULTS: The optical density (OD) endpoint was < 0.1 in 10 sera from neutropenic patients with no evidence of invasive aspergillosis, and in 10 sera from nonneutropenic patients with bacterial pneumonia (group 1). The OD from five of 12 patients with allergic bronchopulmonary aspergillosis (ABPA) (group 2), three with an aspergilloma (group 3), and five with possible invasive aspergillosis (group 4) was > or = 0.1. In 63 sera from 33 cases of proven invasive aspergillosis (group 5) an OD > or = 0.1 was achieved in 48 sera from 30 patients. The maximum OD was 0.510. The level fell in survivors and gradually rose in fatal cases. CONCLUSIONS: This assay validated the concept of diagnosing invasive aspergillosis by measuring levels of circulating fungal DNA in serum. PMID:10562808

Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis.

PubMed

Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao

2013-11-27

The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.

A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

PubMed

Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

2011-06-01

The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

Loop-mediated isothermal PCR (LAMP) for the diagnosis of falciparum malaria.

PubMed

Paris, Daniel H; Imwong, Mallika; Faiz, Abul M; Hasan, Mahtabuddin; Yunus, Emran Bin; Silamut, Kamolrat; Lee, Sue J; Day, Nicholas P J; Dondorp, Arjen M

2007-11-01

A recently described loop-mediated isothermal polymerase chain reaction (LAMP) for molecular detection of Plasmodium falciparum was compared with microscopy, PfHRP2-based rapid diagnostic test (RDT), and nested polymerase chain reaction (PCR) as the "gold standard" in 115 Bangladeshi in-patients with fever. DNA extraction for LAMP was conducted by conventional methods or simple heating of the sample; test results were either assessed visually or by gel electrophoresis. Conventional DNA extraction followed by gel electrophoresis had the highest agreement with the reference method (81.7%, kappa = 0.64), with a sensitivity (95% CI) of 76.1% (68.3-83.9%), comparable to RDT and microscopy, but a specificity of 89.6% (84.0-95.2%) compared with 100% for RDT and microscopy. DNA extraction by heat treatment deteriorated specificity to unacceptable levels. LAMP enables molecular diagnosis of falciparum malaria in settings with limited technical resources but will need further optimization. The results are in contrast with a higher accuracy reported in an earlier study comparing LAMP with a non-validated PCR method.

Chain Reaction Polymerization.

ERIC Educational Resources Information Center

McGrath, James E.

1981-01-01

The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

Characterizing Chain Processes in Visible Light Photoredox Catalysis

PubMed Central

Cismesia, Megan A.

2015-01-01

The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708

Sensitivity, specificity and comparison of three commercially available immunological tests in the diagnosis of Cryptosporidium species in animals.

PubMed

Danišová, Olga; Halánová, Monika; Valenčáková, Alexandra; Luptáková, Lenka

The study was conducted to compare the specificity of immunological diagnostic methods used for the diagnosis of Cryptosporidium species capable of causing life-threatening infection in both immunosuppressed and immunocompetent patients. For the detection of Cryptosporidium species in 79 animals with diarrhoea, we used three Copro-antigen tests: RIDASCREEN ® Cryptosporidium test, Cryptosporidium 2nd Generation (ELISA) and RIDA ® QUICK Cryptosporidium. For immunoassays we used positive and negative samples detected by means of polymerase chain reaction and validated by sequencing and nested polymerase chain reaction to confirm the presence six different species of Cryptosporidium species. Prevalence of cryptosporidiosis in the entire group determined by enzyme immunoassay, enzyme linked immunosorbent assay, immuno-chromatographic test and polymerase chain reaction was 34.17%, 27.84%, 6.33% and 27.84%, respectively. Sensitivity of animal samples with enzyme immunoassay, enzyme linked immunosorbent assay, and immuno-chromatographic test was 63.6%, 40.9% and 22.7%, resp., when questionable samples were considered positive, whereas specificity of enzyme immunoassay, enzyme linked immunosorbent assay and immuno-chromatographic test was 75.9%, 78.9% and 100%, respectively. Positive predictive values and negative predictive values were different for all the tests. These differences results are controversial and therefore reliability and reproducibility of immunoassays as the only diagnostic method is questionable. The use of various Cryptosporidium species in diagnosis based on immunological testing and different results obtained by individual tests indicate potential differences in Copro-antigens produced by individual Cryptosporidium species. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

2016-09-15

It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

Selection and Validation of Reference Genes for Quantitative Real-Time Polymerase Chain Reaction Studies in Mossy Maze Polypore, Cerrena unicolor (Higher Basidiomycetes).

PubMed

Yang, Jie; Lin, Qi; Lin, Juan; Ye, Xiuyun

2016-01-01

With its ability to produce ligninolytic enzymes such as laccases, white-rot basidiomycete Cerrena unicolor, a medicinal mushroom, has great potential in biotechnology. Elucidation of the expression profiles of genes encoding ligninolytic enzymes are important for increasing their production. Quantitative real-time polymerase chain reaction (qPCR) is a powerful tool to study transcriptional regulation of genes of interest. To ensure accuracy and reliability of qPCR analysis of C. unicolor, expression levels of seven candidate reference genes were studied at different growth phases, under various induction conditions, and with a range of carbon/nitrogen ratios and carbon and nitrogen sources. The stability of the genes were analyzed with five statistical approaches, namely geNorm, NormFinder, BestKeeper, the ΔCt method, and RefFinder. Our results indicated that the selection of reference genes varied with sample sets. A combination of four reference genes (Cyt-c, ATP6, TEF1, and β-tubulin) were recommended for normalizing gene expression at different growth phases. GAPDH and Cyt-c were the appropriate reference genes under different induction conditions. ATP6 and TEF1 were most stable in fermentation media with various carbon/nitrogen ratios. In the fermentation media with various carbon or nitrogen sources, 18S rRNA and GAPDH were the references of choice. The present study represents the first validation analysis of reference genes in C. unicolor and serves as a foundation for its qPCR analysis.

Using a bayesian latent class model to evaluate the utility of investigating persons with negative polymerase chain reaction results for pertussis.

PubMed

Tarr, Gillian A M; Eickhoff, Jens C; Koepke, Ruth; Hopfensperger, Daniel J; Davis, Jeffrey P; Conway, James H

2013-07-15

Pertussis remains difficult to control. Imperfect sensitivity of diagnostic tests and lack of specific guidance regarding interpretation of negative test results among patients with compatible symptoms may contribute to its spread. In this study, we examined whether additional pertussis cases could be identified if persons with negative pertussis test results were routinely investigated. We conducted interviews among 250 subjects aged ≤18 years with pertussis polymerase chain reaction (PCR) results reported from 2 reference laboratories in Wisconsin during July-September 2010 to determine whether their illnesses met the Centers for Disease Control and Prevention's clinical case definition (CCD) for pertussis. PCR validity measures were calculated using the CCD as the standard for pertussis disease. Two Bayesian latent class models were used to adjust the validity measures for pertussis detectable by 1) culture alone and 2) culture and/or more sensitive measures such as serology. Among 190 PCR-negative subjects, 54 (28%) had illnesses meeting the CCD. In adjusted analyses, PCR sensitivity and the negative predictive value were 1) 94% and 99% and 2) 43% and 87% in the 2 types of models, respectively. The models suggested that public health follow-up of reported pertussis patients with PCR-negative results leads to the detection of more true pertussis cases than follow-up of PCR-positive persons alone. The results also suggest a need for a more specific pertussis CCD.

Analytical validation of a real-time reverse transcription polymerase chain reaction test for Pan-American lineage H7 subtype Avian influenza viruses

USGS Publications Warehouse

Spackman, Erica; Ip, Hon S.; Suarez, D.L.; Slemons, R.D.; Stallknecht, D.E.

2008-01-01

A real-time reverse transcription polymerase chain reaction test for the identification of the H7 subtype in North American Avian influenza viruses (AIVs) was first reported in 2002; however, recent AIV surveillance efforts in wild birds and H7 outbreaks in poultry demonstrated that the 2002 test did not detect all H7 AIVs present in North and South America. Therefore, a new test, the 2008 Pan-American H7 test, was developed by using recently available H7 nucleotide sequences. The analytical specificity of the new assay was characterized with an RNA panel composed of 19 H7 viruses from around the world and RNA from all hemagglutinin subtypes except H16. Specificity for North and South American lineage H7 viruses was observed. Assay limits of detection were determined to be between 103 and 104 gene copies per reaction with in vitro transcribed RNA, and 100.0 and 10 0.8 50% egg infectious doses per reaction. The 2008 Pan-American H7 test also was shown to perform similarly to the 2002 test with specimens from chickens experimentally exposed to A/Chicken/BritishColumbia/314514-2/04 H7N3 highly pathogenic AIV. Furthermore, the 2008 test was able to detect 100% (n = 27) of the H7 AIV isolates recovered from North American wild birds in a 2006-2007 sample set (none of which were detected by the 2002 H7 test).

Lagrangian simulation of mixing and reactions in complex geochemical systems

NASA Astrophysics Data System (ADS)

Engdahl, Nicholas B.; Benson, David A.; Bolster, Diogo

2017-04-01

Simulations of detailed geochemical systems have traditionally been restricted to Eulerian reactive transport algorithms. This note introduces a Lagrangian method for modeling multicomponent reaction systems. The approach uses standard random walk-based methods for the particle motion steps but allows the particles to interact with each other by exchanging mass of their various chemical species. The colocation density of each particle pair is used to calculate the mass transfer rate, which creates a local disequilibrium that is then relaxed back toward equilibrium using the reaction engine PhreeqcRM. The mass exchange is the only step where the particles interact and the remaining transport and reaction steps are entirely independent for each particle. Several validation examples are presented, which reproduce well-known analytical solutions. These are followed by two demonstration examples of a competitive decay chain and an acid-mine drainage system. The source code, entitled Complex Reaction on Particles (CRP), and files needed to run these examples are hosted openly on GitHub (https://github.com/nbengdahl/CRP), so as to enable interested readers to readily apply this approach with minimal modifications.

Peroxy radical detection by chemical amplification (PERCA)

NASA Technical Reports Server (NTRS)

Stedman, D. H.

1986-01-01

Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.

Tangled nonlinear driven chain reactions of all optical singularities

NASA Astrophysics Data System (ADS)

Vasil'ev, V. I.; Soskin, M. S.

2012-03-01

Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

Implications of Measurement Assay Type in Design of HIV Experiments.

PubMed

Cannon, LaMont; Jagarapu, Aditya; Vargas-Garcia, Cesar A; Piovoso, Michael J; Zurakowski, Ryan

2017-12-01

Time series measurements of circular viral episome (2-LTR) concentrations enable indirect quantification of persistent low-level Human Immunodeficiency Virus (HIV) replication in patients on Integrase-Inhibitor intensified Combined Antiretroviral Therapy (cART). In order to determine the magnitude of these low level infection events, blood has to be drawn from a patients at a frequency and volume that is strictly regulated by the Institutional Review Board (IRB). Once the blood is drawn, the 2-LTR concentration is determined by quantifying the amount of HIV DNA present in the sample via a PCR (Polymerase Chain Reaction) assay. Real time quantitative Polymerase Chain Reaction (qPCR) is a widely used method of performing PCR; however, a newer droplet digital Polymerase Chain Reaction (ddPCR) method has been shown to provide more accurate quantification of DNA. Using a validated model of HIV viral replication, this paper demonstrates the importance of considering DNA quantification assay type when optimizing experiment design conditions. Experiments are optimized using a Genetic Algorithm (GA) to locate a family of suboptimal sample schedules which yield the highest fitness. Fitness is defined as the expected information gained in the experiment, measured by the Kullback-Leibler Divergence (KLD) between the prior and posterior distributions of the model parameters. We compare the information content of the optimized schedules to uniform schedules as well as two clinical schedules implemented by researchers at UCSF and the University of Melbourne. This work shows that there is a significantly greater gain information in experiments using a ddPCR assay vs. a qPCR assay and that certain experiment design considerations should be taken when using either assay.

First report of Toxoplasma gondii sporulated oocysts and Giardia duodenalis in commercial green-lipped mussels (Perna canaliculus) in New Zealand.

PubMed

Coupe, Alicia; Howe, Laryssa; Burrows, Elizabeth; Sine, Abigail; Pita, Anthony; Velathanthiri, Niluka; Vallée, Emilie; Hayman, David; Shapiro, Karen; Roe, Wendi D

2018-05-01

Pollution of marine ecosystems with the protozoan parasites Toxoplasma gondii, Cryptosporidium spp. and Giardia duodenalis can be studied using bivalve shellfish as biosentinels. Although evidence suggests that these parasites are present in New Zealand coastal waters, the extent of protozoal pollution has not been investigated. This study used optimised molecular methods to detect the presence of Cryptosporidium spp., G. duodenalis and T. gondii in commercially sourced green-lipped mussel (Perna canaliculus), an endemic species found throughout coastal New Zealand. A nested polymerase chain reaction was validated for detection of T. gondii DNA and applied to 104 commercially sourced mussels. Thirteen mussels were positive for T. gondii DNA with an estimated true prevalence of 16.4% using Bayesian statistics, and the presence of T. gondii in mussels was significantly associated with collection during the summer compared with that in the winter (P = 0.003). Consumption of contaminated shellfish may also pose a health risk for humans and marine wildlife. As only sporulated T. gondii oocysts can be infectious, a reverse transcriptase-polymerase chain reaction was used to confirm presence of a sporozoite-specific marker (SporoSAG), detected in four mussels. G. duodenalis assemblage B, known to be pathogenic in humans, was also discovered in 1% mussels, tested by polymerase chain reaction (n = 90). Cryptosporidium spp. was not detected in the sampled mussel haemolymph. Results suggest that New Zealand may have high levels of coastal contamination with T. gondii, particularly in summer months, and that naturally exposed mussels can ingest and retain sporulated oocysts, further establishing shellfish consumption as a health concern.

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection.

PubMed

Dacheux, Laurent; Larrous, Florence; Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

2016-07-01

The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus surveillance.

Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection

PubMed Central

Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

2016-01-01

The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus surveillance. PMID:27380028

Detection of Citrus leprosis virus C using specific primers and TaqMan probe in one-step real-time reverse-transcription polymerase chain reaction assays.

PubMed

Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H

2015-11-01

Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence. Published by Elsevier B.V.

Low-energy (anti)neutrino physics with Borexino: Neutrinos from the primary proton-proton fusion process in the Sun

NASA Astrophysics Data System (ADS)

Mosteiro, P.; Bellini, G.; Benziger, J.; Bick, D.; Bonfini, G.; Bravo, D.; Caccianiga, B.; Cadonati, L.; Calaprice, F.; Caminata, A.; Cavalcante, P.; Chavarría, Á.; Chepurnov, A.; D'Angelo, D.; Davini, S.; Derbin, A.; Empl, A.; Etenko, A.; Fomenko, K.; Franco, D.; Gabriele, F.; Galbiati, C.; Gazzana, S.; Ghiano, C.; Giammarchi, M.; Göger-Neff, M.; Goretti, A.; Gromov, M.; Hagner, C.; Hungerford, E.; Ianni, Al.; Ianni, An.; Kobychev, V.; Korablëv, D.; Korga, G.; Kryn, D.; Laubenstein, M.; Lehnert, B.; Lewke, T.; Litvinovich, E.; Lombardi, F.; Lombardi, P.; Ludhova, L.; Lukyanchenko, G.; Machulin, I.; Manecki, S.; Maneschg, W.; Marcocci, S.; Meindl, Q.; Meroni, E.; Meyer, M.; Miramonti, L.; Misiaszek, M.; Montuschi, M.; Muratova, V.; Oberauer, L.; Obolensky, M.; Ortica, F.; Otis, K.; Pallavicini, M.; Papp, L.; Perasso, L.; Pocar, A.; Ranucci, G.; Razeto, A.; Re, A.; Romani, A.; Rossi, N.; Saldanha, R.; Salvo, C.; Schönert, S.; Simgen, H.; Skorokhvatov, M.; Smirnov, O.; Sotnikov, A.; Sukhotin, S.; Suvorov, Y.; Tartaglia, R.; Testera, G.; Vignaud, D.; Vogelaar, R. B.; von Feilitzsch, F.; Wang, H.; Winter, J.; Wojcik, M.; Wright, A.; Wurm, M.; Zaimidoroga, O.; Zavatarelli, S.; Zuber, K.; Zuzel, G.

2015-08-01

The Sun is fueled by a series of nuclear reactions that produce the energy that makes it shine. The primary reaction is the fusion of two protons into a deuteron, a positron and a neutrino. These neutrinos constitute the vast majority of neutrinos reaching Earth, providing us with key information about what goes on at the core of our star. Several experiments have now confirmed the observation of neutrino oscillations by detecting neutrinos from secondary nuclear processes in the Sun; this is the first direct spectral measurement of the neutrinos from the keystone proton-proton fusion. This observation is a crucial step towards the completion of the spectroscopy of pp-chain neutrinos, as well as further validation of the LMA-MSW model of neutrino oscillations.

Development and validation of a SYBR Green I-based real-time polymerase chain reaction method for detection of haptoglobin gene deletion in clinical materials.

PubMed

Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro

2010-06-01

Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).

Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.

PubMed

Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava

2018-05-01

Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.

Chemical Action of Halogenated Agents in Fire Extinguishing

NASA Technical Reports Server (NTRS)

Belles, Frank E.

1955-01-01

The action of halogenated agents in preventing flame propagation in fuel-air mixtures in laboratory tests is discussed in terms of a possible chemical mechanism. The mechanism chosen is that of chain-breaking reactions between agent and active particles (hydrogen and oxygen atoms and hydroxyl radicsls). Data from the literature on the flammability peaks of n-heptane agent-air mixtures are treated. Ratings of agent effectiveness in terms of the fuel equivalent of the agent, based on both fuel and agent concentrations at the peak, are proposed as preferable to ratings in terms of agent concentration alone. These fuel-equivalent ratings are roughly correlated by reactivities assigned to halogen and hydrogen atoms in the agent molecules. It is concluded that the presence of hydrogen in agent need not reduce its fire-fighting ability, provided there is enough halogen to make the agent nonflammable. A method is presented for estimating from quenching-distance data a rate constant for the reaction of agent with active particles. A quantitative result is obtained for methyl bromide. This rate constant predicts the observed peak concentration of methyl bromide quite well. However, more data are needed to prove the validity of the method. The assumption that hal.ogenatedagents act mainly by chain-bresking reactions with active particles is consistent with the experimental facts and should help guide the selection of agents for further tests.

An improved and validated RNA HLA class I SBT approach for obtaining full length coding sequences.

PubMed

Gerritsen, K E H; Olieslagers, T I; Groeneweg, M; Voorter, C E M; Tilanus, M G J

2014-11-01

The functional relevance of human leukocyte antigen (HLA) class I allele polymorphism beyond exons 2 and 3 is difficult to address because more than 70% of the HLA class I alleles are defined by exons 2 and 3 sequences only. For routine application on clinical samples we improved and validated the HLA sequence-based typing (SBT) approach based on RNA templates, using either a single locus-specific or two overlapping group-specific polymerase chain reaction (PCR) amplifications, with three forward and three reverse sequencing reactions for full length sequencing. Locus-specific HLA typing with RNA SBT of a reference panel, representing the major antigen groups, showed identical results compared to DNA SBT typing. Alleles encountered with unknown exons in the IMGT/HLA database and three samples, two with Null and one with a Low expressed allele, have been addressed by the group-specific RNA SBT approach to obtain full length coding sequences. This RNA SBT approach has proven its value in our routine full length definition of alleles. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

PubMed

Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

2018-06-01

Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

Involvement of the chloroplast plastoquinone pool in the Mehler reaction.

PubMed

Vetoshkina, Daria V; Ivanov, Boris N; Khorobrykh, Sergey A; Proskuryakov, Ivan I; Borisova-Mubarakshina, Maria M

2017-09-01

Light-dependent oxygen reduction in the photosynthetic electron transfer chain, i.e. the Mehler reaction, has been studied using isolated pea thylakoids. The role of the plastoquinone pool in the Mehler reaction was investigated in the presence of dinitrophenyl ether of 2-iodo-4-nitrothymol (DNP-INT), the inhibitor of plastohydroquinone oxidation by cytochrome b6/f complex. Oxygen reduction rate in the presence of DNP-INT was higher than in the absence of the inhibitor in low light at pH 6.5 and 7.6, showing that the capacity of the plastoquinone pool to reduce molecular oxygen in this case exceeded that of the entire electron transfer chain. In the presence of DNP-INT, appearance of superoxide anion radicals outside thylakoid membrane represented approximately 60% of the total superoxide anion radicals produced. The remaining 40% of the produced superoxide anion radicals was suggested to be trapped by plastohydroquinone molecules within thylakoid membrane, leading to the formation of hydrogen peroxide (H 2 O 2 ). To validate the reaction of superoxide anion radical with plastohydroquinone, xanthine/xanthine oxidase system was integrated with thylakoid membrane in order to generate superoxide anion radical in close vicinity of plastohydroquinone. Addition of xanthine/xanthine oxidase to the thylakoid suspension resulted in a decrease in the reduction level of the plastoquinone pool in the light. The obtained data provide additional clarification of the aspects that the plastoquinone pool is involved in both reduction of oxygen to superoxide anion radicals and reduction of superoxide anion radicals to H 2 O 2 . Significance of the plastoquinone pool involvement in the Mehler reaction for the acclimation of plants to light conditions is discussed. © 2017 Scandinavian Plant Physiology Society.

Novel approach to quantitative polymerase chain reaction using real-time detection: application to the detection of gene amplification in breast cancer.

PubMed

Bièche, I; Olivi, M; Champème, M H; Vidaud, D; Lidereau, R; Vidaud, M

1998-11-23

Gene amplification is a common event in the progression of human cancers, and amplified oncogenes have been shown to have diagnostic, prognostic and therapeutic relevance. A kinetic quantitative polymerase-chain-reaction (PCR) method, based on fluorescent TaqMan methodology and a new instrument (ABI Prism 7700 Sequence Detection System) capable of measuring fluorescence in real-time, was used to quantify gene amplification in tumor DNA. Reactions are characterized by the point during cycling when PCR amplification is still in the exponential phase, rather than the amount of PCR product accumulated after a fixed number of cycles. None of the reaction components is limited during the exponential phase, meaning that values are highly reproducible in reactions starting with the same copy number. This greatly improves the precision of DNA quantification. Moreover, real-time PCR does not require post-PCR sample handling, thereby preventing potential PCR-product carry-over contamination; it possesses a wide dynamic range of quantification and results in much faster and higher sample throughput. The real-time PCR method, was used to develop and validate a simple and rapid assay for the detection and quantification of the 3 most frequently amplified genes (myc, ccndl and erbB2) in breast tumors. Extra copies of myc, ccndl and erbB2 were observed in 10, 23 and 15%, respectively, of 108 breast-tumor DNA; the largest observed numbers of gene copies were 4.6, 18.6 and 15.1, respectively. These results correlated well with those of Southern blotting. The use of this new semi-automated technique will make molecular analysis of human cancers simpler and more reliable, and should find broad applications in clinical and research settings.

Topological dynamics of optical singularities in speckle-fields induced by photorefractive scattering in a LiNbO{sub 3} : Fe crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vasil'ev, Vasilii I; Soskin, M S

2013-02-28

A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less

A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

PubMed

Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

2014-01-01

A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

A Two-Step Lyssavirus Real-Time Polymerase Chain Reaction Using Degenerate Primers with Superior Sensitivity to the Fluorescent Antigen Test

PubMed Central

Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael

2014-01-01

A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible. PMID:24822188

Short-term application of dexamethasone on stem cells derived from human gingiva reduces the expression of RUNX2 and β-catenin.

PubMed

Kim, Bo-Bae; Kim, Minji; Park, Yun-Hee; Ko, Youngkyung; Park, Jun-Beom

2017-06-01

Objective Next-generation sequencing was performed to evaluate the effects of short-term application of dexamethasone on human gingiva-derived mesenchymal stem cells. Methods Human gingiva-derived stem cells were treated with a final concentration of 10 -7  M dexamethasone and the same concentration of vehicle control. This was followed by mRNA sequencing and data analysis, gene ontology and pathway analysis, quantitative real-time polymerase chain reaction of mRNA, and western blot analysis of RUNX2 and β-catenin. Results In total, 26,364 mRNAs were differentially expressed. Comparison of the results of dexamethasone versus control at 2 hours revealed that 7 mRNAs were upregulated and 25 mRNAs were downregulated. The application of dexamethasone reduced the expression of RUNX2 and β-catenin in human gingiva-derived mesenchymal stem cells. Conclusion The effects of dexamethasone on stem cells were evaluated with mRNA sequencing, and validation of the expression was performed with qualitative real-time polymerase chain reaction and western blot analysis. The results of this study can provide new insights into the role of mRNA sequencing in maxillofacial areas.

A Blood-based Test for the Detection of ROS1 and RET Fusion Transcripts from Circulating Ribonucleic Acid Using Digital Polymerase Chain Reaction

PubMed Central

Mellert, Hestia S.; Alexander, Kristin E.; Jackson, Leisa P.; Pestano, Gary A.

2018-01-01

We have developed novel methods for the isolation and characterization of tumor-derived circulating ribonucleic acid (cRNA) for blood-based liquid biopsy. Robust detection of cRNA recovered from blood represents a solution to a critical unmet need in clinical diagnostics. The test begins with the collection of whole blood into blood collection tubes containing preservatives that stabilize cRNA. Cell-free, exosomal, and platelet-associated RNA is isolated from plasma in this test system. The cRNA is reverse transcribed to complementary DNA (cDNA) and amplified using digital polymerase chain reaction (dPCR). Samples are evaluated for both the target biomarker as well as a control gene. Test validation included limit of detection, accuracy, and robustness studies with analytic samples. The method developed as a result of these studies reproducibly detect multiple fusion variants for ROS1 (C-Ros proto-oncogene 1; 8 variants) and RET (rearranged during transfection proto-oncogene; 8 variants). The sample processing workflow has been optimized so that test results can consistently be generated within 72 hours of sample receipt. PMID:29683453

Real-time PCR assay for the diagnosis of pleural tuberculosis

PubMed Central

Cárdenas Bernal, Ana María; Giraldo-Cadavid, Luis Fernando; Prieto Diago, Enrique; Santander, Sandra Paola

2017-01-01

Abstract Introduction: The diagnosis of pleural tuberculosis requires an invasive and time-consuming reference method. Polymerase chain reaction (PCR) is rapid, but validation in pleural tuberculosis is still weak. Objective: To establish the operating characteristics of real-time polymerase chain reaction (RT-PCR) hybridization probes for the diagnosis of pleural tuberculosis. Methods: The validity of the RT-PCR hybridization probes was evaluated compared to a composite reference method by a cross-sectional study at the Hospital Universitario de la Samaritana. 40 adults with lymphocytic pleural effusion were included. Pleural tuberculosis was confirmed (in 9 patients) if the patient had at least one of three tests using the positive reference method: Ziehl-Neelsen or Mycobacterium tuberculosis culture in fluid or pleural tissue, or pleural biopsy with granulomas. Pleural tuberculosis was ruled out (in 31 patients) if all three tests were negative. The operating characteristics of the RT-PCR, using the Mid-P Exact Test, were determined using the OpenEpi 2.3 Software (2009). Results: The RT-PCR hybridization probes showed a sensitivity of 66.7% (95% CI: 33.2%-90.7%) and a specificity of 93.5% (95% CI: 80.3%-98.9%). The PPV was 75.0% (95% CI: 38.8%-95.6%) and a NPV of 90.6% (95% CI: 76.6%-97.6%). Two false positives were found for the test, one with pleural mesothelioma and the other with chronic pleuritis with mesothelial hyperplasia. Conclusions: The RT-PCR hybridization probes had good specificity and acceptable sensitivity, but a negative value cannot rule out pleural tuberculosis. PMID:29021638

Real-Time Reverse-Transcription Quantitative Polymerase Chain Reaction Assay Is a Feasible Method for the Relative Quantification of Heregulin Expression in Non-Small Cell Lung Cancer Tissue.

PubMed

Kristof, Jessica; Sakrison, Kellen; Jin, Xiaoping; Nakamaru, Kenji; Schneider, Matthias; Beckman, Robert A; Freeman, Daniel; Spittle, Cindy; Feng, Wenqin

2017-01-01

In preclinical studies, heregulin ( HRG ) expression was shown to be the most relevant predictive biomarker for response to patritumab, a fully human anti-epidermal growth factor receptor 3 monoclonal antibody. In support of a phase 2 study of erlotinib ± patritumab in non-small cell lung cancer (NSCLC), a reverse-transcription quantitative polymerase chain reaction (RT-qPCR) assay for relative quantification of HRG expression from formalin-fixed paraffin-embedded (FFPE) NSCLC tissue samples was developed and validated and described herein. Test specimens included matched FFPE normal lung and NSCLC and frozen NSCLC tissue, and HRG -positive and HRG -negative cell lines. Formalin-fixed paraffin-embedded tissue was examined for functional performance. Heregulin distribution was also analyzed across 200 NSCLC commercial samples. Applied Biosystems TaqMan Gene Expression Assays were run on the Bio-Rad CFX96 real-time PCR platform. Heregulin RT-qPCR assay specificity, PCR efficiency, PCR linearity, and reproducibility were demonstrated. The final assay parameters included the Qiagen FFPE RNA Extraction Kit for RNA extraction from FFPE NSCLC tissue, 50 ng of RNA input, and 3 reference (housekeeping) genes ( HMBS, IPO8 , and EIF2B1 ), which had expression levels similar to HRG expression levels and were stable among FFPE NSCLC samples. Using the validated assay, unimodal HRG distribution was confirmed across 185 evaluable FFPE NSCLC commercial samples. Feasibility of an RT-qPCR assay for the quantification of HRG expression in FFPE NSCLC specimens was demonstrated.

Acetylene chain reaction on hydrogenated boron nitride monolayers: a density functional theory study.

PubMed

Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru

2017-11-28

Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.

Real Time Polymerase Chain Reaction (rt-PCR): A New Patent to Diagnostic Purposes for Paracoccidioidomycosis.

PubMed

Rocha-Silva, Fabiana; Gomes, Luciana I; Gracielle-Melo, Cidiane; Goes, Alfredo M; Caligiorne, Rachel B

2017-01-01

Paracoccidioidomycosis (PCM) is a systemic mycosis caused by dimorphic fungi Paracoccidioides brasiliensis and Paracoccidioides lutzii. It is prevalent in Latin American, mainly in Brazil. Therefore, PCM has fundamental impact on the Brazilian global economy, especially in public health system, since it is affecting economical active population in different country regions. The present study aimed to standardize the Real Time-Polymerase Chain Reaction (rt-PCR) for an efficient and safe PCM diagnosis amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. To standardize a methodology of rt-PCR using species-specific primers and probe designed for annealing in this specific region of the fungi´s genome, amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. Followed by design in silico, experiments were performed in vitro to determine rt-PCR specificity, efficiency and genome detection limit. The primers and probe sequences were deposited in Brazilian Coordination of Technological Innovation and Transfer (CTIT), under patent reference number BR1020160078830. The present study demonstrated the rt-PCR applicability for support on diagnosis of paracoccidioidomycosis, presenting low cost, which makes it affordable for public health services in developing countries as Brazil. It is noteworthy that it is necessary to validate this methodology using clinical samples before to use as a safe method of diagnosis. A review of all patents related to this topic was performed and it was shown that, to date, there are no records of patent on kits for paracoccidioidomycosis´s diagnostic. Indeed, there is still a lot to go to reach this goal. The reaction developed was standardized and patented, opening perspectives to molecular diagnosis development for paracoccidioidomycosis, since rt-PCR can be applied to a broad spectrum of infectious diseases. It would need to be tested in biological samples in order to validate this method and then generate a diagnostic kit for Paracoccidioidomycosis. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Supplement to Theory of Neutron Chain Reactions

DOE R&D Accomplishments Database

Weinberg, Alvin M.; Noderer, L. C.

1952-05-26

General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

miR-758-3p: a blood-based biomarker that’s influence on the expression of CERP/ABCA1 may contribute to the progression of obesity to metabolic syndrome

PubMed Central

O’Neill, Sadhbh; Larsen, Mette Bohl; Gregersen, Søren; Hermansen, Kjeld; O’Driscoll, Lorraine

2018-01-01

Due to increasing prevalence of obesity, a simple method or methods for the diagnosis of metabolic syndrome are urgently required to reduce the risk of associated cardiovascular disease, diabetes and cancer. This study aimed to identify a miRNA biomarker that may distinguish metabolic syndrome from obesity and to investigate if such a miRNA may have functional relevance for metabolic syndrome. 52 adults with clinical obesity (n=26) or metabolic syndrome (n=26) were recruited. Plasma specimens were procured from all and were randomly designated to discovery and validation cohorts. miRNA discovery profiling was performed, using array technology, on plasma RNA. Validation was performed by quantitative polymerase chain reaction. The functional effect of miR-758-3p on its predicted target, cholesterol efflux regulatory protein/ATP-binding cassette transporter, was investigated using HepG2 liver cells. Custom miRNA profiling of 25 miRNAs in the discovery cohort found miR-758-3p to be detected in the obese cohort but undetected in the metabolic syndrome cohort. miR-758-3p was subsequently validated as a potential biomarker for metabolic syndrome by quantitative polymerase chain reaction. Bioinformatics analysis identified cholesterol efflux regulatory protein/ATP-binding cassette transporter as miR-758-3p’s predicted target. Specifically, mimicking miR-758-3p in HepG2 cells suppressed cholesterol efflux regulatory protein/ATP-binding cassette transporter protein expression; conversely, inhibiting miR-758-3p increased cholesterol efflux regulatory protein/ATP-binding cassette transporter protein expression. miR-758-3p holds potential as a blood-based biomarker for distinguishing progression from obesity to metabolic syndrome and as a driver in controlling cholesterol efflux regulatory protein/ATP-binding cassette transporter expression, indicating it potential role in cholesterol control in metabolic syndrome. PMID:29507696

Validation of the SHOX2/PTGER4 DNA Methylation Marker Panel for Plasma-Based Discrimination between Patients with Malignant and Nonmalignant Lung Disease.

PubMed

Weiss, Gunter; Schlegel, Anne; Kottwitz, Denise; König, Thomas; Tetzner, Reimo

2017-01-01

Low-dose computed tomography (LDCT) is used for screening for lung cancer (LC) in high-risk patients in the United States. The definition of high risk and the impact of frequent false-positive results of low-dose computed tomography remains a challenge. DNA methylation biomarkers are valuable noninvasive diagnostic tools for cancer detection. This study reports on the evaluation of methylation markers in plasma DNA for LC detection and discrimination of malignant from nonmalignant lung disease. Circulating DNA was extracted from 3.5-mL plasma samples, treated with bisulfite using a commercially available kit, purified, and assayed by real-time polymerase chain reaction for assessment of DNA methylation of short stature homeobox 2 gene (SHOX2), prostaglandin E receptor 4 gene (PTGER4), and forkhead box L2 gene (FOXL2). In three independent case-control studies these assays were evaluated and optimized. The resultant assay, a triplex polymerase chain reaction combining SHOX2, PTGER4, and the reference gene actin, beta gene (ACTB), was validated using plasma from patients with and without malignant disease. A panel of SHOX2 and PTGER4 provided promising results in three independent case-control studies examining a total of 330 plasma specimens (area under the receiver operating characteristic curve = 91%-98%). A validation study with 172 patient samples demonstrated significant discriminatory performance in distinguishing patients with LC from subjects without malignancy (area under the curve = 0.88). At a fixed specificity of 90%, sensitivity for LC was 67%; at a fixed sensitivity of 90%, specificity was 73%. Measurement of SHOX2 and PTGER4 methylation in plasma DNA allowed detection of LC and differentiation of nonmalignant diseases. Development of a diagnostic test based on this panel may provide clinical utility in combination with current imaging techniques to improve LC risk stratification. Copyright © 2016 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

miR-758-3p: a blood-based biomarker that's influence on the expression of CERP/ABCA1 may contribute to the progression of obesity to metabolic syndrome.

PubMed

O'Neill, Sadhbh; Larsen, Mette Bohl; Gregersen, Søren; Hermansen, Kjeld; O'Driscoll, Lorraine

2018-02-06

Due to increasing prevalence of obesity, a simple method or methods for the diagnosis of metabolic syndrome are urgently required to reduce the risk of associated cardiovascular disease, diabetes and cancer. This study aimed to identify a miRNA biomarker that may distinguish metabolic syndrome from obesity and to investigate if such a miRNA may have functional relevance for metabolic syndrome. 52 adults with clinical obesity (n=26) or metabolic syndrome (n=26) were recruited. Plasma specimens were procured from all and were randomly designated to discovery and validation cohorts. miRNA discovery profiling was performed, using array technology, on plasma RNA. Validation was performed by quantitative polymerase chain reaction. The functional effect of miR-758-3p on its predicted target, cholesterol efflux regulatory protein/ATP-binding cassette transporter, was investigated using HepG2 liver cells. Custom miRNA profiling of 25 miRNAs in the discovery cohort found miR-758-3p to be detected in the obese cohort but undetected in the metabolic syndrome cohort. miR-758-3p was subsequently validated as a potential biomarker for metabolic syndrome by quantitative polymerase chain reaction. Bioinformatics analysis identified cholesterol efflux regulatory protein/ATP-binding cassette transporter as miR-758-3p's predicted target. Specifically, mimicking miR-758-3p in HepG2 cells suppressed cholesterol efflux regulatory protein/ATP-binding cassette transporter protein expression; conversely, inhibiting miR-758-3p increased cholesterol efflux regulatory protein/ATP-binding cassette transporter protein expression. miR-758-3p holds potential as a blood-based biomarker for distinguishing progression from obesity to metabolic syndrome and as a driver in controlling cholesterol efflux regulatory protein/ATP-binding cassette transporter expression, indicating it potential role in cholesterol control in metabolic syndrome.

Expression of Biglycan in First Trimester Chorionic Villous Sampling Placental Samples and Altered Function in Telomerase-Immortalized Microvascular Endothelial Cells.

PubMed

Chui, Amy; Gunatillake, Tilini; Brennecke, Shaun P; Ignjatovic, Vera; Monagle, Paul T; Whitelock, John M; van Zanten, Dagmar E; Eijsink, Jasper; Wang, Yao; Deane, James; Borg, Anthony J; Stevenson, Janet; Erwich, Jan Jaap; Said, Joanne M; Murthi, Padma

2017-06-01

Biglycan (BGN) has reduced expression in placentae from pregnancies complicated by fetal growth restriction (FGR). We used first trimester placental samples from pregnancies with later small for gestational age (SGA) infants as a surrogate for FGR. The functional consequences of reduced BGN and the downstream targets of BGN were determined. Furthermore, the expression of targets was validated in primary placental endothelial cells isolated from FGR or control pregnancies. APPROACH AND RESULTS: BGN expression was determined using real-time polymerase chain reaction in placental tissues collected during chorionic villous sampling performed at 10 to 12 weeks' gestation from pregnancies that had known clinical outcomes, including SGA. Short-interference RNA reduced BGN expression in telomerase-immortalized microvascular endothelial cells, and the effect on proliferation, angiogenesis, and thrombin generation was determined. An angiogenesis array identified downstream targets of BGN, and their expression in control and FGR primary placental endothelial cells was validated using real-time polymerase chain reaction. Reduced BGN expression was observed in SGA placental tissues. BGN reduction decreased network formation of telomerase-immortalized microvascular endothelial cells but did not affect thrombin generation or cellular proliferation. The array identified target genes, which were further validated: angiopoetin 4 ( ANGPT4 ), platelet-derived growth factor receptor α ( PDGFRA ), tumor necrosis factor superfamily member 15 ( TNFSF15 ), angiogenin ( ANG ), serpin family C member 1 ( SERPIN1 ), angiopoietin 2 ( ANGPT2 ), and CXC motif chemokine 12 ( CXCL12 ) in telomerase-immortalized microvascular endothelial cells and primary placental endothelial cells obtained from control and FGR pregnancies. This study reports a temporal relationship between altered placental BGN expression and subsequent development of SGA. Reduction of BGN in vascular endothelial cells leads to disrupted network formation and alterations in the expression of genes involved in angiogenesis. Therefore, differential expression of these may contribute to aberrant angiogenesis in SGA pregnancies. © 2017 American Heart Association, Inc.

Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

PubMed

Zhou, Yu; Pearson, John E; Auerbach, Anthony

2005-12-01

We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

PubMed

Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

2017-11-01

Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

Rubber elasticity for percolation network consisting of Gaussian chains.

PubMed

Nishi, Kengo; Noguchi, Hiroshi; Sakai, Takamasa; Shibayama, Mitsuhiro

2015-11-14

A theory describing the elastic modulus for percolation networks of Gaussian chains on general lattices such as square and cubic lattices is proposed and its validity is examined with simulation and mechanical experiments on well-defined polymer networks. The theory was developed by generalizing the effective medium approximation (EMA) for Hookian spring network to Gaussian chain networks. From EMA theory, we found that the ratio of the elastic modulus at p, G to that at p = 1, G0, must be equal to G/G0 = (p - 2/f)/(1 - 2/f) if the position of sites can be determined so as to meet the force balance, where p is the degree of cross-linking reaction. However, the EMA prediction cannot be applicable near its percolation threshold because EMA is a mean field theory. Thus, we combine real-space renormalization and EMA and propose a theory called real-space renormalized EMA, i.e., REMA. The elastic modulus predicted by REMA is in excellent agreement with the results of simulations and experiments of near-ideal diamond lattice gels.

Rubber elasticity for percolation network consisting of Gaussian chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishi, Kengo, E-mail: kengo.nishi@phys.uni-goettingen.de, E-mail: sakai@tetrapod.t.u-tokyo.ac.jp, E-mail: sibayama@issp.u-tokyo.ac.jp; Noguchi, Hiroshi; Shibayama, Mitsuhiro, E-mail: kengo.nishi@phys.uni-goettingen.de, E-mail: sakai@tetrapod.t.u-tokyo.ac.jp, E-mail: sibayama@issp.u-tokyo.ac.jp

2015-11-14

A theory describing the elastic modulus for percolation networks of Gaussian chains on general lattices such as square and cubic lattices is proposed and its validity is examined with simulation and mechanical experiments on well-defined polymer networks. The theory was developed by generalizing the effective medium approximation (EMA) for Hookian spring network to Gaussian chain networks. From EMA theory, we found that the ratio of the elastic modulus at p, G to that at p = 1, G{sub 0}, must be equal to G/G{sub 0} = (p − 2/f)/(1 − 2/f) if the position of sites can be determined somore » as to meet the force balance, where p is the degree of cross-linking reaction. However, the EMA prediction cannot be applicable near its percolation threshold because EMA is a mean field theory. Thus, we combine real-space renormalization and EMA and propose a theory called real-space renormalized EMA, i.e., REMA. The elastic modulus predicted by REMA is in excellent agreement with the results of simulations and experiments of near-ideal diamond lattice gels.« less

An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.

PubMed

Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján

2016-02-20

In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.

An Experimental and Kinetic Modeling Study of Methyl Decanoate Combustion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sarathy, S M; Thomson, M J; Pitz, W J

2009-12-04

Biodiesel is a mixture of long chain fatty acid methyl esters derived from fats and oils. This research study presents opposed-flow diffusion flame data for one large fatty acid methyl ester, methyl decanoate, and uses the experiments to validate an improved skeletal mechanism consisting of 648 species and 2998 reactions. The results indicate that methyl decanoate is consumed via abstraction of hydrogen atoms to produce fuel radicals, which lead to the production of alkenes. The ester moiety in methyl decanoate leads to the formation of low molecular weight oxygenated compounds such as carbon monoxide, formaldehyde, and ketene.

Methods for detection of GMOs in food and feed.

PubMed

Marmiroli, Nelson; Maestri, Elena; Gullì, Mariolina; Malcevschi, Alessio; Peano, Clelia; Bordoni, Roberta; De Bellis, Gianluca

2008-10-01

This paper reviews aspects relevant to detection and quantification of genetically modified (GM) material within the feed/food chain. The GM crop regulatory framework at the international level is evaluated with reference to traceability and labelling. Current analytical methods for the detection, identification, and quantification of transgenic DNA in food and feed are reviewed. These methods include quantitative real-time PCR, multiplex PCR, and multiplex real-time PCR. Particular attention is paid to methods able to identify multiple GM events in a single reaction and to the development of microdevices and microsensors, though they have not been fully validated for application.

Application of Droplet Digital PCR to Validate Rift Valley Fever Vaccines.

PubMed

Ly, Hoai J; Lokugamage, Nandadeva; Ikegami, Tetsuro

2016-01-01

Droplet Digital™ polymerase chain reaction (ddPCR™) is a promising technique that quantitates the absolute concentration of nucleic acids in a given sample. This technique utilizes water-in-oil emulsion technology, a system developed by Bio-Rad Laboratories that partitions a single sample into thousands of nanoliter-sized droplets and counts nucleic acid molecules encapsulated in each individual particle as one PCR reaction. This chapter discusses the applications and methodologies of ddPCR for development of Rift Valley fever (RVF) vaccine, using an example that measures RNA copy numbers of a live-attenuated MP-12 vaccine from virus stocks, infected cells, or animal blood. We also discuss how ddPCR detects a reversion mutant of MP-12 from virus stocks accurately. The use of ddPCR improves the quality control of live-attenuated vaccines in the seed lot systems.

Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

PubMed

Umamaheswari, A; Venkateswarlu, K

2004-06-01

Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

PubMed

Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

2006-07-01

We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

Evaluation of RealStar Reverse Transcription–Polymerase Chain Reaction Kits for Filovirus Detection in the Laboratory and Field

PubMed Central

Rieger, Toni; Kerber, Romy; El Halas, Hussein; Pallasch, Elisa; Duraffour, Sophie; Günther, Stephan; Ölschläger, Stephan

2016-01-01

Background. Diagnosis of Ebola virus (EBOV) disease (EVD) requires laboratory testing. Methods. The RealStar Filovirus Screen reverse transcription–polymerase chain reaction (RT-PCR) kit and the derived RealStar Zaire Ebolavirus RT-PCR kit were validated using in vitro transcripts, supernatant of infected cell cultures, and clinical specimens from patients with EVD. Results. The Filovirus Screen kit detected EBOV, Sudan virus, Taï Forest virus, Bundibugyo virus, Reston virus, and Marburg virus and differentiated between the genera Ebolavirus and Marburgvirus. The amount of filovirus RNA that could be detected with a probability of 95% ranged from 11 to 67 RNA copies/reaction on a LightCycler 480 II. The Zaire Ebolavirus kit is based on the Filovirus Screen kit but was optimized for detection of EBOV. It has an improved signal-to-noise ratio at low EBOV RNA concentrations and is somewhat more sensitive than the Filovirus kit. Both kits show significantly lower analytical sensitivity on a SmartCycler II. Clinical evaluation revealed that the SmartCycler II, compared with other real-time PCR platforms, decreases the clinical sensitivity of the Filovirus Screen kit to diagnose EVD at an early stage. Conclusions. The Filovirus Screen kit detects all human-pathogenic filoviruses with good analytical sensitivity if performed on an appropriate real-time PCR platform. High analytical sensitivity is important for early diagnosis of EVD. PMID:27549586

Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR

PubMed Central

Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao

2012-01-01

AIM: To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. METHODS: Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. RESULTS: cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. CONCLUSION: The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well. PMID:22294830

Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR.

PubMed

Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao

2012-01-21

To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well.

Validation of Geno-Sen's Scrub Typhus Real Time Polymerase Chain Reaction Kit by its Comparison with a Serological ELISA Test

PubMed Central

Anitharaj, Velmurugan; Stephen, Selvaraj; Pradeep, Jothimani; Pooja, Pratheesh; Preethi, Sridharan

2017-01-01

Background: In the recent past, scrub typhus (ST) has been reported from different parts of India, based on Weil-Felix/enzyme-linked immunosorbent assay (ELISA)/indirect immunofluorescence assay (IFA). Molecular tests are applied only by a few researchers. Aims: Evaluation of a new commercial real time polymerase chain reaction (PCR) kit for molecular diagnosis of ST by comparing it with the commonly used IgM ELISA is our aim. Settings and Design: ST has been reported all over India including Puducherry and surrounding Tamil Nadu and identified as endemic for ST. This study was designed to correlate antibody detection by IgM ELISA and Orientia tsutsugamushi DNA in real time PCR. Materials and Methods: ST IgM ELISA (InBios Inc., USA) was carried out for 170 consecutive patients who presented with the symptoms of acute ST during 11 months (November, 2015– September, 2016). All 77 of these patients with IgM ELISA positivity and 49 of 93 IgM ELISA negative patients were subjected to real time PCR (Geno-Sen's ST real time PCR, Himachal Pradesh, India). Statistical Analysis: Statistical analysis for clinical and laboratory results was performed using IBM SPSS Statistics 17 for Windows (SPSS Inc., Chicago, USA). Chi-square test with Yates correction (Fisher's test) was employed for a small number of samples. Results and Conclusion: Among 77 suspected cases of acute ST with IgM ELISA positivity and 49 IgM negative patients, 42 and 7 were positive, respectively, for O. tsutsugamushi 56-kDa type-specific gene in real time PCR kit. Until ST IFA, the gold standard diagnostic test, is properly validated in India, diagnosis of acute ST will depend on both ELISA and quantitative PCR. PMID:28878522

Validation of Geno-Sen's Scrub Typhus Real Time Polymerase Chain Reaction Kit by its Comparison with a Serological ELISA Test.

PubMed

Anitharaj, Velmurugan; Stephen, Selvaraj; Pradeep, Jothimani; Pooja, Pratheesh; Preethi, Sridharan

2017-01-01

In the recent past, scrub typhus (ST) has been reported from different parts of India, based on Weil-Felix/enzyme-linked immunosorbent assay (ELISA)/indirect immunofluorescence assay (IFA). Molecular tests are applied only by a few researchers. Evaluation of a new commercial real time polymerase chain reaction (PCR) kit for molecular diagnosis of ST by comparing it with the commonly used IgM ELISA is our aim. ST has been reported all over India including Puducherry and surrounding Tamil Nadu and identified as endemic for ST. This study was designed to correlate antibody detection by IgM ELISA and Orientia tsutsugamushi DNA in real time PCR. ST IgM ELISA (InBios Inc., USA) was carried out for 170 consecutive patients who presented with the symptoms of acute ST during 11 months (November, 2015- September, 2016). All 77 of these patients with IgM ELISA positivity and 49 of 93 IgM ELISA negative patients were subjected to real time PCR (Geno-Sen's ST real time PCR, Himachal Pradesh, India). Statistical analysis for clinical and laboratory results was performed using IBM SPSS Statistics 17 for Windows (SPSS Inc., Chicago, USA). Chi-square test with Yates correction (Fisher's test) was employed for a small number of samples. Among 77 suspected cases of acute ST with IgM ELISA positivity and 49 IgM negative patients, 42 and 7 were positive, respectively, for O. tsutsugamushi 56-kDa type-specific gene in real time PCR kit. Until ST IFA, the gold standard diagnostic test, is properly validated in India, diagnosis of acute ST will depend on both ELISA and quantitative PCR.

Use of Artificial Intelligence and Machine Learning Algorithms with Gene Expression Profiling to Predict Recurrent Nonmuscle Invasive Urothelial Carcinoma of the Bladder.

PubMed

Bartsch, Georg; Mitra, Anirban P; Mitra, Sheetal A; Almal, Arpit A; Steven, Kenneth E; Skinner, Donald G; Fry, David W; Lenehan, Peter F; Worzel, William P; Cote, Richard J

2016-02-01

Due to the high recurrence risk of nonmuscle invasive urothelial carcinoma it is crucial to distinguish patients at high risk from those with indolent disease. In this study we used a machine learning algorithm to identify the genes in patients with nonmuscle invasive urothelial carcinoma at initial presentation that were most predictive of recurrence. We used the genes in a molecular signature to predict recurrence risk within 5 years after transurethral resection of bladder tumor. Whole genome profiling was performed on 112 frozen nonmuscle invasive urothelial carcinoma specimens obtained at first presentation on Human WG-6 BeadChips (Illumina®). A genetic programming algorithm was applied to evolve classifier mathematical models for outcome prediction. Cross-validation based resampling and gene use frequencies were used to identify the most prognostic genes, which were combined into rules used in a voting algorithm to predict the sample target class. Key genes were validated by quantitative polymerase chain reaction. The classifier set included 21 genes that predicted recurrence. Quantitative polymerase chain reaction was done for these genes in a subset of 100 patients. A 5-gene combined rule incorporating a voting algorithm yielded 77% sensitivity and 85% specificity to predict recurrence in the training set, and 69% and 62%, respectively, in the test set. A singular 3-gene rule was constructed that predicted recurrence with 80% sensitivity and 90% specificity in the training set, and 71% and 67%, respectively, in the test set. Using primary nonmuscle invasive urothelial carcinoma from initial occurrences genetic programming identified transcripts in reproducible fashion, which were predictive of recurrence. These findings could potentially impact nonmuscle invasive urothelial carcinoma management. Copyright © 2016 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Development and validation of a Pneumocystis jirovecii real-time polymerase chain reaction assay for diagnosis of Pneumocystis pneumonia

PubMed Central

Church, Deirdre L; Ambasta, Anshula; Wilmer, Amanda; Williscroft, Holly; Ritchie, Gordon; Pillai, Dylan R; Champagne, Sylvie; Gregson, Daniel G

2015-01-01

BACKGROUND: Pneumocystis jirovecii (PJ), a pathogenic fungus, causes severe interstitial Pneumocystis pneumonia (PCP) among immunocompromised patients. A laboratory-developed real-time polyermase chain reaction (PCR) assay was validated for PJ detection to improve diagnosis of PCP. METHODS: Forty stored bronchoalveolar lavage (BAL) samples (20 known PJ positive [PJ+] and 20 known PJ negative [PJ−]) were initially tested using the molecular assay. Ninety-two sequentially collected BAL samples were then analyzed using an immunofluorescence assay (IFA) and secondarily tested using the PJ real-time PCR assay. Discrepant results were resolved by retesting BAL samples using another real-time PCR assay with a different target. PJ real-time PCR assay performance was compared with the existing gold standard (ie, IFA) and a modified gold standard, in which a true positive was defined as a sample that tested positive in two of three methods in a patient suspected to have PCP. RESULTS: Ninety of 132 (68%) BAL fluid samples were collected from immunocompromised patients. Thirteen of 92 (14%) BALs collected were PJ+ when tested using IFA. A total of 40 BAL samples were PJ+ in the present study including: all IFA positive samples (n=13); all referred PJ+ BAL samples (n=20); and seven additional BAL samples that were IFA negative, but positive using the modified gold standard. Compared with IFA, the PJ real-time PCR had sensitivity, specificity, and positive and negative predictive values of 100%, 91%, 65% and 100%, respectively. Compared with the modified gold standard, PJ real-time PCR had a sensitivity, specificity, and positive and negative predictive values of 100%. CONCLUSION: PJ real-time PCR improved detection of PJ in immunocompromised patients. PMID:26600815

A Study of Mercury Methylation Genetics: Qualitative and Quantitative Analysis of hgcAB in Pure Culture

NASA Astrophysics Data System (ADS)

Christensen, G. A.; Wymore, A. M.; King, A. J.; Podar, M.; Hurt, R. A., Jr.; Santillan, E. F. U.; Gilmour, C. C.; Brandt, C. C.; Brown, S. D.; Palumbo, A. V.; Elias, D. A.

2015-12-01

Two proteins (HgcA and HgcB) have been determined to be essential for mercury (Hg)-methylation and either one alone is not sufficient for this process. Detection and quantification of these genes to determine at risk environments is critical. Universal degenerate polymerase chain reaction (PCR) primers spanning hgcAB were developed to ascertain organismal diversity and validate that both genes were present as an established prerequisite for Hg-methylation. To confirm this approach, an extensive set of pure cultures with published genomes (including methylators and non-methylators: 13 Deltaproteobacteria, 9 Firmicutes, and 10 methanogenic Archaea) were assayed with the newly designed universal hgcAB primer set. A single band within an agarose gel was observed for the majority of the cultures with known hgcAB and confirmed via Sanger sequencing. For environmental applications, once the potential for Hg-methylation is established from PCR amplification with the universal hgcAB primer set, quantification of clade-specific hgcAB gene abundance is desirable. We developed quantitative polymerase chain reaction (qPCR) degenerate primers targeting hgcA from each of the three dominate clades (Deltaproteobacteria, Firmicutes and methanogenic Archaea) known to be associated with anaerobic Hg-methylation. The qPCR primers amplify virtually all hgcA positive cultures overall and are specific for their designed clade. Finally, to ensure the procedure is robust and sensitive in complex environmental matrices, cells from all clades were mixed in different combinations and ratios to assess qPCR primer specificity. The development and validation of these high fidelity quantitative molecular tools now allows for rapid and accurate risk management assessment in any environment.

Digital isothermal quantification of nucleic acids via simultaneous chemical initiation of recombinase polymerase amplification reactions on SlipChip.

PubMed

Shen, Feng; Davydova, Elena K; Du, Wenbin; Kreutz, Jason E; Piepenburg, Olaf; Ismagilov, Rustem F

2011-05-01

In this paper, digital quantitative detection of nucleic acids was achieved at the single-molecule level by chemical initiation of over one thousand sequence-specific, nanoliter isothermal amplification reactions in parallel. Digital polymerase chain reaction (digital PCR), a method used for quantification of nucleic acids, counts the presence or absence of amplification of individual molecules. However, it still requires temperature cycling, which is undesirable under resource-limited conditions. This makes isothermal methods for nucleic acid amplification, such as recombinase polymerase amplification (RPA), more attractive. A microfluidic digital RPA SlipChip is described here for simultaneous initiation of over one thousand nL-scale RPA reactions by adding a chemical initiator to each reaction compartment with a simple slipping step after instrument-free pipet loading. Two designs of the SlipChip, two-step slipping and one-step slipping, were validated using digital RPA. By using the digital RPA SlipChip, false-positive results from preinitiation of the RPA amplification reaction before incubation were eliminated. End point fluorescence readout was used for "yes or no" digital quantification. The performance of digital RPA in a SlipChip was validated by amplifying and counting single molecules of the target nucleic acid, methicillin-resistant Staphylococcus aureus (MRSA) genomic DNA. The digital RPA on SlipChip was also tolerant to fluctuations of the incubation temperature (37-42 °C), and its performance was comparable to digital PCR on the same SlipChip design. The digital RPA SlipChip provides a simple method to quantify nucleic acids without requiring thermal cycling or kinetic measurements, with potential applications in diagnostics and environmental monitoring under resource-limited settings. The ability to initiate thousands of chemical reactions in parallel on the nanoliter scale using solvent-resistant glass devices is likely to be useful for a broader range of applications.

Digital Isothermal Quantification of Nucleic Acids via Simultaneous Chemical Initiation of Recombinase Polymerase Amplification Reactions on SlipChip

PubMed Central

Shen, Feng; Davydova, Elena K.; Du, Wenbin; Kreutz, Jason E.; Piepenburg, Olaf; Ismagilov, Rustem F.

2011-01-01

In this paper, digital quantitative detection of nucleic acids was achieved at the single-molecule level by chemical initiation of over one thousand sequence-specific, nanoliter, isothermal amplification reactions in parallel. Digital polymerase chain reaction (digital PCR), a method used for quantification of nucleic acids, counts the presence or absence of amplification of individual molecules. However it still requires temperature cycling, which is undesirable under resource-limited conditions. This makes isothermal methods for nucleic acid amplification, such as recombinase polymerase amplification (RPA), more attractive. A microfluidic digital RPA SlipChip is described here for simultaneous initiation of over one thousand nL-scale RPA reactions by adding a chemical initiator to each reaction compartment with a simple slipping step after instrument-free pipette loading. Two designs of the SlipChip, two-step slipping and one-step slipping, were validated using digital RPA. By using the digital RPA SlipChip, false positive results from pre-initiation of the RPA amplification reaction before incubation were eliminated. End-point fluorescence readout was used for “yes or no” digital quantification. The performance of digital RPA in a SlipChip was validated by amplifying and counting single molecules of the target nucleic acid, Methicillin-resistant Staphylococcus aureus (MRSA) genomic DNA. The digital RPA on SlipChip was also tolerant to fluctuations of the incubation temperature (37–42 °C), and its performance was comparable to digital PCR on the same SlipChip design. The digital RPA SlipChip provides a simple method to quantify nucleic acids without requiring thermal cycling or kinetic measurements, with potential applications in diagnostics and environmental monitoring under resource-limited settings. The ability to initiate thousands of chemical reactions in parallel on the nanoliter scale using solvent-resistant glass devices is likely to be useful for a broader range of applications. PMID:21476587

Polymerase chain reaction system

DOEpatents

Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

2004-03-02

A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

Versatile Tandem Ring-Opening/Ring-Closing Metathesis Polymerization: Strategies for Successful Polymerization of Challenging Monomers and Their Mechanistic Studies.

PubMed

Park, Hyeon; Kang, Eun-Hye; Müller, Laura; Choi, Tae-Lim

2016-02-24

Tandem ring-opening/ring-closing metathesis (RO/RCM) results in extremely fast living polymerization; however, according to previous reports, only monomers containing certain combinations of cycloalkenes, terminal alkynes, and nitrogen linkers successfully underwent tandem polymerization. After examining the polymerization pathways, we proposed that the relatively slow intramolecular cyclization might lead to competing side reactions such as intermolecular cross metathesis reactions to form inactive propagating species. Thus, we developed two strategies to enhance tandem polymerization efficiency. First, we modified monomer structures to accelerate tandem RO/RCM cyclization by enhancing the Thorpe-Ingold effect. This strategy increased the polymerization rate and suppressed the chain transfer reaction to achieve controlled polymerization, even for challenging syntheses of dendronized polymers. Alternatively, reducing the reaction concentration facilitated tandem polymerization, suggesting that the slow tandem RO/RCM cyclization step was the main reason for the previous failure. To broaden the monomer scope, we used monomers containing internal alkynes and observed that two different polymer units with different ring sizes were produced as a result of nonselective α-addition and β-addition on the internal alkynes. Thorough experiments with various monomers with internal alkynes suggested that steric and electronic effects of the alkyne substituents influenced alkyne addition selectivity and the polymerization reactivity. Further polymerization kinetics studies revealed that the rate-determining step of monomers containing certain internal alkynes was the six-membered cyclization step via β-addition, whereas that for other monomers was the conventional intermolecular propagation step, as observed in other chain-growth polymerizations. This conclusion agrees well with all those polymerization results and thus validates our strategies.

The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

2013-06-28

Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

Control and reduction of peak temperature in self-curing resins.

PubMed

Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A

2009-07-01

INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.

A new multiplex real-time polymerase chain reaction assay for the diagnosis of periprosthetic joint infection.

PubMed

Kawamura, Masaki; Kobayashi, Naomi; Inaba, Yutaka; Choe, Hyonmin; Tezuka, Taro; Kubota, So; Saito, Tomoyuki

2017-11-01

A new multiplex real-time polymerase chain reaction (PCR) assay was developed to detect methicillin-resistant Staphylococcus (MRS) and to distinguish between gram-positive and gram-negative bacteria. In this study, we validated the sensitivity and specificity of this assay with periprosthetic joint infections (PJIs) and evaluated the utility of PCR for culture-negative PJI. Forty-five samples from 23 infectious PJI cases and 106 samples from 64 non-infectious control cases were analyzed by real-time PCR using a LightCycler Nano ® system. Twenty-eight clinical samples, comprising bacteria of known species isolated consecutively in the microbiological laboratory of our hospital, were used to determine the spectrum of bacterial species that could be detected using the new multiplex primers and probes. The sensitivity and specificity of the MRS- and universal-PCR assays were 92% and 99%, and 91% and 88%, respectively. Twenty-eight species of clinically isolated bacteria were detected using this method and the concordance rate for the identification of gram-positive or gram-negative organisms was 96%. Eight samples were identified as PCR-positive despite a culture-negative result. This novel multiplex real-time PCR system has acceptable sensitivity and specificity and several advantages; therefore, it has potential use for the diagnosis of PJIs, particularly in culture-negative cases.

Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing

PubMed Central

White, P. Lewis; Wingard, John R.; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F.; Slavin, Monica A.; Barnes, Rosemary A.; Pappas, Peter G.; Donnelly, J. Peter

2015-01-01

Background. Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. Methods. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. Results. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%–88.0% and 75.0%–94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. Conclusions. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. PMID:26113653

Aspergillus Polymerase Chain Reaction: Systematic Review of Evidence for Clinical Use in Comparison With Antigen Testing.

PubMed

White, P Lewis; Wingard, John R; Bretagne, Stéphane; Löffler, Jürgen; Patterson, Thomas F; Slavin, Monica A; Barnes, Rosemary A; Pappas, Peter G; Donnelly, J Peter

2015-10-15

Aspergillus polymerase chain reaction (PCR) was excluded from the European Organisation for the Research and Treatment of Cancer/Mycoses Study Group (EORTC/MSG) definitions of invasive fungal disease because of limited standardization and validation. The definitions are being revised. A systematic literature review was performed to identify analytical and clinical information available on inclusion of galactomannan enzyme immunoassay (GM-EIA) (2002) and β-d-glucan (2008), providing a minimal threshold when considering PCR. Categorical parameters and statistical performance were compared. When incorporated, GM-EIA and β-d-glucan sensitivities and specificities for diagnosing invasive aspergillosis were 81.6% and 91.6%, and 76.9% and 89.4%, respectively. Aspergillus PCR has similar sensitivity and specificity (76.8%-88.0% and 75.0%-94.5%, respectively) and comparable utility. Methodological recommendations and commercial PCR assays assist standardization. Although all tests have limitations, currently, PCR is the only test with independent quality control. We propose that there is sufficient evidence that is at least equivalent to that used to include GM-EIA and β-d-glucan testing, and that PCR is now mature enough for inclusion in the EORTC/MSG definitions. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

PubMed

Yan, Guiping; Smiley, Richard W

2010-03-01

The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.

A comparison of molecular and enzyme-based assays for the detection of thiopurine methyltransferase mutations.

PubMed

Coulthard, S A; Rabello, C; Robson, J; Howell, C; Minto, L; Middleton, P G; Gandhi, M K; Jackson, G; McLelland, J; O'Brien, H; Smith, S; Reid, M M; Pearson, A D; Hall, A G

2000-09-01

S-Methylation by thiopurine methyltransferase (TPMT) is an important route of metabolism for the thiopurine drugs. About one in 300 individuals are homozygous for a TPMT mutation associated with very low enzyme activity and severe myelosuppression if treated with standard doses of drug. To validate the use of molecular genetic techniques for the detection of TPMT deficiency, we have determined red blood cell TPMT activity in 240 adult blood donors and 55 normal children. Genotype was determined by restriction fragment length analysis of polymerase chain reaction products in a cohort of 79 of the blood donors and five cases of azathioprine-induced myelosupression, and this confirmed a close relationship between genotype and phenotype. In 17 of the 24 cases in which mutations were found, DNA was also available from remission bone marrow. In one of these cases, DNA from the remission marrow sample indicated the presence of a non-mutated allele that had not been seen in the blast DNA sample obtained at presentation. These results indicate that polymerase chain reaction-based assays give reliable and robust results for the detection of TPMT deficiency, but that caution should be exercised in relying exclusively on DNA obtained from lymphoblasts in childhood leukaemia.

A Continuous-Flow Polymerase Chain Reaction Microchip With Regional Velocity Control

PubMed Central

Li, Shifeng; Fozdar, David Y.; Ali, Mehnaaz F.; Li, Hao; Shao, Dongbing; Vykoukal, Daynene M.; Vykoukal, Jody; Floriano, Pierre N.; Olsen, Michael; McDevitt, John T.; Gascoyne, Peter R.C.; Chen, Shaochen

2009-01-01

This paper presents a continuous-flow polymerase chain reaction (PCR) microchip with a serpentine microchannel of varying width for “regional velocity control.” Varying the channel width by incorporating expanding and contracting conduits made it possible to control DNA sample velocities for the optimization of the exposure times of the sample to each temperature phase while minimizing the transitional periods during temperature transitions. A finite element analysis (FEA) and semi-analytical heat transfer model was used to determine the distances between the three heating assemblies that are responsible for creating the denaturation (96 °C), hybridization (60 °C), and extension (72 °C) temperature zones within the microchip. Predictions from the thermal FEA and semi-analytical model were compared with temperature measurements obtained from an infrared (IR) camera. Flow-field FEAs were also performed to predict the velocity distributions in the regions of the expanding and contracting conduits to study the effects of the microchannel geometry on flow recirculation and bubble nucleation. The flow fields were empirically studied using micro particle image velocimetry (μ-PIV) to validate the flow-field FEA’s and to determine experimental velocities in each of the regions of different width. Successful amplification of a 90 base pair (bp) bacillus anthracis DNA fragment was achieved. PMID:19829760

Development and validation of a reverse transcription quantitative polymerase chain reaction for tilapia lake virus detection in clinical samples and experimentally challenged fish.

PubMed

Tattiyapong, P; Sirikanchana, K; Surachetpong, W

2018-02-01

Tilapia lake virus (TiLV) is an emerging pathogen associated with high mortalities of wild and farm-raised tilapia in different countries. In this study, a SYBR green-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay targeting segment three of the virus was developed to detect and quantify TiLV in clinical samples and experimentally challenged fish. All 30 field samples with clinical signs and history consistent with TiLV infection were positive for TiLV as detected by the developed RT-qPCR method. The RT-qPCR technique provided 100 and 10,000 times more sensitive for virus detection than those offered by the RT-PCR and virus isolation in cell culture methods, respectively. The detection limit of the RT-qPCR method was as low as two viral copies/μl. Moreover, the RT-qPCR technique could be applied for TiLV detection in various fish tissues including gills, liver, brain, heart, anterior kidney and spleen. Significantly, this study delivered an accurate and reliable method for rapid detection of TiLV viruses that facilitates active surveillance programme and disease containment. © 2017 John Wiley & Sons Ltd.

Multiplex polymerase chain reaction assay developed to diagnose adult bacterial meningitis in Taiwan.

PubMed

Lee, Chi-Tsung; Hsiao, Kuang-Ming; Chen, Jin-Cherng; Su, Cheng-Chuan

2015-11-01

Acute bacterial meningitis causes high morbidity and mortality; the associated clinical symptoms often are insensitive or non-specific; and the pathogenic bacteria are geographically diverse. Clinical diagnosis requires a rapid and accurate methodology. This study aimed to develop a new multiplex polymerase chain reaction (mPCR) assay to detect simultaneously six major bacteria that cause adult bacterial meningitis in Taiwan: Klebsiella pneumoniae, Pseudomonas aeruginosa, Streptococcus pneumoniae, Staphylococcus aureus, Escherichia coli, and Acinetobacter baumannii. Species-specific primers for the six bacteria were developed using reference strains. The specificities of the mPCRs for these bacteria were validated, and the sensitivities were evaluated via serial dilutions. The mPCR assay specifically detected all of the six pathogens, particularly with sensitivities of 12 colony forming units (CFU)/mL, 90 CFU/mL, and 390 CFU/mL for E. coli, S. pneumoniae, and K. pneumoniae, respectively. This mPCR assay is a rapid and specific tool to detect the six major bacterial pathogens that cause acute adult meningitis in Taiwan, particularly sensitive for detecting E. coli, S. pneumoniae, and K. pneumoniae. The assay may facilitate early diagnosis and guidance for antimicrobial therapy for adult patients with this deadly disease in Taiwan. © 2015 APMIS. Published by John Wiley & Sons Ltd.

A method combining immunocapture and PCR amplification in a microtiter plate for the detection of plant viruses and subviral pathogens.

PubMed

Nolasco, G; de Blas, C; Torres, V; Ponz, F

1993-12-15

A method for the detection of RNA viral and subviral plant pathogens was developed that combines pathogen partial purification by solid-phase adsorbed antibodies, reverse transcriptional-polymerase chain reaction (RT-PCR) and quantitation of the amplified products by fluorescence. The reverse transcription of the RNA is performed directly on the retained material without any previous thermal or chemical disruption of the virus particles. The whole procedure can be carried out in a microtiter plate. Its validity has been successfully confirmed for the detection of bean yellow mosaic virus, cherry leafroll virus, cucumber mosaic virus, citrus tristeza virus, grapevine fanleaf virus, potato leafroll virus, pepper mild mottle virus, and tomato spotted wilt virus, as well as the satellite RNA of cucumber mosaic virus and potato spindle tuber viroid. In this procedure virus-specific antibodies can be replaced by monoclonal antibodies against double-stranded RNA, thus offering the possibility of detection when no specific virus antibodies are available, or immunological methods are difficult to use (i.e., subviral pathogens like satellite-RNAs or viroids). The method described has the typical sensitivity of assays based on the polymerase chain reaction, it is not more laborious than ELISA, and an equivalent degree of automation is possible.

Modeling competitive substitution in a polyelectrolyte complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu

2015-12-28

We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less

Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

PubMed

Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

2011-03-14

Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Randomizing Genome-Scale Metabolic Networks

PubMed Central

Samal, Areejit; Martin, Olivier C.

2011-01-01

Networks coming from protein-protein interactions, transcriptional regulation, signaling, or metabolism may appear to have “unusual” properties. To quantify this, it is appropriate to randomize the network and test the hypothesis that the network is not statistically different from expected in a motivated ensemble. However, when dealing with metabolic networks, the randomization of the network using edge exchange generates fictitious reactions that are biochemically meaningless. Here we provide several natural ensembles of randomized metabolic networks. A first constraint is to use valid biochemical reactions. Further constraints correspond to imposing appropriate functional constraints. We explain how to perform these randomizations with the help of Markov Chain Monte Carlo (MCMC) and show that they allow one to approach the properties of biological metabolic networks. The implication of the present work is that the observed global structural properties of real metabolic networks are likely to be the consequence of simple biochemical and functional constraints. PMID:21779409

High-throughput real-time quantitative reverse transcription PCR.

PubMed

Bookout, Angie L; Cummins, Carolyn L; Mangelsdorf, David J; Pesola, Jean M; Kramer, Martha F

2006-02-01

Extensive detail on the application of the real-time quantitative polymerase chain reaction (QPCR) for the analysis of gene expression is provided in this unit. The protocols are designed for high-throughput, 384-well-format instruments, such as the Applied Biosystems 7900HT, but may be modified to suit any real-time PCR instrument. QPCR primer and probe design and validation are discussed, and three relative quantitation methods are described: the standard curve method, the efficiency-corrected DeltaCt method, and the comparative cycle time, or DeltaDeltaCt method. In addition, a method is provided for absolute quantification of RNA in unknown samples. RNA standards are subjected to RT-PCR in the same manner as the experimental samples, thus accounting for the reaction efficiencies of both procedures. This protocol describes the production and quantitation of synthetic RNA molecules for real-time and non-real-time RT-PCR applications.

A sensible technique to detect mollicutes impurities in human cells cultured in GMP condition.

PubMed

Ugolotti, Elisabetta; Vanni, Irene

2014-01-01

In therapeutic trials the use of manipulated cell cultures for clinical applications is often required. Mollicutes microorganism contamination of tissue cultures is a major problem because it can determine various and severe alterations in cellular function. Thus methods able to detect and trace cell cultures with Mollicutes contamination are needed in the monitoring of cells grown under good manufacturing practice conditions, and cell lines in continuous culture must be tested at regular intervals. We here describe a multiplex quantitative polymerase chain reaction assay able to detect contaminant Mollicutes species in a single-tube reaction through analysis of 16S-23S rRNA intergenic spacer regions and Tuf and P1 cytoadhesin genes. The method shows a sensitivity, specificity, and robustness comparable with the culture and the indicator cell culture as required by the European Pharmacopoeia guidelines and was validated following International Conference on Harmonization guidelines and Food and Drug Administration requirements.

Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

PubMed

Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

2012-12-01

Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Silicon-based sleeve devices for chemical reactions

DOEpatents

Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

1996-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Silicon-based sleeve devices for chemical reactions

DOEpatents

Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

1996-12-31

A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

Multisite analytic performance studies of a real-time polymerase chain reaction assay for the detection of BRAF V600E mutations in formalin-fixed, paraffin-embedded tissue specimens of malignant melanoma.

PubMed

Anderson, Steven; Bloom, Kenneth J; Vallera, Dino U; Rueschoff, Josef; Meldrum, Cliff; Schilling, Robert; Kovach, Barbara; Lee, Ju Ruey-Jiuan; Ochoa, Pam; Langland, Rachel; Halait, Harkanwal; Lawrence, H Jeffrey; Dugan, Michael C

2012-11-01

A polymerase chain reaction-based companion diagnostic (cobas 4800 BRAF V600 Mutation Test) was recently approved by the US Food and Drug Administration to select patients with BRAF-mutant metastatic melanoma for treatment with the BRAF inhibitor vemurafenib. (1) To compare the analytic performance of the cobas test to Sanger sequencing by using screening specimens from phase II and phase III trials of vemurafenib, and (2) to assess the reproducibility of the cobas test at different testing sites. Specimens from 477 patients were used to determine positive and negative percent agreements between the cobas test and Sanger sequencing for detecting V600E (1799T>A) mutations. Specimens were evaluated with a massively parallel pyrosequencing method (454) to resolve discordances between polymerase chain reaction and Sanger results. Reproducibility of the cobas test was assessed at 3 sites by using 3 reagent lots and an 8-member panel of melanoma samples. A valid cobas result was obtained for all eligible patients. Sanger sequencing had a failure rate of 9.2% (44 of 477). For the remaining 433 specimens, positive percent agreement was 96.4% (215 of 223) and negative percent agreement, 80% (168 of 210). Among 42 cobas mutation-positive/Sanger V600E-negative specimens, 17 were V600E positive and 24 were V600K positive by 454. The cobas test detected 70% of V600K mutations. In the reproducibility study, a correct interpretation was made for 100% of wild-type specimens and specimens with greater than 5% mutant alleles; V600E mutations were detected in 90% of specimens with less than 5% mutant alleles. The cobas test (1) had a lower assay failure rate than that of Sanger, (2) was more sensitive in detecting V600E mutations, (3) detected most V600K mutations, and (4) was highly reproducible.

Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

PubMed

Chen, Y T; Mercer, G O; Chen, Y

1993-11-01

Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

PubMed

Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

2016-10-01

The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Lack of detection of feline leukemia and feline sarcoma viruses in diffuse iris melanomas of cats by immunohistochemistry and polymerase chain reaction.

PubMed

Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H

2002-07-01

Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.

Organic reactions mediated by electrochemically generated ArS+.

PubMed

Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi

2011-04-21

Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.

Competitive RT-PCR Strategy for Quantitative Evaluation of the Expression of Tilapia (Oreochromis niloticus) Growth Hormone Receptor Type I

PubMed Central

2009-01-01

Quantization of gene expression requires that an accurate measurement of a specific transcript is made. In this paper, a quantitative reverse transcription-polymerase chain reaction (RT-PCR) by competition for tilapia growth hormone receptor type I is designed and validated. This experimental procedure was used to determine the abundance of growth hormone receptor type I transcript in different tilapia tissues. The results obtained with this developed competitive RT-PCR were similar to real-time PCR results reported recently. This protocol provides a reliable alternative, but less expensive than real-time PCR to quantify specific genes. PMID:19495916

Smad3 mutant mice develop colon cancer with overexpression of COX-2

PubMed Central

Zhu, Yu-Ping; Liu, Zhuo; Fu, Zhi-Xuan; Li, De-Chuan

2017-01-01

Colon cancer is the second most common cause of cancer-associated mortality in human populations. The aim of the present study was to identify the role of cyclooxygenase-2 (COX-2) in Smad3 mutant mice, which are known to develop colon cancer. Homozygous Smad3 (−/−) mutant mice were generated from inbred and hybrid Smad3 mouse strains by intercrossing the appropriate heterozygotes. Immunohistochemistry with COX-2 antibody was performed throughout this experiment and the data was validated and cross-checked with reverse transcription-polymerase chain reaction (RT-PCR). Homozygous mutant Smad3 mice were generated and the overexpression pattern of COX-2 was identified by immunohistochemistry and validated with RT-PCR. The results of the present study demonstrated a link between the Smad3 mutant mice, colon cancer and COX-2. In addition, the overexpression pattern of COX-2 in Smad3 mutant mice that develop colon cancer was identified. PMID:28454287

Surfactant-controlled polymerization of semiconductor clusters to quantum dots through competing step-growth and living chain-growth mechanisms.

PubMed

Evans, Christopher M; Love, Alyssa M; Weiss, Emily A

2012-10-17

This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.

Kinetics of Chemical Reactions in Flames

NASA Technical Reports Server (NTRS)

Zeldovich, Y.; Semenov, N.

1946-01-01

In part I of the paper the theory of flame propagation is developed along the lines followed by Frank-Kamenetsky and one of the writers. The development of chain processes in flames is considered. A basis is given for the application of the method of stationary concentrations to reactions in flames; reactions with branching chains are analyzed. The case of a diffusion coefficient different from the coefficient of temperature conductivity is considered.

Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

USDA-ARS?s Scientific Manuscript database

This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

[Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

PubMed

Wang, F; Zhang, Y Q; Ding, J; Yu, L X

2017-10-18

To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

PubMed

Igarashi, T; Yamamoto, A; Goto, N

1996-10-01

Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

PubMed

Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

2017-01-01

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

Structure–Function Studies of Hydrophobic Residues That Clamp a Basic Glutamate Side Chain during Catalysis by Triosephosphate Isomerase

PubMed Central

2016-01-01

Kinetic parameters are reported for the reactions of whole substrates (kcat/Km, M–1 s–1) (R)-glyceraldehyde 3-phosphate (GAP) and dihydroxyacetone phosphate (DHAP) and for the substrate pieces [(kcat/Km)E·HPi/Kd, M–2 s–1] glycolaldehyde (GA) and phosphite dianion (HPi) catalyzed by the I172A/L232A mutant of triosephosphate isomerase from Trypanosoma brucei brucei (TbbTIM). A comparison with the corresponding parameters for wild-type, I172A, and L232A TbbTIM-catalyzed reactions shows that the effect of I172A and L232A mutations on ΔG⧧ for the wild-type TbbTIM-catalyzed reactions of the substrate pieces is nearly the same as the effect of the same mutations on TbbTIM previously mutated at the second side chain. This provides strong evidence that mutation of the first hydrophobic side chain does not affect the functioning of the second side chain in catalysis of the reactions of the substrate pieces. By contrast, the effects of I172A and L232A mutations on ΔG⧧ for wild-type TbbTIM-catalyzed reactions of the whole substrate are different from the effect of the same mutations on TbbTIM previously mutated at the second side chain. This is due to the change in the rate-determining step that determines the barrier to the isomerization reaction. X-ray crystal structures are reported for I172A, L232A, and I172A/L232A TIMs and for the complexes of these mutants to the intermediate analogue phosphoglycolate (PGA). The structures of the PGA complexes with wild-type and mutant enzymes are nearly superimposable, except that the space opened by replacement of the hydrophobic side chain is occupied by a water molecule that lies ∼3.5 Å from the basic side chain of Glu167. The new water at I172A mutant TbbTIM provides a simple rationalization for the increase in the activation barrier ΔG⧧ observed for mutant enzyme-catalyzed reactions of the whole substrate and substrate pieces. By contrast, the new water at the L232A mutant does not predict the decrease in ΔG⧧ observed for the mutant enzyme-catalyzed reactions of the substrate piece GA. PMID:27149328

Computational study of chain transfer to monomer reactions in high-temperature polymerization of alkyl acrylates.

PubMed

Moghadam, Nazanin; Liu, Shi; Srinivasan, Sriraj; Grady, Michael C; Soroush, Masoud; Rappe, Andrew M

2013-03-28

This article presents a computational study of chain transfer to monomer (CTM) reactions in self-initiated high-temperature homopolymerization of alkyl acrylates (methyl, ethyl, and n-butyl acrylate). Several mechanisms of CTM are studied. The effects of the length of live polymer chains and the type of monoradical that initiated the live polymer chains on the energy barriers and rate constants of the involved reaction steps are investigated theoretically. All calculations are carried out using density functional theory. Three types of hybrid functionals (B3LYP, X3LYP, and M06-2X) and four basis sets (6-31G(d), 6-31G(d,p), 6-311G(d), and 6-311G(d,p)) are applied to predict the molecular geometries of the reactants, products and transition sates, and energy barriers. Transition state theory is used to estimate rate constants. The results indicate that abstraction of a hydrogen atom (by live polymer chains) from the methyl group in methyl acrylate, the methylene group in ethyl acrylate, and methylene groups in n-butyl acrylate are the most likely mechanisms of CTM. Also, the rate constants of CTM reactions calculated using M06-2X are in good agreement with those estimated from polymer sample measurements using macroscopic mechanistic models. The rate constant values do not change significantly with the length of live polymer chains. Abstraction of a hydrogen atom by a tertiary radical has a higher energy barrier than abstraction by a secondary radical, which agrees with experimental findings. The calculated and experimental NMR spectra of dead polymer chains produced by CTM reactions are comparable. This theoretical/computational study reveals that CTM occurs most likely via hydrogen abstraction by live polymer chains from the methyl group of methyl acrylate and methylene group(s) of ethyl (n-butyl) acrylate.

Microfabricated electrochemiluminescence cell for chemical reaction detection

DOEpatents

Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

2003-01-01

A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Analysis of decay chains of superheavy nuclei produced in the 249Bk+48Ca and 243Am+48Ca reactions

NASA Astrophysics Data System (ADS)

Zlokazov, V. B.; Utyonkov, V. K.

2017-07-01

The analysis of decay chains starting at superheavy nuclei 293Ts and 289Mc is presented. The spectroscopic properties of nuclei identified during the experiments using the 249Bk+48Ca and 243Am+48Ca reactions studied at the gas-filled separators DGFRS, TASCA and BGS are considered. We present the analysis of decay data using widely adopted statistical methods and applying them to the short decay chains of parent odd-Z nuclei. We find out that the recently suggested method of analyzing decay chains by Forsberg et al may lead to questionable conclusions when applied for the analysis of radioactive decays. Our discussion demonstrates reasonable congruence of α-particle energies and decay times of nuclei assigned to isotopes 289Mc, 285Nh and 281Rg observed in both reactions.

Rapid and reliable detection and identification of GM events using multiplex PCR coupled with oligonucleotide microarray.

PubMed

Xu, Xiaodan; Li, Yingcong; Zhao, Heng; Wen, Si-yuan; Wang, Sheng-qi; Huang, Jian; Huang, Kun-lun; Luo, Yun-bo

2005-05-18

To devise a rapid and reliable method for the detection and identification of genetically modified (GM) events, we developed a multiplex polymerase chain reaction (PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a single reaction. The system included probes for screening gene, species reference gene, specific gene, construct-specific gene, event-specific gene, and internal and negative control genes. 18S rRNA was combined with species reference genes as internal controls to assess the efficiency of all reactions and to eliminate false negatives. Two sets of the multiplex PCR system were used to amplify four and five targets, respectively. Eight different structure genes could be detected and identified simultaneously for Roundup Ready soybean in a single microarray. The microarray specificity was validated by its ability to discriminate two GM maizes Bt176 and Bt11. The advantages of this method are its high specificity and greatly reduced false-positives and -negatives. The multiplex PCR coupled with microarray technology presented here is a rapid and reliable tool for the simultaneous detection of GM organism ingredients.

A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

NASA Astrophysics Data System (ADS)

Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua

2017-08-01

Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.

Problem-Solving Test: Real-Time Polymerase Chain Reaction

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

EPA Science Inventory

Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

ERIC Educational Resources Information Center

Elkins, Kelly M.

2011-01-01

The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

EPA Science Inventory

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

USDA-ARS?s Scientific Manuscript database

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

PubMed

Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

2005-03-01

We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

EPA Science Inventory

A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

EPA Science Inventory

Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

Momentum Distribution as a Fingerprint of Quantum Delocalization in Enzymatic Reactions: Open-Chain Path-Integral Simulations of Model Systems and the Hydride Transfer in Dihydrofolate Reductase.

PubMed

Engel, Hamutal; Doron, Dvir; Kohen, Amnon; Major, Dan Thomas

2012-04-10

The inclusion of nuclear quantum effects such as zero-point energy and tunneling is of great importance in studying condensed phase chemical reactions involving the transfer of protons, hydrogen atoms, and hydride ions. In the current work, we derive an efficient quantum simulation approach for the computation of the momentum distribution in condensed phase chemical reactions. The method is based on a quantum-classical approach wherein quantum and classical simulations are performed separately. The classical simulations use standard sampling techniques, whereas the quantum simulations employ an open polymer chain path integral formulation which is computed using an efficient Monte Carlo staging algorithm. The approach is validated by applying it to a one-dimensional harmonic oscillator and symmetric double-well potential. Subsequently, the method is applied to the dihydrofolate reductase (DHFR) catalyzed reduction of 7,8-dihydrofolate by nicotinamide adenine dinucleotide phosphate hydride (NADPH) to yield S-5,6,7,8-tetrahydrofolate and NADP(+). The key chemical step in the catalytic cycle of DHFR involves a stereospecific hydride transfer. In order to estimate the amount of quantum delocalization, we compute the position and momentum distributions for the transferring hydride ion in the reactant state (RS) and transition state (TS) using a recently developed hybrid semiempirical quantum mechanics-molecular mechanics potential energy surface. Additionally, we examine the effect of compression of the donor-acceptor distance (DAD) in the TS on the momentum distribution. The present results suggest differential quantum delocalization in the RS and TS, as well as reduced tunneling upon DAD compression.

Rapid and Reliable Genotyping of HLA-B*57:01 in Four Chinese Populations Using a Single-Tube Duplex Real-Time Polymerase Chain Reaction Assay.

PubMed

Han, Min; Kang, Xing; Liu, Zhengbin; Zhang, Tingting; Li, Yanwei; Chen, Chao; Wang, Huijuan

2017-07-01

HLA-B*57:01 is strongly associated with severe adverse drug reaction induced by the anti-HIV drug abacavir (ABC) and antibiotic flucloxacillin. This study was dedicated to establishing a new method for HLA-B*57:01 genotyping and investigating the HLA-B*57:01 distribution pattern in four Chinese populations. A single-tube duplex real-time polymerase chain reaction (PCR) system was established by combining the amplification refractory mutation system and TaqMan probe. The reliability of this assay was validated by comparing the genotyping results with those by sequence-based typing. With this assay, the distribution of HLA-B*57:01 in 354 blood samples from four ethnic groups, namely, Han, Tibetan, Uighur, and Buyei, was determined. A 100% concordance was observed between the results of real-time PCR and sequence-based typing in 50 Uighur samples. As low as 0.016 ng DNA that carried HLA-B*57:01 could be detected with this assay. HLA-B*57:01 carriers identified in 100 Northern Han Chinese, 104 Buyeis, 100 Tibetans, and 50 Uighurs were 0, 1 (0.96%), 3 (3%), and 6 (12%), respectively. The carrier rate of HLA-B*57:01 in Uighur was significantly higher than those in Northern Han (p = .001) and Buyei (p = .005). The newly established real-time PCR assay provides a rapid and reliable tool for HLA-B*57:01 allele screening before the prescription of ABC and flucloxacillin in clinical practice.

The development of a real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay using TaqMan technology for the pan detection of bluetongue virus (BTV).

PubMed

Mulholland, Catherine; McMenamy, Michael J; Hoffmann, Bernd; Earley, Bernadette; Markey, Bryan; Cassidy, Joseph; Allan, Gordon; Welsh, Michael D; McKillen, John

2017-07-01

Bluetongue virus (BTV) is an infectious, non-contagious viral disease of domestic and wild ruminants that is transmitted by adult females of certain Culicoides species. Since 2006, several serotypes including BTV-1, 2, 4, 6, 8, 9 and 16, have spread from the Mediterranean basin into Northern Europe for the first time. BTV-8 in particular, caused a major epidemic in northern Europe. As a result, it is evident that most European countries are at risk of BTV infection. The objective of this study was to develop and validate a real-time reverse transcriptase-polymerase chain reaction (rRT-PCR) assay based on TaqMan technology for the detection of representative strains of all BTV serotypes. Primers and probes were based on genome segment 10 of the virus, the NS3 gene. The assay was tested for sensitivity, and specificity. The analytical sensitivity of the rRT-PCR assay was 200 copies of RNA per reaction. The assay did not amplify the closely related orbivirus epizootic hemorrhagic disease virus (EHDV) but successfully detected all BTV reference strains including clinical samples from animals experimentally infected with BTV-8. This real time RT-PCR assay offers a sensitive, specific and rapid alternative assay for the pan detection of BTV that could be used as part of a panel of diagnostic assays for the detection of all serotypes of BTV. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST

PubMed Central

Keil, Harry; Wasserman, David; Dawson, Charles R.

1944-01-01

1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415

THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST.

PubMed

Keil, H; Wasserman, D; Dawson, C R

1944-10-01

1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.

MicroRNA-150 Is up-regulated in extranodal marginal zone lymphoma of MALT type.

PubMed

Gebauer, Niklas; Kuba, Johannes; Senft, Andrea; Schillert, Arne; Bernard, Veronica; Thorns, Christoph

2014-01-01

The mechanisms promoting malignant transformation from chronic Helicobacter pylori-gastritis to gastric extranodal marginal zone lymphoma (MALT lymphoma) are insufficiently characterized. This follow-up study aimed to validate candidate microRNAs (miRs) in the process of neoplastic transformation. MicroRNA expression signatures (n=20) were generated for a total of 60 cases of gastric lesions ranging from Wotherspoon 0-5 employing a quantitative real-time polymerase chain reaction (PCR) approach. Morphological and immunohistochemical characterization of the cohort was supplemented by PCR-based immunoglobulin heavy chain recombination studies. Quantitative expression of miR-150, miR-142.3p, miR-375 and miR-494 was significantly de-regulated in samples from MALT lymphoma compared to those from gastritis. The previously reported up-regulation of miR-150 in marginal zone lymphoma of MALT type was verified in an independent cohort of lymphoma samples employing a modified methodology. This further substantiates the role of miR-150 as a potential oncomiR in MALT lymphoma.

Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

PubMed Central

deWit, D; Wootton, M; Allan, B; Steyn, L

1993-01-01

A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

Microfabricated sleeve devices for chemical reactions

DOEpatents

Northrup, M. Allen

2003-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

ETMB-RBF: discrimination of metal-binding sites in electron transporters based on RBF networks with PSSM profiles and significant amino acid pairs.

PubMed

Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

2013-01-01

Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation-reduction reactions. In these oxidation-reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins.

ETMB-RBF: Discrimination of Metal-Binding Sites in Electron Transporters Based on RBF Networks with PSSM Profiles and Significant Amino Acid Pairs

PubMed Central

Ou, Yu-Yen; Chen, Shu-An; Wu, Sheng-Cheng

2013-01-01

Background Cellular respiration is the process by which cells obtain energy from glucose and is a very important biological process in living cell. As cells do cellular respiration, they need a pathway to store and transport electrons, the electron transport chain. The function of the electron transport chain is to produce a trans-membrane proton electrochemical gradient as a result of oxidation–reduction reactions. In these oxidation–reduction reactions in electron transport chains, metal ions play very important role as electron donor and acceptor. For example, Fe ions are in complex I and complex II, and Cu ions are in complex IV. Therefore, to identify metal-binding sites in electron transporters is an important issue in helping biologists better understand the workings of the electron transport chain. Methods We propose a method based on Position Specific Scoring Matrix (PSSM) profiles and significant amino acid pairs to identify metal-binding residues in electron transport proteins. Results We have selected a non-redundant set of 55 metal-binding electron transport proteins as our dataset. The proposed method can predict metal-binding sites in electron transport proteins with an average 10-fold cross-validation accuracy of 93.2% and 93.1% for metal-binding cysteine and histidine, respectively. Compared with the general metal-binding predictor from A. Passerini et al., the proposed method can improve over 9% of sensitivity, and 14% specificity on the independent dataset in identifying metal-binding cysteines. The proposed method can also improve almost 76% sensitivity with same specificity in metal-binding histidine, and MCC is also improved from 0.28 to 0.88. Conclusions We have developed a novel approach based on PSSM profiles and significant amino acid pairs for identifying metal-binding sites from electron transport proteins. The proposed approach achieved a significant improvement with independent test set of metal-binding electron transport proteins. PMID:23405059

MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

PubMed Central

Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

2015-01-01

Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

[Validation of three screening tests used for early detection of cervical cancer].

PubMed

Rodriguez-Reyes, Esperanza Rosalba; Cerda-Flores, Ricardo M; Quiñones-Pérez, Juan M; Cortés-Gutiérrez, Elva I

2008-01-01

to evaluate the validity (sensitivity, specificity, and accuracy) of three screening methods used in the early detection of the cervical carcinoma versus the histopathology diagnosis. a selected sample of 107 women attended in the Opportune Detection of Cervicouterine Cancer Program in the Hospital de Zona 46, Instituto Mexicano del Seguro Social in Durango, during the 2003 was included. The application of Papa-nicolaou, acetic acid test, and molecular detection of human papillomavirus, and histopatholgy diagnosis were performed in all the patients at the time of the gynecological exam. The detection and tipification of the human papillomavirus was performed by polymerase chain reaction (PCR) and analysis of polymorphisms of length of restriction fragments (RFLP). Histopathology diagnosis was considered the gold standard. The evaluation of the validity was carried out by the Bayesian method for diagnosis test. the positive cases for acetic acid test, Papanicolaou, and PCR were 47, 22, and 19. The accuracy values were 0.70, 0.80 and 0.99, respectively. since the molecular method showed a greater validity in the early detection of the cervical carcinoma we considered of vital importance its implementation in suitable programs of Opportune Detection of Cervicouterino Cancer Program in Mexico. However, in order to validate this conclusion, cross-sectional studies in different region of country must be carried out.

Enzymatic preparation of structured oils containing short-chain fatty acids.

PubMed

Kanda, Ayato; Namiki, Fusako; Hara, Setsuko

2010-01-01

Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.

An ab initio molecular dynamics and density functional theory study of the formation of phosphate chains from metathiophosphates.

PubMed

Mosey, Nicholas J; Woo, Tom K

2006-09-04

The reactions that occur between metathiophosphate (MTP) molecules are identified and examined through ab initio molecular dynamics simulations and static quantum chemical calculations at the density functional level of theory. The simulations show that certain types of MTPs can react to yield phosphate chains, while others only dimerize. These differences are rationalized in terms of reaction energies and the electronic structures of these molecules. In the reaction leading to the formation of phosphate chains, the reactive center, a tri-coordinate phosphorus atom, is continually regenerated. A polymerization mechanism linking MTPs to phosphate chains is developed on the basis of these results. This information sheds light on the underlying processes that may be responsible for the formation of phosphates under high-temperature conditions and may prove useful in the development of protocols for the rational synthesis of complex phosphate structures.

DISCUSSION OF "DETECTION OF CRYPTOSPORIDIUM PARVUM IN SECONDARY EFFLUENTS USING A MOST PROBABLE NUMBER-POLYMERASE CHAIN REACTION ASSAY"

EPA Science Inventory

The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...

29 CFR 1910.155 - Scope, application and definitions applicable to this subpart.

Code of Federal Regulations, 2010 CFR

2010-07-01

... by inhibiting the chemical chain reaction of fuel and oxygen. It is also known as...F3) which is a medium for extinguishing fires by inhibiting the chemical chain reaction of fuel and..., odorless, electrically nonconductive inert gas (chemical formula CO2) that is a medium for extinguishing...

Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

ERIC Educational Resources Information Center

Phelps, Tara L.; And Others

1996-01-01

Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

Determining Annealing Temperatures for Polymerase Chain Reaction

ERIC Educational Resources Information Center

Porta, Angela R.; Enners, Edward

2012-01-01

The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

USDA-ARS?s Scientific Manuscript database

A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

Stereoselective total synthesis of Oxylipin from open chain gluco-configured building block.

PubMed

Borkar, Santosh Ramdas; Aidhen, Indrapal Singh

2017-04-18

Total synthesis of naturally occurring Oxylipin has been achieved from open chain gluco-configured building block which is readily assembled from inexpensive and commercially available D-(+)-gluconolactone. Grignard reaction and Wittig olefination reactions are key steps for the requisite CC bond formation. Copyright © 2017. Published by Elsevier Ltd.

Multi-scale modeling of diffusion-controlled reactions in polymers: renormalisation of reactivity parameters.

PubMed

Everaers, Ralf; Rosa, Angelo

2012-01-07

The quantitative description of polymeric systems requires hierarchical modeling schemes, which bridge the gap between the atomic scale, relevant to chemical or biomolecular reactions, and the macromolecular scale, where the longest relaxation modes occur. Here, we use the formalism for diffusion-controlled reactions in polymers developed by Wilemski, Fixman, and Doi to discuss the renormalisation of the reactivity parameters in polymer models with varying spatial resolution. In particular, we show that the adjustments are independent of chain length. As a consequence, it is possible to match reactions times between descriptions with different resolution for relatively short reference chains and to use the coarse-grained model to make quantitative predictions for longer chains. We illustrate our results by a detailed discussion of the classical problem of chain cyclization in the Rouse model, which offers the simplest example of a multi-scale descriptions, if we consider differently discretized Rouse models for the same physical system. Moreover, we are able to explore different combinations of compact and non-compact diffusion in the local and large-scale dynamics by varying the embedding dimension.

Validation of quantitative and qualitative methods for detecting allergenic ingredients in processed foods in Japan.

PubMed

Sakai, Shinobu; Adachi, Reiko; Akiyama, Hiroshi; Teshima, Reiko

2013-06-19

A labeling system for food allergenic ingredients was established in Japan in April 2002. To monitor the labeling, the Japanese government announced official methods for detecting allergens in processed foods in November 2002. The official methods consist of quantitative screening tests using enzyme-linked immunosorbent assays (ELISAs) and qualitative confirmation tests using Western blotting or polymerase chain reactions (PCR). In addition, the Japanese government designated 10 μg protein/g food (the corresponding allergenic ingredient soluble protein weight/food weight), determined by ELISA, as the labeling threshold. To standardize the official methods, the criteria for the validation protocol were described in the official guidelines. This paper, which was presented at the Advances in Food Allergen Detection Symposium, ACS National Meeting and Expo, San Diego, CA, Spring 2012, describes the validation protocol outlined in the official Japanese guidelines, the results of interlaboratory studies for the quantitative detection method (ELISA for crustacean proteins) and the qualitative detection method (PCR for shrimp and crab DNAs), and the reliability of the detection methods.

Temperature control apparatus

DOEpatents

Northrup, M. Allen

2003-08-05

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

PubMed

Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

2014-01-01

Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

PubMed

Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

2013-09-15

We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

PubMed Central

Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

2015-01-01

Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

Validation of a high-throughput real-time polymerase chain reaction assay for the detection of capripoxviral DNA.

PubMed

Stubbs, Samuel; Oura, Chris A L; Henstock, Mark; Bowden, Timothy R; King, Donald P; Tuppurainen, Eeva S M

2012-02-01

Capripoxviruses, which are endemic in much of Africa and Asia, are the aetiological agents of economically devastating poxviral diseases in cattle, sheep and goats. The aim of this study was to validate a high-throughput real-time PCR assay for routine diagnostic use in a capripoxvirus reference laboratory. The performance of two previously published real-time PCR methods were compared using commercially available reagents including the amplification kits recommended in the original publication. Furthermore, both manual and robotic extraction methods used to prepare template nucleic acid were evaluated using samples collected from experimentally infected animals. The optimised assay had an analytical sensitivity of at least 63 target DNA copies per reaction, displayed a greater diagnostic sensitivity compared to conventional gel-based PCR, detected capripoxviruses isolated from outbreaks around the world and did not amplify DNA from related viruses in the genera Orthopoxvirus or Parapoxvirus. The high-throughput robotic DNA extraction procedure did not adversely affect the sensitivity of the assay compared to manual preparation of PCR templates. This laboratory-based assay provides a rapid and robust method to detect capripoxviruses following suspicion of disease in endemic or disease-free countries. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

An improved reaction path optimization method using a chain of conformations

NASA Astrophysics Data System (ADS)

Asada, Toshio; Sawada, Nozomi; Nishikawa, Takuya; Koseki, Shiro

2018-05-01

The efficient fast path optimization (FPO) method is proposed to optimize the reaction paths on energy surfaces by using chains of conformations. No artificial spring force is used in the FPO method to ensure the equal spacing of adjacent conformations. The FPO method is applied to optimize the reaction path on two model potential surfaces. The use of this method enabled the optimization of the reaction paths with a drastically reduced number of optimization cycles for both potentials. It was also successfully utilized to define the MEP of the isomerization of the glycine molecule in water by FPO method.

Determining Role of the Chain Mechanism in the Temperature Dependence of the Gas-Phase Rate of Combustion Reactions

NASA Astrophysics Data System (ADS)

Azatyan, V. V.; Bolod'yan, I. A.; Kopylov, N. P.; Kopylov, S. N.; Prokopenko, V. M.; Shebeko, Yu. N.

2018-05-01

It is shown that the strong dependence of the rate of gas-phase combustion reactions on temperature is determined by the high values of the reaction rate constants of free atoms and radicals. It is established that with a branched chain mechanism, a special role in the reaction rate temperature dependence is played by positive feedback between the concentrations of active intermediate species and the rate of their change. The role of the chemical mechanism in the temperature dependence of the process rate with and without inhibitors is considered.

Variation in Bluetongue virus real-time reverse transcription polymerase chain reaction assay results in blood samples of sheep, cattle, and alpaca.

PubMed

Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M

2011-07-01

Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.

Simultaneous and Rapid Detection of Salmonella typhi, Bacillus anthracis, and Yersinia pestis by Using Multiplex Polymerase Chain Reaction (PCR)

PubMed Central

Safari Foroshani, Nargess; Karami, Ali; Pourali, Fatemeh

2013-01-01

Background Salmonella typhi, Bacillus anthracis, and Yersinia pestis are some serious human pathogens, which their early diagnosis is of great importance. Salmonella typhi, Bacillus anthracis, and Yersinia pestis cause typhoid fever, anthrax, and plague respectively. These bacteria can be used to make biologic weapons. Objectives In this study, we designed a new and rapid diagnostic method based on Uniplex and Multiplex PCR method. Materials and Methods Uniplex and multiplex Polymerase Chain Reaction (PCR) were conducted on virulent genes of hp and invA of Salmonella typhimurium, Pa and chr of Bacillus anthracis, and pla of Yersinia pestis. A genome from other bacteria was used to study the specificity of the primer and the PCR test. Results Standard strains used in this study showed that primers were specific. As for sensitivity, it was shown that this method can diagnose 1-10 copies of the genome, or 1-10 Colony Forming Units (CFU) for each of the bacteria. All pieces except anthrax were sequenced in PCR to validate the product. DNA fragment resulted from Bacillus anthracis was confirmed by restriction enzyme digestions. Conclusion The designed methods are accurate, rapid, and inexpensive to find and differentiate these bacteria from similar bacteria. They can be applied for rapid diagnosis of these agents in different specimens, and bioterrorism cases. PMID:24719692

Rapid multiplexed genotyping for hereditary thrombophilia by SELDI-TOF mass spectrometry.

PubMed

Yang, Shangbin; Xu, Lihui; Wu, Haifeng M

2010-03-01

Approximately 50% of patients with venous thromboembolism also present with hereditary predisposition. The most common genetic factors are single nucleotide polymorphisms (SNPs) of factor V Leiden, prothrombin G20210A, and methylenetetrahydrofolate reductase C677T. Genotyping these SNPs helps clinicians to correctly diagnose the disease and properly manage patients. In this study, we report a novel method using surface-enhanced laser desorption and ionization time of flight mass spectrometry to rapidly genotype, in a multiplex fashion, 3 SNPs that predispose patients to thrombosis. First, patient DNA samples were subjected to polymerase chain reaction to amplify and extend the DNA products with masses corresponding to specific genotypes. Polymerase chain reaction products were then applied to Q10 anionic protein chips, undergoing on-chip sample enrichment and clean-up. Finally, the genotypes of the SNPs were determined by surface-enhanced laser desorption and ionization time of flight mass spectrometry. This method offers a rapid turnaround time of less than 5 hours from sample collection to result reporting. The analytical accuracy of each SNP genotyping result has been confirmed by DNA sequencing. In addition, the genotype results produced by this method were validated by comparing them with results obtained by the approved method in the clinical reference laboratory. This novel method is fast, accurate, and reproducible, and thus provides an excellent platform to promote personalized medicine in the management of clotting disorders.

Development of hydrolysis probe-based real-time PCR for identification of virulent gene targets of Burkholderia pseudomallei and B. mallei--a retrospective study on archival cases of service members with melioidosis and glanders.

PubMed

Zhang, Binxue; Wear, Douglas J; Kim, H S; Weina, Peter; Stojadinovic, Alexander; Izadjoo, Mina

2012-02-01

Burkholderia pseudomallei and B. mallei are two highly pathogenic bacteria responsible for melioidosis and glanders, respectively. Our laboratory developed hydrolysis probe-based real-time polymerase chain reaction assays targeting type three secretion system (TTS) and transposase family protein (TFP) of B. pseudomallei and B. malli, respectively. The assays were validated for target specificity, amplification sensitivity, and reproducibility. A bacterial DNA panel, composed of B. pseudomallei (13 strains), B. mallei (11 strains), Burkholderia species close neighbors (5 strains), and other bacterial species (17 strains), was prepared for specificity testing. Reference DNAs from B. pseudomallei and B. mallei bacterial cultures were used as controls for amplification, limit of detection, and reproducibility testing. The two TaqMan assays, Bp-TTS 1 and Bm-TFP, were optimized and applied in a retrospective study of archived cases from the Armed Forces Institute of Pathology. We tested 10 formalin-fixed paraffin-embedded blocks originally from autopsy specimens of patients who died of melioidosis or glanders during or after overseas tours in 1960s. Polymerase chain reaction results confirmed that DNA samples from formalin-fixed paraffin-embedded blocks of eight patients with melioidosis were positive for Bp-TTS 1 target and two patients with glanders were positive for Bm-TFP target.

Validation of Roche LightCycler Epstein-Barr virus quantification reagents in a clinical laboratory setting.

PubMed

Gulley, Margaret L; Fan, Hongxin; Elmore, Sandra H

2006-11-01

Epstein-Barr virus (EBV) is associated with a wide range of benign and malignant diseases, including infectious mononucleosis, lymphoma, posttransplant lymphoproliferative disorder, and nasopharyngeal carcinoma. Measurement of EBV viral load in plasma is increasingly used for rapid assessment of disease status. We evaluated the performance characteristics of an EBV polymerase chain reaction assay that uses commercial reagents and instruments from Roche Diagnostics (Indianapolis, IN). DNA was extracted from plasma using a MagNaPure instrument, and viral load was measured by real-time polymerase chain reaction on a LightCycler. Analyte-specific reagents included primers and hybridization probes targeting the EBV LMP2 gene and a spiked control sequence. Accuracy and reproducibility were established using DNA from three cell lines. The assay was sensitive to approximately 750 copies of EBV DNA per milliliter of plasma and was linear across at least four orders of magnitude. The assay detected EBV DNA in three of five samples from nasopharyngeal carcinoma patients, seven of nine infectious mononucleosis samples, and 34/34 samples from immunosuppressed patients with clinically significant EBV-related disease, whereas EBV DNA was undetectable in plasma from 21 individuals without EBV-related disease. In conclusion, this LightCycler EBV assay is rapid, sensitive, and linear for quantifying EBV viral load. The assay appears to be useful for measuring clinically significant EBV levels in immunodeficient patients.

Development of a real-time polymerase chain reaction assay for the detection of the invasive Mediterranean fanworm, Sabella spallanzanii, in environmental samples.

PubMed

Wood, Susanna A; Zaiko, Anastasija; Richter, Ingrid; Inglis, Graeme J; Pochon, Xavier

2017-07-01

The Mediterranean fanworm, Sabella spallanzanii Gmelin 1791, was first detected in the Southern Hemisphere in the 1990s and is now abundant in many parts of southern Australia and in several locations around northern New Zealand. Once established, it can proliferate rapidly, reaching high densities with potential ecological and economic impacts. Early detection of new S. spallanzanii incursions is important to prevent its spread, guide eradication or control efforts and to increase knowledge on the species' dispersal pathways. In this study, we developed a TaqMan probe real-time polymerase chain reaction assay targeting a region of the mitochondrial cytochrome oxidase I gene. The assay was validated in silico and in vitro using DNA from New Zealand and Australian Sabellidae with no cross-reactivity detected. The assay has a linear range of detection over seven orders of magnitude with a limit of detection reached at 12.4 × 10 -4  ng/μL of DNA. We analysed 145 environmental (water, sediment and biofouling) samples and obtained positive detections only from spiked samples and those collected at a port where S. spallanzanii is known to be established. This assay has the potential to enhance current morphological and molecular-based methods, through its ability to rapidly and accurately identify S. spallanzanii in environmental samples.

Solvent-free iodination of organic molecules using the I(2)/urea-H(2)O(2) reagent system.

PubMed

Pavlinac, Jasminka; Zupan, Marko; Stavber, Stojan

2007-02-21

Introduction of iodine under solvent-free conditions into several aromatic compounds activated toward electrophilic functionalization was found to proceed efficiently using elemental iodine in the presence of a solid oxidizer, the urea-H(2)O(2) (UHP) adduct. Two types of iodo-functionalization through an electrophilic process were observed: iodination of an aromatic ring, and side-chain iodo-functionalization in the case of arylalkyl ketones. Two reaction routes were established based on the required substrate : iodine : oxidizer ratio for the most efficient iodo-transformation, and the role of UHP was elucidated in each route. The first, requiring a 1 : 0.5 : 0.6 stoichiometric ratio of substrate to iodine to UHP, followed the atom economy concept in regard to iodine and was valid in the case of aniline, 4-t-Bu-phenol, 1,2-dimethoxy benzene, 1,3-dimethoxy benzene, 1,2,3-trimethoxy benzene, 1,2,4-trimethoxy benzene, 1,3,5-trimethoxy benzene, 1-indanone and 1-tetralone. The second reaction route, where a 1 : 1 : 1 stoichiometric ratio of substrate : I(2) : UHP was needed for efficient iodination, was suitable for side-chain iodo-functionalization of acetophenone and methoxy-substituted acetophenones. Moreover, addition of iodine to 1-octene and some phenylacetylenic derivatives was found to proceed efficiently without the presence of any oxidizer and solvent at room temperature.

Clinical validation of 3 commercial real-time reverse transcriptase polymerase chain reaction assays for the detection of Middle East respiratory syndrome coronavirus from upper respiratory tract specimens.

PubMed

Mohamed, Deqa H; AlHetheel, AbdulKarim F; Mohamud, Hanat S; Aldosari, Kamel; Alzamil, Fahad A; Somily, Ali M

2017-04-01

Since discovery of Middle East respiratory syndrome coronavirus (MERS-CoV), a novel betacoronavirus first isolated and characterized in 2012, MERS-CoV real-time reverse transcriptase polymerase chain reaction (rRT-PCR) assays represent one of the most rapidly expanding commercial tests. However, in the absence of extensive evaluations of these assays on positive clinical material of different sources, evaluating their diagnostic effectiveness remains challenging. We describe the diagnostic performance evaluation of 3 common commercial MERS-CoV rRT-PCR assays on a large panel (n = 234) of upper respiratory tract specimens collected during an outbreak episode in Saudi Arabia. Assays were compared to the RealStar® MERS-CoV RT-PCR (Alton Diagnostics, Hamburg, Germany) assay as the gold standard. Results showed i) the TIB MolBiol® LightMix UpE and Orf1a assays (TIB MolBiol, Berlin, Germany) to be the most sensitive, followed by ii) the Anyplex™ Seegene MERS-CoV assay (Seegene, Seoul, Korea), and finally iii) the PrimerDesign™ Genesig® HCoV_2012 assay (PrimerDesign, England, United Kingdom). We also evaluate a modified protocol for the PrimerDesign™ Genesig® HCoV_2012 assay. Copyright © 2017 Elsevier Inc. All rights reserved.

Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Vinay, E-mail: winn201@gmail.com; Rajaura, Rajveer; Sharma, Preetam Kumar

An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO compositemore » for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.« less

Ufd2p synthesizes branched ubiquitin chains to promote the degradation of substrates modified with atypical chains

PubMed Central

Liu, Chao; Liu, Weixiao; Ye, Yihong; Li, Wei

2017-01-01

Ubiquitination of a subset of proteins by ubiquitin chain elongation factors (E4), represented by Ufd2p in Saccharomyces cerevisiae, is a pivotal regulator for many biological processes. However, the mechanism of Ufd2p-mediated ubiquitination is largely unclear. Here, we show that Ufd2p catalyses K48-linked multi-monoubiquitination on K29-linked ubiquitin chains assembled by the ubiquitin ligase (Ufd4p), resulting in branched ubiquitin chains. This reaction depends on the interaction of K29-linked ubiquitin chains with two N-terminal loops of Ufd2p. Only following the addition of K48-linked ubiquitin to substrates modified with K29-linked ubiquitin chains, can the substrates be escorted to the proteasome for degradation. We demonstrate that this ubiquitin chain linkage switching reaction is essential for ERAD, oleic acid and acid pH resistance in yeast. Thus, our results suggest that Ufd2p functions by switching ubiquitin chain linkages to allow the degradation of proteins modified with a ubiquitin linkage, which is normally not targeted to the proteasome. PMID:28165462

Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

Identification of Brucella spp. by using the polymerase chain reaction.

PubMed Central

Herman, L; De Ridder, H

1992-01-01

The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903

Detection of Listeria monocytogenes by using the polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bessesen, M.T.; Luo, Q.; Blaser, M.J.

1990-09-01

A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

PubMed

Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

2012-07-09

Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

9 CFR 145.33 - Terminology and classification; flocks and products.

Code of Federal Regulations, 2010 CFR

2010-01-01

.... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

Parallel and automated library synthesis of 2-long alkyl chain benzoazoles and azole[4,5-b]pyridines under microwave irradiation.

PubMed

Martínez-Palou, Rafael; Zepeda, L Gerardo; Höpfl, Herbert; Montoya, Ascensión; Guzmán-Lucero, Diego J; Guzmán, Javier

2005-01-01

A versatile route to 40-membered library of 2-long alkyl chain substituted benzoazoles (1 and 2) and azole[4,5-b]pyridines (3 and 4) via microwave-assisted combinatorial synthesis was developed. The reactions were carried out in both monomode and multimode microwave oven. With the latter, all reactions were performed in high-throughput experimental settings consisting of an 8 x 5 combinatorial library designed to synthesize 40 compounds. Each step, from the addition of reagents to the recovery of final products, was automated. The microwave-assisted N-long chain alkylation reactions of 2-alkyl-1H-benzimidazole (1) and 2-alkyl-1H-benzimidazole[4,5-b] pyridines (3) were also studied.

Immediate hypersensitivity to moxifloxacin with tolerance to ciprofloxacin: report of three cases and review of the literature.

PubMed

Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth

2010-04-01

To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.

No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

PubMed

D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

2006-10-01

Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

Portable gliadin-immunochip for contamination control on the food production chain.

PubMed

Chiriacò, Maria Serena; de Feo, Francesco; Primiceri, Elisabetta; Monteduro, Anna Grazia; de Benedetto, Giuseppe Egidio; Pennetta, Antonio; Rinaldi, Ross; Maruccio, Giuseppe

2015-09-01

Celiac disease (CD) is one of the most common digestive disorders caused by an abnormal immune reaction to gluten. So far there are no available therapies, the only solution is a strict gluten-free diet, which however could be very challenging as gluten can be hidden in many food products. Furthermore an additional problem is related to cross-contamination of nominal gluten-free foods with gluten-based ones during manufacturing. Here we propose a lab on chip platform as a powerful tool to help food manufacturers to evaluate the real amount of gluten in their products by an accurate in-situ control of the production chain and maybe to specify the real gluten content in packages labeling. Our portable gliadin-immunochips, based on an electrochemical impedance spectroscopy transduction method, were first calibrated and then validated for both liquid and solid food matrixes by analyzing different beers and flours. The high specificity of our assay was also demonstrated by performing control experiments on rice and potatoes flours containing prolamin-like proteins. We achieved limit of quantification of 0.5 ppm for gliadin that is 20 times lower than the worldwide limit established for gluten-free food while the method of analysis is faster and cheaper than currently employed ELISA-based methods. Moreover our results on food samples were validated through a mass spectrometry standard analysis. Copyright © 2015 Elsevier B.V. All rights reserved.

New polymer systems: Chain extension by dianhydrides

NASA Technical Reports Server (NTRS)

Rhein, R. A.; Ingham, J. D.

1972-01-01

The results are presented for a systematic investigation on the use of anhydrides to prepare stable elastomeric materials for space use, under mild reaction conditions. The three anhydrides investigated were found to provide effective chain extension of hydroxy-terminated poly(alkylene oxides) and poly(butadienes). These were tetrahydrofuran tetracarboxylic dianhydride, pyromellitic dianhydride, and benzophenone tetracarboxylic diahydride. The most effective catalyst investigated was ferric acetylacetonate, which resulted in chain extension at 333 K (60 C). One feature of these anhydride reactants is that they are difunctional as anhydrides, but tetrafunctional if conditions are selected that lead to reaction of all carboxyl groups. Therefore, chain extension can be effected and then followed by crosslinking via the residual carboxyl groups.

Theoretical study of chain transfer to solvent reactions of alkyl acrylates.

PubMed

Moghadam, Nazanin; Srinivasan, Sriraj; Grady, Michael C; Rappe, Andrew M; Soroush, Masoud

2014-07-24

This computational and theoretical study deals with chain transfer to solvent (CTS) reactions of methyl acrylate (MA), ethyl acrylate (EA), and n-butyl acrylate (n-BA) self-initiated homopolymerization in solvents such as butanol (polar, protic), methyl ethyl ketone (MEK) (polar, aprotic), and p-xylene (nonpolar). The results indicate that abstraction of a hydrogen atom from the methylene group next to the oxygen atom in n-butanol, from the methylene group in MEK, and from a methyl group in p-xylene by a live polymer chain are the most likely mechanisms of CTS reactions in MA, EA, and n-BA. Energy barriers and molecular geometries of reactants, products, and transition states are predicted. The sensitivity of the predictions to three hybrid functionals (B3LYP, X3LYP, and M06-2X) and three different basis sets (6-31G(d,p), 6-311G(d), and 6-311G(d,p)) is investigated. Among n-butanol, sec-butanol, and tert-butanol, tert-butanol has the highest CTS energy barrier and the lowest rate constant. Although the application of the conductor-like screening model (COSMO) does not affect the predicted CTS kinetic parameter values, the application of the polarizable continuum model (PCM) results in higher CTS energy barriers. This increase in the predicted CTS energy barriers is larger for butanol and MEK than for p-xylene. The higher rate constants of chain transfer to n-butanol reactions compared to those of chain transfer to MEK and p-xylene reactions suggest the higher CTS reactivity of n-butanol.

Sleeve reaction chamber system

DOEpatents

Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

2009-08-25

A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

PubMed

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

USDA-ARS?s Scientific Manuscript database

Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

MEANS FOR PRODUCING PLUTONIUM CHAIN REACTIONS

DOEpatents

Wigner, E.P.; Weinberg, A.M.

1961-01-24

A neutronic reactor is described with an active portion capable of operating at an energy level of 0.5 to 1000 ev comprising discrete bodies of Pu/ sup 239/ disposed in a body of water which contains not more than 5 molecules of water to one atom of plutonium, the total amount of Pu/sup 239/ being sufficient to sustain a chain reaction. (auth)

DATA COLLECTION CONSTRAINTS FOR THE USE OF LENGTH HETEROGENEITY POLYMERASE CHAIN REACTION (LH-PCR) AS AN INDICATOR OF STREAM SANITARY AND ECOLOGICAL CONDITION

EPA Science Inventory

This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...

Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

ERIC Educational Resources Information Center

Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

2006-01-01

We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

PubMed

Adewale, B; Mafe, M A; Oyerinde, J P O

2005-01-01

Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

PubMed

Ragheb, Suzan Mohammed; Jimenez, Luis

Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.

Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

PubMed Central

Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

2014-01-01

A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

Multiplex qRT-PCR for the Detection of Western Equine Encephalomyelitis, St. Louis Encephalitis, and West Nile Viral RNA in Mosquito Pools (Diptera: Culicidae)

PubMed Central

Brault, Aaron C.; Fang, Ying; Reisen, William K.

2015-01-01

Following the introduction of West Nile virus into California during the summer of 2003, public health and vector control programs expanded surveillance efforts and were in need of diagnostics capable of rapid, sensitive, and specific detection of arbovirus infections of mosquitoes to inform decision support for intervention. Development of a multiplex TaqMan or real-time semiquantitative reverse transcription polymerase chain reaction (RT-PCR) assay in which three virus specific primer–probe sets were used in the same reaction is described herein for the detection of western equine encephalomyelitis, St. Louis encephalitis and West Nile viral RNA. Laboratory validation and field data from 10 transmission seasons are reported. The comparative sensitivity and specificity of this multiplex assay to singleplex RT-PCR as well as an antigen detection (rapid analyte measurement platform) and standard plaque assays indicate this assay to be rapid and useful in providing mosquito infection data to estimate outbreak risk. PMID:26334826

Multi-template polymerase chain reaction.

PubMed

Kalle, Elena; Kubista, Mikael; Rensing, Christopher

2014-12-01

PCR is a formidable and potent technology that serves as an indispensable tool in a wide range of biological disciplines. However, due to the ease of use and often lack of rigorous standards many PCR applications can lead to highly variable, inaccurate, and ultimately meaningless results. Thus, rigorous method validation must precede its broad adoption to any new application. Multi-template samples possess particular features, which make their PCR analysis prone to artifacts and biases: multiple homologous templates present in copy numbers that vary within several orders of magnitude. Such conditions are a breeding ground for chimeras and heteroduplexes. Differences in template amplification efficiencies and template competition for reaction compounds undermine correct preservation of the original template ratio. In addition, the presence of inhibitors aggravates all of the above-mentioned problems. Inhibitors might also have ambivalent effects on the different templates within the same sample. Yet, no standard approaches exist for monitoring inhibitory effects in multitemplate PCR, which is crucial for establishing compatibility between samples.

An easy and efficient strategy for KEL genotyping in a multiethnic population.

PubMed

Arnoni, Carine Prisco; Muniz, Janaína Guinhem; de Paula, Tatiane Aparecida; Person, Rosangela Duarte de Medeiros; Gazito, Diana; Baleotti, Wilson; Barreto, José Augusto; Castilho, Lilian; Latini, Flavia Roche Moreira

2013-01-01

The Kell blood group system expresses high and low frequency antigens with the most important in relation to transfusion including the antithetic KEL1 and KEL2; KEL3 and KEL4; KEL6 and KEL7 antigens. Kell is a clinically relevant system, as it is highly immunogenic and anti-KEL antibodies are associated with hemolytic transfusion reactions and hemolytic disease of the fetus and newborn. Although required in some situations, Kell antigen phenotyping is restricted due to technical limitations. In these cases, molecular approaches maybe a solution. This study proposes three polymerase chain reaction genotyping protocols to analyze the single nucleotide polymorphisms responsible for six Kell antithetic antigens expressed in a Brazilian population. DNA was extracted from 800 blood donor samples and three polymerase chain reaction-restriction fragment length polymorphism protocols were used to genotype the KEL*1/KEL*2, KEL*3/KEL*4 and KEL*6/KEL*7 alleles. KEL*3/KEL*4 and KEL*6/KEL*7 genotyping was standardized using the NlaIII and MnlI restriction enzymes and validated using sequencing. KEL*1/KEL*2 genotyping was performed using a previously reported assay. KEL genotyping was successfully implemented in the service; the following distribution of KEL alleles was obtained for a population from southeastern Brazil: KEL*1 (2.2%), KEL*2 (97.8%), KEL*3 (0.69%), KEL*4 (99.31%), KEL*6 (2.69%) and KEL*7 (97.31%). Additionally, two individuals with rare genotypes, KEL*1/KEL*1 and KEL*3/KEL*3, were identified. KEL allele genotyping using these methods proved to be reliable and applicable to predict Kell antigen expressions in a Brazilian cohort. This easy and efficient strategy can be employed to provide safer transfusions and to help in rare donor screening.

Safety of medium-chain triglycerides used as an intraocular tamponading agent in an experimental vitrectomy model rabbit.

PubMed

Auriol, Sylvain; Mahieu, Laurence; Brousset, Pierre; Malecaze, François; Mathis, Véronique

2013-01-01

To evaluate safety of medium-chain triglycerides used as a possible intraocular tamponading agent. A 20-gauge pars plana vitrectomy was performed in the right eye of 28 rabbits. An ophthalmologic examination was performed every week until rabbits were killed. At days 7, 30, 60, and 90, rabbits were killed and the treated eyes were examined macroscopically and prepared for histologic examination. Principal outcome was retinal toxicity evaluated by light and electron microscopy, and secondary outcomes were the presence of medium-chain triglyceride emulsification, inflammatory reactions, and the development of cataract. Histologic examination did not reveal any retinal toxicity. Two cases of moderate emulsification were observed, but in these cases, emulsification was caused by the perioperative injection of the agent and did not increase during the postoperative period. We noted 13 cases of inflammatory reaction in vitreous cavity and no case of inflammatory reaction in anterior chamber. Two eyes developed cataract as a result of perioperative trauma to the lens with the vitreous cutter and not secondary to the presence of medium-chain triglycerides in the vitreous cavity. Medium-chain triglycerides did not induce morphologic evidence of retinal toxicity. The results suggest that medium-chain triglycerides could be a promising alternative intraocular tamponading agent for the treatment of retinal detachments.

Neutron-deficient superheavy nuclei obtained in the 240Pu+48Ca reaction

NASA Astrophysics Data System (ADS)

Utyonkov, V. K.; Brewer, N. T.; Oganessian, Yu. Ts.; Rykaczewski, K. P.; Abdullin, F. Sh.; Dmitriev, S. N.; Grzywacz, R. K.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Tsyganov, Yu. S.; Voinov, A. A.; Subbotin, V. G.; Sukhov, A. M.; Karpov, A. V.; Popeko, A. G.; Sabel'nikov, A. V.; Svirikhin, A. I.; Vostokin, G. K.; Hamilton, J. H.; Kovrizhnykh, N. D.; Schlattauer, L.; Stoyer, M. A.; Gan, Z.; Huang, W. X.; Ma, L.

2018-01-01

We present new results from investigations of the 240Pu+48Ca reaction at a projectile energy of 250 MeV. Three new decay chains of 285Fl were detected with decay properties mostly consistent with those measured in earlier studies. An additional chain was observed where the nuclei may decay through energy levels different from those of the other six chains registered so far. The cross section of the 240Pu(48Ca,3 n )285Fl reaction was measured to be 0 .58-0.33+0.60pb , which is a factor of about 4-5 lower than that measured in the previous experiment at 245 MeV beam energy [V. K. Utyonkov et al., Phys. Rev. C 92, 034609 (2015)., 10.1103/PhysRevC.92.034609], consistent with expectations. The origin of an additional chain consisting of a recoil, α particle, and fission event is analyzed. The assignment of 25 short-lived SF events observed in this experiment is also discussed.

Quantification of Short-Chain Chlorinated Paraffins by Deuterodechlorination Combined with Gas Chromatography-Mass Spectrometry.

PubMed

Gao, Yuan; Zhang, Haijun; Zou, Lili; Wu, Ping; Yu, Zhengkun; Lu, Xianbo; Chen, Jiping

2016-04-05

Analysis of short-chain chlorinated paraffins (SCCPs) is extremely difficult because of their complex compositions with thousands of isomers and homologues. A novel analytical method, deuterodechlorination combined with high resolution gas chromatography-high resolution mass spectrometry (HRGC-HRMS), was developed. A protocol is applied in the deuterodechlorination of SCCPs with LiAlD4, and the formed deuterated n-alkanes of different alkane chains can be distinguished readily from each other on the basis of their retention time and fragment mass ([M](+)) by HRGC-HRMS. An internal standard quantification of individual SCCP congeners was achieved, in which branched C10-CPs and branched C12-CPs were used as the extraction and reaction internal standards, respectively. A maximum factor of 1.26 of the target SCCP concentrations were determined by this method, and the relative standard deviations for quantification of total SCCPs were within 10%. This method was applied to determine the congener compositions of SCCPs in commercial chlorinated paraffins and environmental and biota samples after method validation. Low-chlorinated SCCP congeners (Cl1-4) were found to account for 32.4%-62.4% of the total SCCPs. The present method provides an attractive perspective for further studies on the toxicological and environmental characteristics of SCCPs.

Autocatalytic formation of an iron(IV)-oxo complex via scandium ion-promoted radical chain autoxidation of an iron(II) complex with dioxygen and tetraphenylborate.

PubMed

Nishida, Yusuke; Lee, Yong-Min; Nam, Wonwoo; Fukuzumi, Shunichi

2014-06-04

A non-heme iron(IV)-oxo complex, [(TMC)Fe(IV)(O)](2+) (TMC = 1,4,8,11-tetramethyl-1,4,8,11-tetraazacyclotetradecane), was formed by oxidation of an iron(II) complex ([(TMC)Fe(II)](2+)) with dioxygen (O2) and tetraphenylborate (BPh4(-)) in the presence of scandium triflate (Sc(OTf)3) in acetonitrile at 298 K via autocatalytic radical chain reactions rather than by a direct O2 activation pathway. The autocatalytic radical chain reaction is initiated by scandium ion-promoted electron transfer from BPh4(-) to [(TMC)Fe(IV)(O)](2+) to produce phenyl radical (Ph(•)). The chain propagation step is composed of the addition of O2 to Ph(•) and the reduction of the resulting phenylperoxyl radical (PhOO(•)) by scandium ion-promoted electron transfer from BPh4(-) to PhOO(•) to produce phenyl hydroperoxide (PhOOH), accompanied by regeneration of phenyl radical. PhOOH reacts with [(TMC)Fe(II)](2+) to yield phenol (PhOH) and [(TMC)Fe(IV)(O)](2+). Biphenyl (Ph-Ph) was formed via the radical chain autoxidation of BPh3 by O2. The induction period of the autocatalytic radical chain reactions was shortened by addition of a catalytic amount of [(TMC)Fe(IV)(O)](2+), whereas addition of a catalytic amount of ferrocene that can reduce [(TMC)Fe(IV)(O)](2+) resulted in elongation of the induction period. Radical chain autoxidation of BPh4(-) by O2 also occurred in the presence of Sc(OTf)3 without [(TMC)Fe(IV)(O)](2+), initiating the autocatalytic oxidation of [(TMC)Fe(II)](2+) with O2 and BPh4(-) to yield [(TMC)Fe(IV)(O)](2+). Thus, the general view for formation of non-heme iron(IV)-oxo complexes via O2-binding iron species (e.g., Fe(III)(O2(•-))) without contribution of autocatalytic radical chain reactions should be viewed with caution.

Validation of SCT Methylation as a Hallmark Biomarker for Lung Cancers.

PubMed

Zhang, Yu-An; Ma, Xiaotu; Sathe, Adwait; Fujimoto, Junya; Wistuba, Ignacio; Lam, Stephen; Yatabe, Yasushi; Wang, Yi-Wei; Stastny, Victor; Gao, Boning; Larsen, Jill E; Girard, Luc; Liu, Xiaoyun; Song, Kai; Behrens, Carmen; Kalhor, Neda; Xie, Yang; Zhang, Michael Q; Minna, John D; Gazdar, Adi F

2016-03-01

The human secretin gene (SCT) encodes secretin, a hormone with limited tissue distribution. Analysis of the 450k methylation array data in The Cancer Genome Atlas (TCGA) indicated that the SCT promoter region is differentially hypermethylated in lung cancer. Our purpose was to validate SCT methylation as a potential biomarker for lung cancer. We analyzed data from TCGA and developed and applied SCT-specific bisulfite DNA sequencing and quantitative methylation-specific polymerase chain reaction assays. The analyses of TCGA 450K data for 801 samples showed that SCT hypermethylation has an area under the curve (AUC) value greater than 0.98 that can be used to distinguish lung adenocarcinomas or squamous cell carcinomas from nonmalignant lung tissue. Bisulfite sequencing of lung cancer cell lines and normal blood cells allowed us to confirm that SCT methylation is highly discriminative. By applying a quantitative methylation-specific polymerase chain reaction assay, we found that SCT hypermethylation is frequently detected in all major subtypes of malignant non-small cell lung cancer (AUC = 0.92, n = 108) and small cell lung cancer (AUC = 0.93, n = 40) but is less frequent in lung carcinoids (AUC = 0.54, n = 20). SCT hypermethylation appeared in samples of lung carcinoma in situ during multistage pathogenesis and increased in invasive samples. Further analyses of TCGA 450k data showed that SCT hypermethylation is highly discriminative in most other types of malignant tumors but less frequent in low-grade malignant tumors. The only normal tissue with a high level of methylation was the placenta. Our findings demonstrated that SCT methylation is a highly discriminative biomarker for lung and other malignant tumors, is less frequent in low-grade malignant tumors (including lung carcinoids), and appears at the carcinoma in situ stage. Copyright © 2015 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

Specificity of the histopathological triad for the diagnosis of toxoplasmic lymphadenitis: polymerase chain reaction study.

PubMed

Lin, M H; Kuo, T T

2001-08-01

Toxoplasmosis is a common cause of lymphadenopathy, but toxoplasmic cysts are not usually found in histological sections used for establishing diagnosis, except on extremely rare occasions. The histopathological triad of florid reactive follicular hyperplasia, clusters of epithelioid histiocytes, and focal sinusoidal distention by monocytoid B cells has been considered to be diagnostic of toxoplasmic lymphadenitis, but the validity of the histopathological triad is based indirectly on serological correlation only. The demonstration of Toxoplasma gondii DNA in lymph nodes displaying the histopathological triad will indicate the validity of the histopathological triad as the criterion for the histopathological diagnosis of toxoplasmic lymphadenitis. We used frozen tissues of 12 lymph nodes with the histopathological triad and tissues of 27 lymph nodes from patients with various other conditions (including 13 cases of follicular lymphoid hyperplasia, FLH; three cases of dermatopathic lymphadenopathy, DPL; two cases of plasmacytosis; two cases of Castleman's disease; two cases of metastatic adenocarcinoma; and five cases of lymphoma) to detect T. gondii DNA by polymerase chain reaction. Ten out of 12 lymph nodes with the triad and six out of 27 lymph nodes without the triad were positive for T. gondii DNA. Thus, the sensitivity of the triad was 62.5% (10/16) and the specificity was 91.3% (21/23). The predictive value of positive tests was 83.3% (10/12) and the predictive value of negative tests was 77.7% (21/27). The six cases positive for T. gondii DNA without the triad were four cases of FLH, one case of DPL, and one case of plasmacytosis. None of the neoplastic diseases was positive. The false positive and negative cases could be due to sampling problems or past T. gondii infection. The results confirm that the histopathological triad is highly specific for the diagnosis of toxoplasmic lymphadenitis and can be used confidently.

Terminal alkenes as versatile chemical reporter groups for metabolic oligosaccharide engineering.

PubMed

Späte, Anne-Katrin; Schart, Verena F; Schöllkopf, Sophie; Niederwieser, Andrea; Wittmann, Valentin

2014-12-08

The Diels-Alder reaction with inverse electron demand (DAinv reaction) of 1,2,4,5-tetrazines with electron rich or strained alkenes was proven to be a bioorthogonal ligation reaction that proceeds fast and with high yields. An important application of the DAinv reaction is metabolic oligosaccharide engineering (MOE) which allows the visualization of glycoconjugates in living cells. In this approach, a sugar derivative bearing a chemical reporter group is metabolically incorporated into cellular glycoconjugates and subsequently derivatized with a probe by means of a bioorthogonal ligation reaction. Here, we investigated a series of new mannosamine and glucosamine derivatives with carbamate-linked side chains of varying length terminated by alkene groups and their suitability for labeling cell-surface glycans. Kinetic investigations showed that the reactivity of the alkenes in DAinv reactions increases with growing chain length. When applied to MOE, one of the compounds, peracetylated N-butenyloxycarbonylmannosamine, was especially well suited for labeling cell-surface glycans. Obviously, the length of its side chain represents the optimal balance between incorporation efficiency and speed of the labeling reaction. Sialidase treatment of the cells before the bioorthogonal labeling reaction showed that this sugar derivative is attached to the glycans in form of the corresponding sialic acid derivative and not epimerized to another hexosamine derivative to a considerable extent. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Developmental Validation of Short Tandem Repeat Reagent Kit for Forensic DNA Profiling of Canine Biological Materials

PubMed Central

Dayton, Melody; Koskinen, Mikko T; Tom, Bradley K; Mattila, Anna-Maria; Johnston, Eric; Halverson, Joy; Fantin, Dennis; DeNise, Sue; Budowle, Bruce; Smith, David Glenn; Kanthaswamy, Sree

2009-01-01

Aim To develop a reagent kit that enables multiplex polymerase chain reaction (PCR) amplification of 18 short tandem repeats (STR) and the canine sex-determining Zinc Finger marker. Methods Validation studies to determine the robustness and reliability in forensic DNA typing of this multiplex assay included sensitivity testing, reproducibility studies, intra- and inter-locus color balance studies, annealing temperature and cycle number studies, peak height ratio determination, characterization of artifacts such as stutter percentages and dye blobs, mixture analyses, species-specificity, case type samples analyses and population studies. Results The kit robustly amplified domesticated dog samples and consistently generated full 19-locus profiles from as little as 125 pg of dog DNA. In addition, wolf DNA samples could be analyzed with the kit. Conclusion The kit, which produces robust, reliable, and reproducible results, will be made available for the forensic research community after modifications based on this study’s evaluation to comply with the quality standards expected for forensic casework. PMID:19480022

A PCR primer bank for quantitative gene expression analysis.

PubMed

Wang, Xiaowei; Seed, Brian

2003-12-15

Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

Autoclave sterilization of instruments used on women with cervical neoplasia is an effective method of eradicating residual human papillomavirus DNA: a polymerase chain reaction-based evaluation.

PubMed

Estes, Jacob M; Kirby, Tyler O; Huh, Warner K

2007-01-01

To determine whether autoclave sterilization eradicates human papillomavirus (HPV) DNA on specula and instruments used to treat women with cervical neoplasia. Specula and instruments used in two referral colposcopy clinics were evaluated to determine the PGMY9/11 primer system's ability to amplify residual HPV DNA. Each speculum and instrument was sampled with a Dacron swab and stored in PreservCyt solution (Cytyc Corporation, Marlborough, MA) at 4 degrees C. DNA amplification was performed under standard conditions with appropriate controls followed by HPV typing using the reverse line blot test (Roche Molecular Systems, Alameda, CA). Once validated, the same polymerase chain reaction method was used on autoclave-sterilized specula and biopsy instruments and heated glass bead- and Cidex bath (Johnson & Johnson, New Brunswick, NJ)-sterilized instruments. All results, with appropriate positive and negative controls, were confirmed in triplicate. A total of 140 instruments (70 used and 70 autoclaved) were sampled for residual HPV DNA. Five samples in the contaminated specula arm were excluded from analysis secondary to insufficient sampling. Of the remaining samples, 52.3% (34/65) of contaminated instruments-both specula and biopsy instruments-had detectable HPV DNA. Fifty-five percent of contaminated biopsy instruments (11/20) were positive and 51.1% of contaminated specula (23/45) were positive. All 70 autoclaved samples (50 specula and 20 biopsy instruments) were negative for residual HPV DNA or beta-globin. One instrument in the glass bead and Cidex group that was presumed sterile was positive for HPV 16 DNA. The PGMY9/11 primer system is an effective method to detect residual HPV DNA. Autoclave sterilization appears to eradicate HPV DNA to levels undetectable with this sensitive assay, whereas heated glass beads followed by Cidex bath appears to be inadequate methods. These results suggest that autoclave sterilization is effective when using nondisposable instruments and should be the method of choice in studies using polymerase chain reaction-based amplification of HPV DNA.

Proteomic identification of potential biomarkers for cervical squamous cell carcinoma and human papillomavirus infection.

PubMed

Qing, Song; Tulake, Wuniqiemu; Ru, Mingfang; Li, Xiaohong; Yuemaier, Reziwanguli; Lidifu, Dilare; Rouzibilali, Aierken; Hasimu, Axiangu; Yang, Yun; Rouziahong, Reziya; Upur, Halmurat; Abudula, Abulizi

2017-04-01

It is known that high-risk human papillomavirus infection is the main etiological factor in cervical carcinogenesis. However, human papillomavirus screening is not sufficient for early diagnosis. In this study, we aimed to identify potential biomarkers common to cervical carcinoma and human papillomavirus infection by proteomics for human papillomavirus-based early diagnosis and prognosis. To this end, we collected 76 cases of fresh cervical tissues and 116 cases of paraffin-embedded tissue slices, diagnosed as cervical squamous cell carcinoma, cervical intraepithelial neoplasia II-III, or normal cervix from ethnic Uighur and Han women. Human papillomavirus infection by eight oncogenic human papillomavirus types was detected in tissue DNA samples using a quantitative polymerase chain reaction. The protein profile of cervical specimens from human papillomavirus 16-positive squamous cell carcinoma and human papillomavirus-negative normal controls was analyzed by proteomics and bioinformatics. The expression of candidate proteins was further determined by quantitative reverse transcriptase-polymerase chain reaction and immunohistochemistry. We identified 67 proteins that were differentially expressed in human papillomavirus 16-positive squamous cell carcinoma compared to normal cervix. The quantitative reverse transcriptase-polymerase chain reaction analysis verified the upregulation of ASAH1, PCBP2, DDX5, MCM5, TAGLN2, hnRNPA1, ENO1, TYPH, CYC, and MCM4 in squamous cell carcinoma compared to normal cervix ( p < 0.05). In addition, the transcription of PCBP2, MCM5, hnRNPA1, TYPH, and CYC was also significantly increased in cervical intraepithelial neoplasia II-III compared to normal cervix. Immunohistochemistry staining further confirmed the overexpression of PCBP2, hnRNPA1, ASAH1, and DDX5 in squamous cell carcinoma and cervical intraepithelial neoplasia II-III compared to normal controls ( p < 0.05). Our data suggest that the expression of ASAH1, PCBP2, DDX5, and hnRNPA1, and possibly MCM4, MCM5, CYC, ENO1, and TYPH, is upregulated during cervical carcinogenesis and potentially associated with human papillomavirus infection. Further validation studies of the profile will contribute to establishing auxiliary diagnostic markers for human papillomavirus-based cancer prognosis.

Method for polymer synthesis in a reaction well

DOEpatents

Brennan, Thomas M.

1998-01-01

A method of synthesis for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: A) depositing a liquid reagent in a reaction well (26) in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well (26) includes at least one orifice (74) extending into the well (26), and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well (26) to enable polymer chain growth on the solid support. The method further includes the step of B) expelling the reagent solution from the well (26), while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit (80) of the orifice (74) exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well (26) through the orifice exit (80).

Method for polymer synthesis in a reaction well

DOEpatents

Brennan, T.M.

1998-09-29

A method of synthesis is described for building a polymer chain, oligonucleotides in particular, by sequentially adding monomer units to at least one solid support for growing and immobilizing a polymer chain thereon in a liquid reagent solution. The method includes the step of: (A) depositing a liquid reagent in a reaction well in contact with at least one solid support and at least one monomer unit of the polymer chain affixed to the solid support. The well includes at least one orifice extending into the well, and is of a size and dimension to form a capillary liquid seal to retain the reagent solution in the well to enable polymer chain growth on the solid support. The method further includes the step of (B) expelling the reagent solution from the well, while retaining the polymer chain therein. This is accomplished by applying a first gas pressure to the reaction well such that a pressure differential between the first gas pressure and a second gas pressure exerted on an exit of the orifice exceeds a predetermined amount sufficient to overcome the capillary liquid seal and expel the reagent solution from the well through the orifice exit. 9 figs.

Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

Treesearch

David E. Schreiber; Karen J. Garner; James M. Slavicek

1997-01-01

Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

PubMed

Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

2017-01-01

The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

The Beta-Delayed Proton and Gamma Decay of 27P for Nuclear Astrophysics

NASA Astrophysics Data System (ADS)

McCleskey, E.; Banu, A.; McCleskey, M.; Roeder, B.; Saastamoinen, A.; Spiridon, A.; Trache, L.; Tribble, R. E.; Davinson, T.; Doherty, D.; Lotay, G. J.; Wallace, J.; Woods, P. J.

2013-10-01

The main creation site of 26Al is currently under debate. The reactions for its creation or destruction are also not completely known. When 26Al is created in novae, the reaction chain is: 24Mg(p,γ)25Al(β + v)25Mg(p,γ)26Al, but this chain can be by-passed by another chain: 25Al(p,γ)26Si(p,γ)27P and it can also be destroyed directly. Another way to by-pass it is through 26mAl(p,γ)27Si* which is dominated by resonant capture. Using the Momentum Achromat Recoil Spectrometer (MARS) at the Texas A&M Cyclotron Institute and inverse kinematics, this destruction reaction was studied by the beta-delayed proton and gamma decay of 27P. Due to selection rules, states populated above the proton threshold in the compound system (27Si*) can decay to 26mAl, which are the states of interest for the capture reaction. James Madison University, VA, USA.

MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

PubMed

Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

2015-11-16

Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen

NASA Astrophysics Data System (ADS)

Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.

2017-12-01

The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.

Fast and automated DNA assays on a compact disc (CD)-based microfluidic platform

NASA Astrophysics Data System (ADS)

Jia, Guangyao

Nucleic acid-based molecular diagnostics offers enormous potential for the rapid and accurate diagnosis of infectious diseases. However, most of the existing commercial tests are time-consuming and technically complicated, and are thus incompatible with the need for rapid identification of infectious agents. We have successfully developed a CD-based microfluidic platform for fast and automated DNA array hybridization and a low cost, disposable plastic microfluidic platform for polymerase chain reaction (PCR). These platforms have proved to be a promising approach to meet the requirements in terms of detection speed and operational convenience in diagnosis of infectious diseases. In the CD-based microfluidic platform for DNA hybridization, convection is introduced to the system to enhance mass transport so as to accelerate the hybridization rate since DNA hybridization is a diffusion limited reaction. Centrifugal force is utilized for sample propulsion and surface force is used for liquid gating. Standard microscope glass slides are used as the substrates for capture probes owing to their compatibility with commercially available instrumentation (e.g. laser scanners) for detection. Microfabricated polydimethylsiloxane (PDMS) structures are used to accomplish the fluidic functions required by the protocols for DNA hybridization. The assembly of the PDMS structure and the glass slide forms a flow-through hybridization unit that can be accommodated onto the CD platform for reagent manipulation. The above scheme has been validated with oligonucleotides as the targets using commercially available enzyme-labeled fluorescence (ELF 97) for detection of the hybridization events, and tested with amplicons of genomic staphylococcus DNA labeled with Cy dye. In both experiments, significantly higher fluorescence intensities were observed in the flow-through hybridization unit compared to the passive assays. The CD fluidic scheme was also adapted to the immobilization of thiolated oligonucleotides on gold surfaces and up to a 2.5 fold increase was observed for the rate of adsorption compared to passive immobilization. In order to reduce the reaction time for DNA amplification, a miniaturized fluidic platform was developed for rapid polymerase chain reaction (PCR). Commercially available, adhesive-coated aluminum foils and polypropylene films were laminated to structured polycarbonate films forming micro reactors in a card format. Ice valves were employed to seal the reaction chambers during thermal cycling and a Peltier-based thermal cycler was configured for rapid thermal cycling and ice valve actuation. Numerical modeling was conducted to optimize the design of the PCR reactor and explore the thermal gradient in the reaction chamber in the direction of sample depth. The PCR reactor was experimentally characterized by using thin foil thermocouples and validated by a successful amplification of 10 genome copies of E. coli ATCC 35401 tuf gene in 27 minutes. In the future, we will integrate sample preparation, PCR amplification and DNA detection into a single, centrifugal microfluidic disc that is practically affordable for molecular diagnostics.

Additional chain-branching pathways in the low-temperature oxidation of branched alkanes

DOE PAGES

Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; ...

2015-12-31

Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C 8H 14O 4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C 8H 16O 5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C 8H 16O 5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O 2 addition, intramolecular isomerization, and OH release; C 8H 14O 4 species are proposed to result from subsequent reactions of C 8H 16O 5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less

An Enhanced Polymerase Chain Reaction Assay to Detect Pre- and Full Mutation Alleles of the Fragile X Mental Retardation 1 Gene

PubMed Central

Saluto, Alessandro; Brussino, Alessandro; Tassone, Flora; Arduino, Carlo; Cagnoli, Claudia; Pappi, Patrizia; Hagerman, Paul; Migone, Nicola; Brusco, Alfredo

2005-01-01

Several diagnostic strategies have been applied to the detection of FMR1 gene repeat expansions in fragile X syndrome. Here, we report a novel polymerase chain reaction-based strategy using the Expand Long Template PCR System (Roche Diagnostics, Mannheim, Germany) and the osmolyte betaine. Repeat expansions up to ∼330 CGGs in males and up to at least ∼160 CGGs in carrier women could be easily visualized on ethidium bromide agarose gels. We also demonstrated that fluorescence analysis of polymerase chain reaction products was a reliable tool to verify the presence of premutation and full mutation alleles both in males and in females. This technique, primarily designed to detect premutation alleles, can be used as a routine first screen for expanded FMR1 alleles. PMID:16258159

Blood grouping based on PCR methods and agarose gel electrophoresis.

PubMed

Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

2015-01-01

The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

Excitation wavelength dependence of excited state intramolecular proton transfer reaction of 4'-N,N-diethylamino-3-hydroxyflavone in room temperature ionic liquids studied by optical Kerr gate fluorescence measurement.

PubMed

Suda, Kayo; Terazima, Masahide; Sato, Hirofumi; Kimura, Yoshifumi

2013-10-17

Excited state intramolecular proton transfer reactions (ESIPT) of 4'-N,N-diethylamino-3-hydroxyflavone (DEAHF) in ionic liquids have been studied by steady-state and time-resolved fluorescence measurements at different excitation wavelengths. Steady-state measurements show the relative yield of the tautomeric form to the normal form of DEAHF decreases as excitation wavelength is increased from 380 to 450 nm. The decrease in yield is significant in ionic liquids that have cations with long alkyl chains. The extent of the decrease is correlated with the number of carbon atoms in the alkyl chains. Time-resolved fluorescence measurements using optical Kerr gate spectroscopy show that ESIPT rate has a strong excitation wavelength dependence. There is a large difference between the spectra at a 200 ps delay from different excitation wavelengths in each ionic liquid. The difference is pronounced in ionic liquids having a long alkyl chain. The equilibrium constant in the electronic excited state obtained at a 200 ps delay and the average reaction rate are also correlated with the alkyl chain length. Considering the results of the steady-state fluorescence and time-resolved measurements, the excitation wavelength dependence of ESIPT is explained by state selective excitation due to the difference of the solvation, and the number of alkyl chain carbon atoms is found to be a good indicator of the effect of inhomogeneity for this reaction.

Lifetime Neutron Fluence Analysis of the Ringhals Unit 1 Boiling Water Reactor

NASA Astrophysics Data System (ADS)

Kulesza, Joel A.; Roudén, Jenny; Green, Eva-Lena

2016-02-01

This paper describes a neutron fluence assessment considering the entire commercial operating history (35 cycles or ˜ 25 effective full power years) of the Ringhals Unit 1 reactor pressure vessel beltline region. In this assessment, neutron (E >1.0 MeV) fluence and iron atom displacement distributions were calculated on the moderator tank and reactor pressure vessel structures. To validate those calculations, five in-vessel surveillance chain dosimetry sets were evaluated as well as material samples taken from the upper core grid and wide range neutron monitor tubes to act as a form of retrospective dosimetry. During the analysis, it was recognized that delays in characterizing the retrospective dosimetry samples reduced the amount of reactions available to be counted and complicated the material composition determination. However, the comparisons between the surveillance chain dosimetry measurements (M) and calculated (C) results show similar and consistent results with the linear average M/C ratio of 1.13 which is in good agreement with the resultant least squares best estimate (BE)/C ratios of 1.10 for both neutron (E >1.0 MeV) flux and iron atom displacement rate.

On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+11B process

NASA Astrophysics Data System (ADS)

Belyaev, V. S.; Krainov, V. P.; Zagreev, B. V.; Matafonov, A. P.

2015-07-01

Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+11B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from 11B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+11B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons among fusion products. Nuclear reactions that follow the p+11B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+11B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.

A Bullet-Block Experiment that Explains the Chain Fountain

NASA Astrophysics Data System (ADS)

Pantaleone, J.; Smith, R.

2018-05-01

It is common in science for two phenomena to appear to be very different, but in fact follow from the same basic principles. Here we consider such a case, the connection between the chain fountain and a bullet-block collision experiment. When an upward moving bullet strikes a wooden block resting on a horizontal table, the block will rise to a higher height when the bullet strikes near the end of the block. This is because the quickly rotating block experiences an additional upward "reaction" force from its contact with the table. Such a reaction force also explains the chain fountain. When a chain falls from a pile in a container to the floor below, the chain rises up above the container. This rise occurs because the quickly rotating links in the container push off of the surface beneath them. We derive a model that accurately describes our measurements in the bullet-block experiment, and then use this same model to calculate an approximate expression for the distance the chain rises above the container. More extensive discussions of the chain fountain are available elsewhere.

Applicability of three alternative instruments for food authenticity analysis: GMO identification.

PubMed

Burrell, A; Foy, C; Burns, M

2011-03-06

Ensuring foods are correctly labelled for ingredients derived from genetically modified organisms (GMOs) is an issue facing manufacturers, retailers, and enforcement agencies. DNA approaches for the determination of food authenticitys often use the polymerase chain reaction (PCR), and PCR products can be detected using capillary or gel electrophoresis. This study examines the fitness for purpose of the application of three laboratory electrophoresis instruments (Agilent Bioanalyzer 2100, Lab901 TapeStation, and Shimadzu MCE-202 MultiNA) for the detection of GMOs using PCR based on a previously validated protocol. Whilst minor differences in the performance characteristics of bias and precision were observed, all three instruments demonstrated their applicability in using this protocol for screening of GMO ingredients.

Applicability of Three Alternative Instruments for Food Authenticity Analysis: GMO Identification

PubMed Central

Burrell, A.; Foy, C.; Burns, M.

2011-01-01

Ensuring foods are correctly labelled for ingredients derived from genetically modified organisms (GMOs) is an issue facing manufacturers, retailers, and enforcement agencies. DNA approaches for the determination of food authenticitys often use the polymerase chain reaction (PCR), and PCR products can be detected using capillary or gel electrophoresis. This study examines the fitness for purpose of the application of three laboratory electrophoresis instruments (Agilent Bioanalyzer 2100, Lab901 TapeStation, and Shimadzu MCE-202 MultiNA) for the detection of GMOs using PCR based on a previously validated protocol. Whilst minor differences in the performance characteristics of bias and precision were observed, all three instruments demonstrated their applicability in using this protocol for screening of GMO ingredients. PMID:21527985

Case-Study Investigation of Equine Maternity via PCR-RFLP: A Biochemistry Laboratory Experiment

PubMed Central

Millard, Julie T.; Chuang, Edward; Lucas, James S.; Nagy, Erzsebet E.; Davis, Griffin T.

2013-01-01

A simple and robust biochemistry laboratory experiment is described that uses restriction fragment length polymorphism (RFLP) of polymerase chain reaction (PCR) products to verify the identity of a potentially valuable horse. During the first laboratory period, students purify DNA from equine samples and amplify two loci of mitochondrial DNA. During the second laboratory period, students digest PCR products with restriction enzymes and analyze the fragment sizes through agarose gel electrophoresis. An optional step of validating DNA extracts through realtime PCR can expand the experiment to three weeks. This experiment, which has an engaging and versatile scenario, provides students with exposure to key principles and techniques of molecular biology, bioinformatics, and evolution in a forensic context. PMID:24363455

Reverse transcription quantitative real-time polymerase chain reaction reference genes in the spared nerve injury model of neuropathic pain: validation and literature search.

PubMed

Piller, Nicolas; Decosterd, Isabelle; Suter, Marc R

2013-07-10

The reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) is a widely used, highly sensitive laboratory technique to rapidly and easily detect, identify and quantify gene expression. Reliable RT-qPCR data necessitates accurate normalization with validated control genes (reference genes) whose expression is constant in all studied conditions. This stability has to be demonstrated.We performed a literature search for studies using quantitative or semi-quantitative PCR in the rat spared nerve injury (SNI) model of neuropathic pain to verify whether any reference genes had previously been validated. We then analyzed the stability over time of 7 commonly used reference genes in the nervous system - specifically in the spinal cord dorsal horn and the dorsal root ganglion (DRG). These were: Actin beta (Actb), Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal proteins 18S (18S), L13a (RPL13a) and L29 (RPL29), hypoxanthine phosphoribosyltransferase 1 (HPRT1) and hydroxymethylbilane synthase (HMBS). We compared the candidate genes and established a stability ranking using the geNorm algorithm. Finally, we assessed the number of reference genes necessary for accurate normalization in this neuropathic pain model. We found GAPDH, HMBS, Actb, HPRT1 and 18S cited as reference genes in literature on studies using the SNI model. Only HPRT1 and 18S had been once previously demonstrated as stable in RT-qPCR arrays. All the genes tested in this study, using the geNorm algorithm, presented gene stability values (M-value) acceptable enough for them to qualify as potential reference genes in both DRG and spinal cord. Using the coefficient of variation, 18S failed the 50% cut-off with a value of 61% in the DRG. The two most stable genes in the dorsal horn were RPL29 and RPL13a; in the DRG they were HPRT1 and Actb. Using a 0.15 cut-off for pairwise variations we found that any pair of stable reference gene was sufficient for the normalization process. In the rat SNI model, we validated and ranked Actb, RPL29, RPL13a, HMBS, GAPDH, HPRT1 and 18S as good reference genes in the spinal cord. In the DRG, 18S did not fulfill stability criteria. The combination of any two stable reference genes was sufficient to provide an accurate normalization.

Development and validation of real-time PCR tests for the identification of four Spodoptera species: Spodoptera eridania, Spodoptera frugiperda, Spodoptera littoralis, and Spodoptera litura (Lepidoptera: Noctuidae).

PubMed

Van de Vossenberg, B T L H; Van der Straten, M J

2014-08-01

The genus Spodoptera comprises 31 species, 4 of which are listed as quarantine pests for the European Union: Spodoptera eridania (Cramer), Spodoptera frugiperda (Smith), Spodoptera littoralis (Boisduval), and Spodoptera litura (F.). In international trade, the earlier life stages (eggs and larvae) are being intercepted at point of inspection most frequently, challenging the possibilities of morphological identification. To realize a rapid and reliable identification for all stages, we developed and validated four simplex real-time polymerase chain reaction identification tests based on the mitochondrial cytochrome b gene using dual-labeled hydrolysis probes. Method validation on dilutions of extracted DNA of the target organisms showed that low levels of template (up to 0.2-100 pg) can reliably be identified. No cross-reactivity was observed with 14 nontarget Spodoptera and 5 non-Spodoptera species in the specific Spodoptera tests. The tests showed to be repeatable, reproducible (both 100%), and robust. The new Spodoptera tests have proven to be suitable tools for routine identification of all life stages of S. eridania, S. frugiperda, S. littoralis, and S. litura.

Radiolysis of N-acetyl amino acids as model compounds for radiation degradation of polypeptides

NASA Astrophysics Data System (ADS)

Wayne Garrett, R.; Hill, David J. T.; Ho, Sook-Ying; O'Donnell, James H.; O'Sullivan, Paul W.; Pomery, Peter J.

Radiation chemical yields of (i) the volatile radiolysis products and (ii) the trapped free radicals from the y-radiolysis of the N-acetyl derivatives of glycine, L-valine, L-phenylalanine and L-tyrosine in the polycrystalline state have been determined at room temperature (303 K). Carbon dioxide was found to be the major molecular product for all these compounds with G(CO 2) varying from 0.36 for N-acetyl-L-tyrosine to 8 for N-acetyl-L-valine. There was evidence for some scission of the N-C α bond, indicated by the production of acetamide and the corresponding aliphatic acid, but the determination reaction was found to be of much lesser importance than the decarboxylation reaction. A protective effect of the aromatic ring in N-acetyl-L-phenylalanine and in N-acetyl-L-tyrosine was indicated by the lower yields of volatile products for these compounds. The yields of trapped free radicals were found to vary with the nature of the amino acid side chain, increasing with chain length and chain branching. The radical yields were decreased by incorporation of an aromatic moiety in the side chain, this effect being greater for the tyrosyl side chain than for the phenyl side chain. The G(R·) values showed a good correlation with G(CO 2) indicating that a common reaction may be involved in radical production and carbon dioxide formation.

Isotopomer enrichment assay for very short chain fatty acids and its metabolic applications.

PubMed

Tomcik, Kristyen; Ibarra, Rafael A; Sadhukhan, Sushabhan; Han, Yong; Tochtrop, Gregory P; Zhang, Guo-Fang

2011-03-01

The present work illustrated an accurate GC/MS measurement for the low isotopomer enrichment assay of formic acid, acetic acid, propionic aicd, butyric acid, and pentanoic acid. The pentafluorobenzyl bromide derivatives of these very short chain fatty acids have high sensitivity of isotopoic enrichment due to their low natural isotopomer distribution in negative chemical ionization mass spectrometric mode. Pentafluorobenzyl bromide derivatization reaction was optimized in terms of pH, temperature, reaction time, and the amount of pentafluorobenzyl bromide versus sample. The precision, stability, and accuracy of this method for the isotopomer analysis were validated. This method was applied to measure the enrichments of formic acid, acetic acid, and propionic acid in the perfusate from rat liver exposed to Krebs-Ringer bicarbonate buffer only, 0-1mM [3,4-(13)C(2)]-4-hydroxynonanoate, and 0-2mM [5,6,7-(13)C(3)]heptanoate. The enrichments of acetic acid and propionic acid in the perfusate are comparable to the labeling pattern of acetyl-CoA and propionyl-CoA in the rat liver tissues. The enrichment of the acetic acid assay is much more sensitive and precise than the enrichment of acetyl-CoA by LC-MS/MS. The reversibility of propionyl-CoA from succinyl-CoA was confirmed by the low labeling of M1 and M2 of propionic acid from [5,6,7-(13)C(3)]heptanoate perfusates. 2010 Elsevier Inc. All rights reserved.

Comparison of reverse transcription-quantitative polymerase chain reaction methods and platforms for single cell gene expression analysis.

PubMed

Fox, Bridget C; Devonshire, Alison S; Baradez, Marc-Olivier; Marshall, Damian; Foy, Carole A

2012-08-15

Single cell gene expression analysis can provide insights into development and disease progression by profiling individual cellular responses as opposed to reporting the global average of a population. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is the "gold standard" for the quantification of gene expression levels; however, the technical performance of kits and platforms aimed at single cell analysis has not been fully defined in terms of sensitivity and assay comparability. We compared three kits using purification columns (PicoPure) or direct lysis (CellsDirect and Cells-to-CT) combined with a one- or two-step RT-qPCR approach using dilutions of cells and RNA standards to the single cell level. Single cell-level messenger RNA (mRNA) analysis was possible using all three methods, although the precision, linearity, and effect of lysis buffer and cell background differed depending on the approach used. The impact of using a microfluidic qPCR platform versus a standard instrument was investigated for potential variability introduced by preamplification of template or scaling down of the qPCR to nanoliter volumes using laser-dissected single cell samples. The two approaches were found to be comparable. These studies show that accurate gene expression analysis is achievable at the single cell level and highlight the importance of well-validated experimental procedures for low-level mRNA analysis. Copyright © 2012 Elsevier Inc. All rights reserved.

Clinical Usefulness of a One-Tube Nested Reverse Transcription Quantitative Polymerase Chain Reaction Assay for Evaluating Human Epidermal Growth Factor Receptor 2 mRNA Overexpression in Formalin-Fixed and Paraffin-Embedded Breast Cancer Tissue Samples.

PubMed

Wang, Hye-Young; Ahn, Sungwoo; Park, Sunyoung; Kim, SeungIl; Lee, Hyeyoung

2017-01-01

Currently, the two main methods used to analyze human epidermal growth factor receptor 2 (HER2) amplification or overexpression have a limited accuracy and high costs. These limitations can be overcome by the development of complementary quantitative methods. In this study, we analyzed HER2 mRNA expression in clinical formalin-fixed and paraffin-embedded (FFPE) samples using a one-tube nested reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay. We measured expression relative to 3 reference genes and compared the results to those obtained by conventional immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) assays with 226 FFPE breast cancer tissue samples. The one-tube nested RT-qPCR assay proved to be highly sensitive and specific based on comparisons with IHC (96.9 and 97.7%, respectively) and FISH (92.4 and 92.9%, respectively) obtained with the validation set. Comparisons with clinicopathological data revealed significant associations between HER2 overexpression and TNM stage (p < 0.01), histological type (p < 0.01), ER status (p < 0.001), PR status (p < 0.05), HER2 status (p < 0.001), and molecular subtypes (p < 0.001). Based on these findings, our one-tube nested RT-qPCR assay is a potentially useful and complementary screening tool for the detection of HER2 mRNA overexpression. © 2016 S. Karger AG, Basel.

Development of multiplex polymerase chain reaction assay for simultaneous detection of clostero-, badna- and mandari-viruses along with huanglongbing bacterium in citrus trees.

PubMed

Meena, Ram Prasnna; Baranwal, V K

2016-09-01

Citrus trees harbor a large number of viral and bacterial pathogens. Citrus yellow vein clearing virus (CYVCV), Indian citrus ringspot virus (ICRSV), Citrus yellow mosaic virus (CYMV), Citrus tristeza virus (CTV) and a bacterium, Candidatus Liberibacter asiaticus (CLa) associated with huanglongbing (HLB) disease, the most prevalent pathogens in citrus orchards of different regions in India and are responsible for debilitating citriculture. For detection of these viral and bacterial pathogens a quick, sensitive and cost effective detection method is required. With this objective a multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of four viruses and a bacterium in citrus. Several sets of primers were designed for each virus based on the retrieved reference sequences from the GenBank. A primer pair published previously was used for greening bacterium. Each pair of primers was evaluated for their sensitivity and differentiation by simplex and mPCR. The constant amplified products were identified on the basis of molecular size in mPCR and were compared with standard PCR. The amplicons were cloned and results were confirmed with sequencing analysis. The mPCR assay was validated using naturally infected field samples for one or more citrus viruses and the huanglongbing bacterium. The mPCR assay developed here will aid in the production of virus free planting materials and rapid indexing for certification of citrus budwood programme. Copyright © 2016 Elsevier B.V. All rights reserved.

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

PubMed

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

Comparisons of serum miRNA expression profiles in patients with diabetic retinopathy and type 2 diabetes mellitus.

PubMed

Ma, Jianping; Wang, Jufang; Liu, Yanfen; Wang, Changyi; Duan, Donghui; Lu, Nanjia; Wang, Kaiyue; Zhang, Lu; Gu, Kaibo; Chen, Sihan; Zhang, Tao; You, Dingyun; Han, Liyuan

2017-02-01

The aim of this study was to compare the expression levels of serum miRNAs in diabetic retinopathy and type 2 diabetes mellitus. Serum miRNA expression profiles from diabetic retinopathy cases (type 2 diabetes mellitus patients with diabetic retinopathy) and type 2 diabetes mellitus controls (type 2 diabetes mellitus patients without diabetic retinopathy) were examined by miRNA-specific microarray analysis. Quantitative real-time polymerase chain reaction was used to validate the significantly differentially expressed serum miRNAs from the microarray analysis of 45 diabetic retinopathy cases and 45 age-, sex-, body mass index- and duration-of-diabetes-matched type 2 diabetes mellitus controls. The relative changes in serum miRNA expression levels were analyzed using the 2-ΔΔCt method. A total of 5 diabetic retinopathy cases and 5 type 2 diabetes mellitus controls were included in the miRNA-specific microarray analysis. The serum levels of miR-3939 and miR-1910-3p differed significantly between the two groups in the screening stage; however, quantitative real-time polymerase chain reaction did not reveal significant differences in miRNA expression for 45 diabetic retinopathy cases and their matched type 2 diabetes mellitus controls. Our findings indicate that miR-3939 and miR-1910-3p may not play important roles in the development of diabetic retinopathy; however, studies with a larger sample size are needed to confirm our findings.

Biosensor Architectures for High-Fidelity Reporting of Cellular Signaling

PubMed Central

Dushek, Omer; Lellouch, Annemarie C.; Vaux, David J.; Shahrezaei, Vahid

2014-01-01

Understanding mechanisms of information processing in cellular signaling networks requires quantitative measurements of protein activities in living cells. Biosensors are molecular probes that have been developed to directly track the activity of specific signaling proteins and their use is revolutionizing our understanding of signal transduction. The use of biosensors relies on the assumption that their activity is linearly proportional to the activity of the signaling protein they have been engineered to track. We use mechanistic mathematical models of common biosensor architectures (single-chain FRET-based biosensors), which include both intramolecular and intermolecular reactions, to study the validity of the linearity assumption. As a result of the classic mechanism of zero-order ultrasensitivity, we find that biosensor activity can be highly nonlinear so that small changes in signaling protein activity can give rise to large changes in biosensor activity and vice versa. This nonlinearity is abolished in architectures that favor the formation of biosensor oligomers, but oligomeric biosensors produce complicated FRET states. Based on this finding, we show that high-fidelity reporting is possible when a single-chain intermolecular biosensor is used that cannot undergo intramolecular reactions and is restricted to forming dimers. We provide phase diagrams that compare various trade-offs, including observer effects, which further highlight the utility of biosensor architectures that favor intermolecular over intramolecular binding. We discuss challenges in calibrating and constructing biosensors and highlight the utility of mathematical models in designing novel probes for cellular signaling. PMID:25099816

Development of real-time PCR method for the detection and the quantification of a new endogenous reference gene in sugar beet "Beta vulgaris L.": GMO application.

PubMed

Chaouachi, Maher; Alaya, Akram; Ali, Imen Ben Haj; Hafsa, Ahmed Ben; Nabi, Nesrine; Bérard, Aurélie; Romaniuk, Marcel; Skhiri, Fethia; Saïd, Khaled

2013-01-01

KEY MESSAGE : Here, we describe a new developed quantitative real-time PCR method for the detection and quantification of a new specific endogenous reference gene used in GMO analysis. The key requirement of this study was the identification of a new reference gene used for the differentiation of the four genomic sections of the sugar beet (Beta vulgaris L.) (Beta, Corrollinae, Nanae and Procumbentes) suitable for quantification of genetically modified sugar beet. A specific qualitative polymerase chain reaction (PCR) assay was designed to detect the sugar beet amplifying a region of the adenylate transporter (ant) gene only from the species of the genomic section I of the genus Beta (cultivated and wild relatives) and showing negative PCR results for 7 species of the 3 other sections, 8 related species and 20 non-sugar beet plants. The sensitivity of the assay was 15 haploid genome copies (HGC). A quantitative real-time polymerase chain reaction (QRT-PCR) assay was also performed, having high linearity (R (2) > 0.994) over sugar beet standard concentrations ranging from 20,000 to 10 HGC of the sugar beet DNA per PCR. The QRT-PCR assay described in this study was specific and more sensitive for sugar beet quantification compared to the validated test previously reported in the European Reference Laboratory. This assay is suitable for GMO quantification in routine analysis from a wide variety of matrices.

Detection of Onchocerca volvulus in Skin Snips by Microscopy and Real-Time Polymerase Chain Reaction: Implications for Monitoring and Evaluation Activities.

PubMed

Thiele, Elizabeth A; Cama, Vitaliano A; Lakwo, Thomson; Mekasha, Sindeaw; Abanyie, Francisca; Sleshi, Markos; Kebede, Amha; Cantey, Paul T

2016-04-01

Microscopic evaluation of skin biopsies is the monitoring and evaluation (M and E) method currently used by multiple onchocerciasis elimination programs in Africa. However, as repeated mass drug administration suppresses microfilarial loads, the sensitivity and programmatic utility of skin snip microscopy is expected to decrease. Using a pan-filarial real-time polymerase chain reaction with melt curve analysis (qPCR-MCA), we evaluated 1) the use of a single-step molecular assay for detecting and identifying Onchocerca volvulus microfilariae in residual skin snips and 2) the sensitivity of skin snip microscopy relative to qPCR-MCA. Skin snips were collected and examined with routine microscopy in hyperendemic regions of Uganda and Ethiopia (N= 500 each) and "residual" skin snips (tissue remaining after induced microfilarial emergence) were tested with qPCR-MCA. qPCR-MCA detected Onchocerca DNA in 223 residual snips: 139 of 147 microscopy(+) and 84 among microscopy(-) snips, suggesting overall sensitivity of microscopy was 62.3% (139/223) relative to qPCR-MCA (75.6% in Uganda and 28.6% in Ethiopia). These findings demonstrate the insufficient sensitivity of skin snip microscopy for reliable programmatic monitoring. Molecular tools such as qPCR-MCA can augment sensitivity and provide diagnostic confirmation of skin biopsies and will be useful for evaluation or validation of new onchocerciasis M and E tools. © The American Society of Tropical Medicine and Hygiene.

Combinational chromosomal aneuploidies and HPV status for prediction of head and neck squamous cell carcinoma prognosis in biopsies and cytological preparations.

PubMed

Wemmert, Silke; Linxweiler, Maximilian; Lerner, Cornelia; Bochen, Florian; Kulas, Philipp; Linxweiler, Johannes; Smola, Sigrun; Urbschat, Steffi; Wagenpfeil, Stefan; Schick, Bernhard

2018-06-01

Head and neck squamous cell carcinoma (HNSCC) is one of the most common human cancer types with a very poor prognosis despite improvements in therapeutic modalities. The major known risk factors are tobacco use and alcohol consumption or infection with high-risk human papilloma viruses (HPV), especially in oropharyngeal tumors. The current management based on the assessment of a variety of clinical and pathological parameters does not sufficiently predict outcome. Chromosomal alterations detected in HNSCCs were characterized by metaphase comparative genomic hybridization (CGH) and correlated with clinical parameters as well as survival time. Candidate regions were validated by quantitative polymerase chain reaction, fluorescence-in situ-hybridization (FISH) on dapped tumor tissue and liquid-based cytological smear preparations. In addition, HPV status was determined by polymerase chain reaction and simultaneous immunocytochemical p16 INK4a -Ki67 staining. The most frequent DNA copy number gains were observed on chromosome arms 3q, 8q, 5p, 7q, 12p, and 12q. DNA copy number decreases occurred most frequently at 3p, 17p, 4q, and 5q. FISH analysis verified in part the observed alterations by CGH on dapped tissues and was especially able to detect the most frequent DNA copy changes in cytological specimens. The combination of HPV status and prognostic copy number alteration detected by FISH in biopsies or cytological specimens may be an applicable protocol for screening head and neck cancer patients prior to therapy.

CHEK2 1100delC, IVS2+1G>A and I157T mutations are not present in colorectal cancer cases from Turkish population.

PubMed

Bayram, Süleyman; Topaktaş, Mehmet; Akkız, Hikmet; Bekar, Aynur; Akgöllü, Ersin

2012-10-01

The cell cycle checkpoint kinase 2 (CHEK2) protein participates in the DNA damage response in many cell types. Germline mutations in CHEK2 (1100delC, IVS2+1G>A and I157T) have been impaired serine/threonine kinase activity and associated with a range of cancer types. This hospital-based case-control study aimed to investigate whether CHEK2 1100delC, IVS2+1G>A and I157T mutations play an important role in the development of colorectal cancer (CRC) in Turkish population. A total of 210 CRC cases and 446 cancer-free controls were genotyped for CHEK2 mutations by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and allele specific-polymerase chain reaction (AS-PCR) methods. We did not find the CHEK2 1100delC, IVS2+1G>A and I157T mutations in any of the Turkish subjects. Our result demonstrate for the first time that CHEK2 1100delC, IVS2+1G>A and I157T mutations have not been agenetic susceptibility factor for CRC in the Turkish population. Overall, our data suggest that genotyping of CHEK2 mutations in clinical settings in the Turkish population should not be recommended. However, independent studies are need to validate our findings in a larger series, as well as in patients of different ethnic origins. Copyright © 2012 Elsevier Ltd. All rights reserved.

Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

EPA Science Inventory

The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

Highly efficient preparation of selectively isotope cluster-labeled long chain fatty acids via two consecutive C(sp3)-C(sp3) cross-coupling reactions.

PubMed

Lethu, Sébastien; Matsuoka, Shigeru; Murata, Michio

2014-02-07

An efficient synthesis involving two copper-catalyzed alkyl-alkyl coupling reactions has been designed to easily access doubly isotope-labeled fatty acids. Such NMR- and IR-active compounds were obtained in excellent overall yields and will be further used for determining the conformation of an alkyl chain of lipidic biomolecules upon interaction with proteins.

Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

USDA-ARS?s Scientific Manuscript database

This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

Polymer-based microfluidic chips for isothermal amplification of nucleic acids

NASA Astrophysics Data System (ADS)

Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

2017-11-01

Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

Polymerase chain reaction with phase change as intrinsic thermal control

NASA Astrophysics Data System (ADS)

Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

2013-04-01

This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

Photochemical reaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen) with basic amino acids and dipeptides.

PubMed

Suzuki, Tadashi; Shinoda, Mio; Osanai, Yohei; Isozaki, Tasuku

2013-08-22

Photoreaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen, KP) with basic amino acids (histidine, lysine, and arginine) and dipeptides (carnosine and anserine) including a histidine moiety in phosphate buffer solution (pH 7.4) has been investigated with transient absorption spectroscopy. With UV irradiation KP(-) gave rise to a carbanion through a decarboxylation reaction, and the carbanion easily abstracted a proton from the surrounding molecule to yield a 3-ethylbenzophenone ketyl biradical (EBPH). The dipeptides as well as the basic amino acids were found to accelerate the proton transfer reaction whereas alanine and glycine had no effect on the reaction, revealing that these amino acids having a protonated side chain act as a proton donor. The formation quantum yield of EBPH was estimated to be fairly large by means of an actinometrical method with benzophenone, and the bimolecular reaction rate constant for the proton transfer between the carbanion and the protonated basic amino acids or the protonated dipeptides was successfully determined. It has become apparent that the bimolecular reaction rate constant for the proton transfer depended on the acid dissociation constant for the side chain of the amino acids for the first time. This reaction mechanism was interpreted by difference of the heat of reaction for each basic amino acid based on the thermodynamical consideration. These results strongly suggest that the side chain of the basic amino acid residue in protein should play an important role for photochemistry of KP in vivo.

FACTORS AFFECTING THE CHAIN LENGTH OF GROUP A STREPTOCOCCI

PubMed Central

Ekstedt, Richard D.; Stollerman, Gene H.

1960-01-01

Group A streptococci which grew in long chains in the presence of homologous anti-M antibody were split into their original length by the addition of an excess of homologous M protein to the culture. The chain-splitting reaction showed temperature and pH optima (37°C., 7.5) and was completely inhibited at 0°C. or by heat-killing the long chains at 56°C. prior to the addition of M protein. Addition of sublethal doses of HgCl2, or of penicillin, inhibited the chain-splitting reaction. Pneumococci behaved in entirely comparable fashion to streptococci in similar experiments. Virulent strains of streptococci formed the shortest chains when broth media was enriched with serum. The chain-shortening effect of serum enrichment of the media was most apparent with encapsulated strains and under cultural conditions that favored capsule formation. Loss of capsules by mutation or by unfavorable growth conditions resulted in increase in chain length. The activity of the chain-splitting mechanism seemed to be independent of M protein, however, since encapsulated M-negative variants also formed very short chain in serum-enriched media. The physical presence of the capsule was not essential for chain shortening since enzymatic removal of the capsule with hyaluronidase during growth did not affect chain length. These results strongly suggest that chain-splitting of streptococci and pneumococci occurs by an active metabolic mechanism, presumably enzymatic, which is inhibited by the union of surface antigens with specific antibody. PMID:13726267

Assessing the influence of side-chain and main-chain aromatic benzyltrimethyl ammonium on anion exchange membranes.

PubMed

Li, Xiuhua; Nie, Guanghui; Tao, Jinxiong; Wu, Wenjun; Wang, Liuchan; Liao, Shijun

2014-05-28

3,3'-Di(4″-methyl-phenyl)-4,4'-difluorodiphenyl sulfone (DMPDFPS), a new monomer with two pendent benzyl groups, was easily prepared by Suzuki coupling reaction in high yield. A series of side-chain type ionomers (PAES-Qs) containing pendant side-chain benzyltrimethylammonium groups, which linked to the backbone by alkaline resisting conjugated C-C bonds, were synthesized via polycondensation, bromination, followed by quaternization and alkalization. To assess the influence of side-chain and main-chain aromatic benzyltrimethylammonium on anion exchange membranes (AEMs), the main-chain type ionomers (MPAES-Qs) with the same backbone were synthesized following the similar procedure. GPC and (1)H NMR results indicate that the bromination shows no reaction selectivity of polymer configurations and ionizations of the side-chain type polymers display higher conversions than that of the main-chain type ones do. These two kinds of AEMs were evaluated in terms of ion exchange capacity (IEC), water uptake, swelling ratio, λ, volumetric ion exchange capacity (IECVwet), hydroxide conductivity, mechanical and thermal properties, and chemical stability, respectively. The side-chain type structure endows AEMs with lower water uptake, swelling ratio and λ, higher IECVwet, much higher hydroxide conductivity, more robust dimensional stability, mechanical and thermal properties, and higher stability in hot alkaline solution. The side-chain type cationic groups containing molecular configurations have the distinction of being practical AEMs and membrane electrode assemblies of AEMFCs.

Intact carbohydrate structures as part of the melanoidin skeleton.

PubMed

Cämmerer, Bettina; Jalyschko, Walentina; Kroh, Lothar W

2002-03-27

Model melanoidins from monomeric, oligomeric, and polymeric carbohydrates, and amino acids formed under aqueous as well as water-free reaction conditions, were submitted to acidic catalyzed hydrolysis. Their degradation products were detected qualitatively and quantitatively by HPTLC and HPLC-DAD. A considerable amount of monomer carbohydrates from hydrolysis of model melanoidins formed under water-free reaction conditions was detected. It can be seen clearly that the amount of carbohydrates released increased with increasing degree of polymerization of the carbohydrates used as starting material. In comparison, the hydrolysis of melanoidins formed in aqueous condition resulted in only a small glucose release. It seems that in the Maillard reaction under water-free conditions, a significant amount of di- and oligomer carbohydrates were incorporated into the melanoidin skeleton as complete oligomer with intact glycosidic bond, forming side chains at the melanoidin skeleton. Additional side chains could be formed by transglycosylation reactions. With increasing water content, hydrothermolytic as well as retro-aldol reactions of the starting carbonyl components became significant, and therefore the possibility of forming side chains decreased. The results are consistent with the postulated melanoidin structure being built up mainly from sugar degradation products, probably branched via amino compounds.

A non-additive repulsive contribution in an equation of state: The development for homonuclear square well chains equation of state validated against Monte Carlo simulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trinh, Thi-Kim-Hoang; Laboratoire de Science des Procédés et des Matériaux; Passarello, Jean-Philippe, E-mail: Jean-Philippe.Passarello@lspm.cnrs.fr

This work consists of the adaptation of a non-additive hard sphere theory inspired by Malakhov and Volkov [Polym. Sci., Ser. A 49(6), 745–756 (2007)] to a square-well chain. Using the thermodynamic perturbation theory, an additional term is proposed that describes the effect of perturbing the chain of square well spheres by a non-additive parameter. In order to validate this development, NPT Monte Carlo simulations of thermodynamic and structural properties of the non-additive square well for a pure chain and a binary mixture of chains are performed. Good agreements are observed between the compressibility factors originating from the theory and thosemore » from molecular simulations.« less

Biodiesel production from triolein and short chain alcohols through biocatalysis.

PubMed

Salis, Andrea; Pinna, Marcella; Monduzzi, Maura; Solinas, Vincenzo

2005-09-29

Oleic acid alkyl esters (biodiesel) were synthesised by biocatalysis in solvent-free conditions. Different commercial immobilised lipases, namely Candida antarctica B, Rizhomucor miehei, and Pseudomonas cepacia, were tested towards the reaction between triolein and butanol to produce butyl oleate. Pseudomonas cepacia lipase resulted to be the most active enzyme reaching 100% of conversion after 6h. Different operative conditions such as reaction temperature, water activity, and reagent stoichiometric ratio were investigated and optimised. These conditions were then used to investigate the effect of linear and branched short chain alcohols. Methanol and 2-butanol were the worst alcohols: the former, probably, due to its low miscibility with the oil and the latter because secondary alcohols usually are less reactive than primary alcohols. Conversely, linear and branched primary alcohols with short alkyl chains (C(2)--C(4)) showed high reaction rate and conversion. A mixture of linear and branched short chain alcohols that mimics the residual of ethanol distillation (fusel oil) was successfully used for oleic acid ester synthesis. These compounds are important in biodiesel mixtures since they improve low temperature properties.

METHOD OF SUSTAINING A NEUTRONIC CHAIN REACTING SYSTEM

DOEpatents

Fermi, E.; Leverett, M.C.

1957-11-12

This patent relates to neutronic reactors and a method of sustainlng a chain reaction. The reactor shown in the patent for carrying out the method is the gas-cooled type comprised of a solid moderator having a plurality of passages therethrough for receiving bodies of fissionable material. In carrying out the method, the reactor is loaded by inserting in the passages fuel elements and moderator material in a proportion to sustain a chain reaction As the reproduction ratio decreases below the desired fiiaire due to impurities formed during operation of the reactor, the moderator material is gradually replaced with additional fuel material to maintain the reproduction ratio above unity.

Time-Resolved O3 Chemical Chain Reaction Kinetics Via High-Resolution IR Laser Absorption Methods

NASA Technical Reports Server (NTRS)

Kulcke, Axel; Blackmon, Brad; Chapman, William B.; Kim, In Koo; Nesbitt, David J.

1998-01-01

Excimer laser photolysis in combination with time-resolved IR laser absorption detection of OH radicals has been used to study O3/OH(v = 0)/HO2 chain reaction kinetics at 298 K, (i.e.,(k(sub 1) is OH + 03 yields H02 + 02 and (k(sub 2) is H02 + 03 yields OH + 202). From time-resolved detection of OH radicals with high-resolution near IR laser absorption methods, the chain induction kinetics have been measured at up to an order of magnitude higher ozone concentrations ([03] less than or equal to 10(exp 17) molecules/cu cm) than accessible in previous studies. This greater dynamic range permits the full evolution of the chain induction, propagation, and termination process to be temporally isolated and measured in real time. An exact solution for time-dependent OH evolution under pseudo- first-order chain reaction conditions is presented, which correctly predicts new kinetic signatures not included in previous OH + 03 kinetic analyses. Specifically, the solutions predict an initial exponential loss (chain "induction") of the OH radical to a steady-state level ([OH](sub ss)), with this fast initial decay determined by the sum of both chain rate constants, k(sub ind) = k(sub 1) + k(sub 2). By monitoring the chain induction feature, this sum of the rate constants is determined to be k(sub ind) = 8.4(8) x 10(exp -14) cu cm/molecule/s for room temperature reagents. This is significantly higher than the values currently recommended for use in atmospheric models, but in excellent agreement with previous results from Ravishankara et al.

Maillard reaction versus other nonenzymatic modifications in neurodegenerative processes.

PubMed

Pamplona, Reinald; Ilieva, Ekaterina; Ayala, Victoria; Bellmunt, Maria Josep; Cacabelos, Daniel; Dalfo, Esther; Ferrer, Isidre; Portero-Otin, Manuel

2008-04-01

Nonenzymatic protein modifications are generated from direct oxidation of amino acid side chains and from reaction of the nucleophilic side chains of specific amino acids with reactive carbonyl species. These reactions give rise to specific markers that have been analyzed in different neurodegenerative diseases sharing protein aggregation, such as Alzheimer's disease, Pick's disease, Parkinson's disease, dementia with Lewy bodies, Creutzfeldt-Jakob disease, and amyotrophic lateral sclerosis. Collectively, available data demonstrate that oxidative stress homeostasis, mitochondrial function, and energy metabolism are key factors in determining the disease-specific pattern of protein molecular damage. In addition, these findings suggest the lack of a "gold marker of oxidative stress," and, consequently, they strengthen the need for a molecular dissection of the nonenzymatic reactions underlying neurodegenerative processes.

Intramolecular Benzoin Reaction Catalyzed by Benzaldehyde Lyase from Pseudomonas Fluorescens Biovar I.

PubMed

Hernández, Karel; Parella, Teodor; Petrillo, Giovanna; Usón, Isabel; Wandtke, Claudia M; Joglar, Jesús; Bujons, Jordi; Clapés, Pere

2017-05-02

Intramolecular benzoin reactions catalyzed by benzaldehyde lyase from Pseudomonas fluorescens biovar I (BAL) are reported. The structure of the substrates envisaged for this reaction consists of two benzaldehyde derivatives linked by an alkyl chain. The structural requirements needed to achieve the intramolecular carbon-carbon bond reaction catalyzed by BAL were established. Thus, a linker consisting of a linear alkyl chain of three carbon atoms connected through ether-type bonds to the 2 and 2' positions of two benzaldehyde moieties, which could be substituted with either Cl, Br, or OCH 3 at either the 3 and 3' or 5 and 5' positions, were suitable substrates for BAL. Reactions with 61-84 % yields of the intramolecular product and ee values between 64 and 98 %, were achieved. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Impact of toxigenic Clostridium difficile polymerase chain reaction testing on the clinical microbiology laboratory and inpatient epidemiology.

PubMed

Napierala, Maureen; Munson, Erik; Skonieczny, Patrice; Rodriguez, Sonia; Riederer, Nancy; Land, Gayle; Luzinski, Mary; Block, Denise; Hryciuk, Jeanne E

2013-08-01

Conversion from Clostridium difficile toxin A/B EIA to tcdB polymerase chain reaction for diagnosis of C. difficile infection (CDI) resulted in significant decreases in laboratory testing volume and largely unchanged C. difficile toxin detection rates. Decreases in healthcare-associated CDI rates (P ≤ 0.05) reflected a clinical practice benefit of this conversion. Copyright © 2013 Elsevier Inc. All rights reserved.

Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

PubMed

Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

2014-03-01

The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

Preemptive Isolation Precautions of Patients at High Risk for Methicillin-Resistant Staphylococcus aureus in Combination With Ultrarapid Polymerase Chain Reaction Screening as an Effective Tool for Infection Control.

PubMed

Hallak, Ghias; Neuner, Bruno; Schefold, Joerg C; Gorzelniak, Kerstin; Rapsch, Brigitte; Pfüller, Roland; Stengel, Dirk; Wellmann, Jürgen; Ekkernkamp, Axel; Walter, Michael

2016-12-01

This sequential nonrandomized intervention study investigated the role of preemptive isolation precautions plus ultrarapid polymerase chain reaction screening for methicillin-resistant Staphylococcus aureus (MRSA). Compared with no prophylactic isolation plus conventional microbiology MRSA screening, nosocomial MRSA colonization and total MRSA incidence per 10,000 patient days significantly decreased. Infect Control Hosp Epidemiol 2016;1489-1491.

Mycoplasma haemolamae infection in a 4-day-old cria: Support for in utero transmission by use of a polymerase chain reaction assay

PubMed Central

Ladd, Sabine M.; Sponenberg, D. Phillip; Crisman, Mark V.; Messick, Joanne B.

2006-01-01

Abstract Blood smear examination in a 4-day-old alpaca revealed massive erythrocyte parasitism by Mycoplasma haemolamae. Blood collected from both the nonparasitemic dam and the cria were positive for M. haemolamae by polymerase chain reaction (PCR) analysis. These findings suggest in utero transmission of M. haemolamae in camelids, even when the dam is not parasitemic. PMID:16604978

Synthesis of Side-Chain Oxysterols and their Enantiomers through Cross-Metathesis Reactions of Δ22 Steroids

PubMed Central

Brownholland, David P.

2017-01-01

A synthetic route that utilizes a cross-metathesis reaction with Δ22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. PMID:28300584

Clinical Characteristics and Outcomes of Hematologic Malignancy Patients With Positive Clostridium difficile Toxin Immunoassay Versus Polymerase Chain Reaction Test Results.

PubMed

Ziegler, Matthew; Landsburg, Daniel; Pegues, David; Alby, Kevin; Gilmar, Cheryl; Bink, Kristen; Gorman, Theresa; Moore, Amy; Bonhomme, Brittaney; Omorogbe, Jacqueline; Tango, Dana; Tolomeo, Pam; Han, Jennifer H

2018-04-25

In a cohort of inpatients with hematologic malignancy and positive enzyme immunoassay (EIA) or polymerase chain reaction (PCR) Clostridium difficile tests, we found that clinical characteristics and outcomes were similar between these groups. The method of testing is unlikely to predict infection in this population, and PCR-positive results should be treated with concern.Infect Control Hosp Epidemiol 2018;1-4.

METHOD OF OPERATING NUCLEAR REACTORS

DOEpatents

Untermyer, S.

1958-10-14

A method is presented for obtaining enhanced utilization of natural uranium in heavy water moderated nuclear reactors by charging the reactor with an equal number of fuel elements formed of natural uranium and of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction. The reactor is operated until the rate of burnup of plutonium equals its rate of production, the fuel elements are processed to recover plutonium, the depleted uranium is discarded, and the remaining uranium is formed into fuel elements. These fuel elements are charged into a reactor along with an equal number of fuel elements formed of uranium depleted in U/sup 235/ to the extent that the combination will just support a chain reaction, and reuse of the uranium is continued as aforesaid until it wlll no longer support a chain reaction when combined with an equal quantity of natural uranium.

Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

PubMed

Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

1997-09-01

In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

Analysis of self-oscillating behaviors aimed at the development of a molecular robot with organic acids as fuel

NASA Astrophysics Data System (ADS)

Nakazumi, Tomoka; Hara, Yusuke

2017-09-01

We studied the transmittance self-oscillation of a polymer chain driven by an organic acid as the fuel. The self-oscillating polymer chain consists of 4-acryloylmorpholine (ACMO) and the Ru catalyst (Ru(bpy)3) of the Belousov-Zhabotinsky (BZ) reaction. The transmittance self-oscillating behavior was affected significantly by the temperature. As the amplitude of the transmittance self-oscillation, which is reflected by the aggregation state, decreased with time, the oscillation period also decreased. This trend indicates that the polymer aggregation affects the rate of the BZ reaction significantly. The activation energy of the self-oscillating value was almost the same in the normal BZ reaction, which does not include Ru(bpy)3 complexes in the polymer chains. In addition, we demonstrated the effect of one BZ substrate (sodium bromate or malonic acid) on the transmittance self-oscillation period.

Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

PubMed

Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

2001-03-01

A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

Initiator and Photocatalyst-Free Visible Light Induced One-Pot Reaction: Concurrent RAFT Polymerization and CuAAC Click Reaction.

PubMed

Wang, Jie; Wang, Xinbo; Xue, Wentao; Chen, Gaojian; Zhang, Weidong; Zhu, Xiulin

2016-05-01

A new, visible light-catalyzed, one-pot and one-step reaction is successfully employed to design well-controlled side-chain functionalized polymers, by the combination of ambient temperature revisible addtion-fragmentation chain transfer (RAFT) polymerization and click chemistry. Polymerizations are well controlled in a living way under the irradiation of visible light-emitting diode (LED) light without photocatalyst and initiator, using the trithiocarbonate agent as iniferter (initiator-transfer agent-terminator) agent at ambient temperature. Fourier transfer infrared spectroscopy (FT-IR), NMR, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) data confirm the successful one-pot reaction. Compared to the reported zero-valent metal-catalyzed one-pot reaction, the polymerization rate is much faster than that of the click reaction, and the visible light-catalyzed one-pot reaction can be freely and easily regulated by turning on and off the light. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Assessing Cognitive Performance in Badminton Players: A Reproducibility and Validity Study

PubMed Central

van de Water, Tanja; Faber, Irene; Elferink-Gemser, Marije

2017-01-01

Abstract Fast reaction and good inhibitory control are associated with elite sports performance. To evaluate the reproducibility and validity of a newly developed Badminton Reaction Inhibition Test (BRIT), fifteen elite (25 ± 4 years) and nine non-elite (24 ± 4 years) Dutch male badminton players participated in the study. The BRIT measured four components: domain-general reaction time, badminton-specific reaction time, domain-general inhibitory control and badminton-specific inhibitory control. Five participants were retested within three weeks on the badminton-specific components. Reproducibility was acceptable for badminton-specific reaction time (ICC = 0.626, CV = 6%) and for badminton-specific inhibitory control (ICC = 0.317, CV = 13%). Good construct validity was shown for badminton-specific reaction time discriminating between elite and non-elite players (F = 6.650, p < 0.05). Elite players did not outscore non-elite players on domain-general reaction time nor on both components of inhibitory control (p > 0.05). Concurrent validity for domain-general reaction time was good, as it was associated with a national ranking for elite (p = 0.70, p < 0.01) and non-elite (p = 0.70, p < 0.05) players. No relationship was found between the national ranking and badminton-specific reaction time, nor both components of inhibitory control (p > 0.05). In conclusion, reproducibility and validity of inhibitory control assessment was not confirmed, however, the BRIT appears a reproducible and valid measure of reaction time in badminton players. Reaction time measured with the BRIT may provide input for training programs aiming to improve badminton players’ performance. PMID:28210347

Assessing Cognitive Performance in Badminton Players: A Reproducibility and Validity Study.

PubMed

van de Water, Tanja; Huijgen, Barbara; Faber, Irene; Elferink-Gemser, Marije

2017-01-01

Fast reaction and good inhibitory control are associated with elite sports performance. To evaluate the reproducibility and validity of a newly developed Badminton Reaction Inhibition Test (BRIT), fifteen elite (25 ± 4 years) and nine non-elite (24 ± 4 years) Dutch male badminton players participated in the study. The BRIT measured four components: domain-general reaction time, badminton-specific reaction time, domain-general inhibitory control and badminton-specific inhibitory control. Five participants were retested within three weeks on the badminton-specific components. Reproducibility was acceptable for badminton-specific reaction time (ICC = 0.626, CV = 6%) and for badminton-specific inhibitory control (ICC = 0.317, CV = 13%). Good construct validity was shown for badminton-specific reaction time discriminating between elite and non-elite players (F = 6.650, p < 0.05). Elite players did not outscore non-elite players on domain-general reaction time nor on both components of inhibitory control (p > 0.05). Concurrent validity for domain-general reaction time was good, as it was associated with a national ranking for elite (p = 0.70, p < 0.01) and non-elite (p = 0.70, p < 0.05) players. No relationship was found between the national ranking and badminton-specific reaction time, nor both components of inhibitory control (p > 0.05). In conclusion, reproducibility and validity of inhibitory control assessment was not confirmed, however, the BRIT appears a reproducible and valid measure of reaction time in badminton players. Reaction time measured with the BRIT may provide input for training programs aiming to improve badminton players' performance.

T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

PubMed

Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

2012-01-01

Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

Chain photoreduction of CCl3F in TiO2 suspensions: enhancement induced by O2.

PubMed

Winkelmann, Kurt; Calhoun, Robert L; Mills, German

2006-12-28

Trichlorofluoromethane (CFC 11) was photoreduced in aqueous suspensions of TiO2 particles containing HCO2- ions and air. Dissolved O2 inhibited the reaction during an induction period that preceded the rapid formation of chloride ions. Reaction rates were higher in systems containing O2 as compared to analogous reactions that occurred in anaerobic suspensions. High photonic efficiencies of Cl- formation (> or =15) were achieved using suspensions with pH > or = 5. As was the case for studies with air-free suspensions, reactions are best described using a photoinitiated chain mechanism that produced CHCl2F and Cl- during the propagation steps. The enhanced yields obtained in the presence of air are attributed to the removal by O2 of electrons trapped in the oxide, which are converted first into H2O2 and then into reducing radicals that participate in the chain process. Enhanced yields of Freon photoreduction were also observed during illumination of air-free suspensions containing hydrogen peroxide, which were interpreted using a similar mechanism.

Tested Demonstrations.

ERIC Educational Resources Information Center

Gilbert, George L., Ed.

1983-01-01

Free radical chlorination of methane is used in organic chemistry to introduce free radical/chain reactions. In spite of its common occurrence, demonstrations of the reaction are uncommon. Therefore, such a demonstration is provided, including background information, preparation of reactants/reaction vessel, introduction of reactants, irradiation,…

Efficient sampling of reversible cross-linking polymers: Self-assembly of single-chain polymeric nanoparticles

NASA Astrophysics Data System (ADS)

Oyarzún, Bernardo; Mognetti, Bortolo Matteo

2018-03-01

We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.

Recombinase Polymerase Amplification Assay-A Simple, Fast and Cost-Effective Alternative to Real Time PCR for Specific Detection of Feline Herpesvirus-1.

PubMed

Wang, Jianchang; Liu, Libing; Wang, Jinfeng; Sun, Xiaoxia; Yuan, Wanzhe

2017-01-01

Feline herpesvirus 1 (FHV-1), an enveloped dsDNA virus, is one of the major pathogens of feline upper respiratory tract disease (URTD) and ocular disease. Currently, polymerase chain reaction (PCR) remains the gold standard diagnostic tool for FHV-1 infection but is relatively expensive, requires well-equipped laboratories and is not suitable for field tests. Recombinase polymerase amplification (RPA), an isothermal gene amplification technology, has been explored for the molecular diagnosis of infectious diseases. In this study, an exo-RPA assay for FHV-1 detection was developed and validated. Primers targeting specifically the thymidine kinase (TK) gene of FHV-1 were designed. The RPA reaction was performed successfully at 39°C and the results were obtained within 20 min. Using different copy numbers of recombinant plasmid DNA that contains the TK gene as template, we showed the detection limit of exo-RPA was 102 copies DNA/reaction, the same as that of real time PCR. The exo-RPA assay did not cross-detect feline panleukopenia virus, feline calicivirus, bovine herpesvirus-1, pseudorabies virus or chlamydia psittaci, a panel of pathogens important in feline URTD or other viruses in Alphaherpesvirinae, demonstrating high specificity. The assay was validated by testing 120 nasal and ocular conjunctival swabs of cats, and the results were compared with those obtained with real-time PCR. Both assays provided the same testing results in the clinical samples. Compared with real time PCR, the exo-RPA assay uses less-complex equipment that is portable and the reaction is completed much faster. Additionally, commercial RPA reagents in vacuum-sealed pouches can tolerate temperatures up to room temperature for days without loss of activity, suitable for shipment and storage for field tests. Taken together, the exo-RPA assay is a simple, fast and cost-effective alternative to real time PCR, suitable for use in less advanced laboratories and for field detection of FHV-1 infection.

Recombinase Polymerase Amplification Assay—A Simple, Fast and Cost-Effective Alternative to Real Time PCR for Specific Detection of Feline Herpesvirus-1

PubMed Central

Wang, Jianchang; Liu, Libing; Wang, Jinfeng; Sun, Xiaoxia; Yuan, Wanzhe

2017-01-01

Feline herpesvirus 1 (FHV-1), an enveloped dsDNA virus, is one of the major pathogens of feline upper respiratory tract disease (URTD) and ocular disease. Currently, polymerase chain reaction (PCR) remains the gold standard diagnostic tool for FHV-1 infection but is relatively expensive, requires well-equipped laboratories and is not suitable for field tests. Recombinase polymerase amplification (RPA), an isothermal gene amplification technology, has been explored for the molecular diagnosis of infectious diseases. In this study, an exo-RPA assay for FHV-1 detection was developed and validated. Primers targeting specifically the thymidine kinase (TK) gene of FHV-1 were designed. The RPA reaction was performed successfully at 39°C and the results were obtained within 20 min. Using different copy numbers of recombinant plasmid DNA that contains the TK gene as template, we showed the detection limit of exo-RPA was 102 copies DNA/reaction, the same as that of real time PCR. The exo-RPA assay did not cross-detect feline panleukopenia virus, feline calicivirus, bovine herpesvirus-1, pseudorabies virus or chlamydia psittaci, a panel of pathogens important in feline URTD or other viruses in Alphaherpesvirinae, demonstrating high specificity. The assay was validated by testing 120 nasal and ocular conjunctival swabs of cats, and the results were compared with those obtained with real-time PCR. Both assays provided the same testing results in the clinical samples. Compared with real time PCR, the exo-RPA assay uses less-complex equipment that is portable and the reaction is completed much faster. Additionally, commercial RPA reagents in vacuum-sealed pouches can tolerate temperatures up to room temperature for days without loss of activity, suitable for shipment and storage for field tests. Taken together, the exo-RPA assay is a simple, fast and cost-effective alternative to real time PCR, suitable for use in less advanced laboratories and for field detection of FHV-1 infection. PMID:28045956

Biomass Scenario Model: BETO Analysis Platform Peer Review; NREL (National Renewable Energy Laboratory)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bush, B.

2015-03-23

The Biomass Scenario Model (BSM) is a unique, carefully validated, state-of-the-art fourth-generation model of the domestic bioenergy supply chain which explicitly focuses on policy issues and their potential side effects. It integrates resource availability, behavior, policy, and physical, technological, and economic constraints. The BSM uses system-dynamics simulation to model dynamic interactions across the supply chain; it tracks the deployment of biofuels given technological development and the reaction of the investment community to those technologies in the context of land availability, the competing oil market, consumer demand for biofuels, and government policies over time. It places a strong emphasis on themore » behavior and decision-making of various economic agents. The model treats the major infrastructure-compatible fuels. Scenario analysis based on the BSM shows that the biofuels industry tends not to rapidly thrive without significant external actions in the early years of its evolution. An initial focus for jumpstarting the industry typically has strongest results in the BSM in areas where effects of intervention have been identified to be multiplicative. In general, we find that policies which are coordinated across the whole supply chain have significant impact in fostering the growth of the biofuels industry and that the production of tens of billions of gallons of biofuels may occur under sufficiently favorable conditions.« less

Detection of a novel human coronavirus by real-time reverse-transcription polymerase chain reaction.

PubMed

Corman, V M; Eckerle, I; Bleicker, T; Zaki, A; Landt, O; Eschbach-Bludau, M; van Boheemen, S; Gopal, R; Ballhause, M; Bestebroer, T M; Muth, D; Müller, M A; Drexler, J F; Zambon, M; Osterhaus, A D; Fouchier, R M; Drosten, C

2012-09-27

We present two real-time reverse-transcription polymerase chain reaction assays for a novel human coronavirus (CoV), targeting regions upstream of the E gene (upE) or within open reading frame (ORF)1b, respectively. Sensitivity for upE is 3.4 copies per reaction (95% confidence interval (CI): 2.5–6.9 copies) or 291 copies/mL of sample. No cross-reactivity was observed with coronaviruses OC43, NL63, 229E, SARS-CoV, nor with 92 clinical specimens containing common human respiratory viruses. We recommend using upE for screening and ORF1b for confirmation.

Large enhancement in the heterogeneous oxidation rate of organic aerosols by hydroxyl radicals in the presence of nitric oxide

DOE PAGES

Richards-Henderson, Nicole K.; Goldstein, Allen H.; Wilson, Kevin R.

2015-10-27

In this paper we report an unexpectedly large acceleration in the effective heterogeneous OH reaction rate in the presence of NO. This 10–50 fold acceleration originates from free radical chain reactions, propagated by alkoxy radicals that form inside the aerosol by the reaction of NO with peroxy radicals, which do not appear to produce chain terminating products (e.g., alkyl nitrates), unlike gas phase mechanisms. Lastly, a kinetic model, constrained by experiments, suggests that in polluted regions heterogeneous oxidation plays a much more prominent role in the daily chemical evolution of organic aerosol than previously believed.

On the implementation of a chain nuclear reaction of thermonuclear fusion on the basis of the p+{sup 11}B process

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belyaev, V. S.; Krainov, V. P., E-mail: vpkrainov@mail.ru; Zagreev, B. V.

2015-07-15

Various theoretical and experimental schemes for implementing a thermonuclear reactor on the basis of the p+{sup 11}B reaction are considered. They include beam collisions, fusion in degenerate plasmas, ignition upon plasma acceleration by ponderomotive forces, and the irradiation of a solid-state target from {sup 11}B with a proton beam under conditions of a Coulomb explosion of hydrogen microdrops. The possibility of employing ultra-short high-intensity laser pulses to initiate the p+{sup 11}B reaction under conditions far from thermodynamic equilibrium is discussed. This and some other weakly radioactive thermonuclear reactions are promising owing to their ecological cleanness—there are virtually no neutrons amongmore » fusion products. Nuclear reactions that follow the p+{sup 11}B reaction may generate high-energy protons, sustaining a chain reaction, and this is an advantage of the p+{sup 11}B option. The approach used also makes it possible to study nuclear reactions under conditions close to those in the early Universe or in the interior of stars.« less

Synthesis of side-chain oxysterols and their enantiomers through cross-metathesis reactions of Δ22 steroids.

PubMed

Brownholland, David P; Covey, Douglas F

2017-05-01

A synthetic route that utilizes a cross-metathesis reaction with Δ 22 steroids has been developed to prepare sterols with varying C-27 side-chains. Natural sterols containing hydroxyl groups at the 25 and (25R)-26 positions were prepared. Enantiomers of cholesterol and (3β,25R)-26-hydroxycholesterol (27-hydroxycholesterol) trideuterated at C-19 were prepared for future biological studies. Copyright © 2017 Elsevier Inc. All rights reserved.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

PubMed

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

2014-04-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

PubMed Central

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

2014-01-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

Lymphogranuloma venereum variant L2b-specific polymerase chain reaction: insertion used to close an epidemiological gap.

PubMed

Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D

2011-11-01

The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

Ring test evaluation of the detection of influenza A virus in swine oral fluids by real-time, reverse transcription polymerase chain reaction (rRT-PCR) and virus isolation

USDA-ARS?s Scientific Manuscript database

The probability of detecting influenza A virus (IAV) in oral fluid (OF) specimens was calculated for each of 13 real-time, reverse transcription polymerase chain reaction (rRT-PCR) and 7 virus isolation (VI) assays. To conduct the study, OF was inoculated with H1N1 or H3N2 IAV and serially 10-fold d...

Spark Plasma Sintering for Nanostructured Smart Materials

DTIC Science & Technology

2009-03-02

polyester) with excess isocyanate to form a prepolymer , followed by the addition of a short chain diol that acts as a chain extender to link the... prepolymers together. Due to the thermodynamic imicisibility of segments of PU, phase separation into a flexible soft segment (long chain diol) and a...other reactions of the isocyanate groups with the other functional groups in the chain. [Hepburn, 1992] However, during the initial prepolymer

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

PubMed

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Density functional computational studies on the glucose and glycine Maillard reaction: Formation of the Amadori rearrangement products

NASA Astrophysics Data System (ADS)

Jalbout, Abraham F.; Roy, Amlan K.; Shipar, Abul Haider; Ahmed, M. Samsuddin

Theoretical energy changes of various intermediates leading to the formation of the Amadori rearrangement products (ARPs) under different mechanistic assumptions have been calculated, by using open chain glucose (O-Glu)/closed chain glucose (A-Glu and B-Glu) and glycine (Gly) as a model for the Maillard reaction. Density functional theory (DFT) computations have been applied on the proposed mechanisms under different pH conditions. Thus, the possibility of the formation of different compounds and electronic energy changes for different steps in the proposed mechanisms has been evaluated. B-Glu has been found to be more efficient than A-Glu, and A-Glu has been found more efficient than O-Glu in the reaction. The reaction under basic condition is the most favorable for the formation of ARPs. Other reaction pathways have been computed and discussed in this work.0

An effective established biosensor of bifunctional probes-labeled AuNPs combined with LAMP for detection of fish pathogen Streptococcus iniae.

PubMed

Zhou, Ya; Xiao, Jingfan; Ma, Xin; Wang, Qiyao; Zhang, Yuanxing

2018-06-01

In purpose of valid Streptococcus iniae detection, we established a colorimetric biosensor using gold nanoparticles (AuNPs) labeled with dual functional probes and along with loop-mediated isothermal amplification (LAMP) assay (LAMP-AuNPs). Based on the characteristics of self-aggregation and bio-conjugation with ligands, AuNPs were chosen for observable color change in tandem with LAMP amplification method to reach high sensitivity and easy operation. Meanwhile, the improvement of dual probes that could fully utilize the LAMP product gave the biosensor a stable result exhibition. LAMP-AuNPs targeting gene ftsB, one of the ATP transporter-related genes, turned out favorable specificity in cross reaction among other fish pathogens. The detect limit of 10 2 CFU revealed a better sensitivity compared with polymerase chain reaction (PCR) method and AuNPs lateral flow test strip (LFTS). It was also proved to be effective by zebrafish infection model trials with less than 2-h time consumption and nearly no devices which make it a convenient biosensor for point-to-care S. iniae detection.

Methanol Cannon Demonstrations Revisited.

ERIC Educational Resources Information Center

Dolson, David A.; And Others

1995-01-01

Describes two variations on the traditional methanol cannon demonstration. The first variation is a chain reaction using real metal chains. The second example involves using easily available components to produce sequential explosions that can be musical in nature. (AIM)

Bioinformatics approach for choosing the correct reference genes when studying gene expression in human keratinocytes.

PubMed

Beer, Lucian; Mlitz, Veronika; Gschwandtner, Maria; Berger, Tanja; Narzt, Marie-Sophie; Gruber, Florian; Brunner, Patrick M; Tschachler, Erwin; Mildner, Michael

2015-10-01

Reverse transcription polymerase chain reaction (qRT-PCR) has become a mainstay in many areas of skin research. To enable quantitative analysis, it is necessary to analyse expression of reference genes (RGs) for normalization of target gene expression. The selection of reliable RGs therefore has an important impact on the experimental outcome. In this study, we aimed to identify and validate the best suited RGs for qRT-PCR in human primary keratinocytes (KCs) over a broad range of experimental conditions using the novel bioinformatics tool 'RefGenes', which is based on a manually curated database of published microarray data. Expression of 6 RGs identified by RefGenes software and 12 commonly used RGs were validated by qRT-PCR. We assessed whether these 18 markers fulfilled the requirements for a valid RG by the comprehensive ranking of four bioinformatics tools and the coefficient of variation (CV). In an overall ranking, we found GUSB to be the most stably expressed RG, whereas the expression values of the commonly used RGs, GAPDH and B2M were significantly affected by varying experimental conditions. Our results identify RefGenes as a powerful tool for the identification of valid RGs and suggest GUSB as the most reliable RG for KCs. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Quasi-free Proton Knockout Reactions on the Oxygen Isotopic Chain

NASA Astrophysics Data System (ADS)

Atar, Leyla; Aumann, Thomas; Bertulani, Carlos; Paschalis, Stefanos; R3B Collaboration

2017-09-01

It is well known from electron-induced knockout data that the single-particle (SP) strength is reduced to about 60-70% for stable nuclei in comparison to the independent particle model due to the presence of short- and long-range correlations. This finding has been confirmed by nuclear knockout reactions using stable and exotic beams, however, with a strong dependency on the proton-neutron asymmetry. The observed strong reduction of SP cross sections for the deeply bound valence nucleons in asymmetric nuclei is theoretically not understood. To understand this dependency quantitatively a complementary approach, quasi-free (QF) knockout reactions in inverse kinematics, is introduced. We have performed a systematic study of spectroscopic strength of oxygen isotopes using QF (p,2p) knockout reactions in complete kinematics at the R3B/LAND setup at GSI with secondary beams containing 13-24O. The oxygen isotopic chain covers a large variation of separ ation energies, which allow a systematic study of SF with respect to isospin asymmetry. We will present results on the (p,2p) cross sections for the entire oxygen isotopic chain obtained from a single experiment. By comparison with the Eikonal reaction theory the SF and reduction factors will be presented. The work is supported by GSI-TU Darmstadt cooperation and BMBF project 05P15RDFN1.

A chain reaction approach to modelling gene pathways.

PubMed

Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

2012-08-01

BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By applying it to microarray data, the chain reaction model computed a set of reaction rates to examine the effects of three polyphenols (EGCG, genistein, and resveratrol) on gene expression in this pathway during puberty. We first performed statistical analysis to test the time factor on the estrogen synthesis pathway. Global tests were used to evaluate an overall gene expression change during puberty for each experimental group. Then, a chain reaction model was employed to simulate the estrogen synthesis pathway. Specifically, the model computed the reaction rates in a set of ordinary differential equations to describe interactions between genes in the pathway (A reaction rate K of A to B represents gene A will induce gene B per unit at a rate of K; we give details in the "method" section). Since disparate changes of gene expression may cause numerical error problems in solving these differential equations, we used an implicit scheme to address this issue. We first applied the chain reaction model to obtain the reaction rates for the control group. A sensitivity study was conducted to evaluate how well the model fits to the control group data at Day 50. Results showed a small bias and mean square error. These observations indicated the model is robust to low random noises and has a good fit for the control group. Then the chain reaction model derived from the control group data was used to predict gene expression at Day 50 for the three polyphenol groups. If these nutrients affect the estrogen synthesis pathways during puberty, we expect discrepancy between observed and expected expressions. Results indicated some genes had large differences in the EGCG (e.g., Hsd3b and Sts) and the resveratrol (e.g., Hsd3b and Hrmt12) groups. CONCLUSIONS: In the present study, we have presented (I) experimental studies of the effect of nutrient diets on the gene expression changes in a selected estrogen synthesis pathway. This experiment is valuable because it allows us to examine how the nutrient-containing diets regulate gene expression in the estrogen synthesis pathway during puberty; (II) global tests to assess an overall association of this particular pathway with time factor by utilizing generalized linear models to analyze microarray data; and (III) a chain reaction model to simulate the pathway. This is a novel application because we are able to translate the gene pathway into the chemical reactions in which each reaction channel describes gene-gene relationship in the pathway. In the chain reaction model, the implicit scheme is employed to efficiently solve the differential equations. Data analysis results show the proposed model is capable of predicting gene expression changes and demonstrating the effect of nutrient-containing diets on gene expression changes in the pathway. One of the objectives of this study is to explore and develop a numerical approach for simulating the gene expression change so that it can be applied and calibrated when the data of more time slices are available, and thus can be used to interpolate the expression change at a desired time point without conducting expensive experiments for a large amount of time points. Hence, we are not claiming this is either essential or the most efficient way for simulating this problem, rather a mathematical/numerical approach that can model the expression change of a large set of genes of a complex pathway. In addition, we understand the limitation of this experiment and realize that it is still far from being a complete model of predicting nutrient-gene interactions. The reason is that in the present model, the reaction rates were estimated based on available data at two time points; hence, the gene expression change is dependent upon the reaction rates and a linear function of the gene expressions. More data sets containing gene expression at various time slices are needed in order to improve the present model so that a non-linear variation of gene expression changes at different time can be predicted.

Heaviest Nuclei: New Element with Atomic Number 117

ScienceCinema

Oganessian, Yuri

2018-01-24

One of the fundamental outcomes of the nuclear shell model is the prediction of the 'stability islands' in the domain of the hypothetical super heavy elements. The talk is devoted to the experimental verification of these predictions - the synthesis and study of both the decay and chemical properties of the super heavy elements. The discovery of a new chemical element with atomic number Z=117 is reported. The isotopes 293117 and 294117 were produced in fusion reactions between 48Ca and 249Bk. Decay chains involving 11 new nuclei were identified by means of the Dubna gas-filled recoil separator. The measured decay properties show a strong rise of stability for heavier isotopes with Z =111, validating the concept of the long sought island of enhanced stability for heaviest nuclei.

Droplet-Based Segregation and Extraction of Concentrated Samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buie, C R; Buckley, P; Hamilton, J

2007-02-23

Microfluidic analysis often requires sample concentration and separation techniques to isolate and detect analytes of interest. Complex or scarce samples may also require an orthogonal separation and detection method or off-chip analysis to confirm results. To perform these additional steps, the concentrated sample plug must be extracted from the primary microfluidic channel with minimal sample loss and dilution. We investigated two extraction techniques; injection of immiscible fluid droplets into the sample stream (''capping'''') and injection of the sample into an immiscible fluid stream (''extraction''). From our results we conclude that capping is the more effective partitioning technique. Furthermore, this functionalitymore » enables additional off-chip post-processing procedures such as DNA/RNA microarray analysis, realtime polymerase chain reaction (RT-PCR), and culture growth to validate chip performance.« less

Strategic Mobility 21: Smart and Secure E Corridor Stakeholder Evaluation - Savannah

DTIC Science & Technology

2009-12-07

validated to meet Customs-Trade Partnership Against Terrorism ( CTPAT ) level 3 Customs standards and combined with multiple overlain foreign trade zones... CTPAT level 3 benefits of technology validated supply chains insulating shippers against random inspections as the core elements of smart secure...their carrier partners, Customs-Trade Partnership Against Terrorism ( CTPAT ) level 3 technologically verified supply chain security for all shippers

Unraveling reaction pathways and specifying reaction kinetics for complex systems.

PubMed

Vinu, R; Broadbelt, Linda J

2012-01-01

Many natural and industrial processes involve a complex set of competing reactions that include several different species. Detailed kinetic modeling of such systems can shed light on the important pathways involved in various transformations and therefore can be used to optimize the process conditions for the desired product composition and properties. This review focuses on elucidating the various components involved in modeling the kinetics of pyrolysis and oxidation of polymers. The elementary free radical steps that constitute the chain reaction mechanism of gas-phase/nonpolar liquid-phase processes are outlined. Specification of the rate coefficients of the various reaction families, which is central to the theme of kinetics, is described. Construction of the reaction network on the basis of the types of end groups and reactive moieties in a polymer chain is discussed. Modeling frameworks based on the method of moments and kinetic Monte Carlo are evaluated using illustrations. Finally, the prospects and challenges in modeling biomass conversion are addressed.

Diy Geospatial Web Service Chains: Geochaining Make it Easy

NASA Astrophysics Data System (ADS)

Wu, H.; You, L.; Gui, Z.

2011-08-01

It is a great challenge for beginners to create, deploy and utilize a Geospatial Web Service Chain (GWSC). People in Computer Science are usually not familiar with geospatial domain knowledge. Geospatial practitioners may lack the knowledge about web services and service chains. The end users may lack both. However, integrated visual editing interfaces, validation tools, and oneclick deployment wizards may help to lower the learning curve and improve modelling skills so beginners will have a better experience. GeoChaining is a GWSC modelling tool designed and developed based on these ideas. GeoChaining integrates visual editing, validation, deployment, execution etc. into a unified platform. By employing a Virtual Globe, users can intuitively visualize raw data and results produced by GeoChaining. All of these features allow users to easily start using GWSC, regardless of their professional background and computer skills. Further, GeoChaining supports GWSC model reuse, meaning that an entire GWSC model created or even a specific part can be directly reused in a new model. This greatly improves the efficiency of creating a new GWSC, and also contributes to the sharing and interoperability of GWSC.

The use of heteroduplex analysis of polymerase chain reaction products to support the possible transmission of Legionella pneumophila from a malfunctioning automobile air conditioner.

PubMed

Pinar, Ahmet; Ramirez, Julio A; Schindler, Laura L; Miller, Richard D; Summersgill, James T

2002-03-01

Air conditioner condensates have not been previously associated with cases of Legionnaires' disease. We report the possible transmission of Legionella pneumophila serogroup 1 from a malfunctioning automobile air conditioning system's leaking water onto the floorboard of a car driven for a long distance by the patient. Heteroduplex analysis of polymerase chain reaction products was used to help establish an epidemiologic link between the water specimen and the patient.

Identification of co-infection by rotavirus and parvovirus in dogs with gastroenteritis in Mexico.

PubMed

Ortega, Ariadna Flores; Martínez-Castañeda, José Simón; Bautista-Gómez, Linda G; Muñoz, Raúl Fajardo; Hernández, Israel Quijano

This is the first report on circulating canine rotavirus in Mexico. Fifty samples from dogs with gastroenteritis were analyzed used polymerase chain reaction and reverse transcription polymerase chain reaction in order to identify parvovirus and rotavirus, respectively; 7% of dogs were infected with rotavirus exclusively, while 14% were co-infected with both rotavirus and parvovirus; clinical signs in co-infected dogs were more severe. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Detection of Trypanosoma cruzi by Polymerase Chain Reaction.

PubMed

Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz

2016-01-01

American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.

Phenylalanine 445 within oxidosqualene-lanosterol cyclase from Saccharomyces cerevisiae influences C-Ring cyclization and deprotonation reactions.

PubMed

Wu, Tung-Kung; Liu, Yuan-Ting; Chiu, Feng-Hsuan; Chang, Cheng-Hsiang

2006-10-12

[reaction: see text] We describe the Saccharomyces cerevisiae oxidosqualene-lanosterol cyclase Phe445 site-saturated mutants that generate truncated tricyclic and altered deprotonation product profiles. Among these mutants, only polar side-chain group substitutions genetically complemented yeast viability and produced spatially related product diversity, supporting the Johnson model that cation-pi interactions between a carbocationic intermediate and an enzyme can be replaced by an electrostatic or polar side chain to stabilize the cationic intermediate, but with product differentiation.

Real-time polymerase chain reaction for detection of encapsulated Haemophilus influenzae using degenerate primers to target the capsule transport gene bexA.

PubMed

Law, Dennis K S; Tsang, Raymond S W

2013-05-01

A real-time polymerase chain reaction assay that uses degenerate primers and a dual-labelled probe was developed to detect the bexA gene of Haemophilus influenzae, including those belonging to non-b serotypes as well as clonal division II strains. This assay is sensitive and specific, detecting 20 copies of the gene, but negative with a variety of bacteria associated with meningitis and bacteremia or septicemia.

A computational study of pyrolysis reactions of lignin model compounds

Treesearch

Thomas Elder

2010-01-01

Enthalpies of reaction for the initial steps in the pyrolysis of lignin have been evaluated at the CBS-4m level of theory using fully substituted b-O-4 dilignols. Values for competing unimolecular decomposition reactions are consistent with results previously published for phenethyl phenyl ether models, but with lowered selectivity. Chain propagating reactions of free...

Modeling the SOA Forming Potential of Substituted Dihydrofurans from Alkane + OH Reactions in the Atmosphere

NASA Astrophysics Data System (ADS)

Jordan, C. E.; Griffin, R. J.; Lim, Y. B.; Ziemann, P. J.; Atkinson, R.; Arey, J.

2005-12-01

Recent laboratory studies show that δ-hydroxycarbonyls formed in the atmosphere via OH-initiated reactions with alkanes can cyclize then dehydrate to form substituted dihydrofurans. These dihydrofurans are highly reactive, with lifetimes in the atmosphere of 1.3 h (OH), 24 s (NO3), and 7 min (O3). The ability of the δ-hydroxycarbonyls to cyclize and dehydrate has been shown to increase with increasing carbon number. Recent laboratory results show that the secondary organic aerosol (SOA) yields from alkanes also increase with carbon number reaching ~53% for C15. The reaction mechanism proposed based on the chamber results is the basis of the modeling study presented here. We have incorporated this proposed mechanism into the Caltech Atmospheric Chemistry Mechanism (CACM). For computational reasons, similar compounds are lumped together and represented by a single suitable compound. In the present case, alkanes are lumped into 3 groups: short chains (≤C6), medium chains (C7 - C12), and long chains (≥C13). SOA yields obtained in chamber studies increase dramatically from 0.5% for C8 to 25% for C12. The most dramatic increase is observed from C11 (8%) to C13 (~50%). This is attributed to the low volatility of first generation products contributing to the SOA from longer chain alkanes. Here we have studied OH reactions with the substituted dihydrofurans for medium (represented by C10) and long (represented by C16) chain alkanes using CACM along with the aerosol partitioning module MPMPO (Model to Predict the Multi-phase Partitioning of Organics). We will present the results of this modeling study, characterizing the influence of substituted dihydrofurans on the SOA forming potential of alkanes.

Analysis of differential gene expression by bead-based fiber-optic array in nonfunctioning pituitary adenomas.

PubMed

Jiang, Z; Gui, S; Zhang, Y

2011-05-01

Nonfunctioning pituitary adenomas (NFPAs) are relatively common, accounting for 30% of all pituitary adenomas; however, their pathogenesis remains enigmatic. To explore the possible pathogenesis of NFPAs, we used fiber-optic BeadArray to examine gene expression in 5 NFPAs compared with 3 normal pituitaries. 4 differentially expressed genes were chosen randomly for validation by reverse transcriptase-real time quantitative polymerase chain reaction (RT-qPCR). We then analyzed the differentially expressed gene profile with Kyoto Encyclopedia of Genes and Genomes (KEGG). The array analysis indentified significant increases in the expression of 1,402 genes and 383 expressed sequence tags (ESTs), and decreases in 1,697 genes and 113 ESTs in the NFPAs. Bioinformatic and pathway analysis showed that the genes HIGD1B, FAM5C, PMAIP1 and the pathway cell-cycle regulation may play an important role in tumorigenesis and progression of NFPAs. Our data suggest fiber-optic BeadArray combined with pathway analysis of differential gene expression profile appears to be a valid approach for investigating the pathogenesis of tumors. © Georg Thieme Verlag KG Stuttgart · New York.

Development and validation of a real-time PCR assay for the glassy-winged sharpshooter Homalodisca vitripennis (Hemiptera: Cicadellidae).

PubMed

Waite, D W; Li, D; D'Souza, M; Gunawardana, D

2017-06-01

The glassy-winged sharpshooter (Homalodisca vitripennis) is an invasive pest organism, which is found throughout Central America and has recently invaded a few countries in the Pacific Islands. As a carrier of the highly virulent plant pathogenic bacterium Xylella fastidiosa, it is of great economic significance to horticulture and is estimated to cost Californian vineyards over US$100 million per year in control and losses. New Zealand is currently free from this pest, but its recent spread through the Pacific has raised concerns of it establishing in New Zealand, potentially as a result of introduction through human travel. We report here a real-time polymerase chain reaction assay for the rapid identification of H. vitripennis. The assay was extensively validated in silico then optimized and tested against a range of Cicadellidae species, both internationally collected and local to New Zealand. This assay was able to correctly identify H. vitripennis samples, and distinguish between H. vitripennis and close relatives, such as the smoke-tree sharpshooter (Homalodisca liturata) and will be of great benefit to New Zealand biosecurity.

Validation of a screening tool for the rapid and reliable detection of CGG trinucleotide repeat expansions in FMR1.

PubMed

Basehore, Monica J; Marlowe, Natalia M; Jones, Julie R; Behlendorf, Deborah E; Laver, Thomas A; Friez, Michael J

2012-06-01

Most individuals with intellectual disability and/or autism are tested for Fragile X syndrome at some point in their lifetime. Greater than 99% of individuals with Fragile X have an expanded CGG trinucleotide repeat motif in the promoter region of the FMR1 gene, and diagnostic testing involves determining the size of the CGG repeat as well as methylation status when an expansion is present. Using a previously described triplet repeat-primed polymerase chain reaction, we have performed additional validation studies using two cohorts with previous diagnostic testing results available for comparison purposes. The first cohort (n=88) consisted of both males and females and had a high percentage of abnormal samples, while the second cohort (n=624) consisted of only females and was not enriched for expansion mutations. Data from each cohort were completely concordant with the results previously obtained during the course of diagnostic testing. This study further demonstrates the utility of using laboratory-developed triplet repeat-primed FMR1 testing in a clinical setting.

Fully integrated multiplexed lab-on-a-card assay for enteric pathogens

NASA Astrophysics Data System (ADS)

Weigl, B. H.; Gerdes, J.; Tarr, P.; Yager, P.; Dillman, L.; Peck, R.; Ramachandran, S.; Lemba, M.; Kokoris, M.; Nabavi, M.; Battrell, F.; Hoekstra, D.; Klein, E. J.; Denno, D. M.

2006-01-01

Under this NIH-funded project, we are developing a lab-on-a-card platform to identify enteric bacterial pathogens in patients presenting with acute diarrhea, with special reference to infections that might be encountered in developing countries. Component functions that are integrated on this platform include on-chip immunocapture of live or whole pathogens, multiplexed nucleic acid amplification and on-chip detection, sample processing to support direct use of clinical specimens, and dry reagent storage and handling. All microfluidic functions are contained on the lab card. This new diagnostic test will be able to rapidly identify and differentiate Shigella dysenteriae serotype 1, Shigella toxin-producing Escherichia coli, E. coli 0157, Campylobacter jejuni, and Salmonella and Shigella species. This presentation will report on progress to date on sample and bacteria processing methodologies, identification and validation of capture antibodies and strategy for organism immunocapture, identification and validation of specific polymerase chain reaction (PCR) primer sequences for over 200 clinical isolates of enteric pathogens, and implementation of on-chip nucleic acid extraction for a subset of those pathogens.

Multiplex PCR method for use in real-time PCR for identification of fish fillets from grouper (Epinephelus and Mycteroperca species) and common substitute species.

PubMed

Trotta, Michele; Schönhuth, Susana; Pepe, Tiziana; Cortesi, M Luisa; Puyet, Antonio; Bautista, José M

2005-03-23

Mitochondrial 16S rRNA sequences from morphological validated grouper (Epinephelus aeneus, E. caninus, E. costae, and E. marginatus; Mycteroperca fusca and M. rubra), Nile perch (Lates niloticus), and wreck fish (Polyprion americanus) were used to develop an analytical system for group diagnosis based on two alternative Polymerase Chain Reaction (PCR) approaches. The first includes conventional multiplex PCR in which electrophoretic migration of different sizes of bands allowed identification of the fish species. The second approach, involving real-time PCR, produced a single amplicon from each species that showed different Tm values allowing the fish groups to be directly identified. Real-time PCR allows the quick differential diagnosis of the three groups of species and high-throughput screening of multiple samples. Neither PCR system cross-reacted with DNA samples from 41 common marketed fish species, thus conforming to standards for species validation. The use of these two PCR-based methods makes it now possible to discriminate grouper from substitute fish species.

Implementation of Amplicon Parallel Sequencing Leads to Improvement of Diagnosis and Therapy of Lung Cancer Patients.

PubMed

König, Katharina; Peifer, Martin; Fassunke, Jana; Ihle, Michaela A; Künstlinger, Helen; Heydt, Carina; Stamm, Katrin; Ueckeroth, Frank; Vollbrecht, Claudia; Bos, Marc; Gardizi, Masyar; Scheffler, Matthias; Nogova, Lucia; Leenders, Frauke; Albus, Kerstin; Meder, Lydia; Becker, Kerstin; Florin, Alexandra; Rommerscheidt-Fuss, Ursula; Altmüller, Janine; Kloth, Michael; Nürnberg, Peter; Henkel, Thomas; Bikár, Sven-Ernö; Sos, Martin L; Geese, William J; Strauss, Lewis; Ko, Yon-Dschun; Gerigk, Ulrich; Odenthal, Margarete; Zander, Thomas; Wolf, Jürgen; Merkelbach-Bruse, Sabine; Buettner, Reinhard; Heukamp, Lukas C

2015-07-01

The Network Genomic Medicine Lung Cancer was set up to rapidly translate scientific advances into early clinical trials of targeted therapies in lung cancer performing molecular analyses of more than 3500 patients annually. Because sequential analysis of the relevant driver mutations on fixated samples is challenging in terms of workload, tissue availability, and cost, we established multiplex parallel sequencing in routine diagnostics. The aim was to analyze all therapeutically relevant mutations in lung cancer samples in a high-throughput fashion while significantly reducing turnaround time and amount of input DNA compared with conventional dideoxy sequencing of single polymerase chain reaction amplicons. In this study, we demonstrate the feasibility of a 102 amplicon multiplex polymerase chain reaction followed by sequencing on an Illumina sequencer on formalin-fixed paraffin-embedded tissue in routine diagnostics. Analysis of a validation cohort of 180 samples showed this approach to require significantly less input material and to be more reliable, robust, and cost-effective than conventional dideoxy sequencing. Subsequently, 2657 lung cancer patients were analyzed. We observed that comprehensive biomarker testing provided novel information in addition to histological diagnosis and clinical staging. In 2657 consecutively analyzed lung cancer samples, we identified driver mutations at the expected prevalence. Furthermore we found potentially targetable DDR2 mutations at a frequency of 3% in both adenocarcinomas and squamous cell carcinomas. Overall, our data demonstrate the utility of systematic sequencing analysis in a clinical routine setting and highlight the dramatic impact of such an approach on the availability of therapeutic strategies for the targeted treatment of individual cancer patients.

Multiplex polymerase chain reaction-based prognostic models in diffuse large B-cell lymphoma patients treated with R-CHOP.

PubMed

Green, Tina M; Jensen, Andreas K; Holst, René; Falgreen, Steffen; Bøgsted, Martin; de Stricker, Karin; Plesner, Torben; Mourits-Andersen, Torben; Frederiksen, Mikael; Johnsen, Hans E; Pedersen, Lars M; Møller, Michael B

2016-09-01

We present a multiplex analysis for genes known to have prognostic value in an attempt to design a clinically useful classification model in patients with diffuse large B-cell lymphoma (DLBCL). Real-time polymerase chain reaction was used to measure transcript levels of 28 relevant genes in 194 de novo DLBCL patients treated with R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, prednisone). Including International Prognostic Index (IPI) as a variable in a penalized Cox regression, we investigated the association with disease progression for single genes or gene combinations in four models. The best model was validated in data from an online available R-CHOP treated cohort. With progression-free survival (PFS) as primary endpoint, the best performing IPI independent model incorporated the LMO2 and HLADQA1 as well as gene interactions for GCSAMxMIB1, GCSAMxCTGF and FOXP1xPDE4B. This model assigned 33% of patients (n = 60) to poor outcome with an estimated 3-year PFS of 40% vs. 87% for low risk (n = 61) and intermediate (n = 60) risk groups (P < 0·001). However, a simpler, IPI independent model incorporated LMO2 and BCL2 and assigned 33% of the patients with a 3-year PFS of 35% vs. 82% for low risk group (P < 0·001). We have documented the impact of a few single genes added to IPI for assignment in new drug trials. © 2016 John Wiley & Sons Ltd.

Gene expression analysis in hypoplastic lungs in the nitrofen model of congenital diaphragmatic hernia.

PubMed

Burgos, Carmen Mesas; Uggla, Andreas Ringman; Fagerström-Billai, Fredrik; Eklöf, Ann-Christine; Frenckner, Björn; Nord, Magnus

2010-07-01

Pulmonary hypoplasia and persistent pulmonary hypertension are the main causes of mortality and morbidity in newborns with congenital diaphragmatic hernia (CDH). Nitrofen is well known to induce CDH and lung hypoplasia in a rat model, but the mechanism remains unknown. To increase the understanding of the underlying pathogenesis of CDH, we performed a global gene expression analysis using microarray technology. Pregnant rats were given 100 mg nitrofen on gestational day 9.5 to create CDH. On day 21, fetuses after nitrofen administration and control fetuses were removed; and lungs were harvested. Global gene expression analysis was performed using Affymetrix Platform and the RAE 230 set arrays. For validation of microarray data, we performed real-time polymerase chain reaction and Western blot analysis. Significantly decreased genes after nitrofen administration included several growth factors and growth factors receptors involved in lung development, transcription factors, water and ion channels, and genes involved in angiogenesis and extracellular matrix. These results could be confirmed with real-time polymerase chain reaction and protein expression studies. The pathogenesis of lung hypoplasia and CDH in the nitrofen model includes alteration at a molecular level of several pathways involved in lung development. The complexity of the nitrofen mechanism of action reminds of human CDH; and the picture is consistent with lung hypoplasia and vascular disease, both important contributors to the high mortality and morbidity in CDH. Increased understanding of the molecular mechanisms that control lung growth may be the key to develop novel therapeutic techniques to stimulate pre- and postnatal lung growth. Copyright 2010 Elsevier Inc. All rights reserved.

STING-Dependent Interferon-λ1 Induction in HT29 Cells, a Human Colorectal Cancer Cell Line, After Gamma-Radiation.

PubMed

Chen, Jianzhou; Markelc, Bostjan; Kaeppler, Jakob; Ogundipe, Vivian M L; Cao, Yunhong; McKenna, W Gillies; Muschel, Ruth J

2018-05-01

To investigate the induction of type III interferons (IFNs) in human cancer cells by gamma-rays. Type III IFN expression in human cancer cell lines after gamma-ray irradiation in vitro was assessed by reverse transcription-quantitative polymerase chain reaction and enzyme-linked immunosorbent assay. Signaling pathways mediating type III IFN induction were examined by a variety of means, including immunoblotting, flow cytometry, confocal imaging, and reverse transcription-quantitative polymerase chain reaction. Key mediators in these pathways were further explored and validated using gene CRISPR knockout or short hairpin RNA knockdown. Exposure to gamma-rays directly induced type III IFNs (mainly IFNL1) in human cancer cell lines in dose- and time-dependent fashions. The induction of IFNL1 was primarily mediated by the cytosolic DNA sensors-STING-TBK1-IRF1 signaling axis, with a lesser contribution from the nuclear factor kappa b signaling in HT29 cells. In addition, type III IFN signaling through its receptors serves as a positive feedback loop, further enhancing IFN expression via up-regulation of the kinases in the STING-TBK1 signaling axis. Our results suggest that IFNL1 can be up-regulated in human cancer cell lines after gamma-ray treatment. In HT29 cells this induction occurs via the STING pathway, adding another layer of complexity to the understanding of radiation-induced antitumor immunity, and may provide novel insights into IFN-based cancer treatment. Copyright © 2018 Elsevier Inc. All rights reserved.

Expression of chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) in bladder transitional cell carcinoma.

PubMed

Ham, Won Sik; Lee, Joo Hyoung; Yu, Ho Song; Choi, Young Deuk

2008-10-01

An analysis of differentially expressed genes (DEGs) between bladder transitional cell carcinoma (TCC) and the surrounding urothelium to help identify what lies behind the mechanism of multifocal tumor development has not yet been performed. We sought to find a new DEG related to the development of bladder TCC. Thirty-nine bladder TCC tissues paired with normal-appearing urothelium tissues obtained from the same patient were used as subjects. Initially, we compared the messenger RNA (mRNA) profiles between normal-appearing urothelium and TCC tissue of 1 patient by using annealing control primer (ACP)-based GeneFishing polymerase chain reaction (PCR) and selective amplification of family members (SAFM) PCR to identify potential DEGs. To validate the results of the ACP data, reverse transcriptase-polymerase chain reaction (RT-PCR) was performed on those of all 39 patients. Among the several DEGs discovered in the ACP data, 1 DEG was chosen as the candidate for the RT-PCR, that is present or markedly upregulated in normal-appearing urothelial tissue compared with TCC tissue. Gene sequence searching revealed that this DEG is chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI). Downregulation of COUP-TFI mRNA expression in TCC tissue compared to normal-appearing urothelium tissue of the same patient, irrespective of tumor stage and grade, was confirmed by RT-PCR in 39 patients. Our results suggest that the loss of COUP-TFI may play a role in the transition from normal epithelium to TCC. Further characterization of the COUP-TFI gene is expected to give us informations about bladder TCC tumorigenesis.

In situ hybridization detection methods for HPV16 E6/E7 mRNA in identifying transcriptionally active HPV infection of oropharyngeal carcinoma: an updating.

PubMed

Volpi, Chiara C; Ciniselli, Chiara M; Gualeni, Ambra V; Plebani, Maddalena; Alfieri, Salvatore; Verderio, Paolo; Locati, Laura; Perrone, Federica; Quattrone, Pasquale; Carbone, Antonino; Pilotti, Silvana; Gloghini, Annunziata

2018-04-01

The aim of this study is to compare 2 in situ hybridization (ISH) detection methods for human papilloma virus (HPV) 16 E6/E7 mRNA, that is, the RNAscope 2.0 High Definition (HD) and the upgraded RNAscope 2.5 HD version. The RNAscope 2.5 HD has recently replaced the RNAscope 2.0 HD detection kit. Therefore, this investigation starts from the need to analytically validate the new mRNA ISH assay and, possibly, to refine the current algorithm for HPV detection in oropharyngeal squamous cell carcinoma with the final goal of applying it to daily laboratory practice. The study was based on HPV status and on generated data, interpreted by a scoring algorithm. The results highlighted that the compared RNAscope HPV tests had a good level of interchangeability and enabled to identify oropharyngeal squamous cell carcinoma that are truly driven by high-risk HPV infection. This was also supported by the comparison of the RNAscope HPV test with HPV E6/E7 mRNA real-time reverse-transcription polymerase chain reaction in a fraction of cases where material for HPV E6/E7 mRNA real-time reverse-transcription polymerase chain reaction was available. Furthermore, the algorithm that associates p16 immunohistochemistry with the identification of HPV mRNA by RNAscope was more effective than the one that associated p16 immunohistochemistry with the identification of HPV DNA by ISH. Copyright © 2017 Elsevier Inc. All rights reserved.

A multiplex real-time polymerase chain reaction assay with two internal controls for the detection of Brucella species in tissues, blood, and feces from marine mammals.

PubMed

Sidor, Inga F; Dunn, J Lawrence; Tsongalis, Gregory J; Carlson, Jolene; Frasca, Salvatore

2013-01-01

Brucellosis has emerged as a disease of concern in marine mammals in the last 2 decades. Molecular detection techniques have the potential to address limitations of other methods for detecting infection with Brucella in these species. Presented herein is a real-time polymerase chain reaction (PCR) method targeting the Brucella genus-specific bcsp31 gene. The method also includes a target to a conserved region of the eukaryotic mitochondrial 16S ribosomal RNA gene to assess suitability of extracted DNA and a plasmid-based internal control to detect failure of PCR due to inhibition. This method was optimized and validated to detect Brucella spp. in multiple sample matrices, including fresh or frozen tissue, blood, and feces. The analytical limit of detection was low, with 95% amplification at 24 fg, or an estimated 7 bacterial genomic copies. When Brucella spp. were experimentally added to tissue or fecal homogenates, the assay detected an estimated 1-5 bacteria/µl. An experiment simulating tissue autolysis showed relative persistence of bacterial DNA compared to host mitochondrial DNA. When used to screen 1,658 field-collected marine mammal tissues in comparison to microbial culture, diagnostic sensitivity and specificity were 70.4% and 98.3%, respectively. In addition to amplification in fresh and frozen tissues, Brucella spp. were detected in feces and formalin-fixed, paraffin-embedded tissues from culture-positive animals. Results indicate the utility of this real-time PCR for the detection of Brucella spp. in marine species, which may have applications in surveillance or epidemiologic investigations.

Interleukin-6 in cerebrospinal fluid as a biomarker of acute meningitis.

PubMed

García-Hernández, Pablo; Prieto, Belén; Martínez-Morillo, Eduardo; Rodríguez, Verónica; Álvarez, Francisco V

2016-01-01

Microbiological culture of cerebrospinal fluid is the gold standard to differentiate between aseptic and bacterial meningitis, but this method has low sensitivity. A fast and reliable new marker would be of interest in clinical practice. Interleukin-6, secreted by T cells in response to meningeal pathogens and quickly delivered into cerebrospinal fluid, was evaluated as a marker of acute meningitis. A total of 150 cerebrospinal fluid samples were analysed by an electrochemiluminescence method, selected according to patient diagnosis: (a) bacterial meningitis confirmed by positive culture (n = 26); (b) bacterial meningitis with negative culture or not performed (n = 15); (c) viral meningitis confirmed by polymerase chain reaction or immunoglobulin G determination (n = 23); (d) viral meningitis with polymerase chain reaction negative or not performed (n = 42); and (e) controls (n = 44). Cerebrospinal fluid interleukin-6 concentration showed significant differences between all pathologic groups and the control group (P < 0.001). As a diagnostic tool for bacterial meningitis, interleukin-6 showed an area under the curve of 0.937 (95% confidence intervals: 0.895-0.978), significantly higher than those of classical biomarkers. An interleukin-6 cutoff of 1418 pg/mL showed 95.5% sensitivity and 77.5% specificity, whereas a value of 15,060 pg/mL showed 63.6% sensitivity and 96.7% specificity, for diagnosis of bacterial meningitis. Interleukin-6 measured by electrochemiluminescence method is a promising marker for early differentiation between aseptic and bacterial meningitis. More studies are needed to validate clinical implications for future practice in an emergency laboratory. © The Author(s) 2015.

Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes

NASA Astrophysics Data System (ADS)

Denisov, E. T.; Shestakov, A. F.

2018-05-01

Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

QSAR models for degradation of organic pollutants in ozonation process under acidic condition.

PubMed

Zhu, Huicen; Guo, Weimin; Shen, Zhemin; Tang, Qingli; Ji, Wenchao; Jia, Lijuan

2015-01-01

Although some researches about the degradation of organic pollutants have been carried out during recent years, reaction rate constants are available only for homologue compounds with similar structures or components. Therefore, it is of great significance to find a universal relationship between reaction rate and certain parameters of several diverse organic pollutants. In this study, removal ratio and kinetics of 33 kinds of organic substances were investigated by ozonation process, including azo dyes, heterocyclic compounds, ionic compounds and so on. Most quantum chemical parameters were conducted by using Gaussian 09 at the DFT B3LYP/6-311G level, including μ, q H(+), q(C)minq(C)max, ELUMO and EHOMO. Other descriptors, bond order (BO) as well as Fukui indices (f(+), f(-) and f(0)), were calculated by Material Studio 6.1 at Dmol(3)/GGA-BLYP/DNP(3.5) basis for each organic compound. The recommended model for predicting rate constants was lnk'=1.978-95.484f(0)x-3.350q(C)min+38.221f(+)x, which had the squared regression coefficient R(2)=0.763 and standard deviation SD=0.716. The results of t test and the Fisher test suggested that the model exhibited optimum stability. Also, the model was validated by internal and external validations. Recommended QSAR model showed that the highest f(0) value of main-chain carbons (f(0)x) is more closely related to lnk' than other quantum descriptors. Copyright © 2014 Elsevier Ltd. All rights reserved.

Development and clinical validation of a multiplex real-time PCR assay for herpes simplex and varicella zoster virus.

PubMed

Tan, Thean Yen; Zou, Hao; Ong, Danny Chee Tiong; Ker, Khor Jia; Chio, Martin Tze Wei; Teo, Rachael Yu Lin; Koh, Mark Jean Aan

2013-12-01

Herpes simplex virus (HSV) and varicella zoster virus (VZV) are related members of the Herpesviridae family and are well-documented human pathogens causing a spectrum of diseases, from mucocutaneous disease to infections of the central nervous system. This study was carried out to evaluate and validate the performance of a multiplex real-time polymerase chain reaction (PCR) assay in detecting and differentiating HSV1, HSV2, and VZV from clinical samples. Consensus PCR primers for HSV were designed from the UL30 component of the DNA polymerase gene of HSV, with 2 separate hydrolysis probes designed to differentiate HSV1 and HSV2. Separate primers and a probe were also designed against the DNA polymerase gene of VZV. A total of 104 clinical samples were available for testing by real-time PCR, conventional PCR, and viral culture. The sensitivity and specificity of the real-time assay was calculated by comparing the multiplex PCR result with that of a combined standard of virus culture and conventional PCR. The sensitivity of the real-time assay was 100%, with specificity ranging from 98% to 100% depending on the target gene. Both PCR methods detected more positive samples for HSV or VZV, compared with conventional virus culture. This multiplex PCR assay provides accurate and rapid diagnostic capabilities for the diagnosis and differentiation of HSV1, HSV2, and VZV infections, with the presence of an internal control to monitor for inhibition of the PCR reaction.

Validation of RNAi Silencing Efficiency Using Gene Array Data shows 18.5% Failure Rate across 429 Independent Experiments.

PubMed

Munkácsy, Gyöngyi; Sztupinszki, Zsófia; Herman, Péter; Bán, Bence; Pénzváltó, Zsófia; Szarvas, Nóra; Győrffy, Balázs

2016-09-27

No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA) for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal-Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC) of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E-06). Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR) or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E-04). There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.

Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

PubMed

Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

2009-01-01

A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

Cerebral Toxoplasmosis Diagnosed by Nested-polymerase Chain Reaction in a Patient with Rheumatoid Arthritis.

PubMed

Matsuura, Jun; Fujii, Akihiro; Mizuta, Ikuko; Norose, Kazumi; Mizuno, Toshiki

2018-05-15

A 65-year-old woman with rheumatoid arthritis (RA) visited our hospital because of right facial sensory hypoesthesia. Cerebral toxoplasmosis was suspected on brain magnetic resonance imaging. We discontinued methotrexate for RA and started a sulfamethoxazole/trimethoprim (ST) mixture. Although ST treatment was interrupted because of adverse reactions, her prognosis was favorable. The Toxoplasma 18S rDNA gene was detected by nested-polymerase chain reaction (PCR) from blood and cerebrospinal fluid. Detecting the Toxoplasma 18S rDNA gene by nested-PCR is useful for the diagnosis and safer than a brain biopsy. In addition, the discontinuation of immunosuppressants may be recommended in patients compromised by those immunosuppressants.

Chemical reactions directed Peptide self-assembly.

PubMed

Rasale, Dnyaneshwar B; Das, Apurba K

2015-05-13

Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.

Chemical Reactions Directed Peptide Self-Assembly

PubMed Central

Rasale, Dnyaneshwar B.; Das, Apurba K.

2015-01-01

Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly. PMID:25984603

Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

PubMed Central

Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

2004-01-01

A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

One-step production of long-chain hydrocarbons from waste-biomass-derived chemicals using bi-functional heterogeneous catalysts.

PubMed

Wen, Cun; Barrow, Elizabeth; Hattrick-Simpers, Jason; Lauterbach, Jochen

2014-02-21

In this study, we demonstrate the production of long-chain hydrocarbons (C8+) from 2-methylfuran (2MF) and butanal in a single step reactive process by utilizing a bi-functional catalyst with both acid and metallic sites. Our approach utilizes a solid acid for the hydroalkylation function and as a support as well as a transition metal as hydrodeoxygenation catalyst. A series of solid acids was screened, among which MCM-41 demonstrated the best combination of activity and stability. Platinum nanoparticles were then incorporated into the MCM-41. The Pt/MCM-41 catalyst showed 96% yield for C8+ hydrocarbons and the catalytic performance was stable over four reaction cycles of 20 hour each. The reaction pathways for the production of long-chain hydrocarbons is probed with a combination of infrared spectroscopy and steady-state reaction experiments. It is proposed that 2MF and butanal go through hydroalkylation first on the acid site followed by hydrodeoxygenation to produce the hydrocarbon fuels.

Synthesis of surface-anchored DNA-polymer bioconjugates using reversible addition-fragmentation chain transfer polymerization.

PubMed

He, Peng; He, Lin

2009-07-13

We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.

Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.

PubMed

Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W

2007-04-01

Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.

Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

PubMed

Bridge, Julia A

2017-01-01

The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

Reaction pathways of propene pyrolysis.

PubMed

Qu, Yena; Su, Kehe; Wang, Xin; Liu, Yan; Zeng, Qingfeng; Cheng, Laifei; Zhang, Litong

2010-05-01

The gas-phase reaction pathways in preparing pyrolytic carbon with propene pyrolysis have been investigated in detail with a total number of 110 transition states and 50 intermediates. The structure of the species was determined with density functional theory at B3PW91/6-311G(d,p) level. The transition states and their linked intermediates were confirmed with frequency and the intrinsic reaction coordinates analyses. The elementary reactions were explored in the pathways of both direct and the radical attacking decompositions. The energy barriers and the reaction energies were determined with accurate model chemistry method at G3(MP2) level after an examination of the nondynamic electronic correlations. The heat capacities and entropies were obtained with statistical thermodynamics. The Gibbs free energies at 298.15 K for all the reaction steps were reported. Those at any temperature can be developed with classical thermodynamics by using the fitted (as a function of temperature) heat capacities. It was found that the most favorable paths are mainly in the radical attacking chain reactions. The chain was proposed with 26 reaction steps including two steps of the initialization of the chain to produce H and CH(3) radicals. For a typical temperature (1200 K) adopted in the experiments, the highest energy barriers were found in the production of C(3) to be 203.4 and 193.7 kJ/mol. The highest energy barriers for the production of C(2) and C were found 174.1 and 181.4 kJ/mol, respectively. These results are comparable with the most recent experimental observation of the apparent activation energy 201.9 +/- 0.6 or 137 +/- 25 kJ/mol. Copyright 2010 Wiley Periodicals, Inc.

Thermochemistry analyses for transformation of C6 glucose compound into C9, C12 and C15 alkanes using density functional theory

NASA Astrophysics Data System (ADS)

Verma, Anand Mohan; Kishore, Nanda

2017-02-01

The hydrolysis of cellulose fraction of biomass yields C6 glucose which further can be transformed into long-chain hydrocarbons by C-C coupling. In this study, C6 glucose is transformed into three chain alkanes, namely, C9, C12 and C15 using C-C coupling reactions under the gas and aqueous phase milieus. The geometry optimisation and vibrational frequency calculations are carried out at well-known hybrid-GGA functional, B3LYP with the basis set of 6-31+g(d,p) under the density functional theory framework. The single point energetics are calculated at M05-2X/6-311+g(3df,2p) level of theory. All thermochemical properties are calculated over a wide range of temperature between 300 and 900 K at an interval of 100 K. The thermochemistry suggested that the aqueous phase behaviour is suitable for the hydrolysis of sugar into long-chain alkanes compared to gas-phase environment. The hydrodeoxygenation reactions under each reaction pathway are found as most favourable reactions in both phases; however, aqueous phase dominates over gas phase in all discussed thermodynamic parameters.

MicroRNA Changes in Cerebrospinal Fluid After Subarachnoid Hemorrhage.

PubMed

Bache, Søren; Rasmussen, Rune; Rossing, Maria; Laigaard, Finn Pedersen; Nielsen, Finn Cilius; Møller, Kirsten

2017-09-01

Delayed cerebral ischemia (DCI) accounts for a major part of the morbidity and mortality after aneurysmal subarachnoid hemorrhage (SAH). MicroRNAs (miRNAs) are pathophysiologically involved in acute cerebral ischemia. This study compared miRNA profiles in cerebrospinal fluid from neurologically healthy patients, as well as SAH patients with and without subsequent development of DCI. In a prospective case-control study of SAH patients treated with external ventricular drainage and neurologically healthy patients, miRNA profiles in cerebrospinal fluid were screened and validated using 2 different high-throughput real-time quantification polymerase chain reaction techniques. The occurrence of DCI was documented in patient charts and subsequently reviewed independently by 2 physicians. MiRNA profiles from 27 SAH patients and 10 neurologically healthy patients passed quality control. In the validation, 66 miRNAs showed a relative increase in cerebrospinal fluid from SAH patients compared with neurologically healthy patients ( P <0.001); 2 (miR-21 and miR-221) showed a relative increase in SAH patients with DCI compared with those without ( P <0.05) in both the screening and validation. SAH is associated with marked changes in the cerebrospinal fluid miRNA profile. These changes could be associated to the development of DCI. URL: http://www.clinicaltrials.gov. Unique identifier: NCT01791257. © 2017 The Authors.

Optimization and Verification of Droplet Digital PCR Even-Specific Methods for the Quantification of GM Maize DAS1507 and NK603.

PubMed

Grelewska-Nowotko, Katarzyna; Żurawska-Zajfert, Magdalena; Żmijewska, Ewelina; Sowa, Sławomir

2018-05-01

In recent years, digital polymerase chain reaction (dPCR), a new molecular biology technique, has been gaining in popularity. Among many other applications, this technique can also be used for the detection and quantification of genetically modified organisms (GMOs) in food and feed. It might replace the currently widely used real-time PCR method (qPCR), by overcoming problems related to the PCR inhibition and the requirement of certified reference materials to be used as a calibrant. In theory, validated qPCR methods can be easily transferred to the dPCR platform. However, optimization of the PCR conditions might be necessary. In this study, we report the transfer of two validated qPCR methods for quantification of maize DAS1507 and NK603 events to the droplet dPCR (ddPCR) platform. After some optimization, both methods have been verified according to the guidance of the European Network of GMO Laboratories (ENGL) on analytical method verification (ENGL working group on "Method Verification." (2011) Verification of Analytical Methods for GMO Testing When Implementing Interlaboratory Validated Methods). Digital PCR methods performed equally or better than the qPCR methods. Optimized ddPCR methods confirm their suitability for GMO determination in food and feed.

[DNA prints instead of plantar prints in neonatal identification].

PubMed

Rodríguez-Alarcón Gómez, J; Martińez de Pancorbo Gómez, M; Santillana Ferrer, L; Castro Espido, A; Melchor Maros, J C; Linares Uribe, M A; Fernández-Llebrez del Rey, L; Aranguren Dúo, G

1996-06-22

To check the possible usefulness in studying DNA in dried blood spots taken on filter paper blotters for newborn identification. It set out to establish: 1. The validity of the method for analysis; 2. The validity of all stored samples (such as those kept in clinical records); 3. Guarantee of non-intrusion in the genetic code; 4. Acceptable price and execution time. Forty (40) anonymous 13-year-old samples of 20 subjects (2 per subject) were studied. DNA was extracted using Chelex resin and the STR ("small tandem repeat") of microsatellite DNA was studies using the "polimerase chain reaction method" (PCR). Three non coding DNA loci (CSF1PO, TPOX and THO1) were analyzed by Multiplex amplification. It was possible to type 39 samples, making it possible to match the 20 cases (one by exclusion). The complete procedure yielded the results within 24 hours in all cases. The estimated final cost was found to be a fifth of that conventional maternity/paternity tests. The study carried out made matching possible in all 20 cases (directly in 19 cases). It was not necessary to study DNA coding areas. The validity of the method for analyzing samples stored for 13 years without any special care was also demonstrated. The technic was fast, producing the results within 24 hours, and at reasonable cost.

Gene Expression Profile Analysis is Directly Affected by the Selected Reference Gene: The Case of Leaf-Cutting Atta Sexdens

PubMed Central

Máximo, Wesley P. F.; Zanetti, Ronald; Paiva, Luciano V.

2018-01-01

Although several ant species are important targets for the development of molecular control strategies, only a few studies focus on identifying and validating reference genes for quantitative reverse transcription polymerase chain reaction (RT-qPCR) data normalization. We provide here an extensive study to identify and validate suitable reference genes for gene expression analysis in the ant Atta sexdens, a threatening agricultural pest in South America. The optimal number of reference genes varies according to each sample and the result generated by RefFinder differed about which is the most suitable reference gene. Results suggest that the RPS16, NADH and SDHB genes were the best reference genes in the sample pool according to stability values. The SNF7 gene expression pattern was stable in all evaluated sample set. In contrast, when using less stable reference genes for normalization a large variability in SNF7 gene expression was recorded. There is no universal reference gene suitable for all conditions under analysis, since these genes can also participate in different cellular functions, thus requiring a systematic validation of possible reference genes for each specific condition. The choice of reference genes on SNF7 gene normalization confirmed that unstable reference genes might drastically change the expression profile analysis of target candidate genes. PMID:29419794

Development and in-house validation of the event-specific qualitative and quantitative PCR detection methods for genetically modified cotton MON15985.

PubMed

Jiang, Lingxi; Yang, Litao; Rao, Jun; Guo, Jinchao; Wang, Shu; Liu, Jia; Lee, Seonghun; Zhang, Dabing

2010-02-01

To implement genetically modified organism (GMO) labeling regulations, an event-specific analysis method based on the junction sequence between exogenous integration and host genomic DNA has become the preferential approach for GMO identification and quantification. In this study, specific primers and TaqMan probes based on the revealed 5'-end junction sequence of GM cotton MON15985 were designed, and qualitative and quantitative polymerase chain reaction (PCR) assays were established employing the designed primers and probes. In the qualitative PCR assay, the limit of detection (LOD) was 0.5 g kg(-1) in 100 ng total cotton genomic DNA, corresponding to about 17 copies of haploid cotton genomic DNA, and the LOD and limit of quantification (LOQ) for quantitative PCR assay were 10 and 17 copies of haploid cotton genomic DNA, respectively. Furthermore, the developed quantitative PCR assays were validated in-house by five different researchers. Also, five practical samples with known GM contents were quantified using the developed PCR assay in in-house validation, and the bias between the true and quantification values ranged from 2.06% to 12.59%. This study shows that the developed qualitative and quantitative PCR methods are applicable for the identification and quantification of GM cotton MON15985 and its derivates.

Aneuploidy screening of embryonic stem cell clones by metaphase karyotyping and droplet digital polymerase chain reaction.

PubMed

Codner, Gemma F; Lindner, Loic; Caulder, Adam; Wattenhofer-Donzé, Marie; Radage, Adam; Mertz, Annelyse; Eisenmann, Benjamin; Mianné, Joffrey; Evans, Edward P; Beechey, Colin V; Fray, Martin D; Birling, Marie-Christine; Hérault, Yann; Pavlovic, Guillaume; Teboul, Lydia

2016-08-05

Karyotypic integrity is essential for the successful germline transmission of alleles mutated in embryonic stem (ES) cells. Classical methods for the identification of aneuploidy involve cytological analyses that are both time consuming and require rare expertise to identify mouse chromosomes. As part of the International Mouse Phenotyping Consortium, we gathered data from over 1,500 ES cell clones and found that the germline transmission (GLT) efficiency of clones is compromised when over 50 % of cells harbour chromosome number abnormalities. In JM8 cells, chromosomes 1, 8, 11 or Y displayed copy number variation most frequently, whilst the remainder generally remain unchanged. We developed protocols employing droplet digital polymerase chain reaction (ddPCR) to accurately quantify the copy number of these four chromosomes, allowing efficient triage of ES clones prior to microinjection. We verified that assessments of aneuploidy, and thus decisions regarding the suitability of clones for microinjection, were concordant between classical cytological and ddPCR-based methods. Finally, we improved the method to include assay multiplexing so that two unstable chromosomes are counted simultaneously (and independently) in one reaction, to enhance throughput and further reduce the cost. We validated a PCR-based method as an alternative to classical karyotype analysis. This technique enables laboratories that are non-specialist, or work with large numbers of clones, to precisely screen ES cells for the most common aneuploidies prior to microinjection to ensure the highest level of germline transmission potential. The application of this method allows early exclusion of aneuploid ES cell clones in the ES cell to mouse conversion process, thus improving the chances of obtaining germline transmission and reducing the number of animals used in failed microinjection attempts. This method can be applied to any other experiments that require accurate analysis of the genome for copy number variation (CNV).

Vanadium accelerates polymerase chain reaction and expands the applicability of forensic DNA testing.

PubMed

Kaminiwa, Junko; Honda, Katsuya; Sugano, Yukiko; Yano, Shizue; Nishi, Takeki; Sekine, Yuko

2013-05-01

Polymerase chain reaction (PCR) has been rapidly established as one of the most widely used techniques in molecular biology. Because most DNA analysis is PCR-based, the analysis of unamplifiable DNA of poor quality or low quantity is nearly impossible. However, we observed that if an appropriate concentration of vanadium chloride is added to the standard reaction mixture, the enzymatic amplification of DNA could be enhanced. Using multiplex PCR with the addition of vanadium, DNA typing was possible from even trace amounts of DNA that we were unable to amplify using normal reaction conditions. This method might be an effective tool for not only criminal investigations and ancient DNA analysis, but also for nearly all fields using DNA technology. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Kinetics of the Br2-CH3CHO Photochemical Chain Reaction

NASA Technical Reports Server (NTRS)

Nicovich, J. M.; Shackelford, C. J.; Wine, P. H.

1997-01-01

Time-resolved resonance fluorescence spectroscopy was employed in conjunction with laser flash photolysis of Br2 to study the kinetics of the two elementary steps in the photochemical chain reaction nBr2 + nCH3CHO + hv yields nCH3CBrO + nHBr. In the temperature range 255-400 K, the rate coefficient for the reaction Br((sup 2)P(sub 3/2)) + CH3CHO yields CH3CO + HBr is given by the Arrhenius expression k(sub 6)(T) = (1.51 +/- 0.20) x 10(exp -11) exp(-(364 +/- 41)/T)cu cm/(molecule.s). At 298 K, the reaction CH3CO + Br2 yields CH3CBrO + Br proceeds at a near gas kinetic rate, k(sub 7)(298 K) = (1.08 +/- 0.38) x 10(exp -10)cu cm/(molecule.s).

Modelisation de l'historique d'operation de groupes turbine-alternateur

NASA Astrophysics Data System (ADS)

Szczota, Mickael

Because of their ageing fleet, the utility managers are increasingly in needs of tools that can help them to plan efficiently maintenance operations. Hydro-Quebec started a project that aim to foresee the degradation of their hydroelectric runner, and use that information to classify the generating unit. That classification will help to know which generating unit is more at risk to undergo a major failure. Cracks linked to the fatigue phenomenon are a predominant degradation mode and the loading sequences applied to the runner is a parameter impacting the crack growth. So, the aim of this memoir is to create a generator able to generate synthetic loading sequences that are statistically equivalent to the observed history. Those simulated sequences will be used as input in a life assessment model. At first, we describe how the generating units are operated by Hydro-Quebec and analyse the available data, the analysis shows that the data are non-stationnary. Then, we review modelisation and validation methods. In the following chapter a particular attention is given to a precise description of the validation and comparison procedure. Then, we present the comparison of three kind of model : Discrete Time Markov Chains, Discrete Time Semi-Markov Chains and the Moving Block Bootstrap. For the first two models, we describe how to take account for the non-stationnarity. Finally, we show that the Markov Chain is not adapted for our case, and that the Semi-Markov chains are better when they include the non-stationnarity. The final choice between Semi-Markov Chains and the Moving Block Bootstrap depends of the user. But, with a long term vision we recommend the use of Semi-Markov chains for their flexibility. Keywords: Stochastic models, Models validation, Reliability, Semi-Markov Chains, Markov Chains, Bootstrap

Quantitative Polymerase Chain Reaction to Assess Response to Treatment of Bacterial Vaginosis and Risk of Preterm Birth.

PubMed

Abramovici, Adi; Lobashevsky, Elena; Cliver, Suzanne P; Edwards, Rodney K; Hauth, John C; Biggio, Joseph R

2015-10-01

The aim of this study was to determine whether quantitative polymerase chain reaction (qPCR) bacterial load measurement is a valid method to assess response to treatment of bacterial vaginosis and risk of preterm birth in pregnant women. Secondary analysis by utilizing stored vaginal samples obtained during a previous randomized controlled trial studying the effect of antibiotics on preterm birth (PTB). All women had risk factors for PTB: (1) positive fetal fibronectin (n=146), (2) bacterial vaginosis (BV) and a prior PTB (n=43), or (3) BV and a prepregnancy weight<50 kg (n=54). Total and several individual BV-related bacteria loads were measured using qPCR for 16S rRNA. Loads were correlated with Nugent scores (Spearman correlation coefficients). Loads were compared pre- and posttreatment with Wilcoxon rank-sum test. Individual patient differences were examined with Wilcoxon signed-rank test. A total of 243 paired vaginal samples were available for analysis: 123 antibiotics and 120 placebo. Groups did not differ by risk factors for PTB. For all samples, bacterial loads were correlated with Nugent score and each of its specific bacterial components (all p<0.01). Baseline total bacterial load did not differ by treatment group (p=0.87). Posttreatment total bacterial load was significantly lower in the antibiotics group than the placebo group (p<0.01). Individual patient total bacterial load decreased significantly posttreatment in the antibiotics group (p<0.01), but not in the placebo group (p=0.12). The rate of PTB did not differ between groups (p=0.24). PTB relative risks calculated for BV positive versus BV negative women and women with the highest quartile total and individual bacterial loads were not statistically significant. qPCR correlates with Nugent score and demonstrates decreased bacterial load after antibiotic treatment. Therefore, it is a valid method of vaginal flora assessment in pregnant women who are at high risk for PTB. Thieme Medical Publishers 333 Seventh Avenue, New York, NY 10001, USA.

ε-Poly-l-Lysine Peptide Chain Length Regulated by the Linkers Connecting the Transmembrane Domains of ε-Poly-l-Lysine Synthetase

PubMed Central

Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime

2014-01-01

ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. PMID:24907331

Bio-markers: traceability in food safety issues.

PubMed

Raspor, Peter

2005-01-01

Research and practice are focusing on development, validation and harmonization of technologies and methodologies to ensure complete traceability process throughout the food chain. The main goals are: scale-up, implementation and validation of methods in whole food chains, assurance of authenticity, validity of labelling and application of HACCP (hazard analysis and critical control point) to the entire food chain. The current review is to sum the scientific and technological basis for ensuring complete traceability. Tracing and tracking (traceability) of foods are complex processes due to the (bio)markers, technical solutions and different circumstances in different technologies which produces various foods (processed, semi-processed, or raw). Since the food is produced for human or animal consumption we need suitable markers to be stable and traceable all along the production chain. Specific biomarkers can have a function in technology and in nutrition. Such approach would make this development faster and more comprehensive and would make possible that food effect could be monitored with same set of biomarkers in consumer. This would help to develop and implement food safety standards that would be based on real physiological function of particular food component.

Molprobity's ultimate rotamer-library distributions for model validation.

PubMed

Hintze, Bradley J; Lewis, Steven M; Richardson, Jane S; Richardson, David C

2016-09-01

Here we describe the updated MolProbity rotamer-library distributions derived from an order-of-magnitude larger and more stringently quality-filtered dataset of about 8000 (vs. 500) protein chains, and we explain the resulting changes and improvements to model validation as seen by users. To include only side-chains with satisfactory justification for their given conformation, we added residue-specific filters for electron-density value and model-to-density fit. The combined new protocol retains a million residues of data, while cleaning up false-positive noise in the multi- χ datapoint distributions. It enables unambiguous characterization of conformational clusters nearly 1000-fold less frequent than the most common ones. We describe examples of local interactions that favor these rare conformations, including the role of authentic covalent bond-angle deviations in enabling presumably strained side-chain conformations. Further, along with favored and outlier, an allowed category (0.3-2.0% occurrence in reference data) has been added, analogous to Ramachandran validation categories. The new rotamer distributions are used for current rotamer validation in MolProbity and PHENIX, and for rotamer choice in PHENIX model-building and refinement. The multi-dimensional χ distributions and Top8000 reference dataset are freely available on GitHub. These rotamers are termed "ultimate" because data sampling and quality are now fully adequate for this task, and also because we believe the future of conformational validation should integrate side-chain with backbone criteria. Proteins 2016; 84:1177-1189. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Transcriptome-wide analyses indicate mitochondrial responses to particulate air pollution exposure.

PubMed

Winckelmans, Ellen; Nawrot, Tim S; Tsamou, Maria; Den Hond, Elly; Baeyens, Willy; Kleinjans, Jos; Lefebvre, Wouter; Van Larebeke, Nicolas; Peusens, Martien; Plusquin, Michelle; Reynders, Hans; Schoeters, Greet; Vanpoucke, Charlotte; de Kok, Theo M; Vrijens, Karen

2017-08-18

Due to their lack of repair capacity mitochondria are critical targets for environmental toxicants. We studied genes and pathways reflecting mitochondrial responses to short- and medium-term PM 10 exposure. Whole genome gene expression was measured in peripheral blood of 98 adults (49% women). We performed linear regression analyses stratified by sex and adjusted for individual and temporal characteristics to investigate alterations in gene expression induced by short-term (week before blood sampling) and medium-term (month before blood sampling) PM 10 exposure. Overrepresentation analyses (ConsensusPathDB) were performed to identify enriched mitochondrial associated pathways and gene ontology sets. Thirteen Human MitoCarta genes were measured by means of quantitative real-time polymerase chain reaction (qPCR) along with mitochondrial DNA (mtDNA) content in an independent validation cohort (n = 169, 55.6% women). Overrepresentation analyses revealed significant pathways (p-value <0.05) related to mitochondrial genome maintenance and apoptosis for short-term exposure and to the electron transport chain (ETC) for medium-term exposure in women. For men, medium-term PM 10 exposure was associated with the Tri Carbonic Acid cycle. In an independent study population, we validated several ETC genes, including UQCRH and COX7C (q-value <0.05), and some genes crucial for the maintenance of the mitochondrial genome, including LONP1 (q-value: 0.07) and POLG (q-value: 0.04) in women. In this exploratory study, we identified mitochondrial genes and pathways associated with particulate air pollution indicating upregulation of energy producing pathways as a potential mechanism to compensate for PM-induced mitochondrial damage.

Recoil-α-fission and recoil-α-α-fission events observed in the reaction 48Ca + 243Am

NASA Astrophysics Data System (ADS)

Forsberg, U.; Rudolph, D.; Andersson, L.-L.; Di Nitto, A.; Düllmann, Ch. E.; Fahlander, C.; Gates, J. M.; Golubev, P.; Gregorich, K. E.; Gross, C. J.; Herzberg, R.-D.; Heßberger, F. P.; Khuyagbaatar, J.; Kratz, J. V.; Rykaczewski, K.; Sarmiento, L. G.; Schädel, M.; Yakushev, A.; Åberg, S.; Ackermann, D.; Block, M.; Brand, H.; Carlsson, B. G.; Cox, D.; Derkx, X.; Dobaczewski, J.; Eberhardt, K.; Even, J.; Gerl, J.; Jäger, E.; Kindler, B.; Krier, J.; Kojouharov, I.; Kurz, N.; Lommel, B.; Mistry, A.; Mokry, C.; Nazarewicz, W.; Nitsche, H.; Omtvedt, J. P.; Papadakis, P.; Ragnarsson, I.; Runke, J.; Schaffner, H.; Schausten, B.; Shi, Yue; Thörle-Pospiech, P.; Torres, T.; Traut, T.; Trautmann, N.; Türler, A.; Ward, A.; Ward, D. E.; Wiehl, N.

2016-09-01

Products of the fusion-evaporation reaction 48Ca + 243Am were studied with the TASISpec set-up at the gas-filled separator TASCA at the GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt, Germany. Amongst the detected thirty correlated α-decay chains associated with the production of element Z = 115, two recoil-α-fission and five recoil- α- α-fission events were observed. The latter five chains are similar to four such events reported from experiments performed at the Dubna gas-filled separator, and three such events reported from an experiment at the Berkeley gas-filled separator. The four chains observed at the Dubna gas-filled separator were assigned to start from the 2n-evaporation channel 289115 due to the fact that these recoil- α- α-fission events were observed only at low excitation energies. Contrary to this interpretation, we suggest that some of these recoil- α- α-fission decay chains, as well as some of the recoil- α- α-fission and recoil-α-fission decay chains reported from Berkeley and in this article, start from the 3n-evaporation channel 288115.

IgE reactivity to alpha1 and alpha2 chains of bovine type 1 collagen in children with bovine gelatin allergy.

PubMed

Sakaguchi, M; Hori, H; Hattori, S; Irie, S; Imai, A; Yanagida, M; Miyazawa, H; Toda, M; Inouye, S

1999-09-01

Anaphylactic reactions to measles, mumps, and rubella vaccines, including gelatin as a stabilizer, have been reported. It had been found that most of these reactions to live vaccines are caused by the bovine gelatin included in these vaccines. Gelatin mainly includes denatured type I collagen, which consists of alpha1 and alpha2 chains. The current study was designed to investigate the IgE reactivity to alpha1 and alpha2 chains of bovine type I collagen in gelatin-sensitive children. Serum samples were taken from 10 children who had anaphylaxis to the vaccines and high levels of specific IgE to bovine gelatin. Bovine type I collagen was isolated from bovine skin and then separated to alpha1 and alpha2 chains by column chromatography. IgE reactivity to denatured type I collagen and its alpha1 and alpha2 chains was analyzed by immunoblotting, ELISA, and histamine release from the mast cells passive sensitized with IgE antibodies in pooled serum of the children. All children had specific IgE to bovine type I collagen. Furthermore, IgE antibodies in their sera reacted with the alpha;2 chain but not with the alpha1 chain. Similarly, the mast cells sensitized with pooled sera in the children showed alpha2 chain-specific histamine release but not alpha1 chain-specific histamine release. In gelatin allergy denatured bovine type I collagen is a major allergen and IgE-binding sites exist in the alpha2 chain of type I collagen.

Detecting Service Chains and Feature Interactions in Sensor-Driven Home Network Services

PubMed Central

Inada, Takuya; Igaki, Hiroshi; Ikegami, Kosuke; Matsumoto, Shinsuke; Nakamura, Masahide; Kusumoto, Shinji

2012-01-01

Sensor-driven services often cause chain reactions, since one service may generate an environmental impact that automatically triggers another service. We first propose a framework that can formalize and detect such service chains based on ECA (event, condition, action) rules. Although the service chain can be a major source of feature interactions, not all service chains lead to harmful interactions. Therefore, we then propose a method that identifies feature interactions within the service chains. Specifically, we characterize the degree of deviation of every service chain by evaluating the gap between expected and actual service states. An experimental evaluation demonstrates that the proposed method successfully detects 11 service chains and 6 feature interactions within 7 practical sensor-driven services. PMID:23012499

Reaction time as an indicator of insufficient effort: Development and validation of an embedded performance validity parameter.

PubMed

Stevens, Andreas; Bahlo, Simone; Licha, Christina; Liske, Benjamin; Vossler-Thies, Elisabeth

2016-11-30

Subnormal performance in attention tasks may result from various sources including lack of effort. In this report, the derivation and validation of a performance validity parameter for reaction time is described, using a set of malingering-indices ("Slick-criteria"), and 3 independent samples of participants (total n =893). The Slick-criteria yield an estimate of the probability of malingering based on the presence of an external incentive, evidence from neuropsychological testing, from self-report and clinical data. In study (1) a validity parameter is derived using reaction time data of a sample, composed of inpatients with recent severe brain lesions not involved in litigation and of litigants with and without brain lesion. In study (2) the validity parameter is tested in an independent sample of litigants. In study (3) the parameter is applied to an independent sample comprising cooperative and non-cooperative testees. Logistic regression analysis led to a derived validity parameter based on median reaction time and standard deviation. It performed satisfactorily in studies (2) and (3) (study 2 sensitivity=0.94, specificity=1.00; study 3 sensitivity=0.79, specificity=0.87). The findings suggest that median reaction time and standard deviation may be used as indicators of negative response bias. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Ionizing radiation-induced destruction of benzene and dienes in aqueous media.

PubMed

Al-Sheikhly, Mohamad; Poster, Dianne L; An, Jung-Chul; Neta, Pedatsur; Silverman, Joseph; Huie, Robert E

2006-05-01

Pulse radiolysis with spectrophotometric and conductometric detection was utilized to study the formation and reactions of radicals from benzene and dienes in aqueous solutions. The benzene OH adduct, *C6H6OH, reacts with O2 (k = 3 x 10(8) L mol(-1) s(-1)) in a reversible reaction. The peroxyl radical, HOC6H6O2*, undergoes O2*- elimination, bimolecular decay, and reaction with benzene to initiate a chain reaction, depending on the dose rate, benzene concentration, and pH. The occurrence of the chain reaction is demonstrated in low-dose-rate gamma radiolysis experiments where the consumption of O2 was monitored. 1,4-Cyclohexadiene, 1,4-hexadiene, and 1,4-pentadiene form OH-adducts and undergo H-abstraction by O*- radicals. The OH-adducts react with O2 to form peroxyl radicals. These peroxyl radicals, however, do not undergo unimolecular O2*- elimination but rather decay by second-order processes, which lead to subsequent steps of O2*- elimination.

The possibility of a new resonance of three-body linear chain structure in the reaction 12C+16O at Ec.mapprox-33.5MeV

NASA Astrophysics Data System (ADS)

Kong, Xiangjing; P, L. Li; J, J. Kolata; A, Morsad; L, Goetting; R, A. Kryger; S, Dixit; R, Tighe; W, Chune

1990-05-01

There is a peak in the excitation function of total cross section of low energy α-particles in the reaction 12C+16O at Ec.m approx33.5MeV. The experimental distribution of α-particle emitted event has been obtained. The result of theoretical calculation roughly agrees with experimental data, gives an orientation where three-body resonances can be expected, and the information on internal structure of three-body linear chain molecule.

Gel Point Suppression in RAFT Polymerization of Pure Acrylic Cross-Linker Derived from Soybean Oil.

PubMed

Yan, Mengguo; Huang, Yuerui; Lu, Mingjia; Lin, Fang-Yi; Hernández, Nacú B; Cochran, Eric W

2016-08-08

Here we report the reversible addition-fragmentation chain transfer (RAFT) polymerization of acrylated epoxidized soybean oil (AESO), a cross-linker molecule, to high conversion (>50%) and molecular weight (>100 kDa) without macrogelation. Surprisingly, gelation is suppressed in this system far beyond the expectations predicated both on Flory-Stockmeyer theory and multiple other studies of RAFT polymerization featuring cross-linking moieties. By varying AESO and initiator concentrations, we show how intra- versus intermolecular cross-linking compete, yielding a trade-off between the degree of intramolecular linkages and conversion at gel point. We measured polymer chain characteristics, including molecular weight, chain dimensions, polydispersity, and intrinsic viscosity, using multidetector gel permeation chromatography and NMR to track polymerization kinetics. We show that not only the time and conversion at macrogelation, but also the chain architecture, is largely affected by these reaction conditions. At maximal AESO concentration, the gel point approaches that predicted by the Flory-Stockmeyer theory, and increases in an exponential fashion as the AESO concentration decreases. In the most dilute solutions, macrogelation cannot be detected throughout the entire reaction. Instead, cyclization/intramolecular cross-linking reactions dominate, leading to microgelation. This work is important, especially in that it demonstrates that thermoplastic rubbers could be produced based on multifunctional renewable feedstocks.

Bismuth(III) trifluoromethanesulfonate catalyzed ring opening reaction of mono epoxy oleochemicals to form keto and diketo derivatives

USDA-ARS?s Scientific Manuscript database

Using a catalytic system, methyl oleate is transformed into long chain keto and diketo derivatives via an epoxide route. Methyl 9(10)-oxooctadecanoate and methyl 9,10-dioxooctadecanoate were made by a ring opening reaction of epoxidized methyl oleate using bismuth triflate catalyst. Lower reaction t...

75 FR 27979 - Submission for OMB Review; Comment Request

Federal Register 2010, 2011, 2012, 2013, 2014

2010-05-19

... it displays a currently valid OMB control number. Farm Service Agency Title: Web-Based Supply Chain System (WBSCM). OMB Control Number: 0560-0177. Summary of Collection: The Web-Based Supply Chain System...

Direct RNA detection without nucleic acid purification and PCR: Combining sandwich hybridization with signal amplification based on branched hybridization chain reaction.

PubMed

Xu, Yao; Zheng, Zhi

2016-05-15

We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.

Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

PubMed

Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

2008-03-01

Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

Computational study on UV curing characteristics in nanoimprint lithography: Stochastic simulation

NASA Astrophysics Data System (ADS)

Koyama, Masanori; Shirai, Masamitsu; Kawata, Hiroaki; Hirai, Yoshihiko; Yasuda, Masaaki

2017-06-01

A computational simulation model of UV curing in nanoimprint lithography based on a simplified stochastic approach is proposed. The activated unit reacts with a randomly selected monomer within a critical reaction radius. Cluster units are chained to each other. Then, another monomer is activated and the next chain reaction occurs. This process is repeated until a virgin monomer disappears within the reaction radius or until the activated monomers react with each other. The simulation model well describes the basic UV curing characteristics, such as the molecular weight distributions of the reacted monomers and the effect of the initiator concentration on the conversion ratio. The effects of film thickness on UV curing characteristics are also studied by the simulation.

A lab-on-a-chip-based multiplex platform to detect potential fraud of introducing pig, dog, cat, rat and monkey meat into the food chain.

PubMed

Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Ali, Md Eaqub

2015-01-01

Food forgery has posed considerable risk to public health, religious rituals, personal budget and wildlife. Pig, dog, cat, rat and monkey meat are restricted in most religions, but their sporadic adulteration are rampant. Market controllers need a low-cost but reliable technique to track and trace suspected species in the food chain. Considering the need, here we documented a lab-on-a-chip-based multiplex polymerase chain reaction (PCR) assay for the authentication of five non-halal meat species in foods. Using species-specific primers, 172, 163, 141, 129 and 108-bp sites of mitochondrial ND5, ATPase 6 and cytochrome b genes were amplified to detect cat, dog, pig, monkey and rat species under complex matrices. Species-specificity was authenticated against 20 different species with the potential to be used in food. The targets were stable under extreme sterilisation (121°C at 45 psi for 2.5 h) which severely degrades DNA. The assay was optimised under the backgrounds of various commercial meat products and validated for the analysis of meatballs, burgers and frankfurters, which are popular fast food items across the globe. The assay was tested to detect 0.1% suspected meats under commercial backgrounds of marketed foods. Instead of simplex PCR which detects only one species at a time, such a multiplex platform can reduce cost by at least fivefolds by detecting five different species in a single assay platform.

Problem-Solving Test: Pyrosequencing

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2013-01-01

Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…

Hydrolysis of the amorphous cellulose in cotton-based paper.

PubMed

Stephens, Catherine H; Whitmore, Paul M; Morris, Hannah R; Bier, Mark E

2008-04-01

Hydrolysis of cellulose in Whatman no. 42 cotton-based paper was studied using gel permeation chromatography (GPC), electrospray ionization-mass spectrometry (ESI-MS), and uniaxial tensile testing to understand the course and kinetics of the reaction. GPC results suggested that scission reactions passed through three stages. Additionally, the evolution of soluble oligomers in the ESI-MS data and the steady course of strength loss showed that the hydrolysis reaction occurred at a constant rate. These findings are explained with a more detailed description of the cellulose hydrolysis, which includes multiple chain scissions on amorphous segments. The breaks occur with increasing frequency near the ends of amorphous segments, where chains protrude from crystalline domains. Oligomers unattached to crystalline domains are eventually created. Late-stage reactions near the ends of amorphous segments produce a kinetic behavior that falsely suggests that hydrolysis had ceased. Monte Carlo simulations of cellulose degradation corroborated the experimental findings.

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

[The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

PubMed

D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

1993-01-01

The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

Loop-Mediated Isothermal Amplification for Salmonella Detection in Food and Feed: Current Applications and Future Directions

PubMed Central

Yang, Qianru; Domesle, Kelly J.

2018-01-01

Abstract Loop-mediated isothermal amplification (LAMP) has become a powerful alternative to polymerase chain reaction (PCR) for pathogen detection in clinical specimens and food matrices. Nontyphoidal Salmonella is a zoonotic pathogen of significant food and feed safety concern worldwide. The first study employing LAMP for the rapid detection of Salmonella was reported in 2005, 5 years after the invention of the LAMP technology in Japan. This review provides an overview of international efforts in the past decade on the development and application of Salmonella LAMP assays in a wide array of food and feed matrices. Recent progress in assay design, platform development, commercial application, and method validation is reviewed. Future perspectives toward more practical and wider applications of Salmonella LAMP assays in food and feed testing are discussed. PMID:29902082

Identification of feline polycystic kidney disease mutation using fret probes and melting curve analysis.

PubMed

Criado-Fornelio, A; Buling, A; Barba-Carretero, J C

2009-02-01

We developed and validated a real-time polymerase chain reaction (PCR) assay using fluorescent hybridization probes and melting curve analysis to identify the PKD1 exon 29 (C-->A) mutation, which is implicated in polycystic kidney disease of cats. DNA was isolated from peripheral blood of 20 Persian cats. The employ of the new real-time PCR and melting curve analysis in these samples indicated that 13 cats (65%) were wild type homozygotes and seven cats (35%) were heterozygotes. Both PCR-RFLP and sequencing procedures were in full agreement with real-time PCR test results. Sequence analysis showed that the mutant gene had the expected base change compared to the wild type gene. The new procedure is not only very reliable but also faster than the techniques currently applied for diagnosis of the mutation.

Quantification of short chain amines in aqueous matrices using liquid chromatography electrospray ionization tandem mass spectrometry.

PubMed

Viidanoja, Jyrki

2017-01-13

A new liquid chromatography-electrospray ionization-tandem Mass Spectrometry (LC-ESI-MS/MS) method was developed for the determination of more than 20 C 1 -C 6 alkyl and alkanolamines in aqueous matrices. The method employs Hydrophilic Interaction Liquid Chromatography Multiple Reaction Monitoring (HILIC-MRM) with a ZIC-pHILIC column and four stable isotope labeled amines as internal standards for signal normalization and quantification of the amines. The method was validated using a refinery process water sample that was obtained from a cooling cycle of crude oil distillation. The averaged within run precision, between run precision and accuracy were generally within 2-10%, 1-9% and 80-120%, respectively, depending on the analyte and concentration level. Selected aqueous process samples were analyzed with the method. Copyright © 2016 Elsevier B.V. All rights reserved.

Experimental Design for a Macrofoam Swab Study Relating the Recovery Efficiency and False Negative Rate to Low Concentrations of Two Bacillus anthracis Surrogates on Four Surface Materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piepel, Gregory F.; Hutchison, Janine R.

2014-04-16

This report describes the experimental design for a laboratory study to quantify the recovery efficiencies and false negative rates of a validated, macrofoam swab sampling method for low concentrations of Bacillus anthracis Sterne (BAS) and Bacillus atrophaeus (BG) spores on four surface materials (stainless steel, glass, vinyl tile, plastic light cover panel). Two analytical methods (plating/counting and polymerase chain reaction) will be used. Only one previous study has investigated false negative as a function of affecting test factors. The surrogates BAS and BG have not been tested together in the same study previously. Hence, this study will provide for completingmore » gaps in the available information on the performance of macrofoam swab sampling at low concentrations.« less

Blood-induced differential gene expression in Anopheles dirus evaluated using RNA sequencing.

PubMed

Mongkol, W; Nguitragool, W; Sattabongkot, J; Kubera, A

2018-06-08

Malaria parasites are transmitted through blood feeding by female Anopheline mosquitoes. Unveiling the blood-feeding process will improve understanding of vector biology. Anopheles dirus (Diptera: Culicidae) is one of the primary malaria vectors in the Greater Mekong Subregion, the epicentre of malaria drug resistance. In this study, differential gene expression between sugar- and blood-fed An. dirus was investigated by RNA sequencing (RNA-seq). A total of 589 transcripts were found to be upregulated and 703 transcripts downregulated as a result of blood feeding. Transcriptional differences were found in genes involved in blood digestion, peritrophic matrix formation, oogenesis and vitellogenesis. The expression levels of several genes were validated by quantitative reverse transcription polymerase chain reaction. The present results provide better understanding of An. dirus biology in relation to its blood feeding. © 2018 The Royal Entomological Society.

Experimental Design for a Macrofoam-Swab Study Relating the Recovery Efficiency and False Negative Rate to Low Concentrations of Two Bacillus anthracis Surrogates on Four Surface Materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piepel, Gregory F.; Hutchison, Janine R.

This report describes the experimental design for a laboratory study to quantify the recovery efficiencies and false negative rates of a validated, macrofoam-swab sampling method for low concentrations of Bacillus anthracis Sterne (BAS) and Bacillus atrophaeus (BG) spores on four surface materials (stainless steel, glass, vinyl tile, plastic light cover panel). Two analytical methods (culture and polymerase chain reaction) will be used. Only one previous study has investigated how the false negative rate depends on test factors. The surrogates BAS and BG have not been tested together in the same study previously. Hence, this study will provide for completing gapsmore » in the available information on the performance of macrofoam-swab sampling at low concentrations.« less

Form-Deprivation Myopia in Chick Induces Limited Changes in Retinal Gene Expression

PubMed Central

McGlinn, Alice M.; Baldwin, Donald A.; Tobias, John W.; Budak, Murat T.; Khurana, Tejvir S.; Stone, Richard A.

2007-01-01

Purpose Evidence has implicated the retina as a principal controller of refractive development. In the present study, the retinal transcriptome was analyzed to identify alterations in gene expression and potential signaling pathways involved in form-deprivation myopia of the chick. Methods One-week-old white Leghorn chicks wore a unilateral image-degrading goggle for 6 hours or 3 days (n = 6 at each time). Total RNA from the retina/(retinal pigment epithelium) was used for expression profiling with chicken gene microarrays (Chicken GeneChips; Affymetrix, Santa Clara, CA). To identify gene expression level differences between goggled and contralateral nongoggled eyes, normalized microarray signal intensities were analyzed by the significance analysis of microarrays (SAM) approach. Differentially expressed genes were validated by real-time quantitative reverse transcription–polymerase chain reaction (qPCR) in independent biological replicates. Results Small changes were detected in differentially expressed genes in form-deprived eyes. In chickens that had 6 hours of goggle wear, downregulation of bone morphogenetic protein 2 and connective tissue growth factor was validated. In those with 3 days of goggle wear, downregulation of bone morphogenetic protein 2, vasoactive intestinal peptide, preopro-urotensin II–related peptide and mitogen-activated protein kinase phosphatase 2 was validated, and upregulation of endothelin receptor type B and interleukin-18 was validated. Conclusions Form-deprivation myopia, in its early stages, is associated with only minimal changes in retinal gene expression at the level of the transcriptome. While the list of validated genes is short, each merits further study for potential involvement in the signaling cascade mediating myopia development. PMID:17652709

Esterification of fatty acids using nylon-immobilized lipase in n-hexane: kinetic parameters and chain-length effects.

PubMed

Zaidi, A; Gainer, J L; Carta, G; Mrani, A; Kadiri, T; Belarbi, Y; Mir, A

2002-02-28

The esterification of long-chain fatty acids in n-hexane catalyzed by nylon-immobilized lipase from Candida rugosa has been investigated. Butyl oleate (22 carbon atoms), oleyl butyrate (22 carbon atoms) and oleyl oleate (36 carbon atoms) were produced at maximum reaction rates of approximately equal to 60 mmol h(-1) g(-1) immobilized enzyme when the substrates were present in equimolar proportions at an initial concentration of 0.6 mol l(-1). The observed kinetic behavior of all the esterification reactions is found to follow a ping-pong bi-bi mechanism with competitive inhibition by both substrates. The effect of the chain-length of the fatty acids and the alcohols could be correlated to some mechanistic models, in accordance with the calculated kinetic parameters.

Copolymer Synthesis and Characterization by Post-Polymerization Modification

NASA Astrophysics Data System (ADS)

Galvin, Casey James

This PhD thesis examines the physical behavior of surface-grafted polymer assemblies (SGPAs) derived from post-polymerization modification (PPM) reactions in aqueous and vapor enriched environments, and offers an alternative method of creating SGPAs using a PPM approach. SGPAs comprise typically polymer chains grafted covalently to solid substrates. These assemblies show promise in a number of applications and technologies due to the stability imparted by the covalent graft and ability to modify interfacial properties and stability. SGPAs also offer a set of rich physics to explore in fundamental investigations as a result of confining macromolecules to a solid substrate. PPM reactions (also called polymer analogous reactions) apply small molecule organic chemistry reactions to the repeat units of polymer chains in order to generate new chemistries. By applying a PPM strategy to SGPAs, a wide variety of functional groups can be introduced into a small number of well-studied and well-behaved model polymer systems. This approach offers the advantage of holding constant other properties of the SGPA (e.g., molecular weight, MW, and grafting density, sigma) to isolate the effect of chemistry on physical behavior. Using a combination of PPM and fabrication methods that facilitate the formation of SPGAs with position-dependent gradual variation of sigma on flat impenetrable substrate, the influence of polymer chemistry and sigma is examined on the stability of weak polyelectrolyte brushes in aqueous environments at different pH levels. Degrafting of polymer chains in SGPAs exhibits a complex dependence on side chain chemistry, sigma, pH and the charge fraction (alpha) within the brush. Results of these experiments support a proposed mechanism of degrafting, wherein extension of the grafted chains away from the substrate generates tension along the polymer backbone, which activates the grafting chemistry for hydrolysis. The implications of these findings are important in developing technologies that use SGPAs in aqueous environments, and point to a need for potential alternative grafting chemistries. The behavior of SGPAs in vapor environments remains an underexplored phenomenon. By changing systematically the chemistry of SGPAs derived from a parent sample, the influence of side chain functional groups on the swelling of weak and strong polyelectrolyte brushes in the presence of water, methanol and ethanol vapors is explored. The extent of swelling and solvent uptake depends strongly on the chemistry in the polymer side chain and of the solvent. Despite bearing a permanent electrostatic charge in the side chain, the strong polyelectrolyte brushes exhibit no behavior typical of polyelectrolytes in water due to no dissociation of the counterion. Of particular interest is the behavior in humid environments of an SGPA bearing a zwitterionic group in its side chain, which results in exposure of electrostatic charges without counterions. Using substrates bearing the aforementioned sigma gradient of polymeric grafts, evidence of inter- and intramolecular complex formation is presented. Finally, a method of developing SGPAs by polymerizing bulk polymer chains through surface-grafted monomers (SGMs) is described. The SGMs are incorporated onto a solid substrate using the same PPM reaction employed in the degrafting and vapor swelling experiments, highlighting the versatility of PPM. The thickness of these SGPAs is correlated to the bulk polymer chains MW, suggesting this technique can be used in existing industrial bulk polymerization processes.

Apparatus and method for polymer synthesis using arrays

DOEpatents

Brennan, Thomas M.

1995-01-01

A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24) , and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31) , downstream from the nozzles (22) , sweeps the common chamber ( 31 ) of toxic fumes emitted by the reagents. Each reaction well (26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.

Apparatus and method for polymer synthesis using arrays

DOEpatents

Brennan, Thomas M.

1996-01-01

A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24), and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31), downstream from the nozzles (22), sweeps the common chamber (31) of toxic fumes emitted by the reagents. Each reaction well ( 26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82 ) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.

New polymer systems: Chain extension by dianhydrides

NASA Technical Reports Server (NTRS)

Rhein, R. A.; Ingham, J. D.

1974-01-01

Three anhydrides provide effective chain extension of hydroxy-terminated polyalkylene oxides and polybutadienes. Novel feature of these anhydride reactants is that they are difunctional as anhydrides, but they are tetrafunctional if conditions are selected that lead to total esterification or reaction of all carboxyl groups.

Structure-property relationships in a series of diglycerol tetraether model lipids and their lyotropic assemblies: the effect of branching topology and chirality.

PubMed

Markowski, Thomas; Drescher, Simon; Meister, Annette; Blume, Alfred; Dobner, Bodo

2014-06-14

Three novel diglycerol tetraether lipids with one membrane-spanning chain have been synthesized. These lipids contain only two or four racemic methyl branches at selected positions of the hydrophobic chains in contrast to natural lipids from archaebacterial membranes with an isoprenoid substitution pattern. The insertion of the methyl moieties was realized starting from either (RS)-citronellyl bromide or the inexpensive methyl malonic acid ethyl ester. For chain elongation the Cu-catalysed Grignard coupling reaction was used. The preparation of diglycerol tetraethers was either performed by condensing suitable blocked monoglycerol diethers by Grubbs metathesis or by reaction of the transmembrane C32-chain with blocked glycerols followed by further alkylation steps. Finally, we could show that the resulting lipids can form closed lipid vesicles comparable to the optically pure counterparts. Therefore, these much simpler lipids compared to the natural lipids from archaebacterial membranes are also suitable for preparation of stable tailored liposomes.

RICIN-inhibitor design. Final report, 15 April 1993-14 April 1996

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schramm, V.L.

1996-05-01

The purpose of this proposal was to provide information which will permit the design of transition state inhibitors for ricin A-chain. The original goals were to solve the transition state structure based on kinetic isotope effects. Substrates were synthesized and the conditions for assays optimized to provide catalytic rates at least 1000 fold greater than those published prior to this work. Reliable assay methods have been established to permit routine assays for ricin A-chain. Substrate analogues for N-ribohydrolase reactions have been designed to establish whether the reaction involves leaving-group activation or oxycarbonium ion formation. Based on these results, leaving groupmore » activation is a major contributor and oxycarbonium-ion formation is a secondary contribution in the mechanism of catalysis by ricin A-chain. Using this information, the first submicromolar inhibitor of ricin A-chain has been synthesized, tested and kinetically characterized. The development of powerful inhibitors will be a direct extrapolation of these results.« less

ε-Poly-L-lysine peptide chain length regulated by the linkers connecting the transmembrane domains of ε-Poly-L-lysine synthetase.

PubMed

Hamano, Yoshimitsu; Kito, Naoko; Kita, Akihiro; Imokawa, Yuuki; Yamanaka, Kazuya; Maruyama, Chitose; Katano, Hajime

2014-08-01

ε-Poly-l-lysine (ε-PL), consisting of 25 to 35 l-lysine residues with linkages between the α-carboxyl groups and ε-amino groups, is produced by Streptomyces albulus NBRC14147. ε-PL synthetase (Pls) is a membrane protein with six transmembrane domains (TM1 to TM6) as well as both an adenylation domain and a thiolation domain, characteristic of the nonribosomal peptide synthetases. Pls directly generates ε-PL chain length diversity (25- to 35-mer), but the processes that control the chain length of ε-PL during the polymerization reaction are still not fully understood. Here, we report on the identification of Pls amino acid residues involved in the regulation of the ε-PL chain length. From approximately 12,000 variants generated by random mutagenesis, we found 8 Pls variants that produced shorter chains of ε-PL. These variants have one or more mutations in two linker regions connecting the TM1 and TM2 domains and the TM3 and TM4 domains. In the Pls catalytic mechanism, the growing chain of ε-PL is not tethered to the enzyme, implying that the enzyme must hold the growing chain until the polymerization reaction is complete. Our findings reveal that the linker regions are important contributors to grasp the growing chain of ε-PL. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Polyphosphate kinase: demonstration that short chain polyphosphate serves as a primer for the enzymatic synthesis of polyphosphate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robinson, N.A.; Wood, H.G.

1986-05-01

Polyphosphate (poly(P)) kinase, isolated from Propionibacterium shermanii, catalyzes the following reaction: poly(P/sub n/) + ATPin equilibriumpoly(P/sub n+1/) + ADP. The authors have purified this enzyme to 90% homogeneity and have shown it to be composed of 2-3 identical subunits of M/sub r/ 80,000. Investigation of the reaction mechanism by product analysis has revealed that the elongation phase is processive whereby successive elongation occurs without release of intermediate sizes until very long chains are formed. The initiation phase of synthesis has been investigated using (/sup 32/P) poly(P) primer of chain length 11-60. It is incorporated into long chain poly(P) and themore » /sup 32/P has been shown, by use of poly(P) glucokinase, to be localized at the end of the molecule. Calculation of average chain length based upon the incorporation of /sup 32/P, however, yields a value approx.3 fold higher than the value calculated by another method using poly(P) glucokinase. This result indicates that initiation of poly(P) synthesis occurs by at least one other route which does not involve short chain poly(P) primers. The effect of temperature and concentration of poly(P) primer upon the average chain length of poly(P) synthesized was also investigated. A general trend was observed in which the chain length of the synthesized poly(P) decreased as either temperature or concentration or primer was increased.« less

[THE COMPARATIVE ANALYSIS OF EFFECTIVENESS OF QUICK TESTS IN DIAGNOSTIC OF INFLUENZA AND RESPIRATORY SYNCYTIAL VIRAL INFECTION IN CHILDREN].

PubMed

Petrova, E R; Sukhovetskaia, V P; Pisareva, M M; Maiorova, V G; Sverlova, M V; Danilenko, D M; Petrova, P A; Krivitskaia, V Z; Sominina, A A

2015-11-01

The analysis was implemented concerning diagnostic parameters of commercial quick tests (immune chromatographic tests BinaxNOW Influenza A&B and BinaxNow RSV Alere, Scarborough Inc., USA) under detection of antigens of influenza virus A and respiratory syncytial virus in clinical materials. The polymerase chain reaction in real-time and isolation ofviruses in cell cultures. The analysis of naso-pharyngeal smears from 116 children demonstrated that sensitivity and specifcity of detection of influenza virus A using device mariPOC in comparison with polymerase chain reaction made up to 93.8% and 99.0% correspondingly at total concordance of results of both techniques as 98.3%. At diagnosing of respiratory syncytial virus using device mariPOC parameters made up to 77.3%, 98.9% and 862% as compared with polymerase chain reaction. The sensitivity, specificity and total concordance of results of immune chromatographic tests BinaxNOW in comparison ofpolymerase chain reaction made up to 86.7%, 100% and 96.2% correspondingly at detection of influenza virus A and 80.9%, 97.4% and 91.6% correspondingly at detection of respiratory syncytial virus. In comparison with isolation technique in cell cultures sensitivity of system mariPOC and immune chromatographic tests proved to be in 1.3-1.4 times higher at detection of influenza virus A and in 1.7-2 times higher in case of isolation of respiratory syncytial virus. There is no statistically significant differences between diagnostic parameters received for mariPOC and immune chromatographic tests at diagnosing influenza virus A and respiratory syncytial viral infection.

Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

PubMed Central

Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

2010-01-01

Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

PubMed

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

2008-09-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

LETTER TO THE EDITOR: Single-species reactions on a random catalytic chain

NASA Astrophysics Data System (ADS)

Oshanin, G.; Burlatsky, S. F.

2002-11-01

We present an exact solution for a catalytically activated annihilation A + A → 0 reaction taking place on a one-dimensional chain in which some segments (placed at random, with mean concentration p) possess special, catalytic properties. An annihilation reaction takes place as soon as any two A particles land from the reservoir onto two vacant sites at the extremities of the catalytic segment, or when any A particle lands onto a vacant site on a catalytic segment while the site at the other extremity of this segment is already occupied by another A particle. We find that the disorder-average pressure P(quen) per site of such a chain is given by P(quen) = P(Lan) + β-1F, where P(Lan) = β-1 ln(1 + z) is the Langmuir adsorption pressure, (z being the activity and β-1 the temperature), while β-1F is the reaction-induced contribution, which can be expressed, under appropriate change of notation, as the Lyapunov exponent for the product of 2 × 2 random matrices, obtained exactly by Derrida and Hilhorst (1983 J. Phys. A: Math. Gen. 16 2641). Explicit asymptotic formulae for the particle mean density and the compressibility are also presented.

Molecular Machine Powered Surface Programmatic Chain Reaction for Highly Sensitive Electrochemical Detection of Protein.

PubMed

Zhu, Jing; Gan, Haiying; Wu, Jie; Ju, Huangxian

2018-04-17

A bipedal molecular machine powered surface programmatic chain reaction was designed for electrochemical signal amplification and highly sensitive electrochemical detection of protein. The bipedal molecular machine was built through aptamer-target specific recognition for the binding of one target protein with two DNA probes, which hybridized with surface-tethered hairpin DNA 1 (H1) via proximity effect to expose the prelocked toehold domain of H1 for the hybridization of ferrocene-labeled hairpin DNA 2 (H2-Fc). The toehold-mediated strand displacement reaction brought the electrochemical signal molecule Fc close to the electrode and meanwhile released the bipedal molecular machine to traverse the sensing surface by the surface programmatic chain reaction. Eventually, a large number of duplex structures of H1-H2 with ferrocene groups facing to the electrode were formed on the sensor surface to generate an amplified electrochemical signal. Using thrombin as a model target, this method showed a linear detection range from 2 pM to 20 nM with a detection limit of 0.76 pM. The proposed detection strategy was enzyme-free and allowed highly sensitive and selective detection of a variety of protein targets by using corresponding DNA-based affinity probes, showing potential application in bioanalysis.

Development and validation of sensitive real-time RT-PCR assay for broad detection of rabies virus.

PubMed

Faye, Martin; Dacheux, Laurent; Weidmann, Manfred; Diop, Sylvie Audrey; Loucoubar, Cheikh; Bourhy, Hervé; Sall, Amadou Alpha; Faye, Ousmane

2017-05-01

Rabies virus (RABV) remains one of the most important global zoonotic pathogens. RABV causes rabies, an acute encephalomyelitis associated with a high rate of mortality in humans and animals and affecting different parts of the world, particularly in Asia and Africa. Confirmation of rabies diagnosis relies on laboratory diagnosis, in which molecular techniques such as detection of viral RNA by reverse transcription polymerase chain reaction (RT-PCR) are increasingly being used. In this study, two real-time quantitative RT-PCR assays were developed for large-spectrum detection of RABV, with a focus on African isolates. The primer and probe sets were targeted highly conserved regions of the nucleoprotein (N) and polymerase (L) genes. The results indicated the absence of non-specific amplification and cross-reaction with a range of other viruses belonging to the same taxonomic family, i.e. Rhabdoviridae, as well as negative brain tissues from various host species. Analytical sensitivity ranged between 100 to 10 standard RNA copies detected per reaction for N-gene and L-gene assays, respectively. Effective detection and high sensitivity of these assays on African isolates showed that they can be successfully applied in general research and used in diagnostic process and epizootic surveillance in Africa using a double-check strategy. Copyright © 2017 Elsevier B.V. All rights reserved.

Molecular diagnostics of periodontitis.

PubMed

Korona-Głowniak, Izabela; Siwiec, Radosław; Berger, Marcin; Malm, Anna; Szymańska, Jolanta

2017-01-28

The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host's health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization) come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR), real-time polymerase chain reaction (real-time PCR), 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), as well as terminal restriction fragment length polymorphism (TRFLP) and next generation sequencing (NGS). The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.

Expression and mutational analysis of Cip/Kip family in early glottic cancer.

PubMed

Kim, D-K; Lee, J H; Lee, O J; Park, C H

2015-02-01

Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

Direct and quantitative detection of HIV-1 RNA in human plasma with a branched DNA signal amplification assay.

PubMed

Urdea, M S; Wilber, J C; Yeghiazarian, T; Todd, J A; Kern, D G; Fong, S J; Besemer, D; Hoo, B; Sheridan, P J; Kokka, R

1993-11-01

To determine the relative effect of sample matrix on the quantitation of HIV RNA in plasma. Two HIV-positive specimens were diluted into five and 10 different HIV-negative plasma samples, respectively. Branched DNA signal amplification technology and reverse-transcriptase polymerase chain reaction were used to measure the viral load. In one sample the viral load by polymerase chain reaction ranged from undetectable to 1.9 x 10(5) copies/ml, and the branched DNA results ranged from 2.6 x 10(4) to 4.2 x 10(4) HIV RNA equivalent/ml. In the other sample the corresponding figures were 6.3 x 10(4) to 5.5 x 10(5) copies/ml and 5.7 x 10(4) to 7.5 x 10(4) HIV RNA equivalents/ml. In contrast to reverse-transcriptase polymerase chain reaction the branched DNA signal amplification assay does not require a separate extraction step or enzymatic amplification of the target. Therefore this measurement is less affected by the sample matrix and the signal generated is directly proportional to the viral load.

Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

PubMed Central

Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

2006-01-01

Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

Identification of carriers among individuals recruited in the typhoid registry in Malaysia using stool culture, polymerase chain reaction, and dot enzyme immunoassay as detection tools.

PubMed

Chua, Ang Lim; Aziah, Ismail; Balaram, Prabha; Bhuvanendran, Saatheeyavaane; Anthony, Amy Amilda; Mohmad, Siti Norazura; Nasir, Norhafiza M; Hassan, Haslizai; Naim, Rochman; Meran, Lila P; Hussin, Hani M; Ismail, Asma

2015-03-01

Chronic carriers of Salmonella Typhi act as reservoirs for the organism and become the agents of typhoid outbreaks in a community. In this study, chronic carriers in Kelantan, Malaysia were first identified using the culture and polymerase chain reaction method. Then, a novel serological tool, designated Typhidot-C, was evaluated in retrospect using the detected individuals as control positives. Chronic carriage positive by the culture and polymerase chain reaction method was recorded at 3.6% (4 out of 110) among individuals who previously had acute typhoid fever and a 9.4% (10 out of 106) carriage rate was observed among food handlers screened during outbreaks. The Typhidot-C assay was able to detect all these positive carriers showing its potential as a viable carrier screening tool and can be used for efficient detection of typhoid carriers in an endemic area. These findings were used to establish the first carrier registry for S Typhi carriers in Malaysia. © 2012 APJPH.

Adaptation of a visualized loop-mediated isothermal amplification technique for field detection of Plasmodium vivax infection.

PubMed

Tao, Zhi-Yong; Zhou, Hua-Yun; Xia, Hui; Xu, Sui; Zhu, Han-Wu; Culleton, Richard L; Han, Eun-Taek; Lu, Feng; Fang, Qiang; Gu, Ya-Ping; Liu, Yao-Bao; Zhu, Guo-Ding; Wang, Wei-Ming; Li, Ju-Lin; Cao, Jun; Gao, Qi

2011-06-21

Loop-mediated isothermal amplification (LAMP) is a high performance method for detecting DNA and holds promise for use in the molecular detection of infectious pathogens, including Plasmodium spp. However, in most malaria-endemic areas, which are often resource-limited, current LAMP methods are not feasible for diagnosis due to difficulties in accurately interpreting results with problems of sensitive visualization of amplified products, and the risk of contamination resulting from the high quantity of amplified DNA produced. In this study, we establish a novel visualized LAMP method in a closed-tube system, and validate it for the diagnosis of malaria under simulated field conditions. A visualized LAMP method was established by the addition of a microcrystalline wax-dye capsule containing the highly sensitive DNA fluorescence dye SYBR Green I to a normal LAMP reaction prior to the initiation of the reaction. A total of 89 blood samples were collected on filter paper and processed using a simple boiling method for DNA extraction, and then tested by the visualized LAMP method for Plasmodium vivax infection. The wax capsule remained intact during isothermal amplification, and released the DNA dye to the reaction mixture only when the temperature was raised to the melting point following amplification. Soon after cooling down, the solidified wax sealed the reaction mix at the bottom of the tube, thus minimizing the risk of aerosol contamination. Compared to microscopy, the sensitivity and specificity of LAMP were 98.3% (95% confidence interval (CI): 91.1-99.7%) and 100% (95% CI: 88.3-100%), and were in close agreement with a nested polymerase chain reaction method. This novel, cheap and quick visualized LAMP method is feasible for malaria diagnosis in resource-limited field settings.

Ultrasensitive Single Fluorescence-Labeled Probe-Mediated Single Universal Primer-Multiplex-Droplet Digital Polymerase Chain Reaction for High-Throughput Genetically Modified Organism Screening.

PubMed

Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

2018-05-01

As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus".

PubMed

Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond

2018-01-01

Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.

Development of a duplex droplet digital PCR assay for absolute quantitative detection of "Candidatus Liberibacter asiaticus"

PubMed Central

Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg

2018-01-01

Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium “Candidatus Liberibacter asiaticus” (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer. PMID:29772016

Faster and economical screening for vancomycin-resistant enterococci by sequential use of chromogenic agar and real-time polymerase chain reaction.

PubMed

Tan, Thean Yen; Jiang, Boran; Ng, Lily Siew Yong

2017-08-01

Screening for vancomycin-resistant enterococci (VRE) by culture takes days to generate results, while polymerase chain reaction (PCR) testing directly from clinical specimens lacks specificity. The aims of this study were to develop a real-time PCR to detect and identify Enterococcus faecium, Enterococcus faecalis, and vanA and vanB genes, and to evaluate the impact of this PCR on test-reporting times when performing it directly from suspect VRE isolates present on screening chromogenic media. The tetraplex PCR primers were designed to amplify E. faecium, E. faecalis, and vanA and vanB genes, with melt-curve analysis of PCR products. Following analytical and clinical validation of the molecular assay, PCR testing was performed for target colonies present on VRE chromogenic media. PCR results were evaluated against conventional phenotypic identification and susceptibility testing, with the time to result being monitored for both modalities. A total of 519 colonies from clinical specimens were tested concurrently by real-time PCR and phenotypic methods. In all, 223 isolates were identified with phenotypic vancomycin resistance (vanA, n = 108; vanB, n = 105; non-vanA/vanB = 10), with complete agreement between PCR and phenotypic testing for vancomycin-resistant E. faecium and E. faecalis. The majority (88.6%) of PCR results were reported, on average, 24.8 hours earlier than those of phenotypic testing, with 68% reduction in total costs. The use of culture on selective media, followed by direct colony PCR confirmation allows faster and economical VRE screening. Copyright © 2015. Published by Elsevier B.V.

Detection of Histoplasma capsulatum in Organic Fertilizers by Hc100 Nested Polymerase Chain Reaction and Its Correlation with the Physicochemical and Microbiological Characteristics of the Samples.

PubMed

Gómez, Luisa F; Torres, Isaura P; Jiménez-A, María Del Pilar; McEwen, Juan Gmo; de Bedout, Catalina; Peláez, Carlos A; Acevedo, José M; Taylor, María L; Arango, Myrtha

2018-05-01

Histoplasma capsulatum is the causative agent of histoplasmosis and this fungus inhabits soils rich in phosphorus and nitrogen that are enriched with bird and bat manure. The replacement of organic matter in agroecosystems is necessary in the tropics, and the use of organic fertilizers has increased. Cases and outbreaks due to the presence of the fungus in these components have been reported. The Instituto Colombiano Agropecuario resolution 150 of 2003 contains the parameters set by the Colombian Technical Standard (NTC 5167) on the physicochemical and microbiological features of fertilizers, but it does not regulate the search for H. capsulatum . The aim of this study was to demonstrate H. capsulatum presence in organic fertilizers by nested polymerase chain reaction (PCR). A total of 239 samples were collected: 201 (84.1%) corresponded to organic fertilizers, 30 (12.5%) to bird excrement, and 8 (3.4%) to cave soils. The Hc100 nested PCR had a detection limit of 0.1 pg/µL and a specificity of 100%. A total of 25 (10.5%) samples were positive and validated by sequencing. Seven of the positive samples represented locations where H. capsulatum was previously detected, suggesting the persistence of the fungus. No significant correlations were detected between the physicochemical and microbiological parameters with the presence of H. capsulatum by nested PCR, indicating the fungus existence in organic fertilizers that complied with the NTC 5167. The Hc100 nested PCR targeting H. capsulatum standardized in this work will improve the evaluation of organic fertilizers and ensure the prevention of outbreaks and cases due to manufacturing, marketing, and use of fertilizers contaminated with H. capsulatum .

Potential testing of reprocessing procedures by real-time polymerase chain reaction: A multicenter study of colonoscopy devices.

PubMed

Valeriani, Federica; Agodi, Antonella; Casini, Beatrice; Cristina, Maria Luisa; D'Errico, Marcello Mario; Gianfranceschi, Gianluca; Liguori, Giorgio; Liguori, Renato; Mucci, Nicolina; Mura, Ida; Pasquarella, Cesira; Piana, Andrea; Sotgiu, Giovanni; Privitera, Gaetano; Protano, Carmela; Quattrocchi, Annalisa; Ripabelli, Giancarlo; Rossini, Angelo; Spagnolo, Anna Maria; Tamburro, Manuela; Tardivo, Stefano; Veronesi, Licia; Vitali, Matteo; Romano Spica, Vincenzo

2018-02-01

Reprocessing of endoscopes is key to preventing cross-infection after colonoscopy. Culture-based methods are recommended for monitoring, but alternative and rapid approaches are needed to improve surveillance and reduce turnover times. A molecular strategy based on detection of residual traces from gut microbiota was developed and tested using a multicenter survey. A simplified sampling and DNA extraction protocol using nylon-tipped flocked swabs was optimized. A multiplex real-time polymerase chain reaction (PCR) test was developed that targeted 6 bacteria genes that were amplified in 3 mixes. The method was validated by interlaboratory tests involving 5 reference laboratories. Colonoscopy devices (n = 111) were sampled in 10 Italian hospitals. Culture-based microbiology and metagenomic tests were performed to verify PCR data. The sampling method was easily applied in all 10 endoscopy units and the optimized DNA extraction and amplification protocol was successfully performed by all of the involved laboratories. This PCR-based method allowed identification of both contaminated (n = 59) and fully reprocessed endoscopes (n = 52) with high sensibility (98%) and specificity (98%), within 3-4 hours, in contrast to the 24-72 hours needed for a classic microbiology test. Results were confirmed by next-generation sequencing and classic microbiology. A novel approach for monitoring reprocessing of colonoscopy devices was developed and successfully applied in a multicenter survey. The general principle of tracing biological fluids through microflora DNA amplification was successfully applied and may represent a promising approach for hospital hygiene. Copyright © 2018 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

Tools to minimize interlaboratory variability in vitellogenin gene expression monitoring programs

USGS Publications Warehouse

Jastrow, Aaron; Gordon, Denise A.; Auger, Kasie M.; Punska, Elizabeth C.; Arcaro, Kathleen F.; Keteles, Kristen; Winkelman, Dana L.; Lattier, David; Biales, Adam; Lazorchak, James M.

2017-01-01

The egg yolk precursor protein vitellogenin is widely used as a biomarker of estrogen exposure in male fish. However, standardized methodology is lacking and little is known regarding the reproducibility of results among laboratories using different equipment, reagents, protocols, and data analysis programs. To address this data gap we tested the reproducibility across laboratories to evaluate vitellogenin gene (vtg) expression and assessed the value of using a freely available software data analysis program. Samples collected from studies of male fathead minnows (Pimephales promelas) exposed to 17α-ethinylestradiol (EE2) and minnows exposed to processed wastewater effluent were evaluated for vtg expression in 4 laboratories. Our results indicate reasonable consistency among laboratories if the free software for expression analysis LinRegPCR is used, with 3 of 4 laboratories detecting vtg in fish exposed to 5 ng/L EE2 (n = 5). All 4 laboratories detected significantly increased vtg levels in 15 male fish exposed to wastewater effluent compared with 15 male fish held in a control stream. Finally, we were able to determine that the source of high interlaboratory variability from complementary deoxyribonucleic acid (cDNA) to quantitative polymerase chain reaction (qPCR) analyses was the expression analysis software unique to each real-time qPCR machine. We successfully eliminated the interlaboratory variability by reanalyzing raw fluorescence data with independent freeware, which yielded cycle thresholds and polymerase chain reaction (PCR) efficiencies that calculated results independently of proprietary software. Our results suggest that laboratories engaged in monitoring programs should validate their PCR protocols and analyze their gene expression data following the guidelines established in the present study for all gene expression biomarkers. 

Rapid detection of the Vibrio cholerae ctx gene in food enrichments using real-time polymerase chain reaction.

PubMed

Fedio, Willis; Blackstone, George M; Kikuta-Oshima, Lynne; Wendakoon, Chitra; McGrath, Timothy H; DePaola, Angelo

2007-01-01

A real-time polymerase chain reaction (qPCR) assay for the detection of the ctxA gene of toxigenic Vibrio cholerae (Vc) was validated against standard culture techniques. The first experimental phase determined optimal enrichment conditions for detection by culture and qPCR of Vc in shrimp, bottled water, milk, and potato salad. The conditions tested included temperature (35 and 42 degrees C), time (6 and 18 h), and effect of shaking (0 and 100 rpm). No definitive trends were found with enrichment temperature or shaking on Vc isolation frequency or detection by qPCR. Generally, Vc was detected by qPCR more frequently than Vc was isolated, but this difference was significant only in the 35 degrees C 6 h enrichment without shaking. In the second phase of experiments, shrimp, bottled water, milk, potato salad, and oysters were inoculated with each of 3 toxigenic Vc strains (Latin American O1 strain, an O139 strain, and an O1 strain from the U.S. Gulf Coast) and enriched under static conditions at 42OC for 6 and 18 h. Overall, detection frequency of ctx by qPCR was 98% (88/90) and 100% (90/90) after 6 and 18 h enrichments, respectively, while Vc isolation frequency was 87% (78/90) and 83% (75/90) after 6 and 18 h, respectively. Toxigenic Vc can be detected by qPCR within an 8 h work day using the 6 h enrichment procedure, assuming an initial level of at least 1-2 colony-forming units/g; however, overnight enrichment may be necessary to detect lower levels. These data indicate that the qPCR assay for ctx is a more reliable, sensitive, and rapid alternative to standard Vc culture methods and is applicable to diverse food products.

Combination of p16(INK4a) /Ki67 immunocytology and HPV polymerase chain reaction for the noninvasive analysis of HPV involvement in head and neck cancer.

PubMed

Linxweiler, Maximilian; Bochen, Florian; Wemmert, Silke; Lerner, Cornelia; Hasenfus, Andrea; Bohle, Rainer Maria; Al-Kadah, Basel; Takacs, Zoltan Ferenc; Smola, Sigrun; Schick, Bernhard

2015-04-01

High-risk human papillomavirus (HPV) infection has been identified as a relevant risk for the development of head and neck squamous cell carcinomas (HNSCCs). As HPV status has also gained a role as a prognostic and predictive biomarker for this entity, there is a growing demand for valid HPV testing in HNSCC patients Liquid-based cytological smears from 45 HNSCC and 20 control patients were collected and used for simultaneous immunocytochemical p16(INK4a) /Ki67 staining using a CINtec PLUS kit after the presence of tumor cells was verified in a Papanicolaou-stained slide. The same cytological suspension was used for the detection of HPV DNA by specific polymerase chain reaction (PCR). Tumor cells were detected in the swab material of 44 HNSCC patients corresponding to a sensitivity of 98% (44 of 45). PCR analysis revealed the presence of HPV DNA in the cytological suspension of 13 patients (13 of 65, 20%) with simultaneous p16(INK4a) /Ki67 expression by the tumor cells in 11 of these HPV DNA-positive samples (11 of 13, 85%) - a staining pattern that is strongly associated with a carcinogenic HPV infection. A simultaneous immunocytochemical detection of p16(INK4a) and Ki67 can reliably be performed on liquid-based cytological smears from HNSCC patients using a CINtec PLUS kit. In addition, the same cytological material can be used for the detection of HPV DNA by specific PCR. The combined results of both techniques enable better discrimination between latent and carcinogenic HPV infections as well as HPV-negative cases and thus can provide information on the prognosis of HNSCC patients and facilitate therapeutic decisions. © 2014 American Cancer Society.

Coxiellosis in domestic livestock of Puducherry and Tamil Nadu: Detection of Coxiella burnetii DNA by polymerase chain reaction in slaughtered ruminants

PubMed Central

Pradeep, Jothimani; Stephen, Selvaraj; Pooja, Pratheesh; Akshayavardhini, Anbalagan; Sangeetha, Balakrishnan; Antony, Prabakar Xavier

2017-01-01

Background and Aim:: In the course of our Indian Council of Medical Research project on coxiellosis in Puducherry and Tamil Nadu, 5.64% goat, 1.85% sheep, 1.06% buffaloes, and 0.97% cattle were positive for Coxiella burnetii antibodies by enzyme linked immunosorbent assay kit (IDEXX, Liebefeld, Switzerland). In this preliminary study, we have proceeded to look for C. burnetii DNA in those antibody positive specimens employing an imported commercial C. burnetii polymerase chain reaction (PCR) kit. Materials and Methods:: Blood samples were collected during slaughtering. All 15 blood samples of antibody positive ruminants and three antibody negative samples were subjected to conventional Trans-PCR assay with a commercial PCR kit (Genekam Biotechnology AG, Duisburg, Germany). An in-house Trans-PCR was included in the study for comparison. Results:: A total of 15 antibody positive and three antibody-negative serum samples belonging to 11 goat, 4 sheep, 1 cattle, and 2 buffaloes were tested in duplicate for the presence of C. burnetii DNA by the commercial agar gel PCR kit and an in-house Trans-PCR. Only one buffalo serum sample was positive for C. burnetii with a band at 243 bp in in-house Trans-PCR. Discussion:: Seropositivity for C. burnetii need not necessarily translate into infectivity status of the animal. Conversely, seronegative ruminants can shed C. burnetii. Rapid disintegration of C. burnetii DNA during the storage period is an important impediment in QF-PCR research. This is the first time the performance of this commercial PCR kit is being validated in India. Conclusion:: Commercial PCR kit, Genekam did not identify any positive sample, probably because it targeted a larger amplicon of 687 bp. PMID:28717320

Identification and Characterization of Liver MicroRNAs of the Chinese Tree Shrew via Deep Sequencing.

PubMed

Feng, Yue; Feng, Yue-Mei; Feng, Yang; Lu, Caixia; Liu, Li; Sun, Xiaomei; Dai, Jiejie; Xia, Xueshan

2015-10-01

Chinese tree shrew (Tupaia belangeri chinensis) is a small animal that possess many features, which are valuable in biomedical research, as experimental models. Currently, there are numerous attempts to utilize tree shrews as models for hepatitis C virus (HCV) infection. This study aimed to construct a liver microRNA (miRNA) data of the tree shrew. Three second filial generation tree shrews were used in this study. Total RNA was extracted from each liver of the tree shrew and equal quality mixed, then reverse-transcribed to complementary DNA (cDNA). The cDNAs were amplified by polymerase chain reaction and subjected to high-throughput sequencing. A total of 2060 conserved miRNAs were identified through alignment with the mature miRNAs in miRBase 20.0 database. The gene ontology and Kyoto encyclopedia of genes and genomes analyses of the target genes of the miRNAs revealed several candidate miRNAs, genes and pathways that may involve in the process of HCV infection. The abundance of miR-122 and Let-7 families and their other characteristics provided us more evidences for the utilization of this animal, as a potential model for HCV infection and other related biomedical research. Moreover, 80 novel microRNAs were predicted using the software Mireap. The top 3 abundant miRNAs were validated in other tree samples, based on stem-loop quantitative reverse transcription-polymerase chain reaction. According to the liver microRNA data of Chinese tree shrew, characteristics of the miR-122 and Let-7 families further highlight the suitability of tree shrew as the animal model in HCV research.

Absence of Bacteria on Coronary Angioplasty Balloons from Unselected Patients: Results with Use of a High Sensitivity Polymerase Chain Reaction Assay

PubMed Central

Hansen, Gorm Mørk; Nilsson, Martin; Nielsen, Claus Henrik; Holmstrup, Palle; Helqvist, Steffen; Tolker-Nielsen, Tim; Givskov, Michael; Hansen, Peter Riis

2015-01-01

Periodontitis is a chronic, bacterially-induced inflammatory disease of the tooth-supporting tissues, which may result in transient bacteremia and a systemic inflammatory response. Periodontitis is associated with coronary artery disease independently of established cardiovascular risk factors, and translocation of bacteria from the oral cavity to the coronary arteries may play a role in the development of coronary artery disease. Very few studies have used angioplasty balloons for in vivo sampling from diseased coronary arteries, and with varying results. Therefore, the aim of this study was to assess if bacterial DNA from primarily oral bacteria could be detected on coronary angioplasty balloons by use of an optimized sampling process combined with an internally validated sensitive polymerase chain reaction (PCR) assay. Coronary angioplasty balloons and control samples from a total of 45 unselected patients with stable angina, unstable angina/non-ST elevation myocardial infarction, and ST-elevation myocardial infarction (n = 15 in each group) were collected and analyzed using a PCR assay with high sensitivity and specificity for 16S rRNA genes of the oral microbiome. Despite elimination of extraction and purification steps, and demonstration of sensitivity levels of 25–125 colony forming units (CFU), we did not detect bacterial DNA from any of the coronary angioplasty balloons. A subsequent questionnaire indicated that the prevalence of periodontitis in the study cohort was at least 39.5%. Although coronary angioplasty balloons are unlikely to be useful for detection of bacteria with current PCR techniques in unselected patients with coronary artery disease, more studies are warranted to determine the extent to which bacteria contribute to atherosclerosis and its clinical manifestations and whether the presence of bacteria in the arteries is a transient phenomenon. PMID:26695491

Synthetic neutron camera and spectrometer in JET based on AFSI-ASCOT simulations

NASA Astrophysics Data System (ADS)

Sirén, P.; Varje, J.; Weisen, H.; Koskela, T.; contributors, JET

2017-09-01

The ASCOT Fusion Source Integrator (AFSI) has been used to calculate neutron production rates and spectra corresponding to the JET 19-channel neutron camera (KN3) and the time-of-flight spectrometer (TOFOR) as ideal diagnostics, without detector-related effects. AFSI calculates fusion product distributions in 4D, based on Monte Carlo integration from arbitrary reactant distribution functions. The distribution functions were calculated by the ASCOT Monte Carlo particle orbit following code for thermal, NBI and ICRH particle reactions. Fusion cross-sections were defined based on the Bosch-Hale model and both DD and DT reactions have been included. Neutrons generated by AFSI-ASCOT simulations have already been applied as a neutron source of the Serpent neutron transport code in ITER studies. Additionally, AFSI has been selected to be a main tool as the fusion product generator in the complete analysis calculation chain: ASCOT - AFSI - SERPENT (neutron and gamma transport Monte Carlo code) - APROS (system and power plant modelling code), which encompasses the plasma as an energy source, heat deposition in plant structures as well as cooling and balance-of-plant in DEMO applications and other reactor relevant analyses. This conference paper presents the first results and validation of the AFSI DD fusion model for different auxiliary heating scenarios (NBI, ICRH) with very different fast particle distribution functions. Both calculated quantities (production rates and spectra) have been compared with experimental data from KN3 and synthetic spectrometer data from ControlRoom code. No unexplained differences have been observed. In future work, AFSI will be extended for synthetic gamma diagnostics and additionally, AFSI will be used as part of the neutron transport calculation chain to model real diagnostics instead of ideal synthetic diagnostics for quantitative benchmarking.

A single-step polymerase chain reaction for simultaneous detection and differentiation of nontypeable and serotypeable Haemophilus influenzae, Moraxella catarrhalis and Streptococcus pneumoniae.

PubMed

Kunthalert, Duangkamol; Henghiranyawong, Kritsada; Sistayanarain, Anchalee; Khoothiam, Krissana

2013-02-01

The critically high prevalence of bacterial otitis media worldwide has prompted a proper disease management. While vaccine development for otitis media is promising, the reliable and effective methods for diagnosis of such etiologic agents are of importance. We developed a multiplex polymerase chain reaction assay for simultaneous detection and differentiation of nontypeable and serotypeable Haemophilus influenzae, Moraxella catarrhalis and Streptococcus pneumoniae. Five primer pairs targeting genes fumarate reductase (H. influenzae), outer membrane protein B (M. catarrhalis), major autolysin (S. pneumoniae), capsulation-associated BexA protein (all encapsulated H. influenzae) and 16S rRNA were incorporated in this single-step PCR. Validation of the multiplex PCR was also performed on clinical isolates. The developed multiplex PCR was highly specific, enabling the detection of the target pathogens in a specific manner, either individually or as a mixture of all target organisms. The assay was also found to be sensitive with the lowest detection limit of 1 ng of bacterial DNA. When applied to clinical isolates from diverse specimen sources, the multiplex PCR developed in this study correctly identified each microorganism individually or in a combination of two or more target organisms. All results matched with conventional culture identification. In addition, the ability of such assay to differentiate H. influenzae encapsulation from the study clinical isolates was 100%. Our multiplex PCR provides a rapid and accurate diagnostic tool for detection of the 4 target organisms. Such assay would serve as a useful tool for clinicians and epidemiologists in their efforts to the proper treatment and disease management caused by these organisms. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Real-time reverse transcription-polymerase chain reaction assays for identification of wild poliovirus 1 & 3.

PubMed

Sharma, Deepa K; Nalavade, Uma P; Deshpande, Jagadish M

2015-10-01

The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolated in India since 2000. The specificity of the rRT-PCR assays was evaluated using WPV1 and WPV3 of different genetic lineages, non-polio enteroviruses (NPEVs) and mixtures of wild/wild and wild/Sabin vaccine strains. The sensitivity of the assays was determined by testing serial 10-fold dilutions of wild poliovirus 1 and 3 stock suspensions of known titre. No cross-reactivity with Sabin strains, intertypic wild poliovirus isolates or 27 types of NPEVs across all the four Enterovirus species was found for both the wild poliovirus 1 and 3 rRT-PCR assays. All WPV1 and WPV3 strains isolated since 2000 were successfully amplified. The rRT-PCR assays detected 10 4.40 CCID 50 /ml of WPV1 and 10 4.00 CCID 50 /ml of WPV3, respectively either as single isolate or mixture with Sabin vaccine strains or intertypic wild poliovirus. rRT-PCR assays for WPV1 and WPV3 have been validated to detect all the genetic variations of the WPV1 and WPV3 isolated in India for the last decade. When used in combination with the current rRT-PCR assay testing was complete for confirmation of the presence of wild poliovirus in intratypic mixtures.

Development of a microRNA-based molecular assay for the detection of papillary thyroid carcinoma in aspiration biopsy samples.

PubMed

Mazeh, Haggi; Mizrahi, Ido; Halle, David; Ilyayev, Nadia; Stojadinovic, Alexander; Trink, Barry; Mitrani-Rosenbaum, Stella; Roistacher, Marina; Ariel, Ilana; Eid, Ahmed; Freund, Herbert R; Nissan, Aviram

2011-02-01

Although thyroid nodules are common and diagnosed in over 5% of the adult population, only 5% harbor malignancy. Patients with clinically suspicious thyroid nodules need to undergo fine-needle aspiration biopsy (FNAB). The main limitation of FNAB remains indeterminate cytopathology. Only 20%-30% of the indeterminate nodules harbor malignancy, and therefore up to 80% of patients undergo unnecessary thyroidectomy. The aim of this study was to identify and validate a panel of microRNAs (miRNAs) that could serve as a platform for an FNAB-based diagnostic for thyroid neoplasms. The study population included 27 consecutive patients undergoing total thyroidectomy for FNAB-based papillary thyroid cancer (n = 20) and benign disorders (n = 7). Aspiration biopsy was performed from the index lesion and from the opposite lobe normal tissue in all study patients at the time of operation. RNA was extracted from all aspiration biopsy samples. Quantitative polymerase chain reaction on a panel of previously selected miRNAs was performed. Polymerase chain reaction results were compared with final histopathology. miRNA from tumor tissues was amplified using the highest value of each miRNA expression in normal tissue as a threshold for malignancy detection. Diagnostic characteristics were most favorable for mir-221 in differentiating benign from malignant thyroid pathology. mir-221 was overexpressed in 19 patients (p < 0.0001) with a sensitive yield of 95%. Specificity, negative and positive predictive value, and accuracy of the miRNA panel were 100%, 96%, 100%, and 98%, respectively. miRNA quantification for differential diagnosis of thyroid neoplasms within aspiration biopsy samples is feasible and may improve the accuracy of FNAB cytology.

Regulator of calcineurin 1 controls growth plasticity of adult pancreas.

PubMed

Gurda, Grzegorz T; Crozier, Stephen J; Ji, Baoan; Ernst, Stephen A; Logsdon, Craig D; Rothermel, Beverly A; Williams, John A

2010-08-01

Growth of exocrine pancreas is regulated by gastrointestinal hormones, notably cholecystokinin (CCK). CCK-driven pancreatic growth requires calcineurin (CN), which activates Nuclear Factor of Activated T cells (NFATs), but the genetic underpinnings and feedback mechanisms that regulate this response are not known. Pancreatic growth was stimulated by protease inhibitor (PI)-containing chow, which induces secretion of endogenous CCK. Expression profiling of PI stimulation was performed on Affymetrix 430A chips, and CN was inhibited via FK506. Exocrine pancreas-specific overexpression of CN inhibitor Regulator of Calcineurin 1 (Rcan1) was achieved by breeding elastase-Cre(estrogen receptor [ER]) transgenics with "flox-on" Rcan1 mice. CN inhibitor FK506 blocked expression of 38 genes, as confirmed by quantitative polymerase chain reaction. The CN-dependent genes were linked to growth-related processes, whereas their promoters were enriched in NFAT and NFAT/AP1 sites. Multiple NFAT targets, including Rcan1, Rgs2, HB-EGF, Lif, and Gem, were validated by chromatin immunoprecipitation. One of these, a CN feedback inhibitor Rcan1, was induced >50 fold during 1-8 hours course of pancreatic growth and strongly inhibited (>99%) by FK506. To examine its role in pancreatic growth, we overexpressed Rcan1 in an inducible, acinar-specific fashion. Rcan1 overexpression inhibited CN-NFAT signaling, as shown using an NFAT-luciferase reporter and quantitative polymerase chain reaction. Most importantly, the increase in exocrine pancreas size, protein/DNA content, and acinar proliferation were all blocked in Rcan1 overexpressing mice. We profile adaptive pancreatic growth, identify Rcan1 as an important new feedback regulator, and firmly establish that CN-NFAT signaling is required for this response. Copyright (c) 2010 AGA Institute. Published by Elsevier Inc. All rights reserved.

Predictive Modeling for the Growth of Salmonella Enteritidis in Chicken Juice by Real-Time Polymerase Chain Reaction.

PubMed

Noviyanti, Fia; Hosotani, Yukie; Koseki, Shigenobu; Inatsu, Yasuhiro; Kawasaki, Susumu

2018-04-02

The goals of this study were to monitor the growth kinetics of Salmonella Enteritidis in chicken juice using real-time polymerase chain reaction (PCR) and to evaluate its efficacy by comparing the results with an experimental database. Salmonella Enteritidis was inoculated in chicken juice samples at an initial inoculum of 10 4 CFU/mL with inoculated samples incubated at six different temperatures (10, 15, 20, 25, 30, and 35°C). Sampling was carried out for 36 h to observe the growth of Salmonella Enteritidis. The total DNA was extracted from the samples, and the copy number of the Salmonella invasion gene (invA) was quantified by real-time PCR and converted to Salmonella Enteritidis cell concentration. Growth kinetics data were analyzed by the Baranyi and Roberts model to obtain growth parameters, whereas the Ratkowsky's square-root model was used to describe the effect of the interactions between growth parameters and temperature on the growth of Salmonella Enteritidis. The growth parameters of Salmonella Enteritidis obtained from an experiment conducted at a constant temperature were validated with growth data from chicken juice samples that were incubated under fluctuating temperature conditions between 5°C and 30°C for 30-min periods. A high correlation was observed between maximum growth rate (μ max ) and storage temperature, indicating that the real-time PCR-monitoring method provides a precise estimation of Salmonella Enteritidis growth in food material with a microbial flora. Moreover, the μ max data reflected data from microbial responses viewer database and ComBase. The results of this study suggested that real-time PCR monitoring provides a precise estimation of Salmonella Enteritidis growth in food materials with a background microbial flora.

Quantitative fluorescent polymerase chain reaction for rapid prenatal diagnosis of fetal aneuploidies in chorionic villus sampling in a single institution

PubMed Central

Shin, You Jung; Kim, Do Jin; Ryu, Hyun Mee; Kim, Moon Young; Han, Jung Yeol; Choi, June Seek

2016-01-01

Objective To validate quantitative fluorescent polymerase chain reaction (QF-PCR) via chorionic villus sampling (CVS) for the diagnosis of fetal aneuploidies. Methods We retrospectively reviewed the medical records of consecutive pregnant women who had undergone CVS at Cheil General Hospital between December 2009 and June 2014. Only cases with reported QF-PCR before long-term culture (LTC) for conventional cytogenetic analysis were included, and the results of these two methods were compared. Results A total of 383 pregnant women underwent QF-PCR and LTC via CVS during the study period and 403 CVS specimens were collected. The indications of CVS were as follows: abnormal first-trimester ultrasonographic findings, including increased fetal nuchal translucency (85.1%), advanced maternal age (6.8%), previous history of fetal anomalies (4.2%), and positive dual test results for trisomy 21 (3.9%). The results of QF-PCR via CVS were as follows: 76 (18.9%) cases were identified as trisomy 21 (36 cases), 18 (33 cases), or 13 (seven cases), and 4 (1.0%) cases were suspected to be mosaicism. All results of common autosomal trisomies by QF-PCR were consistent with those of LTC and there were no false-positive findings. Four cases suspected as mosaicism in QF-PCR were confirmed as non-mosaic trisomies of trisomy 21 (one case) or trisomy 18 (three cases) in LTC. Conclusion QF-PCR via CVS has the advantage of rapid prenatal screening at an earlier stage of pregnancy for common chromosomal trisomies and thus can reduce the anxiety of parents. In particular, it can be helpful for pregnant women with increased fetal nuchal translucency or abnormal first-trimester ultrasonographic findings. PMID:27896246

Nanobarcoding: detecting nanoparticles in biological samples using in situ polymerase chain reaction

PubMed Central

Eustaquio, Trisha; Leary, James F

2012-01-01

Background Determination of the fate of nanoparticles (NPs) in a biological system, or NP biodistribution, is critical in evaluating an NP formulation for nanomedicine. Current methods to determine NP biodistribution are greatly inadequate, due to their limited detection thresholds. Herein, proof of concept of a novel method for improved NP detection based on in situ polymerase chain reaction (ISPCR), coined “nanobarcoding,” is demonstrated. Methods Nanobarcoded superparamagnetic iron oxide nanoparticles (NB-SPIONs) were characterized by dynamic light scattering, zeta potential, and hyperspectral imaging measurements. Cellular uptake of Cy5-labeled NB-SPIONs (Cy5-NB-SPIONs) was imaged by confocal microscopy. The feasibility of the nanobarcoding method was first validated by solution-phase PCR and “pseudo”-ISPCR before implementation in the model in vitro system of HeLa human cervical adenocarcinoma cells, a cell line commonly used for ISPCR-mediated detection of human papilloma virus (HPV). Results Dynamic light-scattering measurements showed that NB conjugation stabilized SPION size in different dispersion media compared to that of its precursor, carboxylated SPIONs (COOH-SPIONs), while the zeta potential became more positive after NB conjugation. Hyperspectral imaging confirmed NB conjugation and showed that the NB completely covered the SPION surface. Solution-phase PCR and pseudo-ISPCR showed that the expected amplicons were exclusively generated from the NB-SPIONs in a dose-dependent manner. Although confocal microscopy revealed minimal cellular uptake of Cy5-NB-SPIONs at 50 nM over 24 hours in individual cells, ISPCR detected definitive NB-SPION signals inside HeLa cells over large sample areas. Conclusion Proof of concept of the nanobarcoding method has been demonstrated in in vitro systems, but the technique needs further development before its widespread use as a standardized assay. PMID:23144562

Clinical utility of an epigenetic assay to detect occult prostate cancer in histopathologically negative biopsies: results of the MATLOC study.

PubMed

Stewart, Grant D; Van Neste, Leander; Delvenne, Philippe; Delrée, Paul; Delga, Agnès; McNeill, S Alan; O'Donnell, Marie; Clark, James; Van Criekinge, Wim; Bigley, Joseph; Harrison, David J

2013-03-01

Concern about possible false-negative prostate biopsy histopathology findings often leads to rebiopsy. A quantitative methylation specific polymerase chain reaction assay panel, including GSTP1, APC and RASSF1, could increase the sensitivity of detecting cancer over that of pathological review alone, leading to a high negative predictive value and a decrease in unnecessary repeat biopsies. The MATLOC study blindly tested archived prostate biopsy needle core tissue samples of 498 subjects from the United Kingdom and Belgium with histopathologically negative prostate biopsies, followed by positive (cases) or negative (controls) repeat biopsy within 30 months. Clinical performance of the epigenetic marker panel, emphasizing negative predictive value, was assessed and cross-validated. Multivariate logistic regression was used to evaluate all risk factors. The epigenetic assay performed on the first negative biopsies of this retrospective review cohort resulted in a negative predictive value of 90% (95% CI 87-93). In a multivariate model correcting for patient age, prostate specific antigen, digital rectal examination and first biopsy histopathological characteristics the epigenetic assay was a significant independent predictor of patient outcome (OR 3.17, 95% CI 1.81-5.53). A multiplex quantitative methylation specific polymerase chain reaction assay determining the methylation status of GSTP1, APC and RASSF1 was strongly associated with repeat biopsy outcome up to 30 months after initial negative biopsy in men with suspicion of prostate cancer. Adding this epigenetic assay could improve the prostate cancer diagnostic process and decrease unnecessary repeat biopsies. Copyright © 2013 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Multiplex qRT-PCR for the Detection of Western Equine Encephalomyelitis, St. Louis Encephalitis, and West Nile Viral RNA in Mosquito Pools (Diptera: Culicidae).

PubMed

Brault, Aaron C; Fang, Ying; Reisen, William K

2015-05-01

Following the introduction of West Nile virus into California during the summer of 2003, public health and vector control programs expanded surveillance efforts and were in need of diagnostics capable of rapid, sensitive, and specific detection of arbovirus infections of mosquitoes to inform decision support for intervention. Development of a multiplex TaqMan or real-time semiquantitative reverse transcription polymerase chain reaction (RT-PCR) assay in which three virus specific primer-probe sets were used in the same reaction is described herein for the detection of western equine encephalomyelitis, St. Louis encephalitis and West Nile viral RNA. Laboratory validation and field data from 10 transmission seasons are reported. The comparative sensitivity and specificity of this multiplex assay to singleplex RT-PCR as well as an antigen detection (rapid analyte measurement platform) and standard plaque assays indicate this assay to be rapid and useful in providing mosquito infection data to estimate outbreak risk. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Development and validation of a multiplex real-time PCR method to simultaneously detect 47 targets for the identification of genetically modified organisms.

PubMed

Cottenet, Geoffrey; Blancpain, Carine; Sonnard, Véronique; Chuah, Poh Fong

2013-08-01

Considering the increase of the total cultivated land area dedicated to genetically modified organisms (GMO), the consumers' perception toward GMO and the need to comply with various local GMO legislations, efficient and accurate analytical methods are needed for their detection and identification. Considered as the gold standard for GMO analysis, the real-time polymerase chain reaction (RTi-PCR) technology was optimised to produce a high-throughput GMO screening method. Based on simultaneous 24 multiplex RTi-PCR running on a ready-to-use 384-well plate, this new procedure allows the detection and identification of 47 targets on seven samples in duplicate. To comply with GMO analytical quality requirements, a negative and a positive control were analysed in parallel. In addition, an internal positive control was also included in each reaction well for the detection of potential PCR inhibition. Tested on non-GM materials, on different GM events and on proficiency test samples, the method offered high specificity and sensitivity with an absolute limit of detection between 1 and 16 copies depending on the target. Easy to use, fast and cost efficient, this multiplex approach fits the purpose of GMO testing laboratories.

A Technical Approach to Marking Explosives, Propellants, and Precursor Chemicals

DTIC Science & Technology

1998-08-01

polymerase chain reaction (PCR) methods whereby small strands are cut and analyzed under specified temperature mediated enzymatic /molecular reactions (4...such as these are often overlooked. Several other companies have been investigating other methods including immunoassay techniques, microencapsulated

Selected spectroscopic results on element 115 decay chains

DOE PAGES

Rudolph, D.; Forsberg, U.; Golubev, P.; ...

2014-08-24

We observed thirty correlated α-decay chains in an experiment studying the fusion-evaporation reaction 48Ca + 243Am at the GSI Helmholtzzentrum fur Schwerionenforschung. The decay characteristics of the majority of these 30 chains are consistent with previous observations and interpretations of such chains to originate from isotopes of element Z = 115. High-resolution α-photon coincidence spectroscopy in conjunction with comprehensive Monte-Carlo simulations allow to propose excitation schemes of atomic nuclei of the heaviest elements, thereby probing nuclear structure models near the 'Island of Stability' with unprecedented experimental precision.

Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

PubMed

Brzezinski, Jennifer L

2006-01-01

The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

Bi-parentally inherited species-specific markers identify hybridization between rainbow trout and cutthroat trout subspecies

USGS Publications Warehouse

Ostberg, C.O.; Rodriguez, R.J.

2004-01-01

Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.

Flow-through polymerase chain reaction inside a seamless 3D helical microreactor fabricated utilizing a silicone tube and a paraffin mold.

PubMed

Wu, Wenming; Trinh, Kieu The Loan; Lee, Nae Yoon

2015-03-07

We introduce a new strategy for fabricating a seamless three-dimensional (3D) helical microreactor utilizing a silicone tube and a paraffin mold. With this method, various shapes and sizes of 3D helical microreactors were fabricated, and a complicated and laborious photolithographic process, or 3D printing, was eliminated. With dramatically enhanced portability at a significantly reduced fabrication cost, such a device can be considered to be the simplest microreactor, developed to date, for performing the flow-through polymerase chain reaction (PCR).

[Identification of human pathogenic variola and monkeypox viruses by real-time polymerase chain reaction].

PubMed

Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N

2009-01-01

A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.

Molecular implementation of molecular shift register memories

NASA Technical Reports Server (NTRS)

Beratan, David N. (Inventor); Onuchic, Jose N. (Inventor)

1991-01-01

An electronic shift register memory (20) at the molecular level is described. The memory elements are based on a chain of electron transfer molecules (22) and the information is shifted by photoinduced (26) electron transfer reactions. Thus, multi-step sequences of charge transfer reactions are used to move charge with high efficiency down a molecular chain. The device integrates compositions of the invention onto a VLSI substrate (36), providing an example of a molecular electronic device which may be fabricated. Three energy level schemes, molecular implementation of these schemes, optical excitation strategies, charge amplification strategies, and error correction strategies are described.

Identification of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss) by using polymerase chain reaction amplification and restriction analysis of the mitochondrial cytochrome b gene.

PubMed

Carrera, E; García, T; Céspedes, A; González, I; Sanz, B; Hernández, P E; Martín, R

1998-04-01

Restriction site analysis of polymerase chain reaction (PCR) products from a conserved region of the cytochrome b gene has been used for the identification of fresh and smoked samples of Atlantic salmon (Salmo salar) and rainbow trout (Oncorhynchus mykiss). Digestion of the 359-bp PCR product with the endonucleases EcoRV and TaqI yielded specific banding patterns for salmon and trout. This genetic marker can be very useful for detecting fraudulent substitution of the cheaper smoked trout for the more expensive smoked salmon.

Peroxy radical measurements with NCAR's chemical amplifier

NASA Technical Reports Server (NTRS)

Cantrell, Christopher; Shetter, Richard; Calvert, Jack G.

1994-01-01

The present NCAR instrument for HO2/RO2 measurements has been described previously. It is based on the reactions involving HO2, RO2, and HO radicals with CO and NO. Since (HO2) + (RO2) + (HO) is much greater than (HO) for most atmospheres, it is useful as a peroxy radical detector. Operation of the instrument depends on the creation of a chemical chain reaction which is initiated as HO2 and RO2 radicals in ambient air encounter added NO gas; this forms an NO2 molecule and an HO or RO radical: HO2(RO2) + NO yields HO(RO) + NO2. RO radicals react relatively efficiently with O2 to form an HO2 radical, and subsequently an HO-radical, by reaction with NO. CO gas added to the reaction chamber during part of the operating cycle, recycles the HO to HO2; HO + CO (+O2) yields HO2 + CO2. The reaction sequence may form several hundred NO2 molecules per HO2 (RO2) originally present, before chain termination occurs. The added CO is replaced by N2 addition periodically so that the chain reaction is suppressed, and a 'blank' signal resulting from NO2, O3 and possibly other NO2-forming species (non-chain processes) in ambient air is recorded. The difference between the signal with and without CO is proportional to the peroxy radical concentration. The NO2 produced is monitored using a sensitive luminol chemiluminescence detector system. In the NCAR instrument the length of the amplification chain is determined using a stable source of HO2 radicals (H2O2 thermal decomposition); the ratio of the signal seen with CO present to that with N2 present gives the sensitivity of the instrument to HO2 (molecules of NO2 formed/peroxy radical). The instrument is automated to carry out in hourly repeated cycles: (1) chain length determination; (2) NO2 calibration; and (3) linearity check on the response of signals. One minute averages of signals are normally recorded. The sensitivity of the instrument to detect peroxy radicals is in the pptv range. The present instrument has operated continuously (24 hr/day) in the field studies which extended over a period of several weeks. The major advantages of this instrument are as follows: (1) its relative simplicity; (2) low power requirements; and (3) its rapid response to all types of peroxy radicals--HO2, CH3O2 and the higher alkyl and acyl peroxy radicals; however not all RO2 species generate HO2 radicals with perfect efficiency and hence have somewhat lower response/molecule than HO2 radicals.

Silicone derivatives for contact lenses: functionalization, chemical characterization, and cell compatibility assessment.

PubMed

Migonney, V; Lacroix, M D; Ratner, B D; Jozefowicz, M

1995-01-01

Epoxy ring-opening functionalization of polymers at random sites along chains with various chemical groups has been demonstrated. The reaction is performed in an aqueous solution under mild conditions in order to minimize degradation of the macromolecular chains. Silicone lenses made of copolymers with epoxy side chains were functionalized with 4-hydroxybutyric acid, sodium salt. The carboxylated silicone derivatives were characterized by ESCA and radiotracers. A mean value of 30% reaction yield was concluded, based upon data from both methods; nevertheless, the latter can be improved up to 50% or more if the conditions of preparation of the epoxydized silicone lenses are optimized. Derivatized silicones were coated in the wells of culture plates to evaluate the cell compatibility of these new polymers with a fibroblast cell line (McCoy's). No cellular toxicity was observed.

Ab initio study of chain branching reactions involving second generation products in hydrocarbon combustion mechanisms.

PubMed

Davis, Alexander C; Francisco, Joseph S

2012-01-28

sec-Alkyl radicals are key reactive intermediates in the hydrocarbon combustion and atmospheric decomposition mechanisms that are formed by the abstraction of hydrogen from an alkane, or as a second generation product of n-alkyl H-migrations, C-C bond scissions in branched alkyl radicals, or the bimolecular reaction between olefins and n-alkyl radicals. Since alkanes and branched alkanes, which the sec-alkyl radicals are derived from, make up roughly 40-50% of traditional fuels an understanding of their chemistry is essential to improving combustion systems. The present work investigates all H-migration reactions initiated from an sec-alkyl radical that involve the movement of a secondary hydrogen, for the 2-butyl through 4-octyl radicals, using the CBS-Q, G2, and G4 composite methods. The resulting thermodynamic and kinetic parameters are compared to similar reactions in n-alkyl radicals in order to determine underlying trends. Particular attention is paid to the effect of cis/trans and 1,3-diaxial interactions on activation energies and rate coefficients. When combined with our previous work on n-alkyl radical H-migrations, a complete picture of H-migrations in unbranched alkyl radicals is obtained. This full data set suggests that the directionality of the remaining branched chains has a minimal effect on the rate coefficients for all but the largest viable transition states, which is in stark contrast to the differences predicted by the structurally similar dimethylcycloalkanes. In fact the initial location of the secondary radical site has a greater effect on the rate than does the directionality of the remaining alkyl chains. The activation energies for secondary to secondary reactions are much closer to those of the secondary to primary H-migrations. However, the rate coefficients are found to be closer to the corresponding primary to primary reaction values. A significant ramification of these results is that there will be multiple viable reaction pathways for these reactions instead of only one dominant pathway as previously believed.

Lipozyme RM IM-catalyzed acidolysis of Cinnamomum camphora seed oil with oleic acid to produce human milk fat substitutes enriched in medium-chain fatty acids.

PubMed

Zou, Xian-Guo; Hu, Jiang-Ning; Zhao, Man-Li; Zhu, Xue-Mei; Li, Hong-Yan; Liu, Xiao-Ru; Liu, Rong; Deng, Ze-Yuan

2014-10-29

In the present study, a human milk fat substitute (HMFS) enriched in medium-chain fatty acids (MCFAs) was synthesized through acidolysis reaction from Cinnamomum camphora seed oil (CCSO) with oleic acid in a solvent-free system. A commercial immobilized lipase, Lipozyme RM IM, from Rhizomucor miehei, was facilitated as a biocatalyst. Effects of different reaction conditions, including substrate molar ratio, enzyme concentration, reaction temperature, and reaction time were investigated using response surface methodology (RSM) to obtain the optimal oleic acid incorporation. After optimization, results showed that the maximal incorporation of oleic acid into HMFS was 59.68%. Compared with CCSO, medium-chain fatty acids at the sn-2 position of HMFS accounted for >70%, whereas oleic acid was occupied predominantly at the sn-1,3 position (78.69%). Meanwhile, triacylglycerol (TAG) components of OCO (23.93%), CCO (14.94%), LaCO (13.58%), OLaO (12.66%), and OOO (11.13%) were determined as the major TAG species in HMFS. The final optimal reaction conditions were carried out as follows: substrate molar ratio (oleic acid/CCSO), 5:1; enzyme concentration, 12.5% (w/w total reactants); reaction temperature, 60 °C; and reaction time, 28 h. The reusability of Lipozyme RM IM in the acidolysis reaction was also evaluated, and it was found that it could be reused up to 9 times without significant loss of activities. Urea inclusion method was used to separate and purify the synthetic product. As the ratio of HMFS/urea increased to 1:2, the acid value lowered to the minimum. In a scale-up experiment, the contents of TAG and total tocopherols in HMFS (modified CCSO) were 77.28% and 12.27 mg/100 g, respectively. All of the physicochemical indices of purified product were within food standards. Therefore, such a MCFA-enriched HMFS produced by using the acidolysis method might have potential application in the infant formula industry.

Alternative splicing produces transcripts coding for alpha and beta chains of a hetero-dimeric phosphagen kinase.

PubMed

Ellington, W Ross; Yamashita, Daisuke; Suzuki, Tomohiko

2004-06-09

Glycocyamine kinase (GK) catalyzes the reversible phosphorylation of glycocyamine (guanidinoacetate), a reaction central to cellular energy homeostasis in certain animals. GK is a member of the phosphagen kinase enzyme family and appears to have evolved from creatine kinase (CK) early in the evolution of multi-cellular animals. Prior work has shown that GK from the polychaete Neanthes (Nereis) diversicolor exits as a hetero-dimer in vivo and that the two polypeptide chains (termed alpha and beta) are coded for by unique transcripts. In the present study, we demonstrate that the GK from a congener Nereis virens is also hetero-dimeric and is coded for by alpha and beta transcripts, which are virtually identical to the corresponding forms in N. diversicolor. The GK gene from N. diversicolor was amplified by PCR. Sequencing of the PCR products showed that the alpha and beta chains are the result of alternative splicing of the GK primary mRNA transcript. These results also strongly suggest that this gene underwent an early tandem exon duplication event. Full-length cDNAs for N. virens GKalpha and GKbeta were individually ligated into expression vectors and the resulting constructs used to transform Escherichia coli expression hosts. Regardless of expression conditions, minimal GK activity was observed in both GKalpha and GKbeta constructs. Inclusion bodies for both were harvested, unfolded in urea and alpha chains, beta chains and mixtures of alpha and beta chains were refolded by sequential dialysis. Only modest amounts of GK activity were observed when alpha and beta were refolded individually. In contrast, when refolded the alpha and beta mixture yielded highly active hetero-dimers, as validated by size exclusion chromatography, electrophoresis and mass spectrometry, with a specific activity comparable to that of natural GK. The above evidence suggests that there is a preference for hetero-dimer formation in the GKs from these two polychaetes. The evolution of the alternate splicing and an additional exon in these GKs, producing alpha and beta transcripts, can be viewed as a possible compensation for a mutation(s) in the original gene, which most likely coded for a homo-dimeric protein.

A systematic review of validated methods for identifying hypersensitivity reactions other than anaphylaxis (fever, rash, and lymphadenopathy), using administrative and claims data.

PubMed

Schneider, Gary; Kachroo, Sumesh; Jones, Natalie; Crean, Sheila; Rotella, Philip; Avetisyan, Ruzan; Reynolds, Matthew W

2012-01-01

The Food and Drug Administration's Mini-Sentinel pilot program aims to conduct active surveillance to refine safety signals that emerge for marketed medical products. A key facet of this surveillance is to develop and understand the validity of algorithms for identifying health outcomes of interest from administrative and claims data. This article summarizes the process and findings of the algorithm review of hypersensitivity reactions. PubMed and Iowa Drug Information Service searches were conducted to identify citations applicable to the hypersensitivity reactions of health outcomes of interest. Level 1 abstract reviews and Level 2 full-text reviews were conducted to find articles using administrative and claims data to identify hypersensitivity reactions and including validation estimates of the coding algorithms. We identified five studies that provided validated hypersensitivity-reaction algorithms. Algorithm positive predictive values (PPVs) for various definitions of hypersensitivity reactions ranged from 3% to 95%. PPVs were high (i.e. 90%-95%) when both exposures and diagnoses were very specific. PPV generally decreased when the definition of hypersensitivity was expanded, except in one study that used data mining methodology for algorithm development. The ability of coding algorithms to identify hypersensitivity reactions varied, with decreasing performance occurring with expanded outcome definitions. This examination of hypersensitivity-reaction coding algorithms provides an example of surveillance bias resulting from outcome definitions that include mild cases. Data mining may provide tools for algorithm development for hypersensitivity and other health outcomes. Research needs to be conducted on designing validation studies to test hypersensitivity-reaction algorithms and estimating their predictive power, sensitivity, and specificity. Copyright © 2012 John Wiley & Sons, Ltd.

A systematic review of validated methods for identifying transfusion-related ABO incompatibility reactions using administrative and claims data.

PubMed

Carnahan, Ryan M; Kee, Vicki R

2012-01-01

This paper aimed to systematically review algorithms to identify transfusion-related ABO incompatibility reactions in administrative data, with a focus on studies that have examined the validity of the algorithms. A literature search was conducted using PubMed, Iowa Drug Information Service database, and Embase. A Google Scholar search was also conducted because of the difficulty identifying relevant studies. Reviews were conducted by two investigators to identify studies using data sources from the USA or Canada because these data sources were most likely to reflect the coding practices of Mini-Sentinel data sources. One study was found that validated International Classification of Diseases (ICD-9-CM) codes representing transfusion reactions. None of these cases were ABO incompatibility reactions. Several studies consistently used ICD-9-CM code 999.6, which represents ABO incompatibility reactions, and a technical report identified the ICD-10 code for these reactions. One study included the E-code E8760 for mismatched blood in transfusion in the algorithm. Another study reported finding no ABO incompatibility reaction codes in the Healthcare Cost and Utilization Project Nationwide Inpatient Sample database, which contains data of 2.23 million patients who received transfusions, raising questions about the sensitivity of administrative data for identifying such reactions. Two studies reported perfect specificity, with sensitivity ranging from 21% to 83%, for the code identifying allogeneic red blood cell transfusions in hospitalized patients. There is no information to assess the validity of algorithms to identify transfusion-related ABO incompatibility reactions. Further information on the validity of algorithms to identify transfusions would also be useful. Copyright © 2012 John Wiley & Sons, Ltd.

Novel odd/even effect of alkylene chain length on the photopolymerizability of organogelators.

PubMed

Aoki, Ken'ichi; Kudo, Masabumi; Tamaoki, Nobuyuki

2004-10-28

[reaction: see text] Starting from diactylene diacarboxylic acids, we have synthesized a series of photopolymerizable organogelators that possess simple amide structures, different alkylene chain lengths, and either optically active or racemic 3,7-dimethyl-1-octylamine units. The alkylene chain length of these compounds exhibits a prominent odd/even effect with respect to the photopolymerization in the gel state and is accompanied by a stereostructural effect on the gelation ability.

Atomistic Model for the Polyamide Formation from β-Lactam Catalyzed by Candida Antarctica Lipase B

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baum, Iris; Elsasser, Brigitta M.; Schwab, Leendert

2011-04-01

Candida antarctica lipase B (CALB) is an established biocatalyst for a variety of transesterification, amidation, and polymerization reactions. In contrast to polyesters, polyamides are not yet generally accessible via enzymatic polymerization. In this regard, an enzyme-catalyzed ring-opening polymerization of {beta}-lactam (2-azetidinone) using CALB is the first example of an enzymatic polyamide formation yielding unbranched poly({beta}-alanine), nylon 3. The performance of this polymerization, however, is poor, considering the maximum chain length of 18 monomer units with an average length of 8, and the molecular basis of the reaction so far is not understood. We have employed molecular modeling techniques using dockingmore » tools, molecular dynamics, and QM/MM procedures to gain insight into the mechanistic details of the various reaction steps involved. As a result, we propose a catalytic cycle for the oligomerization of {beta}-lactam that rationalizes the activation of the monomer, the chain elongation by additional {beta}-lactam molecules, and the termination of the polymer chain. In addition, the processes leading to a premature chain termination are studied. Particularly, the QM/MM calculation enables an atomistic description of all eight steps involved in the catalytic cycle, which features an in situ-generated {beta}-alanine as the elongating monomer and which is compatible with the experimental findings.« less

Multi angle laser light scattering evaluation of field exposed thermoplastic photovoltaic encapsulant materials

DOE PAGES

Kempe, Michael D.; Miller, David C.; Wohlgemuth, John H.; ...

2016-01-08

As creep of polymeric materials is potentially a safety concern for photovoltaic modules, the potential for module creep has become a significant topic of discussion in the development of IEC 61730 and IEC 61215. To investigate the possibility of creep, modules were constructed, using several thermoplastic encapsulant materials, into thin-film mock modules and deployed in Mesa, Arizona. The materials examined included poly(ethylene)-co-vinyl acetate (EVA, including formulations both cross-linked and with no curing agent), polyethylene/polyoctene copolymer (PO), poly(dimethylsiloxane) (PDMS), polyvinyl butyral (PVB), and thermoplastic polyurethane (TPU). The absence of creep in this experiment is attributable to several factors of which themore » most notable one was the unexpected cross-linking of an EVA formulation without a cross-linking agent. It was also found that some materials experienced both chain scission and cross-linking reactions, sometimes with a significant dependence on location within a module. The TPU and EVA samples were found to degrade with cross-linking reactions dominating over chain scission. In contrast, the PO materials degraded with chain scission dominating over cross-linking reactions. Furthermore, we found no significant indications that viscous creep is likely to occur in fielded modules capable of passing the qualification tests, we note that one should consider how a polymer degrades, chain scission or cross-linking, in assessing the suitability of a thermoplastic polymer in terrestrial photovoltaic applications.« less

Detection of human papillomaviruses by polymerase chain reaction and ligation reaction on universal microarray.

PubMed

Ritari, Jarmo; Hultman, Jenni; Fingerroos, Rita; Tarkkanen, Jussi; Pullat, Janne; Paulin, Lars; Kivi, Niina; Auvinen, Petri; Auvinen, Eeva

2012-01-01

Sensitive and specific detection of human papillomaviruses (HPV) in cervical samples is a useful tool for the early diagnosis of epithelial neoplasia and anogenital lesions. Recent studies support the feasibility of HPV DNA testing instead of cytology (Pap smear) as a primary test in population screening for cervical cancer. This is likely to be an option in the near future in many countries, and it would increase the efficiency of screening for cervical abnormalities. We present here a microarray test for the detection and typing of 15 most important high-risk HPV types and two low risk types. The method is based on type specific multiplex PCR amplification of the L1 viral genomic region followed by ligation detection reaction where two specific ssDNA probes, one containing a fluorescent label and the other a flanking ZipCode sequence, are joined by enzymatic ligation in the presence of the correct HPV PCR product. Human beta-globin is amplified in the same reaction to control for sample quality and adequacy. The genotyping capacity of our approach was evaluated against Linear Array test using cervical samples collected in transport medium. Altogether 14 out of 15 valid samples (93%) gave concordant results between our test and Linear Array. One sample was HPV56 positive in our test and high-risk positive in Hybrid Capture 2 but remained negative in Linear Array. The preliminary results suggest that our test has accurate multiple HPV genotyping capability with the additional advantages of generic detection format, and potential for high-throughput screening.

Construction of combustion models for rapeseed methyl ester bio-diesel fuel for internal combustion engine applications.

PubMed

Golovitchev, Valeri I; Yang, Junfeng

2009-01-01

Bio-diesel fuels are non-petroleum-based diesel fuels consisting of long chain alkyl esters produced by the transesterification of vegetable oils, that are intended for use (neat or blended with conventional fuels) in unmodified diesel engines. There have been few reports of studies proposing theoretical models for bio-diesel combustion simulations. In this study, we developed combustion models based on ones developed previously. We compiled the liquid fuel properties, and the existing detailed mechanism of methyl butanoate ester (MB, C(5)H(10)O(2)) oxidation was supplemented by sub-mechanisms for two proposed fuel constituent components, C(7)H(16) and C(7)H(8)O (and then, by mp2d, C(4)H(6)O(2) and propyne, C(3)H(4)) to represent the combustion model for rapeseed methyl ester described by the chemical formula, C(19)H(34)O(2) (or C(19)H(36)O(2)). The main fuel vapor thermal properties were taken as those of methyl palmitate C(19)H(36)O(2) in the NASA polynomial form of the Burcat database. The special global reaction was introduced to "crack" the main fuel into its constituent components. This general reaction included 309 species and 1472 reactions, including soot and NO(x) formation processes. The detailed combustion mechanism was validated using shock-tube ignition-delay data under diesel engine conditions. For constant volume and diesel engine (Volvo D12C) combustion modeling, this mechanism could be reduced to 88 species participating in 363 reactions.

Shock tube measurements of specific reaction rates in branched chain CH4-CO-O2 system

NASA Technical Reports Server (NTRS)

Brabbs, T. A.; Brokaw, R. S.

1974-01-01

Rate constants of two elementary bimolecular reactions involved in the oxidation of methane were determined by monitoring the exponential growth of CO flame band emission behind incident shocks in three suitably chosen gas mixtures.

International collaborative study of the endogenous reference gene, sucrose phosphate synthase (SPS), used for qualitative and quantitative analysis of genetically modified rice.

PubMed

Jiang, Lingxi; Yang, Litao; Zhang, Haibo; Guo, Jinchao; Mazzara, Marco; Van den Eede, Guy; Zhang, Dabing

2009-05-13

One rice ( Oryza sativa ) gene, sucrose phosphate synthase (SPS), has been proven to be a suitable endogenous reference gene for genetically modified (GM) rice detection in a previous study. Herein are the reported results of an international collaborative ring trial for validation of the SPS gene as an endogenous reference gene and its optimized qualitative and quantitative polymerase chain reaction (PCR) systems. A total of 12 genetically modified organism (GMO) detection laboratories from seven countries participated in the ring trial and returned their results. The validated results confirmed the species specificity of the method through testing 10 plant genomic DNAs, low heterogeneity, and a stable single-copy number of the rice SPS gene among 7 indica varieties and 5 japonica varieties. The SPS qualitative PCR assay was validated with a limit of detection (LOD) of 0.1%, which corresponded to about 230 copies of haploid rice genomic DNA, while the limit of quantification (LOQ) for the quantitative PCR system was about 23 copies of haploid rice genomic DNA, with acceptable PCR efficiency and linearity. Furthermore, the bias between the test and true values of eight blind samples ranged from 5.22 to 26.53%. Thus, we believe that the SPS gene is suitable for use as an endogenous reference gene for the identification and quantification of GM rice and its derivates.

MicroRNA Changes in Cerebrospinal Fluid After Subarachnoid Hemorrhage

PubMed Central

Rasmussen, Rune; Rossing, Maria; Laigaard, Finn Pedersen; Nielsen, Finn Cilius; Møller, Kirsten

2017-01-01

Background and Purpose— Delayed cerebral ischemia (DCI) accounts for a major part of the morbidity and mortality after aneurysmal subarachnoid hemorrhage (SAH). MicroRNAs (miRNAs) are pathophysiologically involved in acute cerebral ischemia. This study compared miRNA profiles in cerebrospinal fluid from neurologically healthy patients, as well as SAH patients with and without subsequent development of DCI. Methods— In a prospective case–control study of SAH patients treated with external ventricular drainage and neurologically healthy patients, miRNA profiles in cerebrospinal fluid were screened and validated using 2 different high-throughput real-time quantification polymerase chain reaction techniques. The occurrence of DCI was documented in patient charts and subsequently reviewed independently by 2 physicians. Results— MiRNA profiles from 27 SAH patients and 10 neurologically healthy patients passed quality control. In the validation, 66 miRNAs showed a relative increase in cerebrospinal fluid from SAH patients compared with neurologically healthy patients (P<0.001); 2 (miR-21 and miR-221) showed a relative increase in SAH patients with DCI compared with those without (P<0.05) in both the screening and validation. Conclusions— SAH is associated with marked changes in the cerebrospinal fluid miRNA profile. These changes could be associated to the development of DCI. Clinical Trial Registration— URL: http://www.clinicaltrials.gov. Unique identifier: NCT01791257. PMID:28768799

Clinical Validation Trial of a Diagnostic for Ebola Zaire Antigen Detection: Design Rationale and Challenges to Implementation

PubMed Central

Schieffelin, John; Moses, Lina M; Shaffer, Jeffrey; Goba, Augustine; Grant, Donald S

2015-01-01

The current Ebola outbreak in West Africa has affected more people than all previous outbreaks combined. The current diagnostic method of choice, quantitative polymerase chain reaction, requires specialized conditions as well as specially trained technicians. Insufficient testing capacity has extended the time from sample collection to results. These delays have led to further delays in the transfer and treatment to Ebola Treatment Units. A sensitive and specific point-of-care device that could be used reliably in low resource settings by healthcare workers with minimal training would increase the efficiency of triage and appropriate transfer of care. This article describes a study designed to validate the sensitivity and specificity of the ReEBOVTM RDT using venous whole blood and capillary blood obtained via fingerprick. We present the scientific and clinical rationale for the decisions made in the design of a diagnostic validation study to be conducted in an outbreak setting. The multi-site strategy greatly complicated implementation. In addition, a decrease in cases in one geographic area along with a concomitant increase in other areas made site selection challenging. Initiation of clinical trials during rapidly evolving outbreaks requires significant cooperation on a national level between research teams implementing studies and clinical care providers. Coordination and streamlining of approval process is essential if trials are to be implemented in a timely fashion. PMID:26768566

Meta-analysis of gene expression profiles associated with histological classification and survival in 829 ovarian cancer samples.

PubMed

Fekete, Tibor; Rásó, Erzsébet; Pete, Imre; Tegze, Bálint; Liko, István; Munkácsy, Gyöngyi; Sipos, Norbert; Rigó, János; Györffy, Balázs

2012-07-01

Transcriptomic analysis of global gene expression in ovarian carcinoma can identify dysregulated genes capable to serve as molecular markers for histology subtypes and survival. The aim of our study was to validate previous candidate signatures in an independent setting and to identify single genes capable to serve as biomarkers for ovarian cancer progression. As several datasets are available in the GEO today, we were able to perform a true meta-analysis. First, 829 samples (11 datasets) were downloaded, and the predictive power of 16 previously published gene sets was assessed. Of these, eight were capable to discriminate histology subtypes, and none was capable to predict survival. To overcome the differences in previous studies, we used the 829 samples to identify new predictors. Then, we collected 64 ovarian cancer samples (median relapse-free survival 24.5 months) and performed TaqMan Real Time Polimerase Chain Reaction (RT-PCR) analysis for the best 40 genes associated with histology subtypes and survival. Over 90% of subtype-associated genes were confirmed. Overall survival was effectively predicted by hormone receptors (PGR and ESR2) and by TSPAN8. Relapse-free survival was predicted by MAPT and SNCG. In summary, we successfully validated several gene sets in a meta-analysis in large datasets of ovarian samples. Additionally, several individual genes identified were validated in a clinical cohort. Copyright © 2011 UICC.

Testing the interaction between analytical modules: an example with Roundup Ready® soybean line GTS 40-3-2

PubMed Central

2010-01-01

Background The modular approach to analysis of genetically modified organisms (GMOs) relies on the independence of the modules combined (i.e. DNA extraction and GM quantification). The validity of this assumption has to be proved on the basis of specific performance criteria. Results An experiment was conducted using, as a reference, the validated quantitative real-time polymerase chain reaction (PCR) module for detection of glyphosate-tolerant Roundup Ready® GM soybean (RRS). Different DNA extraction modules (CTAB, Wizard and Dellaporta), were used to extract DNA from different food/feed matrices (feed, biscuit and certified reference material [CRM 1%]) containing the target of the real-time PCR module used for validation. Purity and structural integrity (absence of inhibition) were used as basic criteria that a DNA extraction module must satisfy in order to provide suitable template DNA for quantitative real-time (RT) PCR-based GMO analysis. When performance criteria were applied (removal of non-compliant DNA extracts), the independence of GMO quantification from the extraction method and matrix was statistically proved, except in the case of Wizard applied to biscuit. A fuzzy logic-based procedure also confirmed the relatively poor performance of the Wizard/biscuit combination. Conclusions For RRS, this study recognises that modularity can be generally accepted, with the limitation of avoiding combining highly processed material (i.e. biscuit) with a magnetic-beads system (i.e. Wizard). PMID:20687918

Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

PubMed

Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

2017-02-15

Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

Structural modulation of silver complexes and their distinctive catalytic properties.

PubMed

Zhao, Yue; Chen, Kai; Fan, Jian; Okamura, Taka-aki; Lu, Yi; Luo, Li; Sun, Wei-Yin

2014-02-07

A family of silver(I) complexes, [Ag2(L)2(OOCCF3)2] (1), [Ag(L)0.5(OOCCF3)] (2), [Ag(L)2](OOCCF3)(H2O)2 (3), was obtained by reactions of 4,4'-di(2-oxazolinyl)biphenyl (L) and AgOOCCF3 in different reaction media. Compound 1 has a 1D chain structure with alternative connections between the Ag(I) and L ligand. When the crystal nucleation inductor, pyrazine, was added into the reaction system, complex 2 was isolated with no pyrazine observed in its structure. In 2, the 1D inorganic chains formed by Ag(I) cations and OOCCF3(-) anions were connected by the L ligand to produce a 2D network. When a different inductor, imidazole, was added into the reaction system, 3 with (4,4) topology was synthesized, and again no imidazole was found in 3. When 1-3 were used as catalysts for cycloaddition reactions between imino esters and methyl acrylate, 3 affords the highest yield, in which the particular size of the channels in 3 led to its selective catalytic performance.

Development of SNP Genotyping Assays for Seed Composition Traits in Soybean

PubMed Central

Patil, Gunvant; Chaudhary, Juhi; Vuong, Tri D.; Jenkins, Brian; Qiu, Dan; Kadam, Suhas; Shannon, Grover J.

2017-01-01

Seed composition is one of the most important determinants of the economic values in soybean. The quality and quantity of different seed components, such as oil, protein, and carbohydrates, are crucial ingredients in food, feed, and numerous industrial products. Soybean researchers have successfully developed and utilized a diverse set of molecular markers for seed trait improvement in soybean breeding programs. It is imperative to design and develop molecular assays that are accurate, robust, high-throughput, cost-effective, and available on a common genotyping platform. In the present study, we developed and validated KASP (Kompetitive allele-specific polymerase chain reaction) genotyping assays based on previously known functional mutant alleles for the seed composition traits, including fatty acids, oligosaccharides, trypsin inhibitor, and lipoxygenase. These assays were validated on mutant sources as well as mapping populations and precisely distinguish the homozygotes and heterozygotes of the mutant genes. With the obvious advantages, newly developed KASP assays in this study can substitute the genotyping assays that were previously developed for marker-assisted selection (MAS). The functional gene-based assay resource developed using common genotyping platform will be helpful to accelerate efforts to improve soybean seed composition traits. PMID:28630621

Advances in PCR technology.

PubMed

Lauerman, Lloyd H

2004-12-01

Since the discovery of the polymerase chain reaction (PCR) 20 years ago, an avalanche of scientific publications have reported major developments and changes in specialized equipment, reagents, sample preparation, computer programs and techniques, generated through business, government and university research. The requirement for genetic sequences for primer selection and validation has been greatly facilitated by the development of new sequencing techniques, machines and computer programs. Genetic libraries, such as GenBank, EMBL and DDBJ continue to accumulate a wealth of genetic sequence information for the development and validation of molecular-based diagnostic procedures concerning human and veterinary disease agents. The mechanization of various aspects of the PCR assay, such as robotics, microfluidics and nanotechnology, has made it possible for the rapid advancement of new procedures. Real-time PCR, DNA microarray and DNA chips utilize these newer techniques in conjunction with computer and computer programs. Instruments for hand-held PCR assays are being developed. The PCR and reverse transcription-PCR (RT-PCR) assays have greatly accelerated the speed and accuracy of diagnoses of human and animal disease, especially of the infectious agents that are difficult to isolate or demonstrate. The PCR has made it possible to genetically characterize a microbial isolate inexpensively and rapidly for identification, typing and epidemiological comparison.

High-performance liquid chromatographic determination of ursodeoxycholic acid after solid phase extraction of blood serum and detection-oriented derivatization.

PubMed

Nobilis, M; Pour, M; Kunes, J; Kopecký, J; Kvĕtina, J; Svoboda, Z; Sládková, K; Vortel, J

2001-03-01

Ursodeoxycholic acid (3 alpha,7 beta-dihydroxy-5 beta-cholanoic acid, UDCA) is a therapeutically applicable bile acid widely used for the dissolution of cholesterol-rich gallstones and in the treatment of chronic liver diseases associated with cholestasis. UDCA is more hydrophilic and less toxic than another therapeutically valuable bile acid, chenodeoxycholic acid (CDCA), the 7 alpha-epimer of UDCA. Procedures for sample preparation and HPLC determination of UDCA in blood serum were developed and validated. A higher homologue of UDCA containing an additional methylene group in the side chain was synthetized and used as an internal standard (IS). Serum samples with IS were diluted with a buffer (pH=7). The bile acids and IS were captured using solid phase extraction (C18 cartridges). The carboxylic group of the analytes was derivatized using 2-bromo-2'-acetonaphthone (a detection-oriented derivatization), and reaction mixtures were analyzed (HPLC with UV 245 nm detection; a 125--4 mm column containing Lichrospher 100 C18, 5 microm; mobile phase: acetonitrile--water, 6:4 (v/v)). Following validation, this method was used for pharmacokinetic studies of UDCA in humans.

Development and validation of a real-time PCR assay for the detection of Toxoplasma gondii DNA in animal and meat samples.

PubMed

Marino, Anna Maria Fausta; Percipalle, Maurizio; Giunta, Renato Paolo; Salvaggio, Antonio; Caracappa, Giulia; Alfonzetti, Tiziana; Aparo, Alessandra; Reale, Stefano

2017-03-01

We report a rapid and reliable method for the detection of Toxoplasma gondii in meat and animal tissues based on real-time polymerase chain reaction (PCR). Samples were collected from cattle, small ruminants, horses, and pigs raised or imported into Sicily, Italy. All DNA preparations were assayed by real-time PCR tests targeted to a 98-bp long fragment in the AF 529-bp repeat element and to the B1 gene using specific primers. Diagnostic sensitivity (100%), diagnostic specificity (100%), limit of detection (0.01 pg), efficiency (92-109%), and precision (mean coefficient of variation = 0.60%), repeatability (100%), reproducibility (100%), and robustness were evaluated using 240 DNA extracted samples (120 positives and 120 negative as per the OIE nested PCR method) from different matrices. Positive results were confirmed by the repetition of both real-time and nested PCR assays. Our study demonstrates the viability of a reliable, rapid, and specific real-time PCR on a large scale to monitor contamination with Toxoplasma cysts in meat and animal specimens. This validated method can be used for postmortem detection in domestic and wild animals and for food safety purposes.

Independent validation of Swarm Level 2 magnetic field products and `Quick Look' for Level 1b data

NASA Astrophysics Data System (ADS)

Beggan, Ciarán D.; Macmillan, Susan; Hamilton, Brian; Thomson, Alan W. P.

2013-11-01

Magnetic field models are produced on behalf of the European Space Agency (ESA) by an independent scientific consortium known as the Swarm Satellite Constellation Application and Research Facility (SCARF), through the Level 2 Processor (L2PS). The consortium primarily produces magnetic field models for the core, lithosphere, ionosphere and magnetosphere. Typically, for each magnetic product, two magnetic field models are produced in separate chains using complementary data selection and processing techniques. Hence, the magnetic field models from the complementary processing chains will be similar but not identical. The final step in the overall L2PS therefore involves inspection and validation of the magnetic field models against each other and against data from (semi-) independent sources (e.g. ground observatories). We describe the validation steps for each magnetic field product and the comparison against independent datasets, and we show examples of the output of the validation. In addition, the L2PS also produces a daily set of `Quick Look' output graphics and statistics to monitor the overall quality of Level 1b data issued by ESA. We describe the outputs of the `Quick Look' chain.