Theory of Neutron Chain Reactions: Extracts from Volume I, Diffusion and Slowing Down of Neutrons: Chapter I. Elementary Theory of Neutron Diffusion. Chapter II. Second Order Diffusion Theory. Chapter III. Slowing Down of Neutrons

DOE R&D Accomplishments Database

Weinberg, Alvin M.; Noderer, L. C.

1951-05-15

The large scale release of nuclear energy in a uranium fission chain reaction involves two essentially distinct physical phenomena. On the one hand there are the individual nuclear processes such as fission, neutron capture, and neutron scattering. These are essentially quantum mechanical in character, and their theory is non-classical. On the other hand, there is the process of diffusion -- in particular, diffusion of neutrons, which is of fundamental importance in a nuclear chain reaction. This process is classical; insofar as the theory of the nuclear chain reaction depends on the theory of neutron diffusion, the mathematical study of chain reactions is an application of classical, not quantum mechanical, techniques.

RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

EPA Science Inventory

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

EPA Science Inventory

Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

Detection limits and cost comparisons of human- and gull-associated conventional and quantitative PCR assays in artificial and environmental waters

EPA Science Inventory

Modern techniques for tracking fecal pollution in environmental waters require investing in DNA-based methods to determine the presence of specific fecal sources. To help water quality managers decide whether to employ routine polymerase chain reaction (PCR) or quantitative PC...

Quantitative competitive (QC) PCR for quantification of porcine DNA.

PubMed

Wolf, C; Lüthy, J

2001-02-01

Many meat products nowadays may contain several species in different proportions. To protect consumers from fraud and misdeclarations, not only a qualitative but also a quantitative monitoring of ingredients of complex food products is necessary. DNA based techniques like the polymerase chain reaction (PCR) are widely used for identification of species but no answer to the proportional amount of a certain species could be given using current techniques. In this study we report the development and evaluation of a quantitative competitive polymerase chain reaction (QC-PCR) for detection and quantification of porcine DNA using a new porcine specific PCR system based on the growth hormone gene of sus scrofa. A DNA competitor differing by 30 bp in length from the porcine target sequence was constructed and used for PCR together with the target DNA. Specificity of the new primers was evaluated with DNA from cattle, sheep, chicken and turkey. The competitor concentration was adjusted to porcine DNA contents of 2 or 20% by coamplification of mixtures containing porcine and corresponding amounts of bovine DNA in defined ratios.

Detection of Listeria monocytogenes by using the polymerase chain reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bessesen, M.T.; Luo, Q.; Blaser, M.J.

1990-09-01

A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

[Radiation therapy and redox imaging].

PubMed

Matsumoto, Ken-ichiro

2015-01-01

Radiation therapy kills cancer cells in part by flood of free radicals. Radiation ionizes and/or excites water molecules to create highly reactive species, i.e. free radicals and/or reactive oxygen species. Free radical chain reactions oxidize biologically important molecules and thereby disrupt their function. Tissue oxygen and/or redox status, which can influence the course of the free radical chain reaction, can affect the efficacy of radiation therapy. Prior observation of tissue oxygen and/or redox status is helpful for planning a safe and efficient course of radiation therapy. Magnetic resonance-based redox imaging techniques, which can estimate tissue redox status non-invasively, have been developed not only for diagnostic information but also for estimating the efficacy of treatment. Redox imaging is now spotlighted to achieve radiation theranostics.

Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

PubMed

Adewale, B; Mafe, M A; Oyerinde, J P O

2005-01-01

Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

[The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

PubMed

Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

2014-04-01

The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems.

PubMed

Ximenes, Camila; Brandão, Eduardo; Oliveira, Paula; Rocha, Abraham; Rego, Tamisa; Medeiros, Rafael; Aguiar-Santos, Ana; Ferraz, João; Reis, Christian; Araujo, Paulo; Carvalho, Luiz; Melo, Fabio L

2014-12-01

The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

Exponential isothermal amplification of nucleic acids and amplified assays for proteins, cells, and enzyme activities.

PubMed

Reid, Michael S; Le, X Chris; Zhang, Hongquan

2018-04-27

Isothermal exponential amplification techniques, such as strand-displacement amplification (SDA), rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP), nucleic acid sequence-based amplification (NASBA), helicase-dependent amplification (HDA), and recombinase polymerase amplification (RPA), have great potential for on-site, point-of-care, and in-situ assay applications. These amplification techniques eliminate the need for temperature cycling required for polymerase chain reaction (PCR) while achieving comparable amplification yield. We highlight here recent advances in exponential amplification reaction (EXPAR) for the detection of nucleic acids, proteins, enzyme activities, cells, and metal ions. We discuss design strategies, enzyme reactions, detection techniques, and key features. Incorporation of fluorescence, colorimetric, chemiluminescence, Raman, and electrochemical approaches enables highly sensitive detection of a variety of targets. Remaining issues, such as undesirable background amplification resulting from non-specific template interactions, must be addressed to further improve isothermal and exponential amplification techniques. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Impacts of Sampling and Handling Procedures on DNA- and RNA-based Microbial Characterization and Quantification of Groundwater and Saturated Soil

DTIC Science & Technology

2012-07-01

use of molecular biological techniques (MBTs) has allowed microbial ecologists and environmental engineers to determine microbial community...metabolic genes). The most common approaches used in bioremediation research are those based on the polymerase chain reaction (PCR) amplification of... bioremediation . Because of its sensitivity compared to direct hybridization/probing, PCR is increasingly used to analyze groundwater samples and soil samples

Enzyme-free and isothermal detection of microRNA based on click-chemical ligation-assisted hybridization coupled with hybridization chain reaction signal amplification.

PubMed

Oishi, Motoi

2015-05-01

An enzyme-free and isothermal microRNA (miRNA) detection method has been developed based on click-chemical ligation-assisted hybridization coupled with hybridization chain reaction (HCR) on magnetic beads (MBs). The click-chemical ligation between an azide-modified probe DNA and a dibenzocyclooctyne-modified probe DNA occurred through the hybridization of target miRNA (miR-141). HCR on MBs was performed by the addition of DNA hairpin monomers (H1 and H2). After magnetic separation and denaturation/rehybridization of HCR products ([H1/H2] n ), the resulting HCR products were analyzed by the fluorescence emitted from an intercalative dye, allowing amplification of the fluorescent signal. The proposed assay had a limit of detection of 0.55 fmol, which was 230-fold more sensitive than that of the HCR on the MBs coupled with a conventional sandwich hybridization assay (without click-chemical ligation) (limit of detection 127 fmol). Additionally, the proposed assay could discriminate between miR-141 and other miR-200 family members. In contrast to quantitative reverse transcription polymerase chain reaction techniques using enzymes and thermal cycling, this is an enzyme-free assay that can be conducted under isothermal conditions and can specifically detect miR-141 in fetal bovine serum.

Susceptibility of Culicoides variipennis sonorensis to infection by polymerase chain reaction-detectable bluetongue virus in cattle blood.

PubMed

Tabachnick, W J; MacLachlan, N J; Thompson, L H; Hunt, G J; Patton, J F

1996-05-01

Cattle bloods containing only polymerase chain reaction (PCR)--detectable bluetongue-10 viral nucleic acid, but as determined by virus isolation techniques, not bluetongue-10 virus, were incapable of infecting intrathoracically inoculated Culicoides variipennis sonorensis. These insects also failed to transmit bluetongue-10 virus when fed on sheep. Cattle whose blood contain only PCR-detectable bluetongue viral nucleic acid, but no infectious virus, are unlikely to play a role in the epidemiology of bluetongue. The biological significance of PCR-based detection assays and their effect on animal health regulations on the international trade of livestock and livestock germplasm is discussed. Bluetongue virus infection provides a very useful model with which to study arthropod-transmitted RNA virus infections of humans and other animals.

Suppression of the chain nuclear fusion reaction based on the p+{sup 11}B reaction because of the deceleration of alpha particles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shmatov, M. L., E-mail: M.Shmatov@mail.ioffe.ru

2016-09-15

It is shown that a rapid deceleration of alpha particles in matter of electron temperature up to 100 keV leads a strong suppression of the chain nuclear fusion reaction on the basis of the p+{sup 11}B reaction with the reproduction of fast protons in the α+{sup 11}B and n+{sup 10}B reactions. The statement that the chain nuclear fusion reaction based on the p+{sup 11}B reaction with an acceleration of {sup 11}B nuclei because of elastic alpha-particle scattering manifests itself in experiments at the PALS (Prague Asterix Laser System) facility is analyzed.

Diagnostic devices for isothermal nucleic acid amplification.

PubMed

Chang, Chia-Chen; Chen, Chien-Cheng; Wei, Shih-Chung; Lu, Hui-Hsin; Liang, Yang-Hung; Lin, Chii-Wann

2012-01-01

Since the development of the polymerase chain reaction (PCR) technique, genomic information has been retrievable from lesser amounts of DNA than previously possible. PCR-based amplifications require high-precision instruments to perform temperature cycling reactions; further, they are cumbersome for routine clinical use. However, the use of isothermal approaches can eliminate many complications associated with thermocycling. The application of diagnostic devices for isothermal DNA amplification has recently been studied extensively. In this paper, we describe the basic concepts of several isothermal amplification approaches and review recent progress in diagnostic device development.

Diagnostic Devices for Isothermal Nucleic Acid Amplification

PubMed Central

Chang, Chia-Chen; Chen, Chien-Cheng; Wei, Shih-Chung; Lu, Hui-Hsin; Liang, Yang-Hung; Lin, Chii-Wann

2012-01-01

Since the development of the polymerase chain reaction (PCR) technique, genomic information has been retrievable from lesser amounts of DNA than previously possible. PCR-based amplifications require high-precision instruments to perform temperature cycling reactions; further, they are cumbersome for routine clinical use. However, the use of isothermal approaches can eliminate many complications associated with thermocycling. The application of diagnostic devices for isothermal DNA amplification has recently been studied extensively. In this paper, we describe the basic concepts of several isothermal amplification approaches and review recent progress in diagnostic device development. PMID:22969402

Determining the thickness of aliphatic alcohol monolayers covalently attached to silicon oxide surfaces using angle-resolved X-ray photoelectron spectroscopy

NASA Astrophysics Data System (ADS)

Lee, Austin W. H.; Kim, Dongho; Gates, Byron D.

2018-04-01

The thickness of alcohol based monolayers on silicon oxide surfaces were investigated using angle-resolved X-ray photoelectron spectroscopy (ARXPS). Advantages of using alcohols as building blocks for the formation of monolayers include their widespread availability, ease of handling, and stability against side reactions. Recent progress in microwave assisted reactions demonstrated the ease of forming uniform monolayers with alcohol based reagents. The studies shown herein provide a detailed investigation of the thickness of monolayers prepared from a series of aliphatic alcohols of different chain lengths. Monolayers of 1-butanol, 1-hexanol, 1-octanol, 1-decanol, and 1-dodecanol were each successfully formed through microwave assisted reactions and characterized by ARXPS techniques. The thickness of these monolayers consistently increased by ∼1.0 Å for every additional methylene (CH2) within the hydrocarbon chain of the reagents. Tilt angles of the molecules covalently attached to silicon oxide surfaces were estimated to be ∼35° for each type of reagent. These results were consistent with the observations reported for thiol based or silane based monolayers on either gold or silicon oxide surfaces, respectively. The results of this study also suggest that the alcohol based monolayers are uniform at a molecular level.

Genomic screening for blood-borne viruses in transfusion settings.

PubMed

Allain, J P

2000-02-01

The residual risk of post-transfusion human immunodeficiency virus (HIV) infection is low but slightly higher for hepatitis B virus (HBV) and hepatitis C virus (HCV), the main reason being viraemia during the window period preceding antibody or antigen detection by enzyme immunoassays. Immunosilent-infected individuals and carriers of distant viral variants also play an unquantifiable role. Multiple techniques, e.g. reverse transcription-polymerase chain reaction (RT-PCR), PCR, ligase-chain reaction, nucleic acid sequence-based amplification (NASBA) and transcription-mediated amplification (TMA) have been developed to amplify and detect viral genomes as single or multiplex assays. Equipment providing various degrees of automation has been adapted to these techniques. Applying nucleic acid amplification techniques (NAT) to blood screening, two main approaches have been advocated: plasma pool and single-donation testing. Pool testing presents the advantage of lower cost and readily available equipment although it is prone to false negative and positive reactions. The time required to identify infected donations is incompatible with blood component release, and may lead to product waste. Single-unit testing, although appealing, is not yet fully automated and potentially very costly unless a systematic multiplex approach is taken. Although technically feasible, NAT applied to the blood supply needs to be clinically evaluated and its cost efficiency assessed in the general public health context. However, pool NAT is currently implemented in continental Europe and the USA.

[Application of isothermal amplification technology for pathogen detection in parasitic and other diseases].

PubMed

Ting, Li; Kun, Yang

2018-04-16

The in vitro nucleic acid amplification technique based on polymerase chain reaction (PCR) has been successfully applied to scientific researches. In recent years, the emergence of isothermal amplification technology is increasingly applied in the molecular diagnosis and disease detection because of its advantages of constant temperature, high efficiency, short time-consuming, and less reliance on equipment and instruments. The principle, characteristics and application of the partial isothermal amplification technique in the pathogen detection in parasitic and other diseases are reviewed in this paper, and the prospects of the wide development of the technique are also discussed.

Market surveillance on non-halal additives incorporated in surimi based products using polymerase chain reaction (PCR)-southern hybridization analysis

NASA Astrophysics Data System (ADS)

Aravindran, S.; Sahilah, A. M.; Aminah, A.

2014-09-01

Halal surveillance on halal ingredients incorporated in surimi based products were studied using polymerase chain reaction (PCR)-southern hybridization on chip analysis. The primers used in this technique were targeted on mitochondria DNA (mtDNA) of cytochrome b (cyt b) gene sequence which able to differentiate 7 type (beef, chicken, duck, goat, buffalo, lamb and pork) of species on a single chip. 17 (n = 17*3) different brands of surimi-based product were purchased randomly from Selangor local market in January 2013. Of 17 brands, 3 (n = 3*3) brands were positive for chicken DNA, 1 (n = 1*3) brand was positive for goat DNA, and the remainder 13 brands (n = 13*3) have no DNA species detected. The sensitivity of PCR-southern hybridization primers to detect each meat species was 0.1 ng. In the present study, it is evidence that PCR-Southern Hybridization analysis offered a reliable result due to its highly specific and sensitive properties in detecting non-halal additive such as plasma protein incorporation in surimi-based product.

A novel rapid genotyping technique for Collie eye anomaly: SYBR Green-based real-time polymerase chain reaction method applicable to blood and saliva specimens on Flinders Technology Associates filter paper.

PubMed

Chang, Hye-Sook; Mizukami, Keijiro; Yabuki, Akira; Hossain, Mohammad A; Rahman, Mohammad M; Uddin, Mohammad M; Arai, Toshiro; Yamato, Osamu

2010-09-01

Collie eye anomaly (CEA) is a canine inherited ocular disease that shows a wide variety of manifestations and severity of clinical lesions. Recently, a CEA-associated mutation was reported, and a DNA test that uses conventional polymerase chain reaction (PCR) has now become available. The objective of the current study was to develop a novel rapid genotyping technique by using SYBR Green-based real-time PCR for future large-scale surveys as a key part in the strategy to eradicate CEA by selective breeding. First, a SYBR Green-based real-time PCR assay for genotyping of CEA was developed and evaluated by using purified DNA samples from normal, carrier, and affected Border Collies in which genotypes had previously been determined by conventional PCR. This real-time PCR assay demonstrated appropriate amplifications in all genotypes, and the results were consistent with those of conventional PCR. Second, the availability of Flinders Technology Associates filter paper (FTA card) as DNA templates for the real-time PCR assay was evaluated by using blood and saliva specimens to determine suitability for CEA screening. DNA-containing solution prepared from a disc of blood- or saliva-spotted FTA cards was available directly as templates for the real-time PCR assay when the volume of solution was 2.5% of the PCR mixture. In conclusion, SYBR Green-based real-time PCR combined with FTA cards is a rapid genotyping technique for CEA that can markedly shorten the overall time required for genotyping as well as simplify the sample preparation. Therefore, this newly developed technique suits large-scale screening in breeding populations of Collie-related breeds.

Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

PubMed

Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

2008-12-01

One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

Accuracy of polimerase chain reaction for the diagnosis of pleural tuberculosis.

PubMed

Trajman, Anete; da Silva Santos Kleiz de Oliveira, Elen Fabricia; Bastos, Mayara Lisboa; Belo Neto, Epaminondas; Silva, Edgar Manoel; da Silva Lourenço, Maria Cristina; Kritski, Afrânio; Oliveira, Martha Maria

2014-06-01

Polymerase chain reaction (PCR)-based techniques to detect Mycobacterium tuberculosis DNA in respiratory specimens have been increasingly used to diagnose pulmonary tuberculosis. Their use in non-respiratory specimens to diagnose extrapulmonary tuberculosis is, however, controversial. In this study, we estimated the accuracy of three in-country commercialized PCR-based diagnostic techniques in pleural fluid samples for the diagnosis of pleural tuberculosis. Patients underwent thoracenthesis for diagnosis purposes; pleural fluid aliquots were frozen and subsequently submitted to two real time PCR tests (COBAS(®)TAQMAN(®)MTB and Xpert(®)MTB/Rif) and one conventional PCR test (Detect-TB(®)). Two different reference standards were considered: probable tuberculosis (based on clinical grounds) and confirmed tuberculosis (bacteriologically or histologically). Ninety-three patients were included, of whom 65 with pleural tuberculosis, 35 of them confirmed. Sensitivities were 29% for COBAS(®)TAQMAN(®)MTB, 3% for Xpert(®)MTB/Rif and 3% for Detect-TB(®); specificities were 86%, 100% and 97% respectively, considering confirmed tuberculosis. Considering all cases, sensitivities were 16%, 3% and 2%, and specificities, 86%, 100%, and 97%. Compared to the 95% sensitivity of adenosine deaminase, the most sensitive test for pleural tuberculosis, the sensitivities of the three PCR-based tests were very low. We conclude that at present, there is no major place for such tests in routine clinical use. Copyright © 2014 Elsevier Ltd. All rights reserved.

[Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

PubMed

Wang, F; Zhang, Y Q; Ding, J; Yu, L X

2017-10-18

To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

Review of Detection of Brucella sp. by Polymerase Chain Reaction

PubMed Central

Yu, Wei Ling; Nielsen, Klaus

2010-01-01

Here we present a review of most of the currently used polymerase chain reaction (PCR)-based methods for identification of Brucella bacteria in biological samples. We focused in particular on methods using single-pair primers, multiplex primers, real-time PCRs, PCRs for marine Brucella, and PCRs for molecular biotyping. These methods are becoming very important tools for the identification of Brucella, at the species level and recently also at the biovar level. These techniques require minimum biological containment and can provide results in a very short time. In addition, genetic fingerprinting of isolates aid in epidemiological studies of the disease and its control. PCR-based methods are more useful and practical than conventional methods used to identify Brucella spp., and new methods for Brucella spp identification and typing are still being developed. However, the sensitivity, specificity, and issues of quality control and quality assurance using these methods must be fully validated on clinical samples before PCR can be used in routine laboratory testing for brucellosis. PMID:20718083

A Technical Approach to Marking Explosives, Propellants, and Precursor Chemicals

DTIC Science & Technology

1998-08-01

polymerase chain reaction (PCR) methods whereby small strands are cut and analyzed under specified temperature mediated enzymatic /molecular reactions (4...such as these are often overlooked. Several other companies have been investigating other methods including immunoassay techniques, microencapsulated

Simple model of inhibition of chain-branching combustion processes

NASA Astrophysics Data System (ADS)

Babushok, Valeri I.; Gubernov, Vladimir V.; Minaev, Sergei S.; Miroshnichenko, Taisia P.

2017-11-01

A simple kinetic model has been suggested to describe the inhibition and extinction of flame propagation in reaction systems with chain-branching reactions typical for hydrocarbon systems. The model is based on the generalised model of the combustion process with chain-branching reaction combined with the one-stage reaction describing the thermal mode of flame propagation with the addition of inhibition reaction steps. Inhibitor addition suppresses the radical overshoot in flame and leads to the change of reaction mode from the chain-branching reaction to a thermal mode of flame propagation. With the increase of inhibitor the transition of chain-branching mode of reaction to the reaction with straight-chains (non-branching chain reaction) is observed. The inhibition part of the model includes a block of three reactions to describe the influence of the inhibitor. The heat losses are incorporated into the model via Newton cooling. The flame extinction is the result of the decreased heat release of inhibited reaction processes and the suppression of radical overshoot with the further decrease of the reaction rate due to the temperature decrease and mixture dilution. A comparison of the results of modelling laminar premixed methane/air flames inhibited by potassium bicarbonate (gas phase model, detailed kinetic model) with the results obtained using the suggested simple model is presented. The calculations with the detailed kinetic model demonstrate the following modes of combustion process: (1) flame propagation with chain-branching reaction (with radical overshoot, inhibitor addition decreases the radical overshoot down to the equilibrium level); (2) saturation of chemical influence of inhibitor, and (3) transition to thermal mode of flame propagation (non-branching chain mode of reaction). The suggested simple kinetic model qualitatively reproduces the modes of flame propagation with the addition of the inhibitor observed using detailed kinetic models.

Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics.

PubMed

Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

2014-02-20

Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

NASA Astrophysics Data System (ADS)

Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

2014-02-01

Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

Reverse transcription and polymerase chain reaction: principles and applications in dentistry.

PubMed

Santos, Carlos Ferreira Dos; Sakai, Vivien Thiemy; Machado, Maria Aparecida de Andrade Moreira; Schippers, Daniela Nicole; Greene, Andrew Seth

2004-03-01

Various molecular biology techniques have become available in the last few years. One of the most revolutionary of these techniques regarding nucleic acid analysis is the polymerase chain reaction (PCR), which was first described in 1985. This method relies on the exponential amplification of specific DNA fragments, resulting in millions of copies that can serve as templates for different kinds of analyses. PCR can be preceded by a reverse transcription (RT) reaction in order to produce cDNA from RNA (RT-PCR). RT-PCR provides the possibility to assess gene transcription in cells or tissues. PCR and RT-PCR techniques have been instrumental in dental research, and show potential to be used for diagnosis as well as for treatment and prevention of many diseases (dental caries, periodontal disease, endodontic infections and oral cancer). Compared to other traditional methodologies, PCR and RT-PCR show many advantages including high specificity, sensitivity, and speed. Since PCR and RT-PCR are relatively new techniques and are not available to most students and professionals involved with dentistry, the aim of this work is to present the details of these techniques as well as dental literature reports in which they were used.

Aspergillus vertebral osteomyelitis in chronic leukocyte leukemia patient diagnosed by a novel panfungal polymerase chain reaction method.

PubMed

Dayan, Lior; Sprecher, Hannah; Hananni, Amos; Rosenbaum, Hana; Milloul, Victor; Oren, Ilana

2007-01-01

Vertebral osteomyelitis and disciitis caused by Aspergillus spp is a rare event. Early diagnosis and early antifungal therapy are critical in improving the prognosis for these patients. The diagnosis of invasive fungal infections is, in many cases, not straightforward and requires invasive procedures so that histological examination and culture can be performed. Furthermore, current traditional microbiological tests (ie, cultures and stains) lack the sensitivity for diagnosis of invasive aspergillosis. To present a case of vertebral osteomyelitis caused by Aspergillus spp diagnosed using a novel polymerase chain reaction (PCR) assay. Case report. Aspergillus DNA was detected in DNA extracted from the necrotic bone tissue by using a "panfungal" PCR novel method. Treatment with voriconazole was started based on the diagnosis. Using this novel technique enabled us to diagnose accurately an unusual bone pathogen that requires a unique treatment.

Analysis of raw meats and fats of pigs using polymerase chain reaction for Halal authentication.

PubMed

Aida, A A; Che Man, Y B; Wong, C M V L; Raha, A R; Son, R

2005-01-01

A method for species identification from pork and lard samples using polymerase chain reaction (PCR) analysis of a conserved region in the mitochondrial (mt) cytochrome b (cyt b) gene has been developed. Genomic DNA of pork and lard were extracted using Qiagen DNeasy(®) Tissue Kits and subjected to PCR amplification targeting the mt cyt b gene. The genomic DNA from lard was found to be of good quality and produced clear PCR products on the amplification of the mt cyt b gene of approximately 360 base pairs. To distinguish between species, the amplified PCR products were cut with restriction enzyme BsaJI resulting in porcine-specific restriction fragment length polymorphisms (RFLP). The cyt b PCR-RFLP species identification assay yielded excellent results for identification of pig species. It is a potentially reliable technique for detection of pig meat and fat from other animals for Halal authentication.

Recombinase polymerase amplification: Emergence as a critical molecular technology for rapid, low-resource diagnostics.

PubMed

James, Ameh; Macdonald, Joanne

2015-01-01

Isothermal molecular diagnostics are bridging the technology gap between traditional diagnostics and polymerase chain reaction-based methods. These new techniques enable timely and accurate testing, especially in settings where there is a lack of infrastructure to support polymerase chain reaction facilities. Despite this, there is a significant lack of uptake of these technologies in developing countries where they are highly needed. Among these novel isothermal technologies, recombinase polymerase amplification (RPA) holds particular potential for use in developing countries. This rapid nucleic acid amplification approach is fast, highly sensitive and specific, and amenable to countries with a high burden of infectious diseases. Implementation of RPA technology in developing countries is critically required to assess limitations and potentials of the diagnosis of infectious disease, and may help identify impediments that prevent adoption of new molecular technologies in low resource- and low skill settings. This review focuses on approaching diagnosis of infectious disease with RPA.

Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

USGS Publications Warehouse

Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

2010-01-01

A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

[Modern bacterial taxonomy: techniques review--application to bacteria that nodulate leguminous plants (BNL)].

PubMed

Zakhia, Frédéric; de Lajudie, Philippe

2006-03-01

Taxonomy is the science that studies the relationships between organisms. It comprises classification, nomenclature, and identification. Modern bacterial taxonomy is polyphasic. This means that it is based on several molecular techniques, each one retrieving the information at different cellular levels (proteins, fatty acids, DNA...). The obtained results are combined and analysed to reach a "consensus taxonomy" of a microorganism. Until 1970, a small number of classification techniques were available for microbiologists (mainly phenotypic characterization was performed: a legume species nodulation ability for a Rhizobium, for example). With the development of techniques based on polymerase chain reaction for characterization, the bacterial taxonomy has undergone great changes. In particular, the classification of the legume nodulating bacteria has been repeatedly modified over the last 20 years. We present here a review of the currently used molecular techniques in bacterial characterization, with examples of application of these techniques for the study of the legume nodulating bacteria.

Measurement of peroxy radicals in the urban atmosphere by PERCA-LIF technique

NASA Astrophysics Data System (ADS)

Sadanaga, Y.; Matsumoto, J.; Sakurai, K.; Kato, S.; Nomaguchi, T.; Bandow, H.; Kajii, Y.

2002-12-01

A new instrument has been developed for measuring peroxy radicals (RO2) using the Chemical Amplifier-Laser Induced Fluorescence (PERCA-LIF) technique. RO2 was converted to NO2 via a chain reaction by the addition of NO and CO in a 1/4" Teflon tube. NO2 was detected by LIF using Nd:YAG laser (532 nm, 5W at 10kHz). More selective detection of NO2 is enabled by the LIF than by luminol chemiluminescence because of free from the interference by other oxidants when using luminol. LIF technique can be more sensitive detection of NO2 than the luminol detector. Optimum conditions were investigated by varying reaction time (i.e. the length of reaction tube) and the concentrations of NO and CO. Maximum chain length of approximately 300 was obtained in dry conditions using a H2O/O2 simultaneous photolysis method. Experiments were performed to characterize the dependence of the chain length on humidity for this instrument. In August 2002, RO2 measurements were performed in Osaka using this method. Maximum concentrations of RO2 in the daytime were approximately 100 pptv. Nighttime observations were also conducted and significant concentrations of RO2 were detected just after the sunset. Existence of formation processes in the dark condition was investigated.

A comparison between polymerase chain reaction (PCR) and traditional techniques for the diagnosis of leptospirosis in bovines.

PubMed

Hernández-Rodríguez, Patricia; Díaz, César A; Dalmau, Ernesto A; Quintero, Gladys M

2011-01-01

Leptospirosis is caused by Leptospira, gram negative spirochaetes whose microbiologic identification is difficult due to their low rate of growth and metabolic activity. In Colombia leptospirosis diagnosis is achieved by serological techniques without unified criteria for what positive titers are. In this study we compared polymerase chain reaction (PCR) with microbiological culture and dark field microscopy for the diagnosis of leptospirosis. Microbiological and molecular techniques were performed on 83 samples of urine taken from bovines in the savannahs surrounding Bogotá in Colombia, with presumptive diagnosis of leptospirosis. 117 samples of urine taken from healthy bovines were used as negative controls. 83 samples were MAT positive with titers ≥ 1:50; 81 with titers ≥ 1:100; and 66 with titers ≥ 1:200. 36% of the total samples (73/200) were Leptospira positives by microbiological culture, 32% (63/200) by dark field microscopy and 37% (74/200) by PCR. Amplicons obtained by PCR were 482 base pair long which are Leptospira specific. An amplicon of 262 base pairs typical of pathogenic Leptospira was observed in 71 out of the 74 PCR positive samples. The remaining 3 samples showed a 240 base pair amplicon which is typical of saprophytic Leptospira. PCR as a Leptospira diagnosis technique was 100% sensitive and 99% specific in comparison to microbiological culture. Kappa value of 0.99 indicated an excellent concordance between these techniques. Sensitivity and specificity reported for MAT when compared to microbiological culture was 0.95 and 0.89 with a ≥ 1:50 cut off. PCR was a reliable method for the rapid and precise diagnosis of leptospirosis when compared to traditional techniques in our study. The research presented here will be helpful to improve diagnosis and control of leptospirosis in Colombia and other endemic countries. Copyright © 2010 Elsevier B.V. All rights reserved.

A Model of Risk Analysis in Analytical Methodology for Biopharmaceutical Quality Control.

PubMed

Andrade, Cleyton Lage; Herrera, Miguel Angel De La O; Lemes, Elezer Monte Blanco

2018-01-01

One key quality control parameter for biopharmaceutical products is the analysis of residual cellular DNA. To determine small amounts of DNA (around 100 pg) that may be in a biologically derived drug substance, an analytical method should be sensitive, robust, reliable, and accurate. In principle, three techniques have the ability to measure residual cellular DNA: radioactive dot-blot, a type of hybridization; threshold analysis; and quantitative polymerase chain reaction. Quality risk management is a systematic process for evaluating, controlling, and reporting of risks that may affects method capabilities and supports a scientific and practical approach to decision making. This paper evaluates, by quality risk management, an alternative approach to assessing the performance risks associated with quality control methods used with biopharmaceuticals, using the tool hazard analysis and critical control points. This tool provides the possibility to find the steps in an analytical procedure with higher impact on method performance. By applying these principles to DNA analysis methods, we conclude that the radioactive dot-blot assay has the largest number of critical control points, followed by quantitative polymerase chain reaction, and threshold analysis. From the analysis of hazards (i.e., points of method failure) and the associated method procedure critical control points, we conclude that the analytical methodology with the lowest risk for performance failure for residual cellular DNA testing is quantitative polymerase chain reaction. LAY ABSTRACT: In order to mitigate the risk of adverse events by residual cellular DNA that is not completely cleared from downstream production processes, regulatory agencies have required the industry to guarantee a very low level of DNA in biologically derived pharmaceutical products. The technique historically used was radioactive blot hybridization. However, the technique is a challenging method to implement in a quality control laboratory: It is laborious, time consuming, semi-quantitative, and requires a radioisotope. Along with dot-blot hybridization, two alternatives techniques were evaluated: threshold analysis and quantitative polymerase chain reaction. Quality risk management tools were applied to compare the techniques, taking into account the uncertainties, the possibility of circumstances or future events, and their effects upon method performance. By illustrating the application of these tools with DNA methods, we provide an example of how they can be used to support a scientific and practical approach to decision making and can assess and manage method performance risk using such tools. This paper discusses, considering the principles of quality risk management, an additional approach to the development and selection of analytical quality control methods using the risk analysis tool hazard analysis and critical control points. This tool provides the possibility to find the method procedural steps with higher impact on method reliability (called critical control points). Our model concluded that the radioactive dot-blot assay has the larger number of critical control points, followed by quantitative polymerase chain reaction and threshold analysis. Quantitative polymerase chain reaction is shown to be the better alternative analytical methodology in residual cellular DNA analysis. © PDA, Inc. 2018.

Silicon-based sleeve devices for chemical reactions

DOEpatents

Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.

1996-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Silicon-based sleeve devices for chemical reactions

DOEpatents

Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.

1996-12-31

A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.

Microfabricated electrochemiluminescence cell for chemical reaction detection

DOEpatents

Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

2003-01-01

A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Detection of Mycoplasma hyopneumoniae by polymerase chain reaction in swine presenting respiratory problems

PubMed Central

Yamaguti, M.; Muller, E.E.; Piffer, A.I.; Kich, J.D.; Klein, C.S.; Kuchiishi, S.S.

2008-01-01

Since Mycoplasma hyopneumoniae isolation in appropriate media is a difficult task and impractical for daily routine diagnostics, Nested-PCR (N-PCR) techniques are currently used to improve the direct diagnostic sensitivity of Swine Enzootic Pneumonia. In a first experiment, this paper describes a N-PCR technique optimization based on three variables: different sampling sites, sample transport media, and DNA extraction methods, using eight pigs. Based on the optimization results, a second experiment was conducted for testing validity using 40 animals. In conclusion, the obtained results of the N-PCR optimization and validation allow us to recommend this test as a routine monitoring diagnostic method for Mycoplasma hyopneumoniae infection in swine herds. PMID:24031248

Real-time polymerase chain reaction assay for rapid and sensitive detection of anthrax spores in spiked soil and talcum powder.

PubMed

Jain, Neha; Merwyn, S; Rai, G P; Agarwal, G S

2012-05-01

Real-time polymerase chain reaction (real-time PCR) is a laboratory technique based on PCR. This technique is able to detect sequence-specific PCR products as they accumulate in "real time" during the PCR amplification, and also to quantify the number of substrates present in the initial PCR mixture before amplification begins. In the present study, real-time PCR assay was employed for rapid and real-time detection of Bacillus anthracis spores spiked in 0.1 g of soil and talcum powder ranging from 5 to 10(7) spores. DNA was isolated from spiked soil and talcum powder, using PBS containing 1 % Triton-X-100, followed by heat treatment. The isolated DNA was used as template for real-time PCR and PCR. Real-time PCR amplification was obtained in 60 min under the annealing condition at 60°C by employing primers targeting the pag gene of B. anthracis. In the present study, the detection limit of real-time PCR assay in soil was 10(3) spores and 10(2) spores in talcum powder, respectively, whereas PCR could detect 10(4) spores in soil and 10(3) spores in talcum powder, respectively.

Development of a reverse transcription polymerase chain reaction method for yellow fever virus detection.

PubMed

Méndez, María C; Domingo, Cristina; Tenorio, Antonio; Pardo, Lissethe C; Rey, Gloria J; Méndez, Jairo A

2013-09-01

Yellow fever is considered a re-emerging disease and is endemic in tropical regions of Africa and South America. At present, there are no standardized or commercialized kits available for yellow fever virus detection. Therefore, diagnosis must be made by time-consuming routine techniques, and sometimes, the virus or its proteins are not detected. Furthermore, co-circulation with other flaviviruses, including dengue virus, increases the difficulty of diagnosis. To develop a specific reverse transcriptase-polymerase chain reaction (RT-PCR) and nested PCR-based assay to improve the detection and diagnosis of yellow fever virus using both serum and fresh tissue samples. RT-PCR primers were designed to amplify a short fragment of all yellow fever virus genotypes reported. A second set of primers was used in a nested PCR to increase sensitivity. Thirty-three clinical samples were tested with the standardized reaction. The expected amplicon was obtained in 25 out of 33 samples analyzed using this approach, and 2 more samples tested positive after a subsequent nested PCR approach. This improved technique not only ensures the specific detection of a wide range of yellow fever virus genotypes but also may increase the sensitivity of detection by introducing a second round of amplification, allowing a rapid differential diagnosis between dengue and yellow fever infection, which is required for effective surveillance and opportune epidemiologic measures.

Visible-Light Actinometry and Intermittent Illumination as Convenient Tools to Study Ru(bpy)3Cl2 Mediated Photoredox Transformations

PubMed Central

Pitre, Spencer P.; McTiernan, Christopher D.; Vine, Wyatt; DiPucchio, Rebecca; Grenier, Michel; Scaiano, Juan C.

2015-01-01

Photoredox catalysis provides many green opportunities for radical-mediated synthetic transformations. However, the determination of the underlying mechanisms has been challenging due to lack of quantitative methods that can be easily implemented in synthetic labs, where this research tends to be centered. We report here on the development, characterization and calibration of a novel actinometer based on the photocatalyst tris(2,2′-bipyridyl)ruthenium(II) chloride (Ru(bpy)3Cl2). By using the same molecule as the photocatalyst and the actinometer, we eliminate problems associated with matching sample spectral distribution, lamp-sample spectral overlap and other problems intrinsic to doing quantitative photochemistry in a laboratory that has little expertise in this area. In order to validate our actinometer system in determining the quantum yield of a Ru(bpy)3Cl2 photosensitized reaction, we test the Ru(bpy)3Cl2 catalyzed oxidation of benzhydrol to benzophenone as a model chain reaction. We also revive the rotating sector method by updating the technique for modern LED technologies and demonstrate how intermittent illumination on the timescale of milliseconds to seconds can help probe a chain reaction, using the benzhydrol to benzophenone oxidation to validate the technique. We envision these methods to have great implications in the field of photoredox catalysis, providing researchers with valuable research tools. PMID:26578341

Capillary sample introduction of polymerase chain reaction (PCR) products separated in ultrathin slab gels.

PubMed

Bullard, K M; Hietpas, P B; Ewing, A G

1998-01-01

Polymerase chain reaction (PCR) amplified short tandem repeat (STR) samples from the HUMVWF locus have been analyzed using a unique sample introduction and separation technique. A single capillary is used to transfer samples onto an ultrathin slab gel (57 microm thin). This ultrathin nondenaturing polyacrylamide gel is used to separate the amplified fragments, and laser-induced fluorescence with ethidium bromide is used for detection. The feasibility of performing STR analysis using this system has been investigated by examining the reproducibility for repeated samples. Reproducibility is examined by comparing the migration of the 14 and 17 HUMVWF alleles on three consecutive separations on the ultrathin slab gel. Using one locus, separations match in migration time with the two alleles 42 s apart for each of the three consecutive separations. This technique shows potential to increase sample throughput in STR analysis techniques although separation resolution still needs to be improved.

An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

PubMed Central

Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

2015-01-01

Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features. PMID:26579116

An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food.

PubMed

Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

2015-01-01

Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

On the complex •OH/•O--induced free radical chemistry of arylalkylamines with special emphasis on the contribution of the alkylamine side chain.

PubMed

Szabó, László; Mile, Viktória; Tóth, Tünde; Balogh, György T; Földes, Tamás; Takács, Erzsébet; Wojnárovits, László

2017-02-01

A full account of the • OH-induced free radical chemistry of an arylalkylamine is given taking all the possible reaction pathways quantitatively into consideration. Such knowledge is indispensable when the alkylamine side chain plays a crucial role in biological activity. The fundamental reactions are investigated on the model compound N-methyl-3-phenypropylamine (MPPA), and extended to its biologically active analog, to the antidepressant fluoxetine (FLX). Pulse radiolysis techniques were applied including redox titration and transient spectral analysis supplemented with DFT calculations. The contribution of the amine moiety to the free radical-induced oxidation mechanism appeared to be appreciable. • O - was used to observe hydrogen atom abstraction events at pH 14 giving rise to the strongly reducing α-aminoalkyl radicals (∼38% of the radical yield) and to benzyl (∼4%), β-aminoalkyl (∼24%), and aminyl radicals (∼31%) of MPPA. One-electron transfer was also observed yielding aminium radicals with low efficiency (∼3%). In the • OH-induced oxidation protonated α-aminoalkyl (∼49%), β-aminoalkyl (∼27%), benzyl radicals (∼4%), and aminium radicals (∼5%) are initially generated on the side chain of MPPA at pH 6, whereas hydroxycyclohexadienyl radicals (∼15%) were also produced. These initial events are followed by complex protonation-deprotonation reactions establishing acid-base equilibria; however, these processes are limited by the transient nature of the radicals and the kinetics of the ongoing reactions. The contribution of the radicals from the side chain alkylamine substituent of FLX totals up to ∼54% of the initially available oxidant yield.

9 CFR 145.33 - Terminology and classification; flocks and products.

Code of Federal Regulations, 2010 CFR

2010-01-01

.... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...

Microfabricated sleeve devices for chemical reactions

DOEpatents

Northrup, M. Allen

2003-01-01

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

PubMed Central

Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

2014-01-01

Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas. PMID:24553130

Quantitative analysis of pork and chicken products by droplet digital PCR.

PubMed

Cai, Yicun; Li, Xiang; Lv, Rong; Yang, Jielin; Li, Jian; He, Yuping; Pan, Liangwen

2014-01-01

In this project, a highly precise quantitative method based on the digital polymerase chain reaction (dPCR) technique was developed to determine the weight of pork and chicken in meat products. Real-time quantitative polymerase chain reaction (qPCR) is currently used for quantitative molecular analysis of the presence of species-specific DNAs in meat products. However, it is limited in amplification efficiency and relies on standard curves based Ct values, detecting and quantifying low copy number target DNA, as in some complex mixture meat products. By using the dPCR method, we find the relationships between the raw meat weight and DNA weight and between the DNA weight and DNA copy number were both close to linear. This enabled us to establish formulae to calculate the raw meat weight based on the DNA copy number. The accuracy and applicability of this method were tested and verified using samples of pork and chicken powder mixed in known proportions. Quantitative analysis indicated that dPCR is highly precise in quantifying pork and chicken in meat products and therefore has the potential to be used in routine analysis by government regulators and quality control departments of commercial food and feed enterprises.

Temperature control apparatus

DOEpatents

Northrup, M. Allen

2003-08-05

A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Modification of aniline containing proteins using an oxidative coupling strategy.

PubMed

Hooker, Jacob M; Esser-Kahn, Aaron P; Francis, Matthew B

2006-12-13

A new bioconjugation reaction has been developed based on the chemoselective modification of anilines through an oxidative coupling pathway. Aryl amines were installed on the surface of protein substrates through lysine acylation reactions or through the use of native chemical ligation techniques. Upon exposure to NaIO4 in aqueous buffer, the anilines coupled rapidly to the aromatic rings of N,N-dialkyl-N'-acyl-p-phenylenediamines. The identities of the reaction products were confirmed using ESI-MS and through comparison to small molecule analogs. Control experiments indicated that none of the native amino acids participated in the reaction. The resulting bioconjugates were found to be stable toward hydrolysis from pH 4 to pH 11 and in the presence of many commonly used oxidants, reductants, and nucleophiles. A fluorescent phenylenediamine reagent was synthesized for the selective detection of aniline labeled proteins in mixtures, and the reaction was used to append the C-terminus of the green fluorescent protein with a single PEG chain. When combined with techniques for the incorporation of unnatural amino acids into proteins, this bioorthogonal coupling method should prove useful for a number of applications requiring a high degree of labeling specificity.

Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction

USGS Publications Warehouse

Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.

2004-01-01

We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism.

PubMed

Souza, M T; Carvalho-Zilse, G A

2014-07-25

In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species.

Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

PubMed

Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

1997-09-01

In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

[THE COMPARATIVE ANALYSIS OF EFFECTIVENESS OF QUICK TESTS IN DIAGNOSTIC OF INFLUENZA AND RESPIRATORY SYNCYTIAL VIRAL INFECTION IN CHILDREN].

PubMed

Petrova, E R; Sukhovetskaia, V P; Pisareva, M M; Maiorova, V G; Sverlova, M V; Danilenko, D M; Petrova, P A; Krivitskaia, V Z; Sominina, A A

2015-11-01

The analysis was implemented concerning diagnostic parameters of commercial quick tests (immune chromatographic tests BinaxNOW Influenza A&B and BinaxNow RSV Alere, Scarborough Inc., USA) under detection of antigens of influenza virus A and respiratory syncytial virus in clinical materials. The polymerase chain reaction in real-time and isolation ofviruses in cell cultures. The analysis of naso-pharyngeal smears from 116 children demonstrated that sensitivity and specifcity of detection of influenza virus A using device mariPOC in comparison with polymerase chain reaction made up to 93.8% and 99.0% correspondingly at total concordance of results of both techniques as 98.3%. At diagnosing of respiratory syncytial virus using device mariPOC parameters made up to 77.3%, 98.9% and 862% as compared with polymerase chain reaction. The sensitivity, specificity and total concordance of results of immune chromatographic tests BinaxNOW in comparison ofpolymerase chain reaction made up to 86.7%, 100% and 96.2% correspondingly at detection of influenza virus A and 80.9%, 97.4% and 91.6% correspondingly at detection of respiratory syncytial virus. In comparison with isolation technique in cell cultures sensitivity of system mariPOC and immune chromatographic tests proved to be in 1.3-1.4 times higher at detection of influenza virus A and in 1.7-2 times higher in case of isolation of respiratory syncytial virus. There is no statistically significant differences between diagnostic parameters received for mariPOC and immune chromatographic tests at diagnosing influenza virus A and respiratory syncytial viral infection.

A One-Step Route to CO2 -Based Block Copolymers by Simultaneous ROCOP of CO2 /Epoxides and RAFT Polymerization of Vinyl Monomers.

PubMed

Wang, Yong; Zhao, Yajun; Ye, Yunsheng; Peng, Haiyan; Zhou, Xingping; Xie, Xiaolin; Wang, Xianhong; Wang, Fosong

2018-03-26

The one-step synthesis of well-defined CO 2 -based diblock copolymers was achieved by simultaneous ring-opening copolymerization (ROCOP) of CO 2 /epoxides and RAFT polymerization of vinyl monomers using a trithiocarbonate compound bearing a carboxylic group (TTC-COOH) as the bifunctional chain transfer agent (CTA). The double chain-transfer effect allows for independent and precise control over the molecular weight of the two blocks and ensures narrow polydispersities of the resultant block copolymers (1.09-1.14). Notably, an unusual axial group exchange reaction between the aluminum porphyrin catalyst and TTC-COOH impedes the formation of homopolycarbonates. By taking advantage of the RAFT technique, it is able to meet the stringent demand for functionality control to well expand the application scopes of CO 2 -based polycarbonates. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

PubMed

Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

2012-12-01

Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

High-throughput detection and screening of plants modified by gene editing using quantitative real-time polymerase chain reaction.

PubMed

Peng, Cheng; Wang, Hua; Xu, Xiaoli; Wang, Xiaofu; Chen, Xiaoyun; Wei, Wei; Lai, Yongmin; Liu, Guoquan; Godwin, Ian Douglas; Li, Jieqin; Zhang, Ling; Xu, Junfeng

2018-05-15

Gene editing techniques are becoming powerful tools for modifying target genes in organisms. Although several methods have been developed to detect gene-edited organisms, these techniques are time and labour intensive. Meanwhile, few studies have investigated high-throughput detection and screening strategies for plants modified by gene editing. In this study, we developed a simple, sensitive and high-throughput quantitative real-time (qPCR)-based method. The qPCR-based method exploits two differently labelled probes that are placed within one amplicon at the gene editing target site to simultaneously detect the wild-type and a gene-edited mutant. We showed that the qPCR-based method can accurately distinguish CRISPR/Cas9-induced mutants from the wild-type in several different plant species, such as Oryza sativa, Arabidopsis thaliana, Sorghum bicolor, and Zea mays. Moreover, the method can subsequently determine the mutation type by direct sequencing of the qPCR products of mutations due to gene editing. The qPCR-based method is also sufficiently sensitive to distinguish between heterozygous and homozygous mutations in T 0 transgenic plants. In a 384-well plate format, the method enabled the simultaneous analysis of up to 128 samples in three replicates without handling the post-polymerase chain reaction (PCR) products. Thus, we propose that our method is an ideal choice for screening plants modified by gene editing from many candidates in T 0 transgenic plants, which will be widely used in the area of plant gene editing. © 2018 The Authors The Plant Journal © 2018 John Wiley & Sons Ltd.

Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

PubMed

Chen, Y T; Mercer, G O; Chen, Y

1993-11-01

Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

A real-time TaqMan polymerase chain reaction for the identification of Culex vectors of West Nile and Saint Louis encephalitis viruses in North America.

PubMed

Sanogo, Yibayiri O; Kim, Chang-Hyun; Lampman, Richard; Novak, Robert J

2007-07-01

In North America, West Nile and St. Louis encephalitis viruses have been detected in a wide range of vector species, but the majority of isolations continue to be from pools of mixed mosquitoes in the Culex subgenus Culex. Unfortunately, the morphologic identification of these important disease vectors is often difficult, particularly in regions of sympatry. We developed a sensitive real-time TaqMan polymerase chain reaction assay that allows reliable identification of Culex mosquitoes including Culex pipiens pipiens, Cx. p. quinquefasciatus, Cx. restuans, Cx. salinarius, Cx. nigripalpus, and Cx. tarsalis. Primers and fluorogenic probes specific to each species were designed based on sequences of the acetylcholinesterase gene (Ace2). Both immature and adult mosquitoes were successfully identified as individuals and as mixed species pools. This identification technique provides the basis for a rapid, sensitive, and high-throughput method for expounding the species-specific contribution of vectors to various phases of arbovirus transmission.

Measuring Fission Chain Dynamics Through Inter-event Timing of Correlated Particles

NASA Astrophysics Data System (ADS)

Monterial, Mateusz

Neutrons born from fission may go on to induce subsequent fissions in self-propagating series of reactions resulting in a fission chain. Fissile materials comprise all isotopes capable of sustaining nuclear fission chain reactions, and are therefore a necessary prerequisite for the construction of a nuclear weapon. As a result the accountancy and characterization of fissile material is of great importance for national security and the international community. The rate at which neutrons "multiply" in a fissile material is a function of the composition, total mass, density, and shape of the object. These are key characteristics sought out in areas of nuclear non-proliferation, safeguards, treaty verification and emergency response. This thesis demonstrates a novel technique of measuring the underlying fission chain dynamics in fissile material through temporal correlation of neutrons and gamma rays emitted from fission. Fissile material exhibits key detectable signatures through the emission of correlated neutrons and gamma rays from fission. The Non-Destructive Assay (NDA) community has developed mature techniques of assaying fissile material that detect these signatures, such as neutron counting by thermal capture based detectors, and gamma-ray spectroscopy. An alternative use of fast organic scintillators provides three additional capabilities: (1) discrimination between neutrons and gamma-ray pulses (2) sub-nanosecond scale timing between correlated events (3) measurement of deposited neutron energy in the detector. This thesis leverages these capabilities into to measure a new signature, which is demonstrated to be sensitive to both fissile neutron multiplication and presence of neutronically coupled reflectors. In addition, a new 3D imaging method of sources of correlated gamma rays and neutrons is presented, which can improve estimation of total source volume and localization.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Disseminated histoplasmosis in a domestic cat imported from the USA to Austria

PubMed Central

Klang, Andrea; Loncaric, Igor; Spergser, Joachim; Eigelsreiter, Sabine; Weissenböck, Herbert

2013-01-01

We present a case of disseminated histoplasmosis in a domestic cat imported from the USA to Austria. Histopathological examination revealed a systemic mycosis with most severe involvement of the lungs suggestive of Histoplasma (H.) capsulatum-infection. Molecular confirmation was based on polymerase chain reaction (PCR) and sequence analysis of a fungal culture from liver samples. This is the first case of feline histoplasmosis proven by molecular diagnostic technique in Europe and reported in Austria, etc. PMID:24432230

Development of reliable techniques for the differential diagnosis of avian tumor viruses by immunohistochemistry and polymerase chain reaction from formalin-fixed paraffin-embedded tissue sections

USDA-ARS?s Scientific Manuscript database

In the past, several techniques have been developed as diagnostic tools for the differential diagnosis of tumours produced by Marek’s disease virus (MDV) from those induced by avian leukosis virus (ALV) and reticuloendotheliosis virus (REV). However, most current techniques are unreliable using form...

The J beta segment of the T cell receptor contributes to the V beta-specific T cell expansion caused by staphylococcal enterotoxin B and Urtica dioica superantigens.

PubMed

Musette, P; Galelli, A; Truffa-Bachi, P; Peumans, W; Kourilsky, P; Gachelin, G

1996-03-01

We have used a new polymerase chain reaction-based technique to analyze at the clonal level the CDR3 diversity and the J beta usage associated with the V beta-dependent T cell receptor (TCR) recognition of two superantigens: the staphylococcal enterotoxin B and the Urtica dioica agglutinin. Our results show that subset of J beta elements is preferentially expanded in a given V beta family, independently of the nature of the superantigen. By contrast, the CDR3 loop does not contribute significantly to the T cell expansion induced by the superantigens. We conclude that the J beta segment of the TCR beta chain, but not the CDR3 region, participates in superantigen binding, presumably by influencing the quaternary structure of the TCR beta chain.

GMO detection using a bioluminescent real time reporter (BART) of loop mediated isothermal amplification (LAMP) suitable for field use.

PubMed

Kiddle, Guy; Hardinge, Patrick; Buttigieg, Neil; Gandelman, Olga; Pereira, Clint; McElgunn, Cathal J; Rizzoli, Manuela; Jackson, Rebecca; Appleton, Nigel; Moore, Cathy; Tisi, Laurence C; Murray, James A H

2012-04-30

There is an increasing need for quantitative technologies suitable for molecular detection in a variety of settings for applications including food traceability and monitoring of genetically modified (GM) crops and their products through the food processing chain. Conventional molecular diagnostics utilising real-time polymerase chain reaction (RT-PCR) and fluorescence-based determination of amplification require temperature cycling and relatively complex optics. In contrast, isothermal amplification coupled to a bioluminescent output produced in real-time (BART) occurs at a constant temperature and only requires a simple light detection and integration device. Loop mediated isothermal amplification (LAMP) shows robustness to sample-derived inhibitors. Here we show the applicability of coupled LAMP and BART reactions (LAMP-BART) for determination of genetically modified (GM) maize target DNA at low levels of contamination (0.1-5.0% GM) using certified reference material, and compare this to RT-PCR. Results show that conventional DNA extraction methods developed for PCR may not be optimal for LAMP-BART quantification. Additionally, we demonstrate that LAMP is more tolerant to plant sample-derived inhibitors, and show this can be exploited to develop rapid extraction techniques suitable for simple field-based qualitative tests for GM status determination. We also assess the effect of total DNA assay load on LAMP-BART quantitation. LAMP-BART is an effective and sensitive technique for GM detection with significant potential for quantification even at low levels of contamination and in samples derived from crops such as maize with a large genome size. The resilience of LAMP-BART to acidic polysaccharides makes it well suited to rapid sample preparation techniques and hence to both high throughput laboratory settings and to portable GM detection applications. The impact of the plant sample matrix and genome loading within a reaction must be controlled to ensure quantification at low target concentrations.

Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

USDA-ARS?s Scientific Manuscript database

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis

PubMed Central

Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

2014-01-01

This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment. PMID:25178301

Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

PubMed

Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

2014-10-01

This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

Genetic structure of soil population of fungus Fusarium oxysporum Schlechtend.: Fr.: Molecular reidentification of the species and genetic differentiation of isolates using polymerase chain reaction technique with universal primers (UP-PCR)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bulat, S.A.; Mironenko, N.V.; Zholkevich, Yu.G.

1995-07-01

The genetic structure of three soil populations of fungus Fusarium oxysporum was analyzed using polymerase chain reaction with universal primers (UP-PCR). Distinct UP-PCR variants revealed by means of cross-dot hybridization of amplified DNA and restriction analysis of nuclear ribosomal DNA represent subspecies or sibling species of F. oxysporum. The remaining isolates of F. oxysporum showed moderate UP-PCR polymorphism characterized by numerous types, whose relatedness was analyzed by computer treatment of the UP-PCR patterns. The genetic distance trees based on the UP-PCR patterns, which were obtained with different universal primers, demonstrated similar topology. This suggests that evolutionarily important genome rearrangements correlativelymore » occur within the entire genome. Isolates representing different UP-PCR polymorphisms were encountered in all populations, being distributed asymmetrically in two of these. In general, soil populations of F. oxysporum were represented by numerous genetically isolated groups with a similar genome structure. The genetic heterogeneity of the isolates within these groups is likely to be caused by the parasexual process. The usefulness of the UP-PCR technique for population studies of F. oxysporum was demonstrated. 39 refs., 7 figs., 2 tabs.« less

Development and validation of a reverse transcription quantitative polymerase chain reaction for tilapia lake virus detection in clinical samples and experimentally challenged fish.

PubMed

Tattiyapong, P; Sirikanchana, K; Surachetpong, W

2018-02-01

Tilapia lake virus (TiLV) is an emerging pathogen associated with high mortalities of wild and farm-raised tilapia in different countries. In this study, a SYBR green-based reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay targeting segment three of the virus was developed to detect and quantify TiLV in clinical samples and experimentally challenged fish. All 30 field samples with clinical signs and history consistent with TiLV infection were positive for TiLV as detected by the developed RT-qPCR method. The RT-qPCR technique provided 100 and 10,000 times more sensitive for virus detection than those offered by the RT-PCR and virus isolation in cell culture methods, respectively. The detection limit of the RT-qPCR method was as low as two viral copies/μl. Moreover, the RT-qPCR technique could be applied for TiLV detection in various fish tissues including gills, liver, brain, heart, anterior kidney and spleen. Significantly, this study delivered an accurate and reliable method for rapid detection of TiLV viruses that facilitates active surveillance programme and disease containment. © 2017 John Wiley & Sons Ltd.

Selective Transformation of β-Lactam Antibiotics by Peroxymonosulfate: Reaction Kinetics and Nonradical Mechanism.

PubMed

Chen, Jiabin; Fang, Cong; Xia, Wenjun; Huang, Tianyin; Huang, Ching-Hua

2018-02-06

While the β-lactam antibiotics are known to be susceptible to oxidative degradation by sulfate radical (SO 4 •- ), here we report that peroxymonosulfate (PMS) exhibits specific high reactivity toward β-lactam antibiotics without SO 4 •- generation for the first time. Apparent second-order reaction constants (k 2,app ) were determined for the reaction of PMS with three penicillins, five cephalosporins, two carbapenems, and several structurally related chemicals. The pH-dependency of k 2,app could be well modeled based on species-specific reactions. On the basis of reaction kinetics, stoichiometry, and structure-activity assessment, the thioether sulfur, on the six- or five-membered rings (penicillins and cephalosporins) and the side chain (carbapenems), was the main reaction site for PMS oxidation. Cephalosporins were more reactive toward PMS than penicillins and carbapenems, and the presence of a phenylglycine side chain significantly enhanced cephalosporins' reactivity toward PMS. Product analysis indicated oxidation of β-lactam antibiotics to two stereoisomeric sulfoxides. A radical scavenging study and electron paramagnetic resonance (EPR) technique confirmed lack of involvement of radical species (e.g., SO 4 •- ). Thus, the PMS-induced oxidation of β-lactam antibiotics was proposed to proceed through a nonradical mechanism involving direct two-electron transfer along with the heterolytic cleavage of the PMS peroxide bond. The new findings of this study are important for elimination of β-lactam antibiotic contamination, because PMS exhibits specific high reactivity and suffers less interference from the water matrix than the radical process.

Teaching Molecular Biological Techniques in a Research Content

ERIC Educational Resources Information Center

Stiller, John W.; Coggins, T. Chad

2006-01-01

Molecular biological methods, such as the polymerase chain reaction (PCR) and gel electrophoresis, are now commonly taught to students in introductory biology courses at the college and even high school levels. This often includes hands-on experience with one or more molecular techniques as part of a general biology laboratory. To assure that most…

Aligning Goals, Assessments, and Activities: An Approach to Teaching PCR and Gel Electrophoresis

ERIC Educational Resources Information Center

Phillips, Allison R.; Robertson, Amber L.; Batzli, Janet; Harris, Michelle; Miller, Sarah

2008-01-01

Polymerase chain reaction (PCR) and gel electrophoresis have become common techniques used in undergraduate molecular and cell biology labs. Although students enjoy learning these techniques, they often cannot fully comprehend and analyze the outcomes of their experiments because of a disconnect between concepts taught in lecture and experiments…

Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

PubMed Central

Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

2014-01-01

A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

Inquiry-based experiments for large-scale introduction to PCR and restriction enzyme digests.

PubMed

Johanson, Kelly E; Watt, Terry J

2015-01-01

Polymerase chain reaction and restriction endonuclease digest are important techniques that should be included in all Biochemistry and Molecular Biology laboratory curriculums. These techniques are frequently taught at an advanced level, requiring many hours of student and faculty time. Here we present two inquiry-based experiments that are designed for introductory laboratory courses and combine both techniques. In both approaches, students must determine the identity of an unknown DNA sequence, either a gene sequence or a primer sequence, based on a combination of PCR product size and restriction digest pattern. The experimental design is flexible, and can be adapted based on available instructor preparation time and resources, and both approaches can accommodate large numbers of students. We implemented these experiments in our courses with a combined total of 584 students and have an 85% success rate. Overall, students demonstrated an increase in their understanding of the experimental topics, ability to interpret the resulting data, and proficiency in general laboratory skills. © 2015 The International Union of Biochemistry and Molecular Biology.

Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

EPA Science Inventory

The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

Identification of Microorganisms by Modern Analytical Techniques.

PubMed

Buszewski, Bogusław; Rogowska, Agnieszka; Pomastowski, Paweł; Złoch, Michał; Railean-Plugaru, Viorica

2017-11-01

Rapid detection and identification of microorganisms is a challenging and important aspect in a wide range of fields, from medical to industrial, affecting human lives. Unfortunately, classical methods of microorganism identification are based on time-consuming and labor-intensive approaches. Screening techniques require the rapid and cheap grouping of bacterial isolates; however, modern bioanalytics demand comprehensive bacterial studies at a molecular level. Modern approaches for the rapid identification of bacteria use molecular techniques, such as 16S ribosomal RNA gene sequencing based on polymerase chain reaction or electromigration, especially capillary zone electrophoresis and capillary isoelectric focusing. However, there are still several challenges with the analysis of microbial complexes using electromigration technology, such as uncontrolled aggregation and/or adhesion to the capillary surface. Thus, an approach using capillary electrophoresis of microbial aggregates with UV and matrix-assisted laser desorption ionization time-of-flight MS detection is presented.

Hybridization chain reaction: a versatile molecular tool for biosensing, bioimaging, and biomedicine.

PubMed

Bi, Sai; Yue, Shuzhen; Zhang, Shusheng

2017-07-17

Developing powerful, simple and low-cost DNA amplification techniques is of great significance to bioanalysis and biomedical research. Thus far, many signal amplification strategies have been developed, such as polymerase chain reaction (PCR), rolling circle amplification (RCA), and DNA strand displacement amplification (SDA). In particular, hybridization chain reaction (HCR), a type of toehold-mediated strand displacement (TMSD) reaction, has attracted great interest because of its enzyme-free nature, isothermal conditions, simple protocols, and excellent amplification efficiency. In a typical HCR, an analyte initiates the cross-opening of two DNA hairpins, yielding nicked double helices that are analogous to alternating copolymers. As an efficient amplification platform, HCR has been utilized for the sensitive detection of a wide variety of analytes, including nucleic acids, proteins, small molecules, and cells. In recent years, more complicated sets of monomers have been designed to develop nonlinear HCR, such as branched HCR and even dendritic systems, achieving quadratic and exponential growth mechanisms. In addition, HCR has attracted enormous attention in the fields of bioimaging and biomedicine, including applications in fluorescence in situ hybridization (FISH) imaging, live cell imaging, and targeted drug delivery. In this review, we introduce the fundamentals of HCR and examine the visualization and analysis techniques for HCR products in detail. The most recent HCR developments in biosensing, bioimaging, and biomedicine are subsequently discussed with selected examples. Finally, the review provides insight into the challenges and future perspectives of HCR.

Microfluidics for cell-based high throughput screening platforms - A review.

PubMed

Du, Guansheng; Fang, Qun; den Toonder, Jaap M J

2016-01-15

In the last decades, the basic techniques of microfluidics for the study of cells such as cell culture, cell separation, and cell lysis, have been well developed. Based on cell handling techniques, microfluidics has been widely applied in the field of PCR (Polymerase Chain Reaction), immunoassays, organ-on-chip, stem cell research, and analysis and identification of circulating tumor cells. As a major step in drug discovery, high-throughput screening allows rapid analysis of thousands of chemical, biochemical, genetic or pharmacological tests in parallel. In this review, we summarize the application of microfluidics in cell-based high throughput screening. The screening methods mentioned in this paper include approaches using the perfusion flow mode, the droplet mode, and the microarray mode. We also discuss the future development of microfluidic based high throughput screening platform for drug discovery. Copyright © 2015 Elsevier B.V. All rights reserved.

DNA recognition by peptide nucleic acid-modified PCFs: from models to real samples

NASA Astrophysics Data System (ADS)

Selleri, S.; Coscelli, E.; Poli, F.; Passaro, D.; Cucinotta, A.; Lantano, C.; Corradini, R.; Marchelli, R.

2010-04-01

The increased concern, emerged in the last few years, on food products safety has stimulated the research on new techniques for traceability of raw food materials. DNA analysis is one of the most powerful tools for the certification of food quality, and it is presently performed through the polymerase chain reaction technique. Photonic crystal fibers, due to the presence of an array of air holes running along their length, can be exploited for performing DNA recognition by derivatizing hole surfaces and checking hybridization of complementary nucledotide chains in the sample. In this paper the application of a suspended core photonic crystal fiber in the recognition of DNA sequences is discussed. The fiber is characterized in terms of electromagnetic properties by means of a full-vector modal solver based on the finite element method. Then, the performances of the fiber in the recognition of mall synthetic oligonucleotides are discussed, together with a test of the possibility to extend this recognition to samples of DNA of applicative interest, such as olive leaves.

Antibiotic resistance and molecular typing among cockle (Anadara granosa) strains of Vibrio parahaemolyticus by polymerase chain reaction (PCR)-based analysis.

PubMed

Sahilah, A M; Laila, R A S; Sallehuddin, H Mohd; Osman, H; Aminah, A; Ahmad Azuhairi, A

2014-02-01

Genomic DNA of Vibrio parahaemolyticus were characterized by antibiotic resistance, enterobacterial repetitive intergenic consensus-polymerase chain reaction (ERIC-PCR) and random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) analysis. These isolates originated from 3 distantly locations of Selangor, Negeri Sembilan and Melaka (East coastal areas), Malaysia. A total of 44 (n = 44) of tentatively V. parahaemolyticus were also examined for the presence of toxR, tdh and trh gene. Of 44 isolates, 37 were positive towards toxR gene; while, none were positive to tdh and trh gene. Antibiotic resistance analysis showed the V. parahaemolyticus isolates were highly resistant to bacitracin (92%, 34/37) and penicillin (89%, 33/37) followed by resistance towards ampicillin (68%, 25/37), cefuroxime (38%, 14/37), amikacin (6%, 2/37) and ceftazidime (14%, 5/37). None of the V. parahaemolyticus isolates were resistant towards chloramphenicol, ciprofloxacin, ceftriaxone, enrofloxacin, norfloxacin, streptomycin and vancomycin. Antibiogram patterns exhibited, 9 patterns and phenotypically less heterogenous when compared to PCR-based techniques using ERIC- and RAPD-PCR. The results of the ERIC- and RAPD-PCR were analyzed using GelCompare software. ERIC-PCR with primers ERIC1R and ERIC2 discriminated the V. parahaemolyticus isolates into 6 clusters and 21 single isolates at a similarity level of 80%. While, RAPD-PCR with primer Gen8 discriminated the V. parahaemolyticus isolates into 11 clusters and 10 single isolates and Gen9 into 8 clusters and 16 single isolates at the same similarity level examined. Results in the presence study demonstrated combination of phenotypically and genotypically methods show a wide heterogeneity among cockle isolates of V. parahaemolyticus.

Utilizing a polymerase chain reaction method for the detection of Toxocara canis and T. cati eggs in soil.

PubMed

Fogt-Wyrwas, R; Jarosz, W; Mizgajska-Wiktor, H

2007-03-01

A polymerase chain reaction (PCR) technique has been used for the differentiation of T. canis and T. cati eggs isolated from soil and previously identified from microscopical observations. The method, using specific primers for the identification of the two Toxocara species, was assessed in both the field and laboratory. Successful results were obtained when only a single or large numbers of eggs were recovered from 40 g soil samples. The method is sensitive, allows analysis of material independent of the stage of egg development and can be adapted for the recovery of other species of parasites from soil.

[The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

PubMed

D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

1993-01-01

The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

Concept of combinatorial de novo design of drug-like molecules by particle swarm optimization.

PubMed

Hartenfeller, Markus; Proschak, Ewgenij; Schüller, Andreas; Schneider, Gisbert

2008-07-01

We present a fast stochastic optimization algorithm for fragment-based molecular de novo design (COLIBREE, Combinatorial Library Breeding). The search strategy is based on a discrete version of particle swarm optimization. Molecules are represented by a scaffold, which remains constant during optimization, and variable linkers and side chains. Different linkers represent virtual chemical reactions. Side-chain building blocks were obtained from pseudo-retrosynthetic dissection of large compound databases. Here, ligand-based design was performed using chemically advanced template search (CATS) topological pharmacophore similarity to reference ligands as fitness function. A weighting scheme was included for particle swarm optimization-based molecular design, which permits the use of many reference ligands and allows for positive and negative design to be performed simultaneously. In a case study, the approach was applied to the de novo design of potential peroxisome proliferator-activated receptor subtype-selective agonists. The results demonstrate the ability of the technique to cope with large combinatorial chemistry spaces and its applicability to focused library design. The technique was able to perform exploitation of a known scheme and at the same time explorative search for novel ligands within the framework of a given molecular core structure. It thereby represents a practical solution for compound screening in the early hit and lead finding phase of a drug discovery project.

Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

PubMed Central

Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

2009-01-01

Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310

Simplification of reversible Markov chains by removal of states with low equilibrium occupancy.

PubMed

Ullah, Ghanim; Bruno, William J; Pearson, John E

2012-10-21

We present a practical method for simplifying Markov chains on a potentially large state space when detailed balance holds. A simple and transparent technique is introduced to remove states with low equilibrium occupancy. The resulting system has fewer parameters. The resulting effective rates between the remaining nodes give dynamics identical to the original system's except on very fast timescales. This procedure amounts to using separation of timescales to neglect small capacitance nodes in a network of resistors and capacitors. We illustrate the technique by simplifying various reaction networks, including transforming an acyclic four-node network to a three-node cyclic network. For a reaction step in which a ligand binds, the law of mass action implies a forward rate proportional to ligand concentration. The effective rates in the simplified network are found to be rational functions of ligand concentration. Copyright © 2012 Elsevier Ltd. All rights reserved.

Optimisation of techniques for quantification of Botrytis cinerea in grape berries and receptacles by quantitative polymerase chain reaction

USDA-ARS?s Scientific Manuscript database

Quantitative PCR (qPCR) can be used to detect and monitor pathogen colonization, but early attempts to apply the technology to Botrytis cinerea infection of grape berries have identified limitations to current techniques. In this study, four DNA extraction methods, two grinding methods, two grape or...

Polymer-based microfluidic chips for isothermal amplification of nucleic acids

NASA Astrophysics Data System (ADS)

Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

2017-11-01

Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

Ultrasensitive electrochemical DNA detection based on dual amplification of circular strand-displacement polymerase reaction and hybridization chain reaction.

PubMed

Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

2013-09-15

We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.

Droplet-Based Segregation and Extraction of Concentrated Samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buie, C R; Buckley, P; Hamilton, J

2007-02-23

Microfluidic analysis often requires sample concentration and separation techniques to isolate and detect analytes of interest. Complex or scarce samples may also require an orthogonal separation and detection method or off-chip analysis to confirm results. To perform these additional steps, the concentrated sample plug must be extracted from the primary microfluidic channel with minimal sample loss and dilution. We investigated two extraction techniques; injection of immiscible fluid droplets into the sample stream (''capping'''') and injection of the sample into an immiscible fluid stream (''extraction''). From our results we conclude that capping is the more effective partitioning technique. Furthermore, this functionalitymore » enables additional off-chip post-processing procedures such as DNA/RNA microarray analysis, realtime polymerase chain reaction (RT-PCR), and culture growth to validate chip performance.« less

Molecular typing of Lactobacillus brevis isolates from Korean food using repetitive element-polymerase chain reaction.

PubMed

Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo

2018-06-01

Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.

Correlation between MGMT promoter methylation and response to temozolomide-based therapy in neuroendocrine neoplasms: an observational retrospective multicenter study.

PubMed

Campana, Davide; Walter, Thomas; Pusceddu, Sara; Gelsomino, Fabio; Graillot, Emmanuelle; Prinzi, Natalie; Spallanzani, Andrea; Fiorentino, Michelangelo; Barritault, Marc; Dall'Olio, Filippo; Brighi, Nicole; Biasco, Guido

2018-06-01

Temozolomide (TEM) based therapy has been reported being effective in the treatment of metastatic neuroendocrine neoplasms (NEN), with response rates ranging from 30 to 70%. Among patients affected by advanced glioblastoma or melanoma and treated with TEM, loss of tumoral O6-methylguanine DNA methyltransferase (MGMT) is correlated with improved survival. In NEN patients, the role of MGMT deficiency in predicting clinical outcomes of TEM treatment is still under debate. In this study we evaluated 95 patients with advanced NENs undergoing treatment with TEM-based therapy. MGMT promoter methylation status was evaluated with two techniques: methylation specific-polymerase chain reaction or pyrosequencing. Treatment with TEM-based therapy was associated with an overall response rate of 27.4% according to RECIST criteria (51.8% of patients with and 17.7% without MGMT promoter methylation). Response to therapy, progression free survival and overall survival was correlated to MGMT status at univariate and multivariate analysis. Methylation of MGMT promoter could be a strong predictive factor of objective response and an important prognostic factor of a longer PFS and OS. According to our results, MGMT methylation status, evaluated with methylation specific-polymerase chain reaction or pyrosequencing, should have an important role in patients with metastatic NENs, in order to guide therapeutic options. These results need further confirmation with prospective studies.

Different DNA methylation patterns detected by the Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) technique among various cell types of bulls.

PubMed

Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol

2010-03-05

The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90%) were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8%) and the lowest in fibroblastic DNA (92.3%, P < or = 0.05). Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P < or = 0.05). The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic cells.

On-site identification of meat species in processed foods by a rapid real-time polymerase chain reaction system.

PubMed

Furutani, Shunsuke; Hagihara, Yoshihisa; Nagai, Hidenori

2017-09-01

Correct labeling of foods is critical for consumers who wish to avoid a specific meat species for religious or cultural reasons. Therefore, gene-based point-of-care food analysis by real-time Polymerase Chain Reaction (PCR) is expected to contribute to the quality control in the food industry. In this study, we perform rapid identification of meat species by our portable rapid real-time PCR system, following a very simple DNA extraction method. Applying these techniques, we correctly identified beef, pork, chicken, rabbit, horse, and mutton in processed foods in 20min. Our system was sensitive enough to detect the interfusion of about 0.1% chicken egg-derived DNA in a processed food sample. Our rapid real-time PCR system is expected to contribute to the quality control in food industries because it can be applied for the identification of meat species, and future applications can expand its functionality to the detection of genetically modified organisms or mutations. Copyright © 2017 Elsevier Ltd. All rights reserved.

Typing of mutans streptococci by arbitrarily primed polymerase chain reaction.

PubMed

Saarela, M; Hannula, J; Mättö, J; Asikainen, S; Alaluusua, S

1996-01-01

The discriminative power of the arbitrarily primed polymerase chain reaction (AP-PCR) in differentiating between Streptococcus mutans and Strep. sobrinus species, serotypes and clones was investigated. Mutans streptococcal isolates (12(7)) obtained from 65 individuals (1-10 isolates per individual) were AP-PCR typed separately with two random primers, OPA-05 and OPA-13. Bacterial cell lysates were used as a template in PCR reactions, which made AP-PCR easy and fast to perform. Eighty-one isolates from 19 individuals were also ribotyped to compare the discriminative ability of ribotyping and AP-PCR techniques. AP-PCR performed with the two primers differentiated between Strep. mutans and Strep. sobrinus isolates, but neither primer detected serotype-specific amplification products. OPA-05 distinguished two main AP-PCR patterns among Strep. mutans isolates and one main pattern among Strep. sobrinus isolates, whereas OPA-13 found one main AP-PCR pattern among Strep. mutans isolates and two main patterns among Strep. sobrinus isolates. Ribotyping and AP-PCR revealed 40 and 33 different types among 81 selected isolates, respectively. Both techniques detected intra-individual heterogeneity in 16 out of 19 participants. The results indicate that AP-PCR has good discriminative ability in differentiating between mutans streptococcal clones and that the technique is suitable for epidemiological studies on mutans streptococci.

Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

PubMed

Zhou, Yu; Pearson, John E; Auerbach, Anthony

2005-12-01

We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

[Comparative cost analysis of molecular biology methods in the diagnosis of sarcomas].

PubMed

Baffert, Sandrine; Italiano, Antoine; Pierron, Gaëlle; Traoré, Marie-Angèle; Rapp, Jocelyn; Escande, Fabienne; Ghnassia, Jean-Pierre; Terrier, Philippe; Voegeli, Anne-Claire; Ranchere-Vince, Dominique; Coindre, Jean-Michel; Pedeutour, Florence

2013-10-01

Sarcomas represent a complex and heterogeneous group of rare malignant tumors and their correct diagnosis is often difficult. Recent molecular biological techniques have been of great diagnostic use and there is a need to assess the cost of these procedures in routine clinical practice. Using prospective and observational data from eight molecular biology laboratories in France, we used "microcosting" method to assess the cost of molecular biological techniques in the diagnosis of five types of sarcoma. The mean cost of fluorescence in situ hybridization (FISH) was 318 € (273-393) per sample; mean reverse transcription polymerase chain reaction (RT-PCR) cost ranged from 300 € (229-481) per formalin-fixed, paraffin-embedded specimen to 258 € (213-339) per frozen specimen; mean quantitative polymerase chain reaction (Q-PCR) cost was 184 € (112-229) and mean CGH-array cost was 332 € (329-335). The cost of these recently implemented techniques varied according to the type of sarcoma; the method of tissue collection and local organizational factors including the level of local expertise and investment. The cost of molecular diagnostic techniques needs to be balanced against their respective performance.

Hybridization chain reaction-based instantaneous derivatization technology for chemiluminescence detection of specific DNA sequences.

PubMed

Wang, Xin; Lau, Choiwan; Kai, Masaaki; Lu, Jianzhong

2013-05-07

We propose here a new amplifying strategy that uses hybridization chain reaction (HCR) to detect specific sequences of DNA, where stable DNA monomers assemble on the magnetic beads only upon exposure to a target DNA. Briefly, in the HCR process, two complementary stable species of hairpins coexist in solution until the introduction of initiator reporter strands triggers a cascade of hybridization events that yield nicked double helices analogous to alternating copolymers. Moreover, a "sandwich-type" detection strategy is employed in our design. Magnetic beads, which are functionalized with capture DNA, are reacted with the target, and sandwiched with the above nicked double helices. Then, chemiluminescence (CL) detection proceeds via an instantaneous derivatization reaction between a specific CL reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG), and the guanine nucleotides within the target DNA, reporter strands and DNA monomers for the generation of light. Our results clearly show that the amplification detection of specific sequences of DNA achieves a better performance (e.g. wide linear response range, low detection limit, and high specificity) as compared to the traditional sandwich type (capture/target/reporter) assays. Upon modification, the approach presented could be extended to detect other types of targets. We believe that this simple technique is promising for improving medical diagnosis and treatment.

A non-radioisotopic quantitative competitive polymerase chain reaction method: application in measurement of human herpesvirus 7 load.

PubMed

Kidd, I M; Clark, D A; Emery, V C

2000-06-01

Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed.

A method for quantitative analysis of standard and high-throughput qPCR expression data based on input sample quantity.

PubMed

Adamski, Mateusz G; Gumann, Patryk; Baird, Alison E

2014-01-01

Over the past decade rapid advances have occurred in the understanding of RNA expression and its regulation. Quantitative polymerase chain reactions (qPCR) have become the gold standard for quantifying gene expression. Microfluidic next generation, high throughput qPCR now permits the detection of transcript copy number in thousands of reactions simultaneously, dramatically increasing the sensitivity over standard qPCR. Here we present a gene expression analysis method applicable to both standard polymerase chain reactions (qPCR) and high throughput qPCR. This technique is adjusted to the input sample quantity (e.g., the number of cells) and is independent of control gene expression. It is efficiency-corrected and with the use of a universal reference sample (commercial complementary DNA (cDNA)) permits the normalization of results between different batches and between different instruments--regardless of potential differences in transcript amplification efficiency. Modifications of the input quantity method include (1) the achievement of absolute quantification and (2) a non-efficiency corrected analysis. When compared to other commonly used algorithms the input quantity method proved to be valid. This method is of particular value for clinical studies of whole blood and circulating leukocytes where cell counts are readily available.

Feasibility determination for use of polymerase chain reaction in the U.S. Air Force air-transportable hospital field environment: lessons learned.

PubMed

Niemeyer, D M; Jaffe, R I; Wiggins, L B

2000-11-01

At present, the use of molecular probes and polymerase chain reaction (PCR) for the identification of microorganisms in body fluids or tissues is becoming more commonplace. There is an added advantage when serological or culture methods are difficult, expensive, or unavailable. Slow-growing or fastidious microorganisms, including Mycobacterium tuberculosis, spirochetes, viruses, and the dimorphic fungi, can be detected rapidly using these techniques. The presence of different chromosomal or plasmid-mediated antibiotic-resistant markers can also be determined. PCR is an extremely powerful tool that has been applied to research, and more recently it has been used to augment standard clinical applications. It is a very simple process that can amplify nucleic acid sequences, both DNA and RNA, a million times over. The sensitivity, rapidity, broad applicability, and compactness of this technology make it an ideal candidate for use in the military arena. We recently established a molecular biology laboratory at a Deployable Medical System at the Camp Parks Army Reserve Training Facility in Dublin, California. This article will briefly summarize the use of PCR and its applicability in the air-transportable hospital field environment. Proper handling, processing, and testing as well as the requirements for setting up a molecular biology laboratory will be discussed. Finally, the benefits and disadvantages of using PCR-based techniques in the deployed field environment will be considered.

Introductory Laboratory Exercises in Radiobiology

ERIC Educational Resources Information Center

Williams, J. R. Parry; Servant, D. M.

1970-01-01

Describes experiments suitable for introducing use of radioisotopes in biology. Includes demonstrations of tracing food chains, uptake of ions by plants, concentration of elements by insects, tracing photosynthetic reactions, activation analysis of copper, and somatic and genetic effects. Uses autoradiographic and counting techniques. (AL)

Evaluation of Four RNA Extraction Methods for Gene Expression Analyses of Cryptosporidium parvum and Toxoplasma gondii Oocys

EPA Science Inventory

Cryptosporidium spp. and Toxoplasma gondii are important coccidian parasites that have caused waterborne and foodborne disease outbreaks worldwide. Techniques like subtractive hybridization, microarrays, and quantitative reverse transcriptase real-time polymerase chain reaction (...

Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nasarabadi, Shanavaz

2011-01-11

A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

A comparison of molecular and enzyme-based assays for the detection of thiopurine methyltransferase mutations.

PubMed

Coulthard, S A; Rabello, C; Robson, J; Howell, C; Minto, L; Middleton, P G; Gandhi, M K; Jackson, G; McLelland, J; O'Brien, H; Smith, S; Reid, M M; Pearson, A D; Hall, A G

2000-09-01

S-Methylation by thiopurine methyltransferase (TPMT) is an important route of metabolism for the thiopurine drugs. About one in 300 individuals are homozygous for a TPMT mutation associated with very low enzyme activity and severe myelosuppression if treated with standard doses of drug. To validate the use of molecular genetic techniques for the detection of TPMT deficiency, we have determined red blood cell TPMT activity in 240 adult blood donors and 55 normal children. Genotype was determined by restriction fragment length analysis of polymerase chain reaction products in a cohort of 79 of the blood donors and five cases of azathioprine-induced myelosupression, and this confirmed a close relationship between genotype and phenotype. In 17 of the 24 cases in which mutations were found, DNA was also available from remission bone marrow. In one of these cases, DNA from the remission marrow sample indicated the presence of a non-mutated allele that had not been seen in the blast DNA sample obtained at presentation. These results indicate that polymerase chain reaction-based assays give reliable and robust results for the detection of TPMT deficiency, but that caution should be exercised in relying exclusively on DNA obtained from lymphoblasts in childhood leukaemia.

Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis).

PubMed

Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret

2003-12-01

A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

Computer Recreations.

ERIC Educational Resources Information Center

Dewdney, A. K.

1988-01-01

Describes the creation of the computer program "BOUNCE," designed to simulate a weighted piston coming into equilibrium with a cloud of bouncing balls. The model follows the ideal gas law. Utilizes the critical event technique to create the model. Discusses another program, "BOOM," which simulates a chain reaction. (CW)

A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

PubMed Central

Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

2014-01-01

The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

Efficient sampling of reversible cross-linking polymers: Self-assembly of single-chain polymeric nanoparticles

NASA Astrophysics Data System (ADS)

Oyarzún, Bernardo; Mognetti, Bortolo Matteo

2018-03-01

We present a new simulation technique to study systems of polymers functionalized by reactive sites that bind/unbind forming reversible linkages. Functionalized polymers feature self-assembly and responsive properties that are unmatched by the systems lacking selective interactions. The scales at which the functional properties of these materials emerge are difficult to model, especially in the reversible regime where such properties result from many binding/unbinding events. This difficulty is related to large entropic barriers associated with the formation of intra-molecular loops. In this work, we present a simulation scheme that sidesteps configurational costs by dedicated Monte Carlo moves capable of binding/unbinding reactive sites in a single step. Cross-linking reactions are implemented by trial moves that reconstruct chain sections attempting, at the same time, a dimerization reaction between pairs of reactive sites. The model is parametrized by the reaction equilibrium constant of the reactive species free in solution. This quantity can be obtained by means of experiments or atomistic/quantum simulations. We use the proposed methodology to study the self-assembly of single-chain polymeric nanoparticles, starting from flexible precursors carrying regularly or randomly distributed reactive sites. We focus on understanding differences in the morphology of chain nanoparticles when linkages are reversible as compared to the well-studied case of irreversible reactions. Intriguingly, we find that the size of regularly functionalized chains, in good solvent conditions, is non-monotonous as a function of the degree of functionalization. We clarify how this result follows from excluded volume interactions and is peculiar of reversible linkages and regular functionalizations.

Diagnosis of toxoplasmosis and typing of Toxoplasma gondii.

PubMed

Liu, Quan; Wang, Ze-Dong; Huang, Si-Yang; Zhu, Xing-Quan

2015-05-28

Toxoplasmosis, caused by the obligate intracellular protozoan Toxoplasma gondii, is an important zoonosis with medical and veterinary importance worldwide. The disease is mainly contracted by ingesting undercooked or raw meat containing viable tissue cysts, or by ingesting food or water contaminated with oocysts. The diagnosis and genetic characterization of T. gondii infection is crucial for the surveillance, prevention and control of toxoplasmosis. Traditional approaches for the diagnosis of toxoplasmosis include etiological, immunological and imaging techniques. Diagnosis of toxoplasmosis has been improved by the emergence of molecular technologies to amplify parasite nucleic acids. Among these, polymerase chain reaction (PCR)-based molecular techniques have been useful for the genetic characterization of T. gondii. Serotyping methods based on polymorphic polypeptides have the potential to become the choice for typing T. gondii in humans and animals. In this review, we summarize conventional non-DNA-based diagnostic methods, and the DNA-based molecular techniques for the diagnosis and genetic characterization of T. gondii. These techniques have provided foundations for further development of more effective and accurate detection of T. gondii infection. These advances will contribute to an improved understanding of the epidemiology, prevention and control of toxoplasmosis.

Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

PubMed

Garg, Pankaj

2017-07-01

Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

Theoretical and computer models of detonation in solid explosives

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tarver, C.M.; Urtiew, P.A.

1997-10-01

Recent experimental and theoretical advances in understanding energy transfer and chemical kinetics have led to improved models of detonation waves in solid explosives. The Nonequilibrium Zeldovich - von Neumann - Doring (NEZND) model is supported by picosecond laser experiments and molecular dynamics simulations of the multiphonon up-pumping and internal vibrational energy redistribution (IVR) processes by which the unreacted explosive molecules are excited to the transition state(s) preceding reaction behind the leading shock front(s). High temperature, high density transition state theory calculates the induction times measured by laser interferometric techniques. Exothermic chain reactions form product gases in highly excited vibrational states,more » which have been demonstrated to rapidly equilibrate via supercollisions. Embedded gauge and Fabry-Perot techniques measure the rates of reaction product expansion as thermal and chemical equilibrium is approached. Detonation reaction zone lengths in carbon-rich condensed phase explosives depend on the relatively slow formation of solid graphite or diamond. The Ignition and Growth reactive flow model based on pressure dependent reaction rates and Jones-Wilkins-Lee (JWL) equations of state has reproduced this nanosecond time resolved experimental data and thus has yielded accurate average reaction zone descriptions in one-, two- and three- dimensional hydrodynamic code calculations. The next generation reactive flow model requires improved equations of state and temperature dependent chemical kinetics. Such a model is being developed for the ALE3D hydrodynamic code, in which heat transfer and Arrhenius kinetics are intimately linked to the hydrodynamics.« less

No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

PubMed

D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

2006-10-01

Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

Chemiluminescence resonance energy transfer imaging on magnetic particles for single-nucleotide polymorphism detection based on ligation chain reaction.

PubMed

Bi, Sai; Zhang, Zhipeng; Dong, Ying; Wang, Zonghua

2015-03-15

A novel ligation chain reaction (LCR) methodology for single-nucleotide polymorphism (SNP) detection was developed based on luminol-H2O2-horseradish peroxidase (HRP)-mimicking DNAzyme-fluorescein chemiluminescence resonance energy transfer (CRET) imaging on magnetic particles. For LCR, four unique target-complement probes (X and X(⁎), YG and Y(⁎)) for the amplification of K-ras (G12C) were designed by modifying G-quadruplex sequence at 3'-end of YG and fluorescein at 5'-end of Y(⁎). After the LCR, the resulting products of XYG/X(⁎)Y(⁎) with biotin-labeled X(⁎) were captured onto streptavidin-coated magnetic particles (SA-MPs) via specific biotin-SA interaction, which stimulated the CRET reaction from hemin/G-quadruplex-catalyzed luminol-H2O2 CL system to fluorescein. By collecting signals by a cooled low-light CCD, a CRET imaging method was proposed for visual detection and quantitative analysis of SNP. As low as 0.86fM mutant DNA was detected by this assay, and positive mutation detection was achieved with a wild-type to mutant ratio of 10,000:1. This high sensitivity and specificity could be attributed to not only the exponential amplification and excellent discrimination of LCR but also the employment of SA-MPs. SA-MPs ensured the feasibility of the proposed strategy, which also simplified the operations through magnetic separation and separated the reaction and detection procedures to improve sensitivity. The proposed LCR-CRET imaging strategy extends the application of signal amplification techniques to SNP detection, providing a promising platform for effective and high-throughput genetic diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

Fracture Behavior in Nylon 6 Fibers. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Lloyd, B. A.

1972-01-01

Electron paramagnetic resonance (EPR) techniques are used to determine the number of free radicals produced during deformation leading to fracture of nylon 6 fibers. A reaction rate molecular model is proposed to explain some of the deformation and bond rupture behavior leading to fracture. High-strength polymer fibers are assumed to consist of a sandwich structure of disordered and ordered regions along the fiber axis. In the disordered or critical flaw regions, tie chains connecting the ordered or crystalline block regions are assumed to have a statistical distribution in length. These chains are, therefore, subjected to different stresses. The effective length distribution was determined by EPR. The probability of bond rupture was assumed to be controlled by reaction-rate theory with a stress-aided activation energy and behavior of various loadings determined by numerical techniques. The model is successfully correlated with experimental stress, strain, and bond rupture results for creep, constant rate loadings, cyclic stress, stress relaxation and step strain tests at room temperature.

[The implementation of polymerase chain reaction technique: the real time to reveal and differentiate the viruses of human papilloma of high carcinogenic risk].

PubMed

Andosova, L D; Kontorshchikova, K N; Blatova, O L; Kudel'kina, S Iu; Kuznetsova, I A; Belov, A V; Baĭkova, R A

2011-07-01

The polymerase chain reaction technique was applied in "real time" format to evaluate the occurrence rate and infection ratio of various genotypes of human papilloma of high carcinogenic risk in virus-positive women and contact persons. The examination sampling consisted of 738 women aged of 17-50 years. The examination results permitted to establish high percentage of infection of 546 patients (74%) by carcinogenic papilloma viruses. The analysis of detection rate of various genotypes of human papilloma of high carcinogenic risk established that the 56th and 16th types of high carcinogenic risk are revealed more often than others--in 33% and 15.4% correspondingly. In males, first place in occurrence rate is for those types of virus of human papilloma: the 56th n = 10 (33.3%), 16th n = 3 (10%), 45th n = 3 (10%), 51th n = 3 (10%). The rest of genotypes are detected in 3-7% cases.

A novel, multiplex, real-time PCR-based approach for the detection of the commonly occurring pathogenic fungi and bacteria.

PubMed

Horváth, Ádám; Pető, Zoltán; Urbán, Edit; Vágvölgyi, Csaba; Somogyvári, Ferenc

2013-12-23

Polymerase chain reaction (PCR)-based techniques are widely used to identify fungal and bacterial infections. There have been numerous reports of different, new, real-time PCR-based pathogen identification methods although the clinical practicability of such techniques is not yet fully clarified.The present study focuses on a novel, multiplex, real-time PCR-based pathogen identification system developed for rapid differentiation of the commonly occurring bacterial and fungal causative pathogens of bloodstream infections. A multiplex, real-time PCR approach is introduced for the detection and differentiation of fungi, Gram-positive (G+) and Gram-negative (G-) bacteria. The Gram classification is performed with the specific fluorescence resonance energy transfer (FRET) probes recommended for LightCycler capillary real-time PCR. The novelty of our system is the use of a non-specific SYBR Green dye instead of labelled anchor probes or primers, to excite the acceptor dyes on the FRET probes. In conjunction with this, the use of an intercalating dye allows the detection of fungal amplicons.With the novel pathogen detection system, fungi, G + and G- bacteria in the same reaction tube can be differentiated within an hour after the DNA preparation via the melting temperatures of the amplicons and probes in the same tube. This modified FRET technique is specific and more rapid than the gold-standard culture-based methods. The fact that fungi, G + and G- bacteria were successfully identified in the same tube within an hour after the DNA preparation permits rapid and early evidence-based management of bloodstream infections in clinical practice.

Polymerase chain displacement reaction.

PubMed

Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

2013-02-01

Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.

Guar gum based biodegradable, antibacterial and electrically conductive hydrogels.

PubMed

Kaith, Balbir S; Sharma, Reena; Kalia, Susheel

2015-04-01

Guar gum-polyacrylic acid-polyaniline based biodegradable electrically conductive interpenetrating network (IPN) structures were prepared through a two-step aqueous polymerization. Hexamine and ammonium persulfate (APS) were used as a cross linker-initiator system to crosslink the poly(AA) chains on Guar gum (Ggum) backbone. Optimum reaction conditions for maximum percentage swelling (7470.23%) were time (min) = 60; vacuum (mmHg) = 450; pH = 7.0; solvent (mL) = 27.5; [APS] (mol L(-1)) = 0.306 × 10(-1); [AA] (mol L(-1)) = 0.291 × 10(-3) and [hexamine] (mol L(-1))=0.356 × 10(-1). The semi-interpenetrating networks (semi-IPNs) were converted into IPNs through impregnation of polyaniline chains under acidic and neutral conditions. Fourier transform infra-red spectroscopy (FTIR), thermogravimetric analysis (TGA) and scanning electron microscopy (SEM) techniques were used to characterize the semi-IPNs and IPNs. Synthesized semi-IPNs and IPNs were further evaluated for moisture retention in different soils, antibacterial and biodegradation behavior. Copyright © 2015 Elsevier B.V. All rights reserved.

Identification of species origin of meat and meat products on the DNA basis: a review.

PubMed

Kumar, Arun; Kumar, Rajiv Ranjan; Sharma, Brahm Deo; Gokulakrishnan, Palanisamy; Mendiratta, Sanjod Kumar; Sharma, Deepak

2015-01-01

The adulteration/substitution of meat has always been a concern for various reasons such as public health, religious factors, wholesomeness, and unhealthy competition in meat market. Consumer should be protected from these malicious practices of meat adulterations by quick, precise, and specific identification of meat animal species. Several analytical methodologies have been employed for meat speciation based on anatomical, histological, microscopic, organoleptic, chemical, electrophoretic, chromatographic, or immunological principles. However, by virtue of their inherent limitations, most of these techniques have been replaced by the recent DNA-based molecular techniques. In the last decades, several methods based on polymerase chain reaction have been proposed as useful means for identifying the species origin in meat and meat products, due to their high specificity and sensitivity, as well as rapid processing time and low cost. This review intends to provide an updated and extensive overview on the DNA-based methods for species identification in meat and meat products.

Surfactant-controlled polymerization of semiconductor clusters to quantum dots through competing step-growth and living chain-growth mechanisms.

PubMed

Evans, Christopher M; Love, Alyssa M; Weiss, Emily A

2012-10-17

This article reports control of the competition between step-growth and living chain-growth polymerization mechanisms in the formation of cadmium chalcogenide colloidal quantum dots (QDs) from CdSe(S) clusters by varying the concentration of anionic surfactant in the synthetic reaction mixture. The growth of the particles proceeds by step-addition from initially nucleated clusters in the absence of excess phosphinic or carboxylic acids, which adsorb as their anionic conjugate bases, and proceeds indirectly by dissolution of clusters, and subsequent chain-addition of monomers to stable clusters (Ostwald ripening) in the presence of excess phosphinic or carboxylic acid. Fusion of clusters by step-growth polymerization is an explanation for the consistent observation of so-called "magic-sized" clusters in QD growth reactions. Living chain-addition (chain addition with no explicit termination step) produces QDs over a larger range of sizes with better size dispersity than step-addition. Tuning the molar ratio of surfactant to Se(2-)(S(2-)), the limiting ionic reagent, within the living chain-addition polymerization allows for stoichiometric control of QD radius without relying on reaction time.

Development of an assay for rapid identification of meat from yak and cattle using polymerase chain reaction technique.

PubMed

Yin, R H; Bai, W L; Wang, J M; Wu, C D; Dou, Q L; Yin, R L; He, J B; Luo, G B

2009-09-01

Yak meat is of good quality with fine texture, high protein and low fat content, and rich in amino acids compared with that of cattle, and it lacks anabolic steroids or other drugs. In general terms, however, the meat yield of yak is relatively low compared with that of the cattle. In order to prevent possible adulteration of yak meat with cattle meat, based on the sequence of mitochondrial 12S rRNA gene, a multiplex PCR-based approach was proposed for rapid identification of the meat from yak and cattle using three primers designed in this work. Through the combinatorial usage of three primers with a single reaction set, two fragments of 290 and 159bp were amplified from the cattle meat DNA, whereas only a fragment of 290bp was obtained from the yak meat DNA. Using the assay described, satisfactory amplification was accomplished in the analysis of raw and heat-treated binary meat mixtures of yak/cattle with a detection limit of 0.1% for cattle meat. The technique is fast and straightforward. It might be a useful tool in the quality control of yak meat and meat products.

Detection of Alternaria fungal contamination in cereal grains by a polymerase chain reaction-based assay.

PubMed

Zur, Gideon; Shimoni, Eyal; Hallerman, Eric; Kashi, Yechezkel

2002-09-01

Alternaria sp. are important fungal contaminants of grain products; they secrete four structural classes of compounds that are toxic or carcinogenic to plants and animals and cause considerable economic losses to growers and the food-processing industry. Alternaria toxins have been detected by high-performance liquid chromatography (HPLC), enzyme-linked immunosorbent assay, and other techniques. Here, we report the development of a polymerase chain reaction (PCR)-based method for the detection of Alternaria DNA. PCR primers were designed to anneal to the ITS1 and ITS2 regions of the 5.8S rDNA gene of Alternaria alternata or Alternaria solani but not to other microbial or plant DNA. We compared the sensitivity of PCR in detecting Alternaria DNA, that of the HPLC method in detecting Alternaria alternariol and alternariol methyl ether toxins, and that of the morphological examination of mycelia and conidia in experimentally infested corn samples. The sensitivity of toxin detection for HPLC was above the level of contamination in a set of commercially obtained grain samples, resulting in negative scores for all samples, while the PCR-based method and mold growth plating followed by morphological identification of Alternaria gave parallel, positive results for 8 of 10 samples. The PCR assay required just 8 h, enabling the rapid and simultaneous testing of many samples at a low cost. PCR-based evidence for the presence of Alternaria DNA followed by positive assay results for Alternaria toxins would support the rejection of a shipment of grain.

Current and Prospective Methods for Plant Disease Detection

PubMed Central

Fang, Yi; Ramasamy, Ramaraja P.

2015-01-01

Food losses due to crop infections from pathogens such as bacteria, viruses and fungi are persistent issues in agriculture for centuries across the globe. In order to minimize the disease induced damage in crops during growth, harvest and postharvest processing, as well as to maximize productivity and ensure agricultural sustainability, advanced disease detection and prevention in crops are imperative. This paper reviews the direct and indirect disease identification methods currently used in agriculture. Laboratory-based techniques such as polymerase chain reaction (PCR), immunofluorescence (IF), fluorescence in-situ hybridization (FISH), enzyme-linked immunosorbent assay (ELISA), flow cytometry (FCM) and gas chromatography-mass spectrometry (GC-MS) are some of the direct detection methods. Indirect methods include thermography, fluorescence imaging and hyperspectral techniques. Finally, the review also provides a comprehensive overview of biosensors based on highly selective bio-recognition elements such as enzyme, antibody, DNA/RNA and bacteriophage as a new tool for the early identification of crop diseases. PMID:26287253

Optical and Thermal Behaviors of Polyamide-Layered Silicate Nanocomposites Based on 4,4'-Azodibenzoic Acid by Solution Intercalation Technique

NASA Astrophysics Data System (ADS)

Faghihi, Khalil; Shabanian, Meisam

2011-04-01

Two new samples of polyamide-montmorillonite reinforced nanocomposites based on 4,4'-azodibenzoic acid were prepared by a convenient solution intercalation technique. Polyamide (PA) 4 as a source of polymer matrix was synthesized by the direct polycondensation reaction of 4,4'-azodibenzoic acid 2 with 4,4'-diamino diphenyl sulfone 3 in the presence of triphenyl phosphate (TPP), CaCl2, pyridine and N-methyl-2-pyrrolidone (NMP). Morphology and structure of the resulting PA-nanocomposite films 4a and 4b with 10 and 20% silicate particles were characterized by FTIR spectroscopy, X-ray diffraction (XRD) and scanning electron microscopy (SEM). The effect of clay dispersion and the interaction between clay and polymeric chains on the properties of nanocomposite films were investigated by using Uv-vis spectroscopy, thermogravimetric analysis (TGA) and water uptake measurements.

RAPID MONITORING BY QPCR FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

EPA Science Inventory

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polymerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventi...

Unknown sequence amplification: Application to in vitro genome walking in Chlamydia trachomatis L2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Copley, C.G.; Boot, C.; Bundell, K.

1991-01-01

A recently described technique, Chemical Genetics' unknown sequence amplification method, which requires only one specific oligonucleotide, has broadened the applicability of the polymerase chain reaction to DNA of unknown sequence. The authors have adapted this technique to the study of the genome of Chlamydia trachomatis, an obligate intracellular bacterium, and describe modifications that significantly improve the utility of this approach. These techniques allow for rapid genomic analysis entirely in vitro, using DNA of limited quantity of purity.

Digital PCR Quantitation of Muscle Mitochondrial DNA: Age, Fiber Type, and Mutation-Induced Changes.

PubMed

Herbst, Allen; Widjaja, Kevin; Nguy, Beatrice; Lushaj, Entela B; Moore, Timothy M; Hevener, Andrea L; McKenzie, Debbie; Aiken, Judd M; Wanagat, Jonathan

2017-10-01

Definitive quantitation of mitochondrial DNA (mtDNA) and mtDNA deletion mutation abundances would help clarify the role of mtDNA instability in aging. To more accurately quantify mtDNA, we applied the emerging technique of digital polymerase chain reaction to individual muscle fibers and muscle homogenates from aged rodents. Individual fiber mtDNA content correlated with fiber type and decreased with age. We adapted a digital polymerase chain reaction deletion assay that was accurate in mixing experiments to a mutation frequency of 0.03% and quantitated an age-induced increase in deletion frequency from rat muscle homogenates. Importantly, the deletion frequency measured in muscle homogenates strongly correlated with electron transport chain-deficient fiber abundance determined by histochemical analyses. These data clarify the temporal accumulation of mtDNA deletions that lead to electron chain-deficient fibers, a process culminating in muscle fiber loss. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Use of Base Modifications in Primers and Amplicons to Improve Nucleic Acids Detection in the Real-Time Snake Polymerase Chain Reaction

PubMed Central

2011-01-01

Abstract The addition of relatively short flap sequence at the 5′-end of one of the polymerase chain reaction (PCR) primers considerably improves performance of real-time assays based on 5′-nuclease activity. This new technology, called Snake, was shown to supersede the conventional methods like TaqMan, Molecular Beacons, and Scorpions in the signal productivity and discrimination of target polymorphic variations as small as single nucleotides. The present article describes a number of reaction conditions and methods that allow further improvement of the assay performance. One of the identified approaches is the use of duplex-destabilizing modifications such as deoxyinosine and deoxyuridine in the design of the Snake primers. This approach was shown to solve the most serious problem associated with the antisense amplicon folding and cleavage. As a result, the method permits the use of relatively long—in this study—14-mer flap sequences. Investigation also revealed that only the 5′-segment of the flap requires the deoxyinosine/deoxyuridine destabilization, whereas the 3′-segment is preferably left unmodified or even stabilized using 2-amino deoxyadenosine d(2-amA) and 5-propynyl deoxyuridine d(5-PrU) modifications. The base-modification technique is especially effective when applied in combination with asymmetric three-step PCR. The most valuable discovery of the present study is the effective application of modified deoxynucleoside 5′-triphosphates d(2-amA)TP and d(5-PrU)TP in Snake PCR. This method made possible the use of very short 6-8-mer 5′-flap sequences in Snake primers. PMID:21050073

Sensitive detection of Treponema pallidum by using the polymerase chain reaction.

PubMed Central

Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D

1991-01-01

We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions of treponemes calculated to contain 10 or more organism and from some suspensions calculated to contain a single organism. Specific PCR products were obtained for the closely related agent of yaws, Treponema pallidum subsp. pertenue, but not with human DNA or DNAs from other spirochetes (including Borrelia burgdoferi), skin microorganisms, sexually transmitted disease pathogens, and central nervous system pathogens. T. pallidum DNA was detected in serum, cerebrospinal fluids, and amniotic fluids from syphilis patients but not in in nonsyphilitic controls. T. pallidum DNA was also amplified from paraffin-embedded tissue. The diagnosis of syphillis by using PCR may become a significant addition to the diagnostic armamentarium and a valuable technique for the investigation of syphilis pathogenesis. Images PMID:1993770

Sensitive detection of Treponema pallidum by using the polymerase chain reaction.

PubMed

Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D

1991-01-01

We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions of treponemes calculated to contain 10 or more organism and from some suspensions calculated to contain a single organism. Specific PCR products were obtained for the closely related agent of yaws, Treponema pallidum subsp. pertenue, but not with human DNA or DNAs from other spirochetes (including Borrelia burgdoferi), skin microorganisms, sexually transmitted disease pathogens, and central nervous system pathogens. T. pallidum DNA was detected in serum, cerebrospinal fluids, and amniotic fluids from syphilis patients but not in in nonsyphilitic controls. T. pallidum DNA was also amplified from paraffin-embedded tissue. The diagnosis of syphillis by using PCR may become a significant addition to the diagnostic armamentarium and a valuable technique for the investigation of syphilis pathogenesis.

Dembo polymerase chain reaction technique for detection of bovine abortion, diarrhea, and respiratory disease complex infectious agents in potential vectors and reservoirs.

PubMed

Rahpaya, Sayed Samim; Tsuchiaka, Shinobu; Kishimoto, Mai; Oba, Mami; Katayama, Yukie; Nunomura, Yuka; Kokawa, Saki; Kimura, Takashi; Kobayashi, Atsushi; Kirino, Yumi; Okabayashi, Tamaki; Nonaka, Nariaki; Mekata, Hirohisa; Aoki, Hiroshi; Shiokawa, Mai; Umetsu, Moeko; Morita, Tatsushi; Hasebe, Ayako; Otsu, Keiko; Asai, Tetsuo; Yamaguchi, Tomohiro; Makino, Shinji; Murata, Yoshiteru; Abi, Ahmad Jan; Omatsu, Tsutomu; Mizutani, Tetsuya

2018-05-31

Bovine abortion, diarrhea, and respiratory disease complexes, caused by infectious agents, result in high and significant economic losses for the cattle industry. These pathogens are likely transmitted by various vectors and reservoirs including insects, birds, and rodents. However, experimental data supporting this possibility are scarce. We collected 117 samples and screened them for 44 bovine abortive, diarrheal, and respiratory disease complex pathogens by using Dembo polymerase chain reaction (PCR), which is based on TaqMan real-time PCR. Fifty-seven samples were positive for at least one pathogen, including bovine viral diarrhea virus, bovine enterovirus, Salmonella enterica ser. Dublin, Salmonella enterica ser. Typhimurium, and Neospora caninum ; some samples were positive for multiple pathogens. Bovine viral diarrhea virus and bovine enterovirus were the most frequently detected pathogens, especially in flies, suggesting an important role of flies in the transmission of these viruses. Additionally, we detected the N. caninum genome from a cockroach sample for the first time. Our data suggest that insects (particularly flies), birds, and rodents are potential vectors and reservoirs of abortion, diarrhea, and respiratory infectious agents, and that they may transmit more than one pathogen at the same time.

Selection of suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using quantitative real-time polymerase chain reaction.

PubMed

Zornhagen, K W; Kristensen, A T; Hansen, A E; Oxboel, J; Kjaer, A

2015-12-01

Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours. The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm was used to analyse the most suitable reference genes. Eight potential reference genes were excluded from this final analysis because of their dissociation curves. β-Glucuronidase (GUSB) and proteasome subunit, beta type, 6 (PSMB6) were most stably expressed with an M value of 0.154 and a CV of 0.053 describing their average stability. We suggest that choice of reference genes should be based on specific testing in every new experimental set-up. © 2014 John Wiley & Sons Ltd.

Genetic diversity of Plasmodium falciparum merozoite surface protein-1 block 2 in sites of contrasting altitudes and malaria endemicities in the Mount Cameroon region.

PubMed

Wanji, Samuel; Kengne-Ouafo, Arnaud J; Eyong, Ebanga E Joan; Kimbi, Helen K; Tendongfor, Nicholas; Ndamukong-Nyanga, Judith L; Nana-Djeunga, Hugues C; Bourguinat, Catherine; Sofeu-Feugaing, David D; Charvet, Claude L

2012-05-01

The present study analyzed the relationship between the genetic diversity of Plasmodium falciparum and parasitologic/entomologic indices in the Mount Cameroon region by using merozoite surface protein 1 as a genetic marker. Blood samples were collected from asymptomatic children from three altitude zones (high, intermediate, and low). Parasitologic and entomologic indices were determined by microscopy and landing catch mosquito collection/circumsporozoite protein-enzyme-linked immunosorbent assay, respectively. A total of 142 randomly selected P. falciparum-positive blood samples were genotyped by using a nested polymerase chain reaction-based technique. K-1 polymerase chain reaction products were also sequenced. As opposed to high altitude, the highest malaria prevalence (70.65%) and entomologic inoculation rate (2.43 infective/bites/night) were recorded at a low altitude site. Seven (18.91%), 22 (36.66%), and 19 (42.22%) samples from high, intermediate, and low altitudes, respectively, contained multiclonal infections. A new K-1 polymorphism was identified. This study shows a positive non-linear association between low/intermediate altitude (high malaria transmission) and an increase in P. falciparum merozoite surface protein 1 block 2 polymorphisms.

The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

2013-06-28

Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

Detection and Quantification of Viable and Nonviable Trypanosoma cruzi Parasites by a Propidium Monoazide Real-Time Polymerase Chain Reaction Assay

PubMed Central

Cancino-Faure, Beatriz; Fisa, Roser; Alcover, M. Magdalena; Jimenez-Marco, Teresa; Riera, Cristina

2016-01-01

Molecular techniques based on real-time polymerase chain reaction (qPCR) allow the detection and quantification of DNA but are unable to distinguish between signals from dead or live cells. Because of the lack of simple techniques to differentiate between viable and nonviable cells, the aim of this study was to optimize and evaluate a straightforward test based on propidium monoazide (PMA) dye action combined with a qPCR assay (PMA-qPCR) for the selective quantification of viable/nonviable epimastigotes of Trypanosoma cruzi. PMA has the ability to penetrate the plasma membrane of dead cells and covalently cross-link to the DNA during exposure to bright visible light, thereby inhibiting PCR amplification. Different concentrations of PMA (50–200 μM) and epimastigotes of the Maracay strain of T. cruzi (1 × 105–10 parasites/mL) were assayed; viable and nonviable parasites were tested and quantified by qPCR with a TaqMan probe specific for T. cruzi. In the PMA-qPCR assay optimized at 100 μM PMA, a significant qPCR signal reduction was observed in the nonviable versus viable epimastigotes treated with PMA, with a mean signal reduction of 2.5 logarithm units and a percentage of signal reduction > 98%, in all concentrations of parasites assayed. This signal reduction was also observed when PMA-qPCR was applied to a mixture of live/dead parasites, which allowed the detection of live cells, except when the concentration of live parasites was low (10 parasites/mL). The PMA-qPCR developed allows differentiation between viable and nonviable epimastigotes of T. cruzi and could thus be a potential method of parasite viability assessment and quantification. PMID:27139452

DU Fragment Carcinogenicity: Extrapolation of Findings in Rodents to Man

DTIC Science & Technology

2004-03-01

changes in intrahepatic cholangiocarcinoma induced by thorotrast. Radiat. Res. 152: S 118-S 124. Khan, J., R. Simon, M. Bittner, Y. Chen, S. B. Leighton, T... cholangiocarcinomas demonstrated with a sensitive polymerase chain reaction technique. Cancer Res. 51: 3497-3502. MacDonald, J. S. and H. H. Scribner (1999

Introduction of Molecular Methods into a Food Microbiology Curriculum

ERIC Educational Resources Information Center

Pleitner, Aaron M.; Hammons, Susan R.; McKenzie, Emily; Cho, Young-Hee; Oliver, Haley F.

2014-01-01

Maintaining current, relevant curriculum in undergraduate Food Microbiology courses is essential for training future experts in food quality and safety. Having an understanding of the fundamental techniques (for example, polymerase chain reaction [PCR]) that are used in the food industry and regulatory agencies is critical for students entering…

Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

ERIC Educational Resources Information Center

Robertson, Amber L.; Phillips, Allison R.

2008-01-01

Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel…

Fully Integrated Microfluidic Device for Direct Sample-to-Answer Genetic Analysis

NASA Astrophysics Data System (ADS)

Liu, Robin H.; Grodzinski, Piotr

Integration of microfluidics technology with DNA microarrays enables building complete sample-to-answer systems that are useful in many applications such as clinic diagnostics. In this chapter, a fully integrated microfluidic device [1] that consists of microfluidic mixers, valves, pumps, channels, chambers, heaters, and a DNA microarray sensor to perform DNA analysis of complex biological sample solutions is present. This device can perform on-chip sample preparation (including magnetic bead-based cell capture, cell preconcentration and purification, and cell lysis) of complex biological sample solutions (such as whole blood), polymerase chain reaction, DNA hybridization, and electrochemical detection. A few novel microfluidic techniques were developed and employed. A micromix-ing technique based on a cavitation microstreaming principle was implemented to enhance target cell capture from whole blood samples using immunomagnetic beads. This technique was also employed to accelerate DNA hybridization reaction. Thermally actuated paraffin-based microvalves were developed to regulate flows. Electrochemical pumps and thermopneumatic pumps were integrated on the chip to provide pumping of liquid solutions. The device is completely self-contained: no external pressure sources, fluid storage, mechanical pumps, or valves are necessary for fluid manipulation, thus eliminating possible sample contamination and simplifying device operation. Pathogenic bacteria detection from ~mL whole blood samples and single-nucleotide polymorphism analysis directly from diluted blood were demonstrated. The device provides a cost-effective solution to direct sample-to-answer genetic analysis, and thus has a potential impact in the fields of point-of-care genetic analysis, environmental testing, and biological warfare agent detection.

The Next-Generation PCR-Based Quantification Method for Ambient Waters: Digital PCR.

PubMed

Cao, Yiping; Griffith, John F; Weisberg, Stephen B

2016-01-01

Real-time quantitative PCR (qPCR) is increasingly being used for ambient water monitoring, but development of digital polymerase chain reaction (digital PCR) has the potential to further advance the use of molecular techniques in such applications. Digital PCR refines qPCR by partitioning the sample into thousands to millions of miniature reactions that are examined individually for binary endpoint results, with DNA density calculated from the fraction of positives using Poisson statistics. This direct quantification removes the need for standard curves, eliminating the labor and materials associated with creating and running standards with each batch, and removing biases associated with standard variability and mismatching amplification efficiency between standards and samples. Confining reactions and binary endpoint measurements to small partitions also leads to other performance advantages, including reduced susceptibility to inhibition, increased repeatability and reproducibility, and increased capacity to measure multiple targets in one analysis. As such, digital PCR is well suited for ambient water monitoring applications and is particularly advantageous as molecular methods move toward autonomous field application.

Direct Observation of Sulfur Radicals as Reaction Media in Lithium Sulfur Batteries

DOE PAGES

Wang, Qiang; Zheng, Jianming; Walter, Eric; ...

2015-01-09

Lithium sulfur (Li-S) battery has been regaining tremendous interest in recent years because of its attractive attributes such as high gravimetric energy, low cost and environmental benignity. However, it is still not conclusively known how polysulfide ring/chain participates in the whole cycling and whether the discharge and charge processes follow the same pathway. Herein, we demonstrate the direct observation of sulfur radicals by using in situ electron paramagnetic resonance (EPR) technique. Based on the concentration changes of sulfur radicals at different potentials and the electrochemical characteristics of the cell, it is revealed that the chemical and electrochemical reactions in Li-Smore » cell are driving each other to proceed through sulfur radicals, leading to two completely different reaction pathways during discharge and charge. The proposed radical mechanism may provide new perspectives to investigate the interactions between sulfur species and the electrolyte, inspiring novel strategies to develop Li-S battery technology.« less

Control and reduction of peak temperature in self-curing resins.

PubMed

Schiavetti, R; DE Vico, G; Casucci, A; Covello, F; Ottria, L; Sannino, G; Barlattani, A

2009-07-01

INTRODUCTION.: The aim of this experimental study was to reduce the exothermic reaction during curing of the resins to cold. The significant exotherm generated by the reaction of polymerization of the resin curing involves many clinical complications including the high risk of necrosis against tooth. MATERIAL AND METHODS.: They were used four different types of self curing resins all based on methyl methacrylate, Jet Kit, Major Dentin, Dura Lay, Temporary Cold. The reaction of polymerization of the resins was done in Teflon pans and was monitored by a thermocouple which recorded the highest level reached by each temperature resin with and without additive. The polymerization reaction took place for each resin in the presence of an essential oil, the terpinolene, which acted as a "chain transfer" and different temperatures were recorded. RESULTS.: Resins Dura Lay and Jet kit showed a reduction of very high temperature in the presence of terpinolene, with a statistically significant difference compared to the same reaction without terpinolene Major resin dentin in the presence of the additive has reduced by 8.4°C peak temperature. Resin Temporary Cold has showed benefits with respect to peak temperature, but the reaction was much more 'consistent presence of the additive. DISCUSSION.: The system through which the chain transfer acts to lower the temperature of the reaction is that of chain transfer. Namely that interfere with the reaction of the polymer chains, by transferring these acrylic radicals are no longer active, ie, no longer able to bind to other monomer units, thus avoiding the excessive growth of macromolecules which are those that determine the temperature rise. This leads to the formation of more polymer chains with lower molecular weight.

Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

PubMed

Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

2017-01-01

Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

Polymerase chain reaction with phase change as intrinsic thermal control

NASA Astrophysics Data System (ADS)

Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

2013-04-01

This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

Cerebrospinal fluid PCR analysis and biochemistry in bodies with severe decomposition.

PubMed

Palmiere, Cristian; Vanhaebost, Jessica; Ventura, Francesco; Bonsignore, Alessandro; Bonetti, Luca Reggiani

2015-02-01

The aim of this study was to assess whether Neisseria meningitidis, Listeria monocytogenes, Streptococcus pneumoniae and Haemophilus influenzae can be identified using the polymerase chain reaction technique in the cerebrospinal fluid of severely decomposed bodies with known, noninfectious causes of death or whether postmortem changes can lead to false positive results and thus erroneous diagnostic information. Biochemical investigations, postmortem bacteriology and real-time polymerase chain reaction analysis in cerebrospinal fluid were performed in a series of medico-legal autopsies that included noninfectious causes of death with decomposition, bacterial meningitis without decomposition, bacterial meningitis with decomposition, low respiratory tract infections with decomposition and abdominal infections with decomposition. In noninfectious causes of death with decomposition, postmortem investigations failed to reveal results consistent with generalized inflammation or bacterial infections at the time of death. Real-time polymerase chain reaction analysis in cerebrospinal fluid did not identify the studied bacteria in any of these cases. The results of this study highlight the usefulness of molecular approaches in bacteriology as well as the use of alternative biological samples in postmortem biochemistry in order to obtain suitable information even in corpses with severe decompositional changes. Copyright © 2014 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Differentiating Entamoeba histolytica, Entamoeba dispar and Entamoeba moshkovskii using nested polymerase chain reaction (PCR) in rural communities in Malaysia

PubMed Central

2012-01-01

Background In this study, a total of 426 human faecal samples were examined for the presence of Entamoeba histolytica, Entamoeba dispar, Entamoeba moshkovskii infection via a combination of microscopic examination and nested polymerase chain reaction (PCR) targeting 16S ribosomal RNA of Entamoeba species. Methods Faecal sample were collected from 426 participants in five rural villages in Peninsular Malaysia. The faecal samples were processed by direct wet smear and formalin ethyl acetate concentration technique followed by iodine staining and examined via microscopy for the presence of Entamoeba species and other intestinal parasites. Microscopically positive samples for Entamoeba species cysts were further characterized using a Nested Polymerase Chain Reaction (Nested-PCR) targeting 16S-like ribosomal RNA gene. The data entry and analysis was carried out using the SPSS software (Statistical Package for the Social Sciences) program for Windows version 17 (SPSS, Chicago, IL, USA). Results Based on single faecal examination, overall prevalence of Entamoeba infection was 17.6% (75/426). Females (19.1%) were more commonly infected compared to males (15.9%). Comparison by age groups showed that adults (23.9%) had higher infection rates than children (15.3%). The PCR results showed that 52 out of 75 microscopy positive samples successfully generated species-specific amplicons. The infection with E. histolytica (75.0%; 39/52) was the most common, followed by E. dispar (30.8%; 18/52) and E. moshkovskii (5.8%; 3/52). Of these, 33 (63.5%) were shown to contain only E. histolytica, 10 (19.2%) contained E. dispar and 3 (5.8%) contained only E. moshkovskii. Mixed infection with E. histolytica and E. dispar was found in 6 (11.5%) samples. Conclusions The present study essentially emphasized the benefit of molecular techniques in discriminating the pathogenic Entamoeba species from the non-pathogenic for accurate diagnosis and better management of amoebiasis. The presence of E. moshkovskii is of great public health concern as it was the first time it has been reported in Malaysia. PMID:22947430

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

Chain-reaction crash in traffic flow controlled by taillights

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-02-01

We study the chain-reaction crash (multiple-vehicle collision) in low-visibility condition on a road. In the traffic situation, drivers brake according to taillights of the forward vehicle. The first crash may induce more collisions. We investigate whether or not the first collision induces the chain-reaction crash, numerically and analytically. The dynamic transitions occur from no collisions through a single collision, double collisions and triple collisions, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow controlled by taillights.

Deep Diversity: Novel Approach to Overcoming the PCR Bias Encountered During Environmental Analysis of Microbial Populations for Alpha-Diversity

NASA Technical Reports Server (NTRS)

Ramirez, Gustavo A; Vaishampayan, Parag A.

2011-01-01

Alpha-diversity studies are of crucial importance to environmental microbiologists. The polymerase chain reaction (PCR) method has been paramount for studies interrogating microbial environmental samples for taxon richness. Phylogenetic studies using this technique are based on the amplification and comparison of the 16S rRNA coding regions. PCR, due disproportionate distribution of microbial species in the environment, increasingly favors the amplification of the most predominant phylotypes with every subsequent reaction cycle. The genetic and chemical complexity of environmental samples are intrinsic factors that exacerbate an inherit bias in PCR-based quantitative and qualitative studies of microbial communities. We report that treatment of a genetically complex total genomic environmental DNA extract with Propidium Monoazide (PMA), a DNA intercalating molecule capable of forming a covalent cross-linkage to organic moieties upon light exposure, disproportionally inactivates predominant phylotypes and results in the exponential amplification of previously shadowed microbial ?-diversity quantified as a 19.5% increase in OUTs reported via phylogenetic screening using PhyloChip.

Universal fluorescent tri-probe ligation equipped with capillary electrophoresis for targeting SMN1 and SMN2 genes in diagnosis of spinal muscular atrophy.

PubMed

Wang, Chun-Chi; Shih, Chi-Jen; Jong, Yuh-Jyh; Wu, Shou-Mei

2014-06-23

This is the first ligase chain reaction used for diagnosis of spinal muscular atrophy (SMA). Universal fluorescent tri-probe ligation (UFTPL), a novel strategy used for distinguishing the multi-nucleotide alternations at single base, is developed to quantitatively analyze the SMN1/SMN2 genes in diagnosis of SMA. Ligase chain reaction was performed by adding three probes including universal fluorescent probe, connecting probe and recognizing probe to differentiate single nucleotide polymorphisms in UFTPL. Our approach was based on the two UFTPL products of survival motor neuron 1 (SMN1) and SMN2 genes (the difference of 9 mer) and analyzed by capillary electrophoresis (CE). We successfully determined various gene dosages of SMN1 and SMN2 genes in homologous or heterologous subjects. By using the UFTPL-CE method, the SMN1 and SMN2 genes were fully resolved with the resolution of 2.16±0.37 (n=3). The r values of SMN1 and SMN2 regression curves over a range of 1-4 copies were above 0.9944. Of the 48 DNA samples, the data of gene dosages were corresponding to that analyzed by conformation sensitive CE and denatured high-performance liquid chromatography (DHPLC). This technique was found to be a good methodology for quantification or determination of the relative genes having multi-nucleotide variants at single base. Copyright © 2014 Elsevier B.V. All rights reserved.

Detection of epsilon class switching and IgE synthesis in human B cells.

PubMed

Pène, Jérôme; Guilhot, Florence; Cognet, Isabelle; Guglielmi, Paul; Guay-Giroux, Angélique; Bonnefoy, Jean-Yves; Elson, Greg C; Yssel, Hans; Gauchat, Jean-François

2006-01-01

We observed that mast cells, as other cells expressing the CD40 ligand CD154, can trigger IgE synthesis in B cells in the presence of interleukin (IL)-4. Numerous complementary techniques can be used to follow the succession of molecular events leading to IgE synthesis. This chapter will illustrate how human B cells (naïve or memory) can be purified, stored, and cultivated in medium that is permissive for IgE synthesis and stimulated with IL-4 or IL-13 and CD40 activation, the latter being induced by soluble CD154, anti-CD40 antibodies, or CD154-expressing cells. All these molecules are expressed by mast cells. The quantification of the epsilon-sterile transcript synthesis by polymerase chain reaction or Northern blot, the epsilon excision circles produced during immunoglobulin heavy chain locus rearrangement by polymerase chain reaction, and the IgE production by enzyme-linked immunosorbent assay will be described.

Molecular Strain Typing of Mycobacterium tuberculosis: a Review of Frequently Used Methods

PubMed Central

2016-01-01

Tuberculosis, caused by the bacterium Mycobacterium tuberculosis, remains one of the most serious global health problems. Molecular typing of M. tuberculosis has been used for various epidemiologic purposes as well as for clinical management. Currently, many techniques are available to type M. tuberculosis. Choosing the most appropriate technique in accordance with the existing laboratory conditions and the specific features of the geographic region is important. Insertion sequence IS6110-based restriction fragment length polymorphism (RFLP) analysis is considered the gold standard for the molecular epidemiologic investigations of tuberculosis. However, other polymerase chain reaction-based methods such as spacer oligonucleotide typing (spoligotyping), which detects 43 spacer sequence-interspersing direct repeats (DRs) in the genomic DR region; mycobacterial interspersed repetitive units–variable number tandem repeats, (MIRU-VNTR), which determines the number and size of tandem repetitive DNA sequences; repetitive-sequence-based PCR (rep-PCR), which provides high-throughput genotypic fingerprinting of multiple Mycobacterium species; and the recently developed genome-based whole genome sequencing methods demonstrate similar discriminatory power and greater convenience. This review focuses on techniques frequently used for the molecular typing of M. tuberculosis and discusses their general aspects and applications. PMID:27709842

Molecular Strain Typing of Mycobacterium tuberculosis: a Review of Frequently Used Methods.

PubMed

Ei, Phyu Win; Aung, Wah Wah; Lee, Jong Seok; Choi, Go Eun; Chang, Chulhun L

2016-11-01

Tuberculosis, caused by the bacterium Mycobacterium tuberculosis, remains one of the most serious global health problems. Molecular typing of M. tuberculosis has been used for various epidemiologic purposes as well as for clinical management. Currently, many techniques are available to type M. tuberculosis. Choosing the most appropriate technique in accordance with the existing laboratory conditions and the specific features of the geographic region is important. Insertion sequence IS6110-based restriction fragment length polymorphism (RFLP) analysis is considered the gold standard for the molecular epidemiologic investigations of tuberculosis. However, other polymerase chain reaction-based methods such as spacer oligonucleotide typing (spoligotyping), which detects 43 spacer sequence-interspersing direct repeats (DRs) in the genomic DR region; mycobacterial interspersed repetitive units-variable number tandem repeats, (MIRU-VNTR), which determines the number and size of tandem repetitive DNA sequences; repetitive-sequence-based PCR (rep-PCR), which provides high-throughput genotypic fingerprinting of multiple Mycobacterium species; and the recently developed genome-based whole genome sequencing methods demonstrate similar discriminatory power and greater convenience. This review focuses on techniques frequently used for the molecular typing of M. tuberculosis and discusses their general aspects and applications.

Atomistic Model for the Polyamide Formation from β-Lactam Catalyzed by Candida Antarctica Lipase B

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baum, Iris; Elsasser, Brigitta M.; Schwab, Leendert

2011-04-01

Candida antarctica lipase B (CALB) is an established biocatalyst for a variety of transesterification, amidation, and polymerization reactions. In contrast to polyesters, polyamides are not yet generally accessible via enzymatic polymerization. In this regard, an enzyme-catalyzed ring-opening polymerization of {beta}-lactam (2-azetidinone) using CALB is the first example of an enzymatic polyamide formation yielding unbranched poly({beta}-alanine), nylon 3. The performance of this polymerization, however, is poor, considering the maximum chain length of 18 monomer units with an average length of 8, and the molecular basis of the reaction so far is not understood. We have employed molecular modeling techniques using dockingmore » tools, molecular dynamics, and QM/MM procedures to gain insight into the mechanistic details of the various reaction steps involved. As a result, we propose a catalytic cycle for the oligomerization of {beta}-lactam that rationalizes the activation of the monomer, the chain elongation by additional {beta}-lactam molecules, and the termination of the polymer chain. In addition, the processes leading to a premature chain termination are studied. Particularly, the QM/MM calculation enables an atomistic description of all eight steps involved in the catalytic cycle, which features an in situ-generated {beta}-alanine as the elongating monomer and which is compatible with the experimental findings.« less

Novel approach to quantitative polymerase chain reaction using real-time detection: application to the detection of gene amplification in breast cancer.

PubMed

Bièche, I; Olivi, M; Champème, M H; Vidaud, D; Lidereau, R; Vidaud, M

1998-11-23

Gene amplification is a common event in the progression of human cancers, and amplified oncogenes have been shown to have diagnostic, prognostic and therapeutic relevance. A kinetic quantitative polymerase-chain-reaction (PCR) method, based on fluorescent TaqMan methodology and a new instrument (ABI Prism 7700 Sequence Detection System) capable of measuring fluorescence in real-time, was used to quantify gene amplification in tumor DNA. Reactions are characterized by the point during cycling when PCR amplification is still in the exponential phase, rather than the amount of PCR product accumulated after a fixed number of cycles. None of the reaction components is limited during the exponential phase, meaning that values are highly reproducible in reactions starting with the same copy number. This greatly improves the precision of DNA quantification. Moreover, real-time PCR does not require post-PCR sample handling, thereby preventing potential PCR-product carry-over contamination; it possesses a wide dynamic range of quantification and results in much faster and higher sample throughput. The real-time PCR method, was used to develop and validate a simple and rapid assay for the detection and quantification of the 3 most frequently amplified genes (myc, ccndl and erbB2) in breast tumors. Extra copies of myc, ccndl and erbB2 were observed in 10, 23 and 15%, respectively, of 108 breast-tumor DNA; the largest observed numbers of gene copies were 4.6, 18.6 and 15.1, respectively. These results correlated well with those of Southern blotting. The use of this new semi-automated technique will make molecular analysis of human cancers simpler and more reliable, and should find broad applications in clinical and research settings.

Hydrolysis of the amorphous cellulose in cotton-based paper.

PubMed

Stephens, Catherine H; Whitmore, Paul M; Morris, Hannah R; Bier, Mark E

2008-04-01

Hydrolysis of cellulose in Whatman no. 42 cotton-based paper was studied using gel permeation chromatography (GPC), electrospray ionization-mass spectrometry (ESI-MS), and uniaxial tensile testing to understand the course and kinetics of the reaction. GPC results suggested that scission reactions passed through three stages. Additionally, the evolution of soluble oligomers in the ESI-MS data and the steady course of strength loss showed that the hydrolysis reaction occurred at a constant rate. These findings are explained with a more detailed description of the cellulose hydrolysis, which includes multiple chain scissions on amorphous segments. The breaks occur with increasing frequency near the ends of amorphous segments, where chains protrude from crystalline domains. Oligomers unattached to crystalline domains are eventually created. Late-stage reactions near the ends of amorphous segments produce a kinetic behavior that falsely suggests that hydrolysis had ceased. Monte Carlo simulations of cellulose degradation corroborated the experimental findings.

Sleeve reaction chamber system

DOEpatents

Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA

2009-08-25

A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.

Atom Transfer Radical Polymerization of Functionalized Vinyl Monomers Using Perylene as a Visible Light Photocatalyst

PubMed Central

Theriot, Jordan C.; Ryan, Matthew D.; French, Tracy A.; Pearson, Ryan M.; Miyake, Garret M.

2016-01-01

A standardized technique for atom transfer radical polymerization of vinyl monomers using perylene as a visible-light photocatalyst is presented. The procedure is performed under an inert atmosphere using air- and water-exclusion techniques. The outcome of the polymerization is affected by the ratios of monomer, initiator, and catalyst used as well as the reaction concentration, solvent, and nature of the light source. Temporal control over the polymerization can be exercised by turning the visible light source off and on. Low dispersities of the resultant polymers as well as the ability to chain-extend to form block copolymers suggest control over the polymerization, while chain end-group analysis provides evidence supporting an atom-transfer radical polymerization mechanism. PMID:27166728

Food labeling issues in patients with severe food allergies: solving a hamlet-like doubt.

PubMed

Fierro, Vincenzo; Di Girolamo, Francesco; Marzano, Valeria; Dahdah, Lamia; Mennini, Maurizio

2017-06-01

We review the laws on labeling in the international community, the difficulties they pose to the food manufacturers to prepare the food labels and the methodologies to determine the concentration of potential allergens in foods. European Food Safety Authority and International Life Sciences Institute Europe are evaluating strategies to identify the threshold level of allergen that can trigger a reaction in individuals. The most used techniques to detect the presence of protein in food are Enzyme-linked immunosorbent assay, polymerase chain reaction and real time polymerase chain reaction. Researchers are now trying to apply proteomics to estimate the amount of protein within the food.In order to protect the health of consumers, the Codex Alimentarius Commission updates constantly the list of allergens. In response to these regulations, some industries have also added some precautionary allergen labeling (PAL). It was generally agreed that PAL statements needed to be visible, simple, and safe. It was suggested that PAL be standardized, an action that would occur if the 'Voluntary Incidental Trace Allergen Labelling' process was made mandatory. So far, no laboratory technique is able to reassure the consumers about the composition of foods found on the packaging. International authorities produced increasingly stringent laws, but more is still to do.

ONR Far East Scientific Information Bulletin

DTIC Science & Technology

1990-09-01

In bone, grafting onto a polymer chain, inter- continuous processes, such as reactive extru- chain reactions, formation of interpenetrat- sion and...reaction kinetics, rheology, and side- and end-chain grafting , homopolymer transport phenomena occurring during REX. chain coupling, polymer...the Grafting reactions yield block or graft coupling species becomes a part of the chain, copolymers. Polyethylene, polypropylene, or by

Fluorescent quenching-based quantitative detection of specific DNA/RNA using a BODIPY® FL-labeled probe or primer

PubMed Central

Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro

2001-01-01

We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011

Effect of perception irregularity on chain-reaction crash in low visibility

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-06-01

We present the dynamic model of the chain-reaction crash to take into account the irregularity of the perception-reaction time. When a driver brakes according to taillights of the forward vehicle, the perception-reaction time varies from driver to driver. We study the effect of the perception irregularity on the chain-reaction crash (multiple-vehicle collision) in low-visibility condition. The first crash may induce more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in traffic flow of vehicles with irregular perception times. We clarify the effect of the perception irregularity on the multiple-vehicle collision.

Sequestration of dyes from artificially prepared textile effluent using RSM-CCD optimized hybrid backbone based adsorbent-kinetic and equilibrium studies.

PubMed

Sukriti; Sharma, Jitender; Chadha, Amritpal Singh; Pruthi, Vaishali; Anand, Prerna; Bhatia, Jaspreet; Kaith, B S

2017-04-01

Present work reports the synthesis of semi-Interpenetrating Network Polymer (semi-IPN) using Gelatin-Gum xanthan hybrid backbone and polyvinyl alcohol in presence of l-tartaric acid and ammonium persulphate as the crosslinker-initiator system. Reaction parameters were optimized with Response Surface Methodology (RSM) in order to maximize the percent gel fraction of the synthesized sample. Polyvinyl alcohol, l-Tartaric acid, ammonium persulphate, reaction temperature, time and pH of the reaction medium were found to make an impact on the percentage gel fraction obtained. Incorporation of polyvinyl alcohol chains onto hybrid backbone and crosslinking between the different polymer chains were confirmed through techniques like FTIR, SEM-EDX and XRD. Semi-IPN was found to be very efficient in the removal of cationic dyes rhodamine-B (70%) and auramine-O (63%) from a mixture with an adsorbent dose of 700 mg, initial concentration of rhodamine-B 6 mgL -1 and auramine-O 26 mgL -1 , at an time interval of 22-25 h and 30 °C temp. Further to determine the nature of adsorption Langmuir and Freundlich adsorption isotherm models were studied and it was found that Langmuir adsorption isotherm was the best fit model for the removal of mixture of dyes. Kinetic studies for the sorption of dyes favored the reaction mechanism to occur via a pseudo second order pathway with R 2 value about 0.99. Copyright © 2017 Elsevier Ltd. All rights reserved.

[Brownian dynamics simulations of protein-protein interactions in photosynthetic electron transport chain].

PubMed

Khruschev, S S; Abaturova, A M; Diakonova, A N; Fedorov, V A; Ustinin, D M; Kovalenko, I B; Riznichenko, G Yu; Rubin, A B

2015-01-01

The application of Brownian dynamics for simulation of transient protein-protein interactions is reviewed. The review focuses on theoretical basics of Brownian dynamics method, its particular implementations, advantages and drawbacks of the method. The outlook for future development of Brownian dynamics-based simulation techniques is discussed. Special attention is given to analysis of Brownian dynamics trajectories. The second part of the review is dedicated to the role of Brownian dynamics simulations in studying photosynthetic electron transport. Interactions of mobile electron carriers (plastocyanin, cytochrome c6, and ferredoxin) with their reaction partners (cytochrome b6f complex, photosystem I, ferredoxin:NADP-reductase, and hydrogenase) are considered.

Polymerase chain reaction-based denaturing gradient gel electrophoresis in the evaluation of oral microbiota.

PubMed

Li, Y; Saxena, D; Barnes, V M; Trivedi, H M; Ge, Y; Xu, T

2006-10-01

Clinical evaluation of oral microbial reduction after a standard prophylactic treatment has traditionally been based on bacterial cultivation methods. However, not all microbes in saliva or dental plaque can be cultivated. Polymerase chain reaction-based denaturing gradient gel electrophoresis (PCR-DGGE) is a cultivation-independent molecular fingerprinting technique that allows the assessment of the predominant bacterial species present in the oral cavity. This study sought to evaluate the oral microbial changes that occurred after a standard prophylactic treatment with a conventional oral care product using PCR-DGGE. Twelve healthy adults participated in the study. Pooled plaque samples were collected at baseline, 24 h after prophylaxis (T1), and 4 days after toothbrushing with fluoride toothpaste (T4). The total microbial genomic DNA of the plaque was isolated. PCR was performed with a set of universal bacterial 16S rDNA primers. The PCR-amplified 16S rDNA fragments were separated by DGGE. The effects of the treatment and of dental brushing were assessed by comparing the PCR-DGGE fingerprinting profiles. The mean numbers of detected PCR amplicons were 22.3 +/- 6.1 for the baseline group, 13.0 +/- 3.1 for the T1 group, and 13.5 +/- 4.3 for the T4 group; the differences among the three groups were statistically significant (P < 0.01). The study also found a significant difference in the mean similarities of microbial profiles between the baseline and the treatment groups (P < 0.001). PCR-based DGGE has been shown to be an excellent means of rapidly and accurately assessing oral microbial changes in this clinical study.

The Prevalence of Antibiotic Resistance Genes in US Waterways and Their Relationship to Water Quality and Land Use Indicators

EPA Science Inventory

Antibiotic resistance genes (ARGs) in freshwaters are an emerging contaminant of concern. We used 1,747 water samples from the USEPA’s 2013-2014 National Rivers and Streams Assessment and digital-droplet polymerase chain reaction techniques to quantify the concentrations (t...

Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze)

USDA-ARS?s Scientific Manuscript database

Quantitative real-time polymerase chain reaction (qRT-PCR) is a commonly used technique for measuring gene expression levels due to its simplicity, specificity, and sensitivity. Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a...

Precision synthesis of functional materials via RAFT polymerization and click-type chemical reactions

NASA Astrophysics Data System (ADS)

Flores, Joel Diez

2011-12-01

The need to tailor polymeric architectures with specific physico-chemical properties via the simplest, cleanest, and most efficient synthetic route possible has become the ultimate goal in polymer synthesis. Recent progress in macromolecular science, such as the discoveries of controlled/"living" free radical polymerization (CRP) methods, has brought about synthetic capabilities to prepare (co)polymers with advanced topologies, predetermined molecular weights, narrow molecular weight distributions, and precisely located functional groups. In addition, the establishment of click chemistry has redefined the selected few highly efficient chemical reactions that become highly useful in post-polymerization modification strategies. Hence, the ability to make well-defined topologies afforded by controlled polymerization techniques and the facile incorporation of functionalities along the chain via click-type reactions have yielded complex architectures, allowing the investigation of physical phenomena which otherwise could not be studied with systems prepared via conventional methods. The overarching theme of the research work described in this dissertation is the fusion of the excellent attributes of reversible addition-fragmentation chain transfer (RAFT) polymerization method, which is one of the CRP techniques, and click-type chemical reactions in the precision of synthesis of advanced functional materials. Chapter IV is divided into three sections. In Section I, the direct RAFT homopolymerization of 2-(acryloyloxy)ethyl isocyanate (AOI) and subsequent post-polymerization modifications are described. The polymerization conditions were optimized in terms of the choice of RAFT chain transfer agent (CTA), polymerization temperature and the reaction medium. Direct RAFT polymerization of AOI requires a neutral CTA, and relatively low reaction temperature to yield AOI homopolymers with low polydispersities. Efficient side-chain functionalization of PAOI homopolymers was achieved via reaction with model amine, thiol and alcohol compounds yielding urea, thiourethane and urethane derivatives, respectively. Reactions with amines and thiols (in the presence of base) were rapid, quantitative and efficient. However, the reaction with alcohols catalyzed by dibutyltin dilaurate (DBTDL) was relatively slow but proceeded to completion. Selective reaction pathways for the addition of difunctional ethanolamine and mercaptoethanol were also investigated. A related strategy is described in Section II wherein a hydroxyl-containing diblock copolymer precursor was transformed into a library of functional copolymers via two sequential post-polymerization modification reactions. A diblock copolymer scaffold, poly[(N,N-dimethylacrylamide)-b-( N-(2-hydroxyethyl)acrylamide] (PDMA-b-PHEA) was first prepared. The hydroxyl groups of the HEA block were then reacted with 2-(acryloyloxy)ethylisocyanate (AOI) and allylisocyanate (AI) resulting in acrylate- and allyl-functionalized copolymer precursors, respectively. The efficiencies of Michael-type and free radical thiol addition reactions were investigated using selected thiols having alkyl, aryl, hydroxyl, carboxylic acid, amine and amino acid functionalities. The steps of RAFT polymerization, isocyanate-hydroxyl coupling and thiol-ene addition are accomplished under mild conditions, thus offering facile and modular routes to synthesize functional copolymers. The synthesis and solution studies of pH- and salt-responsive triblock copolymer are described in Section III. This system is capable of forming self-locked micellar structures which may be controlled by changing solution pH as well as ionic strength. A triblock copolymer containing a permanently hydrophilic poly(N,N-dimethylacrylamide) (PDMA) outer block, a salt-sensitive zwitterionic poly(3[2-(N-methylacrylamido)ethyl dimethylammonio]propanesulfonate) (PMAEDAPS) middle block and a pH-responsive 3-acrylamido-3-methylbutanoic acid (PAMBA) core block was synthesized using aqueous RAFT polymerization. A facile formation of "self-locking" shell cross-linked micelles is achieved by changing solution pH and salt concentration. The reversible "self-locking" is attained from the interactions of zwitterionic groups in the middle block that constitutes the shell of the micelles. The structure slowly dissociates into unimers in 2-3 days at pH above the pKa of the PAMBA block.

Detection and signal amplification in zebrafish RNA FISH.

PubMed

Hauptmann, Giselbert; Lauter, Gilbert; Söll, Iris

2016-04-01

In situ hybridization (ISH) has become an invaluable tool for the detection of RNA in cells, tissues and organisms. Due to improvements in target and signal amplification and in probe design remarkable progress has been made concerning sensitivity, specificity and resolution of chromogenic and fluorescent ISH (FISH). These advancements allow for exquisite cellular and sub-cellular resolution and for detecting multiple RNA species at a time by multiplexing. In zebrafish (F)ISH non-enzymatic and enzymatic amplification systems have been employed to obtain enhanced signal intensities and signal-to-noise ratios. These amplification strategies include branched DNA-based RNAscope and in situ hybridization chain reaction (HCR) techniques, as well as alkaline phosphatase (AP)- and horseradish peroxidase (PO)-based immunoassays. For practical application, we provide proven multiplex FISH protocols for AP- and PO-based visualization of mRNAs at high resolution. The protocols take advantage of optimized tyramide signal amplification (TSA) conditions of the PO assay and long-lasting high signal-to-noise ratio of the AP reaction, thereby enabling detection of less abundant transcripts. Copyright © 2016 Elsevier Inc. All rights reserved.

Expression of TGF-beta1, osteonectin, and BMP-4 in mandibular distraction osteogenesis with compression stimulation: reverse transcriptase-polymerase chain reaction study and biomechanical test.

PubMed

Kim, Uk-Kyu; Park, Seong-Jin; Seong, Wook-Jin; Heo, Jun; Hwang, Dae-Seok; Kim, Yong-Deok; Shin, Sang-Hun; Kim, Gyoo-Cheon

2010-09-01

This study compared the levels of transforming growth factor-beta1 (TGF-beta1), osteonectin, and bone morphogenetic protein-4 (BMP-4) expression in regenerated bone in a rabbit mandible that had undergone conventional distraction osteogenesis (DO) with those in regenerated bone from a modified DO technique with compression stimulation. A total of 42 rabbits were used in this reverse transcriptase-polymerase chain reaction study. In the control group, distraction was performed at 1 mm/day for 8 days. In the experimental group, overdistraction was performed for 10 days, followed by a 3-day latency period and 2 days of compression to achieve the same amount of DO. Three rabbits per subgroup were killed at 0, 5, 13, 20, 27, 34, and 41 days after the initial osteotomy. The levels of TGF-beta1, osteonectin, and BMP-4 in the bone regenerates were measured by reverse transcriptase-polymerase chain reaction. A biomechanical microhardness test was also performed in 8 rabbits as a separate experiment. Reverse transcriptase-polymerase chain reaction revealed a greater level of TGF-beta1 in the experimental group immediately after applying the compression force that continued for 2 weeks. The level then decreased to that of the control group at 3 weeks. The greater level of osteonectin in the experimental group after compression than that in the control group continued for 3 weeks. In the experimental group, the level of BMP-4 increased immediately after compression. However, the level in the control group decreased. The microhardness ratio of distracted bone to normal bone on the cortex was statistically different at 0.47 in the control group and 0.80 in the experimental group (P = .049) at 55 days after osteotomy. The effectiveness of the new DO technique with compression stimulation was confirmed by the gene expression study and the biomechanical test findings. Copyright 2010 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Forensic aspects of DNA-based human identity testing.

PubMed

Roper, Stephen M; Tatum, Owatha L

2008-01-01

The forensic applications of DNA-based human identity laboratory testing are often underappreciated. Molecular biology has seen an exponential improvement in the accuracy and statistical power provided by identity testing in the past decade. This technology, dependent upon an individual's unique DNA sequence, has cemented the use of DNA technology in the forensic laboratory. This paper will discuss the state of modern DNA-based identity testing, describe the technology used to perform this testing, and describe its use as it relates to forensic applications. We will also compare individual technologies, including polymerase chain reaction (PCR) and Southern Blotting, that are used to detect the molecular differences that make all individuals unique. An increasing reliance on DNA-based identity testing dictates that healthcare providers develop an understanding of the background, techniques, and guiding principles of this important forensic tool.

A density functional theory study on the carbon chain growth of ethanol formation on Cu-Co (111) and (211) surfaces

NASA Astrophysics Data System (ADS)

Ren, Bohua; Dong, Xiuqin; Yu, Yingzhe; Wen, Guobin; Zhang, Minhua

2017-08-01

Calculations based on the first-principle density functional theory were carried out to study the most controversial reactions in ethanol formation from syngas on Cu-Co surfaces: CO dissociation mechanism and the key reactions of carbon chain growth of ethanol formation (HCO insertion reactions) on four model surfaces (Cu-Co (111) and (211) with Cu-rich or Co-rich surfaces) to investigate the synergy of the Cu and Co components since the complete reaction network of ethanol formation from syngas is a huge computational burden to calculate on four Cu-Co surface models. We investigated adsorption of important species involved in these reactions, activation barrier and reaction energy of H-assisted dissociation mechanism, directly dissociation of CO, and HCO insertion reactions (CHx + HCO → CHxCHO (x = 1-3)) on four Cu-Co surface models. It was found that reactions on Cu-rich (111) and (211) surfaces all have lower activation barrier in H-assisted dissociation and HCO insertion reactions, especially CH + HCO → CHCHO reaction. The PDOS of 4d orbitals of surface Cu and Co atoms of all surfaces were studied. Analysis of d-band center of Cu and Co atoms and the activation barrier data suggested the correlation between electronic property and catalytic performance. Cu-Co bimetallic with Cu-rich surface allows Co to have higher catalytic activity through the interaction of Cu and Co atom. Then it will improve the adsorption of CO and catalytic activity of Co. Thus it is more favorable to the carbon chain growth in ethanol formation. Our study revealed the factors influencing the carbon chain growth in ethanol production and explained the internal mechanism from electronic property aspect.

Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frank F. Roberto

2008-08-01

Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means ofmore » rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.« less

Experimental studies of one-way reaction front barriers in three-dimensional vortex flows

NASA Astrophysics Data System (ADS)

Gannon, Joanie; Doan, Minh; Simons, Jj; Mitchell, Kevin; Solomon, Tom

2017-11-01

We present results of experimental studies of the evolution of the excitable, Ruthenium (Ru)-catalyzed, Belousov-Zhabotinsky (BZ) reaction in a three-dimensional (3D) flow composed of the superposition of horizontal and vertical vortex chains. The reaction fronts are imaged in 3D with a scanning, laser-induced fluorescence technique that takes advantage of the differential fluoresence of the Ruthenium indicated at the front. When the horizontal and vertical vortex chains are lined up, a dominant scroll structure is observed that acts as a one-way barrier blocking fronts propagating across vortex boundaries and into vortex centers. A second, quarter-tube barrier is observed along the edges of the unit cell. When the vortices are shifted relative to each other, tube-like barriers are observed in the interior. All of these barriers are compared with burning invariant manifolds predicted from a 6D set of differential equations describing the evolution of front elements in the flow. Supported by NSF Grants DMR-1361881 and DUE-1317446.

RICIN-inhibitor design. Final report, 15 April 1993-14 April 1996

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schramm, V.L.

1996-05-01

The purpose of this proposal was to provide information which will permit the design of transition state inhibitors for ricin A-chain. The original goals were to solve the transition state structure based on kinetic isotope effects. Substrates were synthesized and the conditions for assays optimized to provide catalytic rates at least 1000 fold greater than those published prior to this work. Reliable assay methods have been established to permit routine assays for ricin A-chain. Substrate analogues for N-ribohydrolase reactions have been designed to establish whether the reaction involves leaving-group activation or oxycarbonium ion formation. Based on these results, leaving groupmore » activation is a major contributor and oxycarbonium-ion formation is a secondary contribution in the mechanism of catalysis by ricin A-chain. Using this information, the first submicromolar inhibitor of ricin A-chain has been synthesized, tested and kinetically characterized. The development of powerful inhibitors will be a direct extrapolation of these results.« less

Synthesis and characterization of poly-L-leucine initialized and immobilized by rehydrated hydrotalcite: understanding stability and the nature of interaction.

PubMed

Miranda, Ronald-Alexander; Finocchio, Elisabetta; Llorca, Jordi; Medina, Francisco; Ramis, Gianguido; Sueiras, Jesús E; Segarra, Anna M

2013-10-07

PLLs were synthesized by the ring-opening polycondensation (ROP) method using α-L-leucine N-carboxyanhydride (NCA) and initialized by triethylamine (Et3N), water or rehydrated hydrotalcite (HTrus). The role of temperature, different initiators and water in ROP was further investigated. In general, the initiators used in the polymerization reaction lead to PLL alpha-helical chains containing 5-40 monomers with NCA endgroups via a monomer-activated mechanism. However, the water has a twofold effect on ROP, as both a nucleophile and a base, which involves competition between two different types of initiating mechanisms (nucleophilic attack or deprotonation of the NCA monomer) in the polymerization reaction. This competition provides as a main product NCA endgroups with an alpha-helical structure and leads to the formation of the PLL cyclic-chains and beta-sheet structures which reduce the polymer Mw and the PD of the polypeptide. Furthermore, the water can hydrolyze the NCA endgroups resulting in PLL alpha-helical chains that contain living groups as the main product. On the other hand, the HTrus presents a double role: as both an initiator and a support. The polymers synthesized in the presence of HTrus presented a HT-carboxylate endgroup. The PLLs immobilized in HTrus through an anion-exchange method performed for just 30 minutes presented the PLL immobilized in the interlayer space of the HTrus. The PLL chains of the immobilized counterpart are stabilized by H-bonding with the M-OH of the HT structure. All the polypeptides and biohybrid materials synthesized have been characterized using different techniques (EA, ICP, XRD, Raman, MALDI-TOF, ESI-TOF, FT-IR at increasing temperatures, TG/DT analyses and TEM).

Chain-reaction crash on a highway in high visibility

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2016-05-01

We study the chain-reaction crash (multiple-vehicle collision) in high-visibility condition on a highway. In the traffic situation, drivers control their vehicles by both gear-changing and braking. Drivers change the gears according to the headway and brake according to taillights of the forward vehicle. We investigate whether or not the first collision induces the chain-reaction crash numerically. It is shown that dynamic transitions occur from no collisions, through a single collision, to multiple collisions with decreasing the headway. Also, we find that the dynamic transition occurs from the finite chain reaction to the infinite chain reaction when the headway is less than the critical value. We compare the multiple-vehicle collisions in high-visibility with that in low-visibility. We derive the transition points and the region maps for the chain-reaction crash in high visibility.

Fingerprinting and quantification of GMOs in the agro-food sector.

PubMed

Taverniers, I; Van Bockstaele, E; De Loose, M

2003-01-01

Most strategies for analyzing GMOs in plants and derived food and feed products, are based on the polymerase chain reaction (PCR) technique. In conventional PCR methods, a 'known' sequence between two specific primers is amplified. To the contrary, with the 'anchor PCR' technique, unknown sequences adjacent to a known sequence, can be amplified. Because T-DNA/plant border sequences are being amplified, anchor PCR is the perfect tool for unique identification of transgenes, including non-authorized GMOs. In this work, anchor PCR was applied to characterize the 'transgene locus' and to clarify the complete molecular structure of at least six different commercial transgenic plants. Based on sequences of T-DNA/plant border junctions, obtained by anchor PCR, event specific primers were developed. The junction fragments, together with endogeneous reference gene targets, were cloned in plasmids. The latter were then used as event specific calibrators in real-time PCR, a new technique for the accurate relative quantification of GMOs. We demonstrate here the importance of anchor PCR for identification and the usefulness of plasmid DNA calibrators in quantification strategies for GMOs, throughout the agro-food sector.

Slow histidine H/D exchange protocol for thermodynamic analysis of protein folding and stability using mass spectrometry.

PubMed

Tran, Duc T; Banerjee, Sambuddha; Alayash, Abdu I; Crumbliss, Alvin L; Fitzgerald, Michael C

2012-02-07

Described here is a mass spectrometry-based protocol to study the thermodynamic stability of proteins and protein-ligand complexes using the chemical denaturant dependence of the slow H/D exchange reaction of the imidazole C(2) proton in histidine side chains. The protocol is developed using several model protein systems including: ribonuclease (Rnase) A, myoglobin, bovine carbonic anhydrase (BCA) II, hemoglobin (Hb), and the hemoglobin-haptoglobin (Hb-Hp) protein complex. Folding free energies consistent with those previously determined by other more conventional techniques were obtained for the two-state folding proteins, Rnase A and myoglobin. The protocol successfully detected a previously observed partially unfolded intermediate stabilized in the BCA II folding/unfolding reaction, and it could be used to generate a K(d) value of 0.24 nM for the Hb-Hp complex. The compatibility of the protocol with conventional mass spectrometry-based proteomic sample preparation and analysis methods was also demonstrated in an experiment in which the protocol was used to detect the binding of zinc to superoxide dismutase in the yeast cell lysate sample. The yeast cell sample analyses also helped define the scope of the technique, which requires the presence of globally protected histidine residues in a protein's three-dimensional structure for successful application. © 2011 American Chemical Society

Single Fluorescence Channel-based Multiplex Detection of Avian Influenza Virus by Quantitative PCR with Intercalating Dye

PubMed Central

Ahberg, Christian D.; Manz, Andreas; Neuzil, Pavel

2015-01-01

Since its invention in 1985 the polymerase chain reaction (PCR) has become a well-established method for amplification and detection of segments of double-stranded DNA. Incorporation of fluorogenic probe or DNA intercalating dyes (such as SYBR Green) into the PCR mixture allowed real-time reaction monitoring and extraction of quantitative information (qPCR). Probes with different excitation spectra enable multiplex qPCR of several DNA segments using multi-channel optical detection systems. Here we show multiplex qPCR using an economical EvaGreen-based system with single optical channel detection. Previously reported non quantitative multiplex real-time PCR techniques based on intercalating dyes were conducted once the PCR is completed by performing melting curve analysis (MCA). The technique presented in this paper is both qualitative and quantitative as it provides information about the presence of multiple DNA strands as well as the number of starting copies in the tested sample. Besides important internal control, multiplex qPCR also allows detecting concentrations of more than one DNA strand within the same sample. Detection of the avian influenza virus H7N9 by PCR is a well established method. Multiplex qPCR greatly enhances its specificity as it is capable of distinguishing both haemagglutinin (HA) and neuraminidase (NA) genes as well as their ratio. PMID:26088868

Effect of vehicular size on chain-reaction crash

NASA Astrophysics Data System (ADS)

Nagatani, Takashi

2015-11-01

We present the dynamic model of the chain-reaction crash to take account of the vehicular size. Drivers brake according to taillights of the forward vehicle. We investigate the effect of the vehicular size on the chain-reaction crash (multiple-vehicle collision) in the traffic flow controlled by taillights. In the multiple-vehicle collision, the first crash induces more collisions. We investigate how the first collision induces the chain-reaction crash numerically. We derive, analytically, the transition points and the region maps for the chain-reaction crash in the traffic flow of vehicles with finite sizes. We clarify the effect of the vehicular size on the multiple-vehicle collision.

Kinetic aspects of chain growth in Fischer-Tropsch synthesis.

PubMed

Filot, Ivo A W; Zijlstra, Bart; Broos, Robin J P; Chen, Wei; Pestman, Robert; Hensen, Emiel J M

2017-04-28

Microkinetics simulations are used to investigate the elementary reaction steps that control chain growth in the Fischer-Tropsch reaction. Chain growth in the FT reaction on stepped Ru surfaces proceeds via coupling of CH and CR surface intermediates. Essential to the growth mechanism are C-H dehydrogenation and C hydrogenation steps, whose kinetic consequences have been examined by formulating two novel kinetic concepts, the degree of chain-growth probability control and the thermodynamic degree of chain-growth probability control. For Ru the CO conversion rate is controlled by the removal of O atoms from the catalytic surface. The temperature of maximum CO conversion rate is higher than the temperature to obtain maximum chain-growth probability. Both maxima are determined by Sabatier behavior, but the steps that control chain-growth probability are different from those that control the overall rate. Below the optimum for obtaining long hydrocarbon chains, the reaction is limited by the high total surface coverage: in the absence of sufficient vacancies the CHCHR → CCHR + H reaction is slowed down. Beyond the optimum in chain-growth probability, CHCR + H → CHCHR and OH + H → H 2 O limit the chain-growth process. The thermodynamic degree of chain-growth probability control emphasizes the critical role of the H and free-site coverage and shows that at high temperature, chain depolymerization contributes to the decreased chain-growth probability. That is to say, during the FT reaction chain growth is much faster than chain depolymerization, which ensures high chain-growth probability. The chain-growth rate is also fast compared to chain-growth termination and the steps that control the overall CO conversion rate, which are O removal steps for Ru.

New Water Vapor Barrier Film Based on Lamellar Aliphatic-Monoamine-Bridged Polysilsesquioxane.

PubMed

Zhang, Cong; Zhang, Ce; Ding, Ruimin; Cui, Xinmin; Wang, Jing; Zhang, Qinghua; Xu, Yao

2016-06-15

Siloxane-based hybrid lamellar materials with ordered nanostructure units paralleling to the substrate have been widely used for water vapor barrier. However, it is very difficult to control the orientation of the lamellar units at molecular level. In this Research Article, a new lamellar bridged polysilsesquioxane (BPSQ) film, whose voids between lamellae were filled by pendant alkyl chains in the organic bridge, was prepared via the stoichiometric reaction between 3-glycidoxypropyltrimethoxysilane and aliphatic monoamine at 60 °C without catalyst. Experimental evidence obtained from FT-IR, MS, NMR, and GIXRD techniques suggested that the as-prepared BPSQ films were constructed by lamellar units with disordered orientation. Nonetheless, they possessed satisfactory water vapor barrier performance for potassium dihydrogen phosphate (KDP) and deuterated potassium dihydrogen phosphate (DKDP) optical crystals, and the water vapor transmission rate through BPSQ film with thickness of 25 μm was as low as 20.3 g·m(-2)·d(-1). Those results proved that filling the voids between molecular lamellae with alkyl chains greatly weakened the effect of lamellar unit orientation on the vapor barrier property of BPSQ film.

High-throughput amplification of mature microRNAs in uncharacterized animal models using polyadenylated RNA and stem-loop reverse transcription polymerase chain reaction.

PubMed

Biggar, Kyle K; Wu, Cheng-Wei; Storey, Kenneth B

2014-10-01

This study makes a significant advancement on a microRNA amplification technique previously used for expression analysis and sequencing in animal models without annotated mature microRNA sequences. As research progresses into the post-genomic era of microRNA prediction and analysis, the need for a rapid and cost-effective method for microRNA amplification is critical to facilitate wide-scale analysis of microRNA expression. To facilitate this requirement, we have reoptimized the design of amplification primers and introduced a polyadenylation step to allow amplification of all mature microRNAs from a single RNA sample. Importantly, this method retains the ability to sequence reverse transcription polymerase chain reaction (RT-PCR) products, validating microRNA-specific amplification. Copyright © 2014 Elsevier Inc. All rights reserved.

Molecular diversity and tools for deciphering the methanogen community structure and diversity in freshwater sediments.

PubMed

Chaudhary, Prem Prashant; Brablcová, Lenka; Buriánková, Iva; Rulík, Martin

2013-09-01

Methanogenic archaeal communities existing in freshwater sediments are responsible for approximately 50 % of the total global emission of methane. This process contributes significantly to global warming and, hence, necessitates interventional control measures to limit its emission. Unfortunately, the diversity and functional interactions of methanogenic populations occurring in these habitats are yet to be fully characterized. Considering several disadvantages of conventional culture-based methodologies, in recent years, impetus is given to molecular biology approaches to determine the community structure of freshwater sedimentary methanogenic archaea. 16S rRNA and methyl coenzyme M reductase (mcrA) gene-based cloning techniques are the first choice for this purpose. In addition, electrophoresis-based (denaturing gradient gel electrophoresis, temperature gradient gel electrophoresis, and terminal restriction fragment length polymorphism) and quantitative real-time polymerase chain reaction techniques have also found extensive applications. These techniques are highly sensitive, rapid, and reliable as compared to traditional culture-dependent approaches. Molecular diversity studies revealed the dominance of the orders Methanomicrobiales and Methanosarcinales of methanogens in freshwater sediments. The present review discusses in detail the status of the diversity of methanogens and the molecular approaches applied in this area of research.

High-resolution melting analysis of sequence variations in the cytidine deaminase gene (CDA) in patients with cancer treated with gemcitabine.

PubMed

Raynal, Caroline; Ciccolini, Joseph; Mercier, Cédric; Boyer, Jean-Christophe; Polge, Anne; Lallemant, Benjamin; Mouzat, Kévin; Lumbroso, Serge; Brouillet, Jean-Paul; Evrard, Alexandre

2010-02-01

Gemcitabine (2',2'-difluorodeoxycytidine) is a major antimetabolite cytotoxic drug with a wide spectrum of activity against solid tumors. Hepatic elimination of gemcitabine depends on a catabolic pathway through a deamination step driven by the enzyme cytidine deaminase (CDA). Severe hematologic toxicity to gemcitabine was reported in patients harboring genetic polymorphisms in CDA gene. High-resolution melting (HRM) analysis of polymerase chain reaction amplicon emerges today as a powerful technique for both genotyping and gene scanning strategies. In this study, 46 DNA samples from gemcitabine-treated patients were subjected to HRM analysis on a LightCycler 480 platform. Residual serum CDA activity was assayed as a surrogate marker for the overall functionality of this enzyme. Genotyping of three well-described single nucleotide polymorphisms in coding region (c.79A>C, c.208G>A and c.435C>T) was successfully achieved by HRM analysis of small polymerase chain reaction fragments, whereas unknown single nucleotide polymorphisms were searched by a gene scanning strategy with longer amplicons (up to 622 bp). The gene scanning strategy allowed us to find a new intronic mutation c.246+37G>A in a female patient displaying marked CDA deficiency and who had an extreme toxic reaction with a fatal outcome to gemcitabine treatment. Our work demonstrates that HRM-based methods, owing to their simplicity, reliability, and speed, are useful tools for diagnosis of CDA deficiency and could be of interest for personalized medicine.

Use of polymerase chain reaction in human African trypanosomiasis stage determination and follow-up.

PubMed Central

Truc, P.; Jamonneau, V.; Cuny, G.; Frézil, J. L.

1999-01-01

Stage determination of human African trypanosomiasis is based on the detection of parasites and measurements of biological changes in the cerebrospinal fluid (CSF) (concentration of white blood cells > 5 cells per mm3 and increased total protein levels). The patient is treated accordingly. Demonstration of the absence or presence of trypanosomes by the double centrifugation technique is still the only test available to clinicians for assessing treatment success. In this study, however, we evaluate the polymerase chain reaction (PCR) as a tool for assessing the disease stage of trypanosomiasis and for determining whether treatment has been successful. All 15 study patients considered to be in the advanced stage of the disease were PCR positive; however, trypanosomes were demonstrated by double centrifugation in only 11 patients. Of the five remaining patients, who were considered to be in the early stage, PCR and double centrifugation were negative. Following treatment, 13 of the 15 second-stage patients were found to be negative for the disease in at least two samples by PCR and double centrifugation. Two others were still positive by PCR immediately and one month after the treatment. Trypanosome DNA detection using PCR suggested that the two positive patients were not cured but that their possible relapse could not be identified by a search for parasites using the double centrifugation technique. Further evaluation of the PCR method is required, in particular to determine whether PCR assays could be used in studies on patients who fail to respond to melarsoprol, as observed in several foci. PMID:10534898

Sexing chick mRNA: A protocol based on quantitative real-time polymerase chain reaction.

PubMed

Wan, Z; Lu, Y; Rui, L; Yu, X; Li, Z

2017-03-01

The accurate identification of sex in birds is important for research on avian sex determination and differentiation. Polymerase chain reaction (PCR)-based methods have been widely applied for the molecular sexing of birds. However, these methods have used genomic DNA. Here, we present the first sexing protocol for chick mRNA based on real-time quantitative PCR. We demonstrate that this method can accurately determine sex using mRNA from chick gonads and other tissues, such as heart, liver, spleen, lung, and muscle. The strategy of this protocol also may be suitable for other species in which sex is determined by the inheritance of sex chromosomes (ZZ male and ZW female). © 2016 Poultry Science Association Inc.

Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

PubMed

Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

2001-03-01

A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

Standardisation of polymerase chain reaction for the detection of Salmonella typhi in typhoid fever.

PubMed Central

Chaudhry, R; Laxmi, B V; Nisar, N; Ray, K; Kumar, D

1997-01-01

To improve the diagnosis of Salmonella typhi infection, a polymerase chain reaction (PCR) assay was developed for the amplification of the dH flagellin gene of S typhi. Primers were designed from dH flagellin gene sequence which will give an amplification product of 486 base pairs. In tests to study the specificity of the assay, no amplification was seen in non-salmonella strains or salmonella strains with flagellar gene other than "d". Sensitivity tests determined that 28 pg of S typhi target DNA or 3 x 10(2) target bacteria could be detected by the PCR assay. Subsequently, the PCR technique was used for detection of S typhi in blood or clot cultures from 84 patients clinically suspected of having typhoid fever, and from 20 healthy control subjects. Twenty five of 84 samples from clinically suspected cases were positive by PCR; four of which were culture negative. No amplification was seen in samples from patients who were culture positive for organisms other than S typhi or from controls. The time taken for each sample for PCR analysis was less than 48 hours compared with three to five days for blood or clot culture. PCR appeared to be a promising diagnostic test for typhoid fever. Images PMID:9215131

The Detection Method of Escherichia coli in Water Resources: A Review

NASA Astrophysics Data System (ADS)

Nurliyana, M. R.; Sahdan, M. Z.; Wibowo, K. M.; Muslihati, A.; Saim, H.; Ahmad, S. A.; Sari, Y.; Mansor, Z.

2018-04-01

This article reviews several approaches for Escherichia coli (E. coli) bacteria detection from conventional methods, emerging method and goes to biosensor-based techniques. Detection and enumeration of E. coli bacteria usually required long duration of time in obtaining the result since laboratory-based approach is normally used in its assessment. It requires 24 hours to 72 hours after sampling to process the culturing samples before results are available. Although faster technique for detecting E. coli in water such as Polymerase Chain Reaction (PCR) and Enzyme-Linked Immunosorbent Assay (ELISA) have been developed, it still required transporting the samples from water resources to the laboratory, high-cost, complicated equipment usage, complex procedures, as well as the requirement of skilled specialist to cope with the complexity which limit their wide spread practice in water quality detection. Recently, development of biosensor device that is easy to perform, portable, highly sensitive and selective becomes indispensable in detecting extremely lower consolidation of pathogenic E. coli bacteria in water samples.

Molecular analysis of dolphin morbillivirus: A new sensitive detection method based on nested RT-PCR.

PubMed

Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro

2016-09-01

Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.

Testing for Genetically Modified Foods Using PCR

ERIC Educational Resources Information Center

Taylor, Ann; Sajan, Samin

2005-01-01

The polymerase chain reaction (PCR) is a Nobel Prize-winning technique that amplifies a specific segment of DNA and is commonly used to test for the presence of genetic modifications. Students use PCR to test corn meal and corn-muffin mixes for the presence of a promoter commonly used in genetically modified foods, the cauliflower mosaic virus 35S…

Validation of Reference Genes in mRNA Expression Analysis Applied to the Study of Asthma.

PubMed

Segundo-Val, Ignacio San; Sanz-Lozano, Catalina S

2016-01-01

The quantitative Polymerase Chain Reaction is the most used technique for the study of gene expression. To correct putative experimental errors of this technique is necessary normalizing the expression results of the gene of interest with the obtained for reference genes. Here, we describe an example of the process to select reference genes. In this particular case, we select reference genes for expression studies in the peripheral blood mononuclear cells of asthmatic patients.

Graphite grain-size spectrum and molecules from core-collapse supernovae

NASA Astrophysics Data System (ADS)

Clayton, Donald D.; Meyer, Bradley S.

2018-01-01

Our goal is to compute the abundances of carbon atomic complexes that emerge from the C + O cores of core-collapse supernovae. We utilize our chemical reaction network in which every atomic step of growth employs a quantum-mechanically guided reaction rate. This tool follows step-by-step the growth of linear carbon chain molecules from C atoms in the oxygen-rich C + O cores. We postulate that once linear chain molecules reach a sufficiently large size, they isomerize to ringed molecules, which serve as seeds for graphite grain growth. We demonstrate our technique for merging the molecular reaction network with a parallel program that can follow 1017 steps of C addition onto the rare seed species. Due to radioactivity within the C + O core, abundant ambient oxygen is unable to convert C to CO, except to a limited degree that actually facilitates carbon molecular ejecta. But oxygen severely minimizes the linear-carbon-chain abundances. Despite the tiny abundances of these linear-carbon-chain molecules, they can give rise to a small abundance of ringed-carbon molecules that serve as the nucleations on which graphite grain growth builds. We expand the C + O-core gas adiabatically from 6000 K for 109 s when reactions have essentially stopped. These adiabatic tracks emulate the actual expansions of the supernova cores. Using a standard model of 1056 atoms of C + O core ejecta having O/C = 3, we calculate standard ejection yields of graphite grains of all sizes produced, of the CO molecular abundance, of the abundances of linear-carbon molecules, and of Buckminsterfullerene. None of these except CO was expected from the C + O cores just a few years past.

Evaluation of a nested-PCR for mycobacterium tuberculosis detection in blood and urine samples.

PubMed

da Cruz, Heidi Lacerda Alves; de Albuquerque Montenegro, Rosana; de Araújo Lima, Juliana Falcão; da Rocha Poroca, Diogo; da Costa Lima, Juliana Figueirêdo; Maria Lapa Montenegro, Lílian; Crovella, Sergio; Charifker Schindler, Haiana

2011-01-01

The polymerase chain reaction (PCR) and its variations, such as the nested-PCR, have been described as promising techniques for rapid diagnosis of tuberculosis (TB). With the aim of evaluating the usefulness of a nested-PCR method on samples of blood and urine of patients suspected of tuberculosis we analyzed 192 clinical samples, using as a molecular target the insertion element IS6110 specific of M. tuberculosis genome. Nested-PCR method showed higher sensitivity in patients with extrapulmonary tuberculosis (47.8% and 52% in blood and urine) when compared to patients with the pulmonary form of the disease (sensitivity of 29% and 26.9% in blood and urine), regardless of the type of biological sample used. The nested-PCR is a rapid technique that, even if not showing a good sensitivity, should be considered as a helpful tool especially in the extrapulmonary cases or in cases where confirmatory diagnosis is quite difficult to be achieved by routine methods. The performance of PCR-based techniques should be considered and tested in future works on other types of biological specimens besides sputum, like blood and urine, readily obtainable in most cases. The improving of M. tuberculosis nested-PCR detection in TB affected patients will give the possibility of an earlier detection of bacilli thus interrupting the transmission chain of the disease.

Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

PubMed

Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

2015-01-01

Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

Enhanced DNA Sensing via Catalytic Aggregation of Gold Nanoparticles

PubMed Central

Huttanus, Herbert M.; Graugnard, Elton; Yurke, Bernard; Knowlton, William B.; Kuang, Wan; Hughes, William L.; Lee, Jeunghoon

2014-01-01

A catalytic colorimetric detection scheme that incorporates a DNA-based hybridization chain reaction into gold nanoparticles was designed and tested. While direct aggregation forms an inter-particle linkage from only ones target DNA strand, the catalytic aggregation forms multiple linkages from a single target DNA strand. Gold nanoparticles were functionalized with thiol-modified DNA strands capable of undergoing hybridization chain reactions. The changes in their absorption spectra were measured at different times and target concentrations and compared against direct aggregation. Catalytic aggregation showed a multifold increase in sensitivity at low target concentrations when compared to direct aggregation. Gel electrophoresis was performed to compare DNA hybridization reactions in catalytic and direct aggregation schemes, and the product formation was confirmed in the catalytic aggregation scheme at low levels of target concentrations. The catalytic aggregation scheme also showed high target specificity. This application of a DNA reaction network to gold nanoparticle-based colorimetric detection enables highly-sensitive, field-deployable, colorimetric readout systems capable of detecting a variety of biomolecules. PMID:23891867

Manipulation of prenylation reactions by structure-based engineering of bacterial indolactam prenyltransferases

NASA Astrophysics Data System (ADS)

Mori, Takahiro; Zhang, Lihan; Awakawa, Takayoshi; Hoshino, Shotaro; Okada, Masahiro; Morita, Hiroyuki; Abe, Ikuro

2016-03-01

Prenylation reactions play crucial roles in controlling the activities of biomolecules. Bacterial prenyltransferases, TleC from Streptomyces blastmyceticus and MpnD from Marinactinospora thermotolerans, catalyse the `reverse' prenylation of (-)-indolactam V at the C-7 position of the indole ring with geranyl pyrophosphate or dimethylallyl pyrophosphate, to produce lyngbyatoxin or pendolmycin, respectively. Using in vitro analyses, here we show that both TleC and MpnD exhibit relaxed substrate specificities and accept various chain lengths (C5-C25) of the prenyl donors. Comparisons of the crystal structures and their ternary complexes with (-)-indolactam V and dimethylallyl S-thiophosphate revealed the intimate structural details of the enzyme-catalysed `reverse' prenylation reactions and identified the active-site residues governing the selection of the substrates. Furthermore, structure-based enzyme engineering successfully altered the preference for the prenyl chain length of the substrates, as well as the regio- and stereo-selectivities of the prenylation reactions, to produce a series of unnatural novel indolactams.

Immediate hypersensitivity to moxifloxacin with tolerance to ciprofloxacin: report of three cases and review of the literature.

PubMed

Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth

2010-04-01

To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.

Chemical reactions directed Peptide self-assembly.

PubMed

Rasale, Dnyaneshwar B; Das, Apurba K

2015-05-13

Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.

Chemical Reactions Directed Peptide Self-Assembly

PubMed Central

Rasale, Dnyaneshwar B.; Das, Apurba K.

2015-01-01

Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly. PMID:25984603

Real-Time Reverse Transcription–Polymerase Chain Reaction Assay for SARS-associated Coronavirus

PubMed Central

Emery, Shannon L.; Bowen, Michael D.; Newton, Bruce R.; Winchell, Jonas M.; Meyer, Richard F.; Tong, Suxiang; Cook, Byron T.; Holloway, Brian P.; McCaustland, Karen A.; Rota, Paul A.; Bankamp, Bettina; Lowe, Luis E.; Ksiazek, Tom G.; Bellini, William J.; Anderson, Larry J.

2004-01-01

A real-time reverse transcription–polymerase chain reaction (RT-PCR) assay was developed to rapidly detect the severe acute respiratory syndrome–associated coronavirus (SARS-CoV). The assay, based on multiple primer and probe sets located in different regions of the SARS-CoV genome, could discriminate SARS-CoV from other human and animal coronaviruses with a potential detection limit of <10 genomic copies per reaction. The real-time RT-PCR assay was more sensitive than a conventional RT-PCR assay or culture isolation and proved suitable to detect SARS-CoV in clinical specimens. Application of this assay will aid in diagnosing SARS-CoV infection. PMID:15030703

Costs of genetic testing: Supporting Brazilian Public Policies for the incorporating of molecular diagnostic technologies

PubMed Central

Schlatter, Rosane Paixão; Matte, Ursula; Polanczyk, Carisi Anne; Koehler-Santos, Patrícia; Ashton-Prolla, Patricia

2015-01-01

This study identifies and describes the operating costs associated with the molecular diagnosis of diseases, such as hereditary cancer. To approximate the costs associated with these tests, data informed by Standard Operating Procedures for various techniques was collected from hospital software and a survey of market prices. Costs were established for four scenarios of capacity utilization to represent the possibility of suboptimal use in research laboratories. Cost description was based on a single site. The results show that only one technique was not impacted by rising costs due to underutilized capacity. Several common techniques were considerably more expensive at 30% capacity, including polymerase chain reaction (180%), microsatellite instability analysis (181%), gene rearrangement analysis by multiplex ligation probe amplification (412%), non-labeled sequencing (173%), and quantitation of nucleic acids (169%). These findings should be relevant for the definition of public policies and suggest that investment of public funds in the establishment of centralized diagnostic research centers would reduce costs to the Public Health System. PMID:26500437

Pathology and polymerase chain reaction detection of ovine progressive pneumonia (maedi) cases in slaughtered sheep in India

PubMed Central

Singh, Rahul; Kumar, Pawan; Singh, Rajendra; Dhama, Kuldeep; Kumari, Swati; Yadav, Jay Prakash; Kashyap, Gayatri; Singh, Karam Pal; Singh, Vidya; Sahoo, Monalisa

2017-01-01

Aim: The small ruminant lentiviruses are known to cause maedi-visna (MV) and caprine arthritis - encephalitis in sheep and goats, typically affecting joints, udder, lungs, and the central nervous system. The diagnosis usually involves serology, clinical signs, immunohistochemistry, and polymerase chain reaction (PCR). In the present study, the histopathologically positive pneumonia cases of MV were confirmed by PCR in lung tissue probably for the first time in India. Materials and Methods: A total of 888 lungs of adult sheep, aged between 2 and 5 years, were screened during slaughter, of which 121 were found to have pneumonic lesions. The tissues from each pneumonic lung including associated lymph nodes were collected in 10% neutral buffered formalin for histopathology. The frozen tissues of the same were also collected and stored at −20°C for PCR confirmation. Results: Three of 121 cases of pneumonic lungs of sheep revealed gross and histopathological lesions suggestive of maedi or ovine progressive pneumonia infection. These 3 cases were further confirmed by PCR technique that amplified 291-base pair DNA in the long terminal repeat sequence of MV provirus. Conclusion: This study suggests the low occurrence of MV virus (MVV) infection in India in naturally affected sheep based on pathomorphological lesions and using the molecular tool of PCR detection of the virus in tissues. Further, a combination of pathomorphology or/and PCR testing might be optimal for detecting the animals infected with MVV. PMID:29263606

Surface grafting of poly(ethylene glycol) onto poly(acrylamide-co-vinyl amine) cross-linked films under mild conditions.

PubMed

Yamamoto, Y; Sefton, M V

1998-01-01

Poly(ethylene glycol) (PEG) was grafted onto poly(acrylamide-co-vinyl amine) (poly(AM-co-VA)) film using tresylated PEG (TPEG) at 37 degrees C in aqueous buffers (pH 7.4) with a view to surface-modifying microencapsulated mammalian cells. Poly(AM-co-VA) film was synthesized by Hofmann degradation of a cross-linked poly(acrylamide) film. Conversion to vinyl amine on the surface of the film was approximately 50%, but bulk conversion was not observed; surface specificity was thought to be the result of cleavage of aminated polymer chains at the surface due to chain scission. Reaction between primary amine and TPEG gave a graft yield of 2 mol% (based on XPS) with respect to available surface amine groups, equivalent to 54 mol% ethylene oxide based on monomer units. Physical adsorption of non-activated polymer was done under identical conditions as a control and the difference in oxygen content was significant compared to TPEG. The type of buffer agent and buffer concentration did not influence graft yields. This graft reaction, which was completed in as little as 2 h was considered to be mild enough to be used for a surface modification of microcapsules containing cells without affecting their viability. Such a surface modification technique may prove to be a useful means of enhancing the biocompatibility of microcapsules (or any tissue engineering construct) even after cell encapsulation or seeding.

Detecting the Lyme Disease Spirochete, Borrelia Burgdorferi, in Ticks Using Nested PCR.

PubMed

Wills, Melanie K B; Kirby, Andrea M; Lloyd, Vett K

2018-02-04

Lyme disease is a serious vector-borne infection that is caused by the Borrelia burgdorferi sensu lato family of spirochetes, which are transmitted to humans through the bite of infected Ixodes ticks. The primary etiological agent in North America is Borrelia burgdorferi sensu stricto. As geographic risk regions expand, it is prudent to support robust surveillance programs that can measure tick infection rates, and communicate findings to clinicians, veterinarians, and the general public. The molecular technique of nested polymerase chain reaction (nPCR) has long been used for this purpose, and it remains a central, inexpensive, and robust approach in the detection of Borrelia in both ticks and wildlife. This article demonstrates the application of nPCR to tick DNA extracts to identify infected specimens. Two independent B. burgdorferi targets, genes encoding Flagellin B (FlaB) and Outer surface protein A (OspA), have been used extensively with this technique. The protocol involves tick collection, DNA extraction, and then an initial round of PCR to detect each of the two Borrelia-specific loci. Subsequent polymerase chain reaction (PCR) uses the product of the first reaction as a new template to generate smaller, internal amplification fragments. The nested approach improves upon both the specificity and sensitivity of conventional PCR. A tick is considered positive for the pathogen when inner amplicons from both Borrelia genes can be detected by agarose gel electrophoresis.

Travel Behavior Change in Older Travelers: Understanding Critical Reactions to Incidents Encountered in Public Transport.

PubMed

Sundling, Catherine

2015-11-18

Accessibility of travel may be better understood if psychological factors underlying change in travel behavior are known. This paper examines older (65+) travelers' motives for changing their travel behavior. These changes are grounded in critical incidents earlier encountered in public-transport travel. A scientific framework is developed based on cognitive and behavioral theory. In 29 individual interviews, travelers' critical reactions (i.e., cognitive, emotional, and/or behavioral) to 77 critical incidents were examined. By applying critical incident technique (CIT), five reaction themes were identified that had generated travel-behavior change: firm restrictions, unpredictability, unfair treatment, complicated trips, and earlier adverse experiences. To improve older travelers' access to public transport, key findings were: (a) service must be designed so as to strengthen the feeling of being in control throughout the journey; (b) extended personal service would increase predictability in the travel chain and decrease travel complexity; consequently, (c) when designing new services and making effective accessibility interventions, policy makers should consider and utilize underlying psychological factors that could direct traveler behavior.

Travel Behavior Change in Older Travelers: Understanding Critical Reactions to Incidents Encountered in Public Transport

PubMed Central

Sundling, Catherine

2015-01-01

Accessibility of travel may be better understood if psychological factors underlying change in travel behavior are known. This paper examines older (65+) travelers’ motives for changing their travel behavior. These changes are grounded in critical incidents earlier encountered in public-transport travel. A scientific framework is developed based on cognitive and behavioral theory. In 29 individual interviews, travelers’ critical reactions (i.e., cognitive, emotional, and/or behavioral) to 77 critical incidents were examined. By applying critical incident technique (CIT), five reaction themes were identified that had generated travel-behavior change: firm restrictions, unpredictability, unfair treatment, complicated trips, and earlier adverse experiences. To improve older travelers’ access to public transport, key findings were: (a) service must be designed so as to strengthen the feeling of being in control throughout the journey; (b) extended personal service would increase predictability in the travel chain and decrease travel complexity; consequently, (c) when designing new services and making effective accessibility interventions, policy makers should consider and utilize underlying psychological factors that could direct traveler behavior. PMID:26593935

Comparison of the detection of periodontal pathogens in bacteraemia after tooth brushing by culture and molecular techniques.

PubMed

Marín, M-J; Figuero, E; González, I; O'Connor, A; Diz, P; Álvarez, M; Herrera, D; Sanz, M

2016-05-01

The prevalence and amounts of periodontal pathogens detected in bacteraemia samples after tooth brushing-induced by means of four diagnostic technique, three based on culture and one in a molecular-based technique, have been compared in this study. Blood samples were collected from thirty-six subjects with different periodontal status (17 were healthy, 10 with gingivitis and 9 with periodontitis) at baseline and 2 minutes after tooth brushing. Each sample was analyzed by three culture-based methods [direct anaerobic culturing (DAC), hemo-culture (BACTEC), and lysis-centrifugation (LC)] and one molecular-based technique [quantitative polymerase chain reaction (qPCR)]. With culture any bacterial isolate was detected and quantified, while with qPCR only Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans were detected and quantified. Descriptive analyses, ANOVA and Chi-squared tests, were performed. Neither BACTEC nor qPCR detected any type of bacteria in the blood samples. Only LC (2.7%) and DAC (8.3%) detected bacteraemia, although not in the same patients. Fusobacterium nucleatum was the most frequently detected bacterial species. The disparity in the results when the same samples were analyzed with four different microbiological detection methods highlights the need for a proper validation of the methodology to detect periodontal pathogens in bacteraemia samples, mainly when the presence of periodontal pathogens in blood samples after tooth brushing was very seldom.

On fundamental quality of fission chain reaction to oppose rapid runaways of nuclear reactors

NASA Astrophysics Data System (ADS)

Kulikov, G. G.; Shmelev, A. N.; Apse, V. A.; Kulikov, E. G.

2017-01-01

It has been shown that the in-hour equation characterizes the barriers and resistibility of fission chain reaction (FCR) against rapid runaways in nuclear reactors. Traditionally, nuclear reactors are characterized by the presence of barriers based on delayed and prompt neutrons. A new barrier based on the reflector neutrons that can occur when the fast reactor core is surrounded by a weakly absorbing neutron reflector with heavy atomic weight was proposed. It has been shown that the safety of this fast reactor is substantially improved, and considerable elongation of prompt neutron lifetime "devalues" the role of delayed neutron fraction as the maximum permissible reactivity for the reactor safety.

Nested methylation-specific polymerase chain reaction cancer detection method

DOEpatents

Belinsky, Steven A [Albuquerque, NM; Palmisano, William A [Edgewood, NM

2007-05-08

A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

Replaceable Microfluidic Cartridges for a PCR Biosensor

NASA Technical Reports Server (NTRS)

Francis, Kevin; Sullivan, Ron

2005-01-01

The figure depicts a replaceable microfluidic cartridge that is a component of a miniature biosensor that detects target deoxyribonucleic acid (DNA) sequences. The biosensor utilizes (1) polymerase chain reactions (PCRs) to multiply the amount of DNA to be detected, (2) fluorogenic polynucleotide probe chemicals for labeling the target DNA sequences, and (3) a high-sensitivity epifluorescence-detection optoelectronic subsystem. Microfluidics is a relatively new field of device development in which one applies techniques for fabricating microelectromechanical systems (MEMS) to miniature systems for containing and/or moving fluids. Typically, microfluidic devices are microfabricated, variously, from silicon or polymers. The development of microfluidic devices for applications that involve PCR and fluorescence-based detection of PCR products poses special challenges

Solving traveling salesman problems with DNA molecules encoding numerical values.

PubMed

Lee, Ji Youn; Shin, Soo-Yong; Park, Tai Hyun; Zhang, Byoung-Tak

2004-12-01

We introduce a DNA encoding method to represent numerical values and a biased molecular algorithm based on the thermodynamic properties of DNA. DNA strands are designed to encode real values by variation of their melting temperatures. The thermodynamic properties of DNA are used for effective local search of optimal solutions using biochemical techniques, such as denaturation temperature gradient polymerase chain reaction and temperature gradient gel electrophoresis. The proposed method was successfully applied to the traveling salesman problem, an instance of optimization problems on weighted graphs. This work extends the capability of DNA computing to solving numerical optimization problems, which is contrasted with other DNA computing methods focusing on logical problem solving.

Loop-Mediated Isothermal Amplification (LAMP): Emergence As an Alternative Technology for Herbal Medicine Identification.

PubMed

Li, Jing-Jian; Xiong, Chao; Liu, Yue; Liang, Jun-Song; Zhou, Xing-Wen

2016-01-01

Correct identification of medicinal plant ingredients is essential for their safe use and for the regulation of herbal drug supply chain. Loop-mediated isothermal amplification (LAMP) is a recently developed approach to identify herbal medicine species. This novel molecular biology technique enables timely and accurate testing, especially in settings where infrastructures to support polymerase chain reaction facilities are lacking. Studies that used this method have altered our view on the extent and complexity of herbal medicine identification. In this review, we give an introduction into LAMP analysis, covers the basic principles and important aspects in the development of LAMP analysis method. Then we presented a critical review of the application of LAMP-based methods in detecting and identifying raw medicinal plant materials and their processed products. We also provide a practical standard operating procedure (SOP) for the utilization of the LAMP protocol in herbal authentication, and consider the prospects of LAMP technology in the future developments of herbal medicine identification and the challenges associated with its application.

Loop-Mediated Isothermal Amplification (LAMP): Emergence As an Alternative Technology for Herbal Medicine Identification

PubMed Central

Li, Jing-jian; Xiong, Chao; Liu, Yue; Liang, Jun-song; Zhou, Xing-wen

2016-01-01

Correct identification of medicinal plant ingredients is essential for their safe use and for the regulation of herbal drug supply chain. Loop-mediated isothermal amplification (LAMP) is a recently developed approach to identify herbal medicine species. This novel molecular biology technique enables timely and accurate testing, especially in settings where infrastructures to support polymerase chain reaction facilities are lacking. Studies that used this method have altered our view on the extent and complexity of herbal medicine identification. In this review, we give an introduction into LAMP analysis, covers the basic principles and important aspects in the development of LAMP analysis method. Then we presented a critical review of the application of LAMP-based methods in detecting and identifying raw medicinal plant materials and their processed products. We also provide a practical standard operating procedure (SOP) for the utilization of the LAMP protocol in herbal authentication, and consider the prospects of LAMP technology in the future developments of herbal medicine identification and the challenges associated with its application. PMID:28082999

DFT-based prediction of reactivity of short-chain alcohol dehydrogenase

NASA Astrophysics Data System (ADS)

Stawoska, I.; Dudzik, A.; Wasylewski, M.; Jemioła-Rzemińska, M.; Skoczowski, A.; Strzałka, K.; Szaleniec, M.

2017-06-01

The reaction mechanism of ketone reduction by short chain dehydrogenase/reductase, ( S)-1-phenylethanol dehydrogenase from Aromatoleum aromaticum, was studied with DFT methods using cluster model approach. The characteristics of the hydride transfer process were investigated based on reaction of acetophenone and its eight structural analogues. The results confirmed previously suggested concomitant transfer of hydride from NADH to carbonyl C atom of the substrate with proton transfer from Tyr to carbonyl O atom. However, additional coupled motion of the next proton in the proton-relay system, between O2' ribose hydroxyl and Tyr154 was observed. The protonation of Lys158 seems not to affect the pKa of Tyr154, as the stable tyrosyl anion was observed only for a neutral Lys158 in the high pH model. The calculated reaction energies and reaction barriers were calibrated by calorimetric and kinetic methods. This allowed an excellent prediction of the reaction enthalpies (R2 = 0.93) and a good prediction of the reaction kinetics (R2 = 0.89). The observed relations were validated in prediction of log K eq obtained for real whole-cell reactor systems that modelled industrial synthesis of S-alcohols.

Chemical synthesis of oligonucleotides containing a free sulphydryl group and subsequent attachment of thiol specific probes.

PubMed Central

Connolly, B A; Rider, P

1985-01-01

Oligonucleotides containing a free sulphydryl group at their 5'-termini have been synthesised and further derivatised with thiol specific probes. The nucleotide sequence required is prepared using standard solid phase phosphoramidite techniques and an extra round of synthesis is then performed using the S-triphenylmethyl O-methoxymorpholinophosphite derivatives of 2-mercaptoethanol, 3-mercaptopropan (1) ol or 6-mercaptohexan (1) ol. After cleavage from the resin and removal of the phosphate and base protecting groups, this yields an oligonucleotide containing an S-triphenylmethyl group attached to the 5'-phosphate group via a two, three or six carbon chain. The triphenylmethyl group can be readily removed with silver nitrate to give the free thiol. With the three and six carbon chain oligonucleotides, this thiol can be used, at pH 8, for the attachment of thiol specific probes as illustrated by the reaction with fluorescent conjugates of iodoacetates and maleiimides. However, oligonucleotides containing a thiol attached to the 5'-phosphate group via a two carbon chain are unstable at pH 8 decomposing to the free 5'-phosphate and so are unsuitable for further derivatisation. PMID:4011448

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...

Fluorescence resonance energy transfer-based real-time polymerase chain reaction method without DNA extraction for the genotyping of F5, F2, F12, MTHFR, and HFE.

PubMed

Martinez-Serra, Jordi; Robles, Juan; Nicolàs, Antoni; Gutierrez, Antonio; Ros, Teresa; Amat, Juan Carlos; Alemany, Regina; Vögler, Oliver; Abelló, Aina; Noguera, Aina; Besalduch, Joan

2014-01-01

Blood samples are extensively used for the molecular diagnosis of many hematological diseases. The daily practice in a clinical laboratory of molecular diagnosis in hematology involves using a variety of techniques, based on the amplification of nucleic acids. Current methods for polymerase chain reaction (PCR) use purified genomic DNA, mostly isolated from total peripheral blood cells or white blood cells (WBC). In this paper we describe a real-time fluorescence resonance energy transfer-based method for genotyping directly from blood cells. Our strategy is based on an initial isolation of the WBCs, allowing the removal of PCR inhibitors, such as the heme group, present in the erythrocytes. Once the erythrocytes have been lysed, in the LightCycler(®) 2.0 Instrument, we perform a real-time PCR followed by a melting curve analysis for different genes (Factors 2, 5, 12, MTHFR, and HFE). After testing 34 samples comparing the real-time crossing point (CP) values between WBC (5×10(6) WBC/mL) and purified DNA (20 ng/μL), the results for F5 Leiden were as follows: CP mean value for WBC was 29.26±0.566 versus purified DNA 24.79±0.56. Thus, when PCR was performed from WBC (5×10(6) WBC/mL) instead of DNA (20 ng/μL), we observed a delay of about 4 cycles. These small differences in CP values were similar for all genes tested and did not significantly affect the subsequent analysis by melting curves. In both cases the fluorescence values were high enough, allowing a robust genotyping of all these genes without a previous DNA purification/extraction.

Polymerase chain reaction: A molecular diagnostic tool in periodontology

PubMed Central

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

Polymerase chain reaction: A molecular diagnostic tool in periodontology.

PubMed

Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

2016-01-01

This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

Allele related mutation specific-polymerase chain reaction for rapid diagnosis of Hb New York (beta 113 (G15) Val-->Glu, beta(CD113 GTG-->GAG)).

PubMed

Viprakasit, Vip; Tachavanich, Kalaya; Suwantol, Lerlugsn; Pung-Amritt, Parichat; Chinchang, Worawut; Tanphaichitr, Voravarn S

2002-08-01

Hemoglobin New York (beta 113 (G15) Val-->Glu), a beta-globin variant, was first reported in a Chinese family living in New York. Subsequently, this abnormal hemoglobin was reported in many Chinese descendants from several groups and it was also known as Hb Kaohsiung. The subtle change in alpha1beta1 contact region apart from the heme group connecting area by Val-->Glu substitution has minor changes in both the electrophoretic mobility and stability making this hemoglobin variant difficult to distinguish from Hb A using routine hemoglobin analysis. The authors described a case of heterozygosity of Hb New York diagnosed by a molecular technique and revealed a mutation in beta(CD113 GTG-->GAG). A novel Allele Related Mutation Specific-Polymerase Chain Reaction (ARMS-PCR) for rapid diagnosis of this mutation has been proposed.

Theory and applications of the polymerase chain reaction.

PubMed

Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

1990-04-01

The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

Press Releases | Argonne National Laboratory

Science.gov Websites

Electrochemical Energy Science --Center for Transportation Research --Chain Reaction Innovations --Computation renewable energy such as wind and solar power. April 25, 2018 John Carlisle, director of Chain Reaction across nation to grow startups Argonne announces second cohort of Chain Reaction Innovations. April 18

T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

PubMed

Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

2012-01-01

Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

In Situ Solid-State Reactions Monitored by X-ray Absorption Spectroscopy: Temperature-Induced Proton Transfer Leads to Chemical Shifts.

PubMed

Stevens, Joanna S; Walczak, Monika; Jaye, Cherno; Fischer, Daniel A

2016-10-24

The dramatic colour and phase alteration with the solid-state, temperature-dependent reaction between squaric acid and 4,4'-bipyridine has been probed in situ with X-ray absorption spectroscopy. The electronic and chemical sensitivity to the local atomic environment through chemical shifts in the near-edge X-ray absorption fine structure (NEXAFS) revealed proton transfer from the acid to the bipyridine base through the change in nitrogen protonation state in the high-temperature form. Direct detection of proton transfer coupled with structural analysis elucidates the nature of the solid-state process, with intermolecular proton transfer occurring along an acid-base chain followed by a domino effect to the subsequent acid-base chains, leading to the rapid migration along the length of the crystal. NEXAFS thereby conveys the ability to monitor the nature of solid-state chemical reactions in situ, without the need for a priori information or long-range order. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Apparatus and method for polymer synthesis using arrays

DOEpatents

Brennan, Thomas M.

1995-01-01

A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24) , and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31) , downstream from the nozzles (22) , sweeps the common chamber ( 31 ) of toxic fumes emitted by the reagents. Each reaction well (26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.

Apparatus and method for polymer synthesis using arrays

DOEpatents

Brennan, Thomas M.

1996-01-01

A polymer synthesis apparatus (20) for building a polymer chain including a head assembly (21) having an array of nozzles (22) with each nozzle coupled to a reservoir (23) of liquid reagent (24), and a base assembly (25) having an array of reaction wells (26). A transport mechanism (27) aligns the reaction wells (26) and selected nozzles (22) for deposition of the liquid reagent (24) into selected reaction wells (26). A sliding seal (30) is positioned between the head assembly (21) and the base assembly (25) to form a common chamber (31) enclosing both the reaction well (26) and the nozzles (22) therein. A gas inlet (70) into the common chamber (31), upstream from the nozzles (22), and a gas outlet (71) out of the common chamber (31), downstream from the nozzles (22), sweeps the common chamber (31) of toxic fumes emitted by the reagents. Each reaction well ( 26) includes an orifice (74) extending into the well (26) which is of a size and dimension to form a capillary liquid seal to retain the reagent solution (76) in the well (26) for polymer chain growth therein. A pressure regulating device (82 ) is provided for controlling a pressure differential, between a first gas pressure exerted on the reaction well (26) and a second gas pressure exerted on an exit (80) of the orifice, such that upon the pressure differential exceeding a predetermined amount, the reagent solution (76) is expelled from the well (26) through the orifice (74). A method of synthesis of a polymer chain in a synthesis apparatus (20) is also included.

Mechanisms of tail resorption during anuran metamorphosis.

PubMed

Nakai, Yuya; Nakajima, Keisuke; Yaoita, Yoshio

2017-09-26

Amphibian metamorphosis has historically attracted a good deal of scientific attention owing to its dramatic nature and easy observability. However, the genetic mechanisms of amphibian metamorphosis have not been thoroughly examined using modern techniques such as gene cloning, DNA sequencing, polymerase chain reaction or genomic editing. Here, we review the current state of knowledge regarding molecular mechanisms underlying tadpole tail resorption.

The Role of the Side Chain on the Performance of N-type Conjugated Polymers in Aqueous Electrolytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giovannitti, Alexander; Maria, Iuliana P.; Hanifi, David

Here, we report a design strategy that allows the preparation of solution processable n-type materials from low boiling point solvents for organic electrochemical transistors (OECTs). The polymer backbone is based on NDI-T2 copolymers where a branched alkyl side chain is gradually exchanged for a linear ethylene glycol-based side chain. A series of random copolymers was prepared with glycol side chain percentages of 0, 10, 25, 50, 75, 90, and 100 with respect to the alkyl side chains. These were characterized to study the influence of the polar side chains on interaction with aqueous electrolytes, their electrochemical redox reactions, and performancemore » in OECTs when operated in aqueous electrolytes. We observed that glycol side chain percentages of >50% are required to achieve volumetric charging, while lower glycol chain percentages show a mixed operation with high required voltages to allow for bulk charging of the organic semiconductor. A strong dependence of the electron mobility on the fraction of glycol chains was found for copolymers based on NDI-T2, with a significant drop as alkyl side chains are replaced by glycol side chains.« less

The Role of the Side Chain on the Performance of N-type Conjugated Polymers in Aqueous Electrolytes.

PubMed

Giovannitti, Alexander; Maria, Iuliana P; Hanifi, David; Donahue, Mary J; Bryant, Daniel; Barth, Katrina J; Makdah, Beatrice E; Savva, Achilleas; Moia, Davide; Zetek, Matyáš; Barnes, Piers R F; Reid, Obadiah G; Inal, Sahika; Rumbles, Garry; Malliaras, George G; Nelson, Jenny; Rivnay, Jonathan; McCulloch, Iain

2018-05-08

We report a design strategy that allows the preparation of solution processable n-type materials from low boiling point solvents for organic electrochemical transistors (OECTs). The polymer backbone is based on NDI-T2 copolymers where a branched alkyl side chain is gradually exchanged for a linear ethylene glycol-based side chain. A series of random copolymers was prepared with glycol side chain percentages of 0, 10, 25, 50, 75, 90, and 100 with respect to the alkyl side chains. These were characterized to study the influence of the polar side chains on interaction with aqueous electrolytes, their electrochemical redox reactions, and performance in OECTs when operated in aqueous electrolytes. We observed that glycol side chain percentages of >50% are required to achieve volumetric charging, while lower glycol chain percentages show a mixed operation with high required voltages to allow for bulk charging of the organic semiconductor. A strong dependence of the electron mobility on the fraction of glycol chains was found for copolymers based on NDI-T2, with a significant drop as alkyl side chains are replaced by glycol side chains.

The Role of the Side Chain on the Performance of N-type Conjugated Polymers in Aqueous Electrolytes

DOE PAGES

Giovannitti, Alexander; Maria, Iuliana P.; Hanifi, David; ...

2018-04-24

Here, we report a design strategy that allows the preparation of solution processable n-type materials from low boiling point solvents for organic electrochemical transistors (OECTs). The polymer backbone is based on NDI-T2 copolymers where a branched alkyl side chain is gradually exchanged for a linear ethylene glycol-based side chain. A series of random copolymers was prepared with glycol side chain percentages of 0, 10, 25, 50, 75, 90, and 100 with respect to the alkyl side chains. These were characterized to study the influence of the polar side chains on interaction with aqueous electrolytes, their electrochemical redox reactions, and performancemore » in OECTs when operated in aqueous electrolytes. We observed that glycol side chain percentages of >50% are required to achieve volumetric charging, while lower glycol chain percentages show a mixed operation with high required voltages to allow for bulk charging of the organic semiconductor. A strong dependence of the electron mobility on the fraction of glycol chains was found for copolymers based on NDI-T2, with a significant drop as alkyl side chains are replaced by glycol side chains.« less

Run-length encoding graphic rules, biochemically editable designs and steganographical numeric data embedment for DNA-based cryptographical coding system.

PubMed

Kawano, Tomonori

2013-03-01

There have been a wide variety of approaches for handling the pieces of DNA as the "unplugged" tools for digital information storage and processing, including a series of studies applied to the security-related area, such as DNA-based digital barcodes, water marks and cryptography. In the present article, novel designs of artificial genes as the media for storing the digitally compressed data for images are proposed for bio-computing purpose while natural genes principally encode for proteins. Furthermore, the proposed system allows cryptographical application of DNA through biochemically editable designs with capacity for steganographical numeric data embedment. As a model case of image-coding DNA technique application, numerically and biochemically combined protocols are employed for ciphering the given "passwords" and/or secret numbers using DNA sequences. The "passwords" of interest were decomposed into single letters and translated into the font image coded on the separate DNA chains with both the coding regions in which the images are encoded based on the novel run-length encoding rule, and the non-coding regions designed for biochemical editing and the remodeling processes revealing the hidden orientation of letters composing the original "passwords." The latter processes require the molecular biological tools for digestion and ligation of the fragmented DNA molecules targeting at the polymerase chain reaction-engineered termini of the chains. Lastly, additional protocols for steganographical overwriting of the numeric data of interests over the image-coding DNA are also discussed.

Unraveling reaction pathways and specifying reaction kinetics for complex systems.

PubMed

Vinu, R; Broadbelt, Linda J

2012-01-01

Many natural and industrial processes involve a complex set of competing reactions that include several different species. Detailed kinetic modeling of such systems can shed light on the important pathways involved in various transformations and therefore can be used to optimize the process conditions for the desired product composition and properties. This review focuses on elucidating the various components involved in modeling the kinetics of pyrolysis and oxidation of polymers. The elementary free radical steps that constitute the chain reaction mechanism of gas-phase/nonpolar liquid-phase processes are outlined. Specification of the rate coefficients of the various reaction families, which is central to the theme of kinetics, is described. Construction of the reaction network on the basis of the types of end groups and reactive moieties in a polymer chain is discussed. Modeling frameworks based on the method of moments and kinetic Monte Carlo are evaluated using illustrations. Finally, the prospects and challenges in modeling biomass conversion are addressed.

Detecting Service Chains and Feature Interactions in Sensor-Driven Home Network Services

PubMed Central

Inada, Takuya; Igaki, Hiroshi; Ikegami, Kosuke; Matsumoto, Shinsuke; Nakamura, Masahide; Kusumoto, Shinji

2012-01-01

Sensor-driven services often cause chain reactions, since one service may generate an environmental impact that automatically triggers another service. We first propose a framework that can formalize and detect such service chains based on ECA (event, condition, action) rules. Although the service chain can be a major source of feature interactions, not all service chains lead to harmful interactions. Therefore, we then propose a method that identifies feature interactions within the service chains. Specifically, we characterize the degree of deviation of every service chain by evaluating the gap between expected and actual service states. An experimental evaluation demonstrates that the proposed method successfully detects 11 service chains and 6 feature interactions within 7 practical sensor-driven services. PMID:23012499

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

PubMed Central

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

Introduction to Polymer Chemistry.

ERIC Educational Resources Information Center

Harris, Frank W.

1981-01-01

Reviews the physical and chemical properties of polymers and the two major methods of polymer synthesis: addition (chain, chain-growth, or chain-reaction), and condensation (step-growth or step-reaction) polymerization. (JN)

Modification of gDNA extraction from soil for PCR designed for the routine examination of soil samples contaminated with Toxocara spp. eggs.

PubMed

Borecka, A; Gawor, J

2008-06-01

A modification of gDNA extraction was developed for the polymerase chain reaction (PCR) technique, intended for the detection and differentiation of Toxocara spp. eggs in soil or sediments. Sand samples from sandpits confirmed as being contaminated with Toxocara spp. eggs by the flotation technique were analysed by PCR. The use of proteinase K made it possible to obtain genomic DNA from the sample without needing to isolate eggs using flotation or to inactivate PCR inhibitors present in the sand. Specific primers in the PCR reaction allowed discrimination between T. canis and T. cati eggs. The modification simplified the procedure, thanks to eliminating the step of gDNA isolation from eggs, which is both laborious and difficult.

Simultaneous determination of thermodynamic and kinetic parameters of aminopolycarbonate complexes of cobalt(II) and nickel(II) based on isothermal titration calorimetry data.

PubMed

Tesmar, Aleksandra; Wyrzykowski, Dariusz; Muñoz, Eva; Pilarski, Bogusław; Pranczk, Joanna; Jacewicz, Dagmara; Chmurzyński, Lech

2017-04-01

The influence of the different side chain residues on the thermodynamic and kinetic parameters for complexation reactions of the Co 2 + and Ni 2 + ions has been investigated by using the isothermal titration calorimetry (ITC) technique supported by potentiometric titration data. The study was concerned with the 2 common tripodal aminocarboxylate ligands, namely, nitrilotriacetic acid and N-(2-hydroxyethyl) iminodiacetic acid. Calorimetric measurements (ITC) were run in the 2-(N-morpholino)ethanesulfonic acid hydrate (2-(N-morpholino) ethanesulfonic acid), piperazine-N,N'-bis(2-ethanesulfonic acid), and dimethylarsenic acid buffers (0.1 mol L -1 , pH 6) at 298.15 K. The quantification of the metal-buffer interactions and their incorporation into the ITC data analysis enabled to obtain the pH-independent and buffer-independent thermodynamic parameters (K, ΔG, ΔH, and ΔS) for the reactions under study. Furthermore, the kinITC method was applied to obtain kinetic information on complexation reactions from the ITC data. Correlations, based on kinetic and thermodynamic data, between the kinetics of formation of Co 2 + and Ni 2 + complexes and their thermodynamic stabilities are discussed. Copyright © 2016 John Wiley & Sons, Ltd.

[Establishment of a novel HLA genotyping method for preimplantation genetic diagnonis using multiple displacement amplification-polymerase chain reaction-sequencing based technique].

PubMed

Zhang, Yinfeng; Luo, Haining; Zhang, Yunshan

2015-12-01

To establish a novel HLA genotyping method for preimplantation genetic diagnonis (PGD) using multiple displacement amplification-polymerase chain reaction-sequencing based technique (MDA-PCR-SBT). Peripheral blood samples and 76 1PN, 2PN, 3PN discarded embryos from 9 couples were collected. The alleles of HLA-A, B, DR loci were detected from the MDA product with the PCR-SBT method. The HLA genotypes of the parental peripheral blood samples were analyzed with the same protocol. The genotypes of specific HLA region were evaluated for distinguishing the segregation of haplotypes among the family members, and primary HLA matching was performed between the embryos. The 76 embryos were subjected to MDA and 74 (97.4%) were successfully amplified. For the 34 embryos from the single blastomere group, the amplification rate was 94.1%, and for the 40 embryos in the two blastomeres group, the rate was 100%. The dropout rates for DQ allele and DR allele were 1.3% and 0, respectively. The positive rate for MDA in the single blastomere group was 100%, with the dropout rates for DQ allele and DR allele being 1.5% and 0, respectively. The positive rate of MDA for the two blastomere group was 100%, with the dropout rates for both DQ and DR alleles being 0. The recombination rate of fetal HLA was 20.2% (30/148). Due to the improper classification and abnormal fertilized embryos, the proportion of matched embryos HLA was 20.3% (15/74),which was lower than the theoretical value of 25%. PGD with HLA matching can facilitate creation of a HLA-identical donor (saviour child) for umbilical cord blood or bone marrow stem cells for its affected sibling with a genetic disease. Therefore, preimplantation HLA matching may provide a tool for couples desiring to conceive a potential donor progeny for transplantation for its sibling with a life-threatening disorder.

Direct RNA detection without nucleic acid purification and PCR: Combining sandwich hybridization with signal amplification based on branched hybridization chain reaction.

PubMed

Xu, Yao; Zheng, Zhi

2016-05-15

We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.

Computational study on UV curing characteristics in nanoimprint lithography: Stochastic simulation

NASA Astrophysics Data System (ADS)

Koyama, Masanori; Shirai, Masamitsu; Kawata, Hiroaki; Hirai, Yoshihiko; Yasuda, Masaaki

2017-06-01

A computational simulation model of UV curing in nanoimprint lithography based on a simplified stochastic approach is proposed. The activated unit reacts with a randomly selected monomer within a critical reaction radius. Cluster units are chained to each other. Then, another monomer is activated and the next chain reaction occurs. This process is repeated until a virgin monomer disappears within the reaction radius or until the activated monomers react with each other. The simulation model well describes the basic UV curing characteristics, such as the molecular weight distributions of the reacted monomers and the effect of the initiator concentration on the conversion ratio. The effects of film thickness on UV curing characteristics are also studied by the simulation.

Photochemical reaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen) with basic amino acids and dipeptides.

PubMed

Suzuki, Tadashi; Shinoda, Mio; Osanai, Yohei; Isozaki, Tasuku

2013-08-22

Photoreaction of 2-(3-benzoylphenyl)propionic acid (ketoprofen, KP) with basic amino acids (histidine, lysine, and arginine) and dipeptides (carnosine and anserine) including a histidine moiety in phosphate buffer solution (pH 7.4) has been investigated with transient absorption spectroscopy. With UV irradiation KP(-) gave rise to a carbanion through a decarboxylation reaction, and the carbanion easily abstracted a proton from the surrounding molecule to yield a 3-ethylbenzophenone ketyl biradical (EBPH). The dipeptides as well as the basic amino acids were found to accelerate the proton transfer reaction whereas alanine and glycine had no effect on the reaction, revealing that these amino acids having a protonated side chain act as a proton donor. The formation quantum yield of EBPH was estimated to be fairly large by means of an actinometrical method with benzophenone, and the bimolecular reaction rate constant for the proton transfer between the carbanion and the protonated basic amino acids or the protonated dipeptides was successfully determined. It has become apparent that the bimolecular reaction rate constant for the proton transfer depended on the acid dissociation constant for the side chain of the amino acids for the first time. This reaction mechanism was interpreted by difference of the heat of reaction for each basic amino acid based on the thermodynamical consideration. These results strongly suggest that the side chain of the basic amino acid residue in protein should play an important role for photochemistry of KP in vivo.

Polymerization as a Model Chain Reaction

ERIC Educational Resources Information Center

Morton, Maurice

1973-01-01

Describes the features of the free radical, anionic, and cationic mechanisms of chain addition polymerization. Indicates that the nature of chain reactions can be best taught through the study of macromolecules. (CC)

Investigation of polymerase chain reaction assays to improve detection of bacterial involvement in bovine respiratory disease.

PubMed

Bell, Colin J; Blackburn, Paul; Elliott, Mark; Patterson, Tony I A P; Ellison, Sean; Lahuerta-Marin, Angela; Ball, Hywel J

2014-09-01

Bovine respiratory disease (BRD) causes severe economic losses to the cattle farming industry worldwide. The major bacterial organisms contributing to the BRD complex are Mannheimia haemolytica, Histophilus somni, Mycoplasma bovis, Pasteurella multocida, and Trueperella pyogenes. The postmortem detection of these organisms in pneumonic lung tissue is generally conducted using standard culture-based techniques where the presence of therapeutic antibiotics in the tissue can inhibit bacterial isolation. In the current study, conventional and real-time polymerase chain reaction (PCR) assays were used to assess the prevalence of these 5 organisms in grossly pneumonic lung samples from 150 animals submitted for postmortem examination, and the results were compared with those obtained using culture techniques. Mannheimia haemolytica was detected in 51 cases (34%) by PCR and in 33 cases (22%) by culture, H. somni was detected in 35 cases (23.3%) by PCR and in 6 cases (4%) by culture, Myc. bovis was detected in 53 cases (35.3%) by PCR and in 29 cases (19.3%) by culture, P. multocida was detected in 50 cases (33.3%) by PCR and in 31 cases (20.7%) by culture, and T. pyogenes was detected in 42 cases (28%) by PCR and in 31 cases (20.7%) by culture, with all differences being statistically significant. The PCR assays indicated positive results for 111 cases (74%) whereas 82 cases (54.6%) were culture positive. The PCR assays have demonstrated a significantly higher rate of detection of all 5 organisms in cases of pneumonia in cattle in Northern Ireland than was detected by current standard procedures. © 2014 The Author(s).

Detection and management of minimal residual disease in acute lymphoblastic leukemia.

PubMed

Schrappe, Martin

2014-12-05

The detection of minimal residual disease (MRD) has become part of the state-of-the-art diagnostics to guide treatment both in pediatric and adult acute lymphoblastic leukemia (ALL). This applies to the treatment of de novo and recurrent ALL. In high-risk ALL, MRD detection is considered an important tool to adjust therapy before and after hematopoietic stem cell transplantation. Precise quantification and quality control is instrumental to avoid false treatment assignment. A new methodological approach to analyzing MRD has become available and is based on next-generation sequencing. In principle, this technique will be able to detect a large number of leukemic subclones at a much higher speed than before. Carefully designed prospective studies need to demonstrate concordance or even superiority compared with those techniques in use right now: detection of aberrant expression of leukemia-specific antigens by flow cytometry of blood or bone marrow, or detection of specific rearrangements of the T-cell receptor or immunoglobulin genes by real-time quantitative polymerase chain reaction using DNA of leukemic cells. In some cases with known fusion genes, such as BCR/ABL, reverse transcriptase-polymerase chain reaction has been used as additional method to identify leukemic cells by analyzing RNA in patient samples. MRD detection may be used to modulate treatment intensity once it has been demonstrated at well-defined informative checkpoints that certain levels of MRD can reliably predict the risk of relapse. In addition, MRD is used as end point to determine the activity of a given agent or treatment protocol. If activity translates into antileukemic efficacy, MRD may be considered a surrogate clinical end point. © 2014 by The American Society of Hematology. All rights reserved.

Genetic variability and molecular identification of Brazilian Biomphalaria species (Mollusca: Planorbidae).

PubMed

Carvalho, S; Caldeira, R L; Simpson, A J; Vidigal, T H

2001-01-01

Freshwater snails belonging to the genus Biomphalaria are intermediate hosts of the trematode Schistosoma mansoni in the Neotropical region and Africa. In Brazil, one subspecies and ten species of Biomphalaria have been identified: B. glabrata, B. tenagophila, B. straminea, B. occidentalis, B. peregrina, B. kuhniana, B. schrammi, B. amazonica, B. oligoza, B. intermedia and B.t. guaibensis. However, only the first three species are found naturally infected with S. mansoni. The classical identification of these planorbids is based on comparison of morphological characteristics of the shell and male and female reproductive organs, which is greatly complicated by the extensive intra-specific variation. Several molecular techniques have been used in studies on the identification, genetic structure as well as phylogenetic relationships between these groups of organisms. Using the randomly amplified polymorphic DNAs (RAPD) analysis we demonstrated that B. glabrata exhibits a remarkable degree of intra-specific polymorphism. Thus, the genetics of the snail host may be more important to the epidemiology of schistosomiasis than those of the parasite itself. Using the simple sequence repeat anchored polymerase chain reaction (SSR-PCR) in intra-populational and intra-specific studies we have demonstrated that snails belonging to the B. straminea complex (B. straminea, B. kuhniana and B. intermedia) clearly presented higher heterogeneity. Using the low stringency polymerase chain reaction (LS-PCR) technique we were able to separate B. glabrata from B. tenagophila and B. tenagophila from B. occidentalis. To separate all Brazilian Biomphalaria species we used the restriction fragment length polymorphism (PCR-RFLP) of the internal transcribed spacer region (ITS) of the DNA gene. The method also proved to be efficient for the specific identification of DNA extracted from snail eggs. Recently we have sequenced the ITS2 region for phylogenetic studies of all Biomphalaria snails from Brazil.

Development and evaluation of a real-time fluorescent polymerase chain reaction assay for the detection of bovine contaminates in cattle feed.

PubMed

Rensen, Gabriel; Smith, Wayne; Ruzante, Juliana; Sawyer, Mary; Osburn, Bennie; Cullor, James

2005-01-01

A real-time fluorescent polymerase chain reaction assay for detecting prohibited ruminant materials such as bovine meat and bone meal (BMBM) in cattle feed using primers and FRET probes targeting the ruminant specific mitochondrial cytochrome b gene was developed and evaluated on two different types of cattle feed. Common problems involved with PCR based testing of cattle feed include the presence of high levels of PCR inhibitors and the need for certain pre-sample processing techniques in order to perform DNA extractions. We have developed a pre-sample processing technique for extracting DNA from cattle feed which does not require the feed sample to be ground to a fine powder and utilizes materials that are disposed of between samples, thus, reducing the potential of cross contamination. The DNA extraction method utilizes Whatman FTA card technology, is adaptable to high sample throughput analysis and allows for room temperature storage with established archiving of samples of up to 14 years. The Whatman FTA cards are subsequently treated with RNAse and undergo a Chelex-100 extraction (BioRad, Hercules, CA), thus removing potential PCR inhibitors and eluting the DNA from the FTA card for downstream PCR analysis. The detection limit was evaluated over a period of 30 trials on calf starter mix and heifer starter ration feed samples spiked with known concentrations of BMBM. The PCR detection assay detected 0.05% wt/wt BMBM contamination with 100% sensitivity, 100% specificity, and 100% confidence. Concentrations of 0.005% and 0.001% wt/wt BMBM contamination were also detected in both feed types but with varying levels of confidence.

Molecular implementation of molecular shift register memories

NASA Technical Reports Server (NTRS)

Beratan, David N. (Inventor); Onuchic, Jose N. (Inventor)

1991-01-01

An electronic shift register memory (20) at the molecular level is described. The memory elements are based on a chain of electron transfer molecules (22) and the information is shifted by photoinduced (26) electron transfer reactions. Thus, multi-step sequences of charge transfer reactions are used to move charge with high efficiency down a molecular chain. The device integrates compositions of the invention onto a VLSI substrate (36), providing an example of a molecular electronic device which may be fabricated. Three energy level schemes, molecular implementation of these schemes, optical excitation strategies, charge amplification strategies, and error correction strategies are described.

Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

PubMed

Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

2017-08-01

The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

Momentum Distribution as a Fingerprint of Quantum Delocalization in Enzymatic Reactions: Open-Chain Path-Integral Simulations of Model Systems and the Hydride Transfer in Dihydrofolate Reductase.

PubMed

Engel, Hamutal; Doron, Dvir; Kohen, Amnon; Major, Dan Thomas

2012-04-10

The inclusion of nuclear quantum effects such as zero-point energy and tunneling is of great importance in studying condensed phase chemical reactions involving the transfer of protons, hydrogen atoms, and hydride ions. In the current work, we derive an efficient quantum simulation approach for the computation of the momentum distribution in condensed phase chemical reactions. The method is based on a quantum-classical approach wherein quantum and classical simulations are performed separately. The classical simulations use standard sampling techniques, whereas the quantum simulations employ an open polymer chain path integral formulation which is computed using an efficient Monte Carlo staging algorithm. The approach is validated by applying it to a one-dimensional harmonic oscillator and symmetric double-well potential. Subsequently, the method is applied to the dihydrofolate reductase (DHFR) catalyzed reduction of 7,8-dihydrofolate by nicotinamide adenine dinucleotide phosphate hydride (NADPH) to yield S-5,6,7,8-tetrahydrofolate and NADP(+). The key chemical step in the catalytic cycle of DHFR involves a stereospecific hydride transfer. In order to estimate the amount of quantum delocalization, we compute the position and momentum distributions for the transferring hydride ion in the reactant state (RS) and transition state (TS) using a recently developed hybrid semiempirical quantum mechanics-molecular mechanics potential energy surface. Additionally, we examine the effect of compression of the donor-acceptor distance (DAD) in the TS on the momentum distribution. The present results suggest differential quantum delocalization in the RS and TS, as well as reduced tunneling upon DAD compression.

Aligning Goals, Assessments, and Activities: An Approach to Teaching PCR and Gel Electrophoresis

PubMed Central

Robertson, Amber L.; Batzli, Janet; Harris, Michelle; Miller, Sarah

2008-01-01

Polymerase chain reaction (PCR) and gel electrophoresis have become common techniques used in undergraduate molecular and cell biology labs. Although students enjoy learning these techniques, they often cannot fully comprehend and analyze the outcomes of their experiments because of a disconnect between concepts taught in lecture and experiments done in lab. Here we report the development and implementation of novel exercises that integrate the biological concepts of DNA structure and replication with the techniques of PCR and gel electrophoresis. Learning goals were defined based on concepts taught throughout the cell biology lab course and learning objectives specific to the PCR and gel electrophoresis lab. Exercises developed to promote critical thinking and target the underlying concepts of PCR, primer design, gel analysis, and troubleshooting were incorporated into an existing lab unit based on the detection of genetically modified organisms. Evaluative assessments for each exercise were aligned with the learning goals and used to measure student learning achievements. Our analysis found that the exercises were effective in enhancing student understanding of these concepts as shown by student performance across all learning goals. The new materials were particularly helpful in acquiring relevant knowledge, fostering critical-thinking skills, and uncovering prevalent misconceptions. PMID:18316813

Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

PubMed

Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

2014-09-01

The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

Inference of reaction rate parameters based on summary statistics from experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khalil, Mohammad; Chowdhary, Kamaljit Singh; Safta, Cosmin

Here, we present the results of an application of Bayesian inference and maximum entropy methods for the estimation of the joint probability density for the Arrhenius rate para meters of the rate coefficient of the H 2/O 2-mechanism chain branching reaction H + O 2 → OH + O. Available published data is in the form of summary statistics in terms of nominal values and error bars of the rate coefficient of this reaction at a number of temperature values obtained from shock-tube experiments. Our approach relies on generating data, in this case OH concentration profiles, consistent with the givenmore » summary statistics, using Approximate Bayesian Computation methods and a Markov Chain Monte Carlo procedure. The approach permits the forward propagation of parametric uncertainty through the computational model in a manner that is consistent with the published statistics. A consensus joint posterior on the parameters is obtained by pooling the posterior parameter densities given each consistent data set. To expedite this process, we construct efficient surrogates for the OH concentration using a combination of Pad'e and polynomial approximants. These surrogate models adequately represent forward model observables and their dependence on input parameters and are computationally efficient to allow their use in the Bayesian inference procedure. We also utilize Gauss-Hermite quadrature with Gaussian proposal probability density functions for moment computation resulting in orders of magnitude speedup in data likelihood evaluation. Despite the strong non-linearity in the model, the consistent data sets all res ult in nearly Gaussian conditional parameter probability density functions. The technique also accounts for nuisance parameters in the form of Arrhenius parameters of other rate coefficients with prescribed uncertainty. The resulting pooled parameter probability density function is propagated through stoichiometric hydrogen-air auto-ignition computations to illustrate the need to account for correlation among the Arrhenius rate parameters of one reaction and across rate parameters of different reactions.« less

Inference of reaction rate parameters based on summary statistics from experiments

DOE PAGES

Khalil, Mohammad; Chowdhary, Kamaljit Singh; Safta, Cosmin; ...

2016-10-15

Here, we present the results of an application of Bayesian inference and maximum entropy methods for the estimation of the joint probability density for the Arrhenius rate para meters of the rate coefficient of the H 2/O 2-mechanism chain branching reaction H + O 2 → OH + O. Available published data is in the form of summary statistics in terms of nominal values and error bars of the rate coefficient of this reaction at a number of temperature values obtained from shock-tube experiments. Our approach relies on generating data, in this case OH concentration profiles, consistent with the givenmore » summary statistics, using Approximate Bayesian Computation methods and a Markov Chain Monte Carlo procedure. The approach permits the forward propagation of parametric uncertainty through the computational model in a manner that is consistent with the published statistics. A consensus joint posterior on the parameters is obtained by pooling the posterior parameter densities given each consistent data set. To expedite this process, we construct efficient surrogates for the OH concentration using a combination of Pad'e and polynomial approximants. These surrogate models adequately represent forward model observables and their dependence on input parameters and are computationally efficient to allow their use in the Bayesian inference procedure. We also utilize Gauss-Hermite quadrature with Gaussian proposal probability density functions for moment computation resulting in orders of magnitude speedup in data likelihood evaluation. Despite the strong non-linearity in the model, the consistent data sets all res ult in nearly Gaussian conditional parameter probability density functions. The technique also accounts for nuisance parameters in the form of Arrhenius parameters of other rate coefficients with prescribed uncertainty. The resulting pooled parameter probability density function is propagated through stoichiometric hydrogen-air auto-ignition computations to illustrate the need to account for correlation among the Arrhenius rate parameters of one reaction and across rate parameters of different reactions.« less

Techniques for the diagnosis of Fasciola infections in animals: room for improvement.

PubMed

Alvarez Rojas, Cristian A; Jex, Aaron R; Gasser, Robin B; Scheerlinck, Jean-Pierre Y

2014-01-01

The common liver fluke, Fasciola hepatica, causes fascioliasis, a significant disease in mammals, including livestock, wildlife and humans, with a major socioeconomic impact worldwide. In spite of its impact, and some advances towards the development of vaccines and new therapeutic agents, limited attention has been paid to the need for practical and reliable methods for the diagnosis of infection or disease. Accurate diagnosis is central to effective control, particularly given an emerging problem with drug resistance in F. hepatica. Traditional coprological techniques have been widely used, but are often unreliable. Although there have been some advances in establishing immunologic techniques, these tools can suffer from a lack of diagnostic specificity and/or sensitivity. Nonetheless, antigen detection tests seem to have considerable potential, but have not yet been adequately evaluated in the field. Moreover, advanced nucleic acid-based methods appear to offer the most promise for the diagnosis of current infection. This chapter (i) provides a brief account of the biology and significance of F. hepatica/fascioliasis, (ii) describes key techniques currently in use, (iii) compares their advantages/disadvantages and (iv) reviews polymerase chain reaction-based methods for specific diagnosis and/or the genetic characterization of Fasciola species. © 2014 Elsevier Ltd. All rights reserved.

SuFEx-Based Polysulfonate Formation from Ethenesulfonyl Fluoride-Amine Adducts

DOE PAGES

Wang, Hua; Zhou, Feng; Ren, Gerui; ...

2017-05-18

In this article, the SuFEx-based polycondensation between bisalkylsulfonyl fluorides (AA monomers) and bisphenol bis(t-butyldimethylsilyl) ethers (BB monomers) using [Ph 3P=N-PPh 3] +[HF 2] - as the catalyst is described. The AA monomers were prepared via the highly reliable Michael addition of ethenesulfonyl fluoride and amines/anilines while the BB monomers were obtained from silylation of bisphenols by t-butyldimethylsilyl chloride. With these reactions, a remarkable diversity of monomeric building blocks was achieved by exploiting readily available amines, anilines, and bisphenols as starting materials. The SuFEx-based polysulfonate formation reaction exhibited excellent efficiency and functional group tolerance, producing polysulfonates with a variety of sidemore » chain functionalities in >99 % conversion within 10 min to 1 h. When bearing an orthogonal group on the side chain, the polysulfonates can be further functionalized via click-chemistry-based post-polymerization modification.« less

Synthesis of silica-polymer core-shell nanoparticles by reversible addition-fragmentation chain transfer polymerization.

PubMed

Moraes, John; Ohno, Kohji; Maschmeyer, Thomas; Perrier, Sébastien

2013-10-14

Hybrid nanoparticles hold great promise for a range of applications such as drug-delivery vectors or colloidal crystal self-assemblies. The challenge of preparing highly monodisperse particles for these applications has recently been overcome by using living radical polymerization techniques. In particular, the use of reversible addition-fragmentation chain transfer (RAFT), initiated from silica surfaces, yields well-defined particles from a range of precursor monomers resulting in nanoparticles of tailored sizes that are accessible via the rational selection of polymerization conditions. Furthermore, using RAFT allows post-polymerization modification to afford multifunctional, monodisperse, nanostructures under mild and non-stringent reaction conditions.

Enhancement of Localized Surface Plasmon Resonance polymer based biosensor chips using well-defined glycopolymers for lectin detection.

PubMed

Jin, Yan; Wong, Kok Hou; Granville, Anthony Michael

2016-01-15

Poly(methyl methacrylate) polymer based Localized Surface Plasmon Resonance biosensor chips were successfully fabricated using glycopolymer brushes carrying glucose moieties for the detection of concanavalin A. Poly(pentafluorostyrene), with pre-determined polymer chain lengths, were synthesized via a reversible addition-fragmentation chain transfer polymerization technique. The synthesized poly(pentafluorostyrene), was subsequently converted into glycopolymers via a para-fluoro-thiol "click" reaction and grafted onto the surface of sensor chips. The "glycocluster effect" induced by pendent carbohydrate moieties enabled a stronger affinity for concanavalin A binding, which resulted in a dramatic expansion of the sensors' response range. It was discovered that the longer polymer brushes did not guarantee additional enhancements for the sensor chips. Instead, they could lead to higher detection limits. In this study, the limit of detection for the sensor chips was discovered to be 1.3nmolL(-1) with a saturated response at 1054.2nmolL(-1). In addition to the superior performance, the capabilities of the reported sensor chips can be easily manipulated to detect a diverse range of analytes by "clicking" various sensing elements onto the polymer brushes. Copyright © 2015 Elsevier Inc. All rights reserved.

THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST

PubMed Central

Keil, Harry; Wasserman, David; Dawson, Charles R.

1944-01-01

1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive. PMID:19871415

THE RELATION OF CHEMICAL STRUCTURE IN CATECHOL COMPOUNDS AND DERIVATIVES TO POISON IVY HYPERSENSITIVENESS IN MAN AS SHOWN BY THE PATCH TEST.

PubMed

Keil, H; Wasserman, D; Dawson, C R

1944-10-01

1. Additional evidence is presented in support of the view which postulates a close chemical and biologic relation between the active ingredients in poison ivy and Japan lac. 2. Biologic evidence, based on the use of the patch test in man, is presented in support of the view that the active ingredient in poison ivy is a catechol derivative with a long, unsaturated side-chain in the 3-position. 3. Of the catechol compounds and derivatives studied, group reactions in patients sensitive to poison ivy leaves or extract were exhibited by the following compounds: 3-pentadecyl catechol (100 per cent of 21 cases), 4-pentadecyl catechol (38 per cent of 21 cases), "urushiol" dimethyl ether (33 per cent of 33 cases), 3-pentadecenyl-1'-veratrole (21 per cent of 14 cases), 3-methyl catechol (14 per cent of 21 cases), and hydrourushiol dimethyl ether (10 per cent of 20 cases). It has been found that 3-geranyl catechol shows a practically constant group reactivity in persons sensitive to poison ivy. 4. The uniformly positive group reaction to 3-pentadecyl catechol is notable since this substance possesses a saturated side-chain, whereas the active ingredient in poison ivy is known to have an unsaturated side-chain. 5. The group reactivity was not restricted to the 3-position, for in some instances 4-pentadecyl catechol also gave group reactions which, however, were less intense and less frequent than those shown by 3-pentadecyl catechol. This indicates that in some cases a long side-chain in the 4 position may be effective in producing group specific reactions. 6. Only an occasional person showed sensitiveness to 3-methyl catechol (short side-chain), and in one instance the group reactivity appeared to be specific for the 3-position. 7. The position of the side-chain in the catechol configuration has some bearing on the degree and incidence of group reactions in persons hypersensitive to poison ivy. 8. Evidence is presented to indicate that the introduction of double bonds in the alkyl side-chain increases the incidence and intensity of group reactions. 9. Methylating the hydroxyl groups in the catechol configuration diminishes strongly the incidence of group reactivity but does not eliminate it entirely in persons hypersensitive to poison ivy. Thus, "urushiol" dimethyl ether (3-pentadecadienyl veratrole) gave group reactions in 33 per cent of 33 persons. 10. Methylating the hydroxyl groups as well as saturating the double bonds in the alkyl side-chain still further diminishes the group reactions but an occasional person hypersensitive to poison ivy may still show positive reaction to such a substance as 3-pentadecyl veratrole (hydrourushiol dimethyl ether). In this respect our results are not in full agreement with those recorded by Toyama who stated that hydrourushiol dimethyl ether is entirely harmless. 11. The significance of the group reactivity displayed by certain veratrole compounds is discussed, and several possible explanations of their behavior are advanced. 12. The group reactions discussed in this paper relate only to various catechol and veratrole compounds. Preliminary studies by us indicate that this sensitiveness extends to other phenolic derivatives. 13. Among the veratrole compounds showing positive reactions, the order of frequency and intensity was: (1) "urushiol" dimethyl ether (average of two double bonds); (2) S-pentadecenyl-1'-veratrole (one double bond); (3) hydrourushiol dimethyl ether (saturated side-chain). It may be noted that 4-pentadecyl veratrole was inactive.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Hua; Zhou, Feng; Ren, Gerui

In this article, the SuFEx-based polycondensation between bisalkylsulfonyl fluorides (AA monomers) and bisphenol bis(t-butyldimethylsilyl) ethers (BB monomers) using [Ph 3P=N-PPh 3] +[HF 2] - as the catalyst is described. The AA monomers were prepared via the highly reliable Michael addition of ethenesulfonyl fluoride and amines/anilines while the BB monomers were obtained from silylation of bisphenols by t-butyldimethylsilyl chloride. With these reactions, a remarkable diversity of monomeric building blocks was achieved by exploiting readily available amines, anilines, and bisphenols as starting materials. The SuFEx-based polysulfonate formation reaction exhibited excellent efficiency and functional group tolerance, producing polysulfonates with a variety of sidemore » chain functionalities in >99 % conversion within 10 min to 1 h. When bearing an orthogonal group on the side chain, the polysulfonates can be further functionalized via click-chemistry-based post-polymerization modification.« less

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2014 CFR

2014-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2013 CFR

2013-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

9 CFR 147.31 - Laboratory procedures recommended for the real-time polymerase chain reaction test for Mycoplasma...

Code of Federal Regulations, 2012 CFR

2012-01-01

... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...

Emilio Segrè and Spontaneous Fission

Science.gov Websites

fissioned instead. The discovery of fission led in turn to the discovery of the chain reaction that, if material apart before it had a chance to undergo an efficient chain reaction. The possibility of chain reaction. If a similar rate was found in plutonium, it might rule out the use of that element as

Inhalation Toxicology Research Institute Annual Report, 1992-1993

DTIC Science & Technology

1993-11-01

for Mineral and Energy Technology ( CANMET ). The ITRI team participated in all phases of the intercomparison studies. The methods, procedures, and...differential cloning, and differential hybridization techniques. However, with recent advances in polymerase chain reaction (PCR) technology , an...viii I. AEROSOL TECHNOLOGY AND CHARACTERIZATION OF AIRBORNE MATERIALS Measurement of Thoron and Thoron/Radon Mixtures Y. S. Cheng and H. C. Yeh Use of a

A multiple multicomponent approach to chimeric peptide-peptoid podands.

PubMed

Rivera, Daniel G; León, Fredy; Concepción, Odette; Morales, Fidel E; Wessjohann, Ludger A

2013-05-10

The success of multi-armed, peptide-based receptors in supramolecular chemistry traditionally is not only based on the sequence but equally on an appropriate positioning of various peptidic chains to create a multivalent array of binding elements. As a faster, more versatile and alternative access toward (pseudo)peptidic receptors, a new approach based on multiple Ugi four-component reactions (Ugi-4CR) is proposed as a means of simultaneously incorporating several binding and catalytic elements into organizing scaffolds. By employing α-amino acids either as the amino or acid components of the Ugi-4CRs, this multiple multicomponent process allows for the one-pot assembly of podands bearing chimeric peptide-peptoid chains as appended arms. Tripodal, bowl-shaped, and concave polyfunctional skeletons are employed as topologically varied platforms for positioning the multiple peptidic chains formed by Ugi-4CRs. In a similar approach, steroidal building blocks with several axially-oriented isocyano groups are synthesized and utilized to align the chimeric chains with conformational constrains, thus providing an alternative to the classical peptido-steroidal receptors. The branched and hybrid peptide-peptoid appendages allow new possibilities for both rational design and combinatorial production of synthetic receptors. The concept is also expandable to other multicomponent reactions. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Synthesis, Characterization and Application of Thermoresponsive Polyhydroxyalkanoate-graft-Poly(N-isopropylacrylamide).

PubMed

Ma, Yi-Ming; Wei, Dai-Xu; Yao, Hui; Wu, Lin-Ping; Chen, Guo-Qiang

2016-08-08

A thermoresponsive graft copolymer polyhydroxyalkanoate-g-poly(N-isopropylacrylamide) or short as PHA-g-PNIPAm, was successfully synthesized via a three-step reaction. First, PNIPAm oligomer with a trithiocarbonate-based chain transfer agent (CTA), short as PNIPAm-CTA, with designed polymerization degree was synthesized via reversible addition-fragmentation chain transfer (RAFT) polymerization. Subsequently, the PNIPAm-CTA was treated with n-butylamine for aminolysis in order to obtain a pendant thiol group at the end of the chain (PNIPAm-SH). Finally, the PNIPAm-SH was grafted onto unsaturated P(3HDD-co-3H10U), a random copolymer of 3-hydroxydodecanoate (3HDD) and 3-hydroxy-10-undecylenate (3H10U), via a thiol-ene click reaction. Enhanced hydrophilicity and thermoresponsive property of the resulted PHA-g-PNIPAm were confirmed by water contact angle studies. The biocompatibility of PHA-g-PNIPAm was comparable to poly-3-hydroxybutyrate (PHB). The graft copolymer PHA-g-PNIPAm based on biopolyester PHA could be a promising material for biomedical applications.

Amplification of ST50 gene using dry-reagent-based polymerase chain reaction for the detection of Salmonella typhi.

PubMed

Aziah, Ismail; Ravichandran, Manickam; Ismail, Asma

2007-12-01

Conventional polymerase chain reaction (PCR) testing requires many pipetting steps and has to be transported and stored in cold chain. To overcome these limitations, we designed a ready-to-use PCR test for Salmonella typhi using PCR reagents, primers against the ST50 gene of S. typhi, a built-in internal amplification control (IAC), and gel loading dye mixed and freeze-dried in a single tube. The 2-step dry-reagent-based assay was used to amplify a 1238-bp target gene and an 810-bp IAC gene from 73 BACTEC blood culture broths (33 true positives for S. typhi and 40 true negatives for non-S. typhi). The sensitivity, specificity, positive predictive value, and negative predictive value of the PCR assay were 87.9%, 100%, 100%, and 90.9%, respectively. We suggest that this rapid 2-step PCR test could be used for the rapid diagnosis of typhoid fever.

Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

USGS Publications Warehouse

Chase, D.M.; Elliott, D.G.; Pascho, R.J.

2006-01-01

Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

Role of microbiological culture and polymerase chain reaction (PCR) of actinomyces in medication-related osteonecrosis of the jaw (MRONJ).

PubMed

Panya, Sappasith; Fliefel, Riham; Probst, Florian; Tröltzsch, Matthias; Ehrenfeld, Michael; Schubert, Sören; Otto, Sven

2017-03-01

We hypothesized that local infection plays a critical role in the pathogenesis of medication-related osteonecrosis of the jaw (MRONJ). Recent developments in molecular methods have revolutionized new approaches for the rapid detection of microorganisms including those difficult to culture. The aim of our study is to identify the bacterial profiles in MRONJ by microbiological culture and polymerase chain reactions (PCR). A retrospective analysis was performed on MRONJ patients from 2008 to 2014. The bacterial profile from MRONJ bone samples was determined using microbiological culture and PCR. Ninety five patients fulfilled the inclusion criteria with mean age of 69.85 ± 8.71 years. A female predilection was detected. The mandible was more commonly affected than maxilla. Tooth extraction was the frequent triggering factor. Breast cancer was the primary cause for administration and intravenous bisphosphonates were the most commonly administrated antiresorptive drugs. The majority of patients were classified as stage 2. Posterior teeth were most commonly affected. Based on bone culture results, the most common microorganism were both actinomyces and mixed flora. PCR confirmed the presence of actinomyces in 55 patients. Our data suggest that PCR might be an innovative method for detection of microorganisms difficult to culture using traditional microbiological techniques. Copyright © 2017 European Association for Cranio-Maxillo-Facial Surgery. Published by Elsevier Ltd. All rights reserved.

The molecular genetic basis of mitochondrial malfunction in bladder tissue following outlet obstruction.

PubMed

Levin, Robert M; Hudson, Alan P

2004-08-01

Bladder dysfunction following partial outlet obstruction is a frequent consequence of benign prostatic hyperplasia and an increasingly common problem given the aging of the general population. Recent studies from this and other groups have begun to elucidate the molecular bases for the well described physiological malfunctions that characterize this clinical entity. We summarized and synthesized that information. Using modern methods of molecular genetics, including real-time polymerase chain reaction, real-time reverse transcriptase-polymerase chain reaction and others, as well as traditional experimental techniques such as electron microscopy we and others examined the transcriptional profile, morphology, etc of bladder smooth muscle mitochondria in experimental models of outlet obstruction. Data from many studies have demonstrated that aberrant gene expression in the mitochondrial and mitochondria related nuclear genetic systems underlies the loss of compliance and other attributes of bladder dysfunction following outlet obstruction. Such aberrant transcriptional characteristics engender loss of function in the electron transport and oxidative phosphorylation systems. Morphological studies of mitochondria in the animal model systems support this conclusion. In large part the loss of function in bladder smooth muscle following outlet obstruction results from the attenuation of mitochondrial energy production. In this article we reviewed and synthesized all available experimental observations relevant to this problem and we suggest future lines of inquiry that should prove fruitful in developing new strategies to treat the condition.

Human papilloma virus prevalence in laryngeal squamous cell carcinoma.

PubMed

Gungor, A; Cincik, H; Baloglu, H; Cekin, E; Dogru, S; Dursun, E

2007-08-01

To determine the prevalence and type of human papilloma virus deoxyribonucleic acid (DNA) in cases of laryngeal squamous cell carcinoma. We analysed the prevalence of human papilloma virus infection in archived paraffin block specimens taken from 99 cases of laryngeal squamous cell carcinoma between 1990 and 2005, using polymerase chain reaction techniques. Biopsy specimens from five proven verrucous skin lesions were used as positive controls, and peripheral blood samples from five healthy volunteers were used as negative controls. Four test samples were found to have inadequate deoxyribonucleic acid purity and were therefore excluded from the study. Human papilloma virus deoxyribonucleic acid was detected in seven of 95 cases of laryngeal squamous cell carcinoma (7.36 per cent). Human papilloma virus genotyping revealed double human papilloma virus infection in three cases and single human papilloma virus infection in the remaining four cases. The human papilloma virus genotypes detected were 6, 11 and 16 (the latter detected in only one case). In our series, a very low human papilloma virus prevalence was found among laryngeal squamous cell carcinoma cases. The human papilloma virus genotypes detected were mostly 6 and/or 11, and 16 in only one case. To the best of our knowledge, this is the first report of human papilloma virus prevalence in laryngeal squamous cell carcinoma, based on polymerase chain reaction genotyping in a Turkish population.

Additional chain-branching pathways in the low-temperature oxidation of branched alkanes

DOE PAGES

Wang, Zhandong; Zhang, Lidong; Moshammer, Kai; ...

2015-12-31

Chain-branching reactions represent a general motif in chemistry, encountered in atmospheric chemistry, combustion, polymerization, and photochemistry; the nature and amount of radicals generated by chain-branching are decisive for the reaction progress, its energy signature, and the time towards its completion. In this study, experimental evidence for two new types of chain-branching reactions is presented, based upon detection of highly oxidized multifunctional molecules (HOM) formed during the gas-phase low-temperature oxidation of a branched alkane under conditions relevant to combustion. The oxidation of 2,5-dimethylhexane (DMH) in a jet-stirred reactor (JSR) was studied using synchrotron vacuum ultra-violet photoionization molecular beam mass spectrometry (SVUV-PI-MBMS).more » Specifically, species with four and five oxygen atoms were probed, having molecular formulas of C 8H 14O 4 (e.g., diketo-hydroperoxide/keto-hydroperoxy cyclic ether) and C 8H 16O 5 (e.g., keto-dihydroperoxide/dihydroperoxy cyclic ether), respectively. The formation of C 8H 16O 5 species involves alternative isomerization of OOQOOH radicals via intramolecular H-atom migration, followed by third O 2 addition, intramolecular isomerization, and OH release; C 8H 14O 4 species are proposed to result from subsequent reactions of C 8H 16O 5 species. The mechanistic pathways involving these species are related to those proposed as a source of low-volatility highly oxygenated species in Earth's troposphere. At the higher temperatures relevant to auto-ignition, they can result in a net increase of hydroxyl radical production, so these are additional radical chain-branching pathways for ignition. Furthermore, the results presented herein extend the conceptual basis of reaction mechanisms used to predict the reaction behavior of ignition, and have implications on atmospheric gas-phase chemistry and the oxidative stability of organic substances.« less

Stem cell isolation by a morphology-based selection method in postnatal mouse ovary.

PubMed

Parvari, Soraya; Abbasi, Mehdi; Abbasi, Niloufar; Malek, Valliollah Gerayeli; Amidi, Fardin; Aval, Fereydoon Sargolzaei; Roudkenar, Mehryar Habibi; Izadyar, Fariburz

2015-06-19

An increasing body of evidence has emerged regarding the existence and function of spermatogonial stem cells (SSCs); however, their female counterparts are the subject of extensive debate. Theoretically, ovarian germ stem cells (GSCs) have to reside in the murine ovary to support and replenish the follicle pool during the reproductive life span. Recently, various methods have been recruited to isolate and describe aspects of ovarian GSCs, but newer and more convenient strategies in isolation are still growing. Herein, a morphology-based method was used to isolate GSCs. A cell suspension of mouse neonatal ovaries was cultured. Colonies of GSCs were harvested mechanically and cultivated on mouse embryonic fibroblasts (MEF). Alkaline phosphatase activity was assessed to verify stemness features of cells in colonies. Expression of germ and stem cell specific genes (Oct-4, Nanog, Fragilis, C-kit, Dazl, and Mvh) was analyzed by reverse transcription-polymerase chain reaction (RT-PCR). Immunofluorescence of Oct4, Dazl, Mvh, and SSEA-1 was also performed. Small colonies without a clear border appeared during the first 4 days of culture, and the size of colonies increased rapidly. Cells in colonies were positive for alkaline phosphatase activity. Reverse transcription-polymerase chain reaction showed that Oct-4, Fragilis, C-kit, Nanog, Mvh, and Dazl were expressed in colony-forming cells. Immunofluorescence revealed a positive signal for Oct4, Dazl, Mvh, and SSEA-1 in colonies as well. The applicability of morphological selection for isolation of GSCs was verified. This method is easier and more economical than other techniques. The availability of ovarian stem cells can motivate further studies in development of oocyte and cell-based therapies.

Stem cell isolation by a morphology-based selection method in postnatal mouse ovary

PubMed Central

Parvari, Soraya; Abbasi, Niloufar; Malek, Valliollah Gerayeli; Amidi, Fardin; Aval, Fereydoon Sargolzaei; Roudkenar, Mehryar Habibi; Izadyar, Fariburz

2015-01-01

Introduction An increasing body of evidence has emerged regarding the existence and function of spermatogonial stem cells (SSCs); however, their female counterparts are the subject of extensive debate. Theoretically, ovarian germ stem cells (GSCs) have to reside in the murine ovary to support and replenish the follicle pool during the reproductive life span. Recently, various methods have been recruited to isolate and describe aspects of ovarian GSCs, but newer and more convenient strategies in isolation are still growing. Herein, a morphology-based method was used to isolate GSCs. Material and methods A cell suspension of mouse neonatal ovaries was cultured. Colonies of GSCs were harvested mechanically and cultivated on mouse embryonic fibroblasts (MEF). Alkaline phosphatase activity was assessed to verify stemness features of cells in colonies. Expression of germ and stem cell specific genes (Oct-4, Nanog, Fragilis, C-kit, Dazl, and Mvh) was analyzed by reverse transcription-polymerase chain reaction (RT-PCR). Immunofluorescence of Oct4, Dazl, Mvh, and SSEA-1 was also performed. Results Small colonies without a clear border appeared during the first 4 days of culture, and the size of colonies increased rapidly. Cells in colonies were positive for alkaline phosphatase activity. Reverse transcription-polymerase chain reaction showed that Oct-4, Fragilis, C-kit, Nanog, Mvh, and Dazl were expressed in colony-forming cells. Immunofluorescence revealed a positive signal for Oct4, Dazl, Mvh, and SSEA-1 in colonies as well. Conclusions The applicability of morphological selection for isolation of GSCs was verified. This method is easier and more economical than other techniques. The availability of ovarian stem cells can motivate further studies in development of oocyte and cell-based therapies. PMID:26170863

Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay.

PubMed

Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B

2004-01-01

Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.

Chain Reaction Polymerization.

ERIC Educational Resources Information Center

McGrath, James E.

1981-01-01

The salient features and importance of chain-reaction polymerization are discussed, including such topics as the thermodynamics of polymerization, free-radical polymerization kinetics, radical polymerization processes, copolymers, and free-radical chain, anionic, cationic, coordination, and ring-opening polymerizations. (JN)

Characterizing Chain Processes in Visible Light Photoredox Catalysis

PubMed Central

Cismesia, Megan A.

2015-01-01

The recognition that Ru(bpy)32+ andsimilar visible light absorbing transition metal complexes can be photocatalysts for a variety of synthetically useful organic reactions has resulted in a recent resurgence of interest in photoredox catalysis. However, many of the critical mechanistic aspects of this class of reactions remain poorly understood. In particular, the degree to which visible light photoredox reactions involve radical chain processes has been a point of some disagreement that has not been subjected to systematic analysis. We have now performed quantum yield measurements to demonstrate that threerepresentative, mechanistically distinct photoredox processes involve product-forming chain reactions. Moreover, we show that the combination of quantum yield and luminescence quenching experiments provides a rapid method to estimate the length of these chains. Together, these measurements constitute a robust, operationally facile strategy for characterizing chain processes in a wide range of visible light photoredox reactions. PMID:26668708

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

Bioinspired synthesis of pentalene-based chromophores from an oligoketone chain.

PubMed

Saito, Yuki; Higuchi, Masayuki; Yoshioka, Shota; Senboku, Hisanori; Inokuma, Yasuhide

2018-04-24

We report a bioinspired synthesis of 2,5-dihydropentalene-based chromophores from an aliphatic oligoketone bearing 1,3- and 1,4-diketone subunits. Unlike the natural polyketone sequence, fused five-membered rings were formed via an intramolecular aldol condensation. A subsequent Knoevenagel condensation reaction with malononitrile furnished a multiply cross-conjugated π-system with low-lying LUMO levels. Furthermore, pentalenes obtained from a non-conjugated aliphatic chain exhibited visible absorption and solid-state fluorescence.

Oxidation reaction of polyether-based material and its suppression in lithium rechargeable battery using 4 V class cathode, LiNi1/3Mn1/3Co1/3O2.

PubMed

Kobayashi, Takeshi; Kobayashi, Yo; Tabuchi, Masato; Shono, Kumi; Ohno, Yasutaka; Mita, Yuichi; Miyashiro, Hajime

2013-12-11

The all solid-state lithium battery with polyether-based solid polymer electrolyte (SPE) is regarded as one of next-generation lithium batteries, and has potential for sufficient safety because of the flammable-electrolyte-free system. It has been believed that polyether-based SPE is oxidized at the polymer/electrode interface with 4 V class cathodes. Therefore, it has been used for electric devices such as organic transistor, and lithium battery under 3 V. We estimated decomposition reaction of polyether used as SPE of all solid-state lithium battery. We first identified the decomposed parts of polyether-based SPE and the conservation of most main chain framework, considering the results of SPE analysis after long cycle operations. The oxidation reaction was found to occur slightly at the ether bond in the main chain with the branched side chain. Moreover, we resolved the issue by introducing a self-sacrificing buffer layer at the interface. The introduction of sodium carboxymethyl cellulose (CMC) to the 4 V class cathode surface led to the suppression of SPE decomposition at the interface as a result of the preformation of a buffer layer from CMC, which was confirmed by the irreversible exothermic reaction during the first charge, using electrochemical calorimetry. The attained 1500 cycle operation is 1 order of magnitude longer than those of previously reported polymer systems, and compatible with those of reported commercial liquid systems. The above results indicate to proceed to an intensive research toward the realization of 4 V class "safe" lithium polymer batteries without flammable liquid electrolyte.

Comparison of polymerase chain reaction and Warthin-Starry techniques to detect Leptospira spp. in kidneys of slaughtered cattle.

PubMed

Azizi, Shahrzad; Kheirandish, Reza; Rahimi, Elham

2014-11-12

Leptospirosis is a worldwide zoonotic disease that is caused by Gram-negative spirochaetes, Leptospira species. Affected animals excrete the organism in the urine into the environment and act as a source of infection. Cattle are maintenance hosts for some serovars of leptospirosis and are important in the transmission of the infection to humans. At post mortem examination, affected cattle show white spots in their kidneys but these are not specific for leptospirosis. Sometimes it is necessary that leptospirosis be diagnosed in the carcass. Different direct methods, including polymerase chain reaction (PCR), Warthin-Starry silver stain (WS), immunofluorescence (IF) and immunohistochemistry (IHC) can be used in order to diagnose leptospirosis in the affected tissues, such as kidney. The main advantage of the WS technique is direct visualisation of the bacteria in the tissue samples. Silver staining is useful for retrospective studies on formalin-fixed and paraffin-embedded samples but little information is available on the sensitivity and specificity of the technique. The present study aimed to find a simple and inexpensive method that can be used in any laboratory and that also, if clinical samples are not available, can detect Leptospira in tissue samples post mortem. This study was performed on 19 paraffin-embedded kidneys of slaughtered cows that grossly had focal to multifocal white spots. Leptospirosis was confirmed in these samples with PCR based on the LipL32 gene. Out of 19 PCR positive kidneys, Leptospira was identified in 13 stained samples by WS. The kidneys revealed different grades of interstitial nephritis. No relationship was found between severity of lesions and presence of leptospires in the kidneys. The PCR results on the urine and blood were consistent with matching WS stained kidneys. Out of 13 kidneys that were positive with silver staining, 7 matching blood and 10 matching urine samples were confirmed positive for leptospirosis with PCR. In this study, the WS technique provided fewer positive results than PCR. This may be as a result of a low burden of Leptospira in the kidney, but the sensitivity of WS staining needs more investigation.

Strongylus asini (Nematoda, Strongyloidea): genetic relationships with other Strongylus species determined by ribosomal DNA.

PubMed

Hung, G C; Jacobs, D E; Krecek, R C; Gasser, R B; Chilton, N B

1996-12-01

Genomic DNA was isolated from adult Strongylus asini collected from zebra. The second ribosomal transcribed spacer (ITS-2) was amplified and sequenced using polymerase chain reaction (PCR) based techniques. The DNA sequence was compared with previously published data for 3 related Strongylus species. A PCR-linked restriction fragment length polymorphism method allowed the 4 species to be differentiated unequivocally. The ITS-2 sequence of S. asini was found to be more similar to those of S. edentatus (87.1%) and S. equinus (95.3%) than to that of S vulgaris (73.9%). This result confirms that S. Asini and S vulgaris represent separate species and supports the retention of the 4 species within 1 genus.

Sequences of heavy and light chain variable regions from four bovine immunoglobulins.

PubMed

Armour, K L; Tempest, P R; Fawcett, P H; Fernie, M L; King, S I; White, P; Taylor, G; Harris, W J

1994-12-01

Oligodeoxyribonucleotide primers based on the 5' ends of bovine IgG1/2 and lambda constant (C) region genes, together with primers encoding conserved amino acids at the N-terminus of mature variable (V) regions from other species, have been used in cDNA and polymerase chain reactions (PCRs) to amplify heavy and light chain V region cDNA from bovine heterohybridomas. The amino acid sequences of VH and V lambda from four bovine immunoglobulins of different specificities are presented.

Discrimination of the Lactobacillus acidophilus group using sequencing, species-specific PCR and SNaPshot mini-sequencing technology based on the recA gene.

PubMed

Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling

2012-10-01

To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.

The effects of biodegradable poly(lactic-co-glycolic acid)-based microspheres loaded with quercetin on stemness, viability and osteogenic differentiation potential of stem cell spheroids.

PubMed

Lee, H; Nguyen, T T; Kim, M; Jeong, J-H; Park, J-B

2018-05-31

Quercetin has been reported to exert many beneficial effects on the protection against various diseases, such as diabetes, cancer, and inflammation. The aim of this study is to evaluate the potential osteogenic differentiation ability of mesenchymal stem cells in the presence of quercetin. Quercetin-loaded poly(lactic-co-glycolic acid) microspheres were prepared using an electrospraying technique. Characterization of the microspheres was evaluated with a scanning electron microscope and release profile. Three-dimensional cell spheroids were fabricated using silicon elastomer-based concave microwells. Qualitative results of cellular viability were seen under a confocal microscope, and quantitative cellular viability was evaluated using the Cell Counting Kit-8 assay. The alkaline phosphatase activity and Alizarin Red S staining were performed. A quantitative real-time polymerase chain reaction and a western blot analysis were performed. Spheroids were well formed irrespective of quercetin concentration. Most of the cells in spheroids emitted green fluorescence, and the morphology was round without significant changes. The application of quercetin-loaded microspheres produced a significant increase in the alkaline phosphatase activity. The real-time polymerase chain reaction results showed a significant increase in Runx2, and western blot results showed higher expression of Runx2 protein expression. Biodegradable microspheres loaded with quercetin produced prolonged release profiles with increased mineralization. Microspheres loaded with quercetin can be used for the enhancement of osteoblastic differentiation in cell therapy. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

A simple thermometric technique for reaction-rate determination of inorganic species, based on the iodide-catalysed cerium(IV)-arsenic(III) reaction.

PubMed

Grases, F; Forteza, R; March, J G; Cerda, V

1985-02-01

A very simple reaction-rate thermometric technique is used for determination of iodide (5-20 ng ml ), based on its catalytic action on the cerium(IV)-arsenic(III) reaction, and for determination of mercury(II) (1.5-10 ng ml ) and silver(I) (2-10 ng ml ), based on their inhibitory effect on this reaction. The reaction is followed by measuring the rate of temperature increase. The method suffers from very few interferences and is applied to determination of iodide in biological and inorganic samples, and Hg(II) and Ag(I) in pharmaceutical products.

Bio-based phenolic-branched-chain fatty acid isomers synthesized from vegetable oils and natural monophenols using modified h+-ferrierite zeolite

USDA-ARS?s Scientific Manuscript database

A new group of phenolic branched-chain fatty acids (n-PBC-FA), hybrid molecules of natural monophenols (i.e., thymol, carvacrol and creosote) and mixed fatty acid (i.e., derived from soybean and safflower oils), were efficiently produced through a process known as arylation. The reaction involves a...

Molecular testing for familial hypercholesterolaemia-associated mutations in a UK-based cohort: development of an NGS-based method and comparison with multiplex polymerase chain reaction and oligonucleotide arrays.

PubMed

Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K

2016-11-01

Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.

Electrochemical techniques on sequence-specific PCR amplicon detection for point-of-care applications.

PubMed

Luo, Xiaoteng; Hsing, I-Ming

2009-10-01

Nucleic acid based analysis provides accurate differentiation among closely affiliated species and this species- and sequence-specific detection technique would be particularly useful for point-of-care (POC) testing for prevention and early detection of highly infectious and damaging diseases. Electrochemical (EC) detection and polymerase chain reaction (PCR) are two indispensable steps, in our view, in a nucleic acid based point-of-care testing device as the former, in comparison with the fluorescence counterpart, provides inherent advantages of detection sensitivity, device miniaturization and operation simplicity, and the latter offers an effective way to boost the amount of targets to a detectable quantity. In this mini-review, we will highlight some of the interesting investigations using the combined EC detection and PCR amplification approaches for end-point detection and real-time monitoring. The promise of current approaches and the direction for future investigations will be discussed. It would be our view that the synergistic effect of the combined EC-PCR steps in a portable device provides a promising detection technology platform that will be ready for point-of-care applications in the near future.

Application of Droplet Digital PCR to Validate Rift Valley Fever Vaccines.

PubMed

Ly, Hoai J; Lokugamage, Nandadeva; Ikegami, Tetsuro

2016-01-01

Droplet Digital™ polymerase chain reaction (ddPCR™) is a promising technique that quantitates the absolute concentration of nucleic acids in a given sample. This technique utilizes water-in-oil emulsion technology, a system developed by Bio-Rad Laboratories that partitions a single sample into thousands of nanoliter-sized droplets and counts nucleic acid molecules encapsulated in each individual particle as one PCR reaction. This chapter discusses the applications and methodologies of ddPCR for development of Rift Valley fever (RVF) vaccine, using an example that measures RNA copy numbers of a live-attenuated MP-12 vaccine from virus stocks, infected cells, or animal blood. We also discuss how ddPCR detects a reversion mutant of MP-12 from virus stocks accurately. The use of ddPCR improves the quality control of live-attenuated vaccines in the seed lot systems.

Research on BIM-based building information value chain reengineering

NASA Astrophysics Data System (ADS)

Hui, Zhao; Weishuang, Xie

2017-04-01

The achievement of value and value-added factor to the building engineering information is accomplished through a chain-flow, that is, building the information value chain. Based on the deconstruction of the information chain on the construction information in the traditional information mode, this paper clarifies the value characteristics and requirements of each stage of the construction project. In order to achieve building information value-added, the paper deconstructs the traditional building information value chain, reengineer the information value chain model on the basis of the theory and techniques of BIM, to build value-added management model and analyse the value of the model.

Bond Graph Modeling of Chemiosmotic Biomolecular Energy Transduction.

PubMed

Gawthrop, Peter J

2017-04-01

Engineering systems modeling and analysis based on the bond graph approach has been applied to biomolecular systems. In this context, the notion of a Faraday-equivalent chemical potential is introduced which allows chemical potential to be expressed in an analogous manner to electrical volts thus allowing engineering intuition to be applied to biomolecular systems. Redox reactions, and their representation by half-reactions, are key components of biological systems which involve both electrical and chemical domains. A bond graph interpretation of redox reactions is given which combines bond graphs with the Faraday-equivalent chemical potential. This approach is particularly relevant when the biomolecular system implements chemoelectrical transduction - for example chemiosmosis within the key metabolic pathway of mitochondria: oxidative phosphorylation. An alternative way of implementing computational modularity using bond graphs is introduced and used to give a physically based model of the mitochondrial electron transport chain To illustrate the overall approach, this model is analyzed using the Faraday-equivalent chemical potential approach and engineering intuition is used to guide affinity equalisation: a energy based analysis of the mitochondrial electron transport chain.

Data in support of the detection of genetically modified organisms (GMOs) in food and feed samples.

PubMed

Alasaad, Noor; Alzubi, Hussein; Kader, Ahmad Abdul

2016-06-01

Food and feed samples were randomly collected from different sources, including local and imported materials from the Syrian local market. These included maize, barley, soybean, fresh food samples and raw material. GMO detection was conducted by PCR and nested PCR-based techniques using specific primers for the most used foreign DNA commonly used in genetic transformation procedures, i.e., 35S promoter, T-nos, epsps, cryIA(b) gene and nptII gene. The results revealed for the first time in Syria the presence of GM foods and feeds with glyphosate-resistant trait of P35S promoter and NOS terminator in the imported soybean samples with high frequency (5 out of the 6 imported soybean samples). While, tests showed negative results for the local samples. Also, tests revealed existence of GMOs in two imported maize samples detecting the presence of 35S promoter and nos terminator. Nested PCR results using two sets of primers confirmed our data. The methods applied in the brief data are based on DNA analysis by Polymerase Chain Reaction (PCR). This technique is specific, practical, reproducible and sensitive enough to detect up to 0.1% GMO in food and/or feedstuffs. Furthermore, all of the techniques mentioned are economic and can be applied in Syria and other developing countries. For all these reasons, the DNA-based analysis methods were chosen and preferred over protein-based analysis.

Understanding disordered and unfolded proteins using single-molecule FRET and polymer theory.

PubMed

Hofmann, Hagen

2016-11-17

Understanding protein folding and the functional properties of intrinsically disordered proteins (IDPs) requires detailed knowledge of the forces that act in polypeptide chains. These forces determine the dimensions and dynamics of unfolded and disordered proteins and have been suggested to impact processes such as the coupled binding and folding of IDPs, or the rate of protein folding reactions. Much of the progress in understanding the physical and chemical properties of unfolded and intrinsically disordered polypeptide chains has been made possible by the recent developments in single-molecule fluorescence techniques. However, the interpretation of the experimental results requires concepts from polymer physics in order to be understood. Here, I review some of the theories used to describe the dimensions of unfolded polypeptide chains under varying solvent conditions together with their more recent application to experimental data.

Silicone derivatives for contact lenses: functionalization, chemical characterization, and cell compatibility assessment.

PubMed

Migonney, V; Lacroix, M D; Ratner, B D; Jozefowicz, M

1995-01-01

Epoxy ring-opening functionalization of polymers at random sites along chains with various chemical groups has been demonstrated. The reaction is performed in an aqueous solution under mild conditions in order to minimize degradation of the macromolecular chains. Silicone lenses made of copolymers with epoxy side chains were functionalized with 4-hydroxybutyric acid, sodium salt. The carboxylated silicone derivatives were characterized by ESCA and radiotracers. A mean value of 30% reaction yield was concluded, based upon data from both methods; nevertheless, the latter can be improved up to 50% or more if the conditions of preparation of the epoxydized silicone lenses are optimized. Derivatized silicones were coated in the wells of culture plates to evaluate the cell compatibility of these new polymers with a fibroblast cell line (McCoy's). No cellular toxicity was observed.

The Synergize effect of Chain extender to Phosporic acid catalyst to the ultimate property of Soy-Polyurethane

NASA Astrophysics Data System (ADS)

Elvistia Firdaus, Flora

2016-04-01

The polyurethanes (PUs) foam were made from vegetable oil; a soybean based polyol. The foams were categorized into flexible and semi rigid. This research is manufacturally designed polyurethane foams by a process requiring the reaction of mixture of 2, 4- and 2, 6-Toluene di Isocyanate isomers, soy polyol in the presence of other ingredients. The objective of this work was to functionalized soy-polyol using phosporic acid catalyst and chain extender, study their collaborative reaction in producing ultimate property of PU foam. Correlates the foam morphology images in accordance to mechanical properties of foams.

A novel gammaherpesvirus in a large flying fox (Pteropus vampyrus) with blepharitis.

PubMed

Paige Brock, A; Cortés-Hinojosa, Galaxia; Plummer, Caryn E; Conway, Julia A; Roff, Shannon R; Childress, April L; Wellehan, James F X

2013-05-01

A novel gammaherpesvirus was identified in a large flying fox (Pteropus vampyrus) with conjunctivitis, blepharitis, and meibomianitis by nested polymerase chain reaction and sequencing. Polymerase chain reaction amplification and sequencing of 472 base pairs of the DNA-dependent DNA polymerase gene were used to identify a novel herpesvirus. Bayesian and maximum likelihood phylogenetic analyses indicated that the virus is a member of the genus Percavirus in the subfamily Gammaherpesvirinae. Additional research is needed regarding the association of this virus with conjunctivitis and other ocular pathology. This virus may be useful as a biomarker of stress and may be a useful model of virus recrudescence in Pteropus spp.

Polymerase chain reaction-based detection of myc transduction in feline leukemia virus-infected cats.

PubMed

Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo

2018-04-01

Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.

Use of polymerase chain reaction (PCR) in the diagnosis of congenital toxoplasmosis.

PubMed

Loveridge-Easther, Cam; Yardley, Anne-Marie; Breidenstein, Brenda

2018-06-01

Congenital toxoplasmosis (CT) is a parasitic disease that causes serious fetal and neonatal harm or death. In countries that do not have antenatal screening programs, the initiation of CT treatment relies on a postnatal diagnosis. Until recently, diagnosis was based on clinical signs and immunoglobulin seropositivity, which is fraught with difficulty. In these cases, diagnosis was often delayed or treatment, which carries risk, started empirically. We highlight the use of polymerase chain reaction to diagnose a case of congenital toxoplasmosis, allowing early treatment and justifying the treatment burden. Copyright © 2018 American Association for Pediatric Ophthalmology and Strabismus. Published by Elsevier Inc. All rights reserved.

RT-qPCR Demonstrates Light-Dependent AtRBCS1A and AtRBCS3B mRNA Expressions in "Arabidopsis thaliana" Leaves

ERIC Educational Resources Information Center

Chang, Ming-Mei; Li, Anna; Feissner, Robert; Ahmad, Talal

2016-01-01

Reverse transcription quantitative polymerase chain reaction (RT-qPCR) is widely used in diagnosis and research to determine specific mRNA expressions in cells. As RT-qPCR applications increase, it is necessary to provide undergraduates hands-on experience of this modern technique. Here, we report a 3-week laboratory exercise using RT-qPCR to…

Detection of monoclonal immunoglobulin heavy chain gene rearrangement (FR3) in Thai malignant lymphoma by High Resolution Melting curve analysis.

PubMed

Kummalue, Tanawan; Chuphrom, Anchalee; Sukpanichanant, Sanya; Pongpruttipan, Tawatchai; Sukpanichanant, Sathien

2010-05-19

Malignant lymphoma, especially non-Hodgkin lymphoma, is one of the most common hematologic malignancies in Thailand. The diagnosis of malignant lymphoma is often problematic, especially in early stages of the disease. Detection of antigen receptor gene rearrangement including T cell receptor (TCR) and immunoglobulin heavy chain (IgH) by polymerase chain reaction followed by heteroduplex has currently become standard whereas fluorescent fragment analysis (GeneScan) has been used for confirmation test. In this study, three techniques had been compared: thermocycler polymerase chain reaction (PCR) followed by heteroduplex and polyacrylamide gel electrophoresis, GeneScan analysis, and real time PCR with High Resolution Melting curve analysis (HRM). The comparison was carried out with DNA extracted from paraffin embedded tissues diagnosed as B- cell non-Hodgkin lymphoma. Specific PCR primers sequences for IgH gene variable region 3, including fluorescence labeled IgH primers were used and results were compared with HRM. In conclusion, the detection IgH gene rearrangement by HRM in the LightCycler System showed potential for distinguishing monoclonality from polyclonality in B-cell non-Hodgkin lymphoma. Malignant lymphoma, especially non-Hodgkin lymphoma, is one of the most common hematologic malignancies in Thailand. The incidence rate as reported by Ministry of Public Health is 3.1 per 100,000 population in female whereas the rate in male is 4.5 per 100,000 population 1. At Siriraj Hospital, the new cases diagnosed as malignant lymphoma were 214.6 cases/year 2. The diagnosis of malignant lymphoma is often problematic, especially in early stages of the disease. Therefore, detection of antigen receptor gene rearrangement including T cell receptor (TCR) and immunoglobulin heavy chain (IgH) by polymerase chain reaction (PCR) assay has recently become a standard laboratory test for discrimination of reactive from malignant clonal lymphoproliferation 34. Analyzing DNA extracted from formalin-fixed, paraffin-embedded tissues by multiplex PCR techniques is more rapid, accurate and highly sensitive. Measuring the size of the amplicon from PCR analysis could be used to diagnose malignant lymphoma with monoclonal pattern showing specific and distinct bands detected on acrylamide gel electrophoresis. However, this technique has some limitations and some patients might require a further confirmation test such as GeneScan or fragment analysis 56.GeneScan technique or fragment analysis reflects size and peak of DNA by using capillary gel electrophoresis. This technique is highly sensitive and can detect 0.5-1% of clonal lymphoid cells. It measures the amplicons by using various fluorescently labeled primers at forward or reverse sides and a specific size standard. Using a Genetic Analyzer machine and GeneMapper software (Applied Bioscience, USA), the monoclonal pattern revealed one single, sharp and high peak at the specific size corresponding to acrylamide gel pattern, whereas the polyclonal pattern showed multiple and small peak condensed at the same size standard. This technique is the most sensitive and accurate technique; however, it usually requires high technical experience and is also of high cost 7. Therefore, rapid and more cost effective technique are being sought.LightCycler PCR performs the diagnostic detection of amplicon via melting curve analysis within 2 hours with the use of a specific dye 89. This dye consists of two types: one known as SYBR-Green I which is non specific and the other named as High Resolution Melting analysis (HRM) which is highly sensitive, more accurate and stable. Several reports demonstrated that this new instrument combined with DNA intercalating dyes can be used to discriminate sequence changes in PCR amplicon without manual handling of PCR product 1011. Therefore, current investigations using melting curve analysis are being developed 1213.In this study, three different techniques were compared to evaluate the suitability of LightCycler PCR with HRM as the clonal diagnostic tool for IgH gene rearrangement in B-cell non-Hogdkin lymphoma, i.e. thermocycler PCR followed by heteroduplex analysis and PAGE, GeneScan analysis and LightCycler PCR with HRM.

Determination of haemolytic and non haemolytic genes profiles of Bacillus cereus strains isolated from food samples by polymerase chain reaction (pcr) technique

NASA Astrophysics Data System (ADS)

Jawad, Nisreen; Ahemd, Asmat; Abdullah, Aminah

2018-04-01

The aim of this study was to investigate the presence of Bacillus cereus and detection of enterotoxigenic genes in food samples by utilizing a Polymerase Chain Reaction technique (PCR). In this study the providence of B. cereus was carried out to food samples. The B. cereus isolates were investigated for enterotoxigenic gene. The cooked seafood, and raw milk samples were purchased from several restaurants and market in the area of (Bangi, Kajang, Serdang and UKM) Selangor, Malaysia. A total of 60 samples have been analyzed. B. cereus contamination has been formed between 1.4×105 - 3×105 cfu/mL of cooked seafood and raw milk samples. Five colonies have been detected as B. cereus using biochemical test. All B. cereus isolates named BC1 to BC27, were characterized for haemolytic enterotoxin (HBL) complex encoding genes (hblA), non-haemolytic enterotoxin encoding gene (NheA). 10 isolates have been reported to be positive towards hblA and 12 isolates were positive towards NheA. The presence of B. cereus and their enterotoxigenic genes in cooked seafood and raw milk from to food samples obtained may pose a potential risk for public health.

Run-length encoding graphic rules, biochemically editable designs and steganographical numeric data embedment for DNA-based cryptographical coding system

PubMed Central

Kawano, Tomonori

2013-01-01

There have been a wide variety of approaches for handling the pieces of DNA as the “unplugged” tools for digital information storage and processing, including a series of studies applied to the security-related area, such as DNA-based digital barcodes, water marks and cryptography. In the present article, novel designs of artificial genes as the media for storing the digitally compressed data for images are proposed for bio-computing purpose while natural genes principally encode for proteins. Furthermore, the proposed system allows cryptographical application of DNA through biochemically editable designs with capacity for steganographical numeric data embedment. As a model case of image-coding DNA technique application, numerically and biochemically combined protocols are employed for ciphering the given “passwords” and/or secret numbers using DNA sequences. The “passwords” of interest were decomposed into single letters and translated into the font image coded on the separate DNA chains with both the coding regions in which the images are encoded based on the novel run-length encoding rule, and the non-coding regions designed for biochemical editing and the remodeling processes revealing the hidden orientation of letters composing the original “passwords.” The latter processes require the molecular biological tools for digestion and ligation of the fragmented DNA molecules targeting at the polymerase chain reaction-engineered termini of the chains. Lastly, additional protocols for steganographical overwriting of the numeric data of interests over the image-coding DNA are also discussed. PMID:23750303

A High-Throughput Method for Direct Detection of Therapeutic Oligonucleotide-Induced Gene Silencing In Vivo

PubMed Central

Coles, Andrew H.; Osborn, Maire F.; Alterman, Julia F.; Turanov, Anton A.; Godinho, Bruno M.D.C.; Kennington, Lori; Chase, Kathryn; Aronin, Neil

2016-01-01

Preclinical development of RNA interference (RNAi)-based therapeutics requires a rapid, accurate, and robust method of simultaneously quantifying mRNA knockdown in hundreds of samples. The most well-established method to achieve this is quantitative real-time polymerase chain reaction (qRT-PCR), a labor-intensive methodology that requires sample purification, which increases the potential to introduce additional bias. Here, we describe that the QuantiGene® branched DNA (bDNA) assay linked to a 96-well Qiagen TissueLyser II is a quick and reproducible alternative to qRT-PCR for quantitative analysis of mRNA expression in vivo directly from tissue biopsies. The bDNA assay is a high-throughput, plate-based, luminescence technique, capable of directly measuring mRNA levels from tissue lysates derived from various biological samples. We have performed a systematic evaluation of this technique for in vivo detection of RNAi-based silencing. We show that similar quality data is obtained from purified RNA and tissue lysates. In general, we observe low intra- and inter-animal variability (around 10% for control samples), and high intermediate precision. This allows minimization of sample size for evaluation of oligonucleotide efficacy in vivo. PMID:26595721

Diagnosis of Gestational, Congenital, and Placental Malaria in Colombia: Comparison of the Efficacy of Microscopy, Nested Polymerase Chain Reaction, and Histopathology

PubMed Central

Campos, Ivón M.; Uribe, Mary L.; Cuesta, Carolina; Franco-Gallego, Alexander; Carmona-Fonseca, Jaime; Maestre, Amanda

2011-01-01

The technical capability of different methods to diagnose Plasmodium in maternal peripheral blood, placenta, and umbilical cord blood has not been assessed in Colombia and seldom explored in other malaria-endemic regions. We designed a study to compare the technical and the operational-economical performances of light microscopy (LM), nested polymerase chain reaction (nPCR), and histopathology (HP). In maternal blood, LM had 41% sensitivity and 100% specificity and in placental blood, 35% and 100%, respectively, compared with nPCR. In placental tissue, LM had 33% sensitivity and 95% specificity; and nPCR 47% and 77%, respectively; compared with HP. Light microscopy had the best operational-economical qualification. We concluded that nPCR and HP performed better compared with LM, but field implementation of these two techniques remains a problem. Therefore, LM is recommended as the gold standard for diagnosis of gestational malaria and placental blood infection in the field. PMID:21633030

Live-Cell MicroRNA Imaging through MnO2 Nanosheet-Mediated DD-A Hybridization Chain Reaction.

PubMed

Ou, Min; Huang, Jin; Yang, Xiaohai; He, Xiaoxiao; Quan, Ke; Yang, Yanjing; Xie, Nuli; Li, Jing; Wang, Kemin

2018-01-18

Innovative techniques to visualize native microRNAs (miRNAs) in live cells can dramatically impact current research on the roles of miRNA in biology and medicine. Here, we report a novel approach for live-cell miRNA imaging using a biodegradable MnO 2 nanosheet-mediated DD-A FRET hybridization chain reaction (HCR). The MnO 2 nanosheets can adsorb DNA hairpin probes and deliver them into live cells. After entering cells, the MnO 2 nanosheets are degraded by cellular GSH. Then, the target miR-21 triggers cascaded assembly of the liberated hairpin probes into long dsDNA polymers, which brings each two FAMs (donor) and one TAMRA (acceptor) into close proximity to generate significantly enhanced DD-A FRET signals, which was discovered and proven by our previous report. We think the developed approach can serve as an excellent intracellular miRNAs detection tool, which promises the potential for biological and disease studies. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Aneuploidy screening of embryonic stem cell clones by metaphase karyotyping and droplet digital polymerase chain reaction.

PubMed

Codner, Gemma F; Lindner, Loic; Caulder, Adam; Wattenhofer-Donzé, Marie; Radage, Adam; Mertz, Annelyse; Eisenmann, Benjamin; Mianné, Joffrey; Evans, Edward P; Beechey, Colin V; Fray, Martin D; Birling, Marie-Christine; Hérault, Yann; Pavlovic, Guillaume; Teboul, Lydia

2016-08-05

Karyotypic integrity is essential for the successful germline transmission of alleles mutated in embryonic stem (ES) cells. Classical methods for the identification of aneuploidy involve cytological analyses that are both time consuming and require rare expertise to identify mouse chromosomes. As part of the International Mouse Phenotyping Consortium, we gathered data from over 1,500 ES cell clones and found that the germline transmission (GLT) efficiency of clones is compromised when over 50 % of cells harbour chromosome number abnormalities. In JM8 cells, chromosomes 1, 8, 11 or Y displayed copy number variation most frequently, whilst the remainder generally remain unchanged. We developed protocols employing droplet digital polymerase chain reaction (ddPCR) to accurately quantify the copy number of these four chromosomes, allowing efficient triage of ES clones prior to microinjection. We verified that assessments of aneuploidy, and thus decisions regarding the suitability of clones for microinjection, were concordant between classical cytological and ddPCR-based methods. Finally, we improved the method to include assay multiplexing so that two unstable chromosomes are counted simultaneously (and independently) in one reaction, to enhance throughput and further reduce the cost. We validated a PCR-based method as an alternative to classical karyotype analysis. This technique enables laboratories that are non-specialist, or work with large numbers of clones, to precisely screen ES cells for the most common aneuploidies prior to microinjection to ensure the highest level of germline transmission potential. The application of this method allows early exclusion of aneuploid ES cell clones in the ES cell to mouse conversion process, thus improving the chances of obtaining germline transmission and reducing the number of animals used in failed microinjection attempts. This method can be applied to any other experiments that require accurate analysis of the genome for copy number variation (CNV).

Single chain technology: Toward the controlled synthesis of polymer nanostructures

NASA Astrophysics Data System (ADS)

Lyon, Christopher

A technique for fabricating advanced polymer nanostructures enjoying recent popularity is the collapse or folding of single polymer chains in highly dilute solution mediated by intramolecular cross-linking. We term the resultant structures single-chain nanoparticles (SCNP). This technique has proven particularly valuable in the synthesis of nanomaterials on the order of 5 -- 20 nm. Many different types of covalent and non-covalent chemistries have been used to this end. This dissertation investigates the use of so-called single-chain technology to synthesize nanoparticles using modular techniques that allow for easy incorporation of functionality or special structural or characteristic features. Specifically, the synthesis of linear polymers functionalized with pendant monomer units and the subsequent intramolecular polymerization of these monomer units is discussed. In chapter 2, the synthesis of SCNP using alternating radical polymerization is described. Polymers functionalized with pendant styrene and stilbene groups are synthesized via a modular post-polymerization Wittig reaction. These polymers were exposed to radical initiators in the presence (and absence) of maleic anhydride and other electron deficient monomers in order to form intramolecular cross-links. Chapter 3 discusses templated acyclic diene metathesis (ADMET) polymerization using single-chain technology, starting with the controlled ring-opening polymerization of a glycidyl ether functionalized with an ADMET monomer. This polymer was then exposed to Grubbs' catalyst to polymerize the ADMET monomer units. The ADMET polymer was hydrolytically cleaved from the template and separated. Upon characterization, it was found that the daughter ADMET polymer had a similar degree of polymerization, but did not retain the low dispersity of the template. Chapter 4 details the synthesis of aldehyde- and diol-functionalized polymers toward the synthesis of SCNP containing dynamic, acid-degradable acetal cross-links. SCNP fabrication with these materials is beyond the scope of this dissertation.

A lab-on-a-chip-based multiplex platform to detect potential fraud of introducing pig, dog, cat, rat and monkey meat into the food chain.

PubMed

Razzak, Md Abdur; Hamid, Sharifah Bee Abd; Ali, Md Eaqub

2015-01-01

Food forgery has posed considerable risk to public health, religious rituals, personal budget and wildlife. Pig, dog, cat, rat and monkey meat are restricted in most religions, but their sporadic adulteration are rampant. Market controllers need a low-cost but reliable technique to track and trace suspected species in the food chain. Considering the need, here we documented a lab-on-a-chip-based multiplex polymerase chain reaction (PCR) assay for the authentication of five non-halal meat species in foods. Using species-specific primers, 172, 163, 141, 129 and 108-bp sites of mitochondrial ND5, ATPase 6 and cytochrome b genes were amplified to detect cat, dog, pig, monkey and rat species under complex matrices. Species-specificity was authenticated against 20 different species with the potential to be used in food. The targets were stable under extreme sterilisation (121°C at 45 psi for 2.5 h) which severely degrades DNA. The assay was optimised under the backgrounds of various commercial meat products and validated for the analysis of meatballs, burgers and frankfurters, which are popular fast food items across the globe. The assay was tested to detect 0.1% suspected meats under commercial backgrounds of marketed foods. Instead of simplex PCR which detects only one species at a time, such a multiplex platform can reduce cost by at least fivefolds by detecting five different species in a single assay platform.

Network Polymers Formed Under Nonideal Conditions.

DTIC Science & Technology

1986-12-01

the system or the limited ability of the statistical model to account for stochastic correlations. The viscosity of the reacting system was measured as...based on competing reactions (ring, chain) and employs equilibrium chain statistics . The work thus far has been limited to single cycle growth on an...polymerizations, because a large number of differential equations must be solved. The Makovian approach (sometimes referred to as the statistical or

Removing systematic errors in interionic potentials of mean force computed in molecular simulations using reaction-field-based electrostatics

PubMed Central

Baumketner, Andrij

2009-01-01

The performance of reaction-field methods to treat electrostatic interactions is tested in simulations of ions solvated in water. The potential of mean force between sodium chloride pair of ions and between side chains of lysine and aspartate are computed using umbrella sampling and molecular dynamics simulations. It is found that in comparison with lattice sum calculations, the charge-group-based approaches to reaction-field treatments produce a large error in the association energy of the ions that exhibits strong systematic dependence on the size of the simulation box. The atom-based implementation of the reaction field is seen to (i) improve the overall quality of the potential of mean force and (ii) remove the dependence on the size of the simulation box. It is suggested that the atom-based truncation be used in reaction-field simulations of mixed media. PMID:19292522

Monte Carlo Simulation of Endlinking Oligomers

NASA Technical Reports Server (NTRS)

Hinkley, Jeffrey A.; Young, Jennifer A.

1998-01-01

This report describes initial efforts to model the endlinking reaction of phenylethynyl-terminated oligomers. Several different molecular weights were simulated using the Bond Fluctuation Monte Carlo technique on a 20 x 20 x 20 unit lattice with periodic boundary conditions. After a monodisperse "melt" was equilibrated, chain ends were linked whenever they came within the allowed bond distance. Ends remained reactive throughout, so that multiple links were permitted. Even under these very liberal crosslinking assumptions, geometrical factors limited the degree of crosslinking. Average crosslink functionalities were 2.3 to 2.6; surprisingly, they did not depend strongly on the chain length. These results agreed well with the degrees of crosslinking inferred from experiment in a cured phenylethynyl-terminated polyimide oligomer.

Clinical characteristics of children with viral single- and co-infections and a petechial rash.

PubMed

Schneider, Henriette; Adams, Ortwin; Weiss, Christel; Merz, Ulrich; Schroten, Horst; Tenenbaum, Tobias

2013-05-01

Children with petechial rash are more likely to undergo invasive diagnostics, to be treated with antibiotics for potential bacterial infection and to be hospitalized. However, viruses have also been associated with petechial rash. Nonetheless, a systematic analysis of viral infections with modern available techniques as quantitative real-time polymerase chain reaction in the context of petechial rash is lacking. The purpose of this pediatric study was to prospectively uncover viral pathogens that may promote the emergence of petechiae and to analyze the correlation with the clinical characteristics and course. We conducted a prospective study in children (0 to 18 years) presenting with petechiae and signs or symptoms of infection at the emergency department between November 2009 and March 2012. In nasopharyngeal aspirates the following viruses were analyzed by quantitative real-time polymerase chain reaction: cytomegalovirus, Epstein-Barr virus, parvovirus B19, influenza A and B, parainfluenza viruses, human respiratory syncytial virus A and B, human metapneumovirus, rhinovirus, enterovirus, adenovirus, human coronavirus OC43, 229E, NL63 and human bocavirus. A viral pathogen was identified in 67% of the analyzed 58 cases with petechial rash. Virus positive patients showed a significantly higher incidence of lower respiratory tract infections. Forty-one percent were viral coinfections, which were significantly younger than virus negative patients, had a higher leukocyte count and were hospitalized for a longer time. A petechial rash is frequently associated viral single- and coinfections and can rapidly be identified via quantitative real-time polymerase chain reaction.

Copolymer Synthesis and Characterization by Post-Polymerization Modification

NASA Astrophysics Data System (ADS)

Galvin, Casey James

This PhD thesis examines the physical behavior of surface-grafted polymer assemblies (SGPAs) derived from post-polymerization modification (PPM) reactions in aqueous and vapor enriched environments, and offers an alternative method of creating SGPAs using a PPM approach. SGPAs comprise typically polymer chains grafted covalently to solid substrates. These assemblies show promise in a number of applications and technologies due to the stability imparted by the covalent graft and ability to modify interfacial properties and stability. SGPAs also offer a set of rich physics to explore in fundamental investigations as a result of confining macromolecules to a solid substrate. PPM reactions (also called polymer analogous reactions) apply small molecule organic chemistry reactions to the repeat units of polymer chains in order to generate new chemistries. By applying a PPM strategy to SGPAs, a wide variety of functional groups can be introduced into a small number of well-studied and well-behaved model polymer systems. This approach offers the advantage of holding constant other properties of the SGPA (e.g., molecular weight, MW, and grafting density, sigma) to isolate the effect of chemistry on physical behavior. Using a combination of PPM and fabrication methods that facilitate the formation of SPGAs with position-dependent gradual variation of sigma on flat impenetrable substrate, the influence of polymer chemistry and sigma is examined on the stability of weak polyelectrolyte brushes in aqueous environments at different pH levels. Degrafting of polymer chains in SGPAs exhibits a complex dependence on side chain chemistry, sigma, pH and the charge fraction (alpha) within the brush. Results of these experiments support a proposed mechanism of degrafting, wherein extension of the grafted chains away from the substrate generates tension along the polymer backbone, which activates the grafting chemistry for hydrolysis. The implications of these findings are important in developing technologies that use SGPAs in aqueous environments, and point to a need for potential alternative grafting chemistries. The behavior of SGPAs in vapor environments remains an underexplored phenomenon. By changing systematically the chemistry of SGPAs derived from a parent sample, the influence of side chain functional groups on the swelling of weak and strong polyelectrolyte brushes in the presence of water, methanol and ethanol vapors is explored. The extent of swelling and solvent uptake depends strongly on the chemistry in the polymer side chain and of the solvent. Despite bearing a permanent electrostatic charge in the side chain, the strong polyelectrolyte brushes exhibit no behavior typical of polyelectrolytes in water due to no dissociation of the counterion. Of particular interest is the behavior in humid environments of an SGPA bearing a zwitterionic group in its side chain, which results in exposure of electrostatic charges without counterions. Using substrates bearing the aforementioned sigma gradient of polymeric grafts, evidence of inter- and intramolecular complex formation is presented. Finally, a method of developing SGPAs by polymerizing bulk polymer chains through surface-grafted monomers (SGMs) is described. The SGMs are incorporated onto a solid substrate using the same PPM reaction employed in the degrafting and vapor swelling experiments, highlighting the versatility of PPM. The thickness of these SGPAs is correlated to the bulk polymer chains MW, suggesting this technique can be used in existing industrial bulk polymerization processes.

Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

PubMed Central

Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

2006-01-01

Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

The role of living/controlled radical polymerization in the formation of improved imprinted polymers.

PubMed

Salian, Vishal D; Vaughan, Asa D; Byrne, Mark E

2012-06-01

In this work, living/controlled radical polymerization (LRP) is compared with conventional free radical polymerization in the creation of highly and weakly cross-linked imprinted poly(methacrylic acid-co-ethylene glycol dimethacrylate) networks. It elucidates, for the first time, the effect of LRP on the chain level and begins to explain why the efficiency of the imprinting process is improved using LRP. Imprinted polymers produced via LRP exhibited significantly higher template affinity and capacity compared with polymers prepared using conventional methods. The use of LRP in the creation of highly cross-linked imprinted polymers resulted in a fourfold increase in binding capacity without a decrease in affinity; whereas weakly cross-linked gels demonstrated a nearly threefold increase in binding capacity at equivalent affinity when LRP was used. In addition, by adjusting the double bond conversion, we can choose to increase either the capacity or the affinity in highly cross-linked imprinted polymers, thus allowing the creation of imprinted polymers with tailorable binding parameters. Using free radical polymerization in the creation of polymer chains, as the template-monomer ratio increased, the average molecular weight of the polymer chains decreased despite a slight increase in the double bond conversion. Thus, the polymer chains formed were shorter but greater in number. Using LRP neutralized the effect of the template. The addition of chain transfer agent resulted in slow, uniform, simultaneous chain growth, resulting in the formation of longer more monodisperse chains. Reaction analysis revealed that propagation time was extended threefold in the formation of highly cross-linked polymers when LRP techniques were used. This delayed the transition to the diffusion-controlled stage of the reaction, which in turn led to the observed enhanced binding properties, decreased polydispersity in the chains, and a more homogeneous macromolecular architecture. Copyright © 2012 John Wiley & Sons, Ltd.

Development of a propidium monoazide-polymerase chain reaction assay for detection of viable Lactobacillus brevis in beer.

PubMed

Ma, Yanlin; Deng, Yang; Xu, Zhenbo; Liu, Junyan; Dong, Jianjun; Yin, Hua; Yu, Junhong; Chang, Zongming; Wang, Dongfeng

The spoilage of beer by bacteria is of great concern to the brewer as this can lead to turbidity and abnormal flavors. The polymerase chain reaction (PCR) method for detection of beer-spoilage bacteria is highly specific and provides results much faster than traditional microbiology techniques. However, one of the drawbacks is the inability to differentiate between live and dead cells. In this paper, the combination of propidium monoazide (PMA) pretreatment and conventional PCR had been described. The established PMA-PCR identified beer spoilage Lactobacillus brevis based not on their identity, but on the presence of horA gene which we show to be highly correlated with the ability of beer spoilage LAB to grow in beer. The results suggested that the use of 30μg/mL or less of PMA did not inhibit the PCR amplification of DNA derived from viable L. brevis cells. The minimum amount of PMA to completely inhibit the PCR amplification of DNA derived from dead L. brevis cells was 2.0μg/mL. The detection limit of PMA-PCR assay described here was found to be 10 colony forming units (CFU)/reaction for the horA gene. Moreover, the horA-specific PMA-PCR assays were subjected to 18 reference isolates, representing 100% specificity with no false positive amplification observed. Overall the use of horA-specific PMA-PCR allows for a substantial reduction in the time required for detection of potential beer spoilage L. brevis and efficiently differentiates between viable and nonviable cells. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Gel Point Suppression in RAFT Polymerization of Pure Acrylic Cross-Linker Derived from Soybean Oil.

PubMed

Yan, Mengguo; Huang, Yuerui; Lu, Mingjia; Lin, Fang-Yi; Hernández, Nacú B; Cochran, Eric W

2016-08-08

Here we report the reversible addition-fragmentation chain transfer (RAFT) polymerization of acrylated epoxidized soybean oil (AESO), a cross-linker molecule, to high conversion (>50%) and molecular weight (>100 kDa) without macrogelation. Surprisingly, gelation is suppressed in this system far beyond the expectations predicated both on Flory-Stockmeyer theory and multiple other studies of RAFT polymerization featuring cross-linking moieties. By varying AESO and initiator concentrations, we show how intra- versus intermolecular cross-linking compete, yielding a trade-off between the degree of intramolecular linkages and conversion at gel point. We measured polymer chain characteristics, including molecular weight, chain dimensions, polydispersity, and intrinsic viscosity, using multidetector gel permeation chromatography and NMR to track polymerization kinetics. We show that not only the time and conversion at macrogelation, but also the chain architecture, is largely affected by these reaction conditions. At maximal AESO concentration, the gel point approaches that predicted by the Flory-Stockmeyer theory, and increases in an exponential fashion as the AESO concentration decreases. In the most dilute solutions, macrogelation cannot be detected throughout the entire reaction. Instead, cyclization/intramolecular cross-linking reactions dominate, leading to microgelation. This work is important, especially in that it demonstrates that thermoplastic rubbers could be produced based on multifunctional renewable feedstocks.

Peroxy radical detection by chemical amplification (PERCA)

NASA Technical Reports Server (NTRS)

Stedman, D. H.

1986-01-01

Important reactions of atmospheric free radicals are the chain oxidation of NO and CO. Thus: H2O + NO yields OH + NO2; OH + CO yields H + CO2; H + O2 + M yields HO2 + M. In most models, the need to know the free radical concentration could also be described as the need to know the rate of the above oxidation chain in the atmosphere. It is the total rate of this chain (also carried by RO2 and RO) which was measured using the PERCA. The PERCA is thus essentially a RO sub X meter. The PERCA works by adding excess CO (10%) and NO (5ppm) to a stream of air and measuring the NO2 produced after 3s of reaction time. Since other processes produce NO2, the chain reaction is modulated by switching the CO for N2. The chain length is limited by the reaction OH + NO yields HONO and is modeled to be somewhat over 1000. Measured chain lengths agree with the modeled numbers.

Population Based Assessment of MHC Class 1 Antigens Down Regulation as Marker in Increased Risk for Development and Progression of Breast Cancer From Benign Breast Lesions

DTIC Science & Technology

2006-01-01

isolated using a routine salting-out method (DNA E-Z Prepkit, Orchid Diagnostics Europe, St Katelijne Waver, Belgium). Sequence based typing In...electrophoresis using ethidiumbromide to show the single 2 KB band before sequencing. Next, sequencing reactions were performed separately for exons 2, 3...Multiplex reverse transcription-polymerase chain reaction for simultaneous screening of 29 translocations and chromosomal aberrations in acute

Modeling the SOA Forming Potential of Substituted Dihydrofurans from Alkane + OH Reactions in the Atmosphere

NASA Astrophysics Data System (ADS)

Jordan, C. E.; Griffin, R. J.; Lim, Y. B.; Ziemann, P. J.; Atkinson, R.; Arey, J.

2005-12-01

Recent laboratory studies show that δ-hydroxycarbonyls formed in the atmosphere via OH-initiated reactions with alkanes can cyclize then dehydrate to form substituted dihydrofurans. These dihydrofurans are highly reactive, with lifetimes in the atmosphere of 1.3 h (OH), 24 s (NO3), and 7 min (O3). The ability of the δ-hydroxycarbonyls to cyclize and dehydrate has been shown to increase with increasing carbon number. Recent laboratory results show that the secondary organic aerosol (SOA) yields from alkanes also increase with carbon number reaching ~53% for C15. The reaction mechanism proposed based on the chamber results is the basis of the modeling study presented here. We have incorporated this proposed mechanism into the Caltech Atmospheric Chemistry Mechanism (CACM). For computational reasons, similar compounds are lumped together and represented by a single suitable compound. In the present case, alkanes are lumped into 3 groups: short chains (≤C6), medium chains (C7 - C12), and long chains (≥C13). SOA yields obtained in chamber studies increase dramatically from 0.5% for C8 to 25% for C12. The most dramatic increase is observed from C11 (8%) to C13 (~50%). This is attributed to the low volatility of first generation products contributing to the SOA from longer chain alkanes. Here we have studied OH reactions with the substituted dihydrofurans for medium (represented by C10) and long (represented by C16) chain alkanes using CACM along with the aerosol partitioning module MPMPO (Model to Predict the Multi-phase Partitioning of Organics). We will present the results of this modeling study, characterizing the influence of substituted dihydrofurans on the SOA forming potential of alkanes.

An enzyme-free flow cytometric bead assay for the sensitive detection of microRNAs based on click nucleic acid ligation-mediated signal amplification.

PubMed

Qi, Yan; Qiu, Liying; Fan, Wenjiao; Liu, Chenghui; Li, Zhengping

2017-08-07

A versatile flow cytometric bead assay (FCBA) coupled with a completely enzyme-free signal amplification mechanism is developed for the sensitive detection of microRNAs (miRNAs). This new strategy integrates click chemistry-mediated ligation chain reaction (CLCR) with hybridization chain reaction (HCR) for enzyme-free signal amplification on magnetic beads (MBs), and a flow cytometer for the robust fluorescence readout of the MBs. Firstly, target miRNA can initiate CLCR on the surface of MBs based on the click chemical ligation between dibenzocyclooctyne (DBCO)- and azide-modified single-stranded DNA (ssDNA) probes, and the amount of ligated ssDNA sequences on the MBs will be proportional to the dosage of target miRNA. Afterward, each of the ligated ssDNA products can trigger a cascade chain reaction of hybridization events between two alternating fluorophore-tagged hairpin probes, resulting in another signal amplification pathway with an amplified accumulation of fluorophores on the MBs. Finally, the fluorophore-anchored MBs are directly and rapidly analyzed by using a flow cytometer without any separation or elution processes. Herein, the click nucleic acid ligation only occurs on the surface of MBs, so the nonspecific ligations are greatly inhibited compared with that of ligation reaction performed in homogeneous solution. Furthermore, the signal amplification by CLCR-HCR is highly efficient but totally enzyme-free, which may overcome the potential drawbacks of conventional enzyme-catalyzed signal amplification protocols and lead to a high sensitivity. The CLCR-HCR-based FCBA has pushed the detection limit of let-7a miRNA down to the femtomolar (fM) level, showing great potential in miRNA-related biological studies and disease diagnosis.

Linkage analysis with multiplexed short tandem repeat polymorphisms using infrared fluorescence and M13 tailed primers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oetting, W.S.; Lee, H.K.; Flanders, D.J.

The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less

Tangled nonlinear driven chain reactions of all optical singularities

NASA Astrophysics Data System (ADS)

Vasil'ev, V. I.; Soskin, M. S.

2012-03-01

Dynamics of polarization optical singularities chain reactions in generic elliptically polarized speckle fields created in photorefractive crystal LiNbO3 was investigated in details Induced speckle field develops in the tens of minutes scale due to photorefractive 'optical damage effect' induced by incident beam of He-Ne laser. It was shown that polarization singularities develop through topological chain reactions of developing speckle fields driven by photorefractive nonlinearities induced by incident laser beam. All optical singularities (C points, optical vortices, optical diabolos,) are defined by instantaneous topological structure of the output wavefront and are tangled by singular optics lows. Therefore, they have develop in tangled way by six topological chain reactions driven by nonlinear processes in used nonlinear medium (photorefractive LiNbO3:Fe in our case): C-points and optical diabolos for right (left) polarized components domains with orthogonally left (right) polarized optical vortices underlying them. All elements of chain reactions consist from loop and chain links when nucleated singularities annihilated directly or with alien singularities in 1:9 ratio. The topological reason of statistics was established by low probability of far enough separation of born singularities pair from existing neighbor singularities during loop trajectories. Topology of developing speckle field was measured and analyzed by dynamic stokes polarimetry with few seconds' resolution. The hierarchy of singularities govern scenario of tangled chain reactions was defined. The useful space-time data about peculiarities of optical damage evolution were obtained from existence and parameters of 'islands of stability' in developing speckle fields.

EPA Scientists Develop Research Methods for Studying Mold Fact Sheet

EPA Pesticide Factsheets

In 2002, U.S. Environmental Protection Agency researchers developed a DNA-based Mold Specific Quantitative Polymerase Chain Reaction method (MSQPCR) for identifying and quantifying over 100 common molds and fungi.

Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

PubMed

Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

2011-05-01

A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rongle Zhang; Jie Chang; Yuanyuan Xu

A new kinetic model of the Fischer-Tropsch synthesis (FTS) is proposed to describe the non-Anderson-Schulz-Flory (ASF) product distribution. The model is based on the double-polymerization monomers hypothesis, in which the surface C{sub 2}{asterisk} species acts as a chain-growth monomer in the light-product range, while C{sub 1}{asterisk} species acts as a chain-growth monomer in the heavy-product range. The detailed kinetic model in the Langmuir-Hinshelwood-Hougen-Watson type based on the elementary reactions is derived for FTS and the water-gas-shift reaction. Kinetic model candidates are evaluated by minimization of multiresponse objective functions with a genetic algorithm approach. The model of hydrocarbon product distribution ismore » consistent with experimental data (

Preparation of core-shell molecularly imprinted polymer via the combination of reversible addition-fragmentation chain transfer polymerization and click reaction.

PubMed

Chang, Limin; Li, Ying; Chu, Jia; Qi, Jingyao; Li, Xin

2010-11-08

In this paper, we demonstrated an efficient and robust route to the preparation of well-defined molecularly imprinted polymer based on reversible addition-fragmentation chain transfer (RAFT) polymerization and click chemistry. The alkyne terminated RAFT chain transfer agent was first synthesized, and then click reaction was used to graft RAFT agent onto the surface of silica particles which was modified by azide. Finally, imprinted thin film was prepared in the presence of 2,4-dichlorophenol as the template. The imprinted beads were demonstrated with a homogeneous polymer films (thickness of about 2.27 nm), and exhibited thermal stability under 255°C. The as-synthesized product showed obvious molecular imprinting effects towards the template, fast template rebinding kinetics and an appreciable selectivity over structurally related compounds. Copyright © 2010 Elsevier B.V. All rights reserved.

Biotechnological advances in the diagnosis, species differentiation and phylogenetic analysis of Schistosoma spp.

PubMed

Zhao, Guang-Hui; Li, Juan; Blair, David; Li, Xiao-Yan; Elsheikha, Hany M; Lin, Rui-Qing; Zou, Feng-Cai; Zhu, Xing-Quan

2012-01-01

Schistosomiasis is a serious parasitic disease caused by blood-dwelling flukes of the genus Schistosoma. Throughout the world, schistosomiasis is associated with high rates of morbidity and mortality, with close to 800 million people at risk of infection. Precise methods for identification of Schistosoma species and diagnosis of schistosomiasis are crucial for an enhanced understanding of parasite epidemiology that informs effective antiparasitic treatment and preventive measures. Traditional approaches for the diagnosis of schistosomiasis include etiological, immunological and imaging techniques. Diagnosis of schistosomiasis has been revolutionized by the advent of new molecular technologies to amplify parasite nucleic acids. Among these, polymerase chain reaction-based methods have been useful in the analysis of genetic variation among Schistosoma spp. Mass spectrometry is now extending the range of biological molecules that can be detected. In this review, we summarize traditional, non-DNA-based diagnostic methods and then describe and discuss the current and developing molecular techniques for the diagnosis, species differentiation and phylogenetic analysis of Schistosoma spp. These exciting techniques provide foundations for further development of more effective and precise approaches to differentiate schistosomes and diagnose schistosomiasis in the clinic, and also have important implication for exploring novel measures to control schistosomiasis in the near future. Copyright © 2012 Elsevier Inc. All rights reserved.

Label-Free Fluorescent DNA Dendrimers for microRNA Detection Based On Nonlinear Hybridization Chain Reaction-Mediated Multiple G-Quadruplex with Low Background Signal.

PubMed

Xue, Qingwang; Liu, Chunxue; Li, Xia; Dai, Li; Wang, Huaisheng

2018-04-18

Various fluorescent sensing systems for miRNA detection have been developed, but they mostly contain enzymatic amplification reactions and label procedures. The strict reaction conditions of tool enzymes and the high cost of labeling limit their potential applications, especially in complex biological matrices. Here, we have addressed the difficult problems and report a strategy for label-free fluorescent DNA dendrimers based on enzyme-free nonlinear hybridization chain reaction (HCR)-mediated multiple G-quadruplex for simple, sensitive, and selective detection of miRNAs with low-background signal. In the strategy, a split G-quadruplex (3:1) sequence is ingeniously designed at both ends of two double-stranded DNAs, which is exploited as building blocks for nonlinear HCR assembly, thereby acquiring a low background signal. A hairpin switch probe (HSP) was employed as recognition and transduction element. Upon sensing the target miRNA, the nonlinear HCR assembly of two blocks (blocks-A and blocks-B) was initiated with the help of two single-stranded DNA assistants, resulting in chain-branching growth of DNA dendrimers with multiple G-quadruplex incorporation. With the zinc(II)-protoporphyrin IX (ZnPPIX) selectively intercalated into the multiple G-quadruplexes, fluorescent DNA dendrimers were obtained, leading to an exponential fluorescence intensity increase. Benefiting from excellent performances of nonlinear HCR and low background signal, this strategy possesses the characteristics of a simplified reaction operation process, as well as high sensitivity. Moreover, the proposed fluorescent sensing strategy also shows preferable selectivity, and can be implemented without modified DNA blocks. Importantly, the strategy has also been tested for miRNA quantification with high confidence in breast cancer cells. Thus, this proposed strategy for label-free fluorescent DNA dendrimers based on a nonlinear HCR-mediated multiple G-quadruplex will be turned into an alternative approach for simple, sensitive, and selective miRNA quantification.

Molecular Machine Powered Surface Programmatic Chain Reaction for Highly Sensitive Electrochemical Detection of Protein.

PubMed

Zhu, Jing; Gan, Haiying; Wu, Jie; Ju, Huangxian

2018-04-17

A bipedal molecular machine powered surface programmatic chain reaction was designed for electrochemical signal amplification and highly sensitive electrochemical detection of protein. The bipedal molecular machine was built through aptamer-target specific recognition for the binding of one target protein with two DNA probes, which hybridized with surface-tethered hairpin DNA 1 (H1) via proximity effect to expose the prelocked toehold domain of H1 for the hybridization of ferrocene-labeled hairpin DNA 2 (H2-Fc). The toehold-mediated strand displacement reaction brought the electrochemical signal molecule Fc close to the electrode and meanwhile released the bipedal molecular machine to traverse the sensing surface by the surface programmatic chain reaction. Eventually, a large number of duplex structures of H1-H2 with ferrocene groups facing to the electrode were formed on the sensor surface to generate an amplified electrochemical signal. Using thrombin as a model target, this method showed a linear detection range from 2 pM to 20 nM with a detection limit of 0.76 pM. The proposed detection strategy was enzyme-free and allowed highly sensitive and selective detection of a variety of protein targets by using corresponding DNA-based affinity probes, showing potential application in bioanalysis.

Quantum dots for a high-throughput Pfu polymerase based multi-round polymerase chain reaction (PCR).

PubMed

Sang, Fuming; Zhang, Zhizhou; Yuan, Lin; Liu, Deli

2018-02-26

Multi-round PCR is an important technique for obtaining enough target DNA from rare DNA resources, and is commonly used in many fields including forensic science, ancient DNA analysis and cancer research. However, multi-round PCR is often aborted, largely due to the accumulation of non-specific amplification during repeated amplifications. Here, we developed a Pfu polymerase based multi-round PCR technique assisted by quantum dots (QDs). Different PCR assays, DNA polymerases (Pfu and Taq), DNA sizes and GC amounts were compared in this study. In the presence of QDs, PCR specificity could be retained even in the ninth-round amplification. Moreover, the longer and more complex the targets were, the earlier the abortion happened in multi-round PCR. However, no obvious enhancement of specificity was found in multi-round PCR using Taq DNA polymerase. Significantly, the fidelity of Pfu polymerase based multi-round PCR was not sacrificed in the presence of QDs. Besides, pre-incubation at 50 °C for an hour had no impact on multi-round PCR performance, which further authenticated the hot start effect of QDs modulated in multi-round PCR. The findings of this study demonstrated that a cost-effective and promising multi-round PCR technique for large-scale and high-throughput sample analysis could be established with high specificity, sensibility and accuracy.

Toluene nitration in irradiated nitric acid and nitrite solutions

NASA Astrophysics Data System (ADS)

Elias, Gracy; Mincher, Bruce J.; Mezyk, Stephen P.; Muller, Jim; Martin, Leigh R.

2011-04-01

The kinetics, mechanisms, and stable products produced for the nitration of aryl alkyl mild ortho-para director toluene in irradiated nitric acid and neutral nitrite solutions were investigated using γ and pulse radiolysis. Electron pulse radiolysis was used to determine the bimolecular rate constants for the reaction of toluene with different transient species produced by irradiation. HPLC with UV detection, GC-MS and LC-MS, were used to assess the stable reaction products. Free-radical based nitration reaction products were found in irradiated acidic and neutral media. In 6.0 M HNO3, ring substitution, side chain substitution, and oxidation, produced different nitrated toluene products. For ring substitution, nitrogen oxide radicals were added mainly to cyclohexadienyl radicals, whereas for side chain substitution, these radicals were added to the carbon-centered benzyl radical produced by H-atom abstraction. In neutral nitrite solutions, radiolytically-induced ring nitration products approached a statistically random distribution, suggesting a direct free-radical reaction involving addition of the rad NO2 radical.

Effects of macromolecular crowding on biochemical reaction equilibria: a molecular thermodynamic perspective.

PubMed

Hu, Zhongqiao; Jiang, Jianwen; Rajagopalan, Raj

2007-09-01

A molecular thermodynamic model is developed to investigate the effects of macromolecular crowding on biochemical reactions. Three types of reactions, representing protein folding/conformational isomerization, coagulation/coalescence, and polymerization/association, are considered. The reactants, products, and crowders are modeled as coarse-grained spherical particles or as polymer chains, interacting through hard-sphere interactions with or without nonbonded square-well interactions, and the effects of crowder size and chain length as well as product size are examined. The results predicted by this model are consistent with experimentally observed crowding effects based on preferential binding or preferential exclusion of the crowders. Although simple hard-core excluded-volume arguments do in general predict the qualitative aspects of the crowding effects, the results show that other intermolecular interactions can substantially alter the extent of enhancement or reduction of the equilibrium and can even change the direction of the shift. An advantage of the approach presented here is that competing reactions can be incorporated within the model.

Synthesis of lipase-catalysed silicone-polyesters and silicone-polyamides at elevated temperatures.

PubMed

Frampton, Mark B; Zelisko, Paul M

2013-10-18

More and more enzymes are being explored as alternatives to conventional catalysts in chemical reactions. To utilize these biocatalysts to their fullest, it is incumbent on researchers to gain a complete understanding of the reaction conditions that particular enzymes will tolerate. To this end siloxane-containing polyesters and polyamides have been produced via N435-mediated catalysis at temperatures well above the normal denaturation temperature for free CalB. Low molecular weight disiloxane-based acceptors release the enzyme from its acylated state with equal proficiency while longer chain siloxanes favours polyester synthesis. The thermal tolerance of the enzyme catalyst is increased using longer chain diesters and generally more hydrophobic substrates.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krotov, V.V.; Staroverov, S.M.; Nesterenko, P.N.

A series of heterogeneous catalysts for asymmetric Michael additions was synthesized based on ephedrine chemically bound to the surface of silica. The length of the hydrocarbon chain binding the active center to the support surface affects the sign of rotation of the reaction product from the asymmetric addition of thiophenol to benzylideneacetophenone. Grafting ephedrine to the silica surface via a short hydrocarbon chain results in a change in the configuration of the reaction product. Silanol groups on the silica surface are involved in the transition state, as evidenced by data obtained using silica which has been exhaustively treated with trimethylchlorosilane.more » The absolute specific rotation of 1,3-diphenyl-3-thiophenylpropan-1-one has been established.« less

Detection of coliform bacteria and Escherichia coli by multiplex polymerase chain reaction: comparison with defined substrate and plating methods for water quality monitoring.

PubMed Central

Bej, A K; McCarty, S C; Atlas, R M

1991-01-01

Multiplex polymerase chain reaction (PCR) and gene probe detection of target lacZ and uidA genes were used to detect total coliform bacteria and Escherichia coli, respectively, for determining water quality. In tests of environmental water samples, the lacZ PCR method gave results statistically equivalent to those of the plate count and defined substrate methods accepted by the U.S. Environmental Protection Agency for water quality monitoring and the uidA PCR method was more sensitive than 4-methylumbelliferyl-beta-D-glucuronide-based defined substrate tests for specific detection of E. coli. Images PMID:1768116

Mannich Bases: An Important Pharmacophore in Present Scenario

PubMed Central

Sharma, Neha; Kajal, Anu; Saini, Vipin

2014-01-01

Mannich bases are the end products of Mannich reaction and are known as beta-amino ketone carrying compounds. Mannich reaction is a carbon-carbon bond forming nucleophilic addition reaction and is a key step in synthesis of a wide variety of natural products, pharmaceuticals, and so forth. Mannich reaction is important for the construction of nitrogen containing compounds. There is a number of aminoalkyl chain bearing Mannich bases like fluoxetine, atropine, ethacrynic acid, trihexyphenidyl, and so forth with high curative value. The literature studies enlighten the fact that Mannich bases are very reactive and recognized to possess potent diverse activities like anti-inflammatory, anticancer, antifilarial, antibacterial, antifungal, anticonvulsant, anthelmintic, antitubercular, analgesic, anti-HIV, antimalarial, antipsychotic, antiviral activities and so forth. The biological activity of Mannich bases is mainly attributed to α, β-unsaturated ketone which can be generated by deamination of hydrogen atom of the amine group. PMID:25478226

Evaluation of Different PCR-Based Assays and LAMP Method for Rapid Detection of Phytophthora infestans by Targeting the Ypt1 Gene

PubMed Central

Khan, Mehran; Li, Benjin; Jiang, Yue; Weng, Qiyong; Chen, Qinghe

2017-01-01

Late blight, caused by the oomycete Phytophthora infestans, is one of the most devastating diseases affecting potato and tomato worldwide. Early diagnosis of the P. infestans pathogen causing late blight should be the top priority for addressing disease epidemics and management. In this study, we performed a loop-mediated isothermal amplification (LAMP) assay, conventional polymerase chain reaction (PCR), nested PCR, and real-time PCR to verify and compare the sensitivity and specificity of the reaction based on the Ypt1 (Ras-related protein) gene of P. infestans. In comparison with the PCR-based assays, the LAMP technique led to higher specificity and sensitivity, using uncomplicated equipment with an equivalent time frame. All 43 P. infestans isolates, yielded positive detection results using LAMP assay showing no cross reaction with other Phytophthora spp., oomycetes or fungal pathogens. The LAMP assay yielded the lowest detectable DNA concentration (1.28 × 10-4 ng μL-1), being 10 times more sensitive than nested PCR (1.28 × 10-3 ng μL-1), 100 times more sensitive than real-time PCR (1.28 × 10-2 ng μL-1) and 103 times more sensitive than the conventional PCR assay (1.28 × 10-1 ng μL-1). In the field experiment, the LAMP assay outperformed the other tests by amplifying only diseased tissues (leaf and stem), and showing no positive reaction in healthy tissues. Overall, the LAMP assay developed in this study provides a specific, sensitive, simple, and effective visual method for detection of the P. infestans pathogen, and is therefore suitable for application in early prediction of the disease to reduce the risk of epidemics. PMID:29051751

Evaluation of Different PCR-Based Assays and LAMP Method for Rapid Detection of Phytophthora infestans by Targeting the Ypt1 Gene.

PubMed

Khan, Mehran; Li, Benjin; Jiang, Yue; Weng, Qiyong; Chen, Qinghe

2017-01-01

Late blight, caused by the oomycete Phytophthora infestans , is one of the most devastating diseases affecting potato and tomato worldwide. Early diagnosis of the P. infestans pathogen causing late blight should be the top priority for addressing disease epidemics and management. In this study, we performed a loop-mediated isothermal amplification (LAMP) assay, conventional polymerase chain reaction (PCR), nested PCR, and real-time PCR to verify and compare the sensitivity and specificity of the reaction based on the Ypt1 (Ras-related protein) gene of P. infestans. In comparison with the PCR-based assays, the LAMP technique led to higher specificity and sensitivity, using uncomplicated equipment with an equivalent time frame. All 43 P. infestans isolates, yielded positive detection results using LAMP assay showing no cross reaction with other Phytophthora spp., oomycetes or fungal pathogens. The LAMP assay yielded the lowest detectable DNA concentration (1.28 × 10 -4 ng μL -1 ), being 10 times more sensitive than nested PCR (1.28 × 10 -3 ng μL -1 ), 100 times more sensitive than real-time PCR (1.28 × 10 -2 ng μL -1 ) and 10 3 times more sensitive than the conventional PCR assay (1.28 × 10 -1 ng μL -1 ). In the field experiment, the LAMP assay outperformed the other tests by amplifying only diseased tissues (leaf and stem), and showing no positive reaction in healthy tissues. Overall, the LAMP assay developed in this study provides a specific, sensitive, simple, and effective visual method for detection of the P. infestans pathogen, and is therefore suitable for application in early prediction of the disease to reduce the risk of epidemics.

Colorimetric detection of mercury ion based on unmodified gold nanoparticles and target-triggered hybridization chain reaction amplification

NASA Astrophysics Data System (ADS)

Wang, Qing; Yang, Xiaohan; Yang, Xiaohai; Liu, Pei; Wang, Kemin; Huang, Jin; Liu, Jianbo; Song, Chunxia; Wang, Jingjing

2015-02-01

A novel unmodified gold nanoparticles (AuNPs)-based colorimetric strategy for label-free, specific and sensitive mercury ion (Hg2+) detection was demonstrated by using thymine-Hg2+-thymine (T-Hg2+-T) recognition mechanism and hybridization chain reaction (HCR) amplification strategy. In this protocol, a structure-switching probe (H0) was designed to recognize Hg2+ and then propagated a chain reaction of hybridization events between two other hairpin probes (H1 and H2). In the absence of Hg2+, all hairpin probes could stably coexist in solution, the exposed sticky ends of hairpin probes were capable of stabilizing AuNPs. As a result, salt-induced AuNPs aggregation could be effectively prevented. In the presence of Hg2+, thymine bases of H0 could specifically interact with Hg2+ to form stable T-Hg2+-T complex. Consequently, the hairpin structure of H0 probe was changed. As H1/H2 probes were added, the HCR process could be triggered and nicked double-helixes were formed. Since it was difficult for the formed nicked double-helixes to inhibit salt-induced AuNPs aggregation, a red-to-blue color change was observed in the colloid solution as the salt concentration increased. With the elegant amplification effect of HCR, a detection limit of around 30 nM was achieved (S/N = 3), which was about 1-2 orders of magnitudes lower than that of previous unmodified AuNPs-based colorimetric methods. By using the T-Hg2+-T recognition mechanism, high selectivity was also obtained. As an unmodified AuNPs-based colorimetric strategy, the system was simple in design, convenient in operation, and eliminated the requirements of separation processes, chemical modifications, and sophisticated instrumentations.

Enumeration of Ring–Chain Tautomers Based on SMIRKS Rules

PubMed Central

2015-01-01

A compound exhibits (prototropic) tautomerism if it can be represented by two or more structures that are related by a formal intramolecular movement of a hydrogen atom from one heavy atom position to another. When the movement of the proton is accompanied by the opening or closing of a ring it is called ring–chain tautomerism. This type of tautomerism is well observed in carbohydrates, but it also occurs in other molecules such as warfarin. In this work, we present an approach that allows for the generation of all ring–chain tautomers of a given chemical structure. Based on Baldwin’s Rules estimating the likelihood of ring closure reactions to occur, we have defined a set of transform rules covering the majority of ring–chain tautomerism cases. The rules automatically detect substructures in a given compound that can undergo a ring–chain tautomeric transformation. Each transformation is encoded in SMIRKS line notation. All work was implemented in the chemoinformatics toolkit CACTVS. We report on the application of our ring–chain tautomerism rules to a large database of commercially available screening samples in order to identify ring–chain tautomers. PMID:25158156

Topological dynamics of optical singularities in speckle-fields induced by photorefractive scattering in a LiNbO{sub 3} : Fe crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vasil'ev, Vasilii I; Soskin, M S

2013-02-28

A natural singular dynamics of elliptically polarised speckle-fields induced by the 'optical damage' effect in a photorefractive crystal of lithium niobate by a passing beam of a helium - neon laser is studied by the developed methods of singular optics. For the polarisation singularities (C points), a new class of chain reactions, namely, singular chain reactions are discovered and studied. It is shown that they obey the topological charge and sum Poincare index conservation laws. In addition, they exist for all the time of crystal irradiation. They consist of a series of interlocking chains, where singularity pairs arising in amore » chain annihilate with singularities from neighbouring independently created chains. Less often singular 'loop' reactions are observed where arising pairs of singularities annihilate after reversible transformations in within the boundaries of a single speckle. The type of a singular reaction is determined by a topology and dynamics of the speckles, in which the reactions are developing. (laser optics 2012)« less

Combination of p16(INK4a) /Ki67 immunocytology and HPV polymerase chain reaction for the noninvasive analysis of HPV involvement in head and neck cancer.

PubMed

Linxweiler, Maximilian; Bochen, Florian; Wemmert, Silke; Lerner, Cornelia; Hasenfus, Andrea; Bohle, Rainer Maria; Al-Kadah, Basel; Takacs, Zoltan Ferenc; Smola, Sigrun; Schick, Bernhard

2015-04-01

High-risk human papillomavirus (HPV) infection has been identified as a relevant risk for the development of head and neck squamous cell carcinomas (HNSCCs). As HPV status has also gained a role as a prognostic and predictive biomarker for this entity, there is a growing demand for valid HPV testing in HNSCC patients Liquid-based cytological smears from 45 HNSCC and 20 control patients were collected and used for simultaneous immunocytochemical p16(INK4a) /Ki67 staining using a CINtec PLUS kit after the presence of tumor cells was verified in a Papanicolaou-stained slide. The same cytological suspension was used for the detection of HPV DNA by specific polymerase chain reaction (PCR). Tumor cells were detected in the swab material of 44 HNSCC patients corresponding to a sensitivity of 98% (44 of 45). PCR analysis revealed the presence of HPV DNA in the cytological suspension of 13 patients (13 of 65, 20%) with simultaneous p16(INK4a) /Ki67 expression by the tumor cells in 11 of these HPV DNA-positive samples (11 of 13, 85%) - a staining pattern that is strongly associated with a carcinogenic HPV infection. A simultaneous immunocytochemical detection of p16(INK4a) and Ki67 can reliably be performed on liquid-based cytological smears from HNSCC patients using a CINtec PLUS kit. In addition, the same cytological material can be used for the detection of HPV DNA by specific PCR. The combined results of both techniques enable better discrimination between latent and carcinogenic HPV infections as well as HPV-negative cases and thus can provide information on the prognosis of HNSCC patients and facilitate therapeutic decisions. © 2014 American Cancer Society.

Evaluation of the LTQ-Orbitrap mass spectrometer for the analysis of polymerase chain reaction products.

PubMed

Manduzio, Hélène; Ezan, Eric; Fenaille, François

2010-12-30

We have investigated the potential and robustness of the off-line coupling of polymerase chain reaction (PCR) with electrospray ionization mass spectrometry (ESI-MS), for further applications in the screening of single-nucleotide polymorphisms (SNPs). This was based on recently reported data demonstrating that anion-exchange solid-phase extraction was the most efficient technique for efficiently desalting PCR products, with a recovery of ∼70%. Results showed that this purification approach efficiently removes almost all the chemicals commonly added to PCR buffers. ESI-MS analysis of a model 114-bp PCR product performed on the LTQ-Orbitrap instrument demonstrated that detection limits in the nM range along with an average mass measurement uncertainty of 9.15 ± 7.11 ppm can be routinely obtained using an external calibration. The PCR/ESI-MS platform was able to detect just a few copies of a targeted oligonucleotide. However, it was shown that if two PCR products are present in a mixture in a ratio higher than 10 to 1, the lower abundance one might not be reproducibly detected. Applications to SNPs demonstrated that an LTQ-Orbitrap with a resolution of 30 000 (at m/z 400) easily identified a single (A ↔ G) switch, i.e. a 16 Da difference, in binary mixtures of ∼ 35 kDa PCR products. Complementary experiments also showed that the combination of endonucleases and ESI-MS could be used to confirm base composition and sequence, and thus to screen for unknown polymorphisms in specific sequences. For example, a single (T ↔ A) switch (9 Da mass difference) was successfully identified in a 114-bp PCR product. Copyright © 2010 John Wiley & Sons, Ltd.

New developments of the in-source spectroscopy method at RILIS/ISOLDE

NASA Astrophysics Data System (ADS)

Marsh, B. A.; Andel, B.; Andreyev, A. N.; Antalic, S.; Atanasov, D.; Barzakh, A. E.; Bastin, B.; Borgmann, Ch.; Capponi, L.; Cocolios, T. E.; Day Goodacre, T.; Dehairs, M.; Derkx, X.; De Witte, H.; Fedorov, D. V.; Fedosseev, V. N.; Focker, G. J.; Fink, D. A.; Flanagan, K. T.; Franchoo, S.; Ghys, L.; Huyse, M.; Imai, N.; Kalaninova, Z.; Köster, U.; Kreim, S.; Kesteloot, N.; Kudryavtsev, Yu.; Lane, J.; Lecesne, N.; Liberati, V.; Lunney, D.; Lynch, K. M.; Manea, V.; Molkanov, P. L.; Nicol, T.; Pauwels, D.; Popescu, L.; Radulov, D.; Rapisarda, E.; Rosenbusch, M.; Rossel, R. E.; Rothe, S.; Schweikhard, L.; Seliverstov, M. D.; Sels, S.; Sjödin, A. M.; Truesdale, V.; Van Beveren, C.; Van Duppen, P.; Wendt, K.; Wienholtz, F.; Wolf, R. N.; Zemlyanoy, S. G.

2013-12-01

At the CERN ISOLDE facility, long isotope chains of many elements are produced by proton-induced reactions in target materials such as uranium carbide. The Resonance Ionization Laser Ion Source (RILIS) is an efficient and selective means of ionizing the reaction products to produce an ion beam of a chosen isotope. Coupling the RILIS with modern ion detection techniques enables highly sensitive studies of nuclear properties (spins, electromagnetic moments and charge radii) along an isotope chain, provided that the isotope shifts and hyperfine structure splitting of the atomic transitions can be resolved. At ISOLDE the campaign to measure the systematics of isotopes in the lead region (Pb, Bi, Tl and Po) has been extended to include the gold and astatine isotope chains. Several developments were specifically required for the feasibility of the most recent measurements: new ionization schemes (Po, At); a remote controlled narrow line-width mode of operation for the RILIS Ti:sapphire laser (At, Au, Po); isobar free ionization using the Laser Ion Source Trap, LIST (Po); isobar selective particle identification using the multi-reflection time-of-flight mass separator (MR-ToF MS) of ISOLTRAP (Au, At). These are summarized as part of an overview of the current status of the in-source resonance ionization spectroscopy setup at ISOLDE.

Two cases of Cokeromyces recurvatus in liquid-based Papanicolaou tests and a review of the literature.

PubMed

Odronic, Shelley I; Scheidemantel, Thomas; Tuohy, Marion J; Chute, Deborah; Procop, Gary W; Booth, Christine N

2012-12-01

We present 2 cases of Cokeromyces recurvatus in routine, liquid-based Papanicolaou tests (ThinPrep). Patient 1 is a healthy, asymptomatic, 26-year-old woman with no pertinent past medical history. Patient 2 is a healthy, asymptomatic, 47-year-old woman with no pertinent past medical history. The Papanicolaou tests from both patients showed many fungal-like elements as globose, yeastlike forms measuring 10 to 30 µm in diameter with multiple, narrowly attached apparent "daughter" buds. This morphology was consistent with Paracoccidioides brasiliensis. However, broad-range fungal polymerase chain reaction and deoxyribonucleic acid sequence analysis performed with GenBank Basic Local Alignment Search Tool showed an exact match for C recurvatus. Our cases highlight the importance of molecular techniques to prevent misdiagnosis of C recurvatus as P brasiliensis, based on morphology alone. There have been 8 previously published cases of C recurvatus infection in humans, 3 of which were reported in the female genital tract.

Improving the leakage current of polyimide-based resistive memory by tuning the molecular chain stack of the polyimide film

NASA Astrophysics Data System (ADS)

Wu, Chi-Chang; Hsiao, Yu-Ping; You, Hsin-Chiang; Lin, Guan-Wei; Kao, Min-Fang; Manga, Yankuba B.; Yang, Wen-Luh

2018-02-01

We have developed an organic-based resistive random access memory (ReRAM) by using spin-coated polyimide (PI) as the resistive layer. In this study, the chain distance and number of chain stacks of PI molecules are investigated. We employed different solid contents of polyamic acid (PAA) to synthesize various PI films, which served as the resistive layer of ReRAM, the electrical performance of which was evaluated. By tuning the PAA solid content, the intermolecular interaction energy of the PI films is changed without altering the molecular structure. Our results show that the leakage current in the high-resistance state and the memory window of the PI-based ReRAM can be substantially improved using this technique. The superior properties of the PI-based ReRAM are ascribed to fewer molecular chain stacks in the PI films when the PAA solid content is decreased, hence suppressing the leakage current. In addition, a device retention time of more than 107 s can be achieved using this technique. Finally, the conduction mechanism in the PI-based ReRAM was analyzed using hopping and conduction models.

Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

PubMed

Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

2017-02-15

Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

Polyphosphate kinase: demonstration that short chain polyphosphate serves as a primer for the enzymatic synthesis of polyphosphate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robinson, N.A.; Wood, H.G.

1986-05-01

Polyphosphate (poly(P)) kinase, isolated from Propionibacterium shermanii, catalyzes the following reaction: poly(P/sub n/) + ATPin equilibriumpoly(P/sub n+1/) + ADP. The authors have purified this enzyme to 90% homogeneity and have shown it to be composed of 2-3 identical subunits of M/sub r/ 80,000. Investigation of the reaction mechanism by product analysis has revealed that the elongation phase is processive whereby successive elongation occurs without release of intermediate sizes until very long chains are formed. The initiation phase of synthesis has been investigated using (/sup 32/P) poly(P) primer of chain length 11-60. It is incorporated into long chain poly(P) and themore » /sup 32/P has been shown, by use of poly(P) glucokinase, to be localized at the end of the molecule. Calculation of average chain length based upon the incorporation of /sup 32/P, however, yields a value approx.3 fold higher than the value calculated by another method using poly(P) glucokinase. This result indicates that initiation of poly(P) synthesis occurs by at least one other route which does not involve short chain poly(P) primers. The effect of temperature and concentration of poly(P) primer upon the average chain length of poly(P) synthesized was also investigated. A general trend was observed in which the chain length of the synthesized poly(P) decreased as either temperature or concentration or primer was increased.« less

Examination of fluorination effect on physical properties of saturated long-chain alcohols by DSC and Langmuir monolayer.

PubMed

Nakahara, Hiromichi; Nakamura, Shohei; Okahashi, Yoshinori; Kitaguchi, Daisuke; Kawabata, Noritake; Sakamoto, Seiichi; Shibata, Osamu

2013-02-01

Partially fluorinated long-chain alcohols have been newly synthesized from a radical reaction, which is followed by a reductive reaction. The fluorinated alcohols have been investigated by differential scanning calorimetry (DSC) and compression isotherms in a Langmuir monolayer state. Their melting points increase with an increase in chain length due to elongation of methylene groups. However, the melting points for the alcohols containing shorter fluorinated moieties are lower than those for the typical hydrogenated fatty alcohols. Using the Langmuir monolayer technique, surface pressure (π)-molecular area (A) and surface potential (ΔV)-A isotherms of monolayers of the fluorinated alcohols have been measured in the temperature range from 281.2 to 303.2K. In addition, a compressibility modulus (Cs(-1)) is calculated from the π-A isotherms. Four kinds of the alcohol monolayers show a phase transition (π(eq)) from a disordered to an ordered state upon lateral compression. The π(eq) values increase linearly with increasing temperatures. A slope of π(eq) against temperature for the alcohols with shorter fluorocarbons is unexpectedly larger than that for the corresponding fatty alcohols. Generally, fluorinated amphiphiles have a greater thermal stability (or resistance), which is a characteristic of highly fluorinated or perfluorinated compounds. Herein, however, the alcohols containing perfluorobutylated and perfluorohexylated chains show the irregular thermal behavior in both the solid and monolayer states. Copyright © 2012 Elsevier B.V. All rights reserved.

Compositional and stable carbon isotopic fractionation during non-autocatalytic thermochemical sulfate reduction by gaseous hydrocarbons

USGS Publications Warehouse

Xia, Xinyu; Ellis, Geoffrey S.; Ma, Qisheng; Tang, Yongchun

2014-01-01

The possibility of autocatalysis during thermochemical sulfate reduction (TSR) by gaseous hydrocarbons was investigated by examination of previously reported laboratory and field data. This reaction was found to be a kinetically controlled non-autocatalytic process, and the apparent lack of autocatalysis is thought to be due to the absence of the required intermediate species. Kinetic parameters for chemical and carbon isotopic fractionations of gaseous hydrocarbons affected by TSR were calculated and found to be consistent with experimentally derived values for TSR involving long-chain hydrocarbons. Model predictions based on these kinetic values indicate that TSR by gaseous hydrocarbon requires high-temperature conditions. The oxidation of C2–5 hydrocarbons by sulfate reduction is accompanied by carbon isotopic fractionation with the residual C2–5 hydrocarbons becoming more enriched in 13C. Kinetic parameters were calculated for the stable carbon isotopic fractionation of gaseous hydrocarbons that have experienced TSR. Model predictions based on these kinetics indicate that it may be difficult to distinguish the effects of TSR from those of thermal maturation at lower levels of hydrocarbon oxidation; however, unusually heavy δ13C2+ values (>−10‰) can be diagnostic of high levels of conversion (>50%). Stoichiometric and stable carbon isotopic data show that methane is stable under the investigated reaction conditions and is likely a product of TSR by other gaseous hydrocarbons rather than a significant reactant. These results indicate that the overall TSR reaction mechanism for oxidation of organic substrates containing long-chain hydrocarbons involves three distinct phases as follows: (1) an initial slow and non-autocatalytic stage characterized by the reduction of reactive sulfate by long-chain saturated hydrocarbons; (2) a second autocatalytic reaction phase dominated by reactions involving reduced sulfur species and partially oxidized hydrocarbons; (3) and a final, or late-stage, TSR reaction in which hydrocarbon oxidation continues at a slower rate via the non-autocatalytic reduction of sulfate by gaseous hydrocarbons.

Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples

PubMed Central

Pérez, Lester J.; de Arce, Heidy Díaz

2009-01-01

Aujeszky’s disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved viral gD gene fragment. PCR products of the expected size were obtained from PRV strains. Non-specific reactions were not observed when a related herpesvirus, other porcine DNA genome viruses and uninfected cells were used to assess PCR. The analytical sensitivity of the test was estimated to be 1.34 TCID50/ 50 uL. The analysis of tissue homogenate samples from naturally infected animals proved the potential usefulness of the method for a rapid disease diagnosis from field cases. A rapid, sensitive and specific PCR-based diagnostic assay to detect pseudorabies virus in clinical samples is provided. PMID:24031383

Use of multiplex polymerase chain reaction-based assay to conduct epidemiological studies on bovine hemoparasites in Mexico.

PubMed

Figueroa, J V; Alvarez, J A; Ramos, J A; Vega, C A; Buening, G M

1993-01-01

A study was conducted to test the applicability of a Polymerase Chain Reaction (PCR)-based approach for the simultaneous detection of the bovine hemoparasites Babesia bigemina, B. bovis and Anaplasma marginale. Bovine blood samples from cattle ranches of a previously determined enzootic zone in the Yucatan Peninsula of Mexico, were collected from peripheral blood and processed for PCR analysis. Blood samples were subjected to DNA amplification by placing an aliquot in a reaction tube containing oligonucleotide primers specific for DNA of each hemoparasite species. The PCR products were detected by Dot-Blot nucleic acid hybridization utilizing nonradioactive, species-specific, digoxigenin PCR-labeled DNA probes. Four hundred twenty one field samples analyzed by the multiplex PCR-DNA probe assay showed 66.7%, 60.1% and 59.6% prevalence rates for B. bigemina, B. bovis and A. marginale, respectively. The multiplex PCR analysis showed that animals with single, double or triple infection could be detected with the parasite specific DNA probes. The procedure is proposed as a valuable tool for the epidemiological analysis in regions where the hemoparasite species are concurrently infecting cattle.

Thermoswitchable Janus Gold Nanoparticles with Stimuli-Responsive Hydrophilic Polymer Brushes.

PubMed

Niu, Xiaoqin; Ran, Fen; Chen, Limei; Lu, Gabriella Jia-En; Hu, Peiguang; Deming, Christopher P; Peng, Yi; Rojas-Andrade, Mauricio D; Chen, Shaowei

2016-05-03

Well-defined thermoswitchable Janus gold nanoparticles with stimuli-responsive hydrophilic polymer brushes were fabricated by combining ligand exchange reactions and the Langmuir technique. Stimuli-responsive polydi(ethylene glycol) methyl ether methacrylate was prepared by addition-fragmentation chain-transfer polymerization. The polymer brushes were then anchored onto the nanoparticle surface by interfacial ligand exchange reactions with hexanethiolate-protected gold nanoparticles, leading to the formation of a hydrophilic (polymer) hemisphere and a hydrophobic (hexanethiolate) one. The resulting Janus nanoparticles showed temperature-switchable wettability, hydrophobicity at high temperatures, and hydrophilicity at low temperatures, due to thermally induced conformational transition of the polymer ligands. The results further highlight the importance of interfacial engineering in the deliberate functionalization of nanoparticle materials.

Polyisobutylene chain end transformations: Block copolymer synthesis and click chemistry functionalizations

NASA Astrophysics Data System (ADS)

Magenau, Andrew Jackson David

The primary objectives of this research were twofold: (1) development of synthetic procedures for combining quasiliving carbocationic polymerization (QLCCP) of isobutylene (IB) and reversible addition fragmentation chain transfer (RAFT) polymerization for block copolymer synthesis; (2) utilization of efficient, robust, and modular chemistries for facile functionalization of polyisobutylene (PIB). In the first study block copolymers consisting of PIB, and either PMMA or PS block segments, were synthesized by a site transformation approach combining living cationic and reversible addition-fragmentation chain transfer (RAFT) polymerizations. The initial PIB block was synthesized via quasiliving cationic polymerization using the TMPCl/TiCl4 initiation system and was subsequently converted into a hydroxylterminated PIB. Site transformation of the hydroxyl-terminated PIB into a macro chain transfer agent (PIB-CTA) was accomplished by N,N'-dicyclohexylcarbodiimide/dimethylaminopyridine-catalyzed esterification with 4-cyano-4-(dodecylsulfanylthiocarbonylsulfanyl)pentanoic acid. In the second study another site transformation approach was developed to synthesize a novel block copolymer, composed of PIB and PNIPAM segments. The PIB block was prepared via quasiliving cationic polymerization and end functionalized by in-situ quenching to yield telechelic halogen-terminated PIB. Azido functionality was obtained by displacement of the terminal halogen through nucleophilic substitution, which was confirmed by both 1H and 13C NMR. Coupling of an alkyne-functional chain transfer agent (CTA) to azido PIB was successfully accomplished through a copper catalyzed click reaction. Structure of the resulting PIB-based macro-CTA was verified with 1H NMR, FTIR, and GPC; whereas coupling reaction kinetics were monitored by real time variable temperature (VT) 1H NMR. In a third study, a click chemistry functionalization procedure was developed based upon the azide-alkyne 1,3-dipolar cycloaddition reaction. 1-(o-Azidoalkyl)pyrrolyl-terminated PIB was successfully synthesized both by substitution of the terminal halide of 1-(o-haloalkyl)pyrrolyl-terminated PIB with sodium azide and by in situ quenching of quasiliving PIB with a 1-(o-azidoalkyl)pyrrole. GPC indicated the absence of coupled PIB under optimized conditions, confirming exclusive mono-substitution on each pyrrole ring. In a fourth study, radical thiol-ene hydrothiolation "Click" chemistry was explored and adapted to easily and rapidly modify exo -olefin PIB with an array of thiol compounds bearing useful functionalities, including primary halogen, primary amine, primary hydroxyl, and carboxylic acid. The thiol-ene "click" procedure was shown to be applicable to both mono and difunctional exo-olefin polyisobutylene. Telechelic mono- and difunctional exo-olefin PIBs were synthesized via quasiliving cationic polymerization followed by quenching with the hindered amine, 1,2,2,6,6-pentamethylpiperidine. Lower reaction temperatures were found to increase exo-olefin conversion to near quantitative amounts. In the fifth study, thiol-terminated polyisobutylene (PIB-SH) was synthesized by reaction of thiourea with alpha,o-bromine-terminated PIB in a three step one-pot procedure. First the alkylisothiouronium salt was produced using a 1:1 (v:v) DMF:heptane cosolvent mixture at 90°C. Hydrolysis of the salt by aqueous base produced thiolate chain ends, which were then acidified to form the desired thiol functional group. An extension of this reaction was performed by a sequential thiol-ene/thiol-yne procedure to produce tetra-hydroxy functionalized PIB. 1H NMR was used to confirm formation of both alkyne and tetrahydroxyl functional species. Further utility of PIB-SH was demonstrated by base catalyzed thiol-isocyanate reactions. A model reaction was conducted with phenyl isocyanate in THF using triethylamine as the catalyst. Last, conversion of PIB-SH directly into a RAFT macro-CTA was accomplished, as shown by 1H NMR, by treatment of PIB-SH with triethylamine in carbon disulfide and subsequent alkylation with 2-bromopropionic acid. (Abstract shortened by UMI.)

Acetylene chain reaction on hydrogenated boron nitride monolayers: a density functional theory study.

PubMed

Ponce-Pérez, R; Cocoletzi, Gregorio H; Takeuchi, Noboru

2017-11-28

Spin-polarized first-principles total-energy calculations have been performed to investigate the possible chain reaction of acetylene molecules mediated by hydrogen abstraction on hydrogenated hexagonal boron nitride monolayers. Calculations have been done within the periodic density functional theory (DFT), employing the PBE exchange correlation potential, with van der Waals corrections (vdW-DF). Reactions at two different sites have been considered: hydrogen vacancies on top of boron and on top of nitrogen atoms. As previously calculated, at the intermediate state of the reaction, when the acetylene molecule is attached to the surface, the adsorption energy is of the order of -0.82 eV and -0.20 eV (measured with respect to the energy of the non interacting molecule-substrate system) for adsorption on top of boron and nitrogen atoms, respectively. After the hydrogen abstraction takes place, the system gains additional energy, resulting in adsorption energies of -1.52 eV and -1.30 eV, respectively. These results suggest that the chain reaction is energetically favorable. The calculated minimum energy path (MEP) for hydrogen abstraction shows very small energy barriers of the order of 5 meV and 22 meV for the reaction on top of boron and nitrogen atoms, respectively. Finally, the density of states (DOS) evolution study helps to understand the chain reaction mechanism. Graphical abstract Acetylene chain reaction on hydrogenated boron nitride monolayers.

A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

PubMed

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

2008-09-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

Relationship Between Ebola Virus Real-Time Quantitative Polymerase Chain Reaction-Based Threshold Cycle Value and Virus Isolation From Human Plasma.

PubMed

Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F

2015-10-01

We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

A plasmonic colorimetric strategy for visual miRNA detection based on hybridization chain reaction

NASA Astrophysics Data System (ADS)

Miao, Jie; Wang, Jingsheng; Guo, Jinyang; Gao, Huiguang; Han, Kun; Jiang, Chengmin; Miao, Peng

2016-08-01

In this work, a novel colorimetric strategy for miRNA analysis is proposed based on hybridization chain reaction (HCR)-mediated localized surface plasmon resonance (LSPR) variation of silver nanoparticles (AgNPs). miRNA in the sample to be tested is able to release HCR initiator from a solid interface to AgNPs colloid system by toehold exchange-mediated strand displacement, which then triggers the consumption of fuel strands with single-stranded tails for HCR. The final produced long nicked double-stranded DNA loses the ability to protect AgNPs from salt-induced aggregation. The stability variation of the colloid system can then be monitored by recording corresponding UV-vis spectrum and initial miRNA level is thus determined. This sensing system involves only four DNA strands which is quite simple. The practical utility is confirmed to be excellent by employing different biological samples.

Peptostreptococcus micros in primary endodontic infections as detected by 16S rDNA-based polymerase chain reaction.

PubMed

Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton

2003-02-01

A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.

Design and preparation of novel polyarylene ether materials based on Diels-Alder reaction as the crosslinker for electrooptical modulators

NASA Astrophysics Data System (ADS)

Gao, Wu; Hou, Wenjun; Zhen, Zhen; Liu, Xinhou; Liu, Jialei; Fedorchuk, A. A.; Czaja, P.

2016-07-01

Novel crosslinkable organic linear electro-optical (EO) material based on polyarylene ether as the main chain host polymer was designed and prepared. The host polymer with rigid aromatic has demonstrated a good compatibility with the guest chromophore. Long side chain with anthracene ensured the crosslinkable reaction and appropriate glass transition temperature of the host polymer (55 °C). The EO r33 tensor coefficient for this novel EO material has been magnitude of 66 pm/V at 1310 nm and the excellent long term stability at 85 °C. These parameters permit to consider their application in fabrication of organic electro optical devices. The semi-empirical and DFT quantum chemical simulations were performed for 4 principal chromophores to clarify a role of cross-linker in the enhancement of the ground state dipole moments and effective hyperpolarizabilities.

Recombinase polymerase amplification-based assay to diagnose Giardia in stool samples.

PubMed

Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

2015-03-01

Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. © The American Society of Tropical Medicine and Hygiene.

Recombinase Polymerase Amplification-Based Assay to Diagnose Giardia in Stool Samples

PubMed Central

Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

2015-01-01

Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. PMID:25510713

[Experimental study and clinical application of rapid diagnosis of systemic candida albicans infection in burns by polymerase chain reaction].

PubMed

Deng, G; Zhang, Y; Xiao, G

1995-09-01

For rapid diagnosis of systemic candidiasis, the polymerase chain reaction (PCR) was used to amplify a segment of Candida albican DNA coding for the cytochrome P450 L1 A1 in vitro. The technique provided unambiguous evidence of the presence of Candida albicans in as short as 8 hours with a detection threshold of 20 organisms. 200 blood and 120 urine specimens were collected from thirty rabbits with burn and candidiasis. Specimens of blood (n = 6), urine (n = 6), sputum (n = 7) and wound exudate (n = 7) were also collected from eight serious burn patients. PCR technique was used in all the specimens, and the result was compared with conventional fungus culture. It was shown that: (1) The positive detection rate of Candida by PCR was significantly higher than by culture for blood specimens (P < 0.01) and serial specimens of urine (P < 0.05) in infected burn animals. The clinical specimens showed the same results; (2) In evaluating diagnostic value of PCR for systemic Candida albicans infection, it was found that sensitivity, accuracy and negative prediction rate were superior to the conventional culture method. These results suggest that PCR technic may provide a rapid sensitive and specific means for the diagnosis of systemic Candida albicans infection. In addition, it may be helpful in the evaluation of therapeutic response or recurrence of infection.

Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

PubMed

Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

2003-12-15

Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

An evaluation of microbial profile in halitosis with tongue coating using PCR (polymerase chain reaction)- a clinical and microbiological study.

PubMed

Kamaraj R, Dinesh; Bhushan, Kala S; K L, Vandana

2014-01-01

Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load.

Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

NASA Astrophysics Data System (ADS)

Pérez Urquiza, M.; Acatzi Silva, A. I.

2014-02-01

Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

Bio-barcode gel assay for microRNA

NASA Astrophysics Data System (ADS)

Lee, Hyojin; Park, Jeong-Eun; Nam, Jwa-Min

2014-02-01

MicroRNA has been identified as a potential biomarker because expression level of microRNA is correlated with various cancers. Its detection at low concentrations would be highly beneficial for cancer diagnosis. Here, we develop a new type of a DNA-modified gold nanoparticle-based bio-barcode assay that uses a conventional gel electrophoresis platform and potassium cyanide chemistry and show this assay can detect microRNA at aM levels without enzymatic amplification. It is also shown that single-base-mismatched microRNA can be differentiated from perfectly matched microRNA and the multiplexed detection of various combinations of microRNA sequences is possible with this approach. Finally, differently expressed microRNA levels are selectively detected from cancer cells using the bio-barcode gel assay, and the results are compared with conventional polymerase chain reaction-based results. The method and results shown herein pave the way for practical use of a conventional gel electrophoresis for detecting biomolecules of interest even at aM level without polymerase chain reaction amplification.

Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

PubMed

Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

2008-07-23

A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

Four-hour quantitative real-time polymerase chain reaction-based comprehensive chromosome screening and accumulating evidence of accuracy, safety, predictive value, and clinical efficacy.

PubMed

Treff, Nathan R; Scott, Richard T

2013-03-15

Embryonic comprehensive chromosomal euploidy may represent a powerful biomarker to improve the success of IVF. However, there are a number of aneuploidy screening strategies to consider, including different technologic platforms with which to interrogate the embryonic DNA, and different embryonic developmental stages from which DNA can be analyzed. Although there are advantages and disadvantages associated with each strategy, a series of experiments producing evidence of accuracy, safety, clinical predictive value, and clinical efficacy indicate that trophectoderm biopsy and quantitative real-time polymerase chain reaction (qPCR)-based comprehensive chromosome screening (CCS) may represent a useful strategy to improve the success of IVF. This Biomarkers in Reproductive Medicine special issue review summarizes the accumulated experience with the development and clinical application of a 4-hour blastocyst qPCR-based CCS technology. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Development of a polymerase chain reaction-based assay for the detection of Alternaria fungal contamination in food products.

PubMed

Zur, G; Hallerman, E M; Sharf, R; Kashi, Y

1999-10-01

Alternaria sp. are important fungal contaminants of vegetable, fruit, and grain products, including Alternaria alternata, a contaminant of tomato products. To date, the Howard method, based on microscopic observation of fungal filaments, has been the standard examination for inspection of tomato products. We report development of a polymerase chain reaction (PCR)-based method for detection of Alternaria DNA. PCR primers were designed to anneal to the internal transcribed regions ITS1 and ITS2 of the 5.8S rRNA gene of Alternaria but not to other microbial or tomato DNA. We demonstrate use of the PCR assay to detect Alternaria DNA in experimentally infested and commercially obtained tomato sauce and tomato powder. Use of the PCR method offers a rapid and sensitive assay for the presence of Alternaria DNA in tomato products. The apparent breakdown of DNA in tomato sauce may limit the utility of the assay to freshly prepared products. The assay for tomato powder is not affected by storage time.

Supplement to Theory of Neutron Chain Reactions

DOE R&D Accomplishments Database

Weinberg, Alvin M.; Noderer, L. C.

1952-05-26

General discussions are given of the theory of neutron chain reactions. These include observations on exponential experiments, the general reactor with resonance fission, microscopic pile theory, and homogeneous slow neutron reactors. (B.J.H.)

ReaDDy - A Software for Particle-Based Reaction-Diffusion Dynamics in Crowded Cellular Environments

PubMed Central

Schöneberg, Johannes; Noé, Frank

2013-01-01

We introduce the software package ReaDDy for simulation of detailed spatiotemporal mechanisms of dynamical processes in the cell, based on reaction-diffusion dynamics with particle resolution. In contrast to other particle-based reaction kinetics programs, ReaDDy supports particle interaction potentials. This permits effects such as space exclusion, molecular crowding and aggregation to be modeled. The biomolecules simulated can be represented as a sphere, or as a more complex geometry such as a domain structure or polymer chain. ReaDDy bridges the gap between small-scale but highly detailed molecular dynamics or Brownian dynamics simulations and large-scale but little-detailed reaction kinetics simulations. ReaDDy has a modular design that enables the exchange of the computing core by efficient platform-specific implementations or dynamical models that are different from Brownian dynamics. PMID:24040218

Community-based surveillance of zoonotic parasites in a 'One Health' world: A systematic review.

PubMed

Schurer, J M; Mosites, E; Li, C; Meschke, S; Rabinowitz, P

2016-12-01

The One Health (OH) concept provides an integrated framework for observing and improving health issues involving human, animal, and environmental factors, and has been applied in particular to zoonotic disease problems. We conducted a systematic review of English and Chinese language peer-reviewed and grey literature databases to identify zoonotic endoparasite research utilizing an OH approach in community-based settings. Our review identified 32 articles where specimens collected simultaneously from all three OH domains (people, animals, and the environment) were assessed for endoparasite infection or exposure. Study sites spanned 23 countries, and research teams brought together an average of seven authors from two countries. Surveillance of blood-borne and gastrointestinal protozoa were most frequently reported (19 of 32; 59%), followed by trematodes, nematodes, and cestodes. Laboratory techniques varied greatly between studies, and only 16 identified parasites using Polymerase Chain Reaction (PCR) in all three OH domains. Our review identified important gaps in parasitology research operating under an OH framework. We recommend that investigators working in the realm of zoonotic disease strive to evaluate all three OH domains by integrating modern molecular tools as well as techniques provided by economists and social scientists.

A chain reaction approach to modelling gene pathways.

PubMed

Cheng, Gary C; Chen, Dung-Tsa; Chen, James J; Soong, Seng-Jaw; Lamartiniere, Coral; Barnes, Stephen

2012-08-01

BACKGROUND: Of great interest in cancer prevention is how nutrient components affect gene pathways associated with the physiological events of puberty. Nutrient-gene interactions may cause changes in breast or prostate cells and, therefore, may result in cancer risk later in life. Analysis of gene pathways can lead to insights about nutrient-gene interactions and the development of more effective prevention approaches to reduce cancer risk. To date, researchers have relied heavily upon experimental assays (such as microarray analysis, etc.) to identify genes and their associated pathways that are affected by nutrient and diets. However, the vast number of genes and combinations of gene pathways, coupled with the expense of the experimental analyses, has delayed the progress of gene-pathway research. The development of an analytical approach based on available test data could greatly benefit the evaluation of gene pathways, and thus advance the study of nutrient-gene interactions in cancer prevention. In the present study, we have proposed a chain reaction model to simulate gene pathways, in which the gene expression changes through the pathway are represented by the species undergoing a set of chemical reactions. We have also developed a numerical tool to solve for the species changes due to the chain reactions over time. Through this approach we can examine the impact of nutrient-containing diets on the gene pathway; moreover, transformation of genes over time with a nutrient treatment can be observed numerically, which is very difficult to achieve experimentally. We apply this approach to microarray analysis data from an experiment which involved the effects of three polyphenols (nutrient treatments), epigallo-catechin-3-O-gallate (EGCG), genistein, and resveratrol, in a study of nutrient-gene interaction in the estrogen synthesis pathway during puberty. RESULTS: In this preliminary study, the estrogen synthesis pathway was simulated by a chain reaction model. By applying it to microarray data, the chain reaction model computed a set of reaction rates to examine the effects of three polyphenols (EGCG, genistein, and resveratrol) on gene expression in this pathway during puberty. We first performed statistical analysis to test the time factor on the estrogen synthesis pathway. Global tests were used to evaluate an overall gene expression change during puberty for each experimental group. Then, a chain reaction model was employed to simulate the estrogen synthesis pathway. Specifically, the model computed the reaction rates in a set of ordinary differential equations to describe interactions between genes in the pathway (A reaction rate K of A to B represents gene A will induce gene B per unit at a rate of K; we give details in the "method" section). Since disparate changes of gene expression may cause numerical error problems in solving these differential equations, we used an implicit scheme to address this issue. We first applied the chain reaction model to obtain the reaction rates for the control group. A sensitivity study was conducted to evaluate how well the model fits to the control group data at Day 50. Results showed a small bias and mean square error. These observations indicated the model is robust to low random noises and has a good fit for the control group. Then the chain reaction model derived from the control group data was used to predict gene expression at Day 50 for the three polyphenol groups. If these nutrients affect the estrogen synthesis pathways during puberty, we expect discrepancy between observed and expected expressions. Results indicated some genes had large differences in the EGCG (e.g., Hsd3b and Sts) and the resveratrol (e.g., Hsd3b and Hrmt12) groups. CONCLUSIONS: In the present study, we have presented (I) experimental studies of the effect of nutrient diets on the gene expression changes in a selected estrogen synthesis pathway. This experiment is valuable because it allows us to examine how the nutrient-containing diets regulate gene expression in the estrogen synthesis pathway during puberty; (II) global tests to assess an overall association of this particular pathway with time factor by utilizing generalized linear models to analyze microarray data; and (III) a chain reaction model to simulate the pathway. This is a novel application because we are able to translate the gene pathway into the chemical reactions in which each reaction channel describes gene-gene relationship in the pathway. In the chain reaction model, the implicit scheme is employed to efficiently solve the differential equations. Data analysis results show the proposed model is capable of predicting gene expression changes and demonstrating the effect of nutrient-containing diets on gene expression changes in the pathway. One of the objectives of this study is to explore and develop a numerical approach for simulating the gene expression change so that it can be applied and calibrated when the data of more time slices are available, and thus can be used to interpolate the expression change at a desired time point without conducting expensive experiments for a large amount of time points. Hence, we are not claiming this is either essential or the most efficient way for simulating this problem, rather a mathematical/numerical approach that can model the expression change of a large set of genes of a complex pathway. In addition, we understand the limitation of this experiment and realize that it is still far from being a complete model of predicting nutrient-gene interactions. The reason is that in the present model, the reaction rates were estimated based on available data at two time points; hence, the gene expression change is dependent upon the reaction rates and a linear function of the gene expressions. More data sets containing gene expression at various time slices are needed in order to improve the present model so that a non-linear variation of gene expression changes at different time can be predicted.

A novel mechanism for direct real-time polymerase chain reaction that does not require DNA isolation from prokaryotic cells.

PubMed

Soejima, Takashi; Xiao, Jin-Zhong; Abe, Fumiaki

2016-06-23

Typically, polymerase chain reaction (PCR) is performed after DNA isolation. Real-time PCR (qPCR), also known as direct qPCR in mammalian cells with weak membranes, is a common technique using crude samples subjected to preliminary boiling to elute DNA. However, applying this methodology to prokaryotic cells, which have solid cell walls, in contrast to mammalian cells which immediately burst in water, can result in poor detection. We successfully achieved PCR elongation with the addition of 1.3 cfu of Cronobacter muytjensii to a newly developed direct qPCR master mix without performing any crude DNA extraction (detection limit of 1.6 × 10(0) cfu/ml for the test sample compared with a detection limit of 1.6 × 10(3) cfu/ml primarily for crude (boiling) or classical DNA isolation). We revealed that the chromosomal DNA retained in prokaryotic cells can function as a PCR template, similarly to the mechanism in in situ PCR. Elucidating this reaction mechanism may contribute to the development of an innovative master mix for direct qPCR to detect genes in a single bacterium with solid cell walls and might lead to numerous novel findings in prokaryotic genomics research.

Mitochondrial respiratory chain complexes as sources and targets of thiol-based redox-regulation.

PubMed

Dröse, Stefan; Brandt, Ulrich; Wittig, Ilka

2014-08-01

The respiratory chain of the inner mitochondrial membrane is a unique assembly of protein complexes that transfers the electrons of reducing equivalents extracted from foodstuff to molecular oxygen to generate a proton-motive force as the primary energy source for cellular ATP-synthesis. Recent evidence indicates that redox reactions are also involved in regulating mitochondrial function via redox-modification of specific cysteine-thiol groups in subunits of respiratory chain complexes. Vice versa the generation of reactive oxygen species (ROS) by respiratory chain complexes may have an impact on the mitochondrial redox balance through reversible and irreversible thiol-modification of specific target proteins involved in redox signaling, but also pathophysiological processes. Recent evidence indicates that thiol-based redox regulation of the respiratory chain activity and especially S-nitrosylation of complex I could be a strategy to prevent elevated ROS production, oxidative damage and tissue necrosis during ischemia-reperfusion injury. This review focuses on the thiol-based redox processes involving the respiratory chain as a source as well as a target, including a general overview on mitochondria as highly compartmentalized redox organelles and on methods to investigate the redox state of mitochondrial proteins. This article is part of a Special Issue entitled: Thiol-Based Redox Processes. Copyright © 2014 Elsevier B.V. All rights reserved.

Importance of pharmacogenetics in the treatment of children with attention deficit hyperactive disorder: a case report.

PubMed

Tan-Kam, Teerarat; Suthisisang, Chutamanee; Pavasuthipaisit, Chosita; Limsila, Penkhae; Puangpetch, Apichaya; Sukasem, Chonlaphat

2013-01-01

This case report highlights the importance of pharmacogenetic testing in the treatment of attention deficit hyperactive disorder (ADHD). A 6-year-old boy diagnosed with ADHD was prescribed methylphenidate 5 mg twice daily (7 am and noon) and the family was compliant with administration of this medication. On the first day of treatment, the patient had an adverse reaction, becoming disobedient, more mischievous, erratic, resistant to discipline, would not go to sleep until midnight, and had a poor appetite. The All-In-One PGX (All-In-One Pharmacogenetics for Antipsychotics test for CYP2D6, CYP2C19, and CYP2C9) was performed using microarray-based and real-time polymerase chain reaction techniques. The genotype of our patient was identified to be CYP2D6*2/*10, with isoforms of the enzyme consistent with a predicted cytochrome P450 2D6 intermediate metabolizer phenotype. Consequently, the physician adjusted the methylphenidate dose to 2.5 mg once daily in the morning. At this dosage, the patient had a good response without any further adverse reactions. Pharmacogenetic testing should be included in the management plan for ADHD. In this case, cooperation between the medical team and the patients' relatives was key to successful treatment.

Formation of pyroglutamic acid from N-terminal glutamic acid in immunoglobulin gamma antibodies.

PubMed

Chelius, Dirk; Jing, Kay; Lueras, Alexis; Rehder, Douglas S; Dillon, Thomas M; Vizel, Alona; Rajan, Rahul S; Li, Tiansheng; Treuheit, Michael J; Bondarenko, Pavel V

2006-04-01

The status of the N-terminus of proteins is important for amino acid sequencing by Edman degradation, protein identification by shotgun and top-down techniques, and to uncover biological functions, which may be associated with modifications. In this study, we investigated the pyroglutamic acid formation from N-terminal glutamic acid residues in recombinant monoclonal antibodies. Almost half the antibodies reported in the literature contain a glutamic acid residue at the N-terminus of the light or the heavy chain. Our reversed-phase high-performance liquid chromatography-mass spectrometry method could separate the pyroglutamic acid-containing light chains from the native light chains of reduced and alkylated recombinant monoclonal antibodies. Tryptic peptide mapping and tandem mass spectrometry of the reduced and alkylated proteins was used for the identification of the pyroglutamic acid. We identified the formation of pyroglutamic acid from N-terminal glutamic acid in the heavy chains and light chains of several antibodies, indicating that this nonenzymatic reaction does occur very commonly and can be detected after a few weeks of incubation at 37 and 45 degrees C. The rate of this reaction was measured in several aqueous buffers with different pH values, showing minimal formation of pyroglutamic acid at pH 6.2 and increased formation of pyroglutamic acid at pH 4 and pH 8. The half-life of the N-terminal glutamic acid was approximately 9 months in a pH 4.1 buffer at 45 degrees C. To our knowledge, we showed for the first time that glutamic acid residues located at the N-terminus of proteins undergo pyroglutamic acid formation in vitro.

Optimization of the Synthesis of Structured Phosphatidylcholine with Medium Chain Fatty Acid.

PubMed

Ochoa-Flores, Angélica A; Hernández-Becerra, Josafat A; Cavazos-Garduño, Adriana; Vernon-Carter, Eduardo J; García, Hugo S

2017-11-01

Structured phosphatidylcholine was successfully produced by acidolysis between phosphatidylcholine and free medium chain fatty acid, using phospholipase A 1 immobilized on Duolite A568. Response surface methodology was applied to optimize the reaction system using three process parameters: molar ratio of substrates (phosphatidylcholine to free medium chain fatty acid), enzyme loading, and reaction temperature. All parameters evaluated showed linear and quadratic significant effects on the production of modified phosphatidylcholine; molar ratio of substrates contributed positively, but temperature influenced negatively. Increased enzyme loading also led to increased production of modified phosphatidylcholine but only during the first 9 hours of the acidolysis reaction. Optimal conditions obtained from the model were a ratio of phosphatidylcholine to free medium chain fatty acid of 1:15, an enzyme loading of 12%, and a temperature of 45°C. Under these conditions a production of modified phosphatidylcholine of 52.98 % were obtained after 24 h of reaction. The prediction was confirmed from the verification experiments; the production of modified phosphatidylcholine was 53.02%, the total yield of phosphatidylcholine 64.28% and the molar incorporation of medium chain fatty acid was 42.31%. The acidolysis reaction was scaled-up in a batch reactor with a similar production of modified phosphatidylcholine, total yield of phosphatidylcholine and molar incorporation of medium chain fatty acid. Purification by column chromatography of the structured phosphatidylcholine yielded 62.53% of phosphatidylcholine enriched with 42.52% of medium chain fatty acid.

Development of polymerase chain reaction-based diagnostic tests for detection of Malsoor virus & adenovirus isolated from Rousettus species of bats in Maharashtra, India.

PubMed

Shete, Anita M; Yadav, Pragya; Kumar, Vimal; Nikam, Tushar; Mehershahi, Kurosh; Kokate, Prasad; Patil, Deepak; Mourya, Devendra T

2017-01-01

Bats are recognized as important reservoirs for emerging infectious disease and some unknown viral diseases. Two novel viruses, Malsoor virus (family Bunyaviridae, genus, Phlebovirus) and a novel adenovirus (AdV) (family, Adenoviridae genus, Mastadenovirus), were identified from Rousettus bats in the Maharashtra State of India. This study was done to develop and optimize real time reverse transcription - polymerase chain reaction (RT-PCR) assays for Malsoor virus and real time and nested PCR for adenovirus from Rousettus bats. For rapid and accurate screening of Malsoor virus and adenovirus a nested polymerase chain reaction and TaqMan-based real-time PCR were developed. Highly conserved region of nucleoprotein gene of phleboviruses and polymerase gene sequence from the Indian bat AdV isolate polyprotein gene were selected respectively for diagnostic assay development of Malsoor virus and AdV. Sensitivity and specificity of assays were calculated and optimized assays were used to screen bat samples. Molecular diagnostic assays were developed for screening of Malsoor virus and AdV and those were found to be specific. Based on the experiments performed with different parameters, nested PCR was found to be more sensitive than real-time PCR; however, for rapid screening, real-time PCR can be used and further nested PCR can be used for final confirmation or in those laboratories where real-time facility/expertise is not existing. This study reports the development and optimization of nested RT-PCR and a TaqMan-based real-time PCR for Malsoor virus and AdV. The diagnostic assays can be used for rapid detection of these novel viruses to understand their prevalence among bat population.

Early polymerase chain reaction detection of Chagas disease reactivation in heart transplant patients.

PubMed

da Costa, Priscilla Almeida; Segatto, Marcela; Durso, Danielle Fernandes; de Carvalho Moreira, Wagson José; Junqueira, Lucas Lodi; de Castilho, Fábio Morato; de Andrade, Silvio Amadeu; Gelape, Cláudio Léo; Chiari, Egler; Teixeira-Carvalho, Andréa; Junho Pena, Sergio Danilo; Machado, Carlos Renato; Franco, Gloria Regina; Filho, Geraldo Brasileiro; Vieira Moreira, Maria da Consolação; Mara Macedo, Andréa

2017-07-01

Heart transplantation is a valuable therapeutic option for Chagas disease patients with severe cardiomyopathy. During patient follow-up, the differential diagnosis between cardiac transplant rejection and Chagas disease infection reactivation remains a challenging task, which hinders rapid implementation of the appropriate treatment. Herein we investigate whether polymerase chain reaction (PCR) strategies could facilitate early detection of Trypanosoma cruzi (T cruzi) in transplanted endomyocardial biopsies (EMBs). In this study we analyzed 500 EMB specimens obtained from 58 chagasic cardiac transplant patients, using PCR approaches targeted to nuclear (rDNA 24Sα) and kinetoplastid (kDNA) markers, and compared the efficiency of these approaches with that of other tests routinely used. T cruzi DNA was detected in 112 EMB specimens derived from 39 patients (67.2%). The first positive result occurred at a median 1.0 month post-transplant. Conventional histopathologic, blood smear and hemoculture analyses showed lower sensitivity and higher median time to the first positive result. Patient follow-up revealed that 31 of 39 PCR-positive cases presented clinical reactivation of Chagas disease at different time-points after transplantation. PCR techniques showed considerable sensitivity (0.82) and specificity (0.60), with area under the receiver operating characteristic (ROC) curves of 0.708 (p = 0.001). Moreover, PCR techniques anticipated the clinical signs of Chagas disease reactivation by up to 36 months, with a median time of 6 months and an average of 9.1 months. We found a good association between the PCR diagnosis and the clinical signs of the disease, indicating that the PCR approaches used herein are suitable for early diagnosis of Chagas disease reactivation, with high potential to assist physicians in treatment decisions. For this purpose, an algorithm is proposed for surveillance based on the molecular tests. Copyright © 2017 International Society for the Heart and Lung Transplantation. Published by Elsevier Inc. All rights reserved.

Dual-component system dimethyl sulfoxide/LiCl as a solvent and catalyst for homogeneous ring-opening grafted polymerization of ε-caprolactone onto xylan.

PubMed

Zhang, Xue-Qin; Chen, Ming-Jie; Liu, Chuan-Fu; Sun, Run-Cang

2014-01-22

The preparation of xylan-graft-poly(ε-caprolactone) (xylan-g-PCL) copolymers was investigated by homogeneous ring-opening polymerization (ROP) in a dual-component system containing Lewis base LiCl and strong polar aprotic solvent dimethyl sulfoxide (DMSO). DMSO/LiCl acted as solvent, base, and catalyst for the ROP reaction. The effects of the parameters, including the reaction temperature, molar ratio of ε-caprolactone (ε-CL) to anhydroxylose units (AXU) in xylan, and reaction time, on the degree of substitution (DS) and weight percent of PCL side chain (WPCL) were investigated. The results showed that xylan-g-PCL copolymers with low DS in the range of 0.03-0.39 were obtained under the given conditions. The Fourier transform infrared spectroscopy (FTIR), (1)H nuclear magnetic resonance (NMR), (13)C NMR, (1)H-(1)H correlation spectroscopy (COSY), and (1)H-(13)C correlation two-dimensional (2D) NMR [heteronuclear single-quantum coherence (HSQC)] characterization provided more evidence of the attachment of side chains onto xylan. Only one ε-CL was confirmed to be attached onto xylan with each side chain. Integration of resonances assigned to the substituted C2 and C3 in the HSQC spectrum also indicated 69.23 and 30.77% of PCL side chains attached to AXU at C3 and C2 positions, respectively. Although the attachment of PCL onto xylan led to the decreased thermal stability of xylan, the loss of unrecovered xylan fractions with low molecular weight because of the high solubility of xylan in DMSO/LiCl resulted in the increased thermal stability of the samples. This kind of xylan derivative has potential application in environmentally friendly and biodegradable materials considering the good biodegradability of xylan and PCL.

An insight on acyl migration in solvent-free ethanolysis of model triglycerides using Novozym 435.

PubMed

Sánchez, Daniel Alberto; Tonetto, Gabriela Marta; Ferreira, María Luján

2016-02-20

In this work, the ethanolysis of triglycerides catalyzed by immobilized lipase was studied, focusing on the secondary reaction of acyl migration. The catalytic tests were performed in a solvent-free reaction medium using Novozym 435 as biocatalyst. The selected experimental variables were biocatalyst loading (5-20mg), reaction time (30-90min), and chain length of the fatty acids in triglycerides with and without unsaturation (short (triacetin), medium (tricaprylin) and long (tripalmitin/triolein)). The formation of 2-monoglyceride by ethanolysis of triglycerides was favored by long reaction times and large biocatalyst loading with saturated short- to medium-chain triglycerides. In the case of long-chain triglycerides, the formation of this monoglyceride was widely limited by acyl migration. In turn, acyl migration increased the yield of ethyl esters and minimized the content of monoglycerides and diglycerides. Thus, the enzymatic synthesis of biodiesel was favored by long-chain triglycerides (which favor the acyl migration), long reaction times and large biocatalyst loading. The conversion of acylglycerides made from long-chain fatty acids with unsaturation was relatively low due to limitations in their access to the active site of the lipase. Copyright © 2016 Elsevier B.V. All rights reserved.

Novel Scintillating Materials Based on Phenyl-Polysiloxane for Neutron Detection and Monitoring

NASA Astrophysics Data System (ADS)

Degerlier, M.; Carturan, S.; Gramegna, F.; Marchi, T.; Palma, M. Dalla; Cinausero, M.; Maggioni, G.; Quaranta, A.; Collazuol, G.; Bermudez, J.

Neutron detectors are extensively used at many nuclear research facilities across Europe. Their application range covers many topics in basic and applied nuclear research: in nuclear structure and reaction dynamics (reaction reconstruction and decay studies); in nuclear astrophysics (neutron emission probabilities); in nuclear technology (nuclear data measurements and in-core/off-core monitors); in nuclear medicine (radiation monitors, dosimeters); in materials science (neutron imaging techniques); in homeland security applications (fissile materials investigation and cargo inspection). Liquid scintillators, widely used at present, have however some drawbacks given by toxicity, flammability, volatility and sensitivity to oxygen that limit their duration and quality. Even plastic scintillators are not satisfactory because they have low radiation hardness and low thermal stability. Moreover organic solvents may affect their optical properties due to crazing. In order to overcome these problems, phenyl-polysiloxane based scintillators have been recently developed at Legnaro National Laboratory. This new solution showed very good chemical and thermal stability and high radiation hardness. The results on the different samples performance will be presented, paying special attention to a characterization comparison between synthesized phenyl containing polysiloxane resins where a Pt catalyst has been used and a scintillating material obtained by condensation reaction, where tin based compounds are used as catalysts. Different structural arrangements as a result of different substituents on the main chain have been investigated by High Resolution X-Ray Diffraction, while the effect of improved optical transmittance on the scintillation yield has been elucidated by a combination of excitation/fluorescence measurements and scintillation yield under exposure to alpha and γ-rays.

Exact dynamic properties of molecular motors

NASA Astrophysics Data System (ADS)

Boon, N. J.; Hoyle, R. B.

2012-08-01

Molecular motors play important roles within a biological cell, performing functions such as intracellular transport and gene transcription. Recent experimental work suggests that there are many plausible biochemical mechanisms that molecules such as myosin-V could use to achieve motion. To account for the abundance of possible discrete-stochastic frameworks that can arise when modeling molecular motor walks, a generalized and straightforward graphical method for calculating their dynamic properties is presented. It allows the calculation of the velocity, dispersion, and randomness ratio for any proposed system through analysis of its structure. This article extends work of King and Altman ["A schematic method of deriving the rate laws of enzyme-catalyzed reactions," J. Phys. Chem. 60, 1375-1378 (1956)], 10.1021/j150544a010 on networks of enzymatic reactions by calculating additional dynamic properties for spatially hopping systems. Results for n-state systems are presented: single chain, parallel pathway, divided pathway, and divided pathway with a chain. A novel technique for combining multiple system architectures coupled at a reference state is also demonstrated. Four-state examples illustrate the effectiveness and simplicity of these methods.

Enhanced detection rate of typhoid fever among clinically suspected patients in a tertiary referral hospital in Dhaka, Bangladesh using nested polymerase chain reaction technology.

PubMed

Khan, S; Miah, M R; Khatun, S

2015-12-01

A nested polymerase chain reaction (PCR) specific for Salmonella enterica subspecies enteric serovar Typhi was used for the detection of the pathogen, in blood. This study was done during the period of March 2013 to February 2014. A total of 80 clinically suspected cases of typhoid fever were included in the study. Blood was collected from all participating individuals. Nested PCR targeting the flagellin gene (fliC) of Salmonella Typhi & blood culture were done for each of the cases. The positivity rate of PCR & blood culture was 70%& 20% respectively. The positivity rate of PCR was significantly higher than blood culture (P< 0.05). With the nested PCR, S. Typhi DNAs were detected from blood specimens of 67.2% (43/64) patients among the suspected typhoid fever cases on the basis of clinical features but with negative cultures. We conclude that the PCR technique could be used as a novel diagnostic method of typhoid fever, particularly in culture-negative cases in an endemic country like Bangladesh.

Detection of hepatitis "C" virus in formalin-fixed liver tissue by nested polymerase chain reaction.

PubMed

Sallie, R; Rayner, A; Portmann, B; Eddleston, A L; Williams, R

1992-08-01

Interpretation of antibody to hepatitis C virus (HCV) in patients with liver disease is difficult due to false-positive reactivity in some conditions. To evaluate the feasibility of HCV in archival material, HCV was sought in formalin-fixed, paraffin-embedded liver biopsy specimens. Nested polymerase chain reaction was used to detect hepatitis C virus in formalin-fixed, paraffin-embedded liver biopsy specimens after total RNA was extracted from tissue by proteinase K digestion and phenol/chloroform purification. The relative efficiency of amplification of HCV RNA from formalin-fixed material was estimated semiquantitatively by serial dilution of cDNA synthesised from RNA extracted from fresh and formalin-fixed sections from the same liver. Although HCV RNA could be detected in formalin-fixed liver tissue by nested PCR in 5/5 cases in which HCV was detected in serum, amplification was approximately 5-fold less efficient than when HCV was amplified from fresh tissue. Nevertheless, nested PCR of HCV from formalin-fixed liver tissue represents a useful technique in addressing some important questions related to the pathogenesis of liver disease.

[Prevalence of Bartonella henselae in blood donors and risk of blood transmission in Chile].

PubMed

Núñez, M Antonieta; Contreras, Karla; Depix, M Soledad; Geoffroy, Enrique; Villagra, Nicolás; Mellado, Sandra; Salinas, Ana M

2017-12-01

Bartonella henselae is the causal agent of cat scratch disease in immunocompetent persons and bacterial angiomatosis in immunocompromised patients. In Chile, the prevalence of antibodies against B. henselae in healthy children and adolescents is 13.3%, in persons with occupational risk 60.5%, and in cats 85.6%. There are no published data regarding the seroprevalence in blood donors in our country, so determining if B. henselae is present in the blood of donors at the time of donation is very important, since this microorganism can survive up to 35 days in the red blood cells stored in a blood bank at 4 °C. To determine the prevalence of B. henselae in blood donors. 140 donor blood samples were analyzed to detect the presence of B. henselae, using the polymerase chain reaction technique. 13.6% of the blood donors with positive polymerase chain reaction for B. henselae were obtained. The sequence of the amplified fragments showed an identity of over 98% with respect to B. henselae reference sequences. The risk of blood transmission is due to a country with high B. henselae infection.

Quantification of concentrated Chinese medicine granules by quantitative polymerase chain reaction.

PubMed

Lo, Yat-Tung; Shaw, Pang-Chui

2017-10-25

Determination of the amount of constituent in a multi-herb product is important for quality control. In concentrated Chinese medicine granules (CCMG), no dregs are left after dissolution of the CCMG. This study is the first to examine the feasibility of using quantitative polymerase chain reaction (qPCR) to find the amount of CCMG in solution form. DNA was extracted from Hirudo and Zaocys CCMG mixed at different ratios and amplified in qPCR using species-specific primers. The threshold cycle (C T ) obtained was compared with the respective standard curves. Results showed that reproducible quantification results could be obtained (1) for 5-50mg CCMG using a modified DNA extraction protocol, (2) amongst DNA extracted from the same batch of CCMG and (3) amongst different batches of CCMG from the same company. This study demonstrated the constitute amount of CCMG in a mixture could be determined using qPCR. This work has extended the application of DNA techniques for the quantification of herbal products and this approach may be developed for quality assurance in the CCMG industry. Copyright © 2017 Elsevier B.V. All rights reserved.

The design of strain-specific polymerase chain reactions for discrimination of the racoon rabies virus strain from indigenous rabies viruses of Ontario.

PubMed

Nadin-Davis, S A; Huang, W; Wandeler, A I

1996-03-01

Since its recognition as a discrete epizootic in Florida in the early 1950s, the raccoon strain of rabies virus (RV) has spread over almost the entire eastern seaboard of the US and now threatens to enter the southernmost regions of Canada. To characterise this RV strain in more detail, nucleotide sequencing of the N and G genes, encoding the nucleoprotein and glycoprotein, respectively, of representative isolates has been undertaken. This sequence information generated a conserved restriction map of the N gene, thereby permitting unequivocal identification of this strain by molecular techniques. Comparisons of the predicted nucleoprotein and glycoprotein products with those of other RV strains identified a number of amino acid sequence variations conserved only in the raccoon strain. This information was used to design strain-specific primers targeted to the N gene sequences encoding these residues. The incorporation of these primers into a multiplex polymerase chain reaction (PCR) protocol permitted easy and rapid discrimination between the raccoon RV strain and indigenous Ontario RVs.

Impact of nitrophenols on the photosynthetic electron transport chain and ATP content in Nostoc muscorum and Chlorella vulgaris.

PubMed

Umamaheswari, A; Venkateswarlu, K

2004-06-01

Concentration-dependent inhibition of the photosynthetic electron transport chain (photosystem I (PS I), photosystem II (PS II) and whole chain reaction) and ATP content was observed in Nostoc muscorum and Chlorella vulgaris grown with o-nitrophenol, m-nitrophenol, or 2,4-dinitrophenol. Although the extents of inhibition of the photosynthetic electron transport chain in both organisms were similar, PS II was more sensitive than PS I and whole chain reaction to the nitrophenols. Depletion of the ATP pool was noted in nitrophenol-grown cultures, probably as a consequence of nearly complete inhibition of the photosynthetic electron transport chain.

Advances in PCR technology.

PubMed

Lauerman, Lloyd H

2004-12-01

Since the discovery of the polymerase chain reaction (PCR) 20 years ago, an avalanche of scientific publications have reported major developments and changes in specialized equipment, reagents, sample preparation, computer programs and techniques, generated through business, government and university research. The requirement for genetic sequences for primer selection and validation has been greatly facilitated by the development of new sequencing techniques, machines and computer programs. Genetic libraries, such as GenBank, EMBL and DDBJ continue to accumulate a wealth of genetic sequence information for the development and validation of molecular-based diagnostic procedures concerning human and veterinary disease agents. The mechanization of various aspects of the PCR assay, such as robotics, microfluidics and nanotechnology, has made it possible for the rapid advancement of new procedures. Real-time PCR, DNA microarray and DNA chips utilize these newer techniques in conjunction with computer and computer programs. Instruments for hand-held PCR assays are being developed. The PCR and reverse transcription-PCR (RT-PCR) assays have greatly accelerated the speed and accuracy of diagnoses of human and animal disease, especially of the infectious agents that are difficult to isolate or demonstrate. The PCR has made it possible to genetically characterize a microbial isolate inexpensively and rapidly for identification, typing and epidemiological comparison.

Development of a Neuroscience-oriented “Methods” Course for Graduate Students of Pharmacology and Toxicology

PubMed Central

Witt-Enderby, Paula A.; Johnson, David A.; Anderson, Carl A.; Bricker, J. Douglas; Davis, Vicki L.; Firestine, Steven M.; Meng, Wilson S.

2006-01-01

To provide graduate students in pharmacology/toxicology exposure to, and cross-training in, a variety of relevant laboratory skills, the Duquesne University School of Pharmacy developed a “methods” course as part of the core curriculum. Because some of the participating departmental faculty are neuroscientists, this course often applied cutting-edge techniques to neuroscience-based systems, including experiments with brain G protein–coupled receptors. Techniques covered by the course include animal handling and behavioral testing, bacterial and mammalian cell culture, enzyme-linked immunosorbent assay, western blotting, receptor binding of radioligands, plasmid DNA amplification and purification, reverse transcriptase-polymerase chain reaction, gel electrophoresis, and UV-visible and fluorescence spectroscopy. The course also encompasses research aspects such as experimental design and record keeping, statistical analysis, and scientific writing. Students were evaluated via laboratory reports and examinations, and students in turn evaluated the course using a detailed exit survey. This course introduces the graduate student to many more techniques and approaches than can be provided by the traditional graduate “rotation” format alone and should serve as a template for graduate programs in many basic research disciplines. PMID:17012209

Development and validation of a SYBR Green I-based real-time polymerase chain reaction method for detection of haptoglobin gene deletion in clinical materials.

PubMed

Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro

2010-06-01

Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).

Production of polyimide ceria nanocomposites by development of molecular hook technology in nano-sonochemistry.

PubMed

Hatami, Mehdi

2018-06-01

Poly(amic acid), the precursor of polyimide (PI), was used for the preparation of PI/CeO 2 nanocomposites (NC)s by ultrasonic assisted technique via insertion of the surface modified CeO 2 nanoparticles (NP)s into PI matrix. In the preparation stages, in the first, the modifications of CeO 2 NPs by using hexadecyltrimethoxysilane (HDTMS) as a binder were targeted using ultrasonic waves. In the second step, newly designed PI structure was formed from the sonochemical imidization process as a molecular hook. In this step two different reactions were occurred. The acetic acid elimination reaction in the main chain of macromolecule, and the acetylation reaction in the side chains of poly(amic acid) were accomplished. By acetylation process the hook structure was created for trapping of the modified nanoparticles. In the final step the preparation of PI NCs were achieved by sonochemical process. The structural and thermal properties of pure PI and PI/CeO 2 NCs were studied by several techniques such as fourier transform infrared spectroscopy (FT-IR), nuclear magnetic resonance spectroscopy (NMR), field emission scanning electron microscopy (FE-SEM), transmission electron microscopy (TEM), atomic force microscopy (AFM), X-ray diffraction (XRD), and thermal analyses. FT-IR and 1 H NMR spectra confirmed the success in preparation of PI matrix. The FE-SEM, TEM, and AFM analyses showed the uniform distribution of CeO 2 NPs in PI matrix. The XRD patterns of NCs show the presence of crystalline CeO 2 NPs in amorphous PI matrix. The thermal analysis results reveal that, with increases in the content of CeO 2 NPs in PI matrix, the thermally stability factors of samples were improved. Copyright © 2018 Elsevier B.V. All rights reserved.

Effective PCR detection of animal species in highly processed animal byproducts and compound feeds.

PubMed

Fumière, Olivier; Dubois, Marc; Baeten, Vincent; von Holst, Christoph; Berben, Gilbert

2006-07-01

In this paper we present a polymerase chain reaction (PCR)-based method for detecting meat and bone meal (MBM) in compound feedingstuffs. By choosing adequate DNA targets from an appropriate localisation in the genome, the real-time PCR method developed here proved to be robust to severe heat treatment of the MBM, showing high sensitivity in the detection of MBM. The method developed here permits the specific detection of processed pig and cattle materials treated at 134 degrees C in various feed matrices down to a limit of detection of about 0.1%. This technique has also been successfully applied to well-characterised MBM samples heated to as high as 141 degrees C, as well as to various blind feed samples with very low MBM contents. Finally, the method also passed several official European ring trials.

Identification of feline polycystic kidney disease mutation using fret probes and melting curve analysis.

PubMed

Criado-Fornelio, A; Buling, A; Barba-Carretero, J C

2009-02-01

We developed and validated a real-time polymerase chain reaction (PCR) assay using fluorescent hybridization probes and melting curve analysis to identify the PKD1 exon 29 (C-->A) mutation, which is implicated in polycystic kidney disease of cats. DNA was isolated from peripheral blood of 20 Persian cats. The employ of the new real-time PCR and melting curve analysis in these samples indicated that 13 cats (65%) were wild type homozygotes and seven cats (35%) were heterozygotes. Both PCR-RFLP and sequencing procedures were in full agreement with real-time PCR test results. Sequence analysis showed that the mutant gene had the expected base change compared to the wild type gene. The new procedure is not only very reliable but also faster than the techniques currently applied for diagnosis of the mutation.

New Poly(amide-imide)/Nanocomposites Reinforced Silicate Nanoparticles Based on N-pyromellitimido-L-phenyl Alanine Containing Ether Moieties

NASA Astrophysics Data System (ADS)

Faghihi, Khalil; Shabanian, Meisam; Dadfar, Ehsan

2012-02-01

A series of Poly(amide-imide)/montmorillonite nanocomposites containing N-pyromellitimido-L-phenyl alanine moiety in the main chain were synthesized by a convenient solution intercalation technique. Poly(amide-imide) (PAI) 5 as a source of polymer matrix was synthesized by the direct polycondensation reaction of N-pyromellitimido-L-phenyl alanine 3 with 4,4'-diamino diphenyl ether 4 in the presence of triphenyl phosphite (TPP), CaCl2, pyridine and N-methyl-2-pyrrolidone (NMP). The resulting nanocomposite films were characterized by Fourier transform infrared spectra (FT-IR), X-ray diffraction (XRD), scanning electron microscopy (SEM) and thermogravimetric analysis (TGA). The results showed that organo-modified clay was dispersed homogeneously in PAI matrix. TGA indicated an enhancement of thermal stability of new nanocomposites compared with the pure polymer.

Detection of the anaerobic dechlorinating microorganism Desulfomonile tiedjei in environmental matrices by its signature lipopolysacchride branched-long-chain hydroxy fatty acids

USGS Publications Warehouse

Ringleberg, D.B.; Townsend, G.T.; DeWeerd, K.A.; Suflita, J.M.; White, D.C.

1994-01-01

Desulfomonile tiedjei is a Gram-negative sulfate-reducing bacterium capable of catalyzing aryl reductive dehalogenation reactions. Since many toxic and persistent contaminants in the subsurface are halogenated aromatic compounds, the detection and enumeration of dehalogenating microorganisms in the environment may be a useful tool for planning and evaluating bioremediation efforts. In this study, we show that D. tiedjei contains unique lipopolysaccharide branched 3-hydroxy fatty acids, unknown as yet in other bacteria, and that it is possible to detect the bacterium in inoculated aquifer sediments based on these signature lipid biomarkers. The detection of D. tiedjeiand other dehalogenating microorganisms possessing similar cellular properties in environmental matrices may be possible by this technique. Additionally, the effect of such inoculation on dehalogenation activity is examined.

PERMANENT GENETIC RESOURCES: Eighteen new polymorphic microsatellite markers for the endangered Florida manatee, Trichechus manatus latirostris.

PubMed

Tringali, Michael D; Seyoum, Seifu; Carney, Susan L; Davis, Michelle C; Rodriguez-Lopez, Marta A; Reynolds Iii, John E; Haubold, Elsa

2008-03-01

Here we describe 18 polymorphic microsatellite loci for Trichechus manatus latirostris (Florida manatee), isolated using a polymerase chain reaction-based technique. The number of alleles at each locus ranged from two to four (mean = 2.5) in specimens from southwest (n = 58) and northeast (n = 58) Florida. Expected and observed heterozygosities ranged from 0.11 to 0.67 (mean = 0.35) and from 0.02 to 0.78 (mean = 0.34), respectively. Departures from Hardy-Weinberg equilibrium occurred at two loci. There was no evidence of genotypic disequilibrium for any pair of loci. For individual identification, mean random-mating and θ-corrected match probabilities were 9.36 × 10(-7) and 1.95 × 10(-6) , respectively. © 2007 The Authors.

Exploiting the CNC side chain in heterocyclic rearrangements: synthesis of 4(5)-acylamino-imidazoles.

PubMed

Piccionello, Antonio Palumbo; Buscemi, Silvestre; Vivona, Nicolò; Pace, Andrea

2010-08-06

A new variation on the Boulton-Katritzky reaction is reported, namely, involving use of a CNC side chain. A novel Montmorillonite-K10 catalyzed nonreductive transamination of a 3-benzoyl-1,2,4-oxadiazole afforded a 3-(alpha-aminobenzyl)-1,2,4-oxadiazole, which was condensed with benzaldehydes to afford the corresponding imines. In the presence of strong base, these imines underwent Boulton-Katritzky-type rearrangement to afford novel 4(5)-acylaminoimidazoles.

NASBA: A detection and amplification system uniquely suited for RNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sooknanan, R.; Malek, L.T.

1995-06-01

The invention of PCR (polymerase chain reaction) has revolutionized our ability to amplify and manipulate a nucleic acid sequence in vitro. The commercial rewards of this revolution have driven the development of other nuclei acid amplification and detection methodologies. This has created an alphabet soup of technologies that use different amplification methods, including NASBA (nucleic acid sequence-based amplification), LCR (ligase chain reaction), SDA (strand displacement amplification), QBR (Q-beta replicase), CPR (cycling probe reaction), and bDNA (branched DNA). Despite the differences in their processes, these amplification systems can be separated into two broad categories based on how they achieve their goal:more » sequence-based amplification systems, such as PCR, NASBA, and SDA, amplify a target nucleic acid sequence. Signal-based amplification systems, such as LCR, QBR, CPR and bDNA, amplify or alter a signal from a detection reaction that is target-dependent. While the various methods have relative strengths and weaknesses, only NASBA offers the unique ability to homogeneously amplify an RNA analyte in the presence of homologous genomic DNA under isothermal conditions. Since the detection of RNA sequences almost invariably measures biological activity, it is an excellent prognostic indicator of activities as diverse as virus production, gene expression, and cell viability. The isothermal nature of the reaction makes NASBA especially suitable for large-scale manual screening. These features extend NASBA`s application range from research to commercial diagnostic applications. Field test kits are presently under development for human diagnostics as well as the burgeoning fields of food and environmental diagnostic testing. These developments suggest future integration of NASBA into robotic workstations for high-throughput screening as well. 17 refs., 1 tab.« less

Is Galba schirazensis (Mollusca, Gastropoda) an intermediate host of Fasciola hepatica (Trematoda, Digenea) in Ecuador?

PubMed

Caron, Yannick; Celi-Erazo, Maritza; Hurtrez-Boussès, Sylvie; Lounnas, Mannon; Pointier, Jean-Pierre; Saegerman, Claude; Losson, Bertrand; Benítez-Ortíz, Washington

2017-01-01

Fasciolosis is a widely distributed disease in livestock in South America but knowledge about the epidemiology and the intermediate hosts is relatively scarce in Ecuador. For three months, lymnaeid snails were sampled (n = 1482) in Pichincha Province at two sites located in a highly endemic area. Snails were identified (based on morphology and ITS-2 sequences) and the infection status was established through microscopic dissection and a multiplex polymerase chain reaction (PCR)-based technique. Techniques based on morphology were not useful to accurately name the collected snail species. Comparison with available DNA sequences showed that a single snail species was collected, Galba schirazensis. Live rediae were observed in 1.75% (26/1482) and Fasciola sp. DNA was detected in 6% (89/1482) of collected snails. The COX-1 region permitted identification of the parasite as Fasciola hepatica. The relative sensitivity and specificity of the microscope study, compared to PCR results, were 25.84% and 99.78%, respectively. The mean size of the snails recorded positive for F. hepatica through crushing and microscopy was significantly higher than the mean size of negative snails, but there was no such difference in PCR-positive snails. The role of G. schirazensis as an intermediate host of F. hepatica in Ecuador is discussed and the hypothesis of an adaptation of the parasite to this invasive snail is proposed. For the first time, an epidemiological survey based on molecular biology-based techniques assessed the possible role of lymnaeid snails in the epidemiology of fasciolosis in Ecuador. © Y. Caron et al., published by EDP Sciences, 2017.

Is Galba schirazensis (Mollusca, Gastropoda) an intermediate host of Fasciola hepatica (Trematoda, Digenea) in Ecuador?

PubMed Central

Caron, Yannick; Celi-Erazo, Maritza; Hurtrez-Boussès, Sylvie; Lounnas, Mannon; Pointier, Jean-Pierre; Saegerman, Claude; Losson, Bertrand; Benítez-Ortíz, Washington

2017-01-01

Fasciolosis is a widely distributed disease in livestock in South America but knowledge about the epidemiology and the intermediate hosts is relatively scarce in Ecuador. For three months, lymnaeid snails were sampled (n = 1482) in Pichincha Province at two sites located in a highly endemic area. Snails were identified (based on morphology and ITS-2 sequences) and the infection status was established through microscopic dissection and a multiplex polymerase chain reaction (PCR)-based technique. Techniques based on morphology were not useful to accurately name the collected snail species. Comparison with available DNA sequences showed that a single snail species was collected, Galba schirazensis. Live rediae were observed in 1.75% (26/1482) and Fasciola sp. DNA was detected in 6% (89/1482) of collected snails. The COX-1 region permitted identification of the parasite as Fasciola hepatica. The relative sensitivity and specificity of the microscope study, compared to PCR results, were 25.84% and 99.78%, respectively. The mean size of the snails recorded positive for F. hepatica through crushing and microscopy was significantly higher than the mean size of negative snails, but there was no such difference in PCR-positive snails. The role of G. schirazensis as an intermediate host of F. hepatica in Ecuador is discussed and the hypothesis of an adaptation of the parasite to this invasive snail is proposed. For the first time, an epidemiological survey based on molecular biology-based techniques assessed the possible role of lymnaeid snails in the epidemiology of fasciolosis in Ecuador. PMID:28664841

The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.

PubMed

Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W

2006-07-01

We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.

Invited commentary: Lost in estimation--searching for alternatives to markov chains to fit complex Bayesian models.

PubMed

Molitor, John

2012-03-01

Bayesian methods have seen an increase in popularity in a wide variety of scientific fields, including epidemiology. One of the main reasons for their widespread application is the power of the Markov chain Monte Carlo (MCMC) techniques generally used to fit these models. As a result, researchers often implicitly associate Bayesian models with MCMC estimation procedures. However, Bayesian models do not always require Markov-chain-based methods for parameter estimation. This is important, as MCMC estimation methods, while generally quite powerful, are complex and computationally expensive and suffer from convergence problems related to the manner in which they generate correlated samples used to estimate probability distributions for parameters of interest. In this issue of the Journal, Cole et al. (Am J Epidemiol. 2012;175(5):368-375) present an interesting paper that discusses non-Markov-chain-based approaches to fitting Bayesian models. These methods, though limited, can overcome some of the problems associated with MCMC techniques and promise to provide simpler approaches to fitting Bayesian models. Applied researchers will find these estimation approaches intuitively appealing and will gain a deeper understanding of Bayesian models through their use. However, readers should be aware that other non-Markov-chain-based methods are currently in active development and have been widely published in other fields.

Genetic Diversity of Plasmodium falciparum Merozoite Surface Protein-1 Block 2 in Sites of Contrasting Altitudes and Malaria Endemicities in the Mount Cameroon Region

PubMed Central

Wanji, Samuel; Kengne-Ouafo, Arnaud J.; Joan Eyong, Ebanga E.; Kimbi, Helen K.; Tendongfor, Nicholas; Ndamukong-Nyanga, Judith L.; Nana-Djeunga, Hugues C.; Bourguinat, Catherine; Sofeu-Feugaing, David D.; Charvet, Claude L.

2012-01-01

The present study analyzed the relationship between the genetic diversity of Plasmodium falciparum and parasitologic/entomologic indices in the Mount Cameroon region by using merozoite surface protein 1 as a genetic marker. Blood samples were collected from asymptomatic children from three altitude zones (high, intermediate, and low). Parasitologic and entomologic indices were determined by microscopy and landing catch mosquito collection/circumsporozoite protein–enzyme-linked immunosorbent assay, respectively. A total of 142 randomly selected P. falciparum-positive blood samples were genotyped by using a nested polymerase chain reaction–based technique. K-1 polymerase chain reaction products were also sequenced. As opposed to high altitude, the highest malaria prevalence (70.65%) and entomologic inoculation rate (2.43 infective/bites/night) were recorded at a low altitude site. Seven (18.91%), 22 (36.66%), and 19 (42.22%) samples from high, intermediate, and low altitudes, respectively, contained multiclonal infections. A new K-1 polymorphism was identified. This study shows a positive non-linear association between low/intermediate altitude (high malaria transmission) and an increase in P. falciparum merozoite surface protein 1 block 2 polymorphisms. PMID:22556072

Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.

PubMed

Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin

2017-08-01

Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.

A Markov chain technique for determining the acquisition behavior of a digital tracking loop

NASA Technical Reports Server (NTRS)

Chadwick, H. D.

1972-01-01

An iterative procedure is presented for determining the acquisition behavior of discrete or digital implementations of a tracking loop. The technique is based on the theory of Markov chains and provides the cumulative probability of acquisition in the loop as a function of time in the presence of noise and a given set of initial condition probabilities. A digital second-order tracking loop to be used in the Viking command receiver for continuous tracking of the command subcarrier phase was analyzed using this technique, and the results agree closely with experimental data.

A case of nosocomial Legionnaires' disease: The importance of early diagnosis, adequate prevention and eradication measures.

PubMed

Lucardie, A; Rogiers, Ph; Floré, K

2016-02-03

This case-report describes a patient with confirmed nosocomial Legionnaires' disease, a diagnosis which should be suspected when pneumonia does not respond to empiric therapy with beta-lactam antibiotics, or develops in the presence of certain risk factors. Culture is currently the golden standard for diagnosis, although the use of more modern techniques, such as a combination of urinary antigen testing and polymerase chain reaction, are on the rise. Specific detection and eradication methods are discussed.

A Combined Photochemical and Multicomponent Reaction Approach to Precision Oligomers.

PubMed

Konrad, Waldemar; Bloesser, Fabian R; Wetzel, Katharina S; Boukis, Andreas C; Meier, Michael A R; Barner-Kowollik, Christopher

2018-03-07

We introduce the convergent synthesis of linear monodisperse sequence-defined oligomers through a unique approach, combining the Passerini three-component reaction (P-3CR) and a Diels-Alder (DA) reaction based on photocaged dienes. A set of oligomers is prepared resting on a Passerini linker unit carrying an isocyano group for chain extension by P-3CR and a maleimide moiety for photoenol conjugation enabling a modular approach for chain growth. Monodisperse oligomers are accessible in a stepwise fashion by switching between both reaction types. Employing sebacic acid as a core unit allows the synthesis of a library of symmetric sequence-defined oligomers. The oligomers consist of alternating P-3CR and photoblocks with molecular weights up to 3532.16 g mol -1 , demonstrating the successful switching from P-3CR to photoenol conjugation. In-depth characterization was carried out including size-exclusion chromatography (SEC), high-resolution electrospray ionization mass spectrometry (ESI-MS) and NMR spectroscopy, evidencing the monodisperse nature of the precision oligomers. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Nucleic acid probes as a diagnostic method for tick-borne hemoparasites of veterinary importance.

PubMed

Figueroa, J V; Buening, G M

1995-03-01

An increased number of articles on the use of nucleic acid-based hybridization techniques for diagnostic purposes have been recently published. This article reviews nucleic acid-based hybridization as an assay to detect hemoparasite infections of economic relevance in veterinary medicine. By using recombinant DNA techniques, selected clones containing inserts of Anaplasma, Babesia, Cowdria or Theileria genomic DNA sequences have been obtained, and they are now available to be utilized as specific, highly sensitive DNA or RNA probes to detect the presence of the hemoparasite DNA in an infected animal. Either in an isotopic or non-isotopic detection system, probes have allowed scientists to test for--originally in samples collected from experimentally infected animals and later in samples collected in the field--the presence of hemoparasites during the prepatent, patent, convalescent, and chronic periods of the infection in the host. Nucleic acid probes have given researchers the opportunity to carry out genomic analysis of parasite DNA to differentiate hemoparasite species and to identify genetically distinct populations among and within isolates, strains and clonal populations. Prevalence of parasite infection in the tick vector can now be accomplished more specifically with the nucleic acid probes. Lately, with the advent of the polymerase chain reaction technique, small numbers of hemoparasites can be positively identified in the vertebrate host and tick vector. These techniques can be used to assess the veterinary epidemiological situation in a particular geographical region for the planning of control measures.

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions

PubMed Central

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-01-01

To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642

Biochemical behavior of N-oxidized cytosine and adenine bases in DNA polymerase-mediated primer extension reactions.

PubMed

Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo

2011-04-01

To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.

LAMP-PCR detection of ochratoxigenic Aspergillus species collected from peanut kernel.

PubMed

Al-Sheikh, H M

2015-01-30

Over the last decade, ochratoxin A (OTA) has been widely described and is ubiquitous in several agricultural products. Ochratoxins represent the second-most important mycotoxin group after aflatoxins. A total of 34 samples were surveyed from 3 locations, including Mecca, Madina, and Riyadh, Saudi Arabia, during 2012. Fungal contamination frequency was determined for surface-sterilized peanut seeds, which were seeded onto malt extract agar media. Aspergillus niger (35%), Aspergillus ochraceus (30%), and Aspergillus carbonarius (25%) were the most frequently observed Aspergillius species, while Aspergillus flavus and Aspergillus phoenicis isolates were only infrequently recovered and in small numbers (10%). OTA production was evaluated on yeast extract sucrose medium, which revealed that 57% of the isolates were A. niger and 60% of A. carbonarius isolates were OTA producers; 100% belonged to A. ochraceus. Only one isolate, morphologically identified as A. carbonarius, and 3 A. niger isolates unstably produced OTA. A polymerase chain reaction (PCR)-based identification and detection assay was used to identify A. ochraceus isolates. Using the primer sets OCRA1/OCRA2, 400-base pair PCR fragments were produced only when genomic DNA from A. ochraceus isolates was used. Recently, the loop-mediated isothermal amplification assay using recombinase polymerase amplification chemistry was used for A. carbonarius and A. niger DNA identification. As a non-gel-based technique, the amplification product was directly visualized in the reaction tube after adding calcein for naked-eye examination.

Joining of Silicon Carbide-Based Ceramics by Reaction Forming Method

NASA Technical Reports Server (NTRS)

Singh, M.; Kiser, J. D.

1997-01-01

Recently, there has been a surge of interest in the development and testing of silicon-based ceramics and composite components for a number of aerospace and ground based systems. The designs often require fabrication of complex shaped parts which can be quite expensive. One attractive way of achieving this goal is to build up complex shapes by joining together geometrically simple shapes. However, the joints should have good mechanical strength and environmental stability comparable to the bulk materials. These joints should also be able to maintain their structural integrity at high temperatures. In addition, the joining technique should be practical, reliable, and affordable. Thus, joining has been recognized as one of the enabling technologies for the successful utilization of silicon carbide based ceramic components in high temperature applications. Overviews of various joining techniques, i.e., mechanical fastening, adhesive bonding, welding, brazing, and soldering have been provided in recent publications. The majority of the techniques used today are based on the joining of monolithic ceramics with metals either by diffusion bonding, metal brazing, brazing with oxides and oxynitrides, or diffusion welding. These techniques need either very high temperatures for processing or hot pressing (high pressures). The joints produced by these techniques have different thermal expansion coefficients than the ceramic materials, which creates a stress concentration in the joint area. The use temperatures for these joints are around 700 C. Ceramic joint interlayers have been developed as a means of obtaining high temperature joints. These joint interlayers have been produced via pre-ceramic polymers, in-situ displacement reactions, and reaction bonding techniques. Joints produced by the pre-ceramic polymer approach exhibit a large amounts of porosity and poor mechanical properties. On the other hand, hot pressing or high pressures are needed for in-situ displacement reactions and reaction bonding techniques. Due to the equipment required, these techniques are impractical for joining large or complex shaped components.

DIFFERENTIATING HUMAN FROM ANIMAL ISOLATES OF CRYPTOSPORIDIUM PARVUM

EPA Science Inventory

We analyzed 9s Cryptosporidium parvum isolates from humans and animals by a polymerase chain reaction/restriction fragment length polymorphism method based on the thrombospondin-related anonymous protein 2 gene sequence. Used as a molecular marker, this method can differentiate ...

QUALITY ASSURANCE FOR PCR

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) held a workshop in January 2003 on the detection of viruses in water using polymerase chain reaction (PCR)-based methods. Speakers were asked to address a series of specific questions, including whether a single standard method coul...

Brownian cluster dynamics with short range patchy interactions: Its application to polymers and step-growth polymerization

NASA Astrophysics Data System (ADS)

Prabhu, A.; Babu, S. B.; Dolado, J. S.; Gimel, J.-C.

2014-07-01

We present a novel simulation technique derived from Brownian cluster dynamics used so far to study the isotropic colloidal aggregation. It now implements the classical Kern-Frenkel potential to describe patchy interactions between particles. This technique gives access to static properties, dynamics and kinetics of the system, even far from the equilibrium. Particle thermal motions are modeled using billions of independent small random translations and rotations, constrained by the excluded volume and the connectivity. This algorithm, applied to a single polymer chain leads to correct static and dynamic properties, in the framework where hydrodynamic interactions are ignored. By varying patch angles, various local chain flexibilities can be obtained. We have used this new algorithm to model step-growth polymerization under various solvent qualities. The polymerization reaction is modeled by an irreversible aggregation between patches while an isotropic finite square-well potential is superimposed to mimic the solvent quality. In bad solvent conditions, a competition between a phase separation (due to the isotropic interaction) and polymerization (due to patches) occurs. Surprisingly, an arrested network with a very peculiar structure appears. It is made of strands and nodes. Strands gather few stretched chains that dip into entangled globular nodes. These nodes act as reticulation points between the strands. The system is kinetically driven and we observe a trapped arrested structure. That demonstrates one of the strengths of this new simulation technique. It can give valuable insights about mechanisms that could be involved in the formation of stranded gels.

Recent Direct Reaction Experimental Studies with Radioactive Tin Beams

DOE PAGES

Jones, K. L.; Ahn, S.; Allmond, J. M.; ...

2015-01-01

Direct reaction techniques are powerful tools to study the single-particle nature of nuclei. Performing direct reactions on short-lived nuclei requires radioactive ion beams produced either via fragmentation or the Isotope Separation OnLine (ISOL) method. Some of the most interesting regions to study with direct reactions are close to the magic numbers where changes in shell structure can be tracked. These changes can impact the final abundances of explosive nucleosynthesis. The structure of the chain of tin isotopes is strongly influenced by the Z = 50 proton shell closure, as well as the neutron shell closures lying in the neutron-rich, Nmore » = 82, and neutron-deficient, N = 50, regions. Here, we present two examples of direct reactions on exotic tin isotopes. The first uses a one-neutron transfer reaction and a low-energy reaccelerated ISOL beam to study states in Sn-131 from across the N = 82 shell closure. The second example utilizes a one-neutron knockout reaction on fragmentation beams of neutron-deficient Sn- 106,108Sn. In conclusion, In both cases, measurements of γ rays in coincidence with charged particles proved to be invaluable.« less

A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

PubMed Central

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

2008-01-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880

Expression and Functional Properties of an Anti-Triazophos High-Affinity Single-Chain Variable Fragment Antibody with Specific Lambda Light Chain

PubMed Central

Liu, Rui; Liang, Xiao; Xiang, Dandan; Guo, Yirong; Liu, Yihua; Zhu, Guonian

2016-01-01

Triazophos is a widely used organophosphorous insecticide that has potentially adverse effects to organisms. In the present study, a high-affinity single-chain variable fragment (scFv) antibody with specific lambda light chain was developed for residue monitoring. First, the specific variable regions were correctly amplified from a hybridoma cell line 8C10 that secreted monoclonal antibody (mAb) against triazophos. The regions were then assembled as scFv via splicing by overlap extension polymerase chain reaction. Subsequently, the recombinant anti-triazophos scFv-8C10 was successfully expressed in Escherichia coli strain HB2151 in soluble form, purified through immobilized metal ion affinity chromatography, and verified via Western blot and peptide mass fingerprinting analyses. Afterward, an indirect competitive enzyme-linked immunosorbent assay was established based on the purified anti-triazophos scFv-8C10 antibody. The assay exhibited properties similar to those based on the parent mAb, with a high sensitivity (IC50 of 1.73 ng/mL) to triazophos and no cross reaction for other organophosphorus pesticides; it was reliable in detecting triazophos residues in spiked water samples. Moreover, kinetic measurement using a surface plasmon resonance biosensor indicated that the purified scFv-8C10 antibody had a high affinity of 1.8 × 10−10 M and exhibited good binding stability. Results indicated that the recombinant high-affinity scFv-8C10 antibody was an effective detection material that would be promising for monitoring triazophos residues in environment samples. PMID:27338340

Amyloid fibril formation by the chain B subunit of monellin occurs by a nucleation-dependent polymerization mechanism.

PubMed

Sabareesan, A T; Udgaonkar, Jayant B

2014-02-25

Proteins possessing very different structures, or even no structure, form amyloid fibrils that are very similar in internal structure. This suggests that the mechanisms by which amyloid fibrils form might be very similar, irrespective of whether the fibrils are associated with disease or with normal cellular function, or even if they have no physiological importance. In this context, it is important to have a model protein system whose amyloid fibril formation is robust in its reproducibility, which can reveal the fundamentals of the amyloid fibril reaction that may be applicable to all proteins. In this study, the aggregation mechanism of amyloid fibril formation by chain B of the heterodimeric protein monellin has been elucidated in detail. It is shown that the aggregation reaction meets all the stringent kinetic criteria of a homogeneous nucleation-dependent polymerization mechanism, which is valid over a wide range of protein concentrations. Quantitative analyses of the kinetic data using one approach based on features of the entire kinetic curve, and another based on only the initial rate of aggregation, indicate that the thermodynamic nucleus is a dimer. Spherical oligomers are observed by atomic force microscopy to form transiently early during fibril formation but are off-pathway to the direct fibril formation pathway. It is shown that amyloid fibril formation can be prevented by the addition of chain A of monellin at early stages of chain B aggregation: the two free chains combine to form native monellin, which leads to the dissociation of early aggregates.

MHC Class I Chain-Related Gene A Polymorphisms and Linkage Disequilibrium with HLA-B and HLA-C Alleles in Ocular Toxoplasmosis.

PubMed

Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos

2015-01-01

This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05-4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22-0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population.

MHC Class I Chain-Related Gene A Polymorphisms and Linkage Disequilibrium with HLA-B and HLA-C Alleles in Ocular Toxoplasmosis

PubMed Central

Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos

2015-01-01

This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05–4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22–0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population. PMID:26672749

A multiplex real-time polymerase chain reaction assay with two internal controls for the detection of Brucella species in tissues, blood, and feces from marine mammals.

PubMed

Sidor, Inga F; Dunn, J Lawrence; Tsongalis, Gregory J; Carlson, Jolene; Frasca, Salvatore

2013-01-01

Brucellosis has emerged as a disease of concern in marine mammals in the last 2 decades. Molecular detection techniques have the potential to address limitations of other methods for detecting infection with Brucella in these species. Presented herein is a real-time polymerase chain reaction (PCR) method targeting the Brucella genus-specific bcsp31 gene. The method also includes a target to a conserved region of the eukaryotic mitochondrial 16S ribosomal RNA gene to assess suitability of extracted DNA and a plasmid-based internal control to detect failure of PCR due to inhibition. This method was optimized and validated to detect Brucella spp. in multiple sample matrices, including fresh or frozen tissue, blood, and feces. The analytical limit of detection was low, with 95% amplification at 24 fg, or an estimated 7 bacterial genomic copies. When Brucella spp. were experimentally added to tissue or fecal homogenates, the assay detected an estimated 1-5 bacteria/µl. An experiment simulating tissue autolysis showed relative persistence of bacterial DNA compared to host mitochondrial DNA. When used to screen 1,658 field-collected marine mammal tissues in comparison to microbial culture, diagnostic sensitivity and specificity were 70.4% and 98.3%, respectively. In addition to amplification in fresh and frozen tissues, Brucella spp. were detected in feces and formalin-fixed, paraffin-embedded tissues from culture-positive animals. Results indicate the utility of this real-time PCR for the detection of Brucella spp. in marine species, which may have applications in surveillance or epidemiologic investigations.

Electrochemical sensor for glutathione detection based on mercury ion triggered hybridization chain reaction signal amplification.

PubMed

Wang, Yonghong; Jiang, Lun; Leng, Qinggang; Wu, Yaohui; He, Xiaoxiao; Wang, Kemin

2016-03-15

In this work, we design a new simple and highly sensitive strategy for electrochemical detection of glutathione (GSH) via mercury ion (Hg(2+)) triggered hybridization chain reaction (HCR) signal amplification. It is observed that in the absence of GSH, a specific thymine-Hg(2+)-thymine (T-Hg(2+)-T) coordination can fold into hairpin structures. While in the presence of GSH, it thus can be chelated with Hg(2+), resulting in Hg(2+) released from the T-Hg(2+)-T hairpin complex which then forms into ssDNA structure to further hybridize with the surface-immobilized capture DNA probe on the gold electrode with a sticky tail left. The presence of two hairpin helper probes through HCR leads to the formation of extended dsDNA superstructure on the electrode surface, which therefore causes the intercalation of numerous electroactive species ([Ru(NH3)6](3+)) into the dsDNA grooves, followed by a significantly amplified signal output whose intensity is related to the concentration of the GSH. Taking advantage of merits of enzyme-free amplification power of the HCR, the inherent high sensitivity of the electrochemical technique, and label-free detection which utilizes an electroactive species as a signaling molecule that binds to the anionic phosphate backbone of DNA strands via electrostatic force, not only does the proposed strategy enable sensitive detection of GSH, but show high selectivity against other amino acid, making our method a simple and sensitive addition to the amplified GSH detection. Copyright © 2015 Elsevier B.V. All rights reserved.

Versatile fusion source integrator AFSI for fast ion and neutron studies in fusion devices

NASA Astrophysics Data System (ADS)

Sirén, Paula; Varje, Jari; Äkäslompolo, Simppa; Asunta, Otto; Giroud, Carine; Kurki-Suonio, Taina; Weisen, Henri; JET Contributors, The

2018-01-01

ASCOT Fusion Source Integrator AFSI, an efficient tool for calculating fusion reaction rates and characterizing the fusion products, based on arbitrary reactant distributions, has been developed and is reported in this paper. Calculation of reactor-relevant D-D, D-T and D-3He fusion reactions has been implemented based on the Bosch-Hale fusion cross sections. The reactions can be calculated between arbitrary particle populations, including Maxwellian thermal particles and minority energetic particles. Reaction rate profiles, energy spectra and full 4D phase space distributions can be calculated for the non-isotropic reaction products. The code is especially suitable for integrated modelling in self-consistent plasma physics simulations as well as in the Serpent neutronics calculation chain. Validation of the model has been performed for neutron measurements at the JET tokamak and the code has been applied to predictive simulations in ITER.

Polymerase chain reaction system

DOEpatents

Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

2004-03-02

A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

Polymorphisms of interleukin 6 in Down syndrome individuals: a case-control study.

PubMed

Mattos, M F; Uback, L; Biselli-Chicote, P M; Biselli, J M; Goloni-Bertollo, E M; Pavarino, E C

2017-08-17

Down syndrome (DS) individuals present impaired adaptive immune system. However, the etiology of the immunological deficiency in these individuals is not completely understood. This study investigated the frequency of interleukin 6 polymorphisms (rs1800795, rs1800796, and rs1800797) in individuals with DS and individuals without the syndrome. The study included 282 individuals, 94 with DS attended at the General Genetics Outpatient Service of Hospital de Base, São José do Rio Preto, SP, Brazil, and 188 individuals without DS attended at the Pediatric Service of Hospital de Base de São José do Rio Preto, SP, Brazil. Genotyping was performed by allelic discrimination technique by real-time polymerase chain reaction using TaqMan SNP Genotyping Assays (Applied Biosystems). There was no difference in the genotype frequency between individuals with and without DS for the evaluated polymorphisms (P > 0.05). The frequency of interleukin 6 polymorphisms did not differ significantly between individuals with and without DS in the casuistic analyzed.

Magnetic Levitation To Characterize the Kinetics of Free-Radical Polymerization.

PubMed

Ge, Shencheng; Semenov, Sergey N; Nagarkar, Amit A; Milette, Jonathan; Christodouleas, Dionysios C; Yuan, Li; Whitesides, George M

2017-12-27

This work describes the development of magnetic levitation (MagLev) to characterize the kinetics of free-radical polymerization of water-insoluble, low-molecular-weight monomers that show a large change in density upon polymerization. Maglev measures density, and certain classes of monomers show a large change in density when monomers covalently join in polymer chains. MagLev characterized both the thermal polymerization of methacrylate-based monomers and the photopolymerization of methyl methacrylate and made it possible to determine the orders of reaction and the Arrhenius activation energy of polymerization. MagLev also made it possible to monitor polymerization in the presence of solids (aramid fibers, and carbon fibers, and glass fibers). MagLev offers a new analytical technique to materials and polymer scientists that complements other methods (even those based on density, such as dilatometry), and will be useful in investigating polymerizations, evaluating inhibition of polymerizations, and studying polymerization in the presence of included solid materials (e.g., for composite materials).

The readout chain for the bar PANDA MVD strip detector

NASA Astrophysics Data System (ADS)

Schnell, R.; Brinkmann, K.-Th.; Di Pietro, V.; Kleines, H.; Goerres, A.; Riccardi, A.; Rivetti, A.; Rolo, M. D.; Sohlbach, H.; Zaunick, H.-G.

2015-02-01

The bar PANDA (antiProton ANnihilation at DArmstadt) experiment will study the strong interaction in annihilation reactions between an antiproton beam and a stationary gas jet target. The detector will comprise different sub-detectors for tracking, particle identification and calorimetry. The Micro-Vertex Detector (MVD) as the innermost part of the tracking system will allow precise tracking and detection of secondary vertices. For the readout of the double-sided silicon strip sensors a custom-made ASIC is being developed, employing the Time-over-Threshold (ToT) technique for digitization and utilize time-to-digital converters (TDC) to provide a high-precision time stamp of the hit. A custom-made Module Data Concentrator ASIC (MDC) will multiplex the data of all front-ends of one sensor towards the CERN-developed GBT chip set (GigaBit Transceiver). The MicroTCA-based MVD Multiplexer Board (MMB) at the off-detector site will receive and concentrate the data from the GBT links and transfer it to FPGA-based compute nodes for global event building.

Miniaturized thermocycler based on thermoelectric heating for diagnosis of sexually transmitted disease by DNA amplification

NASA Astrophysics Data System (ADS)

Lim, Hyunjung; Jo, Ga Eun; Kim, Kyong Soo; Back, Seung Min; Choi, Hyuk

2017-05-01

Sexually transmitted disease (STD) is among the most common infectious diseases; therefore, it is necessary to develop sensitive early diagnostic techniques. As the gold standard, polymerase chain reaction (PCR) has been most widely employed for STD diagnosis; however, PCR requires large and expensive instruments. In this study, miniaturized thermal cycler using Peltier modules was developed for the PCR analysis. In comparison with the conventional PCR instrument, the Peltier-based micro-PCR (P-mPCR) device developed in this study enables one to amplify and successfully distinguish between DNA of different sizes. Furthermore, by using the clinical vaginal sample collected with the vaginal swab and tampon, different kinds of STD bacteria could be detected with high accuracy (˜94.19%) and high sensitivity (˜95.6%). Therefore, the P-mPCR device will be applicable in STD diagnosis as well as the detection of other bacteria/viruses using DNA amplification in regions including those with limited resources.

Parallel replica dynamics with a heterogeneous distribution of barriers: Application to n-hexadecane pyrolysis

NASA Astrophysics Data System (ADS)

Kum, Oyeon; Dickson, Brad M.; Stuart, Steven J.; Uberuaga, Blas P.; Voter, Arthur F.

2004-11-01

Parallel replica dynamics simulation methods appropriate for the simulation of chemical reactions in molecular systems with many conformational degrees of freedom have been developed and applied to study the microsecond-scale pyrolysis of n-hexadecane in the temperature range of 2100-2500 K. The algorithm uses a transition detection scheme that is based on molecular topology, rather than energetic basins. This algorithm allows efficient parallelization of small systems even when using more processors than particles (in contrast to more traditional parallelization algorithms), and even when there are frequent conformational transitions (in contrast to previous implementations of the parallel replica algorithm). The parallel efficiency for pyrolysis initiation reactions was over 90% on 61 processors for this 50-atom system. The parallel replica dynamics technique results in reaction probabilities that are statistically indistinguishable from those obtained from direct molecular dynamics, under conditions where both are feasible, but allows simulations at temperatures as much as 1000 K lower than direct molecular dynamics simulations. The rate of initiation displayed Arrhenius behavior over the entire temperature range, with an activation energy and frequency factor of Ea=79.7 kcal/mol and log A/s-1=14.8, respectively, in reasonable agreement with experiment and empirical kinetic models. Several interesting unimolecular reaction mechanisms were observed in simulations of the chain propagation reactions above 2000 K, which are not included in most coarse-grained kinetic models. More studies are needed in order to determine whether these mechanisms are experimentally relevant, or specific to the potential energy surface used.

Prediction of Chain Propagation Rate Constants of Polymerization Reactions in Aqueous NIPAM/BIS and VCL/BIS Systems.

PubMed

Kröger, Leif C; Kopp, Wassja A; Leonhard, Kai

2017-04-06

Microgels have a wide range of possible applications and are therefore studied with increasing interest. Nonetheless, the microgel synthesis process and some of the resulting properties of the microgels, such as the cross-linker distribution within the microgels, are not yet fully understood. An in-depth understanding of the synthesis process is crucial for designing tailored microgels with desired properties. In this work, rate constants and reaction enthalpies of chain propagation reactions in aqueous N-isopropylacrylamide/N,N'-methylenebisacrylamide and aqueous N-vinylcaprolactam/N,N'-methylenebisacrylamide systems are calculated to identify the possible sources of an inhomogeneous cross-linker distribution in the resulting microgels. Gas-phase reaction rate constants are calculated from B2PLYPD3/aug-cc-pVTZ energies and B3LYPD3/tzvp geometries and frequencies. Then, solvation effects based on COSMO-RS are incorporated into the rate constants to obtain the desired liquid-phase reaction rate constants. The rate constants agree with experiments within a factor of 2-10, and the reaction enthalpies deviate less than 5 kJ/mol. Further, the effect of rate constants on the microgel growth process is analyzed, and it is shown that differences in the magnitude of the reaction rate constants are a source of an inhomogeneous cross-linker distribution within the resulting microgel.

Metagenomic investigation of gastrointestinal microbiome in cattle

PubMed Central

Kim, Minseok; Park, Tansol; Yu, Zhongtang

2017-01-01

The gastrointestinal (GI) tract, including the rumen and the other intestinal segments of cattle, harbors a diverse, complex, and dynamic microbiome that drives feed digestion and fermentation in cattle, determining feed efficiency and output of pollutants. This microbiome also plays an important role in affecting host health. Research has been conducted for more than a century to understand the microbiome and its relationship to feed efficiency and host health. The traditional cultivation-based research elucidated some of the major metabolism, but studies using molecular biology techniques conducted from late 1980’s to the late early 2000’s greatly expanded our view of the diversity of the rumen and intestinal microbiome of cattle. Recently, metagenomics has been the primary technology to characterize the GI microbiome and its relationship with host nutrition and health. This review addresses the main methods/techniques in current use, the knowledge gained, and some of the challenges that remain. Most of the primers used in quantitative real-time polymerase chain reaction quantification and diversity analysis using metagenomics of ruminal bacteria, archaea, fungi, and protozoa were also compiled. PMID:28830126

Simplified Microarray Technique for Identifying mRNA in Rare Samples

NASA Technical Reports Server (NTRS)

Almeida, Eduardo; Kadambi, Geeta

2007-01-01

Two simplified methods of identifying messenger ribonucleic acid (mRNA), and compact, low-power apparatuses to implement the methods, are at the proof-of-concept stage of development. These methods are related to traditional methods based on hybridization of nucleic acid, but whereas the traditional methods must be practiced in laboratory settings, these methods could be practiced in field settings. Hybridization of nucleic acid is a powerful technique for detection of specific complementary nucleic acid sequences, and is increasingly being used for detection of changes in gene expression in microarrays containing thousands of gene probes. A traditional microarray study entails at least the following six steps: 1. Purification of cellular RNA, 2. Amplification of complementary deoxyribonucleic acid [cDNA] by polymerase chain reaction (PCR), 3. Labeling of cDNA with fluorophores of Cy3 (a green cyanine dye) and Cy5 (a red cyanine dye), 4. Hybridization to a microarray chip, 5. Fluorescence scanning the array(s) with dual excitation wavelengths, and 6. Analysis of the resulting images. This six-step procedure must be performed in a laboratory because it requires bulky equipment.

Polymerase chain reaction identification of three members of the Anopheles sundaicus (Diptera: Culicidae) complex, malaria vectors in Southeast Asia.

PubMed

Dusfour, Isabelle; Blondeau, Johanna; Harbach, Ralph E; Vythilingham, Indra; Baimai, Visut; Trung, Ho D; Sochanta, Tho; Bangs, Michael J; Manguin, Sylvie

2007-09-01

Anopheles sundaicus s.l., a major malaria vector taxon, occurs primarily along coastal areas and on islands in Southeast Asia. Our previous studies using cytochrome oxidase I, cytochrome-b, and internal transcribed spacer 2 markers discriminated three allopatric species: An. sundaicus s.s. in northern Borneo, An. epiroticus in Southeast Asia, and An. sundaicus E on Sumatra and Java, Indonesia. Morphological comparisons of three developmental stages did not reveal unique diagnostic characters that could reliably distinguish the three species. Therefore, we developed a multiplex polymerase chain reaction (PCR) assay based on two mitochondrial DNA markers to unambiguously identify them. This PCR was tested on 374 specimens from 24 different geographical populations, expanding our knowledge of the distribution of these species.

Exploring the limits of ultrafast polymerase chain reaction using liquid for thermal heat exchange: A proof of principle

NASA Astrophysics Data System (ADS)

Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel

2010-12-01

Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA/RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification.

A SIMPLE MULTIPLEX POLYMERASE CHAIN REACTION ASSAY FOR THE IDENTIFICATION OF FOUR ENVIRONMENTALLY RELEVANT FUNGAL CONTAMINANTS

EPA Science Inventory

Historically, identification of filamentous fungal (mold) species has been based on morphological characteristics, both macroscopic and microscopic. These methods have proven to be time consuming and inaccurate, necessitating the development of identification protocols that are ...

Comparison of EPA Method 1615 RT-qPCR Assays in Standard and Kit Format

EPA Science Inventory

EPA Method 1615 contains protocols for measuring enterovirus and norovirus by reverse transcription quantitative polymerase chain reaction. A commercial kit based upon these protocols was designed and compared to the method's standard approach. Reagent grade, secondary effluent, ...

Differential parasitological, molecular, and serological detection of Trypanosoma cruzi I, II, and IV in blood of experimentally infected mice.

PubMed

Margioto Teston, Ana Paula; Paula de Abreu, Ana; Gruendling, Ana Paula; Bahia, Maria Terezinha; Gomes, Mônica Lúcia; Marques de Araújo, Silvana; Jean de Ornelas Toledo, Max

2016-07-01

Trypanosoma cruzi is the etiological agent of American trypanosomiasis (Chagas' disease), which affects 6-7 million people worldwide, mainly in Latin America. It presents great genetic and biological variability that plays an important role in the clinical and epidemiological features of the disease. Our working hypothesis is that the genetic diversity of T. cruzi has an important impact on detection of the parasite using diagnostic techniques. The present study evaluated the diagnostic performance of parasitological, molecular, and serological techniques for detecting 27 strains of T. cruzi that belonged to discrete typing units (DTUs) TcI (11 strains), TcII (four strains), and TcIV (12 strains) that were obtained from different hosts in the states of Amazonas and Paraná, Brazil. Blood samples were taken from experimentally infected mice and analyzed by fresh blood examination, hemoculture in Liver Infusion Tryptose (LIT) medium, polymerase chain reaction (PCR), and enzyme-linked immunosorbent assay (ELISA). Polymerase chain reaction presented the best detection of TcI, with 80.4% positivity. For all of the detection methods, the animals that were inoculated with TcII presented the highest positivity rates (94.1-100%). ELISA that was performed 7 months after inoculation presented a higher detection ability (95.4%) for TcIV. Intra-DTU comparisons showed that the reproducibility of the majority of the results that were obtained with the different methods was weak for TcI and good for TcII and TcIV. Our data indicate that the detection capability of different techniques varies with the DTUs of the parasites in mammalian blood. The implications of these findings with regard to the diagnosis of human T. cruzi infection are discussed. Copyright © 2016. Published by Elsevier Inc.

Deletion patterns of the STS gene and flanking sequences in Israeli X-linked ichthyosis patients and carriers: analysis by polymerase chain reaction and fluorescence in situ hybridization techniques.

PubMed

Aviram-Goldring, A; Goldman, B; Netanelov-Shapira, I; Chen-Shtoyerman, R; Zvulunov, A; Tal, O; Ilan, T; Peleg, L

2000-03-01

Deletion of the entire steroid sulfatase (STS) gene is the most common molecular defect in X-linked ichthyosis (XLI) patients. Usually, additional flanking sequences are also missing. The aim of this study was to estimate the extent of deletions in an ethnically heterogeneous population of Israeli XLI patients. Multiplex polymerase chain reaction (PCR) and fluorescence in situ hybridization (FISH) techniques were applied in the analysis of blood samples of 24 patients and amniotic cells of seven affected fetuses from 22 unrelated families. In 19 families, a large deletion of the 2-3 megabase was found. It included the whole STS gene and spanned adjacent areas up- and downstream between the loci DXS 1139 and DXS 1132. Two unrelated families of Iraqi ancestry had a partial deletion of the gene and its centromeric adjacent sequence. In another family, the telomeric end of the extragenic segment was only partially missing. Application of FISH on metaphase blood cells and interphase amniotic cells confirmed the diagnosis of XLI in all patients, except the three with partial intragenic deletion. In those cases, the remaining fraction of the gene was sufficient to provide a false negative result. Diagnosis of carriers and prenatal diagnosis in uncultured cells was applicable only by FISH. Our study revealed a remarkable heterogeneity in the deletion pattern among Israeli patients with XLI. This heterogeneity could not be attributed to specific ethnic groups because of the small size of the study group. More studies involving patients of various ancestries should be carried out. In addition, this study demonstrated the usefulness of the FISH technique in the prenatal diagnosis of fetuses with suspected XLI.

Fast automated online xylanase activity assay using HPAEC-PAD.

PubMed

Cürten, Christin; Anders, Nico; Juchem, Niels; Ihling, Nina; Volkenborn, Kristina; Knapp, Andreas; Jaeger, Karl-Erich; Büchs, Jochen; Spiess, Antje C

2018-01-01

In contrast to biochemical reactions, which are often carried out under automatic control and maintained overnight, the automation of chemical analysis is usually neglected. Samples are either analyzed in a rudimentary fashion using in situ techniques, or aliquots are withdrawn and stored to facilitate more precise offline measurements, which can result in sampling and storage errors. Therefore, in this study, we implemented automated reaction control, sampling, and analysis. As an example, the activities of xylanases on xylotetraose and soluble xylan were examined using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD). The reaction was performed in HPLC vials inside a temperature-controlled Dionex™ AS-AP autosampler. It was started automatically when the autosampler pipetted substrate and enzyme solution into the reaction vial. Afterwards, samples from the reaction vial were injected repeatedly for 60 min onto a CarboPac™ PA100 column for analysis. Due to the rapidity of the reaction, the analytical method and the gradient elution of 200 mM sodium hydroxide solution and 100 mM sodium hydroxide with 500 mM sodium acetate were adapted to allow for an overall separation time of 13 min and a detection limit of 0.35-1.83 mg/L (depending on the xylooligomer). This analytical method was applied to measure the soluble short-chain products (xylose, xylobiose, xylotriose, xylotetraose, xylopentaose, and longer xylooligomers) that arise during enzymatic hydrolysis. Based on that, the activities of three endoxylanases (EX) were determined as 294 U/mg for EX from Aspergillus niger, 1.69 U/mg for EX from Bacillus stearothermophilus, and 0.36 U/mg for EX from Bacillus subtilis. Graphical abstract Xylanase activity assay automation.

Modeling competitive substitution in a polyelectrolyte complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peng, B.; Muthukumar, M., E-mail: muthu@polysci.umass.edu

2015-12-28

We have simulated the invasion of a polyelectrolyte complex made of a polycation chain and a polyanion chain, by another longer polyanion chain, using the coarse-grained united atom model for the chains and the Langevin dynamics methodology. Our simulations reveal many intricate details of the substitution reaction in terms of conformational changes of the chains and competition between the invading chain and the chain being displaced for the common complementary chain. We show that the invading chain is required to be sufficiently longer than the chain being displaced for effecting the substitution. Yet, having the invading chain to be longermore » than a certain threshold value does not reduce the substitution time much further. While most of the simulations were carried out in salt-free conditions, we show that presence of salt facilitates the substitution reaction and reduces the substitution time. Analysis of our data shows that the dominant driving force for the substitution process involving polyelectrolytes lies in the release of counterions during the substitution.« less

An Evaluation of Microbial Profile in Halitosis with Tongue Coating Using PCR (Polymerase Chain Reaction)- A Clinical and Microbiological Study

PubMed Central

Kamaraj R., Dinesh; Bhushan, Kala S.; K.L., Vandana

2014-01-01

Background: Medline search using key words halitosis, tongue coating, polymerase chain reaction, microbial profile did not reveal any study. Hence, the purpose of the present investigation was to assess the malodor using the organoleptic method and tanita device; to quantify odoriferous microorganisms using Polymerase Chain Reaction technique in chronic periodontitis patients. Materials and Methods: The study included 30 chronic periodontitis patients. Halitosis was detected using organoleptic assessment & tanita breath alert. Microbial analysis of Pg, Tf & Fn was done using PCR. Plaque index (PI), gingival index (GI), gingival bleeding index (GBI) were recorded. Result: The maximum score of 3 for tongue coating was found in 60% of selected subjects. The tanita breath alert measured VSC level of score 2 in 60% of selected subjects while organoleptic score of 4 was found in 50% of subjects. The maximum mean value of 31.1±36.5 was found to be of F. nucleatum (Fn) followed by P. gingivalis (Pg) (13±13.3) & T. forsythia (Tf) (7.16±8.68) in tongue samples of selected patients. A weak positive correlation was found between VSC levels (tanita score & organoleptic score) and clinical parameters. Conclusion: The halitosis assessment by measuring VSC levels using organoleptic method and tanita breath alert are clinically feasible. Maximum tongue coating was found in 60% of patients. Fn was found comparatively more than the Pg & Tf. A weak positive correlation was found between VSC levels and clinical parameters such as PI, GI & GBI. Thus,the dentist/ periodontist should emphasise on tongue cleaning measures that would reduce the odoriferous microbial load. PMID:24596791

A Degradome-Based Polymerase Chain Reaction to Resolve the Potential of Environmental Samples for 2,4-Dichlorophenol Biodegradation.

PubMed

Ibrahim, Eslam S; Kashef, Mona T; Essam, Tamer M; Ramadan, Mohammed A

2017-12-01

A clean way to overcome environmental pollution is biodegradation. In this perspective, at the intersection of biodegradation and metagenomics, the degradome is defined as the totality of genes related to the biodegradation of a certain compound. It includes the genetic elements from both culturable and uncultured microorganisms. The possibility of assessing the biodegradation potential of an environmental samples, using a degradome-based polymerase chain reaction, was explored. 2,4-Dichlorophenol (2,4-DCP) was chosen as a model and the use of tfdB gene as a biodegradation marker was confirmed by bioinformatics study of TfdB protein. Five primer pairs were designed for the detection of different tfdB gene families. A total of 16 environmental samples were collected from Egyptian agricultural soils and wastewaters and tested for the presence of 2,4-DCP. The biodegradation capacity of 2,4-DCP was determined, for all isolated consortia, to reach up to 350 mg/l. Metagenomic DNA was extracted directly from the soil samples while successive 2,4-DCP-degrading microbial communities were enriched, with increasing concentrations of 2,4-DCP, then their DNA was extracted. The extracted DNA was tested for the distribution of the tfdB gene using a degradome-based polymerase chain reaction. tfdB-1 and tfdB-2 were detected in 5 and 9 samples, respectively. However, the co-existence of both genes was detected only in five samples. All tfdB positive samples were capable of 2,4-DCP degradation. The developed approach of assessing the potential of different environments for degrading 2,4-DCP was successfully measured in terms of accuracy (81.25%) and specificity (100%).

Radically Different Kinetics at Low Temperatures

NASA Astrophysics Data System (ADS)

Sims, Ian

2014-06-01

The use of the CRESU (Cinétique de Réaction en Ecoulement Supersonique Uniforme, or Reaction Kinetics in Uniform Supersonic Flow) technique coupled with pulsed laser photochemical kinetics methods has shown that reactions involving radicals can be very rapid at temperatures down to 10 K or below. The results have had a major impact in astrochemistry and planetology, as well as proving an exacting test for theory. The technique has also been applied to the formation of transient complexes of interest both in atmospheric chemistry and combustion. Until now, all of the chemical reactions studied in this way have taken place on attractive potential energy surfaces with no overall barrier to reaction. The F + H2 {→} HF + H reaction does possess a substantial energetic barrier ({\\cong} 800 K), and might therefore be expected to slow to a negligible rate at very low temperatures. In fact, this H-atom abstraction reaction does take place efficiently at low temperatures due entirely to tunneling. I will report direct experimental measurements of the rate of this reaction down to a temperature of 11 K, in remarkable agreement with state-of-the-art quantum reactive scattering calculations by François Lique (Université du Havre) and Millard Alexander (University of Maryland). It is thought that long chain cyanopolyyne molecules H(C2)nCN may play an important role in the formation of the orange haze layer in Titan's atmosphere. The longest carbon chain molecule observed in interstellar space, HC11N, is also a member of this series. I will present new results, obtained in collaboration with Jean-Claude Guillemin (Ecole de Chimie de Rennes) and Stephen Klippenstein (Argonne National Labs), on reactions of C2H, CN and C3N radicals (using a new LIF scheme by Hoshina and Endo which contribute to the low temperature formation of (cyano)polyynes. H. Sabbah, L. Biennier, I. R. Sims, Y. Georgievskii, S. J. Klippenstein, I. W. M. Smith, Science 317, 102 (2007). S. D. Le Picard, M. Tizniti, A. Canosa, I. R. Sims, I. W. M. Smith, Science 328, 1258 (2010). H. Sabbah, L. Biennier, S. J. Klippenstein, I. R. Sims, B. R. Rowe, J. Phys. Chem. Lett. 1, 2962 (2010). M. Tizniti, S. D. Le Picard, F. Lique, C. Berteloite, A. Canosa, M. H. Alexander, I. R. Sims, Nature Chemistry 6, 141 (2014). S. Cheikh Sid Ely, S. B. Morales, J. C. Guillemin, S. J. Klippenstein, I. R. Sims, J. Phys. Chem. A 117, 12155 (2013). K. Hoshina, Y. Endo, J. Chem. Phys. 127, 184304 (2007).

Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

PubMed

Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

2011-03-14

Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

PubMed

Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

2016-05-01

In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

Detection of distribution of avian influenza H5N1 virus by immunohistochemistry, chromogenic in situ hybridization and real-time PCR techniques in experimentally infected chickens.

PubMed

Chamnanpood, Chanpen; Sanguansermsri, Donruedee; Pongcharoen, Sutatip; Sanguansermsri, Phanchana

2011-03-01

Ten specific pathogen free (SPF) chickens were inoculated intranasally with avian influenza virus subtype H5N1. Evaluation revealed distribution of the virus in twelve organs: liver, intestine, bursa, lung, trachea, thymus, heart, pancreas, brain, spleen, kidney, and esophagus. Immunohistochemistry (IHC), chromogenic in situ hybridization (CISH), and real-time polymerase chain reaction (PCR) were developed and compared for detection of the virus from the organs. The distribution of avian influenza H5N1 in chickens varied by animal and detecting technique. The heart, kidneys, intestines, lungs, and pancreas were positive with all three techniques, while the others varied by techique. The three techniques can be used to detect avian influenza effectively, but the pros and cons of each technique need to be determined. The decision of which technique to use depends on the objective of the examination, budget, type and quality of samples, laboratory facilities and technician skills.

A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

PubMed

Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

2011-06-01

The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

*A FASTER METHOD OF MEASURING RECREATIONAL WATER QUALITY FOR BETTER PROTECTION OF SWIMMER'S HEALTH

EPA Science Inventory

We previously reported that a faster method (< 2 hours) of measuring fecal indicator bacteria (FIB), based on Quantitative Polymerase Chain Reaction (QPCR), was predictive of swimming associated gastrointestinal illness. Using data from two additional beaches, we examined the re...

Alcohol-to-acid ratio and substrate concentration affect product structure in chain elongation reactions initiated by unacclimatized inoculum.

PubMed

Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing

2016-10-01

The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Organic reactions mediated by electrochemically generated ArS+.

PubMed

Matsumoto, Kouichi; Suga, Seiji; Yoshida, Jun-ichi

2011-04-21

Low-temperature electrochemical oxidation of ArSSAr was carried out to generate a pool of "ArS(+)". Spectroscopic studies ((1)H NMR and CSI-MS) of the resulting solution revealed the accumulation of ArS(ArSSAr)(+). The resulting "ArS(+)" pool reacted with alkenes and alkynes to give diarylthio-substituted products. The "ArS(+)" pool rapidly reacted with thioacetals to give the corresponding alkoxycarbenium ion pools, which reacted with various carbon nucleophiles (indirect cation pool method). The reaction of the alkoxycarbenium ion pools with stilbene derivatives in the presence of ArSSAr gave thiochroman derivatives. In addition to such stoichiometric reactions, a catalytic amount of "ArS(+)" serves as an initiator and a chain carrier of some cationic chain reactions involving intramolecular carbon-carbon bond formation. In situ generation of "ArS(+)" by electrochemical oxidation of ArSSAr with a catalytic amount of electricity in the presence of a substrate is also effective for such cationic chain reactions.

Identification of the people from whom engorged Aedes aegypti took blood meals in Florida, Puerto Rico, using polymerase chain reaction-based DNA profiling.

PubMed

De Benedictis, John; Chow-Shaffer, Esther; Costero, Adriana; Clark, Gary G; Edman, John D; Scott, Thomas W

2003-04-01

We used polymerase chain reaction-based DNA profiling to construct allelic profiles for residents and visitors of 22 houses in Florida, Puerto Rico, and human DNA from blood meals in Aedes aegypti that were collected in those homes. Complete profiles were obtained for < or = 2 days after blood ingestion. Eighteen percent of the meals came from two different people. There was no evidence of meals from > or = 2 people. Eighty percent of the meal sources were identified, > 70% were taken from residents of the collection house, and > 90% were from residents of the study community. Across the community, feeding was non-random with a bias towards young adults and males. Three people accounted for 56% of the meals. Our results confirm that multiple feeding on different people is an important component in the role of Ae. aegypti in dengue virus transmission and help explain the spatial distribution of dengue cases in a previous epidemic in Florida, Puerto Rico.

Interobserver variability and feasibility of polymerase chain reaction-based assay in distinguishing ischemic colitis from Clostridium difficile colitis in endoscopic mucosal biopsies.

PubMed

Wiland, Homer O; Procop, Gary W; Goldblum, John R; Tuohy, Marion; Rybicki, Lisa; Patil, Deepa T

2013-06-01

Polymerase chain reaction (PCR)-based assays using stool samples are currently the most effective method of detecting Clostridium difficile. This study examines the feasibility of this assay using mucosal biopsy samples and evaluates the interobserver reproducibility in diagnosing and distinguishing ischemic colitis from C difficile colitis. Thirty-eight biopsy specimens were reviewed and classified by 3 observers into C difficile and ischemic colitis. The findings were correlated with clinical data. PCR was performed on 34 cases using BD GeneOhm C difficile assay. The histologic interobserver agreement was excellent (κ= 0.86) and the agreement between histologic and clinical diagnosis was good (κ = 0.84). All 19 ischemic colitis cases tested negative (100% specificity) and 3 of 15 cases of C difficile colitis tested positive (20% sensitivity). C difficile colitis can be reliably distinguished from ischemic colitis using histologic criteria. The C difficile PCR test on endoscopic biopsy specimens has excellent specificity but limited sensitivity.

Momentum-Based Dynamics for Spacecraft with Chained Revolute Appendages

NASA Technical Reports Server (NTRS)

Queen, Steven; London, Ken; Gonzalez, Marcelo

2005-01-01

An efficient formulation is presented for a sub-class of multi-body dynamics problems that involve a six degree-of-freedom base body and a chain of N rigid linkages connected in series by single degree-of-freedom revolute joints. This general method is particularly well suited for simulations of spacecraft dynamics and control that include the modeling of an orbiting platform with or without internal degrees of freedom such as reaction wheels, dampers, and/or booms. In the present work, particular emphasis is placed on dynamic simulation of multi-linkage robotic manipulators. The differential equations of motion are explicitly given in terms of linear and angular momentum states, which can be evaluated recursively along a serial chain of linkages for an efficient real-time solution on par with the best of the O(N3) methods.

Rapid and effective processing of blood specimens for diagnostic PCR using filter paper and Chelex-100.

PubMed Central

Polski, J M; Kimzey, S; Percival, R W; Grosso, L E

1998-01-01

AIM: To provide a more efficient method for isolating DNA from peripheral blood for use in diagnostic DNA mutation analysis. METHODS: The use of blood impregnated filter paper and Chelex-100 in DNA isolation was evaluated and compared with standard DNA isolation techniques. RESULTS: In polymerase chain reaction (PCR) based assays of five point mutations, identical results were obtained with DNA isolated routinely from peripheral blood and isolated using the filter paper and Chelex-100 method. CONCLUSION: In the clinical setting, this method provides a useful alternative to conventional DNA isolation. It is easily implemented and inexpensive, and provides sufficient, stable DNA for multiple assays. The potential for specimen contamination is reduced because most of the steps are performed in a single microcentrifuge tube. In addition, this method provides for easy storage and transport of samples from the point of acquisition. PMID:9893748

Rapid and effective processing of blood specimens for diagnostic PCR using filter paper and Chelex-100.

PubMed

Polski, J M; Kimzey, S; Percival, R W; Grosso, L E

1998-08-01

To provide a more efficient method for isolating DNA from peripheral blood for use in diagnostic DNA mutation analysis. The use of blood impregnated filter paper and Chelex-100 in DNA isolation was evaluated and compared with standard DNA isolation techniques. In polymerase chain reaction (PCR) based assays of five point mutations, identical results were obtained with DNA isolated routinely from peripheral blood and isolated using the filter paper and Chelex-100 method. In the clinical setting, this method provides a useful alternative to conventional DNA isolation. It is easily implemented and inexpensive, and provides sufficient, stable DNA for multiple assays. The potential for specimen contamination is reduced because most of the steps are performed in a single microcentrifuge tube. In addition, this method provides for easy storage and transport of samples from the point of acquisition.

Economic analysis of ALK testing and crizotinib therapy for advanced non-small-cell lung cancer.

PubMed

Lu, Shun; Zhang, Jie; Ye, Ming; Wang, Baoai; Wu, Bin

2016-06-01

The economic outcome of crizotinib in advanced non-small-cell lung cancer harboring anaplastic lymphoma kinase rearrangement would be investigated. Based on a mathematical model, the economic outcome of three techniques for testing ALK gene rearrangement combing with crizotinib would be evaluated and compared with traditional regimen. The impact of the crizotinib patient assistance program (PAP) was assessed. Ventana immunohistochemistry, quantitative real-time reverse transcription-polymerase chain reaction and IHC testing plus fluorescent in situ hybridization confirmation for anaplastic lymphoma kinase testing following crizotinib treatment leaded to the incremental cost-effectiveness ratios of US$16,820 and US$223,242, US$24,424 and US$223,271, and US$16,850 and US$254,668 per quality-adjusted life-year gained with and without PAP, respectively. Gene-guided crizotinib therapy might be a cost-effective alternative comparing with the traditional regimen in the PAP setting.

Detection of isotype switch rearrangement in bulk culture by PCR.

PubMed

Max, E E; Mills, F C; Chu, C

2001-05-01

When a B lymphocyte changes from synthesizing IgM to synthesizing IgG, IgA, or IgE, this isotype switch is generally accompanied by a unique DNA rearrangement. The protocols in this unit describe two polymerase chain reaction (PCR)-based strategies for detecting switch rearrangements in bulk culture. The first involves direct PCR across the switch junctions, providing the opportunity for characterizing the recombination products by nucleotide sequence analysis; however, because of characteristics inherent to the PCR methodology this strategy cannot easily be used as a quantitative assay for recombination. A support protocol details the preparation of the 5' Su PCR probe for this protocol. The second basic protocol describes a method known as digestion-circularization PCR (DCPCR) that is more amenable to quantitation but yields no information on structure of the recombination products. Both techniques should be capable of detecting reciprocal deletion circles as well as functional recombination products remaining on the expressed chromosome.

Expanding the Nucleotide and Sugar 1-Phosphate Promiscuity of Nucleotidyltransferase RmlA via Directed Evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moretti, Rocco; Chang, Aram; Peltier-Pain, Pauline

2012-03-15

Directed evolution is a valuable technique to improve enzyme activity in the absence of a priori structural knowledge, which can be typically enhanced via structure-guided strategies. In this study, a combination of both whole-gene error-prone polymerase chain reaction and site-saturation mutagenesis enabled the rapid identification of mutations that improved RmlA activity toward non-native substrates. These mutations have been shown to improve activities over 10-fold for several targeted substrates, including non-native pyrimidine- and purine-based NTPs as well as non-native d- and l-sugars (both a- and b-isomers). This study highlights the first broadly applicable high throughput sugar-1-phosphate nucleotidyltransferase screen and the firstmore » proof of concept for the directed evolution of this enzyme class toward the identification of uniquely permissive RmlA variants.« less

Detection of genetically modified organisms (GMOs) using isothermal amplification of target DNA sequences.

PubMed

Lee, David; La Mura, Maurizio; Allnutt, Theo R; Powell, Wayne

2009-02-02

The most common method of GMO detection is based upon the amplification of GMO-specific DNA amplicons using the polymerase chain reaction (PCR). Here we have applied the loop-mediated isothermal amplification (LAMP) method to amplify GMO-related DNA sequences, 'internal' commonly-used motifs for controlling transgene expression and event-specific (plant-transgene) junctions. We have tested the specificity and sensitivity of the technique for use in GMO studies. Results show that detection of 0.01% GMO in equivalent background DNA was possible and dilutions of template suggest that detection from single copies of the template may be possible using LAMP. This work shows that GMO detection can be carried out using LAMP for routine screening as well as for specific events detection. Moreover, the sensitivity and ability to amplify targets, even with a high background of DNA, here demonstrated, highlights the advantages of this isothermal amplification when applied for GMO detection.