High-throughput amplification of mature microRNAs in uncharacterized animal models using polyadenylated RNA and stem-loop reverse transcription polymerase chain reaction.

PubMed

Biggar, Kyle K; Wu, Cheng-Wei; Storey, Kenneth B

2014-10-01

This study makes a significant advancement on a microRNA amplification technique previously used for expression analysis and sequencing in animal models without annotated mature microRNA sequences. As research progresses into the post-genomic era of microRNA prediction and analysis, the need for a rapid and cost-effective method for microRNA amplification is critical to facilitate wide-scale analysis of microRNA expression. To facilitate this requirement, we have reoptimized the design of amplification primers and introduced a polyadenylation step to allow amplification of all mature microRNAs from a single RNA sample. Importantly, this method retains the ability to sequence reverse transcription polymerase chain reaction (RT-PCR) products, validating microRNA-specific amplification. Copyright © 2014 Elsevier Inc. All rights reserved.

Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

USDA-ARS?s Scientific Manuscript database

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

Integrative genomic mining for enzyme function to enable engineering of a non-natural biosynthetic pathway.

PubMed

Mak, Wai Shun; Tran, Stephen; Marcheschi, Ryan; Bertolani, Steve; Thompson, James; Baker, David; Liao, James C; Siegel, Justin B

2015-11-24

The ability to biosynthetically produce chemicals beyond what is commonly found in Nature requires the discovery of novel enzyme function. Here we utilize two approaches to discover enzymes that enable specific production of longer-chain (C5-C8) alcohols from sugar. The first approach combines bioinformatics and molecular modelling to mine sequence databases, resulting in a diverse panel of enzymes capable of catalysing the targeted reaction. The median catalytic efficiency of the computationally selected enzymes is 75-fold greater than a panel of naively selected homologues. This integrative genomic mining approach establishes a unique avenue for enzyme function discovery in the rapidly expanding sequence databases. The second approach uses computational enzyme design to reprogramme specificity. Both approaches result in enzymes with >100-fold increase in specificity for the targeted reaction. When enzymes from either approach are integrated in vivo, longer-chain alcohol production increases over 10-fold and represents >95% of the total alcohol products.

Polymerase chain reaction-hybridization method using urease gene sequences for high-throughput Ureaplasma urealyticum and Ureaplasma parvum detection and differentiation.

PubMed

Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing

2016-04-15

In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.

DNA capture elements for rapid detection and identification of biological agents

NASA Astrophysics Data System (ADS)

Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva

2004-08-01

DNA capture elements (DCEs; aptamers) are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. Reporter molecules were attached to the finished sequences. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. These DCEs have demonstrated specificity and sensitivity equal to or better than antibody.

An improved and validated RNA HLA class I SBT approach for obtaining full length coding sequences.

PubMed

Gerritsen, K E H; Olieslagers, T I; Groeneweg, M; Voorter, C E M; Tilanus, M G J

2014-11-01

The functional relevance of human leukocyte antigen (HLA) class I allele polymorphism beyond exons 2 and 3 is difficult to address because more than 70% of the HLA class I alleles are defined by exons 2 and 3 sequences only. For routine application on clinical samples we improved and validated the HLA sequence-based typing (SBT) approach based on RNA templates, using either a single locus-specific or two overlapping group-specific polymerase chain reaction (PCR) amplifications, with three forward and three reverse sequencing reactions for full length sequencing. Locus-specific HLA typing with RNA SBT of a reference panel, representing the major antigen groups, showed identical results compared to DNA SBT typing. Alleles encountered with unknown exons in the IMGT/HLA database and three samples, two with Null and one with a Low expressed allele, have been addressed by the group-specific RNA SBT approach to obtain full length coding sequences. This RNA SBT approach has proven its value in our routine full length definition of alleles. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Code of Federal Regulations, 2010 CFR

2010-01-01

... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

Code of Federal Regulations, 2011 CFR

2011-01-01

... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

Whole genome sequence analysis of unidentified genetically modified papaya for development of a specific detection method.

PubMed

Nakamura, Kosuke; Kondo, Kazunari; Akiyama, Hiroshi; Ishigaki, Takumi; Noguchi, Akio; Katsumata, Hiroshi; Takasaki, Kazuto; Futo, Satoshi; Sakata, Kozue; Fukuda, Nozomi; Mano, Junichi; Kitta, Kazumi; Tanaka, Hidenori; Akashi, Ryo; Nishimaki-Mogami, Tomoko

2016-08-15

Identification of transgenic sequences in an unknown genetically modified (GM) papaya (Carica papaya L.) by whole genome sequence analysis was demonstrated. Whole genome sequence data were generated for a GM-positive fresh papaya fruit commodity detected in monitoring using real-time polymerase chain reaction (PCR). The sequences obtained were mapped against an open database for papaya genome sequence. Transgenic construct- and event-specific sequences were identified as a GM papaya developed to resist infection from a Papaya ringspot virus. Based on the transgenic sequences, a specific real-time PCR detection method for GM papaya applicable to various food commodities was developed. Whole genome sequence analysis enabled identifying unknown transgenic construct- and event-specific sequences in GM papaya and development of a reliable method for detecting them in papaya food commodities. Copyright © 2016 Elsevier Ltd. All rights reserved.

Use of extremely short Förster resonance energy transfer probes in real-time polymerase chain reaction

PubMed Central

Kutyavin, Igor V.

2013-01-01

Described in the article is a new approach for the sequence-specific detection of nucleic acids in real-time polymerase chain reaction (PCR) using fluorescently labeled oligonucleotide probes. The method is based on the production of PCR amplicons, which fold into dumbbell-like secondary structures carrying a specially designed ‘probe-luring’ sequence at their 5′ ends. Hybridization of this sequence to a complementary ‘anchoring’ tail introduced at the 3′ end of a fluorescent probe enables the probe to bind to its target during PCR, and the subsequent probe cleavage results in the florescence signal. As it has been shown in the study, this amplicon-endorsed and guided formation of the probe-target duplex allows the use of extremely short oligonucleotide probes, up to tetranucleotides in length. In particular, the short length of the fluorescent probes makes possible the development of a ‘universal’ probe inventory that is relatively small in size but represents all possible sequence variations. The unparalleled cost-effectiveness of the inventory approach is discussed. Despite the short length of the probes, this new method, named Angler real-time PCR, remains highly sequence specific, and the results of the study indicate that it can be effectively used for quantitative PCR and the detection of polymorphic variations. PMID:24013564

Pyrosequencing-based validation of a simple cell-suspension polymerase chain reaction assay for Campylobacter with application of high-processivity polymerase and novel internal amplification controls for rapid and specific detection.

PubMed

Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S

2012-02-01

Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications. Published by Elsevier Inc.

Lateral flow nucleic acid biosensor for sensitive detection of microRNAs based on the dual amplification strategy of duplex-specific nuclease and hybridization chain reaction.

PubMed

Ying, Na; Ju, Chuanjing; Sun, Xiuwei; Li, Letian; Chang, Hongbiao; Song, Guangping; Li, Zhongyi; Wan, Jiayu; Dai, Enyong

2017-01-01

MicroRNAs (miRNAs) constitute novel biomarkers for various diseases. Accurate and quantitative analysis of miRNA expression is critical for biomedical research and clinical theranostics. In this study, a method was developed for sensitive and specific detection of miRNAs via dual signal amplification based on duplex specific nuclease (DSN) and hybridization chain reaction (HCR). A reporter probe (RP), comprising recognition sequence (3' end modified with biotin) for a target miRNA of miR-21 and capture sequence (5' end modified with Fam) for HCR product, was designed and synthesized. HCR was initiated by partial sequence of initiator probe (IP), the other part of which can hybridize with capture sequence of RP, and was assembled by hairpin probes modified with biotin (H1-bio and H2-bio). A miR-21 triggered cyclical DSN cleavage of RP, which was immobilized to a streptavidin (SA) coated magnetic bead (MB). The released Fam labeled capture sequence then hybridized with the HCR product to generate a detectable dsDNA. This polymer was then dropped on lateral flow strip and positive result was observed. The proposed method allowed quantitative sequence-specific detection of miR-21 (with a detection limit of 2.1 fM, S/N = 3) in a dynamic range from 100 fM to 100 pM, with an excellent ability to discriminate differences in miRNAs. The method showed acceptable testing recoveries for the determination of miRNAs in serum.

Polymerase chain reaction-based identification of clinically relevant Pasteurellaceae isolated from cats and dogs in Poland.

PubMed

Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw

2011-05-01

A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)

Optimization of the performance of the polymerase chain reaction in silicon-based microstructures.

PubMed Central

Taylor, T B; Winn-Deen, E S; Picozza, E; Woudenberg, T M; Albin, M

1997-01-01

We have demonstrated the ability to perform real-time homogeneous, sequence specific detection of PCR products in silicon microstructures. Optimal design/ processing result in equivalent performance (yield and specificity) for high surface-to-volume silicon structures as compared to larger volume reactions in polypropylene tubes. Amplifications in volumes as small as 0.5 microl and thermal cycling times reduced as much as 5-fold from that of conventional systems have been demonstrated for the microstructures. PMID:9224619

Differentiation of closely related but biologically distinct cherry isolates of Prunus necrotic ringspot virus by polymerase chain reaction.

PubMed

Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I

1999-07-01

Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.

Basic quantitative polymerase chain reaction using real-time fluorescence measurements.

PubMed

Ares, Manuel

2014-10-01

This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.

Allele-Specific Polymerase Chain Reaction for the Imatinib-Resistant KIT D816V and D816F Mutations in Mastocytosis and Acute Myelogenous Leukemia

PubMed Central

Corless, Christopher L.; Harrell, Patina; Lacouture, Mario; Bainbridge, Troy; Le, Claudia; Gatter, Ken; White, Clifton; Granter, Scott; Heinrich, Michael C.

2006-01-01

Oncogenic mutations of the receptor tyrosine kinase KIT contribute to the pathogenesis of gastrointestinal stromal tumors, systemic mastocytosis (SM), and some cases of acute myelogenous leukemia (AML). The D816V substitution in the activation loop of KIT results in relative resistance to the kinase inhibitor imatinib (Gleevec). Because this mutation occurs in 80 to 95% of adult SM, its detection has diagnostic and predictive significance. Unfortunately, the fraction of mutation-positive cells in clinical SM samples is often below the 20 to 30% threshold needed for detection by direct DNA sequencing. We have developed an allele-specific polymerase chain reaction assay using a mutation-specific primer combined with a wild-type blocking oligonucleotide that amplifies D816V at the level of 1% mutant allele in DNA extracted from formalin-fixed, paraffin-embedded tissue. There were no amplifications among 64 KIT wild-type tumors and cell lines, whereas all D816V-mutant samples (eight AML and 11 mast cell disease) were positive. Other D816 substitutions associated with resistance to imatinib in vitro are rare in SM. Among these D816F was detectable with the assay whereas D816H, D816Y, and D816G did not amplify. Nine biopsies (bone marrow, skin, or colon) with suspected SM were negative by denaturing high performance liquid chromatography and/or DNA sequencing but positive by allele-specific polymerase chain reaction. Thus, the assay may be useful in confirming the diagnosis of SM. PMID:17065430

Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

PubMed

Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

2003-12-15

Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

Unknown sequence amplification: Application to in vitro genome walking in Chlamydia trachomatis L2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Copley, C.G.; Boot, C.; Bundell, K.

1991-01-01

A recently described technique, Chemical Genetics' unknown sequence amplification method, which requires only one specific oligonucleotide, has broadened the applicability of the polymerase chain reaction to DNA of unknown sequence. The authors have adapted this technique to the study of the genome of Chlamydia trachomatis, an obligate intracellular bacterium, and describe modifications that significantly improve the utility of this approach. These techniques allow for rapid genomic analysis entirely in vitro, using DNA of limited quantity of purity.

Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

PubMed

Navarro, B; Daròs, J A; Flores, R

1998-07-01

A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

The actin multigene family and livestock speciation using the polymerase chain reaction.

PubMed

Fairbrother, K S; Hopwood, A J; Lockley, A K; Bardsley, R G

1998-01-01

Actins constitute a family of highly-conserved multifunctional intracellular proteins, best known as myofibrillar components in striated muscle fibres. Most vertebrate genomes contain numerous actin genes with high sequence homology in protein coding regions but considerable variability in intron number and sizes. This genetic diversity can be utilised for livestock speciation purposes. The high sequence conservation has enabled a single pair of oligonucleotides to be used to prime the polymerase chain reaction (PCR) with DNA extracted from all animals so far studied. Multiple amplification products were obtained which on gel electrophoresis constituted characteristic species-specific 'fingerprints'. The patterns were reproducible, did not vary between individuals of the same breed or between different breeds within a species, and could be generated even from heat-processed muscle held at 120 degrees C for one hour. Given the capacity of PCR to amplify relatively short sequences in highly-degraded DNA, this approach may be suitable for authentication of processed meat products.

A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.

PubMed

Kemp, S J; Maillard, J C; Teale, A J

1993-04-01

A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.

COLD-PCR Technologies in the Area of Personalized Medicine: Methodology and Applications.

PubMed

Mauger, Florence; How-Kit, Alexandre; Tost, Jörg

2017-06-01

Somatic mutations bear great promise for use as biomarkers for personalized medicine, but are often present only in low abundance in biological material and are therefore difficult to detect. Many assays for mutation analysis in cancer-related genes (hotspots) have been developed to improve diagnosis, prognosis, prediction of drug resistance, and monitoring of the response to treatment. Two major approaches have been developed: mutation-specific amplification methods and methods that enrich and detect mutations without prior knowledge on the exact location and identity of the mutation. CO-amplification at Lower Denaturation temperature Polymerase Chain Reaction (COLD-PCR) methods such as full-, fast-, ice- (improved and complete enrichment), enhanced-ice, and temperature-tolerant COLD-PCR make use of a critical temperature in the polymerase chain reaction to selectively denature wild-type-mutant heteroduplexes, allowing the enrichment of rare mutations. Mutations can subsequently be identified using a variety of laboratory technologies such as high-resolution melting, digital polymerase chain reaction, pyrosequencing, Sanger sequencing, or next-generation sequencing. COLD-PCR methods are sensitive, specific, and accurate if appropriately optimized and have a short time to results. A large variety of clinical samples (tumor DNA, circulating cell-free DNA, circulating cell-free fetal DNA, and circulating tumor cells) have been studied using COLD-PCR in many different applications including the detection of genetic changes in cancer and infectious diseases, non-invasive prenatal diagnosis, detection of microorganisms, or DNA methylation analysis. In this review, we describe in detail the different COLD-PCR approaches, highlighting their specificities, advantages, and inconveniences and demonstrating their use in different fields of biological and biomedical research.

Biochemical Characterization of α‐Fetoprotein and Other Serum Proteins Produced by a Uterine Endometrial Adenocarcinoma

PubMed Central

Taketa, Kazuhisa; Azuma, Masaki; Yamamoto, Ritsu; Fujimoto, Seiichiro; Nishi, Shinzo

1996-01-01

A high serum α‐fetoprotein (AFP) level was found in a patient with endometrial adenocarcinoma of the uterus, which appeared to be hepatoid on histological examination. The AFP of this unusual patient was purified hy immunoaffinity chromatography and characterized. The electrophoretic profiles on sodium dodecyl sulfate‐polyacrylamide gel electrophoresis both before and after glycopeptidase F treatment were indistinguishable from those of a hepatoma AFP. This indicates that the patient's AFP was also composed of a single polypeptide chain of Mr 67,000 and an N‐linked sugar chain of Mr 3,000. Amino acid sequence analyses of this AFP, and of AFP from hepatoma and umbilical cord serum indicated that the N‐terminal sequences were essentially the same. The sequence, Arg‐Thr‐Leu‐His‐Arg‐Asn‐Glu‐Tyr‐Gly‐Ile, was slightly different from previous reports, but matched that deduced from the cDNA sequence. AFP isoforms due to microheterogeneity of the sugar chain were analyzed by lectin affinity electrophoresis using a series of lectins. The AFP isoform profiles were distinct from those of proteins derived from cord serum, hepatoma, yolk sac tumor and gastric cancer. The reverse‐transcription of RNA from the tumor tissue followed by a polymerase chain reaction using primers with AFP‐specific sequences gave a product of the size and nucleotide sequence expected for AFP. mRNAs possessing the requisite sequences for albumin and transferrin syntheses were also detected in the tumor. The expression of these hepatocyte‐specific proteins supported the hepatoid nature of this tumor. PMID:8766525

Integrating DNA strand displacement circuitry to the nonlinear hybridization chain reaction.

PubMed

Zhang, Zhuo; Fan, Tsz Wing; Hsing, I-Ming

2017-02-23

Programmable and modular attributes of DNA molecules allow one to develop versatile sensing platforms that can be operated isothermally and enzyme-free. In this work, we present an approach to integrate upstream DNA strand displacement circuits that can be turned on by a sequence-specific microRNA analyte with a downstream nonlinear hybridization chain reaction for a cascading hyperbranched nucleic acid assembly. This system provides a two-step amplification strategy for highly sensitive detection of the miRNA analyte, conducive for multiplexed detection. Multiple miRNA analytes were tested with our integrated circuitry using the same downstream signal amplification setting, showing the decoupling of nonlinear self-assembly with the analyte sequence. Compared with the reported methods, our signal amplification approach provides an additional control module for higher-order DNA self-assembly and could be developed into a promising platform for the detection of critical nucleic-acid based biomarkers.

Design of a glutamine substrate tag enabling protein labelling mediated by Bacillus subtilis transglutaminase.

PubMed

Oteng-Pabi, Samuel K; Clouthier, Christopher M; Keillor, Jeffrey W

2018-01-01

Transglutaminases (TGases) are enzymes that catalyse protein cross-linking through a transamidation reaction between the side chain of a glutamine residue on one protein and the side chain of a lysine residue on another. Generally, TGases show low substrate specificity with respect to their amine substrate, such that a wide variety of primary amines can participate in the modification of specific glutamine residue. Although a number of different TGases have been used to mediate these bioconjugation reactions, the TGase from Bacillus subtilis (bTG) may be particularly suited to this application. It is smaller than most TGases, can be expressed in a soluble active form, and lacks the calcium dependence of its mammalian counterparts. However, little is known regarding this enzyme and its glutamine substrate specificity, limiting the scope of its application. In this work, we designed a FRET-based ligation assay to monitor the bTG-mediated conjugation of the fluorescent proteins Clover and mRuby2. This assay allowed us to screen a library of random heptapeptide glutamine sequences for their reactivity with recombinant bTG in bacterial cells, using fluorescence assisted cell sorting. From this library, several reactive sequences were identified and kinetically characterized, with the most reactive sequence (YAHQAHY) having a kcat/KM value of 19 ± 3 μM-1 min-1. This sequence was then genetically appended onto a test protein as a reactive 'Q-tag' and fluorescently labelled with dansyl-cadaverine, in the first demonstration of protein labelling mediated by bTG.

Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

USGS Publications Warehouse

Taylor, P.W.; Winton, J.R.

2002-01-01

Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

Characterization of Satellite DNA Sequences from the Commercially Important Marine Rotifers Brachionus rotundiformis and Brachionus plicatilis.

PubMed

Boehm; Gibson; Lubzens

2000-01-01

This study was initiated to search for species-specific and strain-specific satellite DNA sequences for which oligonucleotide primers could be designed to differentiate between various commercially important strains of the marine monogonont rotifers Brachionus rotundiformis and Brachionus plicatilis. Two unrelated, highly reiterated satellite sequences were cloned and characterized. The eight sequenced monomers from B. rotundiformis and six from B. plicatilis had low intrarepeat variability and were similar in their overall lengths, A + T compositions, and high degrees of repeated motif substructure. However, hybridizations to 19 representative strains, sequence characterizations, and GenBank searches indicated that these two satellites are morphotype-specific and population-specific, respectively, and share little homology to each other or to other characterized sequences in the database. Primer pairs designed for the B. rotundiformis satellite confirmed hybridization specificities on polymerase chain reaction and could serve as a useful molecular diagnostic tool to identify strains belonging to the SS morphotype, which are gaining widespread usage as first feeds for marine fish in commercial production.

The Power of Real-Time PCR

ERIC Educational Resources Information Center

Valasek, Mark A.; Repa, Joyce J.

2005-01-01

In recent years, real-time polymerase chain reaction (PCR) has emerged as a robust and widely used methodology for biological investigation because it can detect and quantify very small amounts of specific nucleic acid sequences. As a research tool, a major application of this technology is the rapid and accurate assessment of changes in gene…

Detection of potentially cariogenic strains of Streptococcus mutans using the polymerase chain reaction.

PubMed

Aguilera Galaviz, Luis Alejandro; Aceves Medina, Ma del Carmen; Estrada García, Iris C

2002-01-01

Streptococcus mutans is a pathogen related to the occurrence of human dental caries. The determination of total amounts of mutans streptococci, as well as the proportion related to other oral bacteria, is of interest when assessing the risk of developing caries. In this context, it is better to use a sensitive, specific and non-time consuming method such as the polymerase chain reaction (PCR), than to use culture and biochemical identification methods. In this work we identified potentially cariogenic strains of S. mutans and assessed the relationship with the dmft, DMFT or dmft/DMFT index. Using DNA isolated from dental plaque, a 192 bp sequence was identified and amplified from the spaP gene and a 722 bp sequence from the dexA gene. The results suggest that it is important to evaluate the presence of cariogenic S. mutans strains in plaque content rather than the accumulation of plaque itself However, other factors like diet, hygiene, genetic background, the flow rate of saliva and the presence of specific antibodies, also play a key role in the development of caries.

Evaluation of a Campylobacter fetus subspecies venerealis real-time quantitative polymerase chain reaction for direct analysis of bovine preputial samples

PubMed Central

Chaban, Bonnie; Chu, Shirley; Hendrick, Steven; Waldner, Cheryl; Hill, Janet E.

2012-01-01

The detection and subspeciation of Campylobacter fetus subsp. venerealis (CFV) from veterinary samples is important for both clinical and economic reasons. Campylobacter fetus subsp. venerealis is the causative agent of bovine genital campylobacteriosis, a venereal disease that can lead to serious reproductive problems in cattle, and strict international regulations require animals and animal products to be CFV-free for trade. This study evaluated methods reported in the literature for CFV detection and reports the translation of an extensively tested CFV-specific polymerase chain reaction (PCR) primer set; including the VenSF/VenSR primers and a real-time, quantitative PCR (qPCR) platform using SYBR Green chemistry. Three methods of preputial sample preparation for direct qPCR were evaluated and a heat lysis DNA extraction method was shown to allow for CFV detection at the level of approximately one cell equivalent per reaction (or 1.0 × 103 CFU/mL) from prepuce. The optimized sample preparation and qPCR protocols were then used to evaluate 3 western Canadian bull cohorts, which included 377 bulls, for CFV. The qPCR assay detected 11 positive bulls for the CFV-specific parA gene target. DNA sequence data confirmed the identity of the amplified product and revealed that positive samples were comprised of 2 sequence types; one identical to previously reported CFV parA gene sequences and one with a 9% sequence divergence. These results add valuable information towards our understanding of an important CFV subspeciation target and offer a significantly improved format for an internationally recognized PCR test. PMID:23277694

Artificial mismatch hybridization

DOEpatents

Guo, Zhen; Smith, Lloyd M.

1998-01-01

An improved nucleic acid hybridization process is provided which employs a modified oligonucleotide and improves the ability to discriminate a control nucleic acid target from a variant nucleic acid target containing a sequence variation. The modified probe contains at least one artificial mismatch relative to the control nucleic acid target in addition to any mismatch(es) arising from the sequence variation. The invention has direct and advantageous application to numerous existing hybridization methods, including, applications that employ, for example, the Polymerase Chain Reaction, allele-specific nucleic acid sequencing methods, and diagnostic hybridization methods.

Nested methylation-specific polymerase chain reaction cancer detection method

DOEpatents

Belinsky, Steven A [Albuquerque, NM; Palmisano, William A [Edgewood, NM

2007-05-08

A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

Novel high-speed droplet-allele specific-polymerase chain reaction: application in the rapid genotyping of single nucleotide polymorphisms.

PubMed

Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki

2013-09-23

Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.

Identification of verotoxin type 2 variant B subunit genes in Escherichia coli by the polymerase chain reaction and restriction fragment length polymorphism analysis.

PubMed Central

Tyler, S D; Johnson, W M; Lior, H; Wang, G; Rozee, K R

1991-01-01

A set of synthetic oligonucleotide primers was designed for use in a polymerase chain reaction protocol to specifically detect the B subunit genes in vtx2ha and vtx2hb, which code for the production of the VT2 (Shiga-like toxin II) variant cytotoxins VT2v-a and VT2v-b, respectively. An additional set of primers amplified a fragment common to the B subunits of the VT2 and the VT2 variant genes. Subsequent restriction endonuclease digestion of this amplicon permitted prediction of specific VT2 and variant genotypes on the basis of predetermined restriction fragment length polymorphisms. Genotypes of 21 VT2-producing strains of Escherichia coli were determined using this polymerase chain reaction-restriction fragment length polymorphism procedure. Four strains contained B subunit target sequences only for VT2 genes, 9 strains contained sequences only for VT2v-a genes, and 3 strains contained sequences only for VT2v-b. For genes in combination, one strain contained B subunit genes for both VT2 and VT2v-a and two strains contained B subunit genes for VT2 and VT2v-b. Two strains of E. coli O91:H21 contained both VT2v-a and VT2v-b B subunit genes. The VT2 reference strain of E. coli, E32511, was found to contain the targeted sequences from both VT2 and VT2v-a genes, whereas the recombinant E. coli, pEB1, possessed only that of the VT2 gene. The specific activities of extracellular VT2 determined in HeLa cells ranged from 0.3 to 41.7 TCD50 per microgram of protein in strains carrying the VT2 gene target and from 0 to 50.0 TCD50 per microgram of protein in strains carrying only the VT2 variant target (TCD50 is the tissue culture dose by which 50% of the cells were affected), suggesting that phenotypic expression does not correlate with genotype. Images PMID:1679436

Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

PubMed

Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2014-01-01

The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

Identification of the forest strain of Onchocerca volvulus using the polymerase chain reaction technique.

PubMed

Adewale, B; Mafe, M A; Oyerinde, J P O

2005-01-01

Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.

Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

NASA Astrophysics Data System (ADS)

Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

1989-04-01

The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

Ubiquiter circovirus sequences raise challenges in laboratory diagnosis: the case of honey bee and bee mite, reptiles, and free living amoebae.

PubMed

Marton, Szilvia; Ihász, Katalin; Lengyel, György; Farkas, Szilvia L; Dán, Ádám; Paulus, Petra; Bányai, Krisztián; Fehér, Enikő

2015-03-01

Circoviruses of pigs and birds are established pathogens, however, the exact role of other, recently described circoviruses and circovirus-like viruses remains to be elucidated. The aim of this study was the detection of circoviruses in neglected host species, including honey bees, exotic reptiles and free-living amoebae by widely used broad-spectrum polymerase chain reaction (PCR) assays specific for the replication initiation protein coding gene of these viruses. The majority of sequences obtained from honey bees were highly similar to canine and porcine circoviruses, or, were distantly related to dragonfly cycloviruses. Other rep sequences detected in some honey bees, reptiles and amoebae showed similarities to various rep sequences deposited in the GenBank. Back-to-back PCR primers designed for the amplification of whole viral genomes failed to work that suggested the existence of integrated rep-like elements in many samples. Rolling circle amplification and exonuclease treatment confirmed the absence of small circular DNA genomes in the specimens analysed. In case of honey bees Varroa mite DNA contamination might be a source of the identified endogenous rep-like elements. The reptile and amoebae rep-like sequences were nearly identical with each other and with sequences detected in chimpanzee feces raising the possibility that detection of novel or unusual rep-like elements in some host species might originate from the microbial community of the host. Our results indicate that attention is needed when broad-spectrum rep gene specific polymerase chain reaction is chosen for laboratory diagnosis of circovirus infections.

Novel Mutations in pncA Gene of Pyrazinamide Resistant Clinical Isolates of Mycobacterium tuberculosis.

PubMed

Kahbazi, Manijeh; Sarmadian, Hossein; Ahmadi, Azam; Didgar, Farshideh; Sadrnia, Maryam; Poolad, Toktam; Arjomandzadegan, Mohammad

2018-04-16

In clinical isolates of Mycobacterium tuberculosis (MTB), resistance to pyrazinamide occurs by mutations in any positions of the pncA gene (NC_000962.3) especially in nucleotides 359 and 374. In this study we examined the pncA gene sequence in clinical isolates of MTB. Genomic DNA of 33 clinical isolates of MTB was extracted by the Chelex100 method. The polymerase chain reactions (PCR) were performed using specific primers for amplification of 744 bp amplicon comprising the coding sequences (CDS) of the pncA gene. PCR products were sequenced by an automated sequencing Bioscience system. Additionally, semi Nested-allele specific (sNASP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods were carried out for verification of probable mutations in nucleotides 359 and 374. Sequencing results showed that from 33 MTB clinical isolates, nine pyrazinamide-resistant isolates have mutations. Furthermore, no mutation was detected in 24 susceptible strains in the entire 561 bp of the pncA gene. Moreover, new mutations of G→A at position 3 of the pncA gene were identified in some of the resistant isolates. Results showed that the sNASP method could detect mutations in nucleotide 359 and 374 of the pncA gene, but the PCR-RFLP method by the SacII enzyme could not detect these mutations. In conclusion, the identification of new mutations in the pncA gene confirmed the probable occurrence of mutations in any nucleotides of the pncA gene sequence in resistant isolates of MTB.

Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

PubMed

Ririe, K M; Rasmussen, R P; Wittwer, C T

1997-02-15

A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

Theory and applications of the polymerase chain reaction.

PubMed

Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A

1990-04-01

The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.

Problem-Solving Test: Pyrosequencing

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2013-01-01

Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…

[The detection and sequence analysis of the simian T-lymphotrophic retrovirus (STLV-1 Papio) by using the polymerase chain reaction].

PubMed

D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I

1993-01-01

The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.

Next-generation sequencing library preparation method for identification of RNA viruses on the Ion Torrent Sequencing Platform.

PubMed

Chen, Guiqian; Qiu, Yuan; Zhuang, Qingye; Wang, Suchun; Wang, Tong; Chen, Jiming; Wang, Kaicheng

2018-05-09

Next generation sequencing (NGS) is a powerful tool for the characterization, discovery, and molecular identification of RNA viruses. There were multiple NGS library preparation methods published for strand-specific RNA-seq, but some methods are not suitable for identifying and characterizing RNA viruses. In this study, we report a NGS library preparation method to identify RNA viruses using the Ion Torrent PGM platform. The NGS sequencing adapters were directly inserted into the sequencing library through reverse transcription and polymerase chain reaction, without fragmentation and ligation of nucleic acids. The results show that this method is simple to perform, able to identify multiple species of RNA viruses in clinical samples.

Detection of the reemerging agent Burkholderia mallei in a recent outbreak of glanders in the United Arab Emirates by a newly developed fliP-based polymerase chain reaction assay.

PubMed

Scholz, Holger C; Joseph, Marina; Tomaso, Herbert; Al Dahouk, Sascha; Witte, Angela; Kinne, Joerg; Hagen, Ralph M; Wernery, Renate; Wernery, Ulrich; Neubauer, Heinrich

2006-04-01

A polymerase chain reaction (PCR) assay targeting the flagellin P (fliP)-I S407A genomic region of Burkholderia mallei was developed for the specific detection of this organism in pure cultures and clinical samples from a recent outbreak of equine glanders. Primers deduced from the known fliP-IS407A sequence of B. mallei American Type Culture Collection (ATCC) 23344(T) allowed the specific amplification of a 989-bp fragment from each of the 20 B. mallei strains investigated, whereas other closely related organisms tested negative. The detection limit of the assay was 10 fg for purified DNA of B. mallei ATCC 23344(T). B. mallei DNA was also amplified from various tissues of horses with a generalized B. mallei infection. The developed PCR assay can be used as a simple and rapid tool for the specific and sensitive detection of B. mallei in clinical samples.

Development of a peptide nucleic acid polymerase chain reaction clamping assay for semiquantitative evaluation of genetically modified organism content in food.

PubMed

Peano, C; Lesignoli, F; Gulli, M; Corradini, R; Samson, M C; Marchelli, R; Marmiroli, N

2005-09-15

In the present study a peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping method was developed and applied to the detection of genetically modified organisms (GMO), to test PCR products for band identity and to obtain a semiquantitative evaluation of GMO content. The minimal concentration of PNA necessary to block the PCR was determined by comparing PCRs containing a constant amount of DNA in the presence of increasing concentration of target-specific PNA. The lowest PNA concentration at which specific inhibition took place, by the inhibition of primer extension and/or steric hindrance, was the most efficient condition. Optimization of PCR clamping by PNA was observed by testing five different PNAs with a minimum of 13 bp to a maximum of 15 bp, designed on the target sequence of Roundup Ready soybean. The results obtained on the DNA extracted from Roundup Ready soybean standard flour were verified also on DNA extracted from standard flours of maize GA21, Bt176, Bt11, and MON810. A correlation between the PNA concentration necessary for inducing PCR clamping and the percentage of the GMO target sequence in the sample was found.

Phi-value analysis of a linear, sequential reaction mechanism: theory and application to ion channel gating.

PubMed

Zhou, Yu; Pearson, John E; Auerbach, Anthony

2005-12-01

We derive the analytical form of a rate-equilibrium free-energy relationship (with slope Phi) for a bounded, linear chain of coupled reactions having arbitrary connecting rate constants. The results confirm previous simulation studies showing that Phi-values reflect the position of the perturbed reaction within the chain, with reactions occurring earlier in the sequence producing higher Phi-values than those occurring later in the sequence. The derivation includes an expression for the transmission coefficients of the overall reaction based on the rate constants of an arbitrary, discrete, finite Markov chain. The results indicate that experimental Phi-values can be used to calculate the relative heights of the energy barriers between intermediate states of the chain but provide no information about the energies of the wells along the reaction path. Application of the equations to the case of diliganded acetylcholine receptor channel gating suggests that the transition-state ensemble for this reaction is nearly flat. Although this mechanism accounts for many of the basic features of diliganded and unliganded acetylcholine receptor channel gating, the experimental rate-equilibrium free-energy relationships appear to be more linear than those predicted by the theory.

Label-free technology for the amplified detection of microRNA based on the allosteric hairpin DNA switch and hybridization chain reaction.

PubMed

Cai, Sheng; Cao, Zhijuan; Lau, Choiwan; Lu, Jianzhong

2014-11-21

By using the allosteric hairpin DNA switch, a novel assay for the detection of microRNA (miRNA) let-7a via a hybridization chain reaction (HCR) was introduced. Briefly, the hairpin DNA switch probe is a single-stranded DNA consisting of a streptavidin (SA) aptamer sequence, a target binding sequence and a certain sequence that acts as a trigger of the HCR. In the presence of target let-7a, the hairpin DNA switch would open and expose the stem region sequences, where a part of this sequence acts as initiator sequence strands for the HCR and triggers a cascade of hybridization events that yields nicked double helices analogous to alternating copolymers, another part is the SA aptamer sequence which activates its binding affinity to SA on SA-coated magnetic particles. The hybridization event could be sensitively detected via an instantaneous derivatization reaction between a special chemiluminescence (CL) reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG) and the guanine nucleotides within the target, the hairpin DNA switch probe, and HCR helices to form an unstable CL intermediate for the generation of light. Our results show that the coupling of the hairpin DNA switch probe and the HCR for the amplified detection of let-7a achieves a better performance (e.g. wide linear response range: 0.1-1000 fmol, low detection limit: 0.1 fmol, and high specificity). Furthermore, this approach could be easily applied to the detection of let-7a in human lung cells, and extended to detect other types of miRNA and proteins such as PDGF based on aptamers. We believe such advancements will represent a significant step towards improved diagnostics and more personalized medical treatment.

Probing Protein Structure by Amino Acid-Specific Covalent Labeling and Mass Spectrometry

PubMed Central

Mendoza, Vanessa Leah; Vachet, Richard W.

2009-01-01

For many years, amino acid-specific covalent labeling has been a valuable tool to study protein structure and protein interactions, especially for systems that are difficult to study by other means. These covalent labeling methods typically map protein structure and interactions by measuring the differential reactivity of amino acid side chains. The reactivity of amino acids in proteins generally depends on the accessibility of the side chain to the reagent, the inherent reactivity of the label and the reactivity of the amino acid side chain. Peptide mass mapping with ESI- or MALDI-MS and peptide sequencing with tandem MS are typically employed to identify modification sites to provide site-specific structural information. In this review, we describe the reagents that are most commonly used in these residue-specific modification reactions, details about the proper use of these covalent labeling reagents, and information about the specific biochemical problems that have been addressed with covalent labeling strategies. PMID:19016300

Electrochemical detection of sequence-specific DNA based on formation of G-quadruplex-hemin through continuous hybridization chain reaction.

PubMed

Sun, Xiaofan; Chen, Haohan; Wang, Shuling; Zhang, Yiping; Tian, Yaping; Zhou, Nandi

2018-08-27

A high-sensitive detection of sequence-specific DNA was established based on the formation of G-quadruplex-hemin complex through continuous hybridization chain reaction (HCR). Taking HIV DNA sequence as an example, a capture probe complementary to part of HIV DNA was firstly self-assembled onto the surface of Au electrode. Then a specially designed assistant probe with both terminals complementary to the target DNA and a G-quadruplex-forming sequence in the center was introduced into the detection solution. In the presence of both the target DNA and the assistant probe, the target DNA can be captured on the electrode surface and then a continuous HCR can be conducted due to the mutual recognition of the target DNA and the assistant probe, leading to the formation of a large number of G-quadruplex on the electrode surface. With the help of hemin, a pronounced electrochemical signal can be observed in differential pulse voltammetry (DPV), due to the formation of G-quadruplex-hemin complex. The peak current is linearly related with the logarithm of the concentration of the target DNA in the range from 10 fM to 10 pM. The electrochemical sensor has high selectivity to clearly discriminate single-base mismatched and three-base mismatched sequences from the original HIV DNA sequence. Moreover, the established DNA sensor was challenged by detection of HIV DNA in human serum samples, which showed the low detection limit of 6.3 fM. Thus it has great application prospect in the field of clinical diagnosis and environmental monitoring. Copyright © 2018 Elsevier B.V. All rights reserved.

A Motif in the Clathrin Heavy Chain Required for the Hsc70/Auxilin Uncoating Reaction

PubMed Central

Rapoport, Iris; Boll, Werner; Yu, Anan; Böcking, Till

2008-01-01

The 70-kDa heat-shock cognate protein (Hsc70) chaperone is an ATP-dependent “disassembly enzyme” for many subcellular structures, including clathrin-coated vesicles where it functions as an uncoating ATPase. Hsc70, and its cochaperone auxilin together catalyze coat disassembly. Like other members of the Hsp70 chaperone family, it is thought that ATP-bound Hsc70 recognizes the clathrin triskelion through an unfolded exposed hydrophobic segment. The best candidate is the unstructured C terminus (residues 1631–1675) of the heavy chain at the foot of the tripod below the hub, containing the sequence motif QLMLT, closely related to the sequence bound preferentially by the substrate groove of Hsc70 (Fotin et al., 2004b). To test this hypothesis, we generated in insect cells recombinant mammalian triskelions that in vitro form clathrin cages and clathrin/AP-2 coats exactly like those assembled from native clathrin. We show that coats assembled from recombinant clathrin are good substrates for ATP- and auxilin-dependent, Hsc70-catalyzed uncoating. Finally, we show that this uncoating reaction proceeds normally when the coats contain recombinant heavy chains truncated C-terminal to the QLMLT motif, but very inefficiently when the motif is absent. Thus, the QLMLT motif is required for Hsc-70–facilitated uncoating, consistent with the proposal that this sequence is a specific target of the chaperone. PMID:17978091

Removal of inhibitor(s) of the polymerase chain reaction from formalin fixed, paraffin wax embedded tissues.

PubMed

An, S F; Fleming, K A

1991-11-01

A problem associated with use of the polymerase chain reaction to amplify specific DNA fragments from formalin fixed, paraffin wax embedded tissues is the not infrequent failure of amplification. One possible reason for this could be the presence of inhibitor(s), which interfere with the activity of the reaction. It has been shown that such inhibitor(s) exist when amplifying the human beta globin gene (which exists in human genomic DNA as a single copy gene) from routine clinical samples. A variety of methods to remove such inhibitor(s) were investigated. The results indicate that inhibitor(s) are removed by proteinase K digestion, followed by purification with phenol/chloroform, and centrifugation through a Centricon-30 membrane (30,000 molecular weight cut off). Other factors, including the length and concentration of the DNA sequence to be amplified, can also affect amplification.

Polymerase chain displacement reaction.

PubMed

Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

2013-02-01

Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.

[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].

PubMed

Harano, K; Harano, T; Kushida, Y; Ueda, S

1991-08-01

Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.

Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

DTIC Science & Technology

1990-01-30

bisphosphate carboxylase We designed from published sequence information oligonucleotide primers which are complementary to conserved regions on RubisCO ...large and small subunit genes. These primers were used successfully to amplify using polymerase chain reaction (PCR) specific regions of RubisCO ...for the large subunit of ribulose bisphosphate carboxylase/oxygenase ( RubisCO ) to symbiont DNA shows that the symbionts from both deep-sea and shallow

Detection of a Bacteriophage Gene Encoding a Mu-like Portal Protein in Haemophilus parasuis Reference Strains and Field Isolates by Nested Polymerase Chain Reaction

USDA-ARS?s Scientific Manuscript database

A nested PCR assay was developed to determine the presence of a gene encoding a bacteriophage Mu-like portal protein, gp29, in 15 reference strains and 31 field isolates of Haemophilus parasuis. Specific primers, based on the gene’s sequence, were utilized. A majority of the virulent reference strai...

Polymerase chain reaction amplification as a diagnostic tool in culture-negative multiple-valve endocarditis.

PubMed

Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten

2005-03-01

We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.

Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flores, J.; Sears, J.; Schael, I.P.

1990-08-01

We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated frommore » field studies.« less

Design and analysis of linear cascade DNA hybridization chain reactions using DNA hairpins

NASA Astrophysics Data System (ADS)

Bui, Hieu; Garg, Sudhanshu; Miao, Vincent; Song, Tianqi; Mokhtar, Reem; Reif, John

2017-01-01

DNA self-assembly has been employed non-conventionally to construct nanoscale structures and dynamic nanoscale machines. The technique of hybridization chain reactions by triggered self-assembly has been shown to form various interesting nanoscale structures ranging from simple linear DNA oligomers to dendritic DNA structures. Inspired by earlier triggered self-assembly works, we present a system for controlled self-assembly of linear cascade DNA hybridization chain reactions using nine distinct DNA hairpins. NUPACK is employed to assist in designing DNA sequences and Matlab has been used to simulate DNA hairpin interactions. Gel electrophoresis and ensemble fluorescence reaction kinetics data indicate strong evidence of linear cascade DNA hybridization chain reactions. The half-time completion of the proposed linear cascade reactions indicates a linear dependency on the number of hairpins.

Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

PubMed

Hussey, Richard S; Huang, Guozhong; Allen, Rex

2011-01-01

Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

Polymerase chain reaction (PCR) amplification of a nucleoprotein gene sequence of infectious hematopoietic necrosis virus

USGS Publications Warehouse

Arakawa, C.K.; Deering, R.E.; Higman, K.H.; Oshima, K.H.; O'Hara, P.J.; Winton, J.R.

1990-01-01

The polymerase chain reaction [PCR) was used to amplify a portion of the nucleoprotein [NI gene of infectious hematopoietic necrosis virus (IHNV). Using a published sequence for the Round Butte isolate of IHNV, a pair of PCR pnmers was synthesized that spanned a 252 nucleotide region of the N gene from residue 319 to residue 570 of the open reading frame. This region included a 30 nucleotide target sequence for a synthetic oligonucleotide probe developed for detection of IHNV N gene messenger RNA. After 25 cycles of amplification of either messenger or genomic RNA, the PCR product (DNA) of the expected size was easily visible on agarose gels stained with ethidium bromide. The specificity of the amplified DNA was confirmed by Southern and dot-blot analysis using the biotinylated oligonucleotide probe. The PCR was able to amplify the N gene sequence of purified genomic RNA from isolates of IHNV representing 5 different electropherotypes. Using the IHNV primer set, no PCR product was obtained from viral hemorrhagic septicemia virus RNA, but 2 higher molecular weight products were synthesized from hirame rhabdovirus RNA that did not hybridize with the biotinylated probe. The PCR could be efficiently performed with all IHNV genomic RNA template concentrations tested (1 ng to 1 pg). The lowest level of sensitivity was not determined. The PCR was used to amplify RNA extracted from infected cell cultures and selected tissues of Infected rainbow trout. The combination of PCR and nucleic acid probe promises to provide a detection method for IHNV that is rapid, h~ghly specific, and sensitive.

Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.

PubMed

Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2013-05-01

In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.

[Identification of Panax ginseng, P. notoginseng and P. quinquefolius admixture by multiplex allele-specific polymerase chain reaction].

PubMed

Jiang, Chao; Luo, Yu-Qing; Yuan, Yuan; Huang, Lu-Qi; Jin, Yan; Zhao, Yu-Yang

2017-04-01

To achieve a molecular method to identify Panax ginseng, P. notoginseng,P. quinquefolius and their admixture. The ITS,18S and matK sequences of Panax genus were analyzed to develop species-specific SNP marker. Three pairs of species-specific primers were designed to establish a multiplex allele-specific polymerase chain reaction (MAS-PCR) and the samples from different region were tested. The results showed that when the annealing temperature was 60 ℃ and the cycle number was 35, approximately 250, 500,1 000 bp specific band were obtained from P. ginseng, P. notoginseng and P. quinquefolius obtain, respectively. This method could also be used to authentificate admixture samples and could detect 0.5% percent of P. notoginseng or P. quinquefolius adulterated in P. ginseng, or 0.5% percent of P. ginseng or P. quinquefolius adulterated in P. notoginseng. The detect limit of P. ginseng in P. quinquefolius was 0.5% and P. notoginseng in P. quinquefolius was 1%. This results showed that the present method could be used as a promise method to identify Panax ginseng, P. notoginseng, P. quinquefolius and their admixture. Copyright© by the Chinese Pharmaceutical Association.

Multiplexed enrichment of rare DNA variants via sequence-selective and temperature-robust amplification

PubMed Central

Wu, Lucia R.; Chen, Sherry X.; Wu, Yalei; Patel, Abhijit A.; Zhang, David Yu

2018-01-01

Rare DNA-sequence variants hold important clinical and biological information, but existing detection techniques are expensive, complex, allele-specific, or don’t allow for significant multiplexing. Here, we report a temperature-robust polymerase-chain-reaction method, which we term blocker displacement amplification (BDA), that selectively amplifies all sequence variants, including single-nucleotide variants (SNVs), within a roughly 20-nucleotide window by 1,000-fold over wild-type sequences. This allows for easy detection and quantitation of hundreds of potential variants originally at ≤0.1% in allele frequency. BDA is compatible with inexpensive thermocycler instrumentation and employs a rationally designed competitive hybridization reaction to achieve comparable enrichment performance across annealing temperatures ranging from 56 °C to 64 °C. To show the sequence generality of BDA, we demonstrate enrichment of 156 SNVs and the reliable detection of single-digit copies. We also show that the BDA detection of rare driver mutations in cell-free DNA samples extracted from the blood plasma of lung-cancer patients is highly consistent with deep sequencing using molecular lineage tags, with a receiver operator characteristic accuracy of 95%. PMID:29805844

Identification of duck plague virus by polymerase chain reaction.

PubMed

Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L

1999-01-01

A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague.

A real-time TaqMan polymerase chain reaction for the identification of Culex vectors of West Nile and Saint Louis encephalitis viruses in North America.

PubMed

Sanogo, Yibayiri O; Kim, Chang-Hyun; Lampman, Richard; Novak, Robert J

2007-07-01

In North America, West Nile and St. Louis encephalitis viruses have been detected in a wide range of vector species, but the majority of isolations continue to be from pools of mixed mosquitoes in the Culex subgenus Culex. Unfortunately, the morphologic identification of these important disease vectors is often difficult, particularly in regions of sympatry. We developed a sensitive real-time TaqMan polymerase chain reaction assay that allows reliable identification of Culex mosquitoes including Culex pipiens pipiens, Cx. p. quinquefasciatus, Cx. restuans, Cx. salinarius, Cx. nigripalpus, and Cx. tarsalis. Primers and fluorogenic probes specific to each species were designed based on sequences of the acetylcholinesterase gene (Ace2). Both immature and adult mosquitoes were successfully identified as individuals and as mixed species pools. This identification technique provides the basis for a rapid, sensitive, and high-throughput method for expounding the species-specific contribution of vectors to various phases of arbovirus transmission.

Cloning, expression, and characterization of a novel (S)-specific alcohol dehydrogenase from Lactobacillus kefir.

PubMed

Chen, Qilei; Hu, Youjia; Zhao, Wenjie; Zhu, Chunbao; Zhu, Baoquan

2010-01-01

A gene encoding a novel (S)-specific NADH-dependent alcohol dehydrogenase (LK-ADH) was isolated from the genomic DNA of Lactobacillus kefir DSM 20587 by thermal asymmetric interlaced-polymerase chain reaction. The nucleotide sequence of (S)-LK-ADH gene (adhS) was determined, which consists of an open reading frame of 1,044 bp, coding for 347 amino acids with a molecular mass of 37.065 kDa. After a BLAST similarity search in GenBank database, the amino acid sequence of (S)-LK-ADH showed some homologies to several zinc containing medium-chain alcohol dehydrogenases. This novel gene was deposited into GenBank with the accession number of EU877965. adhS gene was subcloned into plasmid pET-28a(+), and recombinant (S)-LK-ADH was successfully expressed in E. coli BL21(DE3) by isopropyl-beta-D-1-thiogalactopyranoside induction. Purified enzyme showed a high enantioselectivity in the reduction of acetophenone to (S)-phenylethanol with an ee value of 99.4%. The substrate specificity and cofactor preference of recombinant (S)-LK-ADH were also tested.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Phylogenetic position of parabasalid symbionts from the termite Calotermes flavicollis based on small subunit rRNA sequences.

PubMed

Gerbod, D; Edgcomb, V P; Noël, C; Delgado-Viscogliosi, P; Viscogliosi, E

2000-09-01

Small subunit rDNA genes were amplified by polymerase chain reaction using specific primers from mixed-population DNA obtained from the whole hindgut of the termite Calotermes flavicollis. Comparative sequence analysis of the clones revealed two kinds of sequences that were both from parabasalid symbionts. In a molecular tree inferred by distance, parsimony and likelihood methods, and including 27 parabasalid sequences retrieved from the data bases, the sequences of the group II (clones Cf5 and Cf6) were closely related to the Devescovinidae/Calonymphidae species and thus were assigned to the Devescovinidae Foaina. The sequence of the group I (clone Cf1) emerged within the Trichomonadinae and strongly clustered with Tetratrichomonas gallinarum. On the basis of morphological data, the Monocercomonadidae Hexamastix termitis might be the most likely origin of this sequence.

Rapid detection of Mannheimia haemolytica in lung tissues of sheep and from bacterial culture.

PubMed

Kumar, Jyoti; Dixit, Shivendra Kumar; Kumar, Rajiv

2015-09-01

This study was aimed to detect Mannheimia haemolytica in lung tissues of sheep and from a bacterial culture. M. haemolytica is one of the most important and well-established etiological agents of pneumonia in sheep and other ruminants throughout the world. Accurate diagnosis of M. haemolytica primarily relies on bacteriological examination, biochemical characteristics and, biotyping and serotyping of the isolates. In an effort to facilitate rapid M. haemolytica detection, polymerase chain reaction assay targeting Pasteurella haemolytica serotype-1 specific antigens (PHSSA), Rpt2 and 12S ribosomal RNA (rRNA) genes were used to detect M. haemolytica directly from lung tissues and from bacterial culture. A total of 12 archived lung tissues from sheep that died of pneumonia on an organized farm were used. A multiplex polymerase chain reaction (mPCR) based on two-amplicons targeted PHSSA and Rpt2 genes of M. haemolytica were used for identification of M. haemolytica isolates in culture from the lung samples. All the 12 lung tissue samples were tested for the presence M. haemolytica by PHSSA and Rpt2 genes based PCR and its confirmation by sequencing of the amplicons. All the 12 lung tissue samples tested for the presence of PHSSA and Rpt2 genes of M. haemolytica by mPCR were found to be positive. Amplification of 12S rRNA gene fragment as internal amplification control was obtained with each mPCR reaction performed from DNA extracted directly from lung tissue samples. All the M. haemolytica were also positive for mPCR. No amplified DNA bands were observed for negative control reactions. All the three nucleotide sequences were deposited in NCBI GenBank (Accession No. KJ534629, KJ534630 and KJ534631). Sequencing of the amplified products revealed the identity of 99-100%, with published sequence of PHSSA and Rpt2 genes of M. haemolytica available in the NCBI database. Sheep specific mitochondrial 12S rRNA gene sequence also revealed the identity of 98% with published sequences in the NCBI database. The present study emphasized the PCR as a valuable tool for rapid detection of M. haemolytica in clinical samples from animals. In addition, it offers the opportunity to perform large-scale epidemiological studies regarding the role of M. haemolytica in clinical cases of pneumonia and other disease manifestations in sheep and other ruminants, thereby providing the basis for effective preventive strategies.

Enrichment of individual KIR2DL4 sequences from genomic DNA using long-template PCR and allele-specific hybridization to magnetic bead-bound oligonucleotide probes.

PubMed

Roberts, C H; Turino, C; Madrigal, J A; Marsh, S G E

2007-06-01

DNA enrichment by allele-specific hybridization (DEASH) was used as a means to isolate individual alleles of the killer cell immunoglobulin-like receptor (KIR2DL4) gene from heterozygous genomic DNA. Using long-template polymerase chain reaction (LT-PCR), the complete KIR2DL4 gene was amplified from a cell line that had previously been characterized for its KIR gene content by PCR using sequence-specific primers (PCR-SSP). The whole gene amplicons were sequenced and we identified two heterozygous positions in accordance with the predictions of the PCR-SSP. The amplicons were then hybridized to allele-specific, biotinylated oligonucleotide probes and through binding to streptavidin-coated beads, the targeted alleles were enriched. A second PCR amplified only the exonic regions of the enriched allele, and these were then sequenced in full. We show DEASH to be capable of enriching single alleles from a heterozygous PCR product, and through sequencing the enriched DNA, we are able to produce complete coding sequences of the KIR2DL4 alleles in accordance with the typing predicted by PCR-SSP.

Development and validation of a novel hydrolysis probe real-time polymerase chain reaction for agamid adenovirus 1 in the central bearded dragon (Pogona vitticeps).

PubMed

Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X

2015-03-01

Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. © 2015 The Author(s).

Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

PubMed

Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

2008-12-01

One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

A survey of the sequence-specific interaction of damaging agents with DNA: emphasis on antitumor agents.

PubMed

Murray, V

1999-01-01

This article reviews the literature concerning the sequence specificity of DNA-damaging agents. DNA-damaging agents are widely used in cancer chemotherapy. It is important to understand fully the determinants of DNA sequence specificity so that more effective DNA-damaging agents can be developed as antitumor drugs. There are five main methods of DNA sequence specificity analysis: cleavage of end-labeled fragments, linear amplification with Taq DNA polymerase, ligation-mediated polymerase chain reaction (PCR), single-strand ligation PCR, and footprinting. The DNA sequence specificity in purified DNA and in intact mammalian cells is reviewed for several classes of DNA-damaging agent. These include agents that form covalent adducts with DNA, free radical generators, topoisomerase inhibitors, intercalators and minor groove binders, enzymes, and electromagnetic radiation. The main sites of adduct formation are at the N-7 of guanine in the major groove of DNA and the N-3 of adenine in the minor groove, whereas free radical generators abstract hydrogen from the deoxyribose sugar and topoisomerase inhibitors cause enzyme-DNA cross-links to form. Several issues involved in the determination of the DNA sequence specificity are discussed. The future directions of the field, with respect to cancer chemotherapy, are also examined.

Diastereoselective chain-elongation reactions using microreactors for applications in complex molecule assembly.

PubMed

Carter, Catherine F; Lange, Heiko; Sakai, Daiki; Baxendale, Ian R; Ley, Steven V

2011-03-14

Diastereoselective chain-elongation reactions are important transformations for the assembly of complex molecular structures, such as those present in polyketide natural products. Here we report new methods for performing crotylation reactions and homopropargylation reactions by using newly developed low-temperature flow-chemistry technology. In-line purification protocols are described, as well as the application of the crotylation protocol in an automated multi-step sequence. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

AlignMiner: a Web-based tool for detection of divergent regions in multiple sequence alignments of conserved sequences

PubMed Central

2010-01-01

Background Multiple sequence alignments are used to study gene or protein function, phylogenetic relations, genome evolution hypotheses and even gene polymorphisms. Virtually without exception, all available tools focus on conserved segments or residues. Small divergent regions, however, are biologically important for specific quantitative polymerase chain reaction, genotyping, molecular markers and preparation of specific antibodies, and yet have received little attention. As a consequence, they must be selected empirically by the researcher. AlignMiner has been developed to fill this gap in bioinformatic analyses. Results AlignMiner is a Web-based application for detection of conserved and divergent regions in alignments of conserved sequences, focusing particularly on divergence. It accepts alignments (protein or nucleic acid) obtained using any of a variety of algorithms, which does not appear to have a significant impact on the final results. AlignMiner uses different scoring methods for assessing conserved/divergent regions, Entropy being the method that provides the highest number of regions with the greatest length, and Weighted being the most restrictive. Conserved/divergent regions can be generated either with respect to the consensus sequence or to one master sequence. The resulting data are presented in a graphical interface developed in AJAX, which provides remarkable user interaction capabilities. Users do not need to wait until execution is complete and can.even inspect their results on a different computer. Data can be downloaded onto a user disk, in standard formats. In silico and experimental proof-of-concept cases have shown that AlignMiner can be successfully used to designing specific polymerase chain reaction primers as well as potential epitopes for antibodies. Primer design is assisted by a module that deploys several oligonucleotide parameters for designing primers "on the fly". Conclusions AlignMiner can be used to reliably detect divergent regions via several scoring methods that provide different levels of selectivity. Its predictions have been verified by experimental means. Hence, it is expected that its usage will save researchers' time and ensure an objective selection of the best-possible divergent region when closely related sequences are analysed. AlignMiner is freely available at http://www.scbi.uma.es/alignminer. PMID:20525162

Hammondia heydorni oocysts in the faeces of a greyhound in New Zealand.

PubMed

Ellis, J T; Pomroy, W E

2003-02-01

To identify oocysts found in faecal material of a greyhound. Polymerase chain reaction (PCR) and DNA sequencing were used to study genomic DNA isolated from oocysts purified from faeces of a greyhound. Database searches with the DNA sequences obtained showed they were derived from Hammondia heydorni. A species-specific PCR was developed to detect H. heydorni DNA. Light microscopy in conjunction with PCR and DNA sequencing definitively identified the presence of H. heydorni oocysts in faeces of a greyhound. This study confirms the presence of H. heydorni in New Zealand and indicates the need to correctly identify similar oocysts from dogs, rather than assume they are Neospora caninum.

Vertebral Osteomyelitis Caused by Helicobacter cinaedi Identified Using Broad-range Polymerase Chain Reaction with Sequencing of the Biopsied Specimen.

PubMed

Hase, Ryota; Hirooka, Takuya; Itabashi, Takashi; Endo, Yasunobu; Otsuka, Yoshihito

2018-05-15

A 65-year-old man presented with gradually exacerbating low back pain. Magnetic resonance imaging revealed vertebral osteomyelitis in the Th11-L2 vertebral bodies and discs. The patient showed negative findings on conventional cultures. Direct broad-range polymerase chain reaction (PCR) with sequencing of the biopsied specimen had the highest similarity to the 16S rRNA gene of Helicobacter cinaedi. This case suggests that direct broad-range PCR with sequencing should be considered when conventional cultures cannot identify the causative organism of vertebral osteomyelitis, and that this method may be particularly useful when the pathogen is a fastidious organism, such as H. cinaedi.

Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

PubMed Central

Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

2015-01-01

This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

Salt Effect Accelerates Site-Selective Cysteine Bioconjugation

PubMed Central

2016-01-01

Highly efficient and selective chemical reactions are desired. For small molecule chemistry, the reaction rate can be varied by changing the concentration, temperature, and solvent used. In contrast for large biomolecules, the reaction rate is difficult to modify by adjusting these variables because stringent biocompatible reaction conditions are required. Here we show that adding salts can change the rate constant over 4 orders of magnitude for an arylation bioconjugation reaction between a cysteine residue within a four-residue sequence (π-clamp) and a perfluoroaryl electrophile. Biocompatible ammonium sulfate significantly enhances the reaction rate without influencing the site-specificity of π-clamp mediated arylation, enabling the fast synthesis of two site-specific antibody–drug conjugates that selectively kill HER2-positive breast cancer cells. Computational and structure–reactivity studies indicate that salts may tune the reaction rate through modulating the interactions between the π-clamp hydrophobic side chains and the electrophile. On the basis of this understanding, the salt effect is extended to other bioconjugation chemistry, and a new regioselective alkylation reaction at π-clamp cysteine is developed. PMID:27725962

A simple nucleic acid hybridization/latex agglutination assay for the rapid detection of polymerase chain reaction amplicons.

PubMed

Vollenhofer-Schrumpf, Sabine; Buresch, Ronald; Schinkinger, Manfred

2007-03-01

We have developed a new method for the detection of nucleic acid hybridization, based on a simple latex agglutination test that can be evaluated by the unaided eye. Nucleic acid, e.g., a polymerase chain reaction (PCR) product, is denatured and incubated with polystyrene beads carrying covalently bound complementary oligonucleotide sequences. Hybridization of the nucleic acids leads to aggregation of the latex particles, thereby verifying the presence of target sequence. The test is performed at room temperature, and results are available within 10 min. As a proof of principle, the hybridization/latex agglutination assay was applied to the detection of purified PCR fragments either specific for Salmonella spp. or a synthetic sequence, and to the detection of Salmonella enterica in artificially contaminated chicken samples. A few nanograms of purified PCR fragments were detectable. In artificially contaminated chicken samples, 3 colony-forming units (cfu)/25 g were detected in one of three replicates, and 30 cfu/25 g were detected in both of two replicates when samples for PCR were taken directly from primary enrichment, demonstrating the practical applicability of this test system. Even multiplex detection might be achievable. This novel kind of assay could be useful for a range of applications where hybridization of nucleic acids, e.g., PCR fragments, is to be detected.

Construction of a Lotus japonicus late nodulin expressed sequence tag library and identification of novel nodule-specific genes.

PubMed Central

Szczyglowski, K; Hamburger, D; Kapranov, P; de Bruijn, F J

1997-01-01

A range of novel expressed sequence tags (ESTs) associated with late developmental events during nodule organogenesis in the legume Lotus japonicus were identified using mRNA differential display; 110 differentially displayed polymerase chain reaction products were cloned and analyzed. Of 88 unique cDNAs obtained, 22 shared significant homology to DNA/protein sequences in the respective databases. This group comprises, among others, a nodule-specific homolog of protein phosphatase 2C, a peptide transporter protein, and a nodule-specific form of cytochrome P450. RNA gel-blot analysis of 16 differentially displayed ESTs confirmed their nodule-specific expression pattern. The kinetics of mRNA accumulation of the majority of the ESTs analyzed were found to resemble the expression pattern observed for the L. japonicus leghemoglobin gene. These results indicate that the newly isolated molecular markers correspond to genes induced during late developmental stages of L. japonicus nodule organogenesis and provide important, novel tools for the study of nodulation. PMID:9276951

Application of Faecalibacterium 16S rDNA genetic marker for accurate identification of duck faeces.

PubMed

Sun, Da; Duan, Chuanren; Shang, Yaning; Ma, Yunxia; Tan, Lili; Zhai, Jun; Gao, Xu; Guo, Jingsong; Wang, Guixue

2016-04-01

The aim of this study was to judge the legal duty of pollution liabilities by assessing a duck faeces-specific marker, which can exclude distractions of residual bacteria from earlier contamination accidents. With the gene sequencing technology and bioinformatics method, we completed the comparative analysis of Faecalibacterium sequences, which were associated with ducks and other animal species, and found the sequences unique to duck faeces. Polymerase chain reaction (PCR) and agarose gel electrophoresis techniques were used to verify the reliability of both human and duck faeces-specific primers. The duck faeces-specific primers generated an amplicon of 141 bp from 43.3 % of duck faecal samples, 0 % of control samples and 100 % of sewage wastewater samples that contained duck faeces. We present here the initial evidence of Faecalibacterium-based applicability as human faeces-specificity in China. Meanwhile, this study represents the initial report of a Faecalibacterium marker for duck faeces and suggests an independent or supplementary environmental biotechnology of microbial source tracking (MST).

Identifying of meat species using polymerase chain reaction (PCR)

NASA Astrophysics Data System (ADS)

Foong, Chow Ming; Sani, Norrakiah Abdullah

2013-11-01

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

Development of an Escherichia coli K12-specific quantitative polymerase chain reaction assay and DNA isolation suited to biofilms associated with iron drinking water pipe corrosion products.

PubMed

Lu, Jingrang; Gerke, Tammie L; Buse, Helen Y; Ashbolt, Nicholas J

2014-12-01

A quantitative polymerase chain reaction assay (115 bp amplicon) specific to Escherichia coli K12 with an ABI(TM) internal control was developed based on sequence data encoding the rfb gene cluster. Assay specificity was evaluated using three E. coli K12 strains (ATCC W3110, MG1655 & DH1), 24 non-K12 E. coli and 23 bacterial genera. The biofilm detection limit was 10(3) colony-forming units (CFU) E. coli K12 mL(-1), but required a modified protocol, which included a bio-blocker Pseudomonas aeruginosa with ethylenediaminetetraacetic acid buffered to pH 5 prior to cell lysis/DNA extraction. The novel protocol yielded the same sensitivity for drinking water biofilms associated with Fe3O4 (magnetite)-coated SiO2 (quartz) grains and biofilm-surface iron corrosion products from a drinking water distribution system. The novel DNA extraction protocol and specific E. coli K12 assay are sensitive and robust enough for detection and quantification within iron drinking water pipe biofilms, and are particularly well suited for studying enteric bacterial interactions within biofilms.

Fingerprinting and quantification of GMOs in the agro-food sector.

PubMed

Taverniers, I; Van Bockstaele, E; De Loose, M

2003-01-01

Most strategies for analyzing GMOs in plants and derived food and feed products, are based on the polymerase chain reaction (PCR) technique. In conventional PCR methods, a 'known' sequence between two specific primers is amplified. To the contrary, with the 'anchor PCR' technique, unknown sequences adjacent to a known sequence, can be amplified. Because T-DNA/plant border sequences are being amplified, anchor PCR is the perfect tool for unique identification of transgenes, including non-authorized GMOs. In this work, anchor PCR was applied to characterize the 'transgene locus' and to clarify the complete molecular structure of at least six different commercial transgenic plants. Based on sequences of T-DNA/plant border junctions, obtained by anchor PCR, event specific primers were developed. The junction fragments, together with endogeneous reference gene targets, were cloned in plasmids. The latter were then used as event specific calibrators in real-time PCR, a new technique for the accurate relative quantification of GMOs. We demonstrate here the importance of anchor PCR for identification and the usefulness of plasmid DNA calibrators in quantification strategies for GMOs, throughout the agro-food sector.

Zepto-molar electrochemical detection of Brucella genome based on gold nanoribbons covered by gold nanoblooms

NASA Astrophysics Data System (ADS)

Rahi, Amid; Sattarahmady, Naghmeh; Heli, Hossein

2015-12-01

Gold nanoribbons covered by gold nanoblooms were sonoelectrodeposited on a polycrystalline gold surface at -1800 mV (vs. AgCl) with the assistance of ultrasound and co-occurrence of the hydrogen evolution reaction. The nanostructure, as a transducer, was utilized to immobilize a Brucella-specific probe and fabrication of a genosensor, and the process of immobilization and hybridization was detected by electrochemical methods, using methylene blue as a redox marker. The proposed method for detection of the complementary sequence, sequences with base-mismatched (one-, two- and three-base mismatches), and the sequence of non-complementary sequence was assayed. The fabricated genosensor was evaluated for the assay of the bacteria in the cultured and human samples without polymerase chain reactions (PCR). The genosensor could detect the complementary sequence with a calibration sensitivity of 0.40 μA dm3 mol-1, a linear concentration range of 10 zmol dm-3 to 10 pmol dm-3, and a detection limit of 1.71 zmol dm-3.

Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

PubMed

Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

2014-12-10

A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.

Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

PubMed

McMeel, O M; Hoey, E M; Ferguson, A

2001-01-01

The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

In situ amplified electrochemical aptasensing for sensitive detection of adenosine triphosphate by coupling target-induced hybridization chain reaction with the assembly of silver nanotags.

PubMed

Zhou, Qian; Lin, Youxiu; Lin, Yuping; Wei, Qiaohua; Chen, Guonan; Tang, Dianping

2016-01-01

Biomolecular immobilization and construction of the sensing platform are usually crucial for the successful development of a high-efficiency detection system. Herein we report on a novel and label-free signal-amplified aptasensing for sensitive electrochemical detection of small molecules (adenosine triphosphate, ATP, used in this case) by coupling with target-induced hybridization chain reaction (HCR) and the assembly of electroactive silver nanotags. The system mainly consisted of two alternating hairpin probes, a partial-pairing trigger-aptamer duplex DNA and a capture probe immobilized on the electrode. Upon target ATP introduction, the analyte attacked the aptamer and released the trigger DNA, which was captured by capture DNA immobilized on the electrode to form a newly partial-pairing double-stranded DNA. Thereafter, the exposed domain at trigger DNA could be utilized as the initator strand to open the hairpin probes in sequence, and propagated a chain reaction of hybridization events between two alternating hairpins to form a long nicked double-helix. The electrochemical signal derived from the assembled silver nanotags on the nicked double-helix. Under optimal conditions, the electrochemical aptasensor could exhibit a high sensitivity and a low detection limit, and allowed the detection of ATP at a concentration as low as 0.03 pM. Our design showed a high selectivity for target ATP against its analogs because of the high-specificity ATP-aptamer reaction, and its applicable for monitoring ATP in the spiking serum samples. Improtantly, the distinct advantages of the developed aptasensor make it hold a great potential for the development of simple and robust sensing strategies for the detection of other small molecules by controlling the apatmer sequence. Copyright © 2015 Elsevier B.V. All rights reserved.

Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

PubMed

Wu, Z; Nagano, I; Xu, D; Takahashi, Y

1997-03-01

Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

ERIC Educational Resources Information Center

Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

2006-01-01

We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

Elimination of endogenous aberrant kappa chain transcripts from sp2/0-derived hybridoma cells by specific ribozyme cleavage: utility in genetic therapy of HIV-1 infections.

PubMed Central

Duan, L; Pomerantz, R J

1994-01-01

The pooled degenerate-primer polymerase chain reaction (PCR) technology is now widely used in the amplification and cloning of murine hybridoma-specific immunoglobulin gene cDNAs. The design of primers is mainly based on the highly conserved 5' terminus of immunoglobulin gene variable regions and the constant region in the 3' terminus. Of note, most murine hybridoma cell lines are derived from the Sp2/0 cell line, which is demonstrated to express endogenous aberrant kappa chains (abV kappa). This high-level endogenous abV kappa mixes with specific kappa chains in the hybridomas and interferes with the efficiency of the reverse transcriptase (RT)-PCR cloning strategy. In this report, during the cloning of murine anti-human immunodeficiency virus type I (HIV-1) hybridoma immunoglobulin cDNAs, a specific primer-PCR screening system was developed, based on the abV kappa complementarity-defining region (CDR), to eliminate abV kappa-carrying plasmids. Furthermore, an abV kappa sequence-specific derived ribozyme was developed and packaged in a retroviral expression vector system. This abV kappa ribozyme can be transduced into different murine hybridomas, and expressed intracellularly to potently eliminate endogenous abV kappa RNA. Images PMID:7816635

Phylogeny of Alternaria fungi known to produce host-specific toxins on the basis of variation in internal transcribed spacers of ribosomal DNA.

PubMed

Kusaba, M; Tsuge, T

1995-10-01

The internal transcribed spacer regions (ITS1 and ITS2) of ribosomal DNA from Alternaria species, including seven fungi known to produce host-specific toxins, were analyzed by polymerase chain reaction-amplification and direct sequencing. Phylogenetic analysis of the sequence data by the Neighbor-joining method showed that the seven toxin-producing fungi belong to a monophyletic group together with A. alternata. In contract, A. dianthi, A. panax, A. dauci, A. bataticola, A. porri, A. sesami and A. solani, species that can be morphologically distinguished from A. alternata, could be clearly separated from A. alternata by phylogenetic of the ITS variation. These results suggest that Alternaria pathogens which produce host-specific toxins are pathogenic variants within a single variable species, A. alternata.

Detection of genetically modified organisms (GMOs) using isothermal amplification of target DNA sequences.

PubMed

Lee, David; La Mura, Maurizio; Allnutt, Theo R; Powell, Wayne

2009-02-02

The most common method of GMO detection is based upon the amplification of GMO-specific DNA amplicons using the polymerase chain reaction (PCR). Here we have applied the loop-mediated isothermal amplification (LAMP) method to amplify GMO-related DNA sequences, 'internal' commonly-used motifs for controlling transgene expression and event-specific (plant-transgene) junctions. We have tested the specificity and sensitivity of the technique for use in GMO studies. Results show that detection of 0.01% GMO in equivalent background DNA was possible and dilutions of template suggest that detection from single copies of the template may be possible using LAMP. This work shows that GMO detection can be carried out using LAMP for routine screening as well as for specific events detection. Moreover, the sensitivity and ability to amplify targets, even with a high background of DNA, here demonstrated, highlights the advantages of this isothermal amplification when applied for GMO detection.

Identification of branched-chain amino acid aminotransferases active towards (R)-(+)-1-phenylethylamine among PLP fold type IV transaminases.

PubMed

Bezsudnova, Ekaterina Yu; Dibrova, Daria V; Nikolaeva, Alena Yu; Rakitina, Tatiana V; Popov, Vladimir O

2018-04-10

New class IV transaminases with activity towards L-Leu, which is typical of branched-chain amino acid aminotransferases (BCAT), and with activity towards (R)-(+)-1-phenylethylamine ((R)-PEA), which is typical of (R)-selective (R)-amine:pyruvate transaminases, were identified by bioinformatics analysis, obtained in recombinant form, and analyzed. The values of catalytic activities in the reaction with L-Leu and (R)-PEA are comparable to those measured for characteristic transaminases with the corresponding specificity. Earlier, (R)-selective class IV transaminases were found to be active, apart from (R)-PEA, only with some other (R)-primary amines and D-amino acids. Sequences encoding new transaminases with mixed type of activity were found by searching for changes in the conserved motifs of sequences of BCAT by different bioinformatics tools. Copyright © 2018 Elsevier B.V. All rights reserved.

Specific detection of Neospora caninum oocysts in fecal samples from experimentally-infected dogs using the polymerase chain reaction.

PubMed

Hill, D E; Liddell, S; Jenkins, M C; Dubey, J P

2001-04-01

Neospora caninum oocysts, passed in the feces of a definitive host (dog), were isolated, and genomic DNA was extracted. A polymerase cahin reaction (PCR) targeting the N. caninum-specific Nc 5 genomic sequence was performed using the isolated DNA. A synthesized competitor molecule containing part of the Nc 5 sequence was included in the assay as a check against false-negative PCR results and to quantify N. caninum oocyst DNA in fecal samples. A standard curve of the ratio of fluorescence intensity of PCR-amplified competitor to that of oocyst DNA was constructed to compare oocyst equivalents from fecal samples containing unknown numbers of N. caninum oocysts and to assess the sensitivity of the assay. The specificity of the assay was determined using the Nc 5-specific primers in PCR assays against other parasites likely to be found in canine feces. Genomic DNA sequences from the canine coccidians Hammondia heydorni, Cryptosporidium parvum, Sarcocystis cruzi, S. tenella, and Isospora ohioensis and the canine helminth parasites Strongyloides stercoralis, Toxocara canis, Dipylidium caninum, and Ancylostoma caninum were not amplified. In addition, genomic DNA sequences from oocysts of coccidian parasites that might contaminate dog feces, such as Hammondia hammondi, Toxoplasma gondii, or Eimeria tenella, were not amplified in the PCR assay. The assay should be useful in epidemiological surveys of both domestic and wild canine hosts and in investigations of oocyst biology in experimental infections.

Sensitivity, specificity and comparison of three commercially available immunological tests in the diagnosis of Cryptosporidium species in animals.

PubMed

Danišová, Olga; Halánová, Monika; Valenčáková, Alexandra; Luptáková, Lenka

The study was conducted to compare the specificity of immunological diagnostic methods used for the diagnosis of Cryptosporidium species capable of causing life-threatening infection in both immunosuppressed and immunocompetent patients. For the detection of Cryptosporidium species in 79 animals with diarrhoea, we used three Copro-antigen tests: RIDASCREEN ® Cryptosporidium test, Cryptosporidium 2nd Generation (ELISA) and RIDA ® QUICK Cryptosporidium. For immunoassays we used positive and negative samples detected by means of polymerase chain reaction and validated by sequencing and nested polymerase chain reaction to confirm the presence six different species of Cryptosporidium species. Prevalence of cryptosporidiosis in the entire group determined by enzyme immunoassay, enzyme linked immunosorbent assay, immuno-chromatographic test and polymerase chain reaction was 34.17%, 27.84%, 6.33% and 27.84%, respectively. Sensitivity of animal samples with enzyme immunoassay, enzyme linked immunosorbent assay, and immuno-chromatographic test was 63.6%, 40.9% and 22.7%, resp., when questionable samples were considered positive, whereas specificity of enzyme immunoassay, enzyme linked immunosorbent assay and immuno-chromatographic test was 75.9%, 78.9% and 100%, respectively. Positive predictive values and negative predictive values were different for all the tests. These differences results are controversial and therefore reliability and reproducibility of immunoassays as the only diagnostic method is questionable. The use of various Cryptosporidium species in diagnosis based on immunological testing and different results obtained by individual tests indicate potential differences in Copro-antigens produced by individual Cryptosporidium species. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

DOEpatents

Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

2001-01-01

Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

Identification of Colletotrichum spp. isolated from strawberry in Zhejiang Province and Shanghai City, China*

PubMed Central

Xie, Liu; Zhang, Jing-ze; Wan, Yao; Hu, Dong-wei

2010-01-01

Strawberry anthracnose, caused by Colletotrichum spp., is a major disease of cultivated strawberry. This study identifies 31 isolates of Colletotrichum spp. which cause strawberry anthracnose in Zhejiang Province and Shanghai City, China. Eleven isolates were identified as C. acutatum, 10 as C. gloeosporioides and 10 as C. fragariae based on morphological characteristics, phylogenetic and sequence analyses. Species-specific polymerase chain reaction (PCR) and enzyme digestion further confirmed the identification of the Colletotrichum spp., demonstrating that these three species are currently the causal agents of strawberry anthracnose in the studied regions. Based on analysis of rDNA internal transcribed spacers (ITS) sequences, sequences of all C. acutatum were identical, and little genetic variability was observed between C. fragariae and C. gloeosporioides. However, the conservative nature of the MvnI specific site from isolates of C. gloeosporioides was confirmed, and this site could be used to differentiate C. gloeosporioides from C. fragariae. PMID:20043353

Simultaneous detection of the three ilarviruses affecting stone fruit trees by nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction.

PubMed

Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V

2000-12-01

ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.

Specific PCR Identification between Peucedanum praeruptorum and Angelica decursiva and Identification between Them and Adulterant Using DNA Barcode.

PubMed

Han, Bang-Xing; Yuan, Yuan; Huang, Lu-Qi; Zhao, Qun; Tan, Ling-Ling; Song, Xiang-Wen; He, Xiao-Mei; Xu, Tao; Liu, Feng; Wang, Jian

2017-01-01

The traditional Chinese medicine (TCM) Qianhu and Zihuaqianhu are the dried roots of Peucedanum praeruptorum and Angelica decursiva , respectively. Since the plant sources of Qianhu and Zihuaqianhu are more complex, the chemical compositions of P. praeruptorum and A. decursiva are significantly different, and many adulterants exist because of the differences in traditional understanding and medication habits. Therefore, the rapid and accurate identification methods are required. The aim was to study the feasibility of using DNA barcoding to distinguish between Traditional Chinese medicine Qianhu ( Peucedanum praeruptorum ), Zihuaqianhu ( Angelica decursiva ), and common adulterants, based on internal transcribed spacer (ITS) sequences, as well as specific PCR identification between P. praeruptorum and A. decursiva . The ITS sequences of P. praeruptorum , A. decursiva , and adulterant were studied, and a phylogenetic tree was constructed. Based on the ITS barcode, the specific PCR primer pairs QH-CP19s/QH-CP19a and ZHQH-CP3s/ZHQH-CP3a were designed for P. praeruptorum and A. decursiva , respectively. The amplification conditions were optimized, and specific PCR products were obtained. The results showed that the phylogenetic trees constructed using the BI and MP methods were consistent, and P. praeruptorum and A. decursiva sequence haplotypes formed their own monophyly. The experimental results showed that in PCR products, the target bands appeared in the genuine drug and not in the adulterant, which suggests the high specificity of the two primer pairs. The ITS sequence was ideal DNA barcode to identify P. praeruptorum , A. decursiva , and adulterant. The specific PCR is a quick and effective method to distinguish between P. praeruptorum and A. decursiva . Peucedanum praeruptorum and Angelica decursiva sequence haplotypes formed their own monophyly.The ITS sequence was ideal DNA barcode to identify P. praeruptorum , A. decursiva , and adulterant.Specific PCR is a quick and effective method to distinguish between P. praeruptorum and A. decursiva . Abbreviations used: TCM: The traditional Chinese medicine, P.: Peucedanum , A.: Angelica , ITS: The internal transcribed spacer, PCR: Polymerase chain reaction, NCBI: National Center for Biotechnology Information, NI: Number of individuals, HN: Haplotype number; GAN: Gen Bank accession numbers, L.: Ligusticum , O.: Ostericum , A.: Angelica , P.: Pimpinella , BI: Bayesian inference, MP: Maximum parsimony, AIC: Akaike Information Criterion, MCMC: Markov Chains Monte Carlo, TBR: Tree bisection-reconnection, LPP: Length of PCR product, PRP: PCR reaction procedure, SNP: Single nucleotide polymorphisms, PP: Posterior probability, BS: Bootstrap.Qun Zhao.

[A new human leukocyte antigen class I allele, HLA- B*52:11].

PubMed

Li, Xiao-feng; Zhang, Xu; Zhang, Kun-lian; Chen, Yang; Liu, Xian-zhi; Li, Jian-ping

2011-12-01

To identify and confirm a novel HLA allele. A new human leukocyte antigen class I allele was found during routine HLA genotyping by polymerase chain reaction-sequence specific oligonucleotide probes (PCR-SSOP) and sequencing-based typing (SBT). The novel HLA-B*52 allele was identical to B*52:01:01 with an exception of one base substitution at position 583 of exon 3 where a C was changed to T resulting in codon 195 changed from CAC(H) to TAC(Y). A new HLA class I allele, B*52:11, is identified, and is named officially by the WHO Nomenclature Committee.

Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.

PubMed Central

Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J

1994-01-01

Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912

Adenine specific DNA chemical sequencing reaction.

PubMed Central

Iverson, B L; Dervan, P B

1987-01-01

Reaction of DNA with K2PdCl4 at pH 2.0 followed by a piperidine workup produces specific cleavage at adenine (A) residues. Product analysis revealed the K2PdCl4 reaction involves selective depurination at adenine, affording an excision reaction analogous to the other chemical DNA sequencing reactions. Adenine residues methylated at the exocyclic amine (N6) react with lower efficiency than unmethylated adenine in an identical sequence. This simple protocol specific for A may be a useful addition to current chemical sequencing reactions. Images PMID:3671067

T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

PubMed

Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

2012-01-01

Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

Quantitative competitive (QC) PCR for quantification of porcine DNA.

PubMed

Wolf, C; Lüthy, J

2001-02-01

Many meat products nowadays may contain several species in different proportions. To protect consumers from fraud and misdeclarations, not only a qualitative but also a quantitative monitoring of ingredients of complex food products is necessary. DNA based techniques like the polymerase chain reaction (PCR) are widely used for identification of species but no answer to the proportional amount of a certain species could be given using current techniques. In this study we report the development and evaluation of a quantitative competitive polymerase chain reaction (QC-PCR) for detection and quantification of porcine DNA using a new porcine specific PCR system based on the growth hormone gene of sus scrofa. A DNA competitor differing by 30 bp in length from the porcine target sequence was constructed and used for PCR together with the target DNA. Specificity of the new primers was evaluated with DNA from cattle, sheep, chicken and turkey. The competitor concentration was adjusted to porcine DNA contents of 2 or 20% by coamplification of mixtures containing porcine and corresponding amounts of bovine DNA in defined ratios.

A fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp.

PubMed

Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan

2011-06-01

The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.

Detection of Citrus leprosis virus C using specific primers and TaqMan probe in one-step real-time reverse-transcription polymerase chain reaction assays.

PubMed

Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H

2015-11-01

Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence. Published by Elsevier B.V.

Identification of human antibody fragment clones specific for tetanus toxoid in a bacteriophage. lambda. immunoexpression library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mullinax, R.L.; Gross, E.A.; Amberg, J.R.

1990-10-01

The authors have applied a molecular biology approach to the identification of human monoclonal antibodies. Human peripheral blood lymphocyte mRNA was converted to cDNA and a select subset was amplified by the polymerase chain reaction. These products, containing coding sequences for numerous immunoglobulin heavy- and {kappa} light-chain variable and constant region domains, were inserted into modified bacteriophase {lambda} expression vectors and introduced into Escherichia coli by infection to yield a combinatorial immunoexpression library. Clones with binding activity to tetanus toxoid were identified by filter hybridization with radiolabeled antigen and appeared at a frequency of 0.2{percent} in the library. These humanmore » antigen binding fragments, consisting of a heavy-chain fragment covalently linked to a light chain, displayed high affinity of binding to tetanus toxoid with equilibrium constants in the nanomolar range but did not cross-react with other proteins tested. They estimate that this human immunoexpression library contains 20,000 clones with high affinity and specificity to our chosen antigen.« less

Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

PubMed

Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

2013-06-01

Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

PubMed

Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

2012-12-01

Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Population Based Assessment of MHC Class 1 Antigens Down Regulation as Marker in Increased Risk for Development and Progression of Breast Cancer From Benign Breast Lesions

DTIC Science & Technology

2006-01-01

isolated using a routine salting-out method (DNA E-Z Prepkit, Orchid Diagnostics Europe, St Katelijne Waver, Belgium). Sequence based typing In...electrophoresis using ethidiumbromide to show the single 2 KB band before sequencing. Next, sequencing reactions were performed separately for exons 2, 3...Multiplex reverse transcription-polymerase chain reaction for simultaneous screening of 29 translocations and chromosomal aberrations in acute

A novel gammaherpesvirus in a large flying fox (Pteropus vampyrus) with blepharitis.

PubMed

Paige Brock, A; Cortés-Hinojosa, Galaxia; Plummer, Caryn E; Conway, Julia A; Roff, Shannon R; Childress, April L; Wellehan, James F X

2013-05-01

A novel gammaherpesvirus was identified in a large flying fox (Pteropus vampyrus) with conjunctivitis, blepharitis, and meibomianitis by nested polymerase chain reaction and sequencing. Polymerase chain reaction amplification and sequencing of 472 base pairs of the DNA-dependent DNA polymerase gene were used to identify a novel herpesvirus. Bayesian and maximum likelihood phylogenetic analyses indicated that the virus is a member of the genus Percavirus in the subfamily Gammaherpesvirinae. Additional research is needed regarding the association of this virus with conjunctivitis and other ocular pathology. This virus may be useful as a biomarker of stress and may be a useful model of virus recrudescence in Pteropus spp.

Sequence-Based Discovery Demonstrates That Fixed Light Chain Human Transgenic Rats Produce a Diverse Repertoire of Antigen-Specific Antibodies.

PubMed

Harris, Katherine E; Aldred, Shelley Force; Davison, Laura M; Ogana, Heather Anne N; Boudreau, Andrew; Brüggemann, Marianne; Osborn, Michael; Ma, Biao; Buelow, Benjamin; Clarke, Starlynn C; Dang, Kevin H; Iyer, Suhasini; Jorgensen, Brett; Pham, Duy T; Pratap, Payal P; Rangaswamy, Udaya S; Schellenberger, Ute; van Schooten, Wim C; Ugamraj, Harshad S; Vafa, Omid; Buelow, Roland; Trinklein, Nathan D

2018-01-01

We created a novel transgenic rat that expresses human antibodies comprising a diverse repertoire of heavy chains with a single common rearranged kappa light chain (IgKV3-15-JK1). This fixed light chain animal, called OmniFlic, presents a unique system for human therapeutic antibody discovery and a model to study heavy chain repertoire diversity in the context of a constant light chain. The purpose of this study was to analyze heavy chain variable gene usage, clonotype diversity, and to describe the sequence characteristics of antigen-specific monoclonal antibodies (mAbs) isolated from immunized OmniFlic animals. Using next-generation sequencing antibody repertoire analysis, we measured heavy chain variable gene usage and the diversity of clonotypes present in the lymph node germinal centers of 75 OmniFlic rats immunized with 9 different protein antigens. Furthermore, we expressed 2,560 unique heavy chain sequences sampled from a diverse set of clonotypes as fixed light chain antibody proteins and measured their binding to antigen by ELISA. Finally, we measured patterns and overall levels of somatic hypermutation in the full B-cell repertoire and in the 2,560 mAbs tested for binding. The results demonstrate that OmniFlic animals produce an abundance of antigen-specific antibodies with heavy chain clonotype diversity that is similar to what has been described with unrestricted light chain use in mammals. In addition, we show that sequence-based discovery is a highly effective and efficient way to identify a large number of diverse monoclonal antibodies to a protein target of interest.

Multiplex polymerase chain reaction-capillary gel electrophoresis: a promising tool for GMO screening--assay for simultaneous detection of five genetically modified cotton events and species.

PubMed

Nadal, Anna; Esteve, Teresa; Pla, Maria

2009-01-01

A multiplex polymerase chain reaction assay coupled to capillary gel electrophoresis for amplicon identification by size and color (multiplex PCR-CGE-SC) was developed for simultaneous detection of cotton species and 5 events of genetically modified (GM) cotton. Validated real-time-PCR reactions targeting Bollgard, Bollgard II, Roundup Ready, 3006-210-23, and 281-24-236 junction sequences, and the cotton reference gene acp1 were adapted to detect more than half of the European Union-approved individual or stacked GM cotton events in one reaction. The assay was fully specific (<1.7% of false classification rate), with limit of detection values of 0.1% for each event, which were also achieved with simulated mixtures at different relative percentages of targets. The assay was further combined with a second multiplex PCR-CGE-SC assay to allow simultaneous detection of 6 cotton and 5 maize targets (two endogenous genes and 9 GM events) in two multiplex PCRs and a single CGE, making the approach more economic. Besides allowing simultaneous detection of many targets with adequate specificity and sensitivity, the multiplex PCR-CGE-SC approach has high throughput and automation capabilities, while keeping a very simple protocol, e.g., amplification and labeling in one step. Thus, it is an easy and inexpensive tool for initial screening, to be complemented with quantitative assays if necessary.

Establishment and application of event-specific polymerase chain reaction methods for two genetically modified soybean events, A2704-12 and A5547-127.

PubMed

Li, Xiang; Pan, Liangwen; Li, Junyi; Zhang, Qigang; Zhang, Shuya; Lv, Rong; Yang, Litao

2011-12-28

For implementation of the issued regulations and labeling policies for genetically modified organism (GMO) supervision, the polymerase chain reaction (PCR) method has been widely used due to its high specificity and sensitivity. In particular, use of the event-specific PCR method based on the flanking sequence of transgenes has become the primary trend. In this study, both qualitative and quantitative PCR methods were established on the basis of the 5' flanking sequence of transgenic soybean A2704-12 and the 3' flanking sequence of transgenic soybean A5547-127, respectively. In qualitative PCR assays, the limits of detection (LODs) were 10 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127. In quantitative real-time PCR assays, the LODs were 5 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127, and the limits of quantification (LOQs) were 10 copies for both. Low bias and acceptable SD and RSD values were also achieved in quantification of four blind samples using the developed real-time PCR assays. In addition, the developed PCR assays for the two transgenic soybean events were used for routine analysis of soybean samples imported to Shanghai in a 6 month period from October 2010 to March 2011. A total of 27 lots of soybean from the United States and Argentina were analyzed: 8 lots from the Unites States were found to have the GM soybean A2704-12 event, and the GM contents were <1.5% in all eight analyzed lots. On the contrary, no GM soybean A5547-127 content was found in any of the eight lots. These results demonstrated that the established event-specific qualitative and quantitative PCR methods could be used effectively in routine identification and quantification of GM soybeans A2704-12 and A5547-127 and their derived products.

Isolation and characterization of the promoter sequence of a cassava gene coding for Pt2L4, a glutamic acid-rich protein differentially expressed in storage roots.

PubMed

de Souza, C R; Aragão, F J; Moreira, E C O; Costa, C N M; Nascimento, S B; Carvalho, L J

2009-03-24

Cassava is one of the most important tropical food crops for more than 600 million people worldwide. Transgenic technologies can be useful for increasing its nutritional value and its resistance to viral diseases and insect pests. However, tissue-specific promoters that guarantee correct expression of transgenes would be necessary. We used inverse polymerase chain reaction to isolate a promoter sequence of the Mec1 gene coding for Pt2L4, a glutamic acid-rich protein differentially expressed in cassava storage roots. In silico analysis revealed putative cis-acting regulatory elements within this promoter sequence, including root-specific elements that may be required for its expression in vascular tissues. Transient expression experiments showed that the Mec1 promoter is functional, since this sequence was able to drive GUS expression in bean embryonic axes. Results from our computational analysis can serve as a guide for functional experiments to identify regions with tissue-specific Mec1 promoter activity. The DNA sequence that we identified is a new promoter that could be a candidate for genetic engineering of cassava roots.

Molecular testing for familial hypercholesterolaemia-associated mutations in a UK-based cohort: development of an NGS-based method and comparison with multiplex polymerase chain reaction and oligonucleotide arrays.

PubMed

Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K

2016-11-01

Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.

First report of Cocksfoot mottle virus infecting wheat (Triticum aestivum) in Ohio

USDA-ARS?s Scientific Manuscript database

Cocksfoot mottle virus (CfMV) was discovered in Ohio wheat during a 2016 field survey utilizing RNA-Seq to identify virus-like sequences. Virus sequences were confirmed by reverse transcriptase-polymerase chain reaction (RT-PCR) and Sanger sequencing, and CfMV was transmitted to orchardgrass and pas...

Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

PubMed

Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

2017-02-01

To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

PubMed

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

2008-09-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

Insights into the Performance of SD Bioline Malaria Ag P.f/Pan Rapid Diagnostic Test and Plasmodium falciparum Histidine-Rich Protein 2 Gene Variation in Madagascar.

PubMed

Willie, Nigani; Mehlotra, Rajeev K; Howes, Rosalind E; Rakotomanga, Tovonahary A; Ramboarina, Stephanie; Ratsimbasoa, Arsène C; Zimmerman, Peter A

2018-06-01

Plasmodium falciparum histidine-rich protein 2 (PfHRP2) forms the basis of many current malaria rapid diagnostic tests (RDTs). However, the parasites lacking part or all of the pfhrp2 gene do not express the PfHRP2 protein and are, therefore, not identifiable by PfHRP2-detecting RDTs. We evaluated the performance of the SD Bioline Malaria Ag P.f/Pan RDT together with pfhrp2 variation in Madagascar. Genomic DNA isolated from 260 patient blood samples were polymerase chain reaction (PCR)-amplified for the parasite 18S rRNA and pfhrp2 genes. Post-PCR ligation detection reaction-fluorescent microsphere assay (LDR-FMA) was performed for the identification of parasite species. Plasmodium falciparum histidine-rich protein 2 amplicons were sequenced. Polymerase chain reaction diagnosis of patient samples showed that 29% (75/260) were infected and P. falciparum was present in 95% (71/75) of these PCR-positive samples. Comparing RDT and P. falciparum detection by LDR-FMA, eight samples were RDT negative but P. falciparum positive (false negatives), all of which were pfhrp2 positive. The sensitivity and specificity of the RDT were 87% and 90%, respectively. Seventy-three samples were amplified for pfhrp2 , from which nine randomly selected amplicons were sequenced, yielding 13 sequences. Amplification of pfhrp2 , combined with RDT analysis and P. falciparum detection by LDR-FMA, showed that there was no indication of pfhrp2 deletion. Sequence analysis of pfhrp2 showed that the correlation between pfhrp2 sequence structure and RDT detection rates was unclear. Although the observed absence of pfhrp2 deletion from the samples screened here is encouraging, continued monitoring of the efficacy of the SD Bioline Malaria Ag P.f/Pan RDT for malaria diagnosis in Madagascar is warranted.

Characterization of a marsupial sperm protamine gene and its transcripts from the North American opossum (Didelphis marsupialis).

PubMed

Winkfein, R J; Nishikawa, S; Connor, W; Dixon, G H

1993-07-01

A synthetic oligonucleotide primer, designed from marsupial protamine protein-sequence data [Balhorn, R., Corzett, M., Matrimas, J. A., Cummins, J. & Faden, B. (1989) Analysis of protamines isolated from two marsupials, the ring-tailed wallaby and gray short-tailed opossum, J. Cell. Biol. 107] was used to amplify, via the polymerase chain reaction, protamine sequences from a North American opossum (Didelphis marsupialis) cDNA. Using the amplified sequences as probes, several protamine cDNA clones were isolated. The protein sequence, predicted from the cDNA sequences, consisted of 57 amino acids, contained a large number of arginine residues and exhibited the sequence ARYR at its amino terminus, which is conserved in avian and most eutherian mammal protamines. Like the true protamines of trout and chicken, the opossum protamine lacked cysteine residues, distinguishing it from placental mammalian protamine 1 (P1 or stable) protamines. Examination of the protamine gene, isolated by polymerase-chain-reaction amplification of genomic DNA, revealed the presence of an intron dividing the protamine-coding region, a common characteristic of all mammalian P1 genes. In addition, extensive sequence identity in the 5' and 3' flanking regions between mouse and opossum sequences classify the marsupial protamine as being closely related to placental mammal P1. Protamine transcripts, in both birds and mammals, are present in two size classes, differing by the length of their poly(A) tails (either short or long). Examination of opossum protamine transcripts by Northern hybridization revealed four distinct mRNA species in the total RNA fraction, two of which were enriched in the poly(A)-rich fraction. Northern-blot analysis, using an intron-specific probe, revealed the presence of intron sequences in two of the four protamine transcripts. If expressed, the corresponding protein from intron-containing transcripts would differ from spliced transcripts by length (49 versus 57 amino acids) and would contain a cysteine residue.

Isolation of Separate Ureaplasma Species From Endotracheal Secretions of Twin Patients.

PubMed

Beeton, Michael L; Maxwell, Nicola C; Chalker, Victoria J; Brown, Rebecca J; Aboklaish, Ali F; Spiller, O Brad

2016-08-01

Isolation of Ureaplasma spp. from preterm neonates and the association with development of bronchopulmonary dysplasia has been previously investigated. However, few studies have contrasted the nature of infection in twins. In this article, we report that dizygotic twins (1 girl, 1 boy) born at 24 weeks gestation both yielded culturable Ureaplasma from endotracheal secretions. The samples were part of a serial blind collection cohort of ventilated premature neonates, and analysis of repeat cultures showed stable, separate infections over a period of 17 and 21 days, respectively. Immunoblot and probe-specific quantitative polymerase chain reaction analysis determined that Twin 1 was solely infected with Ureaplasma parvum (specifically, serovar 6 by gene sequencing), whereas Twin 2 was solely infected with Ureaplasma urealyticum (specifically, genotype A- serovars 2, 5, and 8 by gene sequencing). Immunoblot analysis found that the major surface antigen (multiple-banded antigen) altered relative mass for both strains during the course of infection. Quantitative polymerase chain reaction analysis of extracted endotracheal aspirates confirmed no evidence of mixed infection for either twin. Failure of sentinel ventilated preterm infants on the same ward to acquire Ureaplasma infection after the first week of birth suggests no cot-to-cot transfer of Ureaplasma infection occurred. This study demonstrated not only a contrasting clinical outcome for a set of twins infected with 2 separate species of Ureaplasma, but also the first real-time demonstration of multiple-banded antigen alteration and evolution of Ureaplasma over the course of a clinical infection. Copyright © 2016 by the American Academy of Pediatrics.

Rapid polymerase chain reaction-based screening assay for bacterial biothreat agents.

PubMed

Yang, Samuel; Rothman, Richard E; Hardick, Justin; Kuroki, Marcos; Hardick, Andrew; Doshi, Vishal; Ramachandran, Padmini; Gaydos, Charlotte A

2008-04-01

To design and evaluate a rapid polymerase chain reaction (PCR)-based assay for detecting Eubacteria and performing early screening for selected Class A biothreat bacterial pathogens. The authors designed a two-step PCR-based algorithm consisting of an initial broad-based universal detection step, followed by specific pathogen identification targeted for identification of the Class A bacterial biothreat agents. A region in the bacterial 16S rRNA gene containing a highly variable sequence flanked by clusters of conserved sequences was chosen as the target for the PCR assay design. A previously described highly conserved region located within the 16S rRNA amplicon was selected as the universal probe (UniProbe, Integrated DNA Technology, Coralville, IA). Pathogen-specific TaqMan probes were designed for Bacillus anthracis, Yersinia pestis, and Francisella tularensis. Performance of the assay was assessed using genomic DNA extracted from the aforementioned biothreat-related organisms (inactivated or surrogate) and other common bacteria. The UniProbe detected the presence of all tested Eubacteria (31/31) with high analytical sensitivity. The biothreat-specific probes accurately identified organisms down to the closely related species and genus level, but were unable to discriminate between very close surrogates, such as Yersinia philomiragia and Bacillus cereus. A simple, two-step PCR-based assay proved capable of both universal bacterial detection and identification of select Class A bacterial biothreat and biothreat-related pathogens. Although this assay requires confirmatory testing for definitive species identification, the method has great potential for use in ED-based settings for rapid diagnosis in cases of suspected Category A bacterial biothreat agents.

[Applications of DNA methylation markers in forensic medicine].

PubMed

Zhao, Gui-sen; Yang, Qing-en

2005-02-01

DNA methylation is a post-replication modification that is predominantly found in cytosines of the dinucleotide sequence CpG. Epigenetic information is stored in the distribution of the modified base 5-methylcytosine. DNA methylation profiles represent a more chemically and biologically stable source of molecular diagnostic information than RNA or most proteins. Recent advances attest to the great promise of DNA methylation markers as powerful future tools in the clinic. In the past decade, DNA methylation analysis has been revolutionized by two technological advances--bisulphite modification of DNA and methylation-specific polymerase chain reaction (MSP). The methylation pattern of human genome is space-time specific, sex-specific, parent-of-origin specific and disease specific, providing us an alternative way to solve forensic problems.

Genetic variability and molecular identification of Brazilian Biomphalaria species (Mollusca: Planorbidae).

PubMed

Carvalho, S; Caldeira, R L; Simpson, A J; Vidigal, T H

2001-01-01

Freshwater snails belonging to the genus Biomphalaria are intermediate hosts of the trematode Schistosoma mansoni in the Neotropical region and Africa. In Brazil, one subspecies and ten species of Biomphalaria have been identified: B. glabrata, B. tenagophila, B. straminea, B. occidentalis, B. peregrina, B. kuhniana, B. schrammi, B. amazonica, B. oligoza, B. intermedia and B.t. guaibensis. However, only the first three species are found naturally infected with S. mansoni. The classical identification of these planorbids is based on comparison of morphological characteristics of the shell and male and female reproductive organs, which is greatly complicated by the extensive intra-specific variation. Several molecular techniques have been used in studies on the identification, genetic structure as well as phylogenetic relationships between these groups of organisms. Using the randomly amplified polymorphic DNAs (RAPD) analysis we demonstrated that B. glabrata exhibits a remarkable degree of intra-specific polymorphism. Thus, the genetics of the snail host may be more important to the epidemiology of schistosomiasis than those of the parasite itself. Using the simple sequence repeat anchored polymerase chain reaction (SSR-PCR) in intra-populational and intra-specific studies we have demonstrated that snails belonging to the B. straminea complex (B. straminea, B. kuhniana and B. intermedia) clearly presented higher heterogeneity. Using the low stringency polymerase chain reaction (LS-PCR) technique we were able to separate B. glabrata from B. tenagophila and B. tenagophila from B. occidentalis. To separate all Brazilian Biomphalaria species we used the restriction fragment length polymorphism (PCR-RFLP) of the internal transcribed spacer region (ITS) of the DNA gene. The method also proved to be efficient for the specific identification of DNA extracted from snail eggs. Recently we have sequenced the ITS2 region for phylogenetic studies of all Biomphalaria snails from Brazil.

Allele-specific primer polymerase chain reaction for a single nucleotide polymorphism (C1205T) of swine toll-like receptor 5 and comparison of the allelic frequency among several pig breeds in Japan and the Czech Republic.

PubMed

Muneta, Yoshihiro; Minagawa, Yu; Kusumoto, Masahiro; Shinkai, Hiroki; Uenishi, Hirohide; Splichal, Igor

2012-06-01

In the present study, an allele-specific primer-polymerase chain reaction (ASP-PCR) for genotyping a single nucleotide polymorphism (SNP) of swine Toll-like receptor 5 (TLR5) (C1205T; P402L) that is related to the impaired recognition of Salmonella enterica serovar Choleraesuis (SC) was developed. The allele frequencies in several pig breeds in Japan and the Czech Republic were also compared. The swine TLR5 C1205T mutation was successfully determined by ASP-PCR using genomic DNA samples in Japan that had previously been genotyped by a sequencing method. Using the PCR condition determined, genomic DNA samples from blood obtained from 110 pigs from seven different breeds in the Czech Republic were genotyped by the ASP-PCR. The genotyping results from the ASP-PCR completely matched the results from the sequencing method. The allele frequency of the swine TLR5 C1205T mutation was 27.5% in the Landrace breed of the Czech Republic compared with 50.0% in Japanese Landrace. In Japan, the C1205T mutation was found only in the Landrace breed, whereas in the Czech Republic it was found in both the Landrace and Piétrain breeds. These results indicate the usefulness of ASP-PCR for detecting a specific SNP for swine TLR5 affecting ligand recognition. They also suggest the possibility of genetically improving pigs to enhance their resistance against SC infection by eliminating or selecting this specific SNP of swine TLR5. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

Characterization of a prototype strain of hepatitis E virus.

PubMed

Tsarev, S A; Emerson, S U; Reyes, G R; Tsareva, T S; Legters, L J; Malik, I A; Iqbal, M; Purcell, R H

1992-01-15

A strain of hepatitis E virus (SAR-55) implicated in an epidemic of enterically transmitted non-A, non-B hepatitis, now called hepatitis E, was characterized extensively. Six cynomolgus monkeys (Macaca fascicularis) were infected with a strain of hepatitis E virus from Pakistan. Reverse transcription-polymerase chain reaction was used to determine the pattern of virus shedding in feces, bile, and serum relative to hepatitis and induction of specific antibodies. Virtually the entire genome of SAR-55 (7195 nucleotides) was sequenced. Comparison of the sequence of SAR-55 with that of a Burmese strain revealed a high level of homology except for one region encoding 100 amino acids of a putative nonstructural polyprotein. Identification of this region as hypervariable was obtained by partial sequencing of a third isolate of hepatitis E virus from Kirgizia.

No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

PubMed

D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

2006-10-01

Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food

PubMed Central

Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

2015-01-01

Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features. PMID:26579116

An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food.

PubMed

Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han

2015-01-01

Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

Gene cloning and overexpression of a geranylgeranyl diphosphate synthase of an extremely thermophilic bacterium, Thermus thermophilus.

PubMed

Ohto, C; Ishida, C; Koike-Takeshita, A; Yokoyama, K; Muramatsu, M; Nishino, T; Obata, S

1999-02-01

A geranylgeranyl diphosphate (GGPP) synthase gene of an extremely thermophilic bacterium, Thermus thermophilus, was cloned and sequenced. T. thermophilus GGPP synthase, overexpressed in Escherichia coli cells as a glutathione S-transferase fusion protein, was purified and characterized. The fusion protein, retaining thermostability, formed a homodimer, and showed higher specific activity than did a partially purified thermostable enzyme previously reported. Optimal reaction conditions and kinetic parameters were also examined. The deduced amino acid sequence indicated that T. thermophilus GGPP synthase was excluded from the group of bacterial type GGPP synthases and lacked the insertion amino acid residues in the first aspartate-rich motif as do archaeal and eukaryotic short-chain prenyltransferases.

Systemic Lupus Erythematosus: Molecular Mimicry between Anti-dsDNA CDR3 Idiotype, Microbial and Self Peptides-As Antigens for Th Cells.

PubMed

Aas-Hanssen, Kristin; Thompson, Keith M; Bogen, Bjarne; Munthe, Ludvig A

2015-01-01

Systemic lupus erythematosus (SLE) is marked by a T helper (Th) cell-dependent B cell hyperresponsiveness, with frequent germinal center reactions, and gammaglobulinemia. A feature of SLE is the finding of IgG autoantibodies specific for dsDNA. The specificity of the Th cells that drive the expansion of anti-dsDNA B cells is unresolved. However, anti-microbial, anti-histone, and anti-idiotype Th cell responses have been hypothesized to play a role. It has been entirely unclear if these seemingly disparate Th cell responses and hypotheses could be related or unified. Here, we describe that H chain CDR3 idiotypes from IgG(+) B cells of lupus mice have sequence similarities with both microbial and self peptides. Matched sequences were more frequent within the mutated CDR3 repertoire and when sequences were derived from lupus mice with expanded anti-dsDNA B cells. Analyses of histone sequences showed that particular histone peptides were similar to VDJ junctions. Moreover, lupus mice had Th cell responses toward histone peptides similar to anti-dsDNA CDR3 sequences. The results suggest that Th cells in lupus may have multiple cross-reactive specificities linked to the IgVH CDR3 Id-peptide sequences as well as similar DNA-associated protein motifs.

Development and Evaluation of a Multiplex Real-Time Polymerase Chain Reaction Procedure to Clinically Type Prevalent Salmonella enterica Serovars

PubMed Central

Muñoz, Nélida; Diaz-Osorio, Miguel; Moreno, Jaime; Sánchez-Jiménez, Miryan; Cardona-Castro, Nora

2010-01-01

A multiplex real-time polymerase chain reaction procedure was developed to identify the most prevalent clinical isolates of Salmonella enterica subsp. enterica. Genes from the rfb, fliC, fljB, and viaB groups that encode the O, H, and Vi antigens were used to design 15 primer pairs and TaqMan probes specific for the genes rfbJ, wzx, fliC, fljB, wcdB, the sdf-l sequence, and invA, which was used as an internal amplification control. The primers and probes were variously combined into six sets. The first round of reactions used two of these sets to detect Salmonella O:4, O:9, O:7, O:8, and O:3,10 serogroups. Once the serogroups were identified, the results of a second round of reactions that used primers and probes for the flagellar antigen l genes, 1,2; e,h; g,m; d; e,n,x; and z10, and the Vi gene were used to identify individual serovars. The procedure was standardized using 18 Salmonella reference strains and other enterobacteria. The procedure's reliability and sensitivity was evaluated using 267 randomly chosen serotyped Salmonella clinical isolates. The procedure had a sensitivity of 95.5% and was 100% specific. Thus, our technique is a quick, sensitive, reliable, and specific means of identifying S. enterica serovars and can be used in conjunction with traditional serotyping. Other primer and probe combinations could be used to increase the number of identifiable serovars. PMID:20110454

Automatic polymerase chain reaction product detection system for food safety monitoring using zinc finger protein fused to luciferase.

PubMed

Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi; Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki; Noda, Mamoru; Igimi, Shizunobu; Ikebukuro, Kazunori

2013-11-01

An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268-luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF-luciferase fusion protein. By means of the automatic analyzer with ZF-luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0×10 to 1.0×10(6) copies. Copyright © 2013 Elsevier B.V. All rights reserved.

Detection and genotyping of bovine diarrhea virus by reverse transcription-polymerase chain amplification of the 5' untranslated region.

PubMed

Letellier, C; Kerkhofs, P; Wellemans, G; Vanopdenbosch, E

1999-01-01

A reverse-transcription polymerase chain reaction (RT-PCR) was developed to differentiate the bovine diarrhea virus (BVDV) from other pestiviruses, and to determine the genotype of the BVDV isolates. For this purpose, primer pairs were selected in the 5' untranslated region (5'UTR). The primers BE and B2 were located in highly conserved regions and were pestivirus-specific. Two primer pairs named B3B4 and B5B6 were specific of BVDV genotypes I and II, respectively. With this technique, an amplification product of the expected size was obtained with either the B3B4 or the B5B6 primer pairs for the 107 BVDV isolates tested but not for BDV or CSFV. For some isolates that were grouped in the genotype II, sequence analysis of the PCR fragments confirmed their classification into this genotype.

DNA Sequences from Formalin-Fixed Nematodes: Integrating Molecular and Morphological Approaches to Taxonomy

PubMed Central

Thomas, W. Kelley; Vida, J. T.; Frisse, Linda M.; Mundo, Manuel; Baldwin, James G.

1997-01-01

To effectively integrate DNA sequence analysis and classical nematode taxonomy, we must be able to obtain DNA sequences from formalin-fixed specimens. Microdissected sections of nematodes were removed from specimens fixed in formalin, using standard protocols and without destroying morphological features. The fixed sections provided sufficient template for multiple polymerase chain reaction-based DNA sequence analyses. PMID:19274156

Analysis of the major epitope of the alpha2 chain of bovine type I collagen in children with bovine gelatin allergy.

PubMed

Hori, Hisae; Hattori, Shunji; Inouye, Sakae; Kimura, Akinori; Irie, Shinkichi; Miyazawa, Hiroshi; Sakaguchi, Masahiro

2002-10-01

Anaphylaxis to measles, mumps, and rubella vaccines has been reported. It has been found that most of these reactions to live vaccines are caused by type I allergy with the bovine gelatin present in the vaccines as an allergen. Gelatin mainly includes denatured type I collagen, which consists of alpha1 and alpha2 chains. We previously reported that allergic reactions to gelatin are caused by the type I collagen alpha2 (alpha2[I]) chain. To aid in the development of gelatin that has little or no allergenicity in human subjects, we investigated epitopes of bovine alpha2(I) chain with use of IgE in gelatin-sensitive children. Serum samples were collected from 15 patients who had systemic allergic reactions to vaccines and high levels of specific IgE to bovine gelatin. Eleven overlapping recombinant proteins that cover bovine alpha2(I) were prepared with a bacterial expression vector. We examined IgE reactivity to these recombinant proteins by means of ELISA. Fifteen peptides covering a major reactive recombinant protein were synthesized. The IgE-reacting epitope was identified by means of IgE-ELISA inhibition with these synthetic peptides and pooled serum from the patients. We found that of the 15 patients, 13 showed IgE reactivity to a recombinant protein (no. 3) spanning the central region of the collagenous domain ((418)Gly-(662)Pro). Furthermore, all 13 patients showed IgE reactivity to the 4-kd recombinant protein (no. 3a) spanning the region from (461)Pro to (500)Glu. In IgE-ELISA inhibition we found that a minimum IgE epitope of gelatin allergen was composed of the 10-amino-acid sequence (485)Ile-Pro-Gly-Glu-Phe-Gly-Leu-Pro-Gly-Pro(494). This sequence is not observed in the human type I collagen alpha1 and alpha2 chains, nor is it found in the bovine type I collagen alpha1 chain. We found that Ile-Pro-Gly-Glu-Phe-Gly-Leu-Pro-Gly-Pro is a major IgE epitope of the alpha2 chain of bovine type I collagen in patients with gelatin allergy. The degree of anaphylaxis to gelatin in vaccines might be reduced by digestion of this IgE-binding site in gelatin.

Development and validation of a quantitative PCR for rapid and specific detection of California sea lion adenovirus 1 and prevalence in wild and managed populations.

PubMed

Cortés-Hinojosa, Galaxia; Gulland, Frances M D; Goldstein, Tracey; Venn-Watson, Stephanie; Rivera, Rebecca; Archer, Linda L; Waltzek, Thomas B; Gray, Gregory C; Wellehan, James F X

2017-03-01

California sea lion adenovirus 1 (CSLAdV-1) has been associated with hepatitis and enteritis in several wild and captive populations of diverse pinniped species. Currently available tests have been limited to pan-adenoviral polymerase chain reaction (PCR) followed by sequencing. We present the development of a quantitative probe-hybridization PCR (qPCR) assay for rapid, sensitive, and specific detection of this virus in California sea lions ( Zalophus californianus) and other pinnipeds. This assay did not amplify other mammalian adenoviruses and is able to detect consistently down to 10 viral copies per well. Compared with the gold standard conventional pan-adenovirus PCR/sequencing assay, diagnostic sensitivity and specificity of 100% and 88.2% were found, respectively. The lower diagnostic specificity of this qPCR assay may be the result of the lower limit of detection of this assay compared with the gold standard rather than the result of detection of true false-positives.

Polymerase chain reaction for detection of Leptospira spp. in clinical samples.

PubMed Central

Mérien, F; Amouriaux, P; Perolat, P; Baranton, G; Saint Girons, I

1992-01-01

A sensitive assay for Leptospira spp., the causative agent of leptospirosis, was developed on the basis of the polymerase chain reaction (PCR). A 331-bp sequence from the Leptospira interrogans serovar canicola rrs (16S) gene was amplified, and the PCR products were analyzed by DNA-DNA hybridization by using a 289-bp fragment internal to the amplified DNA. Specific PCR products also were obtained with DNA from the closely related nonpathogenic Leptospira biflexa but not with DNA from other spirochetes, such as Borrelia burgdorferi, Borrelia hermsii, Treponema denticola, Treponema pallidum, Spirochaeta aurantia, or more distant organisms such as Escherichia coli, Staphylococcus aureus, Mycobacterium tuberculosis, and Proteus mirabilis. The assay was able to detect as few as 10 bacteria. Leptospira DNA was detected in urine from experimentally infected mice. In addition, the test was found to be suitable for diagnosing leptospirosis in humans. Cerebrospinal fluid and urine from patients with leptospirosis were positive, whereas samples from control uninfected patients were negative. Images PMID:1400983

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

Comprehensive Panel of Real-Time TaqMan™ Polymerase Chain Reaction Assays for Detection and Absolute Quantification of Filoviruses, Arenaviruses, and New World Hantaviruses

PubMed Central

Trombley, Adrienne R.; Wachter, Leslie; Garrison, Jeffrey; Buckley-Beason, Valerie A.; Jahrling, Jordan; Hensley, Lisa E.; Schoepp, Randal J.; Norwood, David A.; Goba, Augustine; Fair, Joseph N.; Kulesh, David A.

2010-01-01

Viral hemorrhagic fever is caused by a diverse group of single-stranded, negative-sense or positive-sense RNA viruses belonging to the families Filoviridae (Ebola and Marburg), Arenaviridae (Lassa, Junin, Machupo, Sabia, and Guanarito), and Bunyaviridae (hantavirus). Disease characteristics in these families mark each with the potential to be used as a biological threat agent. Because other diseases have similar clinical symptoms, specific laboratory diagnostic tests are necessary to provide the differential diagnosis during outbreaks and for instituting acceptable quarantine procedures. We designed 48 TaqMan™-based polymerase chain reaction (PCR) assays for specific and absolute quantitative detection of multiple hemorrhagic fever viruses. Forty-six assays were determined to be virus-specific, and two were designated as pan assays for Marburg virus. The limit of detection for the assays ranged from 10 to 0.001 plaque-forming units (PFU)/PCR. Although these real-time hemorrhagic fever virus assays are qualitative (presence of target), they are also quantitative (measure a single DNA/RNA target sequence in an unknown sample and express the final results as an absolute value (e.g., viral load, PFUs, or copies/mL) on the basis of concentration of standard samples and can be used in viral load, vaccine, and antiviral drug studies. PMID:20439981

Ultrasensitive and selective signal-on electrochemical DNA detection via exonuclease III catalysis and hybridization chain reaction amplification.

PubMed

Ren, Wang; Gao, Zhong Feng; Li, Nian Bing; Luo, Hong Qun

2015-01-15

This work reported a novel, ultrasensitive, and selective platform for electrochemical detection of DNA, employing an integration of exonuclease III (Exo-III) assisted target recycling and hybridization chain reaction (HCR) for the dual signal amplification strategy. The hairpin capture probe DNA (C-DNA) with an Exo-III 3' overhang end was self-assembled on a gold electrode. In the presence of target DNA (T-DNA), C-DNA hybridized with the T-DNA to form a duplex region, exposing its 5' complementary sequence (initiator). Exo-III was applied to selectively digest duplex region from its 3-hydroxyl termini until the duplex was fully consumed, leaving the remnant initiator. The intact T-DNA spontaneously dissociated from the structure and then initiated the next hybridization process as a result of catalysis of the Exo-III. HCR event was triggered by the initiator and two hairpin helper signal probes labeled with methylene blue, facilitating the polymerization of oligonucleotides into a long nicked dsDNA molecule. The numerous exposed remnant initiators can trigger more HCR events. Because of integration of dual signal amplification and the specific HCR process reaction, the resultant sensor showed a high sensitivity for the detection of the target DNA in a linear range from 1.0 fM to 1.0 nM, and a detection limit as low as 0.2 fM. The proposed dual signal amplification strategy provides a powerful tool for detecting different sequences of target DNA by changing the sequence of capture probe and signal probes, holding a great potential for early diagnosis in gene-related diseases. Copyright © 2014 Elsevier B.V. All rights reserved.

[High resolution melting analysis for detecting of JAK2V617F mutation in patients with myeloproliferative neoplasms].

PubMed

Chen, Hai-Hua; Yang, Ji-Long; Lu, Hui-Fang; Zhou, Wei-Jun; Yao, Fei; Deng, Lan

2014-02-01

This study was purposed to investigate the feasibility of high resolution melting (HRM) in the detection of JAK2V617F mutation in patients with myeloproliferative neoplasm (MPN). The 29 marrow samples randomly selected from patients with clinically diagnosed MPN from January 2008 to January 2011 were detected by HRM method. The results of HRM analysis were compared with that detected by allele specific polymerase chain reaction (AS-PCR) and DNA direct sequencing. The results showed that the JAK2V617F mutations were detected in 11 (37.9%, 11/29) cases by HRM, and its comparability with the direct sequencing result was 100%. While the consistency of AS-PCR with the direct sequencing was moderate (Kappa = 0.179, P = 0.316). It is concluded that the HRM analysis may be an optimal method for clinical screening of JAK2V617F mutation due to its simplicity and promptness with a high specificity.

Typing of artiodactyl MHC-DRB genes with the help of intronic simple repeated DNA sequences.

PubMed

Schwaiger, F W; Buitkamp, J; Weyers, E; Epplen, J T

1993-02-01

An efficient oligonucleotide typing method for the highly polymorphic MHC-DRB genes is described for artiodactyls like cattle, sheep and goat. By means of the polymerase chain reaction, the second exon of MHC-DRB is amplified as well as part of the adjacent intron containing a mixed simple repeat sequence. Using this primer combination we were able to amplify the MHC-DRB exons 2 and adjacent introns from all of the investigated 10 species of the family of Bovidae and giraffes. Therefore, the DRB genes of novel artiodactyl species can also be readily studied. Oligonucleotide probes specific for the polymorphisms of ungulate DRB genes are used with which sequences differing in at least one single base can be distinguished. Exonic polymorphism was found to be correlated with the allele lengths and the patterns of the repeat structures. Hence oligonucleotide probes specific for different simple repeats and polymorphic positions serve also for typing across species barriers. The strict correlation of sequence length and exonic polymorphism permits a preselection of specific oligonucleotides for hybridization. Thus more than 20 alleles can already be differentiated from each of the three species.

A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

PubMed Central

Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

2008-01-01

Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880

Molecular diagnostics of periodontitis.

PubMed

Korona-Głowniak, Izabela; Siwiec, Radosław; Berger, Marcin; Malm, Anna; Szymańska, Jolanta

2017-01-28

The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host's health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization) come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR), real-time polymerase chain reaction (real-time PCR), 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), as well as terminal restriction fragment length polymorphism (TRFLP) and next generation sequencing (NGS). The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.

Development and validation of a multiplex quantitative polymerase chain reaction assay for the detection of Mollicutes impurities in human cells, cultured under good manufacturing practice conditions, and following European Pharmacopoeia requirements and the International Conference on Harmonization guidelines.

PubMed

Vanni, Irene; Ugolotti, Elisabetta; Raso, Alessandro; Di Marco, Eddi; Melioli, Giovanni; Biassoni, Roberto

2012-07-01

The clinical applications of in vitro manipulated cultured cells and their precursors are often made use of in therapeutic trials. However, tissue cultures can be easily contaminated by the ubiquitous Mollicutes micro-organisms, which can cause various and severe alterations in cellular function. Thus methods able to detect and trace Mollicutes impurities contaminating cell cultures are required before starting any attempt to grow cells under good manufacturing practice (GMP) conditions. We developed a multiplex quantitative polymerase chain reaction (qPCR) assay specific for the 16S-23S rRNA intergenic spacer regions, for the Tuf and P1 cytoadhesin genes, able to detect contaminant Mollicutes species in a single tube reaction. The system was validated by analyzing different cell lines and the positive samples were confirmed by 16S and P1 cytoadhesin gene dideoxy sequencing. Our multiplex qPCR detection system was able to reach a sensitivity, specificity and robustness comparable with the culture and the indicator cell culture method, as required by the European Pharmacopoeia guidelines. We have developed a multiplex qPCR method, validated following International Conference on Harmonization (ICH) guidelines, as a qualitative limit test for impurities, assessing the validation characteristics of limit of detection and specificity. It also follows the European Pharmacopoeia guidelines and Food and Drug Administration (FDA) requirements.

Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

PubMed Central

deWit, D; Wootton, M; Allan, B; Steyn, L

1993-01-01

A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752

A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

PubMed

Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

2014-01-01

A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

A Two-Step Lyssavirus Real-Time Polymerase Chain Reaction Using Degenerate Primers with Superior Sensitivity to the Fluorescent Antigen Test

PubMed Central

Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael

2014-01-01

A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible. PMID:24822188

Serine proteases in rodent hippocampus.

PubMed

Davies, B J; Pickard, B S; Steel, M; Morris, R G; Lathe, R

1998-09-04

Brain serine proteases are implicated in developmental processes, synaptic plasticity, and in disorders including Alzheimer's disease. The spectrum of the major enzymes expressed in brain has not been established previously. We now present a systematic study of the serine proteases expressed in adult rat and mouse hippocampus. Using a combination of techniques including polymerase chain reaction amplification and Northern blotting we show that tissue-type plasminogen activator (t-PA) is the major species represented. Unexpectedly, the next most abundant species were RNK-Met-1, a lymphocyte protease not reported previously in brain, and two new family members, BSP1 (brain serine protease 1) and BSP2. We report full-length sequences of the two new proteases; homologies indicate that these are of tryptic specificity. Although BSP2 is expressed in several brain regions, BSP1 expression is strikingly restricted to hippocampus. Other enzymes represented, but at lower levels, included elastase IV, proteinase 3, complement C2, chymotrypsin B, chymotrypsin-like protein, and Hageman factor. Although thrombin and urokinase-type plasminogen activator were not detected in the primary screen, low level expression was confirmed using specific polymerase chain reaction primers. In contrast, and despite robust expression of t-PA, the usual t-PA substrate plasminogen was not expressed at detectable levels.

A polymerase chain reaction assay for detection of virulent and attenuated strains of duck plague virus.

PubMed

Xie, Liji; Xie, Zhixun; Huang, Li; Wang, Sheng; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Luo, Sisi

2017-11-01

Sequence analysis of duck plague virus (DPV) revealed that there was a 528bp (B fragment) deletion within the UL2 gene of DPV attenuated vaccine strain in comparison with field virulent strains. The finding of gene deletion provides a potential differentiation test between DPV virulent strain and attenuated strain based on their UL2 gene sizes. Thus we developed a polymerase chain reaction (PCR) assay targeting to the DPV UL2 gene for simultaneous detection of DPV virulent strain and attenuated strain, 827bp for virulent strain and 299bp for attenuated strain. This newly developed PCR for DPV was highly sensitive and specific. It detected as low as 100fg of DNA on both DPV virulent and attenuated strains, no same size bands were amplified from other duck viruses including duck paramyxovirus, duck tembusu virus, duck circovirus, Muscovy duck parvovirus, duck hepatitis virus type I, avian influenza virus and gosling plague virus. Therefore, this PCR assay can be used for the rapid, sensitive and specific detection of DPV virulent and attenuated strains affecting ducks. Copyright © 2017. Published by Elsevier B.V.

T cell receptor (TCR) structure of autologous melanoma-reactive cytotoxic T lymphocyte (CTL) clones: tumor-infiltrating lymphocytes overexpress in vivo the TCR beta chain sequence used by an HLA-A2- restricted and melanocyte-lineage-specific CTL clone

PubMed Central

1993-01-01

HLA-A2+ melanomas express common melanoma-associated antigens (Ags) recognized in vitro by autologous cytotoxic T lymphocytes (CTL). However, it is not known whether tumor Ags can drive in vivo a selective accumulation/expansion of Ag-specific, tumor-infiltrating T lymphocytes (TIL). Therefore, to evaluate this possibility, 39 CTL clones isolated from several independent mixed lymphocyte tumor cultures (MLTC) of TIL and peripheral blood lymphocytes (PBL) of an HLA- A2+ melanoma patient and selected for T cell receptor (TCR)-dependent, HLA-restricted tumor lysis, were used for analysis of TCR alpha and beta chain structure by the cDNA polymerase chain reaction (PCR) technique with variable gene-specific primers followed by sequencing. Despite absence of oligoclonality in fresh TIL and PBL, as well as in T cells of day 28 MLTC (day of cloning), sequence analysis of TCR alpha and beta chains of TIL clones revealed a dominance of a major category of melanoma-specific, HLA-A2-restricted T cells expressing a V alpha 8.2/J alpha AP511/C alpha and V beta 2.1/D beta 1/J beta 1.1/C beta 1 TCR. The same TCR was also found in 2 out of 14 PBL clones. The other PBL clones employed a V alpha 2.1 gene segment associated with either V beta 13.2, 14, or w22. Clones A81 (V alpha 2.1/J alpha IGRJ alpha 04/C alpha and V beta 14/D beta 1/J beta 1.2/C beta 1) and A21 (V alpha 8.2/J alpha AP511/C alpha and V beta 2.1/D beta 1/J beta 1.1/C beta 1), representative of the two most frequent TCR of PBL and TIL, respectively, expressed different lytic patterns, but both were HLA-A2 restricted and lysed only HLA-A2+ melanomas and normal melanocytes, thus indicating recognition of two distinct HLA-A2-associated and tissue-related Ags. Finally, by the inverse PCR technique, the specific TCR beta chain (V beta 2.1/D beta 1/J beta 1.1/C beta 1) expressed by the dominant TIL clone was found to represent 19 and 18.4% of all V beta 2 sequences expressed in the fresh tumor sample and in the purified TIL, respectively, but < 0.19% of V beta 2+ sequences expressed in PBL. These results are consistent with the hypothesis that a clonal expansion/accumulation of a melanocyte-lineage-specific and HLA-A2-restricted T cell clone occurred in vivo at the site of tumor growth. PMID:8376931

Analytical validation of a real-time reverse transcription polymerase chain reaction test for Pan-American lineage H7 subtype Avian influenza viruses

USGS Publications Warehouse

Spackman, Erica; Ip, Hon S.; Suarez, D.L.; Slemons, R.D.; Stallknecht, D.E.

2008-01-01

A real-time reverse transcription polymerase chain reaction test for the identification of the H7 subtype in North American Avian influenza viruses (AIVs) was first reported in 2002; however, recent AIV surveillance efforts in wild birds and H7 outbreaks in poultry demonstrated that the 2002 test did not detect all H7 AIVs present in North and South America. Therefore, a new test, the 2008 Pan-American H7 test, was developed by using recently available H7 nucleotide sequences. The analytical specificity of the new assay was characterized with an RNA panel composed of 19 H7 viruses from around the world and RNA from all hemagglutinin subtypes except H16. Specificity for North and South American lineage H7 viruses was observed. Assay limits of detection were determined to be between 103 and 104 gene copies per reaction with in vitro transcribed RNA, and 100.0 and 10 0.8 50% egg infectious doses per reaction. The 2008 Pan-American H7 test also was shown to perform similarly to the 2002 test with specimens from chickens experimentally exposed to A/Chicken/BritishColumbia/314514-2/04 H7N3 highly pathogenic AIV. Furthermore, the 2008 test was able to detect 100% (n = 27) of the H7 AIV isolates recovered from North American wild birds in a 2006-2007 sample set (none of which were detected by the 2002 H7 test).

[A new variant of the simian T-lymphotropic retrovirus type I (STLV-IF) in the Sukhumi colony of hamadryas baboons].

PubMed

Chikobaeva, M G; Schatzl, H; Rose, D; Bush, U; Iakovleva, L A; Deinhardt, F; Helm, K; Lapin, B A

1993-01-01

Polymerase chain reaction (PCR) was developed for the detection of simian T-lymphotropic virus type 1 (STLV-1) infection of P. hamadryas and direct sequencing using oligo-nucleotide primer pairs specific for the tax and env regions of the related human T-lymphotropic virus type 1 (HTLV-1). Excellent specificity was shown in the detection of STLV-1 provirus in infected baboons by PCR using HTLV-1-derived primers. The nucleotide sequences of env 467bp and tax 159bp of the proviral genome (env position 5700-6137, tax position 7373-7498 HTLV-1, according to Seiki et al., 1983) derived from STLV-1-infected P. hamadryas were analysed using PCR and direct sequencing techniques. Two STLV-1 isolates from different sources (Sukhumi main-SuTLV-1 and forest stocks-STLV-1F) were compared. Two variants of STLV-1 among P. hamadryas with different level of homology to HTLV-1 were wound (83.8% and 95.2%, respectively). A possible role of nucleotide changes in env and tax sequenced fragments and oncogenicity of STLV-1 variants is discussed.

Isolation of a sex-linked DNA sequence in cranes.

PubMed

Duan, W; Fuerst, P A

2001-01-01

A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.

New single-copy nuclear genes for scale insect systematics

USDA-ARS?s Scientific Manuscript database

Despite the advent of next-generation sequencing, the polymerase chain reaction (PCR) and Sanger sequencing remain useful tools for molecular identification and systematics. To date, molecular systematics of scale insects has been constrained by the paucity of loci that researchers have been able to...

Detection and identification of cutaneous leishmaniasis isolates by culture, Polymerase chain reaction and sequence analyses in Syrian and Central Anatolia patients.

PubMed

Beyhan, Yunus E; Karakus, Mehmet; Karagoz, Alper; Mungan, Mesut; Ozkan, Aysegul T; Hokelek, Murat

2017-09-01

To characterize the cutaneous leishmaniasis (CL) isolates of Syrian and Central Anatolia patients at species levels. Methods: Skin scrapings of 3 patients (2 Syrian, 1 Turkish) were taken and examined by direct examination, culture in Novy-MacNeal-Nicole (NNN) medium, internal transcribed spacer polymerase chain reaction and sequence analysis (PCR). Results:According to microscopic examination, culture and PCR methods, 3 samples were detected positive. The sequencing results of all isolates in the study were identified as Leishmania tropica. The same genotypes were detected in the 3 isolates and nucleotide sequence submitted into GenBank with the accession number: KP689599. Conclusion: This finding could give information about the transmission of CL between Turkey and Syria. Because of the Syrian civil war, most of the Syrian citizens circulating in Turkey and different part of Europe, this can be increase the risk of spreading the disease. So, prevention measurements must be taken urgently.

Identification of the structural mutation responsible for the dibucaine-resistant (atypical) variant form of human serum cholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

McGuire, M.C.; Nogueira, C.P.; Bartels, C.F.

1989-02-01

A point mutation in the gene for human serum cholinesterase was identified that changes Asp-70 to Gly in the atypical form of serum cholinesterase. The mutation in nucleotide 209, which changes codon 70 from GAT to GGT, was found by sequencing a genomic clone and sequencing selected regions of DNA amplified by the polymerase chain reaction. The entire coding sequences for usual and atypical cholinesterases were compared, and no other consistent base differences were found. The nucleotide-209 mutation was detected in all five atypical cholinesterase families examined. There was complete concordance between this mutation and serum cholinesterase phenotypes for allmore » 14 heterozygous and 6 homozygous atypical subjects tested. The mutation causes the loss of a Sau3A1 restriction site; the resulting DNA fragment length polymorphism was verified by electrophoresis of {sup 32}P-labeled DNA restriction fragments from usual and atypical subjects. Dot-blot hybridization analysis with a 19-mer allele-specific probe to the DNA amplified by the polymerase chain reaction distinguished between the usual and atypical genotypes. The authors conclude that the Asp-70 {yields} Gly mutation accounts for reduced affinity of atypical cholinesterase for choline esters and that Asp-70 must be an important component of the anionic site. Heterogeneity in atypical alleles may exist, but the Asp-70 point mutation may represent an appreciable portion of the atypical gene pool.« less

Acid-fast Smear and Histopathology Results Provide Guidance for the Appropriate Use of Broad-Range Polymerase Chain Reaction and Sequencing for Mycobacteria.

PubMed

Miller, Kennon; Harrington, Susan M; Procop, Gary W

2015-08-01

New molecular diagnostic tests are attractive because of the potential they hold for improving diagnostics in microbiology. The value of these tests, which is often assumed, should be investigated to determine the best use of these potentially powerful tools. To investigate the usefulness of broad-range polymerase chain reaction (PCR), followed by sequencing, in mycobacterial infections. We reviewed the test performance of acid-fast bacilli (AFB) PCR and traditional diagnostic methods (histopathology, AFB smear, and culture). We assessed the diagnostic effect and cost of the unrestricted ordering of broad-range PCR for the detection and identification of mycobacteria in clinical specimens. The AFB PCR was less sensitive than culture and histopathology and was less specific than culture, AFB smear, and histopathology. During 18 months, $93 063 was spent on 183 patient specimens for broad-range PCR and DNA sequencing for mycobacteria to confirm one culture-proven Mycobacterium tuberculosis infection that was also known to be positive by AFB smear and histopathology. In this cohort, there was a false-negative AFB PCR for M tuberculosis and a false-positive AFB PCR for Mycobacterium lentiflavum . Testing of AFB smear-negative specimens from patients without an inflammatory response supportive of a mycobacterial infection is costly and has not been proven to improve patient care. Traditional diagnostics (histopathology, AFB smear, and culture) should remain the primary methods for the detection of mycobacteria in clinical specimens.

Chemical synthesis of oligonucleotides containing a free sulphydryl group and subsequent attachment of thiol specific probes.

PubMed Central

Connolly, B A; Rider, P

1985-01-01

Oligonucleotides containing a free sulphydryl group at their 5'-termini have been synthesised and further derivatised with thiol specific probes. The nucleotide sequence required is prepared using standard solid phase phosphoramidite techniques and an extra round of synthesis is then performed using the S-triphenylmethyl O-methoxymorpholinophosphite derivatives of 2-mercaptoethanol, 3-mercaptopropan (1) ol or 6-mercaptohexan (1) ol. After cleavage from the resin and removal of the phosphate and base protecting groups, this yields an oligonucleotide containing an S-triphenylmethyl group attached to the 5'-phosphate group via a two, three or six carbon chain. The triphenylmethyl group can be readily removed with silver nitrate to give the free thiol. With the three and six carbon chain oligonucleotides, this thiol can be used, at pH 8, for the attachment of thiol specific probes as illustrated by the reaction with fluorescent conjugates of iodoacetates and maleiimides. However, oligonucleotides containing a thiol attached to the 5'-phosphate group via a two carbon chain are unstable at pH 8 decomposing to the free 5'-phosphate and so are unsuitable for further derivatisation. PMID:4011448

Targeting Conserved Genes in Penicillium Species.

PubMed

Peterson, Stephen W

2017-01-01

Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of dideoxynucleotide-labeled fragments or NGS. The sequences are compared to a database of validated isolates. Identification of species indicates the potential of the fungus to make particular mycotoxins.

Design and synthesis of digitally encoded polymers that can be decoded and erased

NASA Astrophysics Data System (ADS)

Roy, Raj Kumar; Meszynska, Anna; Laure, Chloé; Charles, Laurence; Verchin, Claire; Lutz, Jean-François

2015-05-01

Biopolymers such as DNA store information in their chains using controlled sequences of monomers. Here we describe a non-natural information-containing macromolecule that can store and retrieve digital information. Monodisperse sequence-encoded poly(alkoxyamine amide)s were synthesized using an iterative strategy employing two chemoselective steps: the reaction of a primary amine with an acid anhydride and the radical coupling of a carbon-centred radical with a nitroxide. A binary code was implemented in the polymer chains using three monomers: one nitroxide spacer and two interchangeable anhydrides defined as 0-bit and 1-bit. This methodology allows encryption of any desired sequence in the chains. Moreover, the formed sequences are easy to decode using tandem mass spectrometry. Indeed, these polymers follow predictable fragmentation pathways that can be easily deciphered. Moreover, poly(alkoxyamine amide)s are thermolabile. Thus, the digital information encrypted in the chains can be erased by heating the polymers in the solid state or in solution.

Design and synthesis of digitally encoded polymers that can be decoded and erased.

PubMed

Roy, Raj Kumar; Meszynska, Anna; Laure, Chloé; Charles, Laurence; Verchin, Claire; Lutz, Jean-François

2015-05-26

Biopolymers such as DNA store information in their chains using controlled sequences of monomers. Here we describe a non-natural information-containing macromolecule that can store and retrieve digital information. Monodisperse sequence-encoded poly(alkoxyamine amide)s were synthesized using an iterative strategy employing two chemoselective steps: the reaction of a primary amine with an acid anhydride and the radical coupling of a carbon-centred radical with a nitroxide. A binary code was implemented in the polymer chains using three monomers: one nitroxide spacer and two interchangeable anhydrides defined as 0-bit and 1-bit. This methodology allows encryption of any desired sequence in the chains. Moreover, the formed sequences are easy to decode using tandem mass spectrometry. Indeed, these polymers follow predictable fragmentation pathways that can be easily deciphered. Moreover, poly(alkoxyamine amide)s are thermolabile. Thus, the digital information encrypted in the chains can be erased by heating the polymers in the solid state or in solution.

PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, S. N.

2013-08-08

Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

Geographic variation in marine turtle fibropapillomatosis

USGS Publications Warehouse

Greenblatt, R.J.; Work, Thierry M.; Dutton, P.; Sutton, C.A.; Spraker, T.R.; Casey, R.N.; Diez, C.E.; Parker, Dana C.; St. Ledger, J.; Balazs, G.H.; Casey, J.W.

2005-01-01

We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

Geographic variation in marine turtle fibropapillomatosis.

PubMed

Greenblatt, Rebecca J; Work, Thierry M; Dutton, Peter; Sutton, Claudia A; Spraker, Terry R; Casey, Rufina N; Diez, Carlos E; Parker, Denise; St Leger, Judy; Balazs, George H; Casey, James W

2005-09-01

We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

Characterization of a prototype strain of hepatitis E virus.

PubMed Central

Tsarev, S A; Emerson, S U; Reyes, G R; Tsareva, T S; Legters, L J; Malik, I A; Iqbal, M; Purcell, R H

1992-01-01

A strain of hepatitis E virus (SAR-55) implicated in an epidemic of enterically transmitted non-A, non-B hepatitis, now called hepatitis E, was characterized extensively. Six cynomolgus monkeys (Macaca fascicularis) were infected with a strain of hepatitis E virus from Pakistan. Reverse transcription-polymerase chain reaction was used to determine the pattern of virus shedding in feces, bile, and serum relative to hepatitis and induction of specific antibodies. Virtually the entire genome of SAR-55 (7195 nucleotides) was sequenced. Comparison of the sequence of SAR-55 with that of a Burmese strain revealed a high level of homology except for one region encoding 100 amino acids of a putative nonstructural polyprotein. Identification of this region as hypervariable was obtained by partial sequencing of a third isolate of hepatitis E virus from Kirgizia. Images PMID:1731327

[The development of molecular human genetics and its significance for perspectives of modern medicine].

PubMed

Coutelle, C; Speer, A; Grade, K; Rosenthal, A; Hunger, H D

1989-01-01

The introduction of molecular human genetics has become a paradigma for the application of genetic engineering in medicine. The main principles of this technology are the isolation of molecular probes, their application in hybridization reactions, specific gene-amplification by the polymerase chain reaction, and DNA sequencing reactions. These methods are used for the analysis of monogenic diseases by linkage studies and the elucidation of the molecular defect causing these conditions, respectively. They are also the basis for genomic diagnosis of monogenic diseases, introduced into the health care system of the GDR by a national project on Duchenne/Becker muscular dystrophy, Cystic Fibrosis and Phenylketonuria. The rapid development of basic research on the molecular analysis of the human genome and genomic diagnosis indicates, that human molecular genetics is becoming a decisive basic discipline of modern medicine.

Molecular identification of Mango, Mangifera indica L.var. totupura

PubMed Central

Jagarlamudi, Sankar; G, Rosaiah; Kurapati, Ravi Kumar; Pinnamaneni, Rajasekhar

2011-01-01

Mango (>Mangifera indica) belonging to Anacardiaceae family is a fruit that grows in tropical regions. It is considered as the King of fruits. The present work was taken up to identify a tool in identifying the mango species at the molecular level. The chloroplast trnL-F region was amplified from extracted total genomic DNA using the polymerase chain reaction (PCR) and sequenced. Sequence of the dominant DGGE band revealed that Mangifera indica in tested leaves was Mangifera indica (100% similarity to the ITS sequences of Mangifera indica). This sequence was deposited in NCBI with the accession no. GQ927757. Abbreviations AFLP - Amplified fragment length polymorphism , cpDNA - Chloroplast DNA, DDGE - Denaturing gradient gel electrophoresis, DNA - Deoxyribo nucleic acid, EDTA - Ethylenediamine tetraacetic acid, HCl - Hydrochloric acid, ISSR - Inter simple sequence repeats, ITS - Internal transcribed spacer, MATAB - Methyl Ammonium Bromide, Na2SO3 - Sodium sulphite, NaCl - Sodium chloride, NCBI - National Centre for Biotechnology Information, PCR - Polymerase chain reaction, PEG - Polyethylene glycol, RAPD - Randomly amplified polymorphic DNA, trnL-F - Transfer RNA genes start codon- termination codon. PMID:21423885

Development of a reverse transcription quantitative polymerase chain reaction-based assay for broad coverage detection of African and Asian Zika virus lineages.

PubMed

Yang, Yang; Wong, Gary; Ye, Baoguo; Li, Shihua; Li, Shanqin; Zheng, Haixia; Wang, Qiang; Liang, Mifang; Gao, George F; Liu, Lei; Liu, Yingxia; Bi, Yuhai

2017-06-01

The Zika virus (ZIKV) is an arbovirus that has spread rapidly worldwide within recent times. There is accumulating evidence that associates ZIKV infections with Guillain-Barré Syndrome (GBS) and microcephaly in humans. The ZIKV is genetically diverse and can be separated into Asian and African lineages. A rapid, sensitive, and specific assay is needed for the detection of ZIKV across various pandemic regions. So far, the available primers and probes do not cover the genetic diversity and geographic distribution of all ZIKV strains. To this end, we have developed a one-step quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay based on conserved sequences in the ZIKV envelope (E) gene. The detection limit of the assay was determined to be five RNA transcript copies and 2.94 × 10 -3 50% tissue culture infectious doses (TCID 50 ) of live ZIKV per reaction. The assay was highly specific and able to detect five different ZIKV strains covering the Asian and African lineages without nonspecific amplification, when tested against other flaviviruses. The assay was also successful in testing for ZIKV in clinical samples. Our assay represents an improvement over the current methods available for the detection ZIKV and would be valuable as a diagnostic tool in various pandemic regions.

Determination of ABO genotypes with DNA extracted from formalin-fixed, paraffin-embedded tissues.

PubMed

Yamada, M; Yamamoto, Y; Tanegashima, A; Kane, M; Ikehara, Y; Fukunaga, T; Nishi, K

1994-01-01

The gene encoding the specific glycosyltransferases which catalyze the conversion of the H antigen to A or B antigens shows a slight but distinct variation in its allelic nucleotide sequence and can be divided into 6 genotypes when digested with specific restriction enzymes. We extracted DNA from formalin-fixed, paraffin-embedded tissues using SDS/proteinase K treatment followed by phenol/chloroform extraction. The sequence of nucleotides for the A, B and O genes was amplified by the polymerase chain reaction (PCR). DNA fragments of 128 bp and 200 bp could be amplified in the second round of PCR, using an aliquot of the first round PCR product as template. Degraded DNA from paraffin blocks stored for up to 10.7 years could be successfully typed. The ABO genotype was deduced from the digestion patterns with an appropriate combination of restriction enzymes and was compatible with the phenotype obtained from the blood sample.

[Diagnosis of tuberculosis meningitis by detection of adenosine deaminase activity and amplification of nucleotide sequences with PCR].

PubMed

Correa, M F; Armas, E; Díaz, D; de Elguezabal, K; De la Rosa, M L; Calles, G; Adjounian, H; Pedroza, R

2001-01-01

Tuberculous meningitis (TBM) is the most severe and lethal form of tuberculosis. The rapid bacteriological diagnosis with the conventional techniques is nearly impossible in TBM. There for many patients are treated with anti-TBC drugs without a definitive diagnosis. A more fast and accurate diagnostic method is necessary, in order to initiate the treatment on time to prevent the irreversible neurologic sequel or death. We evaluated the use of two rapid methods: Adenosine deaminase activity (ADA) and polymerase chain reaction (PCR) for IS6110 and mtp40 sequences on cerebrospinal fluid (CSF) from chronic meningitis patients. For ADA activity > 8.0 U/L the sensibility and specificity was 80% and 91%. PCR sensibility was 80% and specificity 97%. ADA activity and PCR on CSF could be specially useful as complementary tools in the early diagnosis of TBM.

Use of rDNA polymorphism for identification of Heterophyidae infecting freshwater fishes.

PubMed

Dzikowski, R; Levy, M G; Poore, M F; Flowers, J R; Paperna, I

2004-04-21

Infections by trematodes are among the most common fish-borne zoonoses. Metacercariae of the Family Heterophyidae in marine and freshwater fishes are nonfastidious in their choice of definitive hosts, and therefore, cause infections in human and domestic animals. In the present study, species-specific polymerase chain reaction (PCR) assays were developed for identifying and differentiating the various species examined. Sequencing and aligning the 18S (SSU) rDNA revealed interspecific variation for which species-specific DNA oligonucleotides were designed and used for the identification of 6 heterophyid species recovered from piscivorous birds. The oligonucleotides were further used to evaluate the various stages (cercariae recovered from snails, metacercariae recovered from fish and adult trematodes) of the digeneans. By applying this method we elucidated for the first time the life cycle of Pygidiopsis genata. The phylogenetic interrelationship among the newly sequenced species of Heterophyidae is outlined.

Mapping genes to human chromosome 19

DOE Office of Scientific and Technical Information (OSTI.GOV)

Connolly, Sarah

1996-05-01

For this project, 22 Expressed Sequence Tags (ESTs) were fine mapped to regions of human chromosome 19. An EST is a short DNA sequence that occurs once in the genome and corresponds to a single expressed gene. {sup 32}P-radiolabeled probes were made by polymerase chain reaction for each EST and hybridized to filters containing a chromosome 19-specific cosmid library. The location of the ESTs on the chromosome was determined by the location of the ordered cosmid to which the EST hybridized. Of the 22 ESTs that were sublocalized, 6 correspond to known genes, and 16 correspond to anonymous genes. Thesemore » localized ESTs may serve as potential candidates for disease genes, as well as markers for future physical mapping.« less

Lyme neuroborreliosis in 2 horses.

PubMed

Imai, D M; Barr, B C; Daft, B; Bertone, J J; Feng, S; Hodzic, E; Johnston, J M; Olsen, K J; Barthold, S W

2011-11-01

Lyme neuroborreliosis--characterized as chronic, necrosuppurative to nonsuppurative, perivascular to diffuse meningoradiculoneuritis--was diagnosed in 2 horses with progressive neurologic disease. In 1 horse, Borrelia burgdorferi sensu stricto was identified by polymerase chain reaction amplification of B burgdorferi sensu stricto-specific gene targets (ospA, ospC, flaB, dbpA, arp). Highest spirochetal burdens were in tissues with inflammation, including spinal cord, muscle, and joint capsule. Sequence analysis of ospA, ospC, and flaB revealed 99.9% sequence identity to the respective genes in B burgdorferi strain 297, an isolate from a human case of neuroborreliosis. In both horses, spirochetes were visualized in affected tissues with Steiner silver impregnation and by immunohistochemistry, predominantly within the dense collagenous tissue of the dura mater and leptomeninges.

A statistical approach to detection of copy number variations in PCR-enriched targeted sequencing data.

PubMed

Demidov, German; Simakova, Tamara; Vnuchkova, Julia; Bragin, Anton

2016-10-22

Multiplex polymerase chain reaction (PCR) is a common enrichment technique for targeted massive parallel sequencing (MPS) protocols. MPS is widely used in biomedical research and clinical diagnostics as the fast and accurate tool for the detection of short genetic variations. However, identification of larger variations such as structure variants and copy number variations (CNV) is still being a challenge for targeted MPS. Some approaches and tools for structural variants detection were proposed, but they have limitations and often require datasets of certain type, size and expected number of amplicons affected by CNVs. In the paper, we describe novel algorithm for high-resolution germinal CNV detection in the PCR-enriched targeted sequencing data and present accompanying tool. We have developed a machine learning algorithm for the detection of large duplications and deletions in the targeted sequencing data generated with PCR-based enrichment step. We have performed verification studies and established the algorithm's sensitivity and specificity. We have compared developed tool with other available methods applicable for the described data and revealed its higher performance. We showed that our method has high specificity and sensitivity for high-resolution copy number detection in targeted sequencing data using large cohort of samples.

Molecular studies on larvae of Pseudoterranova parasite of Trichiurus lepturus Linnaeus, 1758 and Pomatomus saltatrix (Linnaeus, 1766) off Brazilian waters.

PubMed

Borges, Juliana N; Cunha, Luiz F G; Miranda, Daniele F; Monteiro-Neto, Cassiano; Santos, Cláudia P

2015-12-01

Pseudoterranova larvae parasitizing cutlassfish Trichiurus lepturus and bluefish Pomatomus saltatrix from Southwest Atlantic coast of Brazil were studied in this work by morphological, ultrastructural and molecular approaches. The genetic analysis were performed for the ITS2 intergenic region specific for Pseudoterranova decipiens, the partial 28S (LSU) of ribosomal DNA and the mtDNA cox-1 region. We obtained results for the 28S region and mtDNA cox-1 that was amplified using the polymerase chain reaction and sequenced to evaluate the phylogenetic relationships between sequences of this study and sequences from the GenBank. The morphological profile indicated that all the nine specimens collected from both fish were L3 larvae of Pseudoterranova sp. The genetic profile confirmed the generic level but due to the absence of similar sequences for adult parasites on GenBank for the regions amplifyied, it was not possible to identify them to the species level. The sequences obtained presented 89% of similarity with Pseudoterranova decipiens (28S sequences) and Contracaecum osculatum B (mtDNA cox-1). The low similarity allied to the fact that the amplification with the specific primer for P. decipiens didn't occur, lead us to conclude that our sequences don't belong to P. decipiens complex.

Serial Reaction Time Learning in Preschool- and School-Age Children.

ERIC Educational Resources Information Center

Thomas, Kathleen M.; Nelson, Charles A.

2001-01-01

Two experiments assessed visuomotor sequence learning in 4- to 10-year-olds using a serial reaction time (SRT) task with random and sequenced trials. Found that children demonstrated sequence-specific decreases in RT. Participants with explicit awareness of the sequence at the session's end showed larger sequence-specific RT decrements than…

Diagnostic application of polymerase chain reaction for detection of Ehrlichia risticii in equine monocytic ehrlichiosis (Potomac horse fever).

PubMed

Biswas, B; Mukherjee, D; Mattingly-Napier, B L; Dutta, S K

1991-10-01

Genomic amplification by the polymerase chain reaction (PCR) was used to identify a unique genomic sequence of Ehrlichia risticii directly in DNA isolated from peripheral-blood buffy coat cells of E. risticii-infected horses (Potomac horse fever) and from infected cell cultures. A specific primer pair, selected from a cloned, species-specific, 1-kb DNA fragment of the E. risticii genome as a template, was used for the amplification of the target DNA of 247 bp. The optimal number of 40 PCR cycles, determined by analyzing an amplification profile obtained with a constant Taq polymerase concentration, was used to achieve maximum amplification of the E. risticii DNA segment. Efficient amplification of target DNA was achieved with specimens processed by either the phenol extraction or rapid lysis method. The specificity of the amplified DNA product was confirmed by the proper size (247 bp) and appropriate restriction enzyme cleavage pattern of the amplified target DNA, as well as by the specific hybridization signal obtained by using a PCR-amplified 185-bp internal DNA probe. A 10(5)- to 10(6)-fold amplification of target DNA, which allowed detection of E. risticii from as few as two to three infected cells in culture and from a very small volume of buffy coat cells from infected horses, was achieved. This PCR amplification procedure was found to be highly specific and sensitive for the detection of E. risticii for the study of Potomac horse fever.

Development of a nested polymerase chain reaction for amplification of a sequence of the p57 gene of Renibacterium salmoninarum that provides a highly sensitive method for detection of the bacterium in salmonid kidney

USGS Publications Warehouse

Chase, D.M.; Pascho, R.J.

1998-01-01

Nucleic acid-based assays have shown promise for diagnosing Renibacterium salmoninarum in tissues and body fluids of salmonids. DeVelopment of a nested polymerase chain reaction (PCR) method to detect a 320 bp DNA segment of the gene encoding the p57 protein of R. salmoninarum is described. Whereas a conventional PCR for a 383 bp segment of the p57 gene reliably detected 1000 R. salmoninarum cells per reaction in kidney tissue, the nested PCR detected as few as 10 R. salmoninarum per reaction in kidney tissue. Two DNA extraction methods for the nested PCR were compared and the correlation between replicate samples was generally higher in samples extracted by the QIAamp system compared with those extracted by the phenol/chloroform method. The specificity of the nested PCR was confirmed by testing DNA extracts of common bacterial fish pathogens and a panel of bacterial species reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA) and the fluorescent antibody test (FAT) for R. salmoninarum. Kidney samples from 74 naturally infected chinook Salmon were examined by the nested PCR, the ELISA, and the FAT, and the detected prevalences of R. salmoninarum were 61, 47, and 43%, respectively.

Engineering the DNA cytosine-5 methyltransferase reaction for sequence-specific labeling of DNA

PubMed Central

Lukinavičius, Gražvydas; Lapinaitė, Audronė; Urbanavičiūtė, Giedrė; Gerasimaitė, Rūta; Klimašauskas, Saulius

2012-01-01

DNA methyltransferases catalyse the transfer of a methyl group from the ubiquitous cofactor S-adenosyl-L-methionine (AdoMet) onto specific target sites on DNA and play important roles in organisms from bacteria to humans. AdoMet analogs with extended propargylic side chains have been chemically produced for methyltransferase-directed transfer of activated groups (mTAG) onto DNA, although the efficiency of reactions with synthetic analogs remained low. We performed steric engineering of the cofactor pocket in a model DNA cytosine-5 methyltransferase (C5-MTase), M.HhaI, by systematic replacement of three non-essential positions, located in two conserved sequence motifs and in a variable region, with smaller residues. We found that double and triple replacements lead to a substantial improvement of the transalkylation activity, which manifests itself in a mild increase of cofactor binding affinity and a larger increase of the rate of alkyl transfer. These effects are accompanied with reduction of both the stability of the product DNA–M.HhaI–AdoHcy complex and the rate of methylation, permitting competitive mTAG labeling in the presence of AdoMet. Analogous replacements of two conserved residues in M.HpaII and M2.Eco31I also resulted in improved transalkylation activity attesting a general applicability of the homology-guided engineering to the C5-MTase family and expanding the repertoire of sequence-specific tools for covalent in vitro and ex vivo labeling of DNA. PMID:23042683

cDNA sequences and organization of IgM heavy chain genes in two holostean fish.

PubMed

Wilson, M R; van Ravenstein, E; Miller, N W; Clem, L W; Middleton, D L; Warr, G W

1995-01-01

Immunoglobulin M heavy chain (mu) sequences of two holostean fish, the bowfin, Amia calva, and the longnose gar, Lepisosteus osseus, were amplified from spleen mRNA by RACE-PCR, cloned, and sequenced. Each mu chain showed the conserved four constant domain structure typical of a secreted mu chain. Southern blot analyses with specific heavy chain variable (VH) and constant (CH) region probes suggest that both fish possess an IgH locus that resembles that of the teleosts, amphibians, and mammals in its organization. The overall sequence similarity of gar and bowfin mu chains was 60% and 48% at the nucleotide and amino acid levels, respectively, while similarity to the mu chains of teleosts and elasmobranchs was lower. The bowfin mu chain possesses a distinctive proline-rich sequence at the C mu 1/C mu 2 boundary; a shorter proline-rich sequence is present at this position in the gar mu chain. Both gar and bowfin show, in their C mu 4 sequences, motifs that could serve as cryptic splice donor sites for the production of mRNA encoding the membrane-bound form of the mu chains, and the bowfin also shows a potential cryptic splice donor site in the C mu 3 exon.

Luminex® xMAP® technology is an effective strategy for high-definition human leukocyte antigen typing of cord blood units prior to listing.

PubMed

Guarene, Marco; Badulli, Carla; Cremaschi, Anna L; Sbarsi, Ilaria; Cacciatore, Rosalia; Tinelli, Carmine; Pasi, Annamaria; Bergamaschi, Paola; Perotti, Cesare G

2018-05-01

Allele-level donor-recipient match at HLA-A, HLA-B, HLA-C and HLA-DRB1 loci impacts the outcome after cord blood transplantation for hematologic malignancies and modifies the strategy of donor selection. High definition of both class I and II HLA loci at time of listing is a way to improve the attractiveness of cord blood bank inventories, reducing the time for donor search and procurement and simplifying donor choice, in particular, for patients of non-European heritage. In 2014, Luminex ® xMAP ® technology was introduced in our laboratory practice and was applied to cord blood units typing. In this study, we evaluated the impact of this strategy in comparison with the platform in use until 2013, relying on LiPA reverse polymerase chain reaction-sequence-specific oligonucleotide (revPCR-SSO) plus polymerase chain reaction-sequence-specific primer (PCR-SSP). In 2014, the time for testing was shorter (141 vs 181 days on average), the number of test repetitions was lower (in particular for HLA-A locus, p = 0.026), and the cost reduced (240.7 vs 395.6 euros per unit on average) compared to 2013, demonstrating that Luminex xMAP technology is superior to the previous approach. Luminex xMAP platform has useful application in cord blood banking programs, to achieve high-definition HLA typing of cord blood units at the time of banking in a quick, accurate, and cost-effective manner.

Development of sandwich-form biosensor to detect Mycobacterium tuberculosis complex in clinical sputum specimens.

PubMed

Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh

2014-01-01

Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

Fatal Case of Deer Tick Virus Encephalitis

PubMed Central

Tavakoli, Norma P.; Wang, Heng; Dupuis, Michelle; Hull, Rene; Ebel, Gregory D.; Gilmore, Emily J.; Faust, Phyllis L.

2010-01-01

SUMMARY Deer tick virus is related to Powassan virus, a tickborne encephalitis virus. A 62-year-old man presented with a meningoencephalitis syndrome and eventually died. Analyses of tissue samples obtained during surgery and at autopsy revealed a widespread necrotizing meningoencephalitis. Nucleic acid was extracted from formalin-fixed tissue, and the presence of deer tick virus was verified on a flavivirus-specific polymerase-chain-reaction (PCR) assay, followed by sequence confirmation. Immunohistochemical analysis with antisera specific for deer tick virus identified numerous immunoreactive neurons, with prominent involvement of large neurons in the brain stem, cerebellum, basal ganglia, thalamus, and spinal cord. This case demonstrates that deer tick virus can be a cause of fatal encephalitis. PMID:19439744

Fatal case of deer tick virus encephalitis.

PubMed

Tavakoli, Norma P; Wang, Heng; Dupuis, Michelle; Hull, Rene; Ebel, Gregory D; Gilmore, Emily J; Faust, Phyllis L

2009-05-14

Deer tick virus is related to Powassan virus, a tickborne encephalitis virus. A 62-year-old man presented with a meningoencephalitis syndrome and eventually died. Analyses of tissue samples obtained during surgery and at autopsy revealed a widespread necrotizing meningoencephalitis. Nucleic acid was extracted from formalin-fixed tissue, and the presence of deer tick virus was verified on a flavivirus-specific polymerase-chain-reaction (PCR) assay, followed by sequence confirmation. Immunohistochemical analysis with antisera specific for deer tick virus identified numerous immunoreactive neurons, with prominent involvement of large neurons in the brain stem, cerebellum, basal ganglia, thalamus, and spinal cord. This case demonstrates that deer tick virus can be a cause of fatal encephalitis. 2009 Massachusetts Medical Society

NASBA: A detection and amplification system uniquely suited for RNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sooknanan, R.; Malek, L.T.

1995-06-01

The invention of PCR (polymerase chain reaction) has revolutionized our ability to amplify and manipulate a nucleic acid sequence in vitro. The commercial rewards of this revolution have driven the development of other nuclei acid amplification and detection methodologies. This has created an alphabet soup of technologies that use different amplification methods, including NASBA (nucleic acid sequence-based amplification), LCR (ligase chain reaction), SDA (strand displacement amplification), QBR (Q-beta replicase), CPR (cycling probe reaction), and bDNA (branched DNA). Despite the differences in their processes, these amplification systems can be separated into two broad categories based on how they achieve their goal:more » sequence-based amplification systems, such as PCR, NASBA, and SDA, amplify a target nucleic acid sequence. Signal-based amplification systems, such as LCR, QBR, CPR and bDNA, amplify or alter a signal from a detection reaction that is target-dependent. While the various methods have relative strengths and weaknesses, only NASBA offers the unique ability to homogeneously amplify an RNA analyte in the presence of homologous genomic DNA under isothermal conditions. Since the detection of RNA sequences almost invariably measures biological activity, it is an excellent prognostic indicator of activities as diverse as virus production, gene expression, and cell viability. The isothermal nature of the reaction makes NASBA especially suitable for large-scale manual screening. These features extend NASBA`s application range from research to commercial diagnostic applications. Field test kits are presently under development for human diagnostics as well as the burgeoning fields of food and environmental diagnostic testing. These developments suggest future integration of NASBA into robotic workstations for high-throughput screening as well. 17 refs., 1 tab.« less

Development of polymerase chain reaction-based diagnostic tests for detection of Malsoor virus & adenovirus isolated from Rousettus species of bats in Maharashtra, India.

PubMed

Shete, Anita M; Yadav, Pragya; Kumar, Vimal; Nikam, Tushar; Mehershahi, Kurosh; Kokate, Prasad; Patil, Deepak; Mourya, Devendra T

2017-01-01

Bats are recognized as important reservoirs for emerging infectious disease and some unknown viral diseases. Two novel viruses, Malsoor virus (family Bunyaviridae, genus, Phlebovirus) and a novel adenovirus (AdV) (family, Adenoviridae genus, Mastadenovirus), were identified from Rousettus bats in the Maharashtra State of India. This study was done to develop and optimize real time reverse transcription - polymerase chain reaction (RT-PCR) assays for Malsoor virus and real time and nested PCR for adenovirus from Rousettus bats. For rapid and accurate screening of Malsoor virus and adenovirus a nested polymerase chain reaction and TaqMan-based real-time PCR were developed. Highly conserved region of nucleoprotein gene of phleboviruses and polymerase gene sequence from the Indian bat AdV isolate polyprotein gene were selected respectively for diagnostic assay development of Malsoor virus and AdV. Sensitivity and specificity of assays were calculated and optimized assays were used to screen bat samples. Molecular diagnostic assays were developed for screening of Malsoor virus and AdV and those were found to be specific. Based on the experiments performed with different parameters, nested PCR was found to be more sensitive than real-time PCR; however, for rapid screening, real-time PCR can be used and further nested PCR can be used for final confirmation or in those laboratories where real-time facility/expertise is not existing. This study reports the development and optimization of nested RT-PCR and a TaqMan-based real-time PCR for Malsoor virus and AdV. The diagnostic assays can be used for rapid detection of these novel viruses to understand their prevalence among bat population.

Development of EST Intron-Targeting SNP Markers for Panax ginseng and Their Application to Cultivar Authentication.

PubMed

Wang, Hongtao; Li, Guisheng; Kwon, Woo-Saeng; Yang, Deok-Chun

2016-06-04

Panax ginseng is one of the most valuable medicinal plants in the Orient. The low level of genetic variation has limited the application of molecular markers for cultivar authentication and marker-assisted selection in cultivated ginseng. To exploit DNA polymorphism within ginseng cultivars, ginseng expressed sequence tags (ESTs) were searched against the potential intron polymorphism (PIP) database to predict the positions of introns. Intron-flanking primers were then designed in conserved exon regions and used to amplify across the more variable introns. Sequencing results showed that single nucleotide polymorphisms (SNPs), as well as indels, were detected in four EST-derived introns, and SNP markers specific to "Gopoong" and "K-1" were first reported in this study. Based on cultivar-specific SNP sites, allele-specific polymerase chain reaction (PCR) was conducted and proved to be effective for the authentication of ginseng cultivars. Additionally, the combination of a simple NaOH-Tris DNA isolation method and real-time allele-specific PCR assay enabled the high throughput selection of cultivars from ginseng fields. The established real-time allele-specific PCR assay should be applied to molecular authentication and marker assisted selection of P. ginseng cultivars, and the EST intron-targeting strategy will provide a potential approach for marker development in species without whole genomic DNA sequence information.

The DL1 repeats in the genome of Diphyllobothrium latum.

PubMed

Usmanova, Nadezhda M; Kazakov, Vasiliy I

2010-07-01

Diphyllobothrium latum is a widespread intestinal parasite, which has a great clinical relevance, but there are no sequences of its nuclear genome. In this paper, a repetitive element in the D. latum genome is firstly described. The adult D. latum was obtained in the result of expulsion from intestinum of a patient suffering from diphyllobothriasis. Genomic DNA was isolated from several proglottids of this individual. PstI restriction products of D. latum genomic DNA were sequenced. Polymerase chain reaction (PCR) amplification of these products using genomic DNA and selected primers was carried out. Thereby a cluster of a repetitive element, called DL1, was discovered. For precise identification of a beginning and an end of the repeat, a product of PCR amplification of D. latum genomic DNA with one specific primer was sequenced. In discussion, several evidences that DL1 repeat is a member of the SINE family of retroposons were adduced.

Sex determination of ovine embryos by SRY and amelogenin (AMEL) genes using maternal circulating cell free DNA.

PubMed

Saberivand, Adel; Ahsan, Sima

2016-01-01

Simple and precise methods for sex determination in animals are a pre-requisite for a number of applications in animal production and forensics. Some of the existing methods depend only on the detection of Y-chromosome specific sequences. However, the detection of Y and X-chromosome specific sequences is advantageous. In the present study the accuracy of sex determination by SRY (sex-determining region Y) and AMEL (Amelogenin) gene detection was assessed using a polymerase chain reaction (PCR) of DNA extracted from free fetal cells in maternal blood, which is noninvasive for fetus and easier to collect. The PCR amplification of SRY primers produced a single band of 171bp from ewes bearing a male fetus, whereas no band was amplified from the DNA extracted from ewes pregnant to a female fetus. Moreover, two bands of 182 and 242bp in male and a single band of 242 in female fetuses were produced by AMEL gene primers in the PCR reaction. Using this technique 100% of samples were successfully sexed, excluding twins. In conclusion, we demonstrated that sex determination using DNA of free fetal cells in maternal plasma is efficient using both SRY and AMEL gene sequences. It also is evident that this method is not suitable for sex determination of twin pregnancies. Copyright © 2015 Elsevier B.V. All rights reserved.

Development of a panel of seven duplex real-time PCR assays for detecting 13 streptococcal superantigens.

PubMed

Yang, Peng; Peng, Xiaomin; Cui, Shujuan; Shao, Junbin; Zhu, Xuping; Zhang, Daitao; Liang, Huijie; Wang, Quanyi

2013-07-30

Streptococcal superantigens (SAgs) are the major virulence factors of infection in humans for group A Streptococcus (GAS) bacteria. A panel consisting of seven duplex real-time PCR assays was developed to simultaneously detect 13 streptococcal SAgs and one internal control which may be important in the control of GAS-mediated diseases. Primer and probe sequences were selected based on the highly conserved region from an alignment of nucleotide sequences of the 13 streptococcal SAgs. The reaction conditions of the duplex real-time PCR were optimized and the specificity of the duplex assays was evaluated using SAg positive strains. The limit of detection of the duplex assays was determined by using 10-fold serial dilutions of the DNA of 13 streptococcal SAgs and compared to a conventional polymerase chain reaction (PCR) method for evaluating the duplex assays sensitivity. Using the duplex assays, we were able to differentiate between 13 SAgs from Streptococcus strains and other non-Streptococcus bacteria without cross-reaction. On the other hand, the limit of detection of the duplex assays was at least one or two log dilutions lower than that of the conventional PCR. The panel was highly specific (100%) and the limit of detection of these duplex groups was at least ten times lower than that obtained by using a conventional PCR method.

Identification of the bacterial etiology of culture-negative endocarditis by amplification and sequencing of a small ribosomal RNA gene.

PubMed

Khulordava, Irakli; Miller, Geraldine; Haas, David; Li, Haijing; McKinsey, Joel; Vanderende, Daniel; Tang, Yi-Wei

2003-05-01

We report two cases of culture-negative bacterial endocarditis in which the organisms were identified by amplification and sequencing of the bacterial 16S rRNA gene. These results support an important role for polymerase chain reaction followed by direct sequencing to determine the etiology of culture-negative bacterial endocarditis and to guide appropriate antimicrobial therapy.

Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.

PubMed

Igarashi, T; Yamamoto, A; Goto, N

1996-10-01

Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.

A serotype-specific polymerase chain reaction for identification of Pasteurella multocida serotype 1

USGS Publications Warehouse

Rocke, T.E.; Smith, S.R.; Miyamoto, A.; Shadduck, D.J.

2002-01-01

A serotype-specific polymerase chain reaction (PCR) assay was developed for detection and identification of Pasteurella multocida serotype 1, the causative agent of avian cholera in wild waterfowl. Arbitrarily primed PCR was used to detect DNA fragments that distinguish serotype 1 from the other 15 serotypes of P. multocida (with the exception of serotype 14). Oligonucleotide primers were constructed from these sequences, and a PCR assay was optimized and evaluated. PCR reactions consistently resulted in amplification products with reference strains 1 and 14 and all other serotype 1 strains tested, with cell numbers as low as 2.3 cells/ml. No amplification products were produced with other P. multocida serotypes or any other bacterial species tested. To compare the sensitivity and further test the specificity of this PCR assay with traditional culturing and serotyping techniques, tissue samples from 84 Pekin ducks inoculated with field strains of P. multocida and 54 wild lesser snow geese collected during an avian cholera outbreak were provided by other investigators working on avian cholera. PCR was as sensitive (58/64) as routine isolation (52/64) in detecting and identifying P. multocida serotype 1 from the livers of inoculated Pekins that became sick or died from avian cholera. No product was amplified from tissues of 20 other Pekin ducks that received serotypes other than type 1 (serotype 3, 12 × 3, or 10) or 12 control birds. Of the 54 snow geese necropsied and tested for P. multocida, our PCR detected and identified the bacteria from 44 compared with 45 by direct isolation. The serotype-specific PCR we developed was much faster and less labor intensive than traditional culturing and serotyping procedures and could result in diagnosis of serotype 1 pasteurellosis within 24 hr of specimen submission.

Isolation and characterization of microsatellite markers in Fraser fir (Abies fraseri)

Treesearch

S.A. Josserand; K.M. Potter; G. Johnson; J.A. Bowen; J. Frampton; C.D. Nelson

2006-01-01

We describe the isolation and characterization of 14 microsatellite loci from Fraser fir (Abies fraseri). These markers originated from cloned inserts enriched for DNA sequences containing tandem di- and tri-nucleotide repeats. In total, 36 clones were selected, sequenced and evaluated. Polymerase chain reaction (PCR) primers for 14 of these...

A Combined Photochemical and Multicomponent Reaction Approach to Precision Oligomers.

PubMed

Konrad, Waldemar; Bloesser, Fabian R; Wetzel, Katharina S; Boukis, Andreas C; Meier, Michael A R; Barner-Kowollik, Christopher

2018-03-07

We introduce the convergent synthesis of linear monodisperse sequence-defined oligomers through a unique approach, combining the Passerini three-component reaction (P-3CR) and a Diels-Alder (DA) reaction based on photocaged dienes. A set of oligomers is prepared resting on a Passerini linker unit carrying an isocyano group for chain extension by P-3CR and a maleimide moiety for photoenol conjugation enabling a modular approach for chain growth. Monodisperse oligomers are accessible in a stepwise fashion by switching between both reaction types. Employing sebacic acid as a core unit allows the synthesis of a library of symmetric sequence-defined oligomers. The oligomers consist of alternating P-3CR and photoblocks with molecular weights up to 3532.16 g mol -1 , demonstrating the successful switching from P-3CR to photoenol conjugation. In-depth characterization was carried out including size-exclusion chromatography (SEC), high-resolution electrospray ionization mass spectrometry (ESI-MS) and NMR spectroscopy, evidencing the monodisperse nature of the precision oligomers. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular basis of beta-thalassemia in the Maldives.

PubMed

Furuumi, H; Firdous, N; Inoue, T; Ohta, H; Winichagoon, P; Fucharoen, S; Fukumaki, Y

1998-03-01

We have systematically analyzed beta-thalassemia genes using polymerase chain reaction-related techniques, dot-blot hybridization with oligonucleotide probes, allele specific-polymerase chain reaction, and sequencing of amplified DNA fragments from 41 unrelated patients, including 37 beta-thalassemia homozygotes, three with beta-thalassemia/Hb E, and one with beta-thalassemia/Hb S. Four different beta-thalassemia mutations were detected in 78 alleles. These are the IVS-I-5 (G-->C), codon 30 (AGG-->ACG) [also indicated as IVS-I (-1)], IVS-I-1 (G-->A), and codons 41/42 (-TTCT) mutations. The distribution of the beta-thalassemia mutations in the Maldives is 58 alleles (74.3%) with the IVS-I-5 (G-->C) mutation, 12 (15.4%) with the codon 30 (AGG-->ACG) mutation, seven (9%) with the IVS-I-1 (G-->A) mutation, and one with the codons 41/42 (-TTCT) mutation. The first three mutations account for 98.7% of the total number of beta-thalassemia chromosomes studied. These mutations are clustered in the region spanning 6 bp around the junction of exon 1 and the first intervening sequence of the beta-globin gene. These observations have significant implications for setting up a thalassemia prevention and control program in the Maldives. Analysis of haplotypes and frameworks of chromosomes bearing each beta-thalassemia mutation suggested that the origin and spread of these mutations were reflected by the historical record.

Detection of novel strains genetically related to Anaplasma platys in Tunisian one-humped camels (Camelus dromedarius).

PubMed

Belkahia, Hanène; Ben Said, Mourad; Sayahi, Lotfi; Alberti, Alberto; Messadi, Lilia

2015-10-29

Little information is currently available regarding the presence of Anaplasma species in North African dromedaries. To fill this gap in knowledge, the prevalence, risk factors, and genetic diversity of Anaplasma species were investigated in Tunisian dromedary camels. A total of 226 camels from three different bioclimatic areas were sampled and tested for the presence of Anaplasma species by quantitative polymerase chain reaction (qPCR) and nested polymerase chain reaction (nPCR) assays. Detected Anaplasma strains were characterized by 16S rRNA sequence analysis. Overall infection rate of Anaplasma spp. was 17.7%, and was significantly higher in females. Notably, A. marginale, A. centrale, A. bovis, and A. phagocytophilum were not detected. Animals were severely infested by three tick species belonging to the genus Hyalomma (H. dromedarii, H. impeltatum, and H. excavatum). Alignment, similarity comparison, and phylogenetic analysis of the 16S rRNA sequence variants obtained in this study suggest that Tunisian dromedaries are infected by more than one novel Anaplasma strain genetically related to A. platys. This study reports the presence of novel Anaplasma sp. strains genetically related to A. platys in dromedaries from various bioclimatic areas of Tunisia. Findings raise new concerns about the specificity of the direct and indirect diagnostic tests routinely used to detect different Anaplasma species in ruminants and provide useful molecular information to elucidate the evolutionary history of bacterial species related to A. platys.

Dynamics of Delayed p53 Mutations in Mice Given Whole-Body Irradiation at 8 Weeks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Okazaki, Ryuji, E-mail: ryuji-o@med.uoeh-u.ac.j; Ootsuyama, Akira; Kakihara, Hiroyo

2011-01-01

Purpose: Ionizing irradiation might induce delayed genotoxic effects in a p53-dependent manner. However, a few reports have shown a p53 mutation as a delayed effect of radiation. In this study, we investigated the p53 gene mutation by the translocation frequency in chromosome 11, loss of p53 alleles, p53 gene methylation, p53 nucleotide sequence, and p53 protein expression/phosphorylation in p53{sup +/+} and p53{sup +/-} mice after irradiation at a young age. Methods and Materials: p53{sup +/+} and p53{sup +/-} mice were exposed to 3 Gy of whole-body irradiation at 8 weeks of age. Chromosome instability was evaluated by fluorescence in situmore » hybridization analysis. p53 allele loss was evaluated by polymerase chain reaction, and p53 methylation was evaluated by methylation-specific polymerase chain reaction. p53 sequence analysis was performed. p53 protein expression was evaluated by Western blotting. Results: The translocation frequency in chromosome 11 showed a delayed increase after irradiation. In old irradiated mice, the number of mice that showed p53 allele loss and p53 methylation increased compared to these numbers in old non-irradiated mice. In two old irradiated p53{sup +/-} mice, the p53 sequence showed heteromutation. In old irradiated mice, the p53 and phospho-p53 protein expressions decreased compared to old non-irradiated mice. Conclusion: We concluded that irradiation at a young age induced delayed p53 mutations and p53 protein suppression.« less

Identification of the structural mutation responsible for the dibucaine-resistant (atypical) variant form of human serum cholinesterase.

PubMed Central

McGuire, M C; Nogueira, C P; Bartels, C F; Lightstone, H; Hajra, A; Van der Spek, A F; Lockridge, O; La Du, B N

1989-01-01

A point mutation in the gene for human serum cholinesterase was identified that changes Asp-70 to Gly in the atypical form of serum cholinesterase. The mutation in nucleotide 209, which changes codon 70 from GAT to GGT, was found by sequencing a genomic clone and sequencing selected regions of DNA amplified by the polymerase chain reaction. The entire coding sequences for usual and atypical cholinesterases were compared, and no other consistent base differences were found. A polymorphic site near the C terminus of the coded region was detected, but neither allele at this locus segregated consistently with the atypical trait. The nucleotide-209 mutation was detected in all five atypical cholinesterase families examined. There was complete concordance between this mutation and serum cholinesterase phenotypes for all 14 heterozygous and 6 homozygous atypical subjects tested. The mutation causes the loss of a Sau3A1 restriction site; the resulting DNA fragment length polymorphism was verified by electrophoresis of 32P-labeled DNA restriction fragments from usual and atypical subjects. Dot-blot hybridization analysis with a 19-mer allele-specific probe to the DNA amplified by the polymerase chain reaction distinguished between the usual and atypical genotypes. We conclude that the Asp-70----Gly mutation (acidic to neutral amino acid substitution) accounts for reduced affinity of atypical cholinesterase for choline esters and that Asp-70 must be an important component of the anionic site. Heterogeneity in atypical alleles may exist, but the Asp-70 point mutation may represent an appreciable portion of the atypical gene pool. Images PMID:2915989

Detection of Plasmodium sp. in capybara.

PubMed

dos Santos, Leonilda Correia; Curotto, Sandra Mara Rotter; de Moraes, Wanderlei; Cubas, Zalmir Silvino; Costa-Nascimento, Maria de Jesus; de Barros Filho, Ivan Roque; Biondo, Alexander Welker; Kirchgatter, Karin

2009-07-07

In the present study, we have microscopically and molecularly surveyed blood samples from 11 captive capybaras (Hydrochaeris hydrochaeris) from the Sanctuary Zoo for Plasmodium sp. infection. One animal presented positive on blood smear by light microscopy. Polymerase chain reaction was carried out accordingly using a nested genus-specific protocol, which uses oligonucleotides from conserved sequences flanking a variable sequence region in the small subunit ribosomal RNA (ssrRNA) of all Plasmodium organisms. This revealed three positive animals. Products from two samples were purified and sequenced. The results showed less than 1% divergence between the two capybara sequences. When compared with GenBank sequences, a 55% similarity was obtained to Toxoplasma gondii and a higher similarity (73-77.2%) was found to ssrRNAs from Plasmodium species that infect reptile, avian, rodents, and human beings. The most similar Plasmodium sequence was from Plasmodium mexicanum that infects lizards of North America, where around 78% identity was found. This work is the first report of Plasmodium in capybaras, and due to the low similarity with other Plasmodium species, we suggest it is a new species, which, in the future could be denominated "Plasmodium hydrochaeri".

Identification of Y-Chromosome Sequences in Turner Syndrome.

PubMed

Silva-Grecco, Roseane Lopes da; Trovó-Marqui, Alessandra Bernadete; Sousa, Tiago Alves de; Croce, Lilian Da; Balarin, Marly Aparecida Spadotto

2016-05-01

To investigate the presence of Y-chromosome sequences and determine their frequency in patients with Turner syndrome. The study included 23 patients with Turner syndrome from Brazil, who gave written informed consent for participating in the study. Cytogenetic analyses were performed in peripheral blood lymphocytes, with 100 metaphases per patient. Genomic DNA was also extracted from peripheral blood lymphocytes, and gene sequences DYZ1, DYZ3, ZFY and SRY were amplified by Polymerase Chain Reaction. The cytogenetic analysis showed a 45,X karyotype in 9 patients (39.2 %) and a mosaic pattern in 14 (60.8 %). In 8.7 % (2 out of 23) of the patients, Y-chromosome sequences were found. This prevalence is very similar to those reported previously. The initial karyotype analysis of these patients did not reveal Y-chromosome material, but they were found positive for Y-specific sequences in the lymphocyte DNA analysis. The PCR technique showed that 2 (8.7 %) of the patients with Turner syndrome had Y-chromosome sequences, both presenting marker chromosomes on cytogenetic analysis.

Genetic study of KIR and HLA ligands in 235 individuals from Northeastern Thailand.

PubMed

Chaisri, Suwit; Leelayuwat, Chanvit; Romphruk, Amornrat

The diversity of 17 KIR and HLA ligands (HLA-C1, C2, Bw4, A11) were investigated in two hundred and thirty-five unrelated healthy donors in Northeastern Thais (NETs) by the polymerase chain reaction with sequence-specific primer (PCR-SSP) method. The Hardy-Weinberg Equilibrium (HWE) was used to verify genotyping method for dimorphic KIR and HLA. They were in HWE (p>0.05). KIR and HLA ligands frequencies, genotypes, haplotypes and linkage disequilibrium (LD) were presented. The genetic data are available in allele Frequencies Net Database. Copyright © 2017. Published by Elsevier Inc.

Evaluation of real-time PCR detection methods for detecting rice products contaminated by rice genetically modified with a CpTI-KDEL-T-nos transgenic construct.

PubMed

Nakamura, Kosuke; Akiyama, Hiroshi; Kawano, Noriaki; Kobayashi, Tomoko; Yoshimatsu, Kayo; Mano, Junichi; Kitta, Kazumi; Ohmori, Kiyomi; Noguchi, Akio; Kondo, Kazunari; Teshima, Reiko

2013-12-01

Genetically modified (GM) rice (Oryza sativa) lines, such as insecticidal Kefeng and Kemingdao, have been developed and found unauthorised in processed rice products in many countries. Therefore, qualitative detection methods for the GM rice are required for the GM food regulation. A transgenic construct for expressing cowpea (Vigna unguiculata) trypsin inhibitor (CpTI) was detected in some imported processed rice products contaminated with Kemingdao. The 3' terminal sequence of the identified transgenic construct for expression of CpTI included an endoplasmic reticulum retention signal coding sequence (KDEL) and nopaline synthase terminator (T-nos). The sequence was identical to that in a report on Kefeng. A novel construct-specific real-time polymerase chain reaction (PCR) detection method for detecting the junction region sequence between the CpTI-KDEL and T-nos was developed. The imported processed rice products were evaluated for the contamination of the GM rice using the developed construct-specific real-time PCR methods, and detection frequency was compared with five event-specific detection methods. The construct-specific detection methods detected the GM rice at higher frequency than the event-specific detection methods. Therefore, we propose that the construct-specific detection method is a beneficial tool for screening the contamination of GM rice lines, such as Kefeng, in processed rice products for the GM food regulation. Copyright © 2013 Elsevier Ltd. All rights reserved.

Detection and Typing of Human Papilloma Viruses by Nested Multiplex Polymerase Chain Reaction Assay in Cervical Cancer

PubMed Central

Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila

2015-01-01

Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940

Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

PubMed

Cheng, Yu-Huei

2014-12-01

Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

Ultrasensitive electrochemical biosensor for detection of DNA from Bacillus subtilis by coupling target-induced strand displacement and nicking endonuclease signal amplification.

PubMed

Hu, Yuhua; Xu, Xueqin; Liu, Qionghua; Wang, Ling; Lin, Zhenyu; Chen, Guonan

2014-09-02

A simple, ultrasensitive, and specific electrochemical biosensor was designed to determine the given DNA sequence of Bacillus subtilis by coupling target-induced strand displacement and nicking endonuclease signal amplification. The target DNA (TD, the DNA sequence from the hypervarient region of 16S rDNA of Bacillus subtilis) could be detected by the differential pulse voltammetry (DPV) in a range from 0.1 fM to 20 fM with the detection limit down to 0.08 fM at the 3s(blank) level. This electrochemical biosensor exhibits high distinction ability to single-base mismatch, double-bases mismatch, and noncomplementary DNA sequence, which may be expected to detect single-base mismatch and single nucleotide polymorphisms (SNPs). Moreover, the applicability of the designed biosensor for detecting the given DNA sequence from Bacillus subtilis was investigated. The result obtained by electrochemical method is approximately consistent with that by a real-time quantitative polymerase chain reaction detecting system (QPCR) with SYBR Green.

Non-lethal sampling for the detection of Myxobolus cerebralis in asymptomatic rainbow trout

USGS Publications Warehouse

Schill, Bane; Waldrop, Thomas; Densmore, Christine; Blazer, Vicki

1999-01-01

We have described in previous reports (Schill et al., 1998) the development of a polymerase chain reaction (PCR) amplification of 18S ribosomal RNA for the detection of Myxozoan parasites. Oligonucleotide primers were developed by multiple alignment of Myxozoan sequence information and analysis by a custom-written computer program (PRIM). Candidate pairs of primer sequences were then analyzed for specificity by BLAST (Basic Local Alignment Search Tool). From these, a set of promising primers (MYXFWD and MYXREV) was chosen for further testing. These were chosen because they should direct detection of a number of Myxozoan species (Table 1). PCR using MXYFWD and MYXREV proved to be robust and relatively free of artifact products. Further, we were able to routinely detect Myxobolus cerebralis in fish tissues (Figure 1).

Isolation and characterization of cDNAs encoding wheat 3-hydroxy-3-methylglutaryl coenzyme A reductase.

PubMed Central

Aoyagi, K; Beyou, A; Moon, K; Fang, L; Ulrich, T

1993-01-01

The enzyme 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR, EC 1.1.1.34) is a key enzyme in the isoprenoid biosynthetic pathway. We have isolated partial cDNAs from wheat (Triticum aestivum) using the polymerase chain reaction. Comparison of deduced amino acid sequences of these cDNAs shows that they represent a small family of genes that share a high degree of sequence homology among themselves as well as among genes from other organisms including tomato, Arabidopsis, hamster, human, Drosophila, and yeast. Southern blot analysis reveals the presence of at least four genes. Our results concerning the tissue-specific expression as well as developmental regulation of these HMGR cDNAs highlight the important role of this enzyme in the growth and development of wheat. PMID:8108513

Single-cell mRNA cytometry via sequence-specific nanoparticle clustering and trapping

NASA Astrophysics Data System (ADS)

Labib, Mahmoud; Mohamadi, Reza M.; Poudineh, Mahla; Ahmed, Sharif U.; Ivanov, Ivaylo; Huang, Ching-Lung; Moosavi, Maral; Sargent, Edward H.; Kelley, Shana O.

2018-05-01

Cell-to-cell variation in gene expression creates a need for techniques that can characterize expression at the level of individual cells. This is particularly true for rare circulating tumour cells, in which subtyping and drug resistance are of intense interest. Here we describe a method for cell analysis—single-cell mRNA cytometry—that enables the isolation of rare cells from whole blood as a function of target mRNA sequences. This approach uses two classes of magnetic particles that are labelled to selectively hybridize with different regions of the target mRNA. Hybridization leads to the formation of large magnetic clusters that remain localized within the cells of interest, thereby enabling the cells to be magnetically separated. Targeting specific intracellular mRNAs enablescirculating tumour cells to be distinguished from normal haematopoietic cells. No polymerase chain reaction amplification is required to determine RNA expression levels and genotype at the single-cell level, and minimal cell manipulation is required. To demonstrate this approach we use single-cell mRNA cytometry to detect clinically important sequences in prostate cancer specimens.

Female pseudohermaphroditism with multiple caudal anomalies: Absence of Y-specific DNA sequences as pathogenetic factors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seaver, L.H.; Grimes, J.; Erickson, R.P.

1994-05-15

46,XX female pseudohermaphrodites have been previously described with nearly complete masculinization of the external genitalia and no apparent source of testosterone. Multiple malformations of internal genital, urinary, and gastrointestinal tracts are associated. We have evaluated four such infants with female pseudohermaphroditism and multiple caudal anomalies. Three cases had apparently normal chromosome (46,XX); one had a 46,XX,del(10)(q25.3{yields}qter) chromosome constitution. The chromosome breakpoint is in the region of PAX2, a developmentally important paired box gene which is expressed in urogenital tissue. Using the polymerase chain reaction, we screened for the presence of multiple Y specific sequences, including SRY (sex determining region, Ymore » chromosome), that could explain masculinization of the external genitalia. All were negative for Y centromeric sequences, ZFY (Zinc finger Y), and SRY. Furthermore, there was no evidence for adrenal or other sources of testosterone. We suggest that the masculinization in these cases is the result of abnormal expression of genes which would normally be regulated by testosterone. 32 refs., 1 fig., 2 tabs.« less

Market surveillance on non-halal additives incorporated in surimi based products using polymerase chain reaction (PCR)-southern hybridization analysis

NASA Astrophysics Data System (ADS)

Aravindran, S.; Sahilah, A. M.; Aminah, A.

2014-09-01

Halal surveillance on halal ingredients incorporated in surimi based products were studied using polymerase chain reaction (PCR)-southern hybridization on chip analysis. The primers used in this technique were targeted on mitochondria DNA (mtDNA) of cytochrome b (cyt b) gene sequence which able to differentiate 7 type (beef, chicken, duck, goat, buffalo, lamb and pork) of species on a single chip. 17 (n = 17*3) different brands of surimi-based product were purchased randomly from Selangor local market in January 2013. Of 17 brands, 3 (n = 3*3) brands were positive for chicken DNA, 1 (n = 1*3) brand was positive for goat DNA, and the remainder 13 brands (n = 13*3) have no DNA species detected. The sensitivity of PCR-southern hybridization primers to detect each meat species was 0.1 ng. In the present study, it is evidence that PCR-Southern Hybridization analysis offered a reliable result due to its highly specific and sensitive properties in detecting non-halal additive such as plasma protein incorporation in surimi-based product.

Detection and Identification of Psilocybe cubensis DNA Using a Real-Time Polymerase Chain Reaction High Resolution Melt Assay.

PubMed

Cowan, Ashley F; Elkins, Kelly M

2017-12-01

Psilocybe cubensis, or "magic mushroom," is the most common species of fungus with psychedelic characteristics. Two primer sets were designed to target Psilocybe DNA using web-based software and NBCI gene sequences. DNA was extracted from eighteen samples, including twelve mushroom species, using the Qiagen DNeasy ® Plant Mini Kit. The DNA was amplified by the polymerase chain reaction (PCR) using the primers and a master mix containing either a SYBR ® Green I, Radiant™ Green, or LCGreen Plus ® intercalating dye; amplicon size was determined using agarose gel electrophoresis. The PCR assays were tested for amplifiability, specificity, reproducibility, robustness, sensitivity, and multiplexing with primers that target marijuana. The observed high resolution melt (HRM) temperatures for primer sets 1 and 7 were 78.85 ± 0.31°C and 73.22 ± 0.61°C, respectively, using SYBR ® Green I dye and 81.67 ± 0.06°C and 76.04 ± 0.11°C, respectively, using Radiant™ Green dye. © 2017 American Academy of Forensic Sciences.

Rapid detection of duck hepatitis A virus genotype C using reverse transcription loop-mediated isothermal amplification.

PubMed

Li, Chuanfeng; Chen, Zongyan; Meng, Chunchun; Liu, Guangqing

2014-02-01

A one-step reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay was used and optimized to develop a rapid and sensitive detection system for duck hepatitis A virus genotype C (DHAV-C) RNA. A set of four specific primers was designed against highly conserved sequences located within the 3D gene from DHAV (strain GX1201). Under optimal reaction conditions, the sensitivity of DHAV-C-specific RT-LAMP was 100-fold higher than that of reverse transcriptase-polymerase chain reaction (RT-PCR), with a detection limit of 0.3pg (6.59×10(4) copies) per reaction. No cross-reactivity was observed from the samples of other duck viruses, which is in good accordance with RT-PCR. Furthermore, a positive reaction can be visually inspected by observing turbidity or color change after the addition of SYBR green I dye. The DHAV-C-specific RT-LAMP assay was applied to the samples and compared with RT-PCR. The positive-sample ratios were 26.7% (12 of 45) by RT-LAMP and 20% (9 of 45) by RT-PCR. Therefore, the newly developed RT-LAMP assay is a rapid, specific, sensitive, and cost-effective method of DHAV-C detection. This assay has potential applications in both clinical diagnosis and field surveillance of DHAV-C infection. Copyright © 2013. Published by Elsevier B.V.

Expanding the Halohydrin Dehalogenase Enzyme Family: Identification of Novel Enzymes by Database Mining.

PubMed

Schallmey, Marcus; Koopmeiners, Julia; Wells, Elizabeth; Wardenga, Rainer; Schallmey, Anett

2014-12-01

Halohydrin dehalogenases are very rare enzymes that are naturally involved in the mineralization of halogenated xenobiotics. Due to their catalytic potential and promiscuity, many biocatalytic reactions have been described that have led to several interesting and industrially important applications. Nevertheless, only a few of these enzymes have been made available through recombinant techniques; hence, it is of general interest to expand the repertoire of these enzymes so as to enable novel biocatalytic applications. After the identification of specific sequence motifs, 37 novel enzyme sequences were readily identified in public sequence databases. All enzymes that could be heterologously expressed also catalyzed typical halohydrin dehalogenase reactions. Phylogenetic inference for enzymes of the halohydrin dehalogenase enzyme family confirmed that all enzymes form a distinct monophyletic clade within the short-chain dehydrogenase/reductase superfamily. In addition, the majority of novel enzymes are substantially different from previously known phylogenetic subtypes. Consequently, four additional phylogenetic subtypes were defined, greatly expanding the halohydrin dehalogenase enzyme family. We show that the enormous wealth of environmental and genome sequences present in public databases can be tapped for in silico identification of very rare but biotechnologically important biocatalysts. Our findings help to readily identify halohydrin dehalogenases in ever-growing sequence databases and, as a consequence, make even more members of this interesting enzyme family available to the scientific and industrial community. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

No implication of Simian virus 40 in pathogenesis of malignant pleural mesothelioma in Slovenia.

PubMed

Hmeljak, Julija; Kern, Izidor; Cör, Andrej

2010-01-01

Malignant mesothelioma is predominantly caused by asbestos exposure, although the association of Simian virus 40 in its pathogenesis is currently still under debate. Simian virus 40, a DNA rhesus monkey virus with oncogenic properties, accidentally contaminated early batches of polio vaccine in the 1960s. In the 1990s, viral sequences and proteins were discovered in several human tumors, which triggered research to find a link between Simian virus 40 and human cancers, especially malignant mesothelioma. The aim of our study was to establish an effective laboratory procedure for Simian virus 40 detection and to investigate the presence of Simian virus 40 DNA and small t antigen in mesothelioma samples from Slovenian patients. Paraffin-embedded malignant pleural mesothelioma specimens from 103 Slovenian patients were collected and used for total DNA isolation and real-time polymerase chain reaction for Simian virus 40 small t and large T DNA analysis. Special attention was devoted to primer design, good laboratory practice and polymerase chain reaction contamination prevention. Polymerase chain reaction products were sequenced and BLAST aligned. One 5 microm thick paraffin section from each patient's tissue block was stained with hematoxylin and eosin for histological typing and one for immunohistochemical detection of Simian virus 40 small t antigen using a monoclonal antibody against Simian virus 40 (Pab280). SV40-expressing Wi-38 cells were used as positive control in both PCR and immunohistochemistry. In real-time polymerase chain reaction analyses, only 4 samples gave products with primer pairs amplifying small t antigen and were inconsistent and poorly reproducible. BLAST alignment showed no homology with any deposited SV40 sequences. No immunopositive staining for SV40 small t antigen was found in any of the samples. We found no evidence of SV40 presence in tissue samples from 103 Slovenian patients with malignant pleural mesothelioma. Asbestos exposure remains the main risk factor for malignant pleural mesothelioma in Slovenia.

A protein kinase from Colletotrichum trifolii is induced by plant cutin and is required for appressorium formation.

PubMed

Dickman, M B; Ha, Y S; Yang, Z; Adams, B; Huang, C

2003-05-01

When certain phytopathogenic fungi contact plant surfaces, specialized infection structures (appressoria) are produced that facilitate penetration of the plant external barrier; the cuticle. Recognition of this hydrophobic host surface must be sensed by the fungus, initiating the appropriate signaling pathway or pathways for pathogenic development. Using polymerase chain reaction and primers designed from mammalian protein kinase C sequences (PKC), we have isolated, cloned, and characterized a protein kinase from Colletotrichum trifolii, causal agent of alfalfa anthracnose. Though sequence analysis indicated conserved sequences in mammalian PKC genes, we were unable to induce activity of the fungal protein using known activators of PKC. Instead, we show that the C. trifolii gene, designated LIPK (lipid-induced protein kinase) is induced specifically by purified plant cutin or long-chain fatty acids which are monomeric constituents of cutin. PKC inhibitors prevented appressorium formation and, to a lesser extent, spore germination. Overexpression of LIPK resulted in multiple, abnormally shaped appressoria. Gene replacement of lipk yielded strains which were unable to develop appressoria and were unable to infect intact host plant tissue. However, these mutants were able to colonize host tissue following artificial wounding, resulting in typical anthracnose lesions. Taken together, these data indicate a central role in triggering infection structure formation for this protein kinase, which is induced specifically by components of the plant cuticle. Thus, the fungus is able to sense and use host surface chemistry to induce a protein kinase-mediated pathway that is required for pathogenic development.

Distribution of Diego blood group alleles and identification of four novel mutations on exon 19 of SLC4A1 gene in the Chinese Han population by polymerase chain reaction sequence-based typing.

PubMed

Xu, X G; He, J; He, Y M; Tao, S D; Ying, Y L; Zhu, F M; Lv, H J; Yan, L X

2011-04-01

The Diego blood group system plays an important role in transfusion medicine. Genotyping of DI1 and DI2 alleles is helpful for the investigation into haemolytic disease of the newborn (HDN) and for the development of rare blood group databases. Here, we set up a polymerase chain reaction sequence-based typing (PCR-SBT) method for genotyping of Diego blood group alleles. Specific primers for exon 19 of the solute carrier family 4, anion exchanger, member1 (SLC4A1) gene were designed, and our PCR-SBT method was established and optimized for Diego genotyping. A total of 1053 samples from the Chinese Han population and the family members of a rare proband with DI1/DI1 genotype were investigated by the PCR-SBT method. An allele-specific primer PCR (PCR-ASP) was used to verify the reliability of the PCR-SBT method. The frequencies of DI1 and DI2 alleles in the Chinese Han population were 0.0247 and 0.9753, respectively. Six new single nucleotide polymorphisms (SNPs) were found in the sequenced regions of the SLC4A1 gene, and four novel SNPs located in the exon 19, in which one SNP could cause an amino acid alteration of Ala858Ser on erythrocyte anion exchanger protein 1. The genotypes for Diego blood group were identical among 41 selected samples with PCR-ASP and PCR-SBT. The PCR-SBT method can be used in Diego genotyping as a substitute of serological technique when the antisera is lacking and was suitable for screening large numbers of donors in rare blood group databases. © 2010 The Author(s). Vox Sanguinis © 2010 International Society of Blood Transfusion.

Real-time PCR probe optimization using design of experiments approach.

PubMed

Wadle, S; Lehnert, M; Rubenwolf, S; Zengerle, R; von Stetten, F

2016-03-01

Primer and probe sequence designs are among the most critical input factors in real-time polymerase chain reaction (PCR) assay optimization. In this study, we present the use of statistical design of experiments (DOE) approach as a general guideline for probe optimization and more specifically focus on design optimization of label-free hydrolysis probes that are designated as mediator probes (MPs), which are used in reverse transcription MP PCR (RT-MP PCR). The effect of three input factors on assay performance was investigated: distance between primer and mediator probe cleavage site; dimer stability of MP and target sequence (influenza B virus); and dimer stability of the mediator and universal reporter (UR). The results indicated that the latter dimer stability had the greatest influence on assay performance, with RT-MP PCR efficiency increased by up to 10% with changes to this input factor. With an optimal design configuration, a detection limit of 3-14 target copies/10 μl reaction could be achieved. This improved detection limit was confirmed for another UR design and for a second target sequence, human metapneumovirus, with 7-11 copies/10 μl reaction detected in an optimum case. The DOE approach for improving oligonucleotide designs for real-time PCR not only produces excellent results but may also reduce the number of experiments that need to be performed, thus reducing costs and experimental times.

Maillard reaction versus other nonenzymatic modifications in neurodegenerative processes.

PubMed

Pamplona, Reinald; Ilieva, Ekaterina; Ayala, Victoria; Bellmunt, Maria Josep; Cacabelos, Daniel; Dalfo, Esther; Ferrer, Isidre; Portero-Otin, Manuel

2008-04-01

Nonenzymatic protein modifications are generated from direct oxidation of amino acid side chains and from reaction of the nucleophilic side chains of specific amino acids with reactive carbonyl species. These reactions give rise to specific markers that have been analyzed in different neurodegenerative diseases sharing protein aggregation, such as Alzheimer's disease, Pick's disease, Parkinson's disease, dementia with Lewy bodies, Creutzfeldt-Jakob disease, and amyotrophic lateral sclerosis. Collectively, available data demonstrate that oxidative stress homeostasis, mitochondrial function, and energy metabolism are key factors in determining the disease-specific pattern of protein molecular damage. In addition, these findings suggest the lack of a "gold marker of oxidative stress," and, consequently, they strengthen the need for a molecular dissection of the nonenzymatic reactions underlying neurodegenerative processes.

Food Fish Identification from DNA Extraction through Sequence Analysis

ERIC Educational Resources Information Center

Hallen-Adams, Heather E.

2015-01-01

This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…

Fragmentation of whole-transcriptome RNA using E. coli RNase III.

PubMed

Ares, Manuel

2013-05-01

High-throughput sequencing (HTS) methods can provide short sequence reads for many millions of individual molecules in a sample, allowing the use of sequencing to measure the abundance of RNA molecules. To quantify the amount of a particular sequence in a sample of large RNAs (e.g., mRNAs), it is important to fragment the RNA into short pieces that can be ligated to oligonucleotides that allow polymerase chain reaction (PCR) amplification and sequencing. The most desired end structure of RNA for such ligation steps is a 5' phosphate and a 3' OH. Thus, enzymes that leave these groups after cleavage are of particular utility, avoiding the need to dephosphorylate the 3' end with phosphatases or phosphorylate the 5' end with kinase before proceeding. One such enzyme, RNase III, is widely available. Although it primarily cuts duplex RNA, this specificity is salt- and concentration-dependent, and many RNAs that lack strong extended duplexes are nonetheless susceptible to cleavage at many spots. RNA fragmentation by RNase III does not seem to grossly affect the distribution of RNA sequencing reads. Thus, it has become a standard method for creating nominally representative pools of transcriptome sequences with 5' phosphates and 3' OH for library construction. Three steps in preparing fragmented transcriptome RNA for sequencing library construction are described here: (1) fragmenting the RNA with RNase III to the extent that ~60-100-nucleotide fragments are created, (2) purifying the RNA from the RNase III reaction, and (3) analyzing the digestion products for their suitability in library production.

Genetic characterization of an alloalbumin, albumin Kashmir, using gene amplification and allele-specific oligonucleotides.

PubMed Central

Savva, D; Tárnoky, A L; Vickers, M F

1990-01-01

The molecular basis for albumin Kashmir was studied using the polymerase chain reaction to amplify a DNA fragment containing codon 501 in exon 12 of the human albumin gene. Southern blots of the amplified DNA were hybridized to oligonucleotide probes specific either for the normal allele of albumin or for albumin Kashmir. The results provide strong evidence that codon 501 in albumin Kashmir is AAG (lysine) instead of GAG (glutamic acid), thus confirming the protein sequences reported. This approach was used to characterize a bisalbuminaemic individual as a carrier for albumin Kashmir. Similar strategies may be devised to study the molecular basis and to identify carriers of other alloalbumins. Images Fig. 1. Fig. 2. PMID:2317208

Detection and characterization of cry1Ac transgene construct in Bt cotton: multiple polymerase chain reaction approach.

PubMed

Singh, Chandra K; Ojha, Abhishek; Kachru, Devendra N

2007-01-01

To comply with international labeling regulations for genetically modified (GM) crops and food, and to enable proper identification of GM organisms (GMOs), effective methodologies and reliable approaches are needed. The spurious and unapproved GM planting has contributed to crop failures and commercial losses. To ensure effective and genuine GM cultivation, a methodology is needed to detect and identify the trait of interest and concurrently evaluate the structural and functional stability of the transgene insert. A multiple polymerase chain reaction (PCR) approach was developed for detection, identification, and gene stability confirmation of cry1Ac transgene construct in Bt cotton. As many as 9 samples of Bt cotton hybrid seeds comprising 3 approved Bt hybrids, MECH-12Bt, MECH-162Bt, MECH-184Bt, and a batch of 6 nonapproved Bt hybrids were tested. Initially, single standard PCR assays were run to amplify predominant GM DNA sequences (CaMV 35S promoter, nos terminator, and npt-II marker gene); a housekeeping gene, Gossypium hirsutum fiber-specific acyl carrier protein gene (acp1); a trait-specific transgene (cry1Ac); and a sequence of 7S 3' transcription terminator which specifically borders with 3' region of cry1Ac transgene cassette. The concurrent amplification of all sequences of the entire cassette was performed by 3 assays, duplex, triplex, and quadruplex multiplex PCR assays, under common assay conditions. The identity of amplicons was reconfirmed by restriction endonuclease digestion profile. The 2 distinct transgene cassettes, cry1Ac and npt-II, of the Bt cotton were amplified using the respective forward primer of promoter and reverse primer of terminator. The resultant amplicons were excised, eluted, and purified. The purified amplicons served as template for nested PCR assays. The nested PCR runs confirmed the transgene construct orientation and identity. The limit of detection as established by our assay for GM trait (cry1Ac) was 0.1%. This approach can be adopted as a standard procedure for complete molecular characterization of Bt cotton. These assays will be of interest and use to importers, breeders, research laboratories, safety regulators, and food processors for detection of cry1Ac bearing GMOs.

An electrochemical impedance biosensor for Hg2+ detection based on DNA hydrogel by coupling with DNAzyme-assisted target recycling and hybridization chain reaction.

PubMed

Cai, Wei; Xie, Shunbi; Zhang, Jin; Tang, Dianyong; Tang, Ying

2017-12-15

In this work, an electrochemical impedance biosensor for high sensitive detection of Hg 2+ was presented by coupling with Hg 2+ -induced activation of Mg 2+ -specific DNAzyme (Mg 2+ -DNAzyme) for target cycling and hybridization chain reaction (HCR) assembled DNA hydrogel for signal amplification. Firstly, we synthesized two different copolymer chains P1 and P2 by modifying hairpin DNA H3 and H4 with acrylamide polymer, respectively. Subsequently, Hg 2+ was served as trigger to activate the Mg 2+ -DNAzyme for selectively cleavage ribonucleobase-modified substrate in the presence of Mg 2+ . The partial substrate strand could dissociate from DNAzyme structure, and hybridize with capture probe H1 to expose its concealed sequence for further hybridization. With the help of the exposed sequence, the HCR between hairpin DNA H3 and H4 in P1 and P2 was initiated, and assembled a layer of DNA cross-linked hydrogel on the electrode surface. The formed non-conductive DNA hydrogel film could greatly hinder the interfacial electronic transfer which provided a possibility for us to construct a high sensitive impedance biosensor for Hg 2+ detection. Under the optimal conditions, the impedance biosensor showed an excellent sensitivity and selectivity toward Hg 2+ in a concentration range of 0.1pM - 10nM with a detection limit of 0.042pM Moreover, the real sample analysis reveal that the proposed biosensor is capable of discriminating Hg 2+ ions in reliable and quantitative manners, indicating this method has a promising potential for preliminary application in routine tests. Copyright © 2017 Elsevier B.V. All rights reserved.

Identifying of meat species using polymerase chain reaction (PCR)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foong, Chow Ming; Sani, Norrakiah Abdullah

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reactionmore » (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.« less

Xp11.2 translocation renal cell carcinoma with PSF-TFE3 rearrangement.

PubMed

Zhong, Minghao; Weisman, Paul; Zhu, Bing; Brassesco, Maria; Yang, Youfeng; Linehan, W Marston; Merino, Maria J; Zhang, David; Rohan, Stephen; Cai, Dongming; Yang, Ximing

2013-06-01

Xp11.2 translocation renal cell carcinoma (Xp11.2 RCC) is a subtype of RCC characterized by translocations involving a breakpoint at the TFE3 gene (Xp11.2). Moderate to strong nuclear TFE3 immunoreactivity has been recognized as a specific diagnostic marker for this type of tumor. However, exclusive cytoplasmic localization of a TFE3 fusion protein was reported in UOK 145 cells, a cell line derived from an Xp11.2 RCC harboring the PSF-TFE3 translocation. If reproducible using immunohistochemistry (IHC), this finding would have important implications for pathologists in the diagnosis of Xp11.2 RCC, calling into question the specificity of nuclear immunoreactivity for TFE3 in these tumors. The purpose of this study was to determine whether the above-noted cytoplasmic localization of the TFE3 fusion protein could be reproduced using IHC. UOK 145 cells and fresh frozen tissue from 2 clinical cases of Xp11.2 RCC found to harbor the PSF-TFE3 gene rearrangement (by cytogenetic testing) were collected. All samples were subjected to histopathologic evaluation by board-certified pathologists, TFE3 IHC, reverse transcription polymerase chain reaction, and Sanger sequencing analysis. A strong nuclear TFE3 immunoreactivity was demonstrated in all samples including the UOK 145 cell line. No cytoplasmic immunoreactivity was seen. Reverse transcription polymerase chain reaction and Sanger sequencing confirmed the previously reported PSF-TFE3 gene fusion between exon 9 of PSF and exon 6 of TFE3 in the UOK 145 cell line and in one of 2 clinical cases of Xp11.2 RCC. A novel PSF-TFE3 gene fusion between exon 9 of PSF and exon 5 of TFE3 was detected in the second clinical case of Xp11.2 RCC.

Detection of viral sequences in archival spinal cords from fatal cases of poliomyelitis in 1951-1952.

PubMed

Rekand, Tiina; Male, Rune; Myking, Andreas O; Nygaard, Svein J T; Aarli, Johan A; Haarr, Lars; Langeland, Nina

2003-12-01

Poliovirus (PV) subjected to genetic characterization is often isolated from faecal carriage. Such virus is not necessarily identical to the virus causing paralytic disease since genetic modifications may occur during replication outside the nervous system. We have searched for poliovirus genomes in the 14 fatal cases occurring during the last epidemics in Norway in 1951-1952. A method was developed for isolation and analysis of poliovirus RNA from formalin-fixed and paraffin-embedded archival tissue. RNA was purified by incubation with Chelex-100 and heating followed by treatment with the proteinase K and chloroform extraction. Viral sequences were amplified by a reverse transcriptase-polymerase chain reaction (RT-PCR), the products subjected to TA cloning and sequenced. RNA from the beta-actin gene, as a control, was identified in 13 cases, while sequences specific for poliovirus were achieved in 11 cases. The sequences from the 2C region of poliovirus were rather conserved while those in the 5'-untranslated region were variable. The developed method should be suitable also for other genetic studies of old archival material.

Molecular implementation of molecular shift register memories

NASA Technical Reports Server (NTRS)

Beratan, David N. (Inventor); Onuchic, Jose N. (Inventor)

1991-01-01

An electronic shift register memory (20) at the molecular level is described. The memory elements are based on a chain of electron transfer molecules (22) and the information is shifted by photoinduced (26) electron transfer reactions. Thus, multi-step sequences of charge transfer reactions are used to move charge with high efficiency down a molecular chain. The device integrates compositions of the invention onto a VLSI substrate (36), providing an example of a molecular electronic device which may be fabricated. Three energy level schemes, molecular implementation of these schemes, optical excitation strategies, charge amplification strategies, and error correction strategies are described.

A de novo transcriptome and valid reference genes for quantitative real-time PCR in Colaphellus bowringi.

PubMed

Tan, Qian-Qian; Zhu, Li; Li, Yi; Liu, Wen; Ma, Wei-Hua; Lei, Chao-Liang; Wang, Xiao-Ping

2015-01-01

The cabbage beetle Colaphellus bowringi Baly is a serious insect pest of crucifers and undergoes reproductive diapause in soil. An understanding of the molecular mechanisms of diapause regulation, insecticide resistance, and other physiological processes is helpful for developing new management strategies for this beetle. However, the lack of genomic information and valid reference genes limits knowledge on the molecular bases of these physiological processes in this species. Using Illumina sequencing, we obtained more than 57 million sequence reads derived from C. bowringi, which were assembled into 39,390 unique sequences. A Clusters of Orthologous Groups classification was obtained for 9,048 of these sequences, covering 25 categories, and 16,951 were assigned to 255 Kyoto Encyclopedia of Genes and Genomes pathways. Eleven candidate reference gene sequences from the transcriptome were then identified through reverse transcriptase polymerase chain reaction. Among these candidate genes, EF1α, ACT1, and RPL19 proved to be the most stable reference genes for different reverse transcriptase quantitative polymerase chain reaction experiments in C. bowringi. Conversely, aTUB and GAPDH were the least stable reference genes. The abundant putative C. bowringi transcript sequences reported enrich the genomic resources of this beetle. Importantly, the larger number of gene sequences and valid reference genes provide a valuable platform for future gene expression studies, especially with regard to exploring the molecular mechanisms of different physiological processes in this species.

Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

PubMed

Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

2015-04-01

Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

454 next generation-sequencing outperforms allele-specific PCR, Sanger sequencing, and pyrosequencing for routine KRAS mutation analysis of formalin-fixed, paraffin-embedded samples

PubMed Central

Altimari, Annalisa; de Biase, Dario; De Maglio, Giovanna; Gruppioni, Elisa; Capizzi, Elisa; Degiovanni, Alessio; D’Errico, Antonia; Pession, Annalisa; Pizzolitto, Stefano; Fiorentino, Michelangelo; Tallini, Giovanni

2013-01-01

Detection of KRAS mutations in archival pathology samples is critical for therapeutic appropriateness of anti-EGFR monoclonal antibodies in colorectal cancer. We compared the sensitivity, specificity, and accuracy of Sanger sequencing, ARMS-Scorpion (TheraScreen®) real-time polymerase chain reaction (PCR), pyrosequencing, chip array hybridization, and 454 next-generation sequencing to assess KRAS codon 12 and 13 mutations in 60 nonconsecutive selected cases of colorectal cancer. Twenty of the 60 cases were detected as wild-type KRAS by all methods with 100% specificity. Among the 40 mutated cases, 13 were discrepant with at least one method. The sensitivity was 85%, 90%, 93%, and 92%, and the accuracy was 90%, 93%, 95%, and 95% for Sanger sequencing, TheraScreen real-time PCR, pyrosequencing, and chip array hybridization, respectively. The main limitation of Sanger sequencing was its low analytical sensitivity, whereas TheraScreen real-time PCR, pyrosequencing, and chip array hybridization showed higher sensitivity but suffered from the limitations of predesigned assays. Concordance between the methods was k = 0.79 for Sanger sequencing and k > 0.85 for the other techniques. Tumor cell enrichment correlated significantly with the abundance of KRAS-mutated deoxyribonucleic acid (DNA), evaluated as ΔCt for TheraScreen real-time PCR (P = 0.03), percentage of mutation for pyrosequencing (P = 0.001), ratio for chip array hybridization (P = 0.003), and percentage of mutation for 454 next-generation sequencing (P = 0.004). Also, 454 next-generation sequencing showed the best cross correlation for quantification of mutation abundance compared with all the other methods (P < 0.001). Our comparison showed the superiority of next-generation sequencing over the other techniques in terms of sensitivity and specificity. Next-generation sequencing will replace Sanger sequencing as the reference technique for diagnostic detection of KRAS mutation in archival tumor tissues. PMID:23950653

Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

PubMed

Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

2004-10-15

This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

Quantification of simian immunodeficiency virus cytotoxic T lymphocyte escape mutant viruses.

PubMed

Loh, Liyen; Kent, Stephen J

2008-08-01

Escape from cytotoxic T-lymphocyte (CTL) pressure is common in HIV-1 infection of humans and simian immunodeficiency virus (SIV) infections of macaques. CTL escape typically incurs a fitness cost as reversion back to wild-type can occur upon transmission. We utilized sequence-specific primers and DNA probes with real-time polymerase chain reaction (PCR) to sensitively and specifically track wild-type and escape mutant viremia at the Mane-A*17-restricted SIV Gag(371379) epitope AF9 in pigtail macaques. The generation of minor escape mutant populations is detected by the real-time PCR 2 weeks earlier than observed using standard sequencing techniques. We passaged the AF9 CTL escape mutant virus into two naïve Mane-A*17-negative pigtail macaques and showed that reversion to wild-type was rapid during acute infection and then slowed considerably at later stages of the infection. These data help refine our understanding of how CTL escape mutant viruses evolve.

Mitochondrial targeting of electron scavenging antioxidants: Regulation of selective oxidation vs random chain reactions

PubMed Central

Kagan, Valerian E.; Wipf, Peter; Stoyanovsky, Detcho; Greenberger, Joel S.; Borisenko, Grigory; Belikova, Natalia A.; Yanamala, Naveena; Samhan Arias, Alejandro K.; Tungekar, Muhammad A.; Jiang, Jianfei; Tyurina, Yulia Y.; Ji, Jing; Klein-Seetharaman, Judith; Pitt, Bruce R.; Shvedova, Anna A; Bayır, Hülya

2009-01-01

Effective regulation of highly compartmentalized production of reactive oxygen species and peroxidation reactions in mitochondria requires targeting of small molecule antioxidants and antioxidant enzymes into the organelles. This review describes recently developed approaches to mitochondrial targeting of small biologically active molecules based on: (i) preferential accumulation in mitochondria because of their hydrophobicity and positive charge (hydrophobic cations), (ii) binding with high affinity to an intra-mitochondrial constituent, and (iii) metabolic conversions by specific mitochondrial enzymes to reveal an active entity. In addition, targeted delivery of antioxidant enzymes via expression of leader-sequences directing the proteins into mitochondria is considered. Examples of successful antioxidant and anti-apoptotic protection based on the ability of targeted cargoes to inhibit cytochrome c-catalyzed peroxidation of a mitochondria-specific phospholipid cardiolipin, in vitro and in vivo are presented. Particular emphasis is placed on the employment of triphenylphosphonium- and hemi-gramicidin S-moieties as two effective vehicles for mitochondrial delivery of antioxidants. PMID:19716396

Development of a multiplex PCR assay for detection and discrimination of Theileria annulata and Theileria sergenti in cattle.

PubMed

Junlong, Liu; Li, Youquan; Liu, Aihong; Guan, Guiquan; Xie, Junren; Yin, Hong; Luo, Jianxun

2015-07-01

Aim to construct a simple and efficient diagnostic assay for Theileria annulata and Theileria sergenti, a multiplex polymerase chain reaction (PCR) method was developed in this study. Following the alignment of the related sequences, two primer sets were designed specific targeting on T. annulata cytochrome b (COB) gene and T. sergenti internal transcribed spacer (ITS) sequences. It was found that the designed primers could react in one PCR system and generating amplifications of 818 and 393 base pair for T. sergenti and T. annulata, respectively. The standard genomic DNA of both species Theileria was serial tenfold diluted for testing the sensitivity, while specificity test confirmed both primer sets have no cross-reaction with other Theileria and Babesia species. In addition, 378 field samples were used for evaluation of the utility of the multiplex PCR assay for detection of the pathogens infection. The detection results were compared with the other two published PCR methods which targeting on T. annulata COB gene and T. sergenti major piroplasm surface protein (MPSP) gene, respectively. The developed multiplex PCR assay has similar efficient detection with COB and MPSP PCR, which indicates this multiplex PCR may be a valuable assay for the epidemiological studies for T. annulata and T. sergenti.

Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax

PubMed Central

Pakalapati, Deepak; Garg, Shilpi; Middha, Sheetal; Acharya, Jyoti; Subudhi, Amit K; Boopathi, Arunachalam P; Saxena, Vishal; Kochar, Sanjay K; Kochar, Dhanpat K; Das, Ashis

2013-01-01

The 28S rRNA gene was amplified and sequenced from P. falciparum and P. vivax isolates collected from northwest India. Based upon the sequence diversity of the Plasmodium 28SrRNA gene in comparison with its human counterpart, various nested polymerase chain reaction (PCR) primers were designed from the 3R region of the 28SrRNA gene and evaluated on field isolates. This is the first report demonstrating the utility of this gene for species-specific diagnosis of malaria for these two species, prevalent in India. The initial evaluation on 363 clinical isolates indicated that, in comparison with microscopy, which showed sensitivity and specificity of 85.39% and 100% respectively, the sensitivity and specificity of the nested PCR assay was found to be 99.08% and 100% respectively. This assay was also successful in detecting mixed infections that are undetected by microscopy. Our results demonstrate the utility of the 28S rRNA gene as a diagnostic target for the detection of the major plasmodial species infecting humans. PMID:23816509

Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers

PubMed Central

Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie

2013-01-01

The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915

Molecular cloning of the myo-inositol oxygenase gene from the kidney of baboons

PubMed Central

González-Álvarez, Rafael; Pérez-Ibave, Diana Cristina; Garza-Rodríguez, María Lourdes; Lugo-Trampe, Ángel; Delgado-Enciso, Iván; Tejero-Barrera, María Elizabeth; Martínez-De-Villarreal, Laura Elia; Garza-Guajardo, Raquel; Sánchez-Chaparro, María Marisela; Ruiz-Ayma, Gabriel; Barboza-Quintana, Oralia; Barrera-Saldaña, Hugo Alberto; Rocha-Pizaña, María Del Refugio; Rodríguez-Sánchez, Irám Pablo

2017-01-01

The enzyme myo-Inositol oxygenase (MIOX) is also termed ALDRL6. It is a kidney-specific member of the aldo-keto reductase family. MIOX catalyzes the first reaction involved in the myo-inositol metabolism signaling pathway and is fully expressed in mammalian tissues. MIOX catalyzes the oxidative cleavage of myo-Inositol and its epimer, D-chiro-Inositol to D-glucuronate. The dioxygen-dependent cleavage of the C6 and C1 bond in myo-Inositol is achieved by utilizing the Fe2+/Fe3+ binuclear iron center of MIOX. This enzyme has also been implicated in the complications of diabetes, including diabetic nephropathy. The MIOX gene was amplified with reverse transcription-polymerase chain reaction from baboon tissue samples, and the product was cloned and sequenced. MIOX expression in the baboon kidney is described in the present study. The percentages of nucleotide and amino acid similarities between baboons and humans were 95 and 96%, respectively. The MIOX protein of the baboon may be structurally identical to that of humans. Furthermore, the evolutionary changes, which have affected these sequences, have resulted from purifying forces. PMID:29085625

Molecular cloning of the myo-inositol oxygenase gene from the kidney of baboons.

PubMed

González-Álvarez, Rafael; Pérez-Ibave, Diana Cristina; Garza-Rodríguez, María Lourdes; Lugo-Trampe, Ángel; Delgado-Enciso, Iván; Tejero-Barrera, María Elizabeth; Martínez-De-Villarreal, Laura Elia; Garza-Guajardo, Raquel; Sánchez-Chaparro, María Marisela; Ruiz-Ayma, Gabriel; Barboza-Quintana, Oralia; Barrera-Saldaña, Hugo Alberto; Rocha-Pizaña, María Del Refugio; Rodríguez-Sánchez, Irám Pablo

2017-10-01

The enzyme myo-Inositol oxygenase (MIOX) is also termed ALDRL6. It is a kidney-specific member of the aldo-keto reductase family. MIOX catalyzes the first reaction involved in the myo-inositol metabolism signaling pathway and is fully expressed in mammalian tissues. MIOX catalyzes the oxidative cleavage of myo-Inositol and its epimer, D-chiro-Inositol to D-glucuronate. The dioxygen-dependent cleavage of the C6 and C1 bond in myo-Inositol is achieved by utilizing the Fe 2+ /Fe 3+ binuclear iron center of MIOX. This enzyme has also been implicated in the complications of diabetes, including diabetic nephropathy. The MIOX gene was amplified with reverse transcription-polymerase chain reaction from baboon tissue samples, and the product was cloned and sequenced. MIOX expression in the baboon kidney is described in the present study. The percentages of nucleotide and amino acid similarities between baboons and humans were 95 and 96%, respectively. The MIOX protein of the baboon may be structurally identical to that of humans. Furthermore, the evolutionary changes, which have affected these sequences, have resulted from purifying forces.

Quantification of sequence exchange events between PMS2 and PMS2CL provides a basis for improved mutation scanning of Lynch syndrome patients.

PubMed

van der Klift, Heleen M; Tops, Carli M J; Bik, Elsa C; Boogaard, Merel W; Borgstein, Anne-Marijke; Hansson, Kerstin B M; Ausems, Margreet G E M; Gomez Garcia, Encarna; Green, Andrew; Hes, Frederik J; Izatt, Louise; van Hest, Liselotte P; Alonso, Angel M; Vriends, Annette H J T; Wagner, Anja; van Zelst-Stams, Wendy A G; Vasen, Hans F A; Morreau, Hans; Devilee, Peter; Wijnen, Juul T

2010-05-01

Heterozygous mutations in PMS2 are involved in Lynch syndrome, whereas biallelic mutations are found in Constitutional mismatch repair-deficiency syndrome patients. Mutation detection is complicated by the occurrence of sequence exchange events between the duplicated regions of PMS2 and PMS2CL. We investigated the frequency of such events with a nonspecific polymerase chain reaction (PCR) strategy, co-amplifying both PMS2 and PMS2CL sequences. This allowed us to score ratios between gene and pseudogene-specific nucleotides at 29 PSV sites from exon 11 to the end of the gene. We found sequence transfer at all investigated PSVs from intron 12 to the 3' end of the gene in 4 to 52% of DNA samples. Overall, sequence exchange between PMS2 and PMS2CL was observed in 69% (83/120) of individuals. We demonstrate that mutation scanning with PMS2-specific PCR primers and MLPA probes, designed on PSVs, in the 3' duplicated region is unreliable, and present an RNA-based mutation detection strategy to improve reliability. Using this strategy, we found 19 different putative pathogenic PMS2 mutations. Four of these (21%) are lying in the region with frequent sequence transfer and are missed or called incorrectly as homozygous with several PSV-based mutation detection methods. (c) 2010 Wiley-Liss, Inc.

[Identification of human pathogenic variola and monkeypox viruses by real-time polymerase chain reaction].

PubMed

Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N

2009-01-01

A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.

Chemiluminescence resonance energy transfer imaging on magnetic particles for single-nucleotide polymorphism detection based on ligation chain reaction.

PubMed

Bi, Sai; Zhang, Zhipeng; Dong, Ying; Wang, Zonghua

2015-03-15

A novel ligation chain reaction (LCR) methodology for single-nucleotide polymorphism (SNP) detection was developed based on luminol-H2O2-horseradish peroxidase (HRP)-mimicking DNAzyme-fluorescein chemiluminescence resonance energy transfer (CRET) imaging on magnetic particles. For LCR, four unique target-complement probes (X and X(⁎), YG and Y(⁎)) for the amplification of K-ras (G12C) were designed by modifying G-quadruplex sequence at 3'-end of YG and fluorescein at 5'-end of Y(⁎). After the LCR, the resulting products of XYG/X(⁎)Y(⁎) with biotin-labeled X(⁎) were captured onto streptavidin-coated magnetic particles (SA-MPs) via specific biotin-SA interaction, which stimulated the CRET reaction from hemin/G-quadruplex-catalyzed luminol-H2O2 CL system to fluorescein. By collecting signals by a cooled low-light CCD, a CRET imaging method was proposed for visual detection and quantitative analysis of SNP. As low as 0.86fM mutant DNA was detected by this assay, and positive mutation detection was achieved with a wild-type to mutant ratio of 10,000:1. This high sensitivity and specificity could be attributed to not only the exponential amplification and excellent discrimination of LCR but also the employment of SA-MPs. SA-MPs ensured the feasibility of the proposed strategy, which also simplified the operations through magnetic separation and separated the reaction and detection procedures to improve sensitivity. The proposed LCR-CRET imaging strategy extends the application of signal amplification techniques to SNP detection, providing a promising platform for effective and high-throughput genetic diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.

Development of EST Intron-Targeting SNP Markers for Panax ginseng and Their Application to Cultivar Authentication

PubMed Central

Wang, Hongtao; Li, Guisheng; Kwon, Woo-Saeng; Yang, Deok-Chun

2016-01-01

Panax ginseng is one of the most valuable medicinal plants in the Orient. The low level of genetic variation has limited the application of molecular markers for cultivar authentication and marker-assisted selection in cultivated ginseng. To exploit DNA polymorphism within ginseng cultivars, ginseng expressed sequence tags (ESTs) were searched against the potential intron polymorphism (PIP) database to predict the positions of introns. Intron-flanking primers were then designed in conserved exon regions and used to amplify across the more variable introns. Sequencing results showed that single nucleotide polymorphisms (SNPs), as well as indels, were detected in four EST-derived introns, and SNP markers specific to “Gopoong” and “K-1” were first reported in this study. Based on cultivar-specific SNP sites, allele-specific polymerase chain reaction (PCR) was conducted and proved to be effective for the authentication of ginseng cultivars. Additionally, the combination of a simple NaOH-Tris DNA isolation method and real-time allele-specific PCR assay enabled the high throughput selection of cultivars from ginseng fields. The established real-time allele-specific PCR assay should be applied to molecular authentication and marker assisted selection of P. ginseng cultivars, and the EST intron-targeting strategy will provide a potential approach for marker development in species without whole genomic DNA sequence information. PMID:27271615

A new arenavirus in a cluster of fatal transplant-associated diseases.

PubMed

Palacios, Gustavo; Druce, Julian; Du, Lei; Tran, Thomas; Birch, Chris; Briese, Thomas; Conlan, Sean; Quan, Phenix-Lan; Hui, Jeffrey; Marshall, John; Simons, Jan Fredrik; Egholm, Michael; Paddock, Christopher D; Shieh, Wun-Ju; Goldsmith, Cynthia S; Zaki, Sherif R; Catton, Mike; Lipkin, W Ian

2008-03-06

Three patients who received visceral-organ transplants from a single donor on the same day died of a febrile illness 4 to 6 weeks after transplantation. Culture, polymerase-chain-reaction (PCR) and serologic assays, and oligonucleotide microarray analysis for a wide range of infectious agents were not informative. We evaluated RNA obtained from the liver and kidney transplant recipients. Unbiased high-throughput sequencing was used to identify microbial sequences not found by means of other methods. The specificity of sequences for a new candidate pathogen was confirmed by means of culture and by means of PCR, immunohistochemical, and serologic analyses. High-throughput sequencing yielded 103,632 sequences, of which 14 represented an Old World arenavirus. Additional sequence analysis showed that this new arenavirus was related to lymphocytic choriomeningitis viruses. Specific PCR assays based on a unique sequence confirmed the presence of the virus in the kidneys, liver, blood, and cerebrospinal fluid of the recipients. Immunohistochemical analysis revealed arenavirus antigen in the liver and kidney transplants in the recipients. IgM and IgG antiviral antibodies were detected in the serum of the donor. Seroconversion was evident in serum specimens obtained from one recipient at two time points. Unbiased high-throughput sequencing is a powerful tool for the discovery of pathogens. The use of this method during an outbreak of disease facilitated the identification of a new arenavirus transmitted through solid-organ transplantation. Copyright 2008 Massachusetts Medical Society.

Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

PubMed Central

Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

2010-01-01

Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

PubMed

Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

2010-04-01

Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

Short-term application of dexamethasone on stem cells derived from human gingiva reduces the expression of RUNX2 and β-catenin.

PubMed

Kim, Bo-Bae; Kim, Minji; Park, Yun-Hee; Ko, Youngkyung; Park, Jun-Beom

2017-06-01

Objective Next-generation sequencing was performed to evaluate the effects of short-term application of dexamethasone on human gingiva-derived mesenchymal stem cells. Methods Human gingiva-derived stem cells were treated with a final concentration of 10 -7  M dexamethasone and the same concentration of vehicle control. This was followed by mRNA sequencing and data analysis, gene ontology and pathway analysis, quantitative real-time polymerase chain reaction of mRNA, and western blot analysis of RUNX2 and β-catenin. Results In total, 26,364 mRNAs were differentially expressed. Comparison of the results of dexamethasone versus control at 2 hours revealed that 7 mRNAs were upregulated and 25 mRNAs were downregulated. The application of dexamethasone reduced the expression of RUNX2 and β-catenin in human gingiva-derived mesenchymal stem cells. Conclusion The effects of dexamethasone on stem cells were evaluated with mRNA sequencing, and validation of the expression was performed with qualitative real-time polymerase chain reaction and western blot analysis. The results of this study can provide new insights into the role of mRNA sequencing in maxillofacial areas.

Description of polymerase chain reaction and sequencing DNA Mycobacterium tuberculosis from specimen sputum of tuberculosis patients in Medan

NASA Astrophysics Data System (ADS)

Lily; Siregar, Y.; Ilyas, S.

2018-03-01

This study purposed to describe the product Polymerase Chain Reaction (PCR) and sequencing of DNA Mycobacterium (M.) tuberculosis from sputum of tuberculosis (TB) patients in Medan. Sputum was collected from patients that diagnosed with pulmonary TB by a physician. Specimen processed by PCR method of Li et al. and sequencing at Macrogen Laboratory. All of 12 product PCR were showed brightness bands at 126 base pair (bp). These results indicated similarity to the study of Li et al. Sequencing analysis showed the presence of a mutation and non-mutation groups of M. tuberculosis. The reference and outcome berange of the mutation and non-mutation of M. tuberculosis were 56-107, 59-85, 60-120 and 63-94, respectively. The percentage bp difference between the outcome and references for mutation and non-mutation were 3.448-6.569and 3.278-7.428%, respectively. In conclusion, the successful amplification of PCR products in a 1.5% agarose gel electrophoresis where all 12 sputa contained rpoB-positive M. tuberculosis and 0.644% difference was found between the outcome with reference bp of the mutation and non-mutation M. tuberculosis groups.

A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

PubMed

Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

2016-12-01

To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

Accuracy of Reaction Cross Section for Exotic Nuclei in Glauber Model Based on MCMC Diagnostics

NASA Astrophysics Data System (ADS)

Rueter, Keiti; Novikov, Ivan

2017-01-01

Parameters of a nuclear density distribution for an exotic nuclei with halo or skin structures can be determined from the experimentally measured reaction cross-section. In the presented work, to extract parameters such as nuclear size information for a halo and core, we compare experimental data on reaction cross-sections with values obtained using expressions of the Glauber Model. These calculations are performed using a Markov Chain Monte Carlo algorithm. We discuss the accuracy of the Monte Carlo approach and its dependence on k*, the power law turnover point in the discreet power spectrum of the random number sequence and on the lag-1 autocorrelation time of the random number sequence.

Deletion patterns of the STS gene and flanking sequences in Israeli X-linked ichthyosis patients and carriers: analysis by polymerase chain reaction and fluorescence in situ hybridization techniques.

PubMed

Aviram-Goldring, A; Goldman, B; Netanelov-Shapira, I; Chen-Shtoyerman, R; Zvulunov, A; Tal, O; Ilan, T; Peleg, L

2000-03-01

Deletion of the entire steroid sulfatase (STS) gene is the most common molecular defect in X-linked ichthyosis (XLI) patients. Usually, additional flanking sequences are also missing. The aim of this study was to estimate the extent of deletions in an ethnically heterogeneous population of Israeli XLI patients. Multiplex polymerase chain reaction (PCR) and fluorescence in situ hybridization (FISH) techniques were applied in the analysis of blood samples of 24 patients and amniotic cells of seven affected fetuses from 22 unrelated families. In 19 families, a large deletion of the 2-3 megabase was found. It included the whole STS gene and spanned adjacent areas up- and downstream between the loci DXS 1139 and DXS 1132. Two unrelated families of Iraqi ancestry had a partial deletion of the gene and its centromeric adjacent sequence. In another family, the telomeric end of the extragenic segment was only partially missing. Application of FISH on metaphase blood cells and interphase amniotic cells confirmed the diagnosis of XLI in all patients, except the three with partial intragenic deletion. In those cases, the remaining fraction of the gene was sufficient to provide a false negative result. Diagnosis of carriers and prenatal diagnosis in uncultured cells was applicable only by FISH. Our study revealed a remarkable heterogeneity in the deletion pattern among Israeli patients with XLI. This heterogeneity could not be attributed to specific ethnic groups because of the small size of the study group. More studies involving patients of various ancestries should be carried out. In addition, this study demonstrated the usefulness of the FISH technique in the prenatal diagnosis of fetuses with suspected XLI.

Analysis of a repetitive DNA sequence from Bordetella pertussis and its application to the diagnosis of pertussis using the polymerase chain reaction.

PubMed Central

Glare, E M; Paton, J C; Premier, R R; Lawrence, A J; Nisbet, I T

1990-01-01

A tandemly repeated 1,046-base-pair (bp) ClaI DNA fragment from Bordetella pertussis was cloned into Escherichia coli by using the vector pUC19. This fragment, when isolated, hybridized strongly to DNA from all 100 clinical isolates of B. pertussis tested. It was shown to have homology to single-copy sequences in Bordetella bronchiseptica but not Bordetella parapertussis and did not hybridize to lysate blots of a wide range of other bacteria, including members of the closely related genera Pasteurella, Alcaligenes, and Haemophilus. The 1,046-bp fragment was sequenced, and complementary synthetic oligonucleotides flanking a 153-bp region within the repeated element were used as primers for specific amplification of this region using the polymerase chain reaction (PCR). This procedure was then applied to the rapid (5-h) detection of B. pertussis in nasopharyngeal secretions collected from 332 children with suspected pertussis. The test yielded positive results in a total of 98 samples, compared with 66 for culture and 33 for direct immunofluorescence (IF). All of the IF-positive samples were PCR positive, as were 63 of the samples from which B. pertussis was eventually cultured. Two hundred thirty-one specimens which were negative by IF and culture were also negative in the PCR assay. However, 33 culture- and IF-negative specimens were positive by PCR assay. Several of these specimens were collected from close contacts of culture-proven pertussis patients, were follow-up specimens from such patients, or were from patients with serological evidence of pertussis and therefore may be true-rather than false-positives. Images PMID:2229381

Three cases of mumps virus and enterovirus coinfection in children with enteroviral meningitis

PubMed Central

Rasti, Mojtaba; Makvandi, Manoochehr; Neisi, Niloofar; Azaran, Azarakhsh; Rastegarvand, Nasrin; Khalafkhany, Davod; Jahangirnezhad, Emad; Teimoori, Ali; Hadian, Maryam; Shabani, Abdolnabi; Shamsizadeh, Ahmad; Nikfar, Roya; Varnaseri, Mehran

2016-01-01

Abstract Several viruses are responsible for aseptic meningitis; however, in the region of Southwest Iran, the role played by each virus is still not very well known. The aim of this study is to determine the relative frequencies of mumps virus, herpes viruses, and enteroviruses, as well as coinfections among them, in patients with aseptic meningitis. In this cross-sectional study, samples of cerebrospinal fluid were collected between December 2012 and December 2013 from patients under 14 years, who were hospitalized in Abuzar Children's Hospital in Ahvaz, Southwest Iran (the only children's hospital in Khuzestan province and Southwest Iran). All 66 cerebrospinal fluid samples and corresponding clinical data were collected from patients with aseptic meningitis by specialists, and with the patients’ consent. The DNA and RNA were extracted from these samples and subjected to polymerase chain reaction as well as reverse transcription polymerase chain reaction (RT-PCR) for detection of mumps virus, herpes viruses, and enteroviruses. Nine of the samples (3 mumps-positive and 6 enterovirus-positive) were sequenced. The mumps virus sequences were investigated for possible mutations in the SH and partial HN regions. Up to 39 patients (59.09%) were found to be positive for enteroviruses, 3 (4.5%) for mumps virus, and 1 (1.5%) for herpes viruses (specifically, the varicella-zoster virus). Two patients (3.03%) had a mumps virus and enterovirus coinfection. Among the 3 detected mumps virus samples, 1 belonged to genotype B, while the others belonged to genotype N. Six sequenced enteroviruses indicated the highest similarity with Echovirus 30. An amino acid substitution at position 51 (N→T) was detected in the HN region of genotype N mumps virus samples, in comparison to the reference strain. PMID:27930588

Three cases of mumps virus and enterovirus coinfection in children with enteroviral meningitis.

PubMed

Rasti, Mojtaba; Makvandi, Manoochehr; Neisi, Niloofar; Azaran, Azarakhsh; Rastegarvand, Nasrin; Khalafkhany, Davod; Jahangirnezhad, Emad; Teimoori, Ali; Hadian, Maryam; Shabani, Abdolnabi; Shamsizadeh, Ahmad; Nikfar, Roya; Varnaseri, Mehran

2016-12-01

Several viruses are responsible for aseptic meningitis; however, in the region of Southwest Iran, the role played by each virus is still not very well known. The aim of this study is to determine the relative frequencies of mumps virus, herpes viruses, and enteroviruses, as well as coinfections among them, in patients with aseptic meningitis.In this cross-sectional study, samples of cerebrospinal fluid were collected between December 2012 and December 2013 from patients under 14 years, who were hospitalized in Abuzar Children's Hospital in Ahvaz, Southwest Iran (the only children's hospital in Khuzestan province and Southwest Iran).All 66 cerebrospinal fluid samples and corresponding clinical data were collected from patients with aseptic meningitis by specialists, and with the patients' consent. The DNA and RNA were extracted from these samples and subjected to polymerase chain reaction as well as reverse transcription polymerase chain reaction (RT-PCR) for detection of mumps virus, herpes viruses, and enteroviruses. Nine of the samples (3 mumps-positive and 6 enterovirus-positive) were sequenced. The mumps virus sequences were investigated for possible mutations in the SH and partial HN regions.Up to 39 patients (59.09%) were found to be positive for enteroviruses, 3 (4.5%) for mumps virus, and 1 (1.5%) for herpes viruses (specifically, the varicella-zoster virus). Two patients (3.03%) had a mumps virus and enterovirus coinfection. Among the 3 detected mumps virus samples, 1 belonged to genotype B, while the others belonged to genotype N. Six sequenced enteroviruses indicated the highest similarity with Echovirus 30. An amino acid substitution at position 51 (N→T) was detected in the HN region of genotype N mumps virus samples, in comparison to the reference strain.

Sensitivity of Small RNA-Based Detection of Plant Viruses.

PubMed

Santala, Johanna; Valkonen, Jari P T

2018-01-01

Plants recognize unrelated viruses by the antiviral defense system called RNA interference (RNAi). RNAi processes double-stranded viral RNA into small RNAs (sRNAs) of 21-24 nucleotides, the reassembly of which into longer strands in silico allows virus identification by comparison with the sequences available in databases. The aim of this study was to compare the virus detection sensitivity of sRNA-based virus diagnosis with the established virus species-specific polymerase chain reaction (PCR) approach. Viruses propagated in tobacco plants included three engineered, infectious clones of Potato virus A (PVA), each carrying a different marker gene, and an infectious clone of Potato virus Y (PVY). Total RNA (containing sRNA) was isolated and subjected to reverse-transcription real-time PCR (RT-RT-PCR) and sRNA deep-sequencing at different concentrations. RNA extracted from various crop plants was included in the reactions to normalize RNA concentrations. Targeted detection of selected viruses showed a similar threshold for the sRNA and reverse-transcription quantitative PCR (RT-qPCR) analyses. The detection limit for PVY and PVA by RT-qPCR in this study was 3 and 1.5 fg of viral RNA, respectively, in 50 ng of total RNA per PCR reaction. When knowledge was available about the viruses likely present in the samples, sRNA-based virus detection was 10 times more sensitive than RT-RT-PCR. The advantage of sRNA analysis is the detection of all tested viruses without the need for virus-specific primers or probes.

Development and use of polymerase chain reaction for the specific detection of Salmonella Typhimurium in stool and food samples.

PubMed

Lin, J S; Tsen, H Y

1999-10-01

Salmonella Typhimurium is one of the most important Salmonella serovars that may cause foodborne disease and human salmonellosis infection. Detection of this organism in the clinical samples of persons with gastroenteritis and the food samples associated with such persons may allow us to trace the cause of disease. Because malic acid dehydrogenase, an enzyme of the citric acid cycle, is common to organisms, the gene (mdh) coding for this enzyme was selected for the design of Salmonella Typhimurium-specific polymerase chain reaction (PCR) primers. By comparison of the mdh gene sequences of Salmonella Typhimurium and other Salmonella serotypes and of some isolates of other genera, two oligonucleotides were designed and used as PCR primers for the specific detection of Salmonella Typhimurium. The molecular weight of the PCR product was 261 bp as expected. Salmonella serovars other than Salmonella Typhimurium and isolates of other genera in the Enterobacteriaceae that is closely related to Salmonella did not generate any false-positive results. When this primer pair was used for the detection of Salmonella Typhimurium cells artificially inoculated into human stool specimens and food samples, such as milk and raw chicken meat, levels as low as 10(0) CFU per 0.1 g of stool specimen or per ml of milk or food homogenate could be detected if an 8- to 12-h preculture step using combined lactose-tetrathionate broth was performed prior to the PCR.

Validation of SCT Methylation as a Hallmark Biomarker for Lung Cancers.

PubMed

Zhang, Yu-An; Ma, Xiaotu; Sathe, Adwait; Fujimoto, Junya; Wistuba, Ignacio; Lam, Stephen; Yatabe, Yasushi; Wang, Yi-Wei; Stastny, Victor; Gao, Boning; Larsen, Jill E; Girard, Luc; Liu, Xiaoyun; Song, Kai; Behrens, Carmen; Kalhor, Neda; Xie, Yang; Zhang, Michael Q; Minna, John D; Gazdar, Adi F

2016-03-01

The human secretin gene (SCT) encodes secretin, a hormone with limited tissue distribution. Analysis of the 450k methylation array data in The Cancer Genome Atlas (TCGA) indicated that the SCT promoter region is differentially hypermethylated in lung cancer. Our purpose was to validate SCT methylation as a potential biomarker for lung cancer. We analyzed data from TCGA and developed and applied SCT-specific bisulfite DNA sequencing and quantitative methylation-specific polymerase chain reaction assays. The analyses of TCGA 450K data for 801 samples showed that SCT hypermethylation has an area under the curve (AUC) value greater than 0.98 that can be used to distinguish lung adenocarcinomas or squamous cell carcinomas from nonmalignant lung tissue. Bisulfite sequencing of lung cancer cell lines and normal blood cells allowed us to confirm that SCT methylation is highly discriminative. By applying a quantitative methylation-specific polymerase chain reaction assay, we found that SCT hypermethylation is frequently detected in all major subtypes of malignant non-small cell lung cancer (AUC = 0.92, n = 108) and small cell lung cancer (AUC = 0.93, n = 40) but is less frequent in lung carcinoids (AUC = 0.54, n = 20). SCT hypermethylation appeared in samples of lung carcinoma in situ during multistage pathogenesis and increased in invasive samples. Further analyses of TCGA 450k data showed that SCT hypermethylation is highly discriminative in most other types of malignant tumors but less frequent in low-grade malignant tumors. The only normal tissue with a high level of methylation was the placenta. Our findings demonstrated that SCT methylation is a highly discriminative biomarker for lung and other malignant tumors, is less frequent in low-grade malignant tumors (including lung carcinoids), and appears at the carcinoma in situ stage. Copyright © 2015 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

Identification and expression analysis of genes involved in early ovary development in diploid gynogenetic hybrids of red crucian carp x common carp.

PubMed

Liu, Dong; Liu, Shaojun; You, Cuiping; Chen, Lin; Liu, Zhen; Liu, Liangguo; Wang, Jing; Liu, Yun

2010-04-01

Diploid eggs of allotetraploid hybrids (red crucian carp female symbol x common carp male symbol), when activated by UV-irradiated sperm of scatter scale carp, can develop into diploid progenies without chromosome duplication treatment. Diploid progenies produce diploid eggs, which develop into diploid population by the same way. To understand the molecular mechanism underlying the production of diploid eggs by the diploid fish, we constructed a forward suppression subtractive hybridization complementary DNA (cDNA) library. The cDNAs from the ovary in proliferation phase were employed as the "tester," and those in growth phase were used as the "driver." Seventy-three cDNA clones that are specifically expressed in proliferation phase were detected by dot-blot hybridization. Sequencing analyses revealed that several of these cDNAs have high homologies to the known sequences in the NCBI database. Their encoded proteins include the protein preventing mitosis catastrophe (PMC), the signal recognition particle 9, the ATP-binding cassette transporter, the glucanase-xylanase fusion protein, and others. These genes were confirmed by reverse transcriptase-polymerase chain reaction. The expression profile of the PMC gene at different time points was analyzed by quantitative real-time polymerase chain reaction. The results indicated that the expression of this suppression subtractive hybridization-identified gene changed during the time course, corresponding with the cellular phenomenon in the ovary development. Our studies provide insights into the molecular mechanism underlying the ovary development of diploid gynogenetic fish.

Molecular blood group typing in Banjar, Jawa, Mandailing and Kelantan Malays in Peninsular Malaysia.

PubMed

Abd Gani, Rahayu; Manaf, Siti Mariam; Zafarina, Zainuddin; Panneerchelvam, Sundararajulu; Chambers, Geoffrey Keith; Norazmi, Mohd Noor; Edinur, Hisham Atan

2015-08-01

In this study we genotyped ABO, Rhesus, Kell, Kidd and Duffy blood group loci in DNA samples from 120 unrelated individuals representing four Malay subethnic groups living in Peninsular Malaysia (Banjar: n = 30, Jawa: n = 30, Mandailing: n = 30 and Kelantan: n = 30). Analyses were performed using commercial polymerase chain reaction-sequence specific primer (PCR-SSP) typing kits (BAG Health Care GmbH, Lich, Germany). Overall, the present study has successfully compiled blood group datasets for the four Malay subethnic groups and used the datasets for studying ancestry and health. Copyright © 2015 Elsevier Ltd. All rights reserved.

Human papillomavirus hpv-16 DNA as an epitheliotropic virus that induces hyperproliferation in squamous penile tissue.

PubMed

Salazar, Edith L; Mercado, E; Calzada, L

2005-01-01

The prevalence of human papillomavirus HPV-16DNA sequences in 57 penile carcinoma biopsies was examined using the polymerase chain reaction (PCR) with type specific internal probes, employing HPV consensus primers from the L1 region. The cases comprised 39 typical squamous cell carcinoma and 18 specimens with different subtype. PCR products were analyzed and HPV-16DNA was detected in a high percentage of specimens. Thirty-eight biopsies were HPV-16DNA positive. This determination was correlated with cellular differentiation and growth pattern. Our data corroborates that squamous cell carcinoma was invariably associated with HPV-16DNA.

Concurrent infection with dengue virus type-2 and DENV-3 in a patient from Ceará, Brazil.

PubMed

Araújo, Fernanda Montenegro de Carvalho; Nogueira, Rita Maria Ribeiro; de Araújo, Josélio Maria Galvão; Ramalho, Izabel Letícia Cavalcante; Roriz, Maria Lucia Feitosa de Sá; de Melo, Maria Elizabeth Lisboa; Coelho, Ivo Castelo Branco

2006-12-01

Dengue outbreaks have occurred in several regions in Brazil and cocirculating dengue virus type 1 (DENV-1), DENV-2, and DENV-3 have been frequently observed. Dual infection by DENV-2 and DENV-3 was identified by type-specific indirect immunofluorescence assay and confirmed by reverse transcription polymerase chain reaction in a patient in Ceará with a mild disease. This is the first documented case of simultaneous infection with DENV-2 and DENV-3 in Brazil. Sequencing confirmed DENV-2 and DENV-3 (South-East/American) genotype III and (SriLanka/India), genotype III respectively.

Tracking polypeptide folds on the free energy surface: effects of the chain length and sequence.

PubMed

Brukhno, Andrey V; Ricchiuto, Piero; Auer, Stefan

2012-07-26

Characterization of the folding transition in polypeptides and assessing the thermodynamic stability of their structured folds are of primary importance for approaching the problem of protein folding. We use molecular dynamics simulations for a coarse grained polypeptide model in order to (1) obtain the equilibrium conformation diagram of homopolypeptides in a broad range of the chain lengths, N = 10, ..., 100, and temperatures, T (in a multicanonical ensemble), and (2) determine free energy profiles (FEPs) projected onto an optimal, so-called "natural", reaction coordinate that preserves the height of barriers and the diffusion coefficients on the underlying free energy hyper-surface. We then address the following fundamental questions. (i) How well does a kinetically determined free energy landscape of a single chain represent the polypeptide equilibrium (ensemble) behavior? In particular, under which conditions might the correspondence be lost, and what are the possible implications for the folding processes? (ii) How does the free energy landscape depend on the chain length (homopolypeptides) and the monomer interaction sequence (heteropolypeptides)? Our data reveal that at low T values equilibrium structures adopted by relatively short homopolypeptides (N < 60) are dominated by α-helical folds which correspond to the primary and secondary minima of the FEP. In contrast, longer homopolypeptides (N > 70), upon quasi-equilibrium cooling, fold preferentially in β-bundles with small helical portions, while the FEPs exhibit no distinct global minima. Moreover, subject to the choice of the initial configuration, at sufficiently low T, essentially metastable structures can be found and prevail far from the true thermodynamic equilibrium. We also show that, by sequence-enabling the polypeptide model, it is possible to restrict the chain to a very specific part of the configuration space, which results in substantial simplification and smoothing of the free energy landscape as compared to the case of the corresponding homopolypeptide.

Miniaturized isothermal nucleic acid amplification, a review.

PubMed

Asiello, Peter J; Baeumner, Antje J

2011-04-21

Micro-Total Analysis Systems (µTAS) for use in on-site rapid detection of DNA or RNA are increasingly being developed. Here, amplification of the target sequence is key to increasing sensitivity, enabling single-cell and few-copy nucleic acid detection. The several advantages to miniaturizing amplification reactions and coupling them with sample preparation and detection on the same chip are well known and include fewer manual steps, preventing contamination, and significantly reducing the volume of expensive reagents. To-date, the majority of miniaturized systems for nucleic acid analysis have used the polymerase chain reaction (PCR) for amplification and those systems are covered in previous reviews. This review provides a thorough overview of miniaturized analysis systems using alternatives to PCR, specifically isothermal amplification reactions. With no need for thermal cycling, isothermal microsystems can be designed to be simple and low-energy consuming and therefore may outperform PCR in portable, battery-operated detection systems in the future. The main isothermal methods as miniaturized systems reviewed here include nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), rolling circle amplification (RCA), and strand displacement amplification (SDA). Also, important design criteria for the miniaturized devices are discussed. Finally, the potential of miniaturization of some new isothermal methods such as the exponential amplification reaction (EXPAR), isothermal and chimeric primer-initiated amplification of nucleic acids (ICANs), signal-mediated amplification of RNA technology (SMART) and others is presented.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Statistical theory for protein combinatorial libraries. Packing interactions, backbone flexibility, and the sequence variability of a main-chain structure.

PubMed

Kono, H; Saven, J G

2001-02-23

Combinatorial experiments provide new ways to probe the determinants of protein folding and to identify novel folding amino acid sequences. These types of experiments, however, are complicated both by enormous conformational complexity and by large numbers of possible sequences. Therefore, a quantitative computational theory would be helpful in designing and interpreting these types of experiment. Here, we present and apply a statistically based, computational approach for identifying the properties of sequences compatible with a given main-chain structure. Protein side-chain conformations are included in an atom-based fashion. Calculations are performed for a variety of similar backbone structures to identify sequence properties that are robust with respect to minor changes in main-chain structure. Rather than specific sequences, the method yields the likelihood of each of the amino acids at preselected positions in a given protein structure. The theory may be used to quantify the characteristics of sequence space for a chosen structure without explicitly tabulating sequences. To account for hydrophobic effects, we introduce an environmental energy that it is consistent with other simple hydrophobicity scales and show that it is effective for side-chain modeling. We apply the method to calculate the identity probabilities of selected positions of the immunoglobulin light chain-binding domain of protein L, for which many variant folding sequences are available. The calculations compare favorably with the experimentally observed identity probabilities.

Immediate hypersensitivity to moxifloxacin with tolerance to ciprofloxacin: report of three cases and review of the literature.

PubMed

Chang, Brenda; Knowles, Sandra R; Weber, Elizabeth

2010-04-01

To report 3 cases of immediate hypersensitivity reactions to moxifloxacin in patients who tolerated ciprofloxacin. A 71-year-old man, a 44-year-old woman, and a 70-year-old woman with a history of a moxifloxacin reaction developed an immediate hypersensitivity reaction upon oral challenge with moxifloxacin in our Drug Safety Clinic. The reaction was mainly characterized by pruritus and urticaria, although dyspnea and hypotension were noted in the first and second patient, respectively. Two of the patients had negative oral challenge tests with ciprofloxacin and all 3 patients tolerated full treatment courses of oral ciprofloxacin. In all 3 cases, use of the Naranjo probability scale indicated a highly probable adverse drug reaction. Moxifloxacin, similar to other fluoroquinolones, can cause immediate hypersensitivity reactions. Previous publications have reported both cross-reactivity and a lack of cross-reactivity among various fluoroquinolones. The 3 patients discussed demonstrated a lack of cross-reactivity between moxifloxacin and ciprofloxacin since they tolerated oral challenge tests and full treatment courses of ciprofloxacin. Moxifloxacin has unique side chains at positions 7 and 8 on its bicyclic ring structure. Antigenic specificity to particular side chains at positions 7 and 8 on the bicyclic ring structure of moxifloxacin may explain this lack of cross-reactivity. Higher reporting rates of anaphylaxis to moxifloxacin compared to other fluoroquinolones may also be related to side chain specificity, although definitive evidence for this is lacking. Based on our experience, patients who develop immediate hypersensitivity reactions to moxifloxacin may receive ciprofloxacin therapy in an appropriately monitored setting if they have previously tolerated full treatment courses of ciprofloxacin. Research into whether there is a specific side chain reaction unique to moxifloxacin is warranted.

Detection of nonauthorized genetically modified organisms using differential quantitative polymerase chain reaction: application to 35S in maize.

PubMed

Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves

2008-05-15

Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.

Human metapneumovirus-associated hospital admissions over five consecutive epidemic seasons: evidence for alternating circulation of different genotypes.

PubMed

Apostoli, Paola; Zicari, Sonia; Lo Presti, Alessandra; Ciccozzi, Massimo; Ciotti, Marco; Caruso, Arnaldo; Fiorentini, Simona

2012-03-01

Human metapneumovirus (hMPV) is a pathogen of the respiratory tract with a worldwide distribution. The purpose of this study was to identify hMPV as the cause of acute respiratory diseases in children admitted at Spedali Civili, a public hospital in Brescia, Italy. Eight hundred forty-six nasopharyngeal aspirate samples negative for the presence of other common respiratory viruses were tested for the presence of hMPV RNA by reverse transcription-polymerase chain reaction. Of the 846 samples, 79 (9.3%) were positive for hMPV. Polymerase chain reaction products, obtained by amplification of the partial nucleotide sequence of gene F, were sequenced and compared with sequences deposited in GenBank. All four hMPV subtypes were identified, including the proposed subtype A2 sublineages "A" and "B". In successive epidemic seasons, large outbreaks of hMPV alternated with small outbreaks in a biannual pattern. This local study provides further evidence that hMPV infection should be considered as a reason for hospital admission for acute respiratory disease in children. Copyright © 2012 Wiley Periodicals, Inc.

Saponin Biosynthesis in Saponaria vaccaria. cDNAs Encoding β-Amyrin Synthase and a Triterpene Carboxylic Acid Glucosyltransferase1[OA

PubMed Central

Meesapyodsuk, Dauenpen; Balsevich, John; Reed, Darwin W.; Covello, Patrick S.

2007-01-01

Saponaria vaccaria (Caryophyllaceae), a soapwort, known in western Canada as cowcockle, contains bioactive oleanane-type saponins similar to those found in soapbark tree (Quillaja saponaria; Rosaceae). To improve our understanding of the biosynthesis of these saponins, a combined polymerase chain reaction and expressed sequence tag approach was taken to identify the genes involved. A cDNA encoding a β-amyrin synthase (SvBS) was isolated by reverse transcription-polymerase chain reaction and characterized by expression in yeast (Saccharomyces cerevisiae). The SvBS gene is predominantly expressed in leaves. A S. vaccaria developing seed expressed sequence tag collection was developed and used for the isolation of a full-length cDNA bearing sequence similarity to ester-forming glycosyltransferases. The gene product of the cDNA, classified as UGT74M1, was expressed in Escherichia coli, purified, and identified as a triterpene carboxylic acid glucosyltransferase. UGT74M1 is expressed in roots and leaves and appears to be involved in monodesmoside biosynthesis in S. vaccaria. PMID:17172290

Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

NASA Astrophysics Data System (ADS)

Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

2018-01-01

Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

The biological activity of ABA-1-like protein from Ascaris lumbricoides.

PubMed

Muto, R; Imai, S; Tezuka, H; Furuhashi, Y; Fujita, K

2001-09-01

The elevation of non-specific IgE (total IgE) in Ascaris infection can be seen one week after infection, and reaches a peak after approximately two weeks. It has been reported that ABA-1 protein is the main constituent in the pseudocoelomic fluid of Ascaris suum. To investigate the effect of the ABA-1-like protein from Ascaris lumbricoides (ALB), the cDNA was cloned by reverse transcriptase polymerase chain reaction, using original primers based on the consensus sequences of ABA-1 and TBA-1, that is an ABA-1-like protein from Toxocara canis. The clone was sequenced, we constructed the recombinant polyprotein of ALB (rALB14 and rALB7) based on the ALB sequence, and rALB was administrated to BALB/c mice. Fourteen days after inoculation with rALB14 which is the full length of ALB, the elevation of total IgE which we supposed to contain non-specific IgE was observed, and the results were as we expected. Furthermore, in an in-vitro experiment, we confirmed that the spleen cells proliferated when stimulated by rALB14 and concanavalin A. Therefore, the whole conformation of ALB is considered to be involved in the elevation of non-specific IgE, and is involved in the activation of T cells.

Biotype-specific tcpA genes in Vibrio cholerae.

PubMed

Iredell, J R; Manning, P A

1994-08-01

The tcpA gene, encoding the structural subunit of the toxin-coregulated pilus, has been isolated from a variety of clinical isolates of Vibrio cholerae, and the nucleotide sequence determined. Strict biotype-specific conservation within both the coding and putative regulatory regions was observed, with important differences between the El Tor and classical biotypes. V. cholerae O139 Bengal strains appear to have El Tor-type tcpA genes. Environmental O1 and non-O1 isolates have sequences that bind an El Tor-specific tcpA DNA probe and that are weakly and variably amplified by tcpA-specific polymerase chain reaction primers, under conditions of reduced stringency. The data presented allow the selection of primer pairs to help distinguish between clinical and environmental isolates, and to distinguish El Tor (and Bengal) biotypes from classical biotypes of V. cholerae. While the role of TcpA in cholera vaccine preparations remains unclear, the data strongly suggest that TcpA-containing vaccines directed at O1 strains need include only the two forms of TcpA, and that such vaccines directed at (O139) Bengal strains should include the TcpA of El Tor biotype.

Polymerase chain reaction assay for verifying the labeling of meat and commercial meat products from game birds targeting specific sequences from the mitochondrial D-loop region.

PubMed

Rojas, M; González, I; Pavón, M A; Pegels, N; Hernández, P E; García, T; Martín, R

2010-05-01

A PCR assay was developed for the identification of meats and commercial meat products from quail (Coturnix coturnix), pheasant (Phasianus colchicus), partridge (Alectoris spp.), guinea fowl (Numida meleagris), pigeon (Columba spp.), Eurasian woodcock (Scolopax rusticola), and song thrush (Turdus philomelos) based on oligonucleotide primers targeting specific sequences from the mitochondrial D-loop region. The primers designed generated specific fragments of 96, 100, 104, 106, 147, 127, and 154 bp in length for quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock, and song thrush tissues, respectively. The specificity of each primer pair was tested against DNA from various game and domestic species. In this work, satisfactory amplification was accomplished in the analysis of experimentally pasteurized (72 degrees C for 30 min) and sterilized (121 degrees C for 20 min) meats, as well as in commercial meat products from the target species. The technique was also applied to raw and sterilized muscular binary mixtures, with a detection limit of 0.1% (wt/wt) for each of the targeted species. The proposed PCR assay represents a rapid and straightforward method for the detection of possible mislabeling in game bird meat products.

Simultaneous and Rapid Detection of Salmonella typhi, Bacillus anthracis, and Yersinia pestis by Using Multiplex Polymerase Chain Reaction (PCR)

PubMed Central

Safari Foroshani, Nargess; Karami, Ali; Pourali, Fatemeh

2013-01-01

Background Salmonella typhi, Bacillus anthracis, and Yersinia pestis are some serious human pathogens, which their early diagnosis is of great importance. Salmonella typhi, Bacillus anthracis, and Yersinia pestis cause typhoid fever, anthrax, and plague respectively. These bacteria can be used to make biologic weapons. Objectives In this study, we designed a new and rapid diagnostic method based on Uniplex and Multiplex PCR method. Materials and Methods Uniplex and multiplex Polymerase Chain Reaction (PCR) were conducted on virulent genes of hp and invA of Salmonella typhimurium, Pa and chr of Bacillus anthracis, and pla of Yersinia pestis. A genome from other bacteria was used to study the specificity of the primer and the PCR test. Results Standard strains used in this study showed that primers were specific. As for sensitivity, it was shown that this method can diagnose 1-10 copies of the genome, or 1-10 Colony Forming Units (CFU) for each of the bacteria. All pieces except anthrax were sequenced in PCR to validate the product. DNA fragment resulted from Bacillus anthracis was confirmed by restriction enzyme digestions. Conclusion The designed methods are accurate, rapid, and inexpensive to find and differentiate these bacteria from similar bacteria. They can be applied for rapid diagnosis of these agents in different specimens, and bioterrorism cases. PMID:24719692

An A-T linker adapter polymerase chain reaction method for chromosome walking without restriction site cloning bias.

PubMed

Trinh, Quoclinh; Xu, Wentao; Shi, Hui; Luo, Yunbo; Huang, Kunlun

2012-06-01

A-T linker adapter polymerase chain reaction (PCR) was modified and employed for the isolation of genomic fragments adjacent to a known DNA sequence. The improvements in the method focus on two points. The first is the modification of the PO(4) and NH(2) groups in the adapter to inhibit the self-ligation of the adapter or the generation of nonspecific products. The second improvement is the use of the capacity of rTaq DNA polymerase to add an adenosine overhang at the 3' ends of digested DNA to suppress self-ligation in the digested DNA and simultaneously resolve restriction site clone bias. The combination of modifications in the adapter and in the digested DNA leads to T/A-specific ligation, which enhances the flexibility of this method and makes it feasible to use many different restriction enzymes with a single adapter. This novel A-T linker adapter PCR overcomes the inherent limitations of the original ligation-mediated PCR method such as low specificity and a lack of restriction enzyme choice. Moreover, this method also offers higher amplification efficiency, greater flexibility, and easier manipulation compared with other PCR methods for chromosome walking. Experimental results from 143 Arabidopsis mutants illustrate that this method is reliable and efficient in high-throughput experiments. Copyright © 2012 Elsevier Inc. All rights reserved.

Evaluation of quantitative polymerase chain reaction assays targeting Mycobacterium avium, M. intracellulare, and M. avium subspecies paratuberculosis in drinking water biofilms.

PubMed

Chern, Eunice C; King, Dawn; Haugland, Richard; Pfaller, Stacy

2015-03-01

Mycobacterium avium (MA), Mycobacterium intracellulare (MI), and Mycobacterium avium subsp. paratuberculosis (MAP) are difficult to culture due to their slow growing nature. A quantitative polymerase chain reaction (qPCR) method for the rapid detection of MA, MI, and MAP can be used to provide data supporting drinking water biofilms as potential sources of human exposure. The aim of this study was to characterize two qPCR assays targeting partial 16S rRNA gene sequences of MA and MI and use these assays, along with two previously reported MAP qPCR assays (IS900 and Target 251), to investigate Mycobacterium occurrence in kitchen faucet biofilms. MA and MI qPCR assays demonstrated 100% specificity and sensitivity when evaluated against 18 non-MA complex, 76 MA, and 17 MI isolates. Both assays detected approximately 1,000 cells from a diluted cell stock inoculated on a sampling swab 100% of the time. DNA analysis by qPCR indicated that 35.3, 56.9 and 11.8% of the 51 kitchen faucet biofilm samples collected contained MA, MI, and MAP, respectively. This study introduces novel qPCR assays designed to specifically detect MA and MI in biofilm. Results support the use of qPCR as an alternative to culture for detection and enumeration of MA, MI, and MAP in microbiologically complex samples.

Molecular characterization of banana bunchy top virus isolate from Sri Lanka and its genetic relationship with other isolates.

PubMed

Wickramaarachchi, W A R T; Shankarappa, K S; Rangaswamy, K T; Maruthi, M N; Rajapakse, R G A S; Ghosh, Saptarshi

2016-06-01

Bunchy top disease of banana caused by Banana bunchy top virus (BBTV, genus Babuvirus family Nanoviridae) is one of the most important constraints in production of banana in the different parts of the world. Six genomic DNA components of BBTV isolate from Kandy, Sri Lanka (BBTV-K) were amplified by polymerase chain reaction (PCR) with specific primers using total DNA extracted from banana tissues showing typical symptoms of bunchy top disease. The amplicons were of expected size of 1.0-1.1 kb, which were cloned and sequenced. Analysis of sequence data revealed the presence of six DNA components; DNA-R, DNA-U3, DNA-S, DNA-N, DNA-M and DNA-C for Sri Lanka isolate. Comparisons of sequence data of DNA components followed by the phylogenetic analysis, grouped Sri Lanka-(Kandy) isolate in the Pacific Indian Oceans (PIO) group. Sri Lanka-(Kandy) isolate of BBTV is classified a new member of PIO group based on analysis of six components of the virus.

'Mitominis': multiplex PCR analysis of reduced size amplicons for compound sequence analysis of the entire mtDNA control region in highly degraded samples.

PubMed

Eichmann, Cordula; Parson, Walther

2008-09-01

The traditional protocol for forensic mitochondrial DNA (mtDNA) analyses involves the amplification and sequencing of the two hypervariable segments HVS-I and HVS-II of the mtDNA control region. The primers usually span fragment sizes of 300-400 bp each region, which may result in weak or failed amplification in highly degraded samples. Here we introduce an improved and more stable approach using shortened amplicons in the fragment range between 144 and 237 bp. Ten such amplicons were required to produce overlapping fragments that cover the entire human mtDNA control region. These were co-amplified in two multiplex polymerase chain reactions and sequenced with the individual amplification primers. The primers were carefully selected to minimize binding on homoplasic and haplogroup-specific sites that would otherwise result in loss of amplification due to mis-priming. The multiplexes have successfully been applied to ancient and forensic samples such as bones and teeth that showed a high degree of degradation.

[Morphological and molecular characterization of isolates of Macrophomina phaseolina associated with sugarcane in Mexico].

PubMed

Leyva-Mir, Santos G; Velázquez-Martínez, Guadalupe C; Tlapal-Bolaños, Bertha; Tovar-Pedraza, Juan M; Rosas-Saito, Greta H; Alvarado-Gómez, Omar G

2015-01-01

Charcoal rot caused by Macrophomina phaseolina is an important disease of sugarcane in Mexico. This study was carried out to characterize isolates of M. phaseolina obtained from sugarcane by the combination of morphological and molecular analyses. The morphological characterization of 10 isolates was performed using scanning electron microscopy and light microscopy. To confirm the morphological identification, rDNA from two representative isolates was extracted, and the internal transcribed spacer (ITS) region was amplified by polymerase chain reaction and sequenced using specific primers MpKF1 and MpKR1. Based on their morphological characteristics, all isolates were identified as M. phaseolina. Moreover, the analysis of two ITS sequences showed 100% similarity with the M. phaseolina sequences deposited in the GenBank. To our knowledge, this is the first study in the world aimed at characterizing isolates of M. phaseolina obtained from sugarcane. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

Molecular epidemiology demonstrated three emerging clusters of human immunodeficiency virus type 1 subtype B infection in Hong Kong.

PubMed

Leung, Tommy W C; Mak, Darwin; Wong, K H; Wang, Y; Song, Y H; Tsang, D N C; Wong, C; Shao, Y M; Lim, W L

2008-07-01

We conducted a molecular epidemiological study on newly diagnosed human immunodeficiency virus type 1 (HIV-1)-infected patients in Hong Kong to identify the epidemiological linkage of HIV-1 infection in the locality. Reverse transcription polymerase chain reaction (RT-PCR) for HIV-1 was performed on newly diagnosed HIV-1-positive sera collected from January 2002 to December 2006. PCR products correspond to the env C2V3V4 region and gag p17/p24 junction of the HIV-1 genome were nucleotide sequenced. Phylogenetic analyses performed on the acquired nucleotide sequences revealed that CRF01_AE and subtype B were the two dominant HIV-1 subtypes. Analyses also demonstrated the presence of three emerging HIV-1 clusters among the subtype B sequences in Hong Kong. Individual cluster possesses a unique cluster-specific amino acid signature for identification. Data show that one of the clusters (Cluster I) is rapidly expanding. In addition to the unique cluster-specific amino acid signature, the majority of sequences in Cluster I harbor a 6-amino acid insertion at the gag p17/p24 junction in a region that is thought to be closely associated with HIV-1 infectivity.

Exponential isothermal amplification of nucleic acids and amplified assays for proteins, cells, and enzyme activities.

PubMed

Reid, Michael S; Le, X Chris; Zhang, Hongquan

2018-04-27

Isothermal exponential amplification techniques, such as strand-displacement amplification (SDA), rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP), nucleic acid sequence-based amplification (NASBA), helicase-dependent amplification (HDA), and recombinase polymerase amplification (RPA), have great potential for on-site, point-of-care, and in-situ assay applications. These amplification techniques eliminate the need for temperature cycling required for polymerase chain reaction (PCR) while achieving comparable amplification yield. We highlight here recent advances in exponential amplification reaction (EXPAR) for the detection of nucleic acids, proteins, enzyme activities, cells, and metal ions. We discuss design strategies, enzyme reactions, detection techniques, and key features. Incorporation of fluorescence, colorimetric, chemiluminescence, Raman, and electrochemical approaches enables highly sensitive detection of a variety of targets. Remaining issues, such as undesirable background amplification resulting from non-specific template interactions, must be addressed to further improve isothermal and exponential amplification techniques. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular Evidence of Bartonella Infection in Domestic Dogs from Algeria, North Africa, by Polymerase Chain Reaction (PCR)

PubMed Central

Kernif, Tahar; Aissi, Meriem; Doumandji, Salah-Eddine; Chomel, Bruno B.; Raoult, Didier; Bitam, Idir

2010-01-01

Bartonella species are being recognized as important bacterial human and canine pathogens, and are associated with multiple arthropod vectors. Bartonella DNA extracted from blood samples was obtained from domestic dogs in Algiers, Algeria. Polymerase chain reaction (PCR) and DNA sequence analyses of the ftsZ gene and the 16S-23S intergenic spacer region (ITS) were performed. Three Bartonella species: Bartonella vinsonii subsp. berkhoffii, Bartonella clarridgeiae, and Bartonells elizabethae were detected infecting Algerian dogs. To our knowledge, this study is the first report of detection by PCR amplification of Bartonella in dogs in North Africa. PMID:20682871

Expression optimization and biochemical characterization of a recombinant gamma-glutamyltranspeptidase from Escherichia coli novablue.

PubMed

Yao, Ya-Feng; Weng, Yih-Ming; Hu, Hui-Yu; Ku, Kuo-Lung; Lin, Long-Liu

2006-09-01

A truncated Escherichia coli Novablue gamma-glutamyltranspeptidase (EcGGT) gene lacking the first 48-bp coding sequence for part of the signal sequence was amplified by polymerase chain reaction and cloned into expression vector pQE-30 to generate pQE-EcGGT. The maximum production of His(6)-tagged enzyme by E. coli M15 (pQE-EcGGT) was achieved with 0.1 mM IPTG induction for 12 h at 20 degrees C. The overexpressed enzyme was purified to homogeneity by nickel-chelate chromatography to a specific transpeptidase activity of 4.25 U/mg protein and a final yield of 83%. The molecular masses of the subunits of the purified enzyme were estimated to be 41 and 21 kDa respectively by SDS-PAGE, indicating EcGGT still undergoes the post-translational cleavage even in the truncation of signal sequence. The optimum temperature and pH for the recombinant enzyme were 40 degrees C and 9, respectively. The apparent K (m) and V (max) values for gamma-glutamyl-p-nitroanilide as gamma-glutamyl donor in the transpeptidation reaction were 37.9 microM and 53.7 x 10(-3) mM min(-1), respectively. The synthesis of L -theanine was performed in a reaction mixture containing 10 mM L -Gln, 40 mM ethylamine, and 1.04 U His(6)-tagged EcGGT/ml, pH 10, and a conversion rate of 45% was obtained.

Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter.

PubMed

Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian

2018-03-12

ZmbZIP25 ( Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5' RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from -2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from -2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5'-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5'-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5'-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5'-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from -1117 to -957 that were responsible for the specificity of the ZmbZIP25 5'-flanking sequence.

Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter

PubMed Central

Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian

2018-01-01

ZmbZIP25 (Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5′ RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from −2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from −2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5′-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5′-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5′-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5′-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from −1117 to −957 that were responsible for the specificity of the ZmbZIP25 5′-flanking sequence. PMID:29534529

Lack of association of the Norrie disease gene with retinoschisis phenotype.

PubMed

Shastry, B S; Hiraoka, M; Trese, M T

2000-01-01

It has been reported recently that mice carrying a disrupted Norrie disease gene produced alterations in the murine eye that are similar to congenital retinoschisis. Therefore, it was of interest to determine whether mutations in the Norrie disease gene can account for the disease in families with retinoschisis that do not carry mutations in the retinoschisis gene. The patient set comprised 5 cases of retinoschisis (1 familial and 4 sporadic), all unrelated to each other. Fundus examination of affected individuals showed foveal and peripheral schisis, and the visual acuity range was 20/40-20/60. Peripheral blood specimens were collected from affected and unaffected family members. DNA was extracted and amplified by polymerase chain reaction amplification of exons of the Norrie disease gene. The amplified products were sequenced by the dideoxy chain termination method. The data revealed no disease-specific sequence alterations in the Norrie disease gene. Although we cannot completely exclude the possibility of the Norrie disease gene as a candidate gene, the above results suggest that the structural and functional changes in the Norrie disease gene are not associated with clinically typical retinoschisis families that do not contain mutations in the coding regions and splice sites of the retinoschisis gene.

Quartz crystal microbalance (QCM) affinity biosensor for genetically modified organisms (GMOs) detection.

PubMed

Mannelli, Ilaria; Minunni, Maria; Tombelli, Sara; Mascini, Marco

2003-03-01

A DNA piezoelectric sensor has been developed for the detection of genetically modified organisms (GMOs). Single stranded DNA (ssDNA) probes were immobilised on the sensor surface of a quartz crystal microbalance (QCM) device and the hybridisation between the immobilised probe and the target complementary sequence in solution was monitored. The probe sequences were internal to the sequence of the 35S promoter (P) and Nos terminator (T), which are inserted sequences in the genome of GMOs regulating the transgene expression. Two different probe immobilisation procedures were applied: (a) a thiol-dextran procedure and (b) a thiol-derivatised probe and blocking thiol procedure. The system has been optimised using synthetic oligonucleotides, which were then applied to samples of plasmidic and genomic DNA isolated from the pBI121 plasmid, certified reference materials (CRM), and real samples amplified by the polymerase chain reaction (PCR). The analytical parameters of the sensor have been investigated (sensitivity, reproducibility, lifetime etc.). The results obtained showed that both immobilisation procedures enabled sensitive and specific detection of GMOs, providing a useful tool for screening analysis in food samples.

Analysis of sequence diversity through internal transcribed spacers and simple sequence repeats to identify Dendrobium species.

PubMed

Liu, Y T; Chen, R K; Lin, S J; Chen, Y C; Chin, S W; Chen, F C; Lee, C Y

2014-04-08

The Orchidaceae is one of the largest and most diverse families of flowering plants. The Dendrobium genus has high economic potential as ornamental plants and for medicinal purposes. In addition, the species of this genus are able to produce large crops. However, many Dendrobium varieties are very similar in outward appearance, making it difficult to distinguish one species from another. This study demonstrated that the 12 Dendrobium species used in this study may be divided into 2 groups by internal transcribed spacer (ITS) sequence analysis. Red and yellow flowers may also be used to separate these species into 2 main groups. In particular, the deciduous characteristic is associated with the ITS genetic diversity of the A group. Of 53 designed simple sequence repeat (SSR) primer pairs, 7 pairs were polymorphic for polymerase chain reaction products that were amplified from a specific band. The results of this study demonstrate that these 7 SSR primer pairs may potentially be used to identify Dendrobium species and their progeny in future studies.

The First Isolation and Whole Genome Sequencing of Murray Valley Encephalitis Virus from Cerebrospinal Fluid of a Patient with Encephalitis.

PubMed

Russell, Jessica S; Caly, Leon; Kostecki, Renata; McGuinness, Sarah L; Carter, Glen; Bulach, Dieter; Seemann, Torsten; Stinear, Tim P; Baird, Rob; Catton, Mike; Druce, Julian

2018-06-11

Murray Valley Encephalitis virus (MVEV) is a mosquito-borne Flavivirus. Clinical presentation is rare but severe, with a case fatality rate of 15⁻30%. Here we report a case of MVEV from the cerebrospinal fluid (CSF) of a patient in the Northern Territory in Australia. Initial diagnosis was performed using both MVEV-specific real-time, and Pan- Flavivirus conventional, Polymerase Chain Reaction (PCR), with confirmation by Sanger sequencing. Subsequent isolation, the first from CSF, was conducted in Vero cells and the observed cytopathic effect was confirmed by increasing viral titre in the real-time PCR. Isolation allowed for full genome sequencing using the Scriptseq V2 RNASeq library preparation kit. A consensus genome for VIDRL-MVE was generated and phylogenetic analysis identified it as Genotype 2. This is the first reported isolation, and full genome sequencing of MVEV from CSF. It is also the first time Genotype 2 has been identified in humans. As such, this case has significant implications for public health surveillance, epidemiology, and the understanding of MVEV evolution.

Determination of locust bean gum and guar gum by polymerase chain reaction and restriction fragment length polymorphism analysis.

PubMed

Meyer, K; Rosa, C; Hischenhuber, C; Meyer, R

2001-01-01

A polymerase chain reaction (PCR) was developed to differentiate the thickening agents locust bean gum (LBG) and the cheaper guar gum in finished food products. Universal primers for amplification of the intergenic spacer region between trnL 3' (UAA) exon and trnF (GAA) gene in the chloroplast (cp) genome and subsequent restriction analysis were applied to differentiate guar gum and LBG. The presence of <5% (w/w) guar gum powder added to LBG powder was detectable. Based on data obtained from sequencing this intergenic spacer region, a second PCR method for the specific detection of guar gum DNA was also developed. This assay detected guar gum powder in LBG in amounts as low as 1% (w/w). Both methods successfully detected guar gum and/or LBG in ice cream stabilizers and in foodstuffs, such as dairy products, ice cream, dry seasoning mixes, a finished roasting sauce, and a fruit jelly product, but not in products with highly degraded DNA, such as tomato ketchup and sterilized chocolate cream. Both methods detected guar gum and LBG in ice cream and fresh cheese at levels <0.1%.

Development and evaluation of a species diagnostic polymerase chain reaction-restriction fragment-length polymorphism procedure for cryptic members of the Culex sitiens (Diptera: Culicidae) subgroup in Australia and the southwest Pacific.

PubMed

Beebe, N W; van den Hurk, A F; Chapman, H F; Frances, S P; Williams, C R; Cooper, R D

2002-03-01

Members of the Culex sitiens subgroup are important vectors of arboviruses, including Japanese encephalitis virus, Murray Valley encephalitis virus and Ross River virus. Of the eight described species, Cx. annulirostris Skuse, Cx. sitiens Wiedemann, and Cx. palpalis Taylor appear to be the most abundant and widespread throughout northern Australia and Papua New Guinea (PNG). Recent investigations using allozymes have shown this subgroup to contain cryptic species that possess overlapping adult morphology. We report the development of a polymerase chain reaction-restriction fragment-length polymorphism (PCR-RFLP) procedure that reliably separates these three species. This procedure utilizes the sequence variation in the ribosomal DNA ITS1 and demonstrates species-specific PCR-RFLP profiles from both colony and field collected material. Assessment of the consistency of this procedure was undertaken on mosquitoes sampled from a wide geographic area including Australia, PNG, and the Solomon Islands. Overlapping adult morphology was observed for Cx. annulirostris and Cx. palpalis in both northern Queensland and PNG and for all three species at one site in northwest Queensland.

Real-time polymerase chain reaction assay for rapid and sensitive detection of anthrax spores in spiked soil and talcum powder.

PubMed

Jain, Neha; Merwyn, S; Rai, G P; Agarwal, G S

2012-05-01

Real-time polymerase chain reaction (real-time PCR) is a laboratory technique based on PCR. This technique is able to detect sequence-specific PCR products as they accumulate in "real time" during the PCR amplification, and also to quantify the number of substrates present in the initial PCR mixture before amplification begins. In the present study, real-time PCR assay was employed for rapid and real-time detection of Bacillus anthracis spores spiked in 0.1 g of soil and talcum powder ranging from 5 to 10(7) spores. DNA was isolated from spiked soil and talcum powder, using PBS containing 1 % Triton-X-100, followed by heat treatment. The isolated DNA was used as template for real-time PCR and PCR. Real-time PCR amplification was obtained in 60 min under the annealing condition at 60°C by employing primers targeting the pag gene of B. anthracis. In the present study, the detection limit of real-time PCR assay in soil was 10(3) spores and 10(2) spores in talcum powder, respectively, whereas PCR could detect 10(4) spores in soil and 10(3) spores in talcum powder, respectively.

Detection by hemi-nested reverse transcription polymerase chain reaction and genetic characterization of wild type strains of Canine distemper virus in suspected infected dogs.

PubMed

Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio

2012-01-01

A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.

Blood grouping based on PCR methods and agarose gel electrophoresis.

PubMed

Sell, Ana Maria; Visentainer, Jeane Eliete Laguila

2015-01-01

The study of erythrocyte antigens continues to be an intense field of research, particularly after the development of molecular testing methods. More than 300 specificities have been described by the International Society for Blood Transfusion as belonging to 33 blood group systems. The polymerase chain reaction (PCR) is a central tool for red blood cells (RBC) genotyping. PCR and agarose gel electrophoresis are low cost, easy, and versatile in vitro methods for amplifying defined target DNA (RBC polymorphic region). Multiplex-PCR, AS-PCR (Specific Allele Polymerase Chain Reaction), and RFLP-PCR (Restriction Fragment Length Polymorphism-Polymerase Chain Reaction) techniques are usually to identify RBC polymorphisms. Furthermore, it is an easy methodology to implement. This chapter describes the PCR methodology and agarose gel electrophoresis to identify the polymorphisms of the Kell, Duffy, Kidd, and MNS blood group systems.

DIFFERENTIATING HUMAN FROM ANIMAL ISOLATES OF CRYPTOSPORIDIUM PARVUM

EPA Science Inventory

We analyzed 9s Cryptosporidium parvum isolates from humans and animals by a polymerase chain reaction/restriction fragment length polymorphism method based on the thrombospondin-related anonymous protein 2 gene sequence. Used as a molecular marker, this method can differentiate ...

Functional PMS2 Hybrid Alleles Containing a Pseudogene-Specific Missense Variant Trace Back to a Single Ancient Intrachromosomal Recombination Event

PubMed Central

Ganster, Christina; Wernstedt, Annekatrin; Kehrer-Sawatzki, Hildegard; Messiaen, Ludwine; Schmidt, Konrad; Rahner, Nils; Heinimann, Karl; Fonatsch, Christa; Zschocke, Johannes; Wimmer, Katharina

2012-01-01

Sequence exchange between PMS2 and its pseudogene PMS2CL, embedded in an inverted duplication on chromosome 7p22, has been reported to be an ongoing process that leads to functional PMS2 hybrid alleles containing PMS2- and PMS2CL-specific sequence variants at the 5′-and the 3′-end, respectively. The frequency of PMS2 hybrid alleles, their biological significance, and the mechanisms underlying their formation are largely unknown. Here we show that overall hybrid alleles account for one-third of 384 PMS2 alleles analyzed in individuals of different ethnic backgrounds. Depending on the population, 14–60% of hybrid alleles carry PMS2CL-specific sequences in exons 13–15, the remainder only in exon 15. We show that exons 13–15 hybrid alleles, named H1 hybrid alleles, constitute different haplotypes but trace back to a single ancient intrachromosomal recombination event with crossover. Taking advantage of an ancestral sequence variant specific for all H1 alleles we developed a simple gDNA-based polymerase chain reaction (PCR) assay that can be used to identify H1-allele carriers with high sensitivity and specificity (100 and 99%, respectively). Because H1 hybrid alleles harbor missense variant p.N775S of so far unknown functional significance, we assessed the H1-carrier frequency in 164 colorectal cancer patients. So far, we found no indication that the variant plays a major role with regard to cancer susceptibility. PMID:20186689

Functional PMS2 hybrid alleles containing a pseudogene-specific missense variant trace back to a single ancient intrachromosomal recombination event.

PubMed

Ganster, Christina; Wernstedt, Annekatrin; Kehrer-Sawatzki, Hildegard; Messiaen, Ludwine; Schmidt, Konrad; Rahner, Nils; Heinimann, Karl; Fonatsch, Christa; Zschocke, Johannes; Wimmer, Katharina

2010-05-01

Sequence exchange between PMS2 and its pseudogene PMS2CL, embedded in an inverted duplication on chromosome 7p22, has been reported to be an ongoing process that leads to functional PMS2 hybrid alleles containing PMS2- and PMS2CL-specific sequence variants at the 5'-and the 3'-end, respectively. The frequency of PMS2 hybrid alleles, their biological significance, and the mechanisms underlying their formation are largely unknown. Here we show that overall hybrid alleles account for one-third of 384 PMS2 alleles analyzed in individuals of different ethnic backgrounds. Depending on the population, 14-60% of hybrid alleles carry PMS2CL-specific sequences in exons 13-15, the remainder only in exon 15. We show that exons 13-15 hybrid alleles, named H1 hybrid alleles, constitute different haplotypes but trace back to a single ancient intrachromosomal recombination event with crossover. Taking advantage of an ancestral sequence variant specific for all H1 alleles we developed a simple gDNA-based polymerase chain reaction (PCR) assay that can be used to identify H1-allele carriers with high sensitivity and specificity (100 and 99%, respectively). Because H1 hybrid alleles harbor missense variant p.N775S of so far unknown functional significance, we assessed the H1-carrier frequency in 164 colorectal cancer patients. So far, we found no indication that the variant plays a major role with regard to cancer susceptibility. (c) 2010 Wiley-Liss, Inc.

Development of chemiluminescent probe hybridization, RT-PCR and nucleic acid cycle sequencing assays of Sabin type 3 isolates to identify base pair 472 Sabin type 3 mutants associated with vaccine associated paralytic poliomyelitis.

PubMed

Old, M O; Logan, L H; Maldonado, Y A

1997-11-01

Sabin type 3 polio vaccine virus is the most common cause of poliovaccine associated paralytic poliomyelitis. Vaccine associated paralytic poliomyelitis cases have been associated with Sabin type 3 revertants containing a single U to C substitution at bp 472 of Sabin type 3. A rapid method of identification of Sabin type 3 bp 472 mutants is described. An enterovirus group-specific probe for use in a chemiluminescent dot blot hybridization assay was developed to identify enterovirus positive viral lysates. A reverse transcription-polymerase chain reaction (RT-PCR) assay producing a 319 bp PCR product containing the Sabin type 3 bp 472 mutation site was then employed to identify Sabin type 3 isolates. Chemiluminescent nucleic acid cycle sequencing of the purified 319 bp PCR product was then employed to identify nucleic acid sequences at bp 472. The enterovirus group probe hybridization procedure and isolation of the Sabin type 3 PCR product were highly sensitive and specific; nucleic acid cycle sequencing corresponded to the known sequence of stock Sabin type 3 isolates. These methods will be used to identify the Sabin type 3 reversion rate from sequential stool samples of infants obtained after the first and second doses of oral poliovirus vaccine.

A serotype-specific polymerase chain reaction for identification of Pasteurella multocida serotype 1

USGS Publications Warehouse

Rocke, Tonie E.; Smith, Susan R.; Miyamoto, Amy; Shadduck, Daniel J.

2002-01-01

A serotype-specific polymerase chain reaction (PCR) assay was developed for detection and identification of Pasteurella multocida serotype 1, the causative agent of avian cholera in wild waterfowl. Arbitrarily primed PCR was used to detect DNA fragments that distinguish serotype 1 from the other 15 serotypes of P. multocida (with the exception of serotype 14). Oligonucleotide primers were constructed from these sequences, and a PCR assay was optimized and evaluated. PCR reactions consistently resulted in amplification products with reference strains 1 and 14 and all other serotype 1 strains tested, with cell numbers as low as 2.3 cells/ml. No amplification products were produced with other P. multocida serotypes or any other bacterial species tested. To compare the sensitivity and further test the specificity of this PCR assay with traditional culturing and serotyping techniques, tissue samples from 84 Pekin ducks inoculated with field strains of P. multocida and 54 wild lesser snow geese collected during an avian cholera outbreak were provided by other investigators working on avian cholera. PCR was as sensitive (58/64) as routine isolation (52/64) in detecting and identifying P. multocida serotype 1 from the livers of inoculated Pekins that became sick or died from avian cholera. No product was amplified from tissues of 20 other Pekin ducks that received serotypes other than type 1 (serotype 3, 12 × 3, or 10) or 12 control birds. Of the 54 snow geese necropsied and tested for P. multocida, our PCR detected and identified the bacteria from 44 compared with 45 by direct isolation. The serotype-specific PCR we developed was much faster and less labor intensive than traditional culturing and serotyping procedures and could result in diagnosis of serotype 1 pasteurellosis within 24 hr of specimen submission.

Is ITS-2 rDNA suitable marker for genetic characterization of Sarcoptes mites from different wild animals in different geographic areas?

PubMed

Alasaad, S; Soglia, D; Spalenza, V; Maione, S; Soriguer, R C; Pérez, J M; Rasero, R; Degiorgis, M P Ryser; Nimmervoll, H; Zhu, X Q; Rossi, L

2009-02-05

The present study examined the relationship among individual Sarcoptes scabiei mites from 13 wild mammalian populations belonging to nine species in four European countries using the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) as genetic marker. The ITS-2 plus primer flanking 5.8S and 28S rDNA (ITS-2+) was amplified from individual mites by polymerase chain reaction (PCR) and the amplicons were sequenced directly. A total of 148 ITS-2+ sequences of 404bp in length were obtained and 67 variable sites were identified (16.59%). UPGMA analyses did not show any geographical or host-specific clustering, and a similar outcome was obtained using population pairwise Fst statistics. These results demonstrated that ITS-2 rDNA does not appear to be suitable for examining genetic diversity among mite populations.

[Nah-plasmids of IncP-9 group from natural strains of Pseudomonas].

PubMed

Levchuk, A A; Bulyga, I M; Izmalkova, T Iu; Sevast'ianovich, Ia R; Kosheleva, I A; Thomas, C M; Titok, M A

2006-01-01

Use of polymerase chain reaction helped to establish that the most frequent among naphthalene utilizing bacteria, isolated on the territory of Belarus, are Nah-plasmids of IncP-9 incompatibility group and those with indefinite systematic belonging. With the help of classical test of incompatibility, restriction and sequence analyses three new subgroups within the IncP-9 group were discovered (zeta, eta and IncP-9-like replicons). Conducting of restriction analysis for amplification products of nahG and nahAc genes allowed us to reveal, in addition to known sequences of stated determinants, two new types of nahG gene. Restriction analysis performed on amplification products of 16S RNA genes (ARDRA method) showed that native hosts of Nah-plasmids of IncP-9 group are not only fluorescent bacteria from genus Pseudomonas (P. fluorescens, P. putida, P. aeruginosa, P. species), but also non-fluorescent bacteria with indefinite specific belonging.

Successful amplification of DNA aboard the International Space Station.

PubMed

Boguraev, Anna-Sophia; Christensen, Holly C; Bonneau, Ashley R; Pezza, John A; Nichols, Nicole M; Giraldez, Antonio J; Gray, Michelle M; Wagner, Brandon M; Aken, Jordan T; Foley, Kevin D; Copeland, D Scott; Kraves, Sebastian; Alvarez Saavedra, Ezequiel

2017-01-01

As the range and duration of human ventures into space increase, it becomes imperative that we understand the effects of the cosmic environment on astronaut health. Molecular technologies now widely used in research and medicine will need to become available in space to ensure appropriate care of astronauts. The polymerase chain reaction (PCR) is the gold standard for DNA analysis, yet its potential for use on-orbit remains under-explored. We describe DNA amplification aboard the International Space Station (ISS) through the use of a miniaturized miniPCR system. Target sequences in plasmid, zebrafish genomic DNA, and bisulfite-treated DNA were successfully amplified under a variety of conditions. Methylation-specific primers differentially amplified bisulfite-treated samples as would be expected under standard laboratory conditions. Our findings establish proof of concept for targeted detection of DNA sequences during spaceflight and lay a foundation for future uses ranging from environmental monitoring to on-orbit diagnostics.

USE OF TAQMAN TO ENUMERATE ENTEROCOCCUS FAECALIS IN WATER

EPA Science Inventory

The Polymerase Chain Reaction (PCR) has become a useful tool in the detection of microorganisms. However, conventional PCR is somewhat time-consuming considering that additional steps (e.g., gel electrophoresis and gene sequencing) are required to confirm the presence of the tar...

Molecular method for determining sex of walruses

USGS Publications Warehouse

Fischbach, Anthony S.; Jay, C.V.; Jackson, J.V.; Andersen, L.W.; Sage, G.K.; Talbot, S.L.

2008-01-01

We evaluated the ability of a set of published trans-species molecular sexing primers and a set of walrus-specific primers, which we developed, to accurately identify sex of 235 Pacific walruses (Odobenus rosmarus divergens). The trans-species primers were developed for mammals and targeted the X- and Y-gametologs of the zinc finger protein genes (ZFX, ZFY). We extended this method by using these primers to obtain sequence from Pacific and Atlantic walrus (0. r. rosmarus) ZFX and ZFY genes to develop new walrus-specific primers, which yield polymerase chain reaction products of distinct lengths (327 and 288 base pairs from the X- and Y-chromosome, respectively), allowing them to be used for sex determination. Both methods yielded a determination of sex in all but 1-2% of samples with an accuracy of 99.6-100%. Our walrus-specific primers offer the advantage of small fragment size and facile application to automated electrophoresis and visualization.

Streptococcus massiliensis in the human mouth: a phylogenetic approach for the inference of bacterial habitats.

PubMed

Póntigo, F; Silva, C; Moraga, M; Flores, S V

2015-12-29

Streptococcus is a diverse bacterial lineage. Species of this genus occupy a myriad of environments inside humans and other animals. Despite the elucidation of several of these habitats, many remain to be identified. Here, we explore a methodological approach to reveal unknown bacterial environments. Specifically, we inferred the phylogeny of the Mitis group by analyzing the sequences of eight genes. In addition, information regarding habitat use of species belonging to this group was obtained from the scientific literature. The oral cavity emerged as a potential, previously unknown, environment of Streptococcus massiliensis. This phylogeny-based prediction was confirmed by species-specific polymerase chain reaction (PCR) amplification. We propose employing a similar approach, i.e., use of bibliographic data and molecular phylogenetics as predictive methods, and species-specific PCR as confirmation, in order to reveal other unknown habitats in further bacterial taxa.

Multiplex polymerase chain reaction for identification of Escherichia coli, Escherichia albertii and Escherichia fergusonii.

PubMed

Lindsey, Rebecca L; Garcia-Toledo, L; Fasulo, D; Gladney, L M; Strockbine, N

2017-09-01

Escherichia coli, Escherichia albertii, and Escherichia fergusonii are closely related bacteria that can cause illness in humans, such as bacteremia, urinary tract infections and diarrhea. Current identification strategies for these three species vary in complexity and typically rely on the use of multiple phenotypic and genetic tests. To facilitate their rapid identification, we developed a multiplex PCR assay targeting conserved, species-specific genes. We used the Daydreamer™ (Pattern Genomics, USA) software platform to concurrently analyze whole genome sequence assemblies (WGS) from 150 Enterobacteriaceae genomes (107 E. coli, 5 Shigella spp., 21 E. albertii, 12 E. fergusonii and 5 other species) and design primers for the following species-specific regions: a 212bp region of the cyclic di-GMP regulator gene (cdgR, AW869_22935 from genome K-12 MG1655, CP014225) for E. coli/Shigella; a 393bp region of the DNA-binding transcriptional activator of cysteine biosynthesis gene (EAKF1_ch4033 from genome KF1, CP007025) for E. albertii; and a 575bp region of the palmitoleoyl-acyl carrier protein (ACP)-dependent acyltransferase (EFER_0790 from genome ATCC 35469, CU928158) for E. fergusonii. We incorporated the species-specific primers into a conventional multiplex PCR assay and assessed its performance with a collection of 97 Enterobacteriaceae strains. The assay was 100% sensitive and specific for detecting the expected species and offers a quick and accurate strategy for identifying E. coli, E. albertii, and E. fergusonii in either a single reaction or by in silico PCR with sequence assemblies. Published by Elsevier B.V.

MHC Class I Chain-Related Gene A Polymorphisms and Linkage Disequilibrium with HLA-B and HLA-C Alleles in Ocular Toxoplasmosis.

PubMed

Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos

2015-01-01

This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05-4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22-0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population.

MHC Class I Chain-Related Gene A Polymorphisms and Linkage Disequilibrium with HLA-B and HLA-C Alleles in Ocular Toxoplasmosis

PubMed Central

Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos

2015-01-01

This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05–4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22–0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population. PMID:26672749

Hybridization-based antibody cDNA recovery for the production of recombinant antibodies identified by repertoire sequencing.

PubMed

Valdés-Alemán, Javier; Téllez-Sosa, Juan; Ovilla-Muñoz, Marbella; Godoy-Lozano, Elizabeth; Velázquez-Ramírez, Daniel; Valdovinos-Torres, Humberto; Gómez-Barreto, Rosa E; Martinez-Barnetche, Jesús

2014-01-01

High-throughput sequencing of the antibody repertoire is enabling a thorough analysis of B cell diversity and clonal selection, which may improve the novel antibody discovery process. Theoretically, an adequate bioinformatic analysis could allow identification of candidate antigen-specific antibodies, requiring their recombinant production for experimental validation of their specificity. Gene synthesis is commonly used for the generation of recombinant antibodies identified in silico. Novel strategies that bypass gene synthesis could offer more accessible antibody identification and validation alternatives. We developed a hybridization-based recovery strategy that targets the complementarity-determining region 3 (CDRH3) for the enrichment of cDNA of candidate antigen-specific antibody sequences. Ten clonal groups of interest were identified through bioinformatic analysis of the heavy chain antibody repertoire of mice immunized with hen egg white lysozyme (HEL). cDNA from eight of the targeted clonal groups was recovered efficiently, leading to the generation of recombinant antibodies. One representative heavy chain sequence from each clonal group recovered was paired with previously reported anti-HEL light chains to generate full antibodies, later tested for HEL-binding capacity. The recovery process proposed represents a simple and scalable molecular strategy that could enhance antibody identification and specificity assessment, enabling a more cost-efficient generation of recombinant antibodies.

Molecular Strain Typing of Mycobacterium tuberculosis: a Review of Frequently Used Methods

PubMed Central

2016-01-01

Tuberculosis, caused by the bacterium Mycobacterium tuberculosis, remains one of the most serious global health problems. Molecular typing of M. tuberculosis has been used for various epidemiologic purposes as well as for clinical management. Currently, many techniques are available to type M. tuberculosis. Choosing the most appropriate technique in accordance with the existing laboratory conditions and the specific features of the geographic region is important. Insertion sequence IS6110-based restriction fragment length polymorphism (RFLP) analysis is considered the gold standard for the molecular epidemiologic investigations of tuberculosis. However, other polymerase chain reaction-based methods such as spacer oligonucleotide typing (spoligotyping), which detects 43 spacer sequence-interspersing direct repeats (DRs) in the genomic DR region; mycobacterial interspersed repetitive units–variable number tandem repeats, (MIRU-VNTR), which determines the number and size of tandem repetitive DNA sequences; repetitive-sequence-based PCR (rep-PCR), which provides high-throughput genotypic fingerprinting of multiple Mycobacterium species; and the recently developed genome-based whole genome sequencing methods demonstrate similar discriminatory power and greater convenience. This review focuses on techniques frequently used for the molecular typing of M. tuberculosis and discusses their general aspects and applications. PMID:27709842

Comparative sequence analyses of sixteen reptilian paramyxoviruses

USGS Publications Warehouse

Ahne, W.; Batts, W.N.; Kurath, G.; Winton, J.R.

1999-01-01

Viral genomic RNA of Fer-de-Lance virus (FDLV), a paramyxovirus highly pathogenic for reptiles, was reverse transcribed and cloned. Plasmids with significant sequence similarities to the hemagglutinin-neuraminidase (HN) and polymerase (L) genes of mammalian paramyxoviruses were identified by BLAST search. Partial sequences of the FDLV genes were used to design primers for amplification by nested polymerase chain reaction (PCR) and sequencing of 518-bp L gene and 352-bp HN gene fragments from a collection of 15 previously uncharacterized reptilian paramyxoviruses. Phylogenetic analyses of the partial L and HN sequences produced similar trees in which there were two distinct subgroups of isolates that were supported with maximum bootstrap values, and several intermediate isolates. Within each subgroup the nucleotide divergence values were less than 2.5%, while the divergence between the two subgroups was 20-22%. This indicated that the two subgroups represent distinct virus species containing multiple virus strains. The five intermediate isolates had nucleotide divergence values of 11-20% and may represent additional distinct species. In addition to establishing diversity among reptilian paramyxoviruses, the phylogenetic groupings showed some correlation with geographic location, and clearly demonstrated a low level of host species-specificity within these viruses. Copyright (C) 1999 Elsevier Science B.V.

Micropreparative capillary gel electrophoresis of DNA: rapid expressed sequence tag library construction.

PubMed

Shi, Liang; Khandurina, Julia; Ronai, Zsolt; Li, Bi-Yu; Kwan, Wai King; Wang, Xun; Guttman, András

2003-01-01

A capillary gel electrophoresis based automated DNA fraction collection technique was developed to support a novel DNA fragment-pooling strategy for expressed sequence tag (EST) library construction. The cDNA population is first cleaved by BsaJ I and EcoR I restriction enzymes, and then subpooled by selective ligation with specific adapters followed by polymerase chain reaction (PCR) amplification and labeling. Combination of this cDNA fingerprinting method with high-resolution capillary gel electrophoresis separation and precise fractionation of individual cDNA transcript representatives avoids redundant fragment selection and concomitant repetitive sequencing of abundant transcripts. Using a computer-controlled capillary electrophoresis device the transcript representatives were separated by their size and fractions were automatically collected in every 30 s into 96-well plates. The high resolving power of the sieving matrix ensured sequencing grade separation of the DNA fragments (i.e., single-base resolution) and successful fraction collection. Performance and precision of the fraction collection procedure was validated by PCR amplification of the collected DNA fragments followed by capillary electrophoresis analysis for size and purity verification. The collected and PCR-amplified transcript representatives, ranging up to several hundred base pairs, were then sequenced to create an EST library.

Molecular Strain Typing of Mycobacterium tuberculosis: a Review of Frequently Used Methods.

PubMed

Ei, Phyu Win; Aung, Wah Wah; Lee, Jong Seok; Choi, Go Eun; Chang, Chulhun L

2016-11-01

Tuberculosis, caused by the bacterium Mycobacterium tuberculosis, remains one of the most serious global health problems. Molecular typing of M. tuberculosis has been used for various epidemiologic purposes as well as for clinical management. Currently, many techniques are available to type M. tuberculosis. Choosing the most appropriate technique in accordance with the existing laboratory conditions and the specific features of the geographic region is important. Insertion sequence IS6110-based restriction fragment length polymorphism (RFLP) analysis is considered the gold standard for the molecular epidemiologic investigations of tuberculosis. However, other polymerase chain reaction-based methods such as spacer oligonucleotide typing (spoligotyping), which detects 43 spacer sequence-interspersing direct repeats (DRs) in the genomic DR region; mycobacterial interspersed repetitive units-variable number tandem repeats, (MIRU-VNTR), which determines the number and size of tandem repetitive DNA sequences; repetitive-sequence-based PCR (rep-PCR), which provides high-throughput genotypic fingerprinting of multiple Mycobacterium species; and the recently developed genome-based whole genome sequencing methods demonstrate similar discriminatory power and greater convenience. This review focuses on techniques frequently used for the molecular typing of M. tuberculosis and discusses their general aspects and applications.

Conservation of the sequence of the Alzheimer's disease amyloid peptide in dog, polar bear and five other mammals by cross-species polymerase chain reaction analysis.

PubMed

Johnstone, E M; Chaney, M O; Norris, F H; Pascual, R; Little, S P

1991-07-01

Neuritic plaque and cerebrovascular amyloid deposits have been detected in the aged monkey, dog, and polar bear and have rarely been found in aged rodents (Biochem. Biophy. Res. Commun., 12 (1984) 885-890; Proc. Natl. Acad. Sci. U.S.A., 82 (1985) 4245-4249). To determine if the primary structure of the 42-43 residue amyloid peptide is conserved in species that accumulate plaques, the region of the amyloid precursor protein (APP) cDNA that encodes the peptide region was amplified by the polymerase chain reaction and sequenced. The deduced amino acid sequence was compared to those species where amyloid accumulation has not been detected. The DNA sequences of dog, polar bear, rabbit, cow, sheep, pig and guinea pig were compared and a phylogenetic tree was generated. We conclude that the amino acid sequence of dog and polar bear and other mammals which may form amyloid plaques is conserved and the species where amyloid has not been detected (mouse, rat) may be evolutionarily a distinct group. In addition, the predicted secondary structure of mouse and rat amyloid that differs from that of amyloid bearing species is its lack of propensity to form a beta sheeted structure. Thus, a cross-species examination of the amyloid peptide may suggest what is essential for amyloid deposition.

A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

PubMed

Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

2008-12-01

A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

Identification of Alternative Splicing and Fusion Transcripts in Non-Small Cell Lung Cancer by RNA Sequencing.

PubMed

Hong, Yoonki; Kim, Woo Jin; Bang, Chi Young; Lee, Jae Cheol; Oh, Yeon-Mok

2016-04-01

Lung cancer is the most common cause of cancer related death. Alterations in gene sequence, structure, and expression have an important role in the pathogenesis of lung cancer. Fusion genes and alternative splicing of cancer-related genes have the potential to be oncogenic. In the current study, we performed RNA-sequencing (RNA-seq) to investigate potential fusion genes and alternative splicing in non-small cell lung cancer. RNA was isolated from lung tissues obtained from 86 subjects with lung cancer. The RNA samples from lung cancer and normal tissues were processed with RNA-seq using the HiSeq 2000 system. Fusion genes were evaluated using Defuse and ChimeraScan. Candidate fusion transcripts were validated by Sanger sequencing. Alternative splicing was analyzed using multivariate analysis of transcript sequencing and validated using quantitative real time polymerase chain reaction. RNA-seq data identified oncogenic fusion genes EML4-ALK and SLC34A2-ROS1 in three of 86 normal-cancer paired samples. Nine distinct fusion transcripts were selected using DeFuse and ChimeraScan; of which, four fusion transcripts were validated by Sanger sequencing. In 33 squamous cell carcinoma, 29 tumor specific skipped exon events and six mutually exclusive exon events were identified. ITGB4 and PYCR1 were top genes that showed significant tumor specific splice variants. In conclusion, RNA-seq data identified novel potential fusion transcripts and splice variants. Further evaluation of their functional significance in the pathogenesis of lung cancer is required.

Isolation and characterization of DNA from archaeological bone.

PubMed

Hagelberg, E; Clegg, J B

1991-04-22

DNA was extracted from human and animal bones recovered from archaeological sites and mitochondrial DNA sequences were amplified from the extracts using the polymerase chain reaction. Evidence is presented that the amplified sequences are authentic and do not represent contamination by extraneous DNA. The results show that significant amounts of genetic information can survive for long periods in bone, and have important implications for evolutionary genetics, anthropology and forensic science.

Two methods for construction of internal amplification controls for the detection of Escherichia coli O157 by polymerase chain reaction.

PubMed

Abdulmawjood, A; Roth, S; Bülte, M

2002-10-01

For the detection of food born bacteria by polymerase chain reaction (PCR) in food products, an internal amplification control (IAC) is required in order to prevent false negative results that might be caused by PCR inhibitors. In the present study, two IACs were constructed using two different methods. These IACs were designed in a way that the same primer pair can be used to amplify the target DNA and coamplify the IAC. The first IAC with a size of approximately 200 bp was constructed by deleting a part of the amplicon of the original target DNA (500 bp) between the two primer sites to produce an IAC smaller than the target DNA. The second IAC with a size of approximately 600 bp was synthesized in a one step PCR reaction. The primers used in this reaction possessed 5' over-hanging ends, which were identical to the primers used in the diagnostic reaction, whereas their 3' ends were complementary to the (pUC19) predetermined DNA sequence of defined length and sequence. The concentration of IACs appeared to be critical. Too much IAC DNA template would out-compete the target DNA template, thus giving a false negative result. However the use of an optimal IAC concentration increased the reliability of the PCR assays and appeared to be useful for food diagnostics.

Characterization and application of a quantitative DNA marker that discriminates sex in Chinook salmon (Oncorhynchus tshawytscha)

USGS Publications Warehouse

Clifton, D.R.; Rodriguez, R.J.

1997-01-01

A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.

Characterization and application of a quantitative DNA marker that discriminates sex in chinook salmon (Oncorhynchus tshawytscha)

USGS Publications Warehouse

Clifton, D.R.; Rodriguez, R.J.

1997-01-01

A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.

Molecular Design of Antifouling Polymer Brushes Using Sequence-Specific Peptoids.

PubMed

Lau, King Hang Aaron; Sileika, Tadas S; Park, Sung Hyun; Sousa, Ana Maria Leal; Burch, Patrick; Szleifer, Igal; Messersmith, Phillip B

2015-01-07

Material systems that can be used to flexibly and precisely define the chemical nature and molecular arrangement of a surface would be invaluable for the control of complex biointerfacial interactions. For example, progress in antifouling polymer biointerfaces that prevent non-specific protein adsorption and cell attachment, which can significantly improve the performance of an array of biomedical and industrial applications, is hampered by a lack of chemical models to identify the molecular features conferring their properties. Poly(N-substituted glycine) "peptoids" are peptidomimetic polymers that can be conveniently synthesized with specific monomer sequences and chain lengths, and are presented as a versatile platform for investigating the molecular design of antifouling polymer brushes. Zwitterionic antifouling polymer brushes have captured significant recent attention, and a targeted library of zwitterionic peptoid brushes with a different charge densities, hydration, separations between charged groups, chain lengths, and grafted chain densities, is quantitatively evaluated for their antifouling properties through a range of protein adsorption and cell attachment assays. Specific zwitterionic brush designs were found to give rise to distinct but subtle differences in properties. The results also point to the dominant roles of the grafted chain density and chain length in determining the performance of antifouling polymer brushes.

URPD: a specific product primer design tool

PubMed Central

2012-01-01

Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

URPD: a specific product primer design tool.

PubMed

Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

2012-06-19

Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

IgE reactivity to alpha1 and alpha2 chains of bovine type 1 collagen in children with bovine gelatin allergy.

PubMed

Sakaguchi, M; Hori, H; Hattori, S; Irie, S; Imai, A; Yanagida, M; Miyazawa, H; Toda, M; Inouye, S

1999-09-01

Anaphylactic reactions to measles, mumps, and rubella vaccines, including gelatin as a stabilizer, have been reported. It had been found that most of these reactions to live vaccines are caused by the bovine gelatin included in these vaccines. Gelatin mainly includes denatured type I collagen, which consists of alpha1 and alpha2 chains. The current study was designed to investigate the IgE reactivity to alpha1 and alpha2 chains of bovine type I collagen in gelatin-sensitive children. Serum samples were taken from 10 children who had anaphylaxis to the vaccines and high levels of specific IgE to bovine gelatin. Bovine type I collagen was isolated from bovine skin and then separated to alpha1 and alpha2 chains by column chromatography. IgE reactivity to denatured type I collagen and its alpha1 and alpha2 chains was analyzed by immunoblotting, ELISA, and histamine release from the mast cells passive sensitized with IgE antibodies in pooled serum of the children. All children had specific IgE to bovine type I collagen. Furthermore, IgE antibodies in their sera reacted with the alpha;2 chain but not with the alpha1 chain. Similarly, the mast cells sensitized with pooled sera in the children showed alpha2 chain-specific histamine release but not alpha1 chain-specific histamine release. In gelatin allergy denatured bovine type I collagen is a major allergen and IgE-binding sites exist in the alpha2 chain of type I collagen.

Primer-independent RNA sequencing with bacteriophage phi6 RNA polymerase and chain terminators.

PubMed

Makeyev, E V; Bamford, D H

2001-05-01

Here we propose a new general method for directly determining RNA sequence based on the use of the RNA-dependent RNA polymerase from bacteriophage phi6 and the chain terminators (RdRP sequencing). The following properties of the polymerase render it appropriate for this application: (1) the phi6 polymerase can replicate a number of single-stranded RNA templates in vitro. (2) In contrast to the primer-dependent DNA polymerases utilized in the sequencing procedure by Sanger et al. (Proc Natl Acad Sci USA, 1977, 74:5463-5467), it initiates nascent strand synthesis without a primer, starting the polymerization on the very 3'-terminus of the template. (3) The polymerase can incorporate chain-terminating nucleotide analogs into the nascent RNA chain to produce a set of base-specific termination products. Consequently, 3' proximal or even complete sequence of many target RNA molecules can be rapidly deduced without prior sequence information. The new technique proved useful for sequencing several synthetic ssRNA templates. Furthermore, using genomic segments of the bluetongue virus we show that RdRP sequencing can also be applied to naturally occurring dsRNA templates. This suggests possible uses of the method in the RNA virus research and diagnostics.

Conservation of Shannon's redundancy for proteins. [information theory applied to amino acid sequences

NASA Technical Reports Server (NTRS)

Gatlin, L. L.

1974-01-01

Concepts of information theory are applied to examine various proteins in terms of their redundancy in natural originators such as animals and plants. The Monte Carlo method is used to derive information parameters for random protein sequences. Real protein sequence parameters are compared with the standard parameters of protein sequences having a specific length. The tendency of a chain to contain some amino acids more frequently than others and the tendency of a chain to contain certain amino acid pairs more frequently than other pairs are used as randomness measures of individual protein sequences. Non-periodic proteins are generally found to have random Shannon redundancies except in cases of constraints due to short chain length and genetic codes. Redundant characteristics of highly periodic proteins are discussed. A degree of periodicity parameter is derived.

Development and application of a multiplex reverse-transcription polymerase chain reaction assay for screening a global collection of Citrus tristeza virus isolates.

PubMed

Roy, Avijit; Ananthakrishnan, G; Hartung, John S; Brlansky, R H

2010-10-01

The emerging diversity of Citrus tristeza virus (CTV) genotypes has complicated detection and diagnostic measures and prompted the search for new differentiation methods. To simplify the identification and differentiation of CTV genotypes, a multiplex reverse-transcription polymerase chain reaction (RT-PCR) technique for the screening of CTV isolates was developed. Variable regions within the open reading frame (ORF)-1a of diverse CTV genotypes were identified to develop first a simplex (S) and then a hexaplex (H) RT-PCR. CTV isolates have been grouped previously into five genotypes (namely, T3, T30, T36, VT, and B165) based on the nucleotide sequence comparisons and phylogenetic analyses. Nucleotide sequences from GenBank were used to design species and genotype-specific primers (GSPs). The GSPs were initially used for reliable detection of all CTV genotypes using S-RT-PCR. Furthermore, detection of all five recognized CTV genotypes was established using the H-RT-PCR. Six amplicons, one generic to all CTV isolates and one for each of the five recognized genotypes, were identified on the basis of their size and were confirmed by sequence analysis. In all, 175 CTV isolates from 29 citrus-growing countries were successfully analyzed by S- and H-RT-PCR. Of these, 97 isolates contained T36 genotypes, 95 contained T3 genotypes, 76 contained T30 genotypes, 71 contained VT genotypes, and 24 contained B165 genotype isolates. In total, 126 isolates contained mixed infections of 2 to 5 of the known CTV genotypes. Two of the CTV isolates could not be assigned to a known genotype. H-RT-PCR provides a sensitive, specific, reliable, and rapid way to screen for CTV genotypes compared with other methods for CTV genotype detection. Efficient identification of CTV genotypes will facilitate a better understanding of CTV isolates, including the possible interaction of different genotypes in causing or preventing diseases. The methods described can also be used in virus-free citrus propagation programs and in the development of CTV-resistant cultivars.

Evaluation of the utility of conventional polymerase chain reaction for detection and species differentiation in human hookworm infections.

PubMed

Chidambaram, Meenachi; Parija, Subhash Chandra; Toi, Pampa Ch; Mandal, Jharna; Sankaramoorthy, Dhanalakshmi; George, Santosh; Natarajan, Mailan; Padukone, Shashiraja

2017-01-01

Human hookworm infection is caused mainly by Necator americanus and Ancylostoma duodenale . Among the zoonotic hookworm species, only Ancylostoma ceylanicum causes potent human infections where dogs and cats act as reservoir of infection. Hence, species differentiation is imperative because the eradication of both anthroponotic and zoonotic hookworm depends on the concurrent human and animal health programs, hygienic practices, and mass drug administration for humans and dogs. This study was performed to evaluate the utility of polymerase chain reaction (PCR) for detection of hookworm infections. A total of 209 stool samples were collected and subjected to stool microscopy, Kato-Katz method to identify the intensity of the infection, coproculture for L3 larval identification and species differentiation and semi-nested PCR with sequencing. The prevalence of hookworm was estimated as 7.6%. Highest hookworm prevalence was seen in 20-30 years of age group. Majority of the infections were mild intensity infections. Sensitivity of stool microscopy was found to be 81.2% and the specificity was 100%. Sensitivity of Kato-Katz method was 87.5% and specificity was 100%. True positivity by agar plate culture was 83.3% and false positivity rate was 16.6%. Stool microscopy is the major mode of detection, but it has a higher false negative rate. Coproculture is time-consuming and needs the expertise to differentiate the species. On the other hand, PCR is known to be a sensitive, specific, and a reliable investigative tool which can help in diagnosis as well as in species differentiation.

HLA-A, -B, -C, -DRB1 and -DQB1 alleles and haplotypes in 951 Southeast Asia Malays from Peninsular Malaysia.

PubMed

Tan, Lay-Kim; Mohd-Farid, Baharin; Salsabil, Sulaiman; Heselynn, Hussein; Wahinuddin, Sulaiman; Lau, Ing-Soo; Gun, Suk-Chyn; Nor-Suhaila, Sharil; Eashwary, M; Mohd-Shahrir, Mohamed Said; Ainon, Mohd-Mokhtar; Azmillah, Rosman; Muhaini, Othman; Shahnaz, Murad; Too, Chun-Lai

2016-10-01

A total of 951 Southeast Asia Malays from Peninsular Malaysia were genotyped for HLA-A, -B, -C -DRB1, and -DQB1 loci using polymerase chain reaction sequence-specific oligonucleotide probe hybridization methods. In this report, there were significant deviation from Hardy-Weinberg proportions for the HLA-A (p<0.0001), -B (p<0.0001), -DRB1 (p<0.0001) and -DQB1 (p<0.01) loci. Minor deviations from HWEP were detected for HLA-C (p=0.01). This genotype data was available in Allele Frequencies Network Database (AFND) Gonzalez-Galarza et al. (2015). Copyright © 2016. Published by Elsevier Inc.

[Lymphadenopathy caused by Toxoplasma in an intramammary lymph node: role of molecular biology in the diagnosis].

PubMed

Voglino, G; Arisio, R; Novero, D; Marchi, C; Fessia, L

1997-08-01

We describe a case of Toxoplasma gondii lymphoadenopathy in an intramammary lymph node in a 22 year old woman. Clinical evidence and ultrasound were suggestive for fibroadenoma, while cytology on fine needle aspiration suspected a lymphomatous lesion. The pathological examination demonstrated a lymph node with granulomatous foci with epithelioid histiocytes, consistent with Toxoplasma gondii lymphadenopathy. The pathological finding was confirmed by serological tests and by PCR (Polymerase Chain Reaction) using specific primers designed on ribosomal 18s DNA sequence of Toxoplasma gondii. The aim of this work is to emphasize the role of molecular biology techniques as an aid to pathological diagnosis in parasite diseases.

The Molecular Basis of Muscular Dystrophy in the mdx Mouse: A Point Mutation

NASA Astrophysics Data System (ADS)

Sicinski, Piotr; Geng, Yan; Ryder-Cook, Allan S.; Barnard, Eric A.; Darlison, Mark G.; Barnard, Pene J.

1989-06-01

The mdx mouse is an X-linked myopathic mutant, an animal model for human Duchenne muscular dystrophy. In both mouse and man the mutations lie within the dystrophin gene, but the phenotypic differences of the disease in the two species confer much interest on the molecular basis of the mdx mutation. The complementary DNA for mouse dystrophin has been cloned, and the sequence has been used in the polymerase chain reaction to amplify normal and mdx dystrophin transcripts in the area of the mdx mutation. Sequence analysis of the amplification products showed that the mdx mouse has a single base substitution within an exon, which causes premature termination of the polypeptide chain.

Molecular Diagnostic Analysis of Outbreak Scenarios

ERIC Educational Resources Information Center

Morsink, M. C.; Dekter, H. E.; Dirks-Mulder, A.; van Leeuwen, W. B.

2012-01-01

In the current laboratory assignment, technical aspects of the polymerase chain reaction (PCR) are integrated in the context of six different bacterial outbreak scenarios. The "Enterobacterial Repetitive Intergenic Consensus Sequence" (ERIC) PCR was used to analyze different outbreak scenarios. First, groups of 2-4 students determined optimal…

Identification of TCT, a novel knockdown resistance allele mutation and analysis of resistance detection methods in the voltage-gated Na⁺ channel of Culex pipiens pallens from Shandong Province, China.

PubMed

Liu, Hong-Mei; Cheng, Peng; Huang, Xiaodan; Dai, Yu-Hua; Wang, Hai-Fang; Liu, Li-Juan; Zhao, Yu-Qiang; Wang, Huai-Wei; Gong, Mao-Qing

2013-02-01

The present study aimed to investigate deltamethrin resistance in Culex pipiens pallens (C. pipiens pallens) mosquitoes and its correlation with knockdown resistance (kdr) mutations. In addition, mosquito‑resistance testing methods were analyzed. Using specific primers in polymerase chain reaction (PCR) and allele-specific (AS)-PCR, kdr gene sequences isolated from wild C. pipiens pallens mosquitoes were sequenced. Linear regression analysis was used to determine the correlation between the mutations and deltamethrin resistance. A kdr allelic gene was cloned and sequenced. Analysis of the DNA sequences revealed the presence of two point mutations at the L1014 residue in the IIS6 transmembrane segment of the voltage‑gated sodium channel (VGSC): L1014F, TTA→TTT, replacing a leucine (L) with a phenylalanine (F); L1014S, TTA→TCA, replacing leucine (L) with serine (S). Two alternative kdr-like mutations, L1014F and L1014S, were identified to be positively correlated with the deltamethrin-resistant phenotype. In addition a novel mutation, TCT, was identified in the VGSC of C. pipiens pallens. PCR and AS-PCR yielded consistent results with respect to mosquito resistance. However, the detection rate of PCR was higher than that of AS-PCR. Further studies are required to determine the specific resistance mechanism. PCR and AS-PCR demonstrated suitability for mosquito resistance field tests, however, the former method may be superior to the latter.

Detection of trypanosomatid Phytomonas parasitic in plants by polymerase chain reaction amplification of small subunit ribosomal DNA.

PubMed

Teixeira, M M; Campaner, M; Camargo, E P

1994-01-01

To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.

Diagnostic exercise: chronic vomiting in a dog.

PubMed

Ellis, A E; Brown, C A; Miller, D L

2010-09-01

An approximately one-and-a-half-year-old, neutered male, mixed-breed dog was presented for a chronic history of vomiting. Profuse diarrhea was also noted during examination. An exploratory laparotomy was performed, bone chips were removed from the stomach, and a raised, circular area of gastric mucosa was biopsied. Histologically, there was severe gastric cryptosporidiosis as well as numerous spiral bacteria, consistent with Helicobacter spp. Polymerase chain reaction revealed visible bands for the 18S ribosomal RNA gene for Cryptosporidium spp. The polymerase chain reaction product was sequenced and was found to be most similar to Cryptosporidium muris. Both the gastric location and the species of Cryptosporidium are unusual in a dog.

Two cases of maternal alloimmunization against human neutrophil alloantigen-4b, one causing severe alloimmune neonatal neutropenia.

PubMed

Curtis, Brian R; Roman, Ashley S; Sullivan, Mia J; Raven, Cindy S; Larison, Judy; Weitekamp, Lee Ann

2016-01-01

Human neutrophil antigen (HNA)-4a/4bw is encoded by 230G>A in ITGAM, which results in an Arg61His substitution of the αM chain (CD11b) of complement receptor 3 (CR3; CD11b/18 or Mac-1). HNA-4a antibodies have been detected in the sera of female blood donors and in maternal sera that caused alloimmune neonatal neutropenia (ANN), in which maternal immunoglobulin (Ig)G antibodies against a paternally inherited HNA cross the placenta and destroy fetal and neonatal neutrophils. However, to date, antibodies specific for HNA-4b have not been reported. Here, we report the first two examples of HNA-4b antibodies. The two sera studied were both from previously pregnant females, one a multiparous female blood donor implicated in two separate transfusion reactions and the second a mother whose first pregnancy resulted in the birth of a severely neutropenic (0 × 10(6) neutrophils/L) infant affected with ANN. Serum neutrophil antibody testing was by flow cytometry and CD11b/18 monoclonal antibody immobilization of granulocyte antigens assay, and HNA genotyping was performed by polymerase chain reaction with sequence-specific priming and allele-specific 5' exonuclease assays. Sera from both women contained IgG antibodies reactive only with HNA-4b+ neutrophils and both typed HNA-4a/a. Both were immunized through pregnancy since their husbands and children all typed HNA-4a/b. The serologic results, together with the genotype results, confirm that these are the first reported cases of neutrophil antibodies specific for HNA-4b. © 2015 AABB.

Epidemiological, bacteriological and molecular studies on caseous lymphadenitis in Sirohi goats of Rajasthan, India.

PubMed

Kumar, Jyoti; Singh, Fateh; Tripathi, Bhupendra Nath; Kumar, Rajiv; Dixit, Shivendra Kumar; Sonawane, Ganesh Gangaram

2012-10-01

Corynebacterium pseudotuberculosis is the causative agent of caseous lymphadenitis (CL), a chronic debilitating disease of goats. In the present study, a total of 575 goats of Sirohi breed on an organized farm situated in the semi-arid tropical region of Rajasthan, India were clinically examined. Pus samples from superficial lymph nodes of 27 (4.7%) adult goats presenting clinical lesions suggestive of CL were collected for bacteriological and molecular analyses. Of these goats, 51.9% yielded C. pseudotuberculosis on the basis of morphological, cultural and biochemical characteristics. A polymerase chain reaction (PCR) assay targeting proline iminopeptidase gene specific to C. pseudotuberculosis was developed that confirmed all 14 bacterial isolates. The specificity of the PCR product was confirmed by sequencing of the 551-bp amplicon in both senses, showing 98-100% homology with published sequences. Thus, overall prevalence rate based on clinical, bacterial culture and PCR assay were found to be 4.7%, 2.4% and 2.4%, respectively. The PCR assay developed in this study was found to be specific and rapid, and could be used for confirmation of CL in goats as an alternative method to generally cumbersome, time-consuming and less reliable conventional methods.

Fatal columbid herpesvirus-1 infections in three species of Australian birds of prey.

PubMed

Phalen, D N; Holz, P; Rasmussen, L; Bayley, C

2011-05-01

We document columbid herpesvirus-1 (CoHV-1) infection in two barking owls (Ninox connivens), a powerful owl (Ninox strenua) and an Australian hobby (Falco longipennis). Antemortem signs of infection were non-specific and the birds either died soon after they were identified as ill or were found dead unexpectedly. Gross postmortem findings were also not specific. Microscopically, marked to massive splenic and hepatic necrosis with the presence of eosinophilic inclusion bodies in remaining splenocytes and hepatocytes was found in all birds. Herpesvirus virions were identified in liver sections from one of the boobook owls by electron microscopy. Using CoHV-1-specific primers and polymerase chain reaction, CoHV-1 DNA was amplified from tissue samples from all birds. A comparison of these sequences to previously reported sequences of CoHV-1 found them to be identical or to vary by a single base pair. These findings increase the number of known species of birds of prey that are susceptible to CoHV-1 infection and indicate that rock pigeons (Columbia livia) should not be included in the diet of captive Australian birds of prey. © 2011 The Authors. Australian Veterinary Journal © 2011 Australian Veterinary Association.

Mutant fatty acid desaturase

DOEpatents

Shanklin, John; Cahoon, Edgar B.

2004-02-03

The present invention relates to a method for producing mutants of a fatty acid desaturase having a substantially increased activity towards fatty acid substrates with chains containing fewer than 18 carbons relative to an unmutagenized precursor desaturase having an 18 carbon atom chain length substrate specificity. The method involves inducing one or more mutations in the nucleic acid sequence encoding the precursor desaturase, transforming the mutated sequence into an unsaturated fatty acid auxotroph cell such as MH13 E. coli, culturing the cells in the absence of supplemental unsaturated fatty acids, thereby selecting for recipient cells which have received and which express a mutant fatty acid desaturase with an elevated specificity for fatty acid substrates having chain lengths of less than 18 carbon atoms. A variety of mutants having 16 or fewer carbon atom chain length substrate specificities are produced by this method. Mutant desaturases produced by this method can be introduced via expression vectors into prokaryotic and eukaryotic cells and can also be used in the production of transgenic plants which may be used to produce specific fatty acid products.

Evaluation of Faecalibacterium 16S rDNA genetic markers for accurate identification of swine faecal waste by quantitative PCR.

PubMed

Duan, Chuanren; Cui, Yamin; Zhao, Yi; Zhai, Jun; Zhang, Baoyun; Zhang, Kun; Sun, Da; Chen, Hang

2016-10-01

A genetic marker within the 16S rRNA gene of Faecalibacterium was identified for use in a quantitative PCR (qPCR) assay to detect swine faecal contamination in water. A total of 146,038 bacterial sequences were obtained using 454 pyrosequencing. By comparative bioinformatics analysis of Faecalibacterium sequences with those of numerous swine and other animal species, swine-specific Faecalibacterium 16S rRNA gene sequences were identified and Polymerase Chain Okabe (PCR) primer sets designed and tested against faecal DNA samples from swine and non-swine sources. Two PCR primer sets, PFB-1 and PFB-2, showed the highest specificity to swine faecal waste and had no cross-reaction with other animal samples. PFB-1 and PFB-2 amplified 16S rRNA gene sequences from 50 samples of swine with positive ratios of 86 and 90%, respectively. We compared swine-specific Faecalibacterium qPCR assays for the purpose of quantifying the newly identified markers. The quantification limits (LOQs) of PFB-1 and PFB-2 markers in environmental water were 6.5 and 2.9 copies per 100 ml, respectively. Of the swine-associated assays tested, PFB-2 was more sensitive in detecting the swine faecal waste and quantifying the microbial load. Furthermore, the microbial abundance and diversity of the microbiomes of swine and other animal faeces were estimated using operational taxonomic units (OTUs). The species specificity was demonstrated for the microbial populations present in various animal faeces. Copyright © 2016 Elsevier Ltd. All rights reserved.

Bioinspired synthesis of pentalene-based chromophores from an oligoketone chain.

PubMed

Saito, Yuki; Higuchi, Masayuki; Yoshioka, Shota; Senboku, Hisanori; Inokuma, Yasuhide

2018-04-24

We report a bioinspired synthesis of 2,5-dihydropentalene-based chromophores from an aliphatic oligoketone bearing 1,3- and 1,4-diketone subunits. Unlike the natural polyketone sequence, fused five-membered rings were formed via an intramolecular aldol condensation. A subsequent Knoevenagel condensation reaction with malononitrile furnished a multiply cross-conjugated π-system with low-lying LUMO levels. Furthermore, pentalenes obtained from a non-conjugated aliphatic chain exhibited visible absorption and solid-state fluorescence.

Characterization of the cod (Gadus morhua) steroidogenic acute regulatory protein (StAR) sheds light on StAR gene structure in fish.

PubMed

Goetz, Frederick W; Norberg, Birgitta; McCauley, Linda A R; Iliev, Dimitar B

2004-03-01

The full-length cDNA for the cod (Gadus morhua) StAR was cloned by RT-PCR and library screening using ovarian RNA. From the library screening, 2 size classes of cDNA were obtained; a 1577 bp cDNA (cStAR1) and a 2851 bp cDNA (cStAR2). The cStAR1 cDNA presumably encodes a protein of 286 amino acids. The cStAR2 cDNA was composed of 6 separated sequences that contained all of the coding regions of cStAR1 when added together, but also contained 5 noncoding regions not observed in cStAR1. Polymerase chain reactions of cod genomic DNA produced products slightly larger than cStAR2. The sequence of these products were the same as cStAR2 but revealed one additional noncoding region (intron). Thus, the fish StAR gene contains the same number of exons (7) and introns (6) as observed in mammals, but is approximately half the size of the mammalian gene. Using Northern analysis and RT-PCR, cStAR1 expression was observed only in testes, ovaries and head kidneys. Polymerase chain reaction products were also observed using cDNA from steroidogenic tissues and primers designed to regions specific for cStAR2, indicating that cStAR2 is expressed in tissues and may account for the presence of larger transcripts observed on Northern blots.

Electrochemical techniques on sequence-specific PCR amplicon detection for point-of-care applications.

PubMed

Luo, Xiaoteng; Hsing, I-Ming

2009-10-01

Nucleic acid based analysis provides accurate differentiation among closely affiliated species and this species- and sequence-specific detection technique would be particularly useful for point-of-care (POC) testing for prevention and early detection of highly infectious and damaging diseases. Electrochemical (EC) detection and polymerase chain reaction (PCR) are two indispensable steps, in our view, in a nucleic acid based point-of-care testing device as the former, in comparison with the fluorescence counterpart, provides inherent advantages of detection sensitivity, device miniaturization and operation simplicity, and the latter offers an effective way to boost the amount of targets to a detectable quantity. In this mini-review, we will highlight some of the interesting investigations using the combined EC detection and PCR amplification approaches for end-point detection and real-time monitoring. The promise of current approaches and the direction for future investigations will be discussed. It would be our view that the synergistic effect of the combined EC-PCR steps in a portable device provides a promising detection technology platform that will be ready for point-of-care applications in the near future.

Development of real-time PCR for detection and quantitation of Streptococcus parauberis.

PubMed

Nguyen, T L; Lim, Y J; Kim, D-H; Austin, B

2016-01-01

Streptococcus parauberis is an increasing threat to aquaculture of olive flounder, Paralichthys olivaceus Temminck & Schlegel, in South Korea. We developed a real-time polymerase chain reaction (PCR) method using the TaqMan probe assay to detect and quantify S. parauberis by targeting the gyrB gene sequences, which are effective for molecular analysis of the genus Streptococcus. Our real-time PCR assay is capable of detecting 10 fg of genomic DNA per reaction. The intra- and interassay coefficient of variation (CV) values ranged from 0.42-1.95%, demonstrating that the assay has good reproducibility. There was not any cross-reactivity to Streptococcus iniae or to other streptococcal/lactococcal fish pathogens, such as S. agalactiae and Lactococcus garvieae, indicating that the assay is highly specific to S. parauberis. The results of the real-time PCR assay corresponded well to those of conventional culture assays for S. parauberis from inoculated tissue homogenates (r = 0.957; P < 0.05). Hence, this sensitive and specific real-time PCR is a valuable tool for diagnostic quantitation of S. parauberis in clinical samples. © 2014 John Wiley & Sons Ltd.

Sequence differences in the diagnostic region of the cysteine protease 8 gene of Tritrichomonas foetus parasites of cats and cattle.

PubMed

Sun, Zichen; Stack, Colin; Šlapeta, Jan

2012-05-25

In order to investigate the genetic variation between Tritrichomonas foetus from bovine and feline origins, cysteine protease 8 (CP8) coding sequence was selected as the polymorphic DNA marker. Direct sequencing of CP8 coding sequence of T. foetus from four feline isolates and two bovine isolates with polymerase chain reaction successfully revealed conserved nucleotide polymorphisms between feline and bovine isolates. These results provide useful information for CP8-based molecular differentiation of T. foetus genotypes. Copyright © 2011 Elsevier B.V. All rights reserved.

Detection of a putative novel adenovirus by PCR amplification, sequencing and phylogenetic characterisation of two gene fragments from formalin-fixed paraffin-embedded tissues of a cat diagnosed with disseminated adenovirus disease.

PubMed

Lakatos, Béla; Hornyák, Ákos; Demeter, Zoltán; Forgách, Petra; Kennedy, Frances; Rusvai, Miklós

2017-12-01

Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in formalin-fixed paraffin-embedded tissue samples of a cat that had suffered from disseminated adenovirus infection. The identity of the amplified products from the hexon and DNA-dependent DNA polymerase genes was confirmed by DNA sequencing. The sequences were clearly distinguishable from corresponding hexon and polymerase sequences of other mastadenoviruses, including human adenoviruses. These results suggest the possible existence of a distinct feline adenovirus.

Identification of three randomly amplified polymorphic DNA-polymerase chain reaction markers for distinguishing Asian and North American Gypsy Moths (Lepidoptera: Lymantriidae)

Treesearch

David E. Schreiber; Karen J. Garner; James M. Slavicek

1997-01-01

Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...

Generation of human Fab antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences.

PubMed

Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F

2011-09-01

The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human Fab (fragment antigen binding) antibody libraries. In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final Fab products that are used for cloning.

Implementation of Amplicon Parallel Sequencing Leads to Improvement of Diagnosis and Therapy of Lung Cancer Patients.

PubMed

König, Katharina; Peifer, Martin; Fassunke, Jana; Ihle, Michaela A; Künstlinger, Helen; Heydt, Carina; Stamm, Katrin; Ueckeroth, Frank; Vollbrecht, Claudia; Bos, Marc; Gardizi, Masyar; Scheffler, Matthias; Nogova, Lucia; Leenders, Frauke; Albus, Kerstin; Meder, Lydia; Becker, Kerstin; Florin, Alexandra; Rommerscheidt-Fuss, Ursula; Altmüller, Janine; Kloth, Michael; Nürnberg, Peter; Henkel, Thomas; Bikár, Sven-Ernö; Sos, Martin L; Geese, William J; Strauss, Lewis; Ko, Yon-Dschun; Gerigk, Ulrich; Odenthal, Margarete; Zander, Thomas; Wolf, Jürgen; Merkelbach-Bruse, Sabine; Buettner, Reinhard; Heukamp, Lukas C

2015-07-01

The Network Genomic Medicine Lung Cancer was set up to rapidly translate scientific advances into early clinical trials of targeted therapies in lung cancer performing molecular analyses of more than 3500 patients annually. Because sequential analysis of the relevant driver mutations on fixated samples is challenging in terms of workload, tissue availability, and cost, we established multiplex parallel sequencing in routine diagnostics. The aim was to analyze all therapeutically relevant mutations in lung cancer samples in a high-throughput fashion while significantly reducing turnaround time and amount of input DNA compared with conventional dideoxy sequencing of single polymerase chain reaction amplicons. In this study, we demonstrate the feasibility of a 102 amplicon multiplex polymerase chain reaction followed by sequencing on an Illumina sequencer on formalin-fixed paraffin-embedded tissue in routine diagnostics. Analysis of a validation cohort of 180 samples showed this approach to require significantly less input material and to be more reliable, robust, and cost-effective than conventional dideoxy sequencing. Subsequently, 2657 lung cancer patients were analyzed. We observed that comprehensive biomarker testing provided novel information in addition to histological diagnosis and clinical staging. In 2657 consecutively analyzed lung cancer samples, we identified driver mutations at the expected prevalence. Furthermore we found potentially targetable DDR2 mutations at a frequency of 3% in both adenocarcinomas and squamous cell carcinomas. Overall, our data demonstrate the utility of systematic sequencing analysis in a clinical routine setting and highlight the dramatic impact of such an approach on the availability of therapeutic strategies for the targeted treatment of individual cancer patients.

Diagnosing leprosy: revisiting the role of the slit-skin smear with critical analysis of the applicability of polymerase chain reaction in diagnosis.

PubMed

Banerjee, Surajita; Biswas, Nibir; Kanti Das, Nilay; Sil, Amrita; Ghosh, Pramit; Hasanoor Raja, Abu Hena; Dasgupta, Sarbani; Kanti Datta, Pijush; Bhattacharya, Basudev

2011-12-01

Diagnosing leprosy is challenging, especially in early-stage cases, and the need for a sensitive diagnostic tool is urgent. Polymerase chain reaction (PCR) holds promise as a simple and sensitive diagnostic tool, but its usefulness in the Indian context requires further evaluation. Slit-skin smear (SSS) remains the conventional method of leprosy detection. Hence, this study was undertaken to evaluate and compare the diagnostic efficacy of PCR versus that of SSS. Punch biopsy of skin and SSS were obtained from the active margins of lesions. Cases were clinically grouped according to whether they were multibacillary (MB) or paucibacillary (PB) and classified into tuberculoid (TT), borderline tuberculoid (BT), borderline lepromatous (BL), lepromatous (LL), histoid, and indeterminate groups after clinicopathological correlation. DNA was extracted from biopsy specimens, and multiplex PCR was carried out incorporating primers intended for the amplification of a specific 372-bp fragment of a repetitive sequence of Mycobacterium leprae DNA. Among 164 patients, PCR was positive in 82.3%. The sensitivity of PCR was significantly greater (P < 0.0001) than that of SSS in both the MB (85.9% vs. 59.8%) and PB (75.4% vs. 1.8%) subgroups; the difference in sensitivity in the PB subgroup is remarkable. Positivity by PCR and SSS was found in 100% of LL and histoid leprosy, but PCR had significantly greater (P < 0.0001) positivity in BT leprosy and was of definite increased value in indeterminate and TT leprosy. Polymerase chain reaction had higher sensitivity compared with SSS, especially in diagnostically challenging and PB cases. Thus, the use of this costly but sensitive tool should be restricted to this subgroup, because SSS is sufficiently sensitive in the diagnosis of LL and histoid leprosy. © 2011 The International Society of Dermatology.

Enzyme- and label-free electrochemical aptasensor for kanamycin detection based on double stir bar-assisted toehold-mediated strand displacement reaction for dual-signal amplification.

PubMed

Hong, Feng; Chen, Xixue; Cao, Yuting; Dong, Youren; Wu, Dazhen; Hu, Futao; Gan, Ning

2018-07-30

It is critically important to detect antibiotic residues for monitoring food safety. In this study, an enzyme- and label-free electrochemical aptasensor for antibiotics, with kanamycin (Kana) as a typical analyte, was developed based on a double stir bar-assisted toehold-mediated strand displacement reaction (dSB-TMSDR) for dual-signal amplification. First, we modified two gold electrodes (E-1 and E-2) with different DNA probes (S1/S2 hybrid probe in E-1 and DNA fuel strand S3 in E-2). In the presence of Kana, an S1/S2 probe can be disassembled from E-1 to form an S2/Kana complex in supernatant. The S2/Kana could react with S3 on E-2 to form S2/S3 hybrid and release Kana through TMSDR. After then, the target recycling was triggered. Subsequently, the formed S2/S3 hybrid can also trigger a hybridization chain reaction (HCR). Consequently, the dual-signal amplification strategy was established, which resulted in many long dsDNA chains on E-2. The chains can associate with methylene blue (MB) as redox probes to produce a current response for the quantification of Kana. The assay exhibited high sensitivity and specificity with a detection limit at 16 fM Kana due to the dual-signal amplification. The double stir bars system can both increase phase separation and prevent leakage of DNA fuel to reduce background interference. Moreover, it allows flexible sequence design of the TMSDR probes. The assay was successfully employed to detect Kana residues in food and showed potential application value in food safety detection. Copyright © 2018 Elsevier B.V. All rights reserved.

Fatal hemorrhagic fever caused by West Nile virus in the United States.

PubMed

Paddock, Christopher D; Nicholson, William L; Bhatnagar, Julu; Goldsmith, Cynthia S; Greer, Patricia W; Hayes, Edward B; Risko, Joseph A; Henderson, Corey; Blackmore, Carina G; Lanciotti, Robert S; Campbell, Grant L; Zaki, Sherif R

2006-06-01

Most West Nile virus (WNV) infections in humans are asymptomatic; severe disease occurs in relatively few patients and typically manifests as encephalitis, meningitis, or acute flaccid paralysis. A few cases of life-threatening disease with diffuse hemorrhagic manifestations have been reported in Africa; however, this clinical presentation has not been documented for any of the >16,700 cases of WNV disease reported in the United States during 1999-2004. We describe a case of fulminant WNV infection in a 59-year-old Florida man who died following a brief illness that resembled hemorrhagic disease caused by Rickettsia reckettsii, dengue virus or yellow fever virus. Traditional and contemporary diagnostic assays, including culture isolation, electron microscopic examination, reverse-transcriptase polymerase chain reaction amplification, and immunohistochemical stains, were used to confirm systemic WNV infection in the patient. WNV was isolated in a cell culture from a skin biopsy specimen obtained from the patient shortly prior to death. Electron microscopic examination identified the isolate as a flavivirus, and reverse-transcriptase polymerase chain reaction amplified specific WNV sequences from the isolate and patient tissue. Quantitative polymerase chain reaction identified approximately 1x10(7) viral copies/mL in the patient's serum. WNV antigens were detected by immunohistochemical stains in intravascular mononuclear cells and endothelium in skin, lung, liver, kidney, spleen, bone marrow, and central nervous system; no viral antigens were identified in neurons or glial cells of the central nervous system. Although hemorrhagic disease is a rare manifestation of WNV infection, the findings provided by this report may offer new insights regarding the clinical spectrum and pathogenesis of WNV disease in humans.

Isolation of a full-length CC-NBS-LRR resistance gene analog candidate from sugar pine showing low nucleotide diversity.

Treesearch

K.D. Jermstad; L.A. Sheppard; B.B. Kinloch; A. Delfino-Mix; E.S. Ersoz; K.V. Krutovsky; D.B Neale

2006-01-01

The nucleotide-binding-site and leucine-rich-repeat (NBS–LRR) class of R proteins is abundant and widely distributed in plants. By using degenerate primers designed on the NBS domain in lettuce, we amplified sequences in sugar pine that shared sequence identity with many of the NBS–LRR class resistance genes catalogued in GenBank. The polymerase chain reaction products...

BIALLELIC POLYMORPHISM IN THE INTRON REGION OF B-TUBULIN GENE OF CRYPTOSPORIDIUM PARASITES

EPA Science Inventory

Nucleotide sequencing of polymerase chain reaction-amplified intron region of the Cryptosporidium parvum B-tubulin gene in 26 human and 15 animal isolates revealed distinct genetic polymorphism between the human and bovine genotypes. The separation of 2 genotypes of C. parvum is...

DEVELOPMENT OF A MOLECULAR METHOD TO IDENTIFY HEPATITIS E VIRUS IN WATER

EPA Science Inventory

Hepatitis E virus (HEV) causes an infectious form of hepatitis associated with contaminated water. By analyzing the sequence of several HEV isolates, a reverse transciption-polymerase chain reaction method was developed and optimized that should be able to identify all of the kn...

Nanostructure Control of Biologically Inspired Polymers

NASA Astrophysics Data System (ADS)

Rosales, Adrianne Marie

Biological polymers, such as polypeptides, are responsible for many of life's most sophisticated functions due to precisely evolved hierarchical structures. These protein structures are the result of monodisperse sequences of amino acids that fold into well-defined chain shapes and tertiary structures. Recently, there has been much interest in the design of such sequence-specific polymers for materials applications in fields ranging from biotechnology to separations membranes. Non-natural polymers offer the stability and robustness necessary for materials applications; however, our ability to control monomer sequence in non-natural polymers has traditionally operated on a much simpler level. In addition, the relationship between monomer sequence and self-assembly is not well understood for biological molecules, much less synthetic polymers. Thus, there is a need to explore self-assembly phase space with sequence using a model system. Polypeptoids are non-natural, sequence-specific polymers that offer the opportunity to probe the effect of sequence on self-assembly. A variety of monomer interactions have an impact on polymer properties, such as chirality, hydrophobicity, and electrostatic interactions. Thus, a necessary starting point for this project was to investigate monomer sequence effects on the bulk properties of polypeptoid homopolymers. It was found that several polypeptoids have experimentally accessible melting transitions that are dependent on the choice of side chains, and it was shown that this transition is tuned by the incorporation of "defects" or a comonomer. The polypeptoid chain shape is also controlled with the choice of monomer and monomer sequence. By using at least 50% monomers with bulky, chiral side chains, the polypeptoid backbone is sterically twisted into a helix, and as found for the first time in this work, the persistence length is increased. However, this persistence length, which is a measure of the stiffness of the polymer, is small compared to other folded helices, indicating the conformational flexibility of polypeptoid chains. With a firmer understanding of how monomer sequence and composition influence polypeptoid bulk properties, we designed block copolymer systems for self-assembly. Because the governing parameters of block copolymer self-assembly are well understood, this architecture provides a convenient starting point for probing the effect of changing polymer sequence. We found that polystyrene-polypeptoid block copolymers readily self-assemble into hexagonally-packed and lamellar morphologies with long range order, and furthermore, sequence control of the polypeptoid block enables us to tune the strength of segregation (and therefore the order-disorder transition) of the block copolymer. Polypeptoid chain shape also affects self-assembly. In classical synthetic block copolymers, it has typically been difficult to change chain shape without also changing polymer chemistry and therefore other factors affecting self-assembly. The advantage of the polypeptoid system is that it is modular, as the side chain chemistry (and therefore polymer properties) can easily be changed without changing the backbone chemistry. Thus, we have decoupled conformational effects from chemical composition by comparing the self-assembly of block copolymers containing either a helical peptoid block or its racemic, non-helical analog. The increase in the persistence length of the peptoid block due to helicity translates to an increase in the morphological domain spacing. In this work, we further the understanding of the effect of monomer sequence on bulk polypeptoid properties and self-assembly. Our findings pave the way for the rational design of structured synthetic polymers with tunable, sequence-specific properties.

Simultaneous detection and differentiation of three genotypes of Brassica yellows virus by multiplex reverse transcription-polymerase chain reaction.

PubMed

Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui

2016-11-22

Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.

Detection of human papillomavirus (HPV) DNA in human prostatic tissues by polymerase chain reaction (PCR).

PubMed

Sarkar, F H; Sakr, W A; Li, Y W; Sreepathi, P; Crissman, J D

1993-01-01

Human papillomavirus (HPV) infections are strongly linked to the pathogenesis of uterine cervical neoplasms, and have been implicated in other cancers of the female genital tract. In contrast, the association of HPV with the cancers of the male urogenital tract is less evident, except in anal and penile cancers. However, recent studies reporting the prevalence of HPV infections in human prostate cancers (60-100% HPV 16 positive vs. no infection of HPV) have raised controversies regarding the prevalence of HPV in benign and neoplastic human prostate. We investigated the prevalence of HPV infections in prostatic intraepithelial neoplasia (PIN) and prostatic adenocarcinomas in 23 surgically resected prostates. Polymerase chain reaction (PCR) was used to amplify HPV 6b/11, 16, and 18 specific DNA sequences, using type specific HPV primers selected from the transforming gene E6-E7. The areas of PIN and cancer in 6 microns H&E stained tissue sections were identified, and respective areas of PIN and cancer were isolated from the adjacent serial sections and used for DNA amplification and HPV detection (Fig. 1). Our results demonstrated the presence of HPV 16 in three carcinomas (13%), using type specific primers in PCR amplified samples. We were not able to demonstrate the presence of other HPV types (HPV 6b/11 or HPV 18) in any of the samples using specific primers. Two of these prostates showed relatively strong positive signals by dot blot analysis, when hybridized with a 32P-labeled HPV 16 type specific oligonucleotide probe. One more sample showed weak positivity, when hybridized with a 32P-labeled HPV 16 type specific oligonucleotide probe. Subsequently, we have confirmed these results by Southern hybridization of the samples transferred to nylon membrane after agarose gel electrophoresis and detected by HPV 16 type specific oligonucleotide probe, using chemiluminescent assay. We, therefore, conclude that HPV infections of the prostate in general are not as common as has been previously claimed by other investigators.

Novel, In-House, SYBR Green Based One-Step rRT-PCR: Rapid and Accurate Diagnosis of Crimean-Congo Hemorrhagic Fever Virus in Suspected Patients From Iran.

PubMed

Zahraei, Bentolhoda; Hashemzadeh, Mohammad Sadegh; Najarasl, Mohammad; Zahiriyeganeh, Samaneh; Tat, Mahdi; Metanat, Maliheh; Sepehri Rad, Nahid; Khansari-Nejad, Behzad; Zafari, Ehsan; Sharti, Mojtaba; Dorostkar, Ruhollah

2016-01-01

The Crimean-Congo hemorrhagic fever (CCHF) virus causes severe disease in humans, with a high mortality rate. Since, there is no approved vaccine or specific treatment for CCHF, an early and accurate diagnosis, as well as reliable surveillance, is essential for case management and patient improvement. For this research, our aim was to evaluate the application of a novel SYBR Green based one-step real-time reverse-transcriptase polymerase chain reaction (rRT-PCR) assay for the in-house diagnosis of the CCHF virus. In this experimental study, the highly conserved S-region sequence of the CCHF viral genome was first adapted from GenBank, and the specific primers targeting this region were designed. Then, the viral RNA was extracted from 75 serum samples from different patients in eastern Iran. The sensitivity and specificity of the primers were also evaluated in positive serum samples previously confirmed to have the CCHF virus, by this one-step rRT-PCR assay, as well as a DNA sequencing analysis. From a total of 75 suspected serum samples, 42 were confirmed to be positive for CCHF virus, with no false-positives detected by the sequencing results. After 40 amplification cycles, the melting curve analysis revealed a mean melting temperature (Tm) of 86.5 ± 0.6°C (quite different from those of the primer-dimers), and the positive samples showed only a small variation in the parameters. In all of the positive samples, the predicted length of 420 bp was confirmed by electrophoresis. Moreover, the sensitivity test showed that this assay can detect less than 20 copies of viral RNA per reaction. This study showed that this novel one-step rRT-PCR assay is a rapid, reliable, repeatable, specific, sensitive, and simple tool for the detection of the CCHF virus.

A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

PubMed Central

2010-01-01

Background The hepatitis C virus (HCV) genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR) assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM), at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP)/COBAS TaqMan (CTM) assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection. PMID:20529244

The genotyping of infectious bronchitis virus in Taiwan by a multiplex amplification refractory mutation system reverse transcription polymerase chain reaction.

PubMed

Huang, Shr-Wei; Ho, Chia-Fang; Chan, Kun-Wei; Cheng, Min-Chung; Shien, Jui-Hung; Liu, Hung-Jen; Wang, Chi-Young

2014-11-01

Infectious bronchitis virus (IBV; Avian coronavirus) causes acute respiratory and reproductive and urogenital diseases in chickens. Following sequence alignment of IBV strains, a combination of selective primer sets was designed to individually amplify the IBV wild-type and vaccine strains using a multiplex amplification refractory mutation system reverse transcription polymerase chain reaction (ARMS RT-PCR) approach. This system was shown to discriminate the IBV wild-type and vaccine strains. Moreover, an ARMS real-time RT-PCR (ARMS qRT-PCR) was combined with a high-resolution analysis (HRMA) to establish a melt curve analysis program. The specificity of the ARMS RT-PCR and the ARMS qRT-PCR was verified using unrelated avian viruses. Different melting temperatures and distinct normalized and shifted melting curve patterns for the IBV Mass, IBV H120, IBV TW-I, and IBV TW-II strains were detected. The new assays were used on samples of lung and trachea as well as virus from allantoic fluid and cell culture. In addition to being able to detect the presence of IBV vaccine and wild-type strains by ARMS RT-PCR, the IBV Mass, IBV H120, IBV TW-I, and IBV TW-II strains were distinguished using ARMS qRT-PCR by their melting temperatures and by HRMA. These approaches have acceptable sensitivities and specificities and therefore should be able to serve as options when carrying out differential diagnosis of IBV in Taiwan and China. © 2014 The Author(s).

Generation of human scFv antibody libraries: PCR amplification and assembly of light- and heavy-chain coding sequences.

PubMed

Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F

2011-09-01

The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human scFv (single chain antibody fragment) libraries using a short linker (GGSSRSS) or a long linker (GGSSRSSSSGGGGSGGGG). In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final scFv products that are used for cloning.

Genetic variability in isolates of Chromobacterium violaceum from pulmonary secretion, water, and soil.

PubMed

Santini, A C; Magalhães, J T; Cascardo, J C M; Corrêa, R X

2016-04-28

Chromobacterium violaceum is a free-living Gram-negative bacillus usually found in the water and soil in tropical regions, which causes infections in humans. Chromobacteriosis is characterized by rapid dissemination and high mortality. The aim of this study was to detect the genetic variability among C. violaceum type strain ATCC 12472, and seven isolates from the environment and one from a pulmonary secretion from a chromobacteriosis patient from Ilhéus, Bahia. The molecular characterization of all samples was performed by polymerase chain reaction (PCR) sequencing and 16S rDNA analysis. Primers specific for two ATCC 12472 pathogenicity genes, hilA and yscD, as well as random amplified polymorphic DNA (RAPD), were used for PCR amplification and comparative sequencing of the products. For a more specific approach, the PCR products of 16S rDNA were digested with restriction enzymes. Seven of the samples, including type-strain ATCC 12472, were amplified by the hilA primers; these were subsequently sequenced. Gene yscD was amplified only in type-strain ATCC 12472. MspI and AluI digestion revealed 16S rDNA polymorphisms. This data allowed the generation of a dendogram for each analysis. The isolates of C. violaceum have variability in random genomic regions demonstrated by RAPD. Also, these isolates have variability in pathogenicity genes, as demonstrated by sequencing and restriction enzyme digestion.

Solid-state mAbs and ADCs subjected to heat-stress stability conditions can be covalently modified with buffer and excipient molecules.

PubMed

Valliere-Douglass, John F; Lewis, Patsy; Salas-Solano, Oscar; Jiang, Shan

2015-02-01

We report that a unique type of chemical modification occurs on lyophilized proteins. Freeze-dried mAbs and antibody-drug conjugates (ADCs) can be covalently modified with buffer and excipient molecules on the side chains of Glu, Asp, Thr, and Ser amino acids when subjected to temperature stress. The reaction occurs primarily via condensation of common buffers and excipients such as histidine, tris, trehalose and sucrose, with Glu and Asp carboxylates in the primary sequence of proteins. The reaction was also found to proceed through condensation of carboxylate containing buffers such as citrate, with Thr and Ser hydroxyls in the primary sequence of proteins. Based on the mass of the covalent adducts observed on mAbs and ADCs, it is apparent that the reaction produces water as a product and is thus favored in a low moisture environments such as a lyophilized protein cake. Herein, we present the evidence for the covalent modification of proteins drawn from case studies of in-depth characterization of heat-stressed mAbs and ADCs in the solid state. We also demonstrate how common charge variant assays such as imaged capillary isoelectric focusing and mass spectrometry can be used to monitor this specific class of protein modification. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.

An SRY mutation causing human sex reversal resolves a general mechanism of structure-specific DNA recognition: application to the four-way DNA junction.

PubMed

Peters, R; King, C Y; Ukiyama, E; Falsafi, S; Donahoe, P K; Weiss, M A

1995-04-11

SRY, a genetic "master switch" for male development in mammals, exhibits two biochemical activities: sequence-specific recognition of duplex DNA and sequence-independent binding to the sharp angles of four-way DNA junctions. Here, we distinguish between these activities by analysis of a mutant SRY associated with human sex reversal (46, XY female with pure gonadal dysgenesis). The substitution (168T in human SRY) alters a nonpolar side chain in the minor-groove DNA recognition alpha-helix of the HMG box [Haqq, C.M., King, C.-Y., Ukiyama, E., Haqq, T.N., Falsalfi, S., Donahoe, P.K., & Weiss, M.A. (1994) Science 266, 1494-1500]. The native (but not mutant) side chain inserts between specific base pairs in duplex DNA, interrupting base stacking at a site of induced DNA bending. Isotope-aided 1H-NMR spectroscopy demonstrates that analogous side-chain insertion occurs on binding of SRY to a four-way junction, establishing a shared mechanism of sequence- and structure-specific DNA binding. Although the mutant DNA-binding domain exhibits > 50-fold reduction in sequence-specific DNA recognition, near wild-type affinity for four-way junctions is retained. Our results (i) identify a shared SRY-DNA contact at a site of either induced or intrinsic DNA bending, (ii) demonstrate that this contact is not required to bind an intrinsically bent DNA target, and (iii) rationalize patterns of sequence conservation or diversity among HMG boxes. Clinical association of the I68T mutation with human sex reversal supports the hypothesis that specific DNA recognition by SRY is required for male sex determination.

Principles of protein folding--a perspective from simple exact models.

PubMed Central

Dill, K. A.; Bromberg, S.; Yue, K.; Fiebig, K. M.; Yee, D. P.; Thomas, P. D.; Chan, H. S.

1995-01-01

General principles of protein structure, stability, and folding kinetics have recently been explored in computer simulations of simple exact lattice models. These models represent protein chains at a rudimentary level, but they involve few parameters, approximations, or implicit biases, and they allow complete explorations of conformational and sequence spaces. Such simulations have resulted in testable predictions that are sometimes unanticipated: The folding code is mainly binary and delocalized throughout the amino acid sequence. The secondary and tertiary structures of a protein are specified mainly by the sequence of polar and nonpolar monomers. More specific interactions may refine the structure, rather than dominate the folding code. Simple exact models can account for the properties that characterize protein folding: two-state cooperativity, secondary and tertiary structures, and multistage folding kinetics--fast hydrophobic collapse followed by slower annealing. These studies suggest the possibility of creating "foldable" chain molecules other than proteins. The encoding of a unique compact chain conformation may not require amino acids; it may require only the ability to synthesize specific monomer sequences in which at least one monomer type is solvent-averse. PMID:7613459

Dynamics and control of DNA sequence amplification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marimuthu, Karthikeyan; Chakrabarti, Raj, E-mail: raj@pmc-group.com, E-mail: rajc@andrew.cmu.edu; Division of Fundamental Research, PMC Advanced Technology, Mount Laurel, New Jersey 08054

2014-10-28

DNA amplification is the process of replication of a specified DNA sequence in vitro through time-dependent manipulation of its external environment. A theoretical framework for determination of the optimal dynamic operating conditions of DNA amplification reactions, for any specified amplification objective, is presented based on first-principles biophysical modeling and control theory. Amplification of DNA is formulated as a problem in control theory with optimal solutions that can differ considerably from strategies typically used in practice. Using the Polymerase Chain Reaction as an example, sequence-dependent biophysical models for DNA amplification are cast as control systems, wherein the dynamics of the reactionmore » are controlled by a manipulated input variable. Using these control systems, we demonstrate that there exists an optimal temperature cycling strategy for geometric amplification of any DNA sequence and formulate optimal control problems that can be used to derive the optimal temperature profile. Strategies for the optimal synthesis of the DNA amplification control trajectory are proposed. Analogous methods can be used to formulate control problems for more advanced amplification objectives corresponding to the design of new types of DNA amplification reactions.« less

Development of allele-specific primer PCR for a swine TLR2 SNP and comparison of the frequency among several pig breeds of Japan and the Czech Republic.

PubMed

Muneta, Yoshihiro; Minagawa, Yu; Kusumoto, Masahiro; Shinkai, Hiroki; Uenishi, Hirohide; Splichal, Igor

2012-05-01

In the present study, we have developed an allele-specific primer-polymerase chain reaction (ASP-PCR) for genotyping a single nucleotide polymorphism (SNP) of swine Toll-like receptor 2 (TLR2) (C406G), which is related to the prevalence of pneumonia caused by Mycoplasma hyopneumoniae. We also compared the allele frequency among several pig breeds of Japan and the Czech Republic. Allele-specific primers were constructed by introducing 1-base mismatch sequence before the SNP site. The swine TLR2 C406G mutation was successfully determined by the ASP-PCR using genomic DNA samples in Japan as previously genotyped by a sequencing method. Using the PCR condition determined, genomic DNA samples from pig blood obtained from 110 pigs from 7 different breeds in the Czech Republic were genotyped by the ASP-PCR. The genotyping results from the ASP-PCR were completely matched with the results from the sequencing method. The allele frequency of the swine TLR2 C406G mutation was 27.5% in the Czech Republic and 3.6% in Japan. The C406G mutation was only found in the Landrace breed in Japan, and was almost exclusively found in the Landrace breed in the Czech Republic as well. These results indicated the usefulness of ASP-PCR for detecting a specific SNP for swine TLR2.

Development of Species-Specific Primers for Agronomical Thrips and Multiplex Assay for Quarantine Identification of Western Flower Thrips.

PubMed

Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S

2014-10-01

While morphological identification of thrips species has been difficult because of their minute size and a lack of easily recognizable characteristics, molecular identification based on the development of specific molecular markers can be easily and reliably carried out. Among the known molecular markers, the nuclear internal transcribed spacer (ITS) exhibits distinguishable variations among thrips species. In this study, sequences of ITS2 region of 10 agriculturally important thrips were established to design species-specific primers for polymerase chain reaction (PCR). ITS2 sequence variations within these species were far less than those among species, indicating the suitability of this marker for species-specific primers design. These primers, though with one or two sporadically variable positions, showed a good efficacy within species. The specificity of these primers, examined on thrips species belonging to 15 genera, proved satisfactory. Furthermore, a multiplex PCR was used successfully for identifying Frankliniella occidentalis (Pergande), an insect pest monitored for quarantine purpose, and three additional thrips also commonly found in imported agricultural products and field samples, i.e., Thrips tabaci Lindeman, Thrips hawaiiensis (Morgan), and Frankliniella intonsa (Trybom). This study has demonstrated that specific primers and multiplex PCR based on ITS2 are reliable, convenient, and diagnostic tool to discriminate thrips species of quarantine and agricultural importance. © 2014 Entomological Society of America.

Detection of two fungal biocontrol agents against root-knot nematodes by RAPD markers.

PubMed

Zhu, Ming Liang; Mo, Ming He; Xia, Zhen Yuan; Li, Yun Hua; Yang, Shu Jun; Li, Tian Fei; Zhang, Ke Qin

2006-05-01

The strain ZK7 of Pochonia chlamydosporia var. chlamydosporia and IPC of Paecilomyces lilacinus are highly effective in the biological control against root-knot nematodes infecting tobacco. When applied, they require a specific monitoring method to evaluate the colonization and dispersal in soil. In this work, the randomly amplified polymorphic DNA (RAPD) technique was used to differentiate between the two individual strains and 95 other isolates, including isolates of the same species and common soil fungi. This approach allowed the selection of specific fragments of 1.2 kb (Vc1200) and 2.0 kb (Vc2000) specific for ZK7, 1.4 kb (P1400) and 0.85 kb (P850) specific for IPC, using the random Primers OPL-02, OPD-05, OPD-05 and OPC-11, respectively. These fragments were cloned, sequenced, and used to design sequence-characterized amplification region (SCAR) primers specific for the two strains. In classical polymerase chain reaction (PCR), with serial dilution of ZK7 and IPC pure culture DNAs template, the detection limits of these oligonucleotide SCAR-PCR primers were found to be 10, 1000, 500, 100 pg, respectively. In the dot blotting, digoxigenin (DIG)-labeled amplicons from these four primers specifically recognized the corresponding fragments in the DNAs template of these two strains. The detection limit of these amplicons were 0.2, 0.2, 0.5, 0.5 mug, respectively.

Foldamer hypothesis for the growth and sequence differentiation of prebiotic polymers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guseva, Elizaveta; Zuckermann, Ronald N.; Dill, Ken A.

It is not known how life originated. It is thought that prebiotic processes were able to synthesize short random polymers. However, then, how do short-chain molecules spontaneously grow longer? Also, how would random chains grow more informational and become autocatalytic (i.e., increasing their own concentrations)? We study the folding and binding of random sequences of hydrophobic ( H) and polar ( P) monomers in a computational model. We find that even short hydrophobic polar ( HP) chains can collapse into relatively compact structures, exposing hydrophobic surfaces. In this way, they act as primitive versions of today’s protein catalysts, elongating othermore » such HP polymers as ribosomes would now do. Such foldamer catalysts are shown to form an autocatalytic set, through which short chains grow into longer chains that have particular sequences. An attractive feature of this model is that it does not overconverge to a single solution; it gives ensembles that could further evolve under selection. This mechanism describes how specific sequences and conformations could contribute to the chemistry-to-biology (CTB) transition.« less

Foldamer hypothesis for the growth and sequence differentiation of prebiotic polymers

DOE PAGES

Guseva, Elizaveta; Zuckermann, Ronald N.; Dill, Ken A.

2017-08-22

It is not known how life originated. It is thought that prebiotic processes were able to synthesize short random polymers. However, then, how do short-chain molecules spontaneously grow longer? Also, how would random chains grow more informational and become autocatalytic (i.e., increasing their own concentrations)? We study the folding and binding of random sequences of hydrophobic ( H) and polar ( P) monomers in a computational model. We find that even short hydrophobic polar ( HP) chains can collapse into relatively compact structures, exposing hydrophobic surfaces. In this way, they act as primitive versions of today’s protein catalysts, elongating othermore » such HP polymers as ribosomes would now do. Such foldamer catalysts are shown to form an autocatalytic set, through which short chains grow into longer chains that have particular sequences. An attractive feature of this model is that it does not overconverge to a single solution; it gives ensembles that could further evolve under selection. This mechanism describes how specific sequences and conformations could contribute to the chemistry-to-biology (CTB) transition.« less

Foldamer hypothesis for the growth and sequence differentiation of prebiotic polymers

PubMed Central

Guseva, Elizaveta; Zuckermann, Ronald N.; Dill, Ken A.

2017-01-01

It is not known how life originated. It is thought that prebiotic processes were able to synthesize short random polymers. However, then, how do short-chain molecules spontaneously grow longer? Also, how would random chains grow more informational and become autocatalytic (i.e., increasing their own concentrations)? We study the folding and binding of random sequences of hydrophobic (H) and polar (P) monomers in a computational model. We find that even short hydrophobic polar (HP) chains can collapse into relatively compact structures, exposing hydrophobic surfaces. In this way, they act as primitive versions of today’s protein catalysts, elongating other such HP polymers as ribosomes would now do. Such foldamer catalysts are shown to form an autocatalytic set, through which short chains grow into longer chains that have particular sequences. An attractive feature of this model is that it does not overconverge to a single solution; it gives ensembles that could further evolve under selection. This mechanism describes how specific sequences and conformations could contribute to the chemistry-to-biology (CTB) transition. PMID:28831002

A universal colorimetry for nucleic acids and aptamer-specific ligands detection based on DNA hybridization amplification.

PubMed

Li, Shuang; Shang, Xinxin; Liu, Jia; Wang, Yujie; Guo, Yingshu; You, Jinmao

2017-07-01

We present a universal amplified-colorimetric for detecting nucleic acid targets or aptamer-specific ligand targets based on gold nanoparticle-DNA (GNP-DNA) hybridization chain reaction (HCR). The universal arrays consisted of capture probe and hairpin DNA-GNP. First, capture probe recognized target specificity and released the initiator sequence. Then dispersed hairpin DNA modified GNPs were cross-linked to form aggregates through HCR events triggered by initiator sequence. As the aggregates accumulate, a significant red-to purple color change can be easily visualized by the naked eye. We used miRNA target sequence (miRNA-203) and aptamer-specific ligand (ATP) as target molecules for this proof-of-concept experiment. Initiator sequence (DNA2) was released from the capture probe (MNP/DNA1/2 conjugates) under the strong competitiveness of miRNA-203. Hairpin DNA (H1 and H2) can be complementary with the help of initiator DNA2 to form GNP-H1/GNP-H2 aggregates. The absorption ratio (A 620 /A 520 ) values of solutions were a sensitive function of miRNA-203 concentration covering from 1.0 × 10 -11  M to 9.0 × 10 -10  M, and as low as 1.0 × 10 -11  M could be detected. At the same time, the color changed from light wine red to purple and then to light blue have occurred in the solution. For ATP, initiator sequence (5'-end of DNA3) was released from the capture probe (DNA3) under the strong combination of aptamer-ATP. The present colorimetric for specific detection of ATP exhibited good sensitivity and 1.0 × 10 -8  M ATP could be detected. The proposed strategy also showed good performances for qualitative analysis and quantitative analysis of intracellular nucleic acids and aptamer-specific ligands. Copyright © 2017 Elsevier Inc. All rights reserved.

Synthesis oftrans-3-hexadecenoic acid and oftrans-3-hexadecenoic-1-C(14) acid.

PubMed

Knipprath, W G; Stein, R A

1966-01-01

Thetrans-3-hexadecenoic acid has been synthesized. Physical properties and chemical degradation prove its identity with the acid earlier isolated from several plant lipids. In the sequence of the synthesis, the introduction of a terminal triple bond into commercially available 1-tetradecene was performed by bromination and debromination with KOH and NaNH(2). Chain elongation by a Grignard reaction with CO(2) gave a carboxylic acid with a triple bond in the 2-position. Reduction with LiAlH(4) yielded the corresponding alcohol, and reduction of the triple to thetrans double bond was accomplished with Na in ethanol. Bromination of the alcohol with PBr(3) and conversion of the bromide to the nitrile with KCN or KC(14)N elongated the carbon chain to the desired length. Methanolysis with HCl in methanol and saponification with KOH formed the acid with acceptable yields, and in the case of the C(14)-labeled carboxyl, group, with high specific activity.

Molecular cloning, sequence analysis, prokaryotic expression, and function prediction of foot-specific peroxidase in Hydra magnipapillata Chinese strain.

PubMed

Pan, H C; Yang, H Q; Zhao, F X; Qian, X C

2014-08-28

The cDNA sequence of foot-specific peroxidase PPOD1 from the Chinese strain of Hydra magnipapillata was cloned by reverse transcription-polymerase chain reaction. The cDNA sequence contained a coding region with an 873-bp open reading frame, a 31-bp 5'-untranslated region, and a 36-bp 3'-untranslated region. The structure prediction results showed that PPOD1 contains 10.34% of α-helix, 38.62% of extended strand, 12.41% of β-turn, and 38.62% of random coil. The structural core was α-helix at the N terminus. The GenBank protein blast server showed that PPOD1 contains 2 fascin-like domains. In addition, high-level PPOD1 activity was only present in the ectodermal epithelial cells located on the edge of the adhesive face of the basal disc, and that these cells extended lamellipodia and filopodia when the basal disc was tightly attached to a glass slide. The fascin-like domains of Hydra PPOD1 might contribute to the bundling of the actin filament of these cells, and hence, the formation of filopodia. In conclusion, these cells might play an important role in strengthening the adsorbability of the basal disc to substrates.

Bi-parentally inherited species-specific markers identify hybridization between rainbow trout and cutthroat trout subspecies

USGS Publications Warehouse

Ostberg, C.O.; Rodriguez, R.J.

2004-01-01

Eight polymerase chain reaction primer sets amplifying bi-parentally inherited species-specific markers were developed that differentiate between rainbow trout (Oncorhynchus mykiss) and various cutthroat trout (O. clarki) subspecies. The primers were tested within known F1 and first generation hybrid backcrosses and were shown to amplify codominantly within hybrids. Heterozygous individuals also amplified a slower migrating band that was a heteroduplex, caused by the annealing of polymerase chain reaction products from both species. These primer sets have numerous advantages for native cutthroat trout conservation including statistical genetic analyses of known crosses and simple hybrid identification.

A SIMPLE POLYMERASE CHAIN REACTION-SEQUENCING ANALYSIS CAPABLE OF IDENTIFYING MULTIPLE MEDICALLY RELEVANT FILAMENTOUS FUNGAL SPECIES

EPA Science Inventory

Due to the accumulating evidence that suggests that numerous unhealthy conditions in the indoor environment are the result of abnormal growth of the filamentous fungi (mold) in and on building surfaces, it is necessary to accurately determine the organisms responsible for these m...

UW Team Reaches Out to Grade- and High-School Students.

ERIC Educational Resources Information Center

Hood, Leroy

1994-01-01

Describes an outreach program designed to expose high school students to cutting-edge science. High school students are provided with hands-on experience in molecular biology (polymerase chain reaction, restriction mapping, chromatography, gel electrophoresis, human DNA sequencing, etc.) and may have an opportunity to participate in the Human…

Isolation and characterization of an AGAMOUS homolog from Fraxinus pennsylvanica

Treesearch

Ningxia Du; Paula M. Pijut

2010-01-01

An AGAMOUS homolog (FpAG) was isolated from green ash (Fraxinus pennsylvanica) using a reverse transcriptase polymerase chain reaction method. Southern blot analysis indicated that FpAG was present as a single-copy sequence in the genome of green ash. RNA accumulated in the reproductive tissues (female...

A Practical Workshop for Generating Simple DNA Fingerprints of Plants

ERIC Educational Resources Information Center

Rouziere, A.-S.; Redman, J. E.

2011-01-01

Gel electrophoresis DNA fingerprints offer a graphical and visually appealing illumination of the similarities and differences between DNA sequences of different species and individuals. A polymerase chain reaction (PCR) and restriction digest protocol was designed to give high-school students the opportunity to generate simple fingerprints of…

Checking of individuality by DNA profiling.

PubMed

Brdicka, R; Nürnberg, P

1993-08-25

A review of methods of DNA analysis used in forensic medicine for identification, paternity testing, etc. is provided. Among other techniques, DNA fingerprinting using different probes and polymerase chain reaction-based techniques such as amplified sequence polymorphisms and minisatellite variant repeat mapping are thoroughly described and both theoretical and practical aspects are discussed.

Nanoparticle-labeled DNA capture elements for detection and identification of biological agents

NASA Astrophysics Data System (ADS)

Kiel, Johnathan L.; Holwitt, Eric A.; Parker, Jill E.; Vivekananda, Jeevalatha; Franz, Veronica

2004-12-01

Aptamers, synthetic DNA capture elements (DCEs), can be made chemically or in genetically engineered bacteria. DNA capture elements are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare or terrorism agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. The probes can then be conjugated to Quantum Dots and super paramagnetic nanoparticles. The former provide intense, bleach-resistant fluorescent detection of bioagent and the latter provide a means to collect the bioagents with a magnet. The fluorescence can be detected in a flow cytometer, in a fluorescence plate reader, or with a fluorescence microscope. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. DCEs can easily distinguish Bacillus anthracis from its nearest relatives, Bacillus cereus and Bacillus thuringiensis. Development of a high through-put process is currently being investigated.

Expression and mutational analysis of Cip/Kip family in early glottic cancer.

PubMed

Kim, D-K; Lee, J H; Lee, O J; Park, C H

2015-02-01

Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

Real Time Polymerase Chain Reaction (rt-PCR): A New Patent to Diagnostic Purposes for Paracoccidioidomycosis.

PubMed

Rocha-Silva, Fabiana; Gomes, Luciana I; Gracielle-Melo, Cidiane; Goes, Alfredo M; Caligiorne, Rachel B

2017-01-01

Paracoccidioidomycosis (PCM) is a systemic mycosis caused by dimorphic fungi Paracoccidioides brasiliensis and Paracoccidioides lutzii. It is prevalent in Latin American, mainly in Brazil. Therefore, PCM has fundamental impact on the Brazilian global economy, especially in public health system, since it is affecting economical active population in different country regions. The present study aimed to standardize the Real Time-Polymerase Chain Reaction (rt-PCR) for an efficient and safe PCM diagnosis amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. To standardize a methodology of rt-PCR using species-specific primers and probe designed for annealing in this specific region of the fungi´s genome, amplifying the recombinant protein PB27 gene, only expressed by specimens of Paracoccidioides genus. Followed by design in silico, experiments were performed in vitro to determine rt-PCR specificity, efficiency and genome detection limit. The primers and probe sequences were deposited in Brazilian Coordination of Technological Innovation and Transfer (CTIT), under patent reference number BR1020160078830. The present study demonstrated the rt-PCR applicability for support on diagnosis of paracoccidioidomycosis, presenting low cost, which makes it affordable for public health services in developing countries as Brazil. It is noteworthy that it is necessary to validate this methodology using clinical samples before to use as a safe method of diagnosis. A review of all patents related to this topic was performed and it was shown that, to date, there are no records of patent on kits for paracoccidioidomycosis´s diagnostic. Indeed, there is still a lot to go to reach this goal. The reaction developed was standardized and patented, opening perspectives to molecular diagnosis development for paracoccidioidomycosis, since rt-PCR can be applied to a broad spectrum of infectious diseases. It would need to be tested in biological samples in order to validate this method and then generate a diagnostic kit for Paracoccidioidomycosis. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Hybridization chain reaction amplification for highly sensitive fluorescence detection of DNA with dextran coated microarrays.

PubMed

Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua

2016-07-15

Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

Multiplex Polymerase Chain Reaction for Identification of Shigellae and Four Shigella Species Using Novel Genetic Markers Screened by Comparative Genomics.

PubMed

Kim, Hyun-Joong; Ryu, Ji-Oh; Song, Ji-Yeon; Kim, Hae-Yeong

2017-07-01

In the detection of Shigella species using molecular biological methods, previously known genetic markers for Shigella species were not sufficient to discriminate between Shigella species and diarrheagenic Escherichia coli. The purposes of this study were to screen for genetic markers of the Shigella genus and four Shigella species through comparative genomics and develop a multiplex polymerase chain reaction (PCR) for the detection of shigellae and Shigella species. A total of seven genomic DNA sequences from Shigella species were subjected to comparative genomics for the screening of genetic markers of shigellae and each Shigella species. The primer sets were designed from the screened genetic markers and evaluated using PCR with genomic DNAs from Shigella and other bacterial strains in Enterobacteriaceae. A novel Shigella quintuplex PCR, designed for the detection of Shigella genus, S. dysenteriae, S. boydii, S. flexneri, and S. sonnei, was developed from the evaluated primer sets, and its performance was demonstrated with specifically amplified results from each Shigella species. This Shigella multiplex PCR is the first to be reported with novel genetic markers developed through comparative genomics and may be a useful tool for the accurate detection of the Shigella genus and species from closely related bacteria in clinical microbiology and food safety.

[Identification of a novel aberrant spliceosome of MPL gene (MPLL391-V392ins12)in patients with myeloproliferative neoplasms].

PubMed

Tian, Ruiyuan; Chen, Xiuhua; Chang, Jianmei; Zhang, Na; Tan, Yanhong; Xu, Zhifang; Ren, Fanggang; Zhao, Junxia; Pan, Jie; Guo, Haixiu; Wang, Xiaojuan; Wang, Hongwei

2015-07-01

To identify the MPL L391-V392ins12 spliceosome and analyze its frequencies in patients with myeloproliferative neoplasms (MPN). MPL aberrant spliceosome was identified through reverse transcription polymerase chain reaction (RT-PCR)combined with cloning sequencing. The mutation of this spliceosome in 248 MPN patients and 200 normal people was determined by allele-specific polymerase chain reaction (AS-PCR). A novel aberrant spliceosome of MPL gene (MPL L391-V392ins12)was identified, i.e. 36 bp intron was retained between exon7 and exon8, and there were 12 amino acids (EGLKLLPADIPV)inserted. MPL L391-V392ins12 mutation was detected in 19 (7.66%)of the 248 patients with MPN, including 1 (1.92%) of 52 patients with PV, 14 (9.66%) of 145 with ET, and 4 (7.84%) of 51 with PMF. And the mutation was not detected in the group of 200 normal people. MPL L391-V392ins12 spliceosome is an aberrant spliceosome present in the MPN. It can be detected in PV, ET and PMF, and more frequently in ET and PMF. This mutation may play an important role in the process of MPN.

Standardisation of polymerase chain reaction for the detection of Salmonella typhi in typhoid fever.

PubMed Central

Chaudhry, R; Laxmi, B V; Nisar, N; Ray, K; Kumar, D

1997-01-01

To improve the diagnosis of Salmonella typhi infection, a polymerase chain reaction (PCR) assay was developed for the amplification of the dH flagellin gene of S typhi. Primers were designed from dH flagellin gene sequence which will give an amplification product of 486 base pairs. In tests to study the specificity of the assay, no amplification was seen in non-salmonella strains or salmonella strains with flagellar gene other than "d". Sensitivity tests determined that 28 pg of S typhi target DNA or 3 x 10(2) target bacteria could be detected by the PCR assay. Subsequently, the PCR technique was used for detection of S typhi in blood or clot cultures from 84 patients clinically suspected of having typhoid fever, and from 20 healthy control subjects. Twenty five of 84 samples from clinically suspected cases were positive by PCR; four of which were culture negative. No amplification was seen in samples from patients who were culture positive for organisms other than S typhi or from controls. The time taken for each sample for PCR analysis was less than 48 hours compared with three to five days for blood or clot culture. PCR appeared to be a promising diagnostic test for typhoid fever. Images PMID:9215131

Development and evaluation of a sensitive enzyme-linked oligonucleotide-sorbent assay for detection of polymerase chain reaction-amplified hepatitis C virus of genotypes 1-6.

PubMed

Huang, Rong-Yuan; Chang, Hao-Teng; Lan, Chung-Yu; Pai, Tun-Wen; Wu, Chao-Nan; Ling, Chung-Mei; Chang, Margaret Dah-Tsyr

2008-08-01

A high-throughput polymerase chain reaction (PCR)-based enzyme-linked oligonucleotide-sorbent assay (ELOSA) was developed for use in the diagnostic testing of serum from patients who may be infected with different hepatitis C virus (HCV) genotypes. Twelve genotype-specific 5'-aminated DNA-coated probes were designed based on the variable 5'-untranslated region sequences of the HCV genotypes 1-6. Using 100 clinical serum samples, the performance of the PCR-ELOSA method was compared with Roche's COBAS Amplicor HCV Monitor V2.0 assay and the VERSANT HCV genotype assay (LiPA), and the overall agreement was 99% at the level of HCV genotypes with a detection range of 2.0 x 10(2) to 1.0 x 10(7)IU/ml for PCR-ELOSA. The PCR-ELOSA was more comprehensive as demonstrated by the fact that approximately 20% of the samples with different subtypes could be discriminated by this method but not by LiPA. In addition, the PCR-ELOSA system showed high accuracy (CV

Molecular cloning and expression analysis of annexin A2 gene in sika deer antler tip.

PubMed

Xia, Yanling; Qu, Haomiao; Lu, Binshan; Zhang, Qiang; Li, Heping

2018-04-01

Molecular cloning and bioinformatics analysis of annexin A2 ( ANXA2 ) gene in sika deer antler tip were conducted. The role of ANXA2 gene in the growth and development of the antler were analyzed initially. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to clone the cDNA sequence of the ANXA2 gene from antler tip of sika deer ( Cervus Nippon hortulorum ) and the bioinformatics methods were applied to analyze the amino acid sequence of Anxa2 protein. The mRNA expression levels of the ANXA2 gene in different growth stages were examined by real time reverse transcriptase polymerase chain reaction (real time RT-PCR). The nucleotide sequence analysis revealed an open reading frame of 1,020 bp encoding 339 amino acids long protein of calculated molecular weight 38.6 kDa and isoelectric point 6.09. Homologous sequence alignment and phylogenetic analysis indicated that the Anxa2 mature protein of sika deer had the closest genetic distance with Cervus elaphus and Bos mutus . Real time RT-PCR results showed that the gene had differential expression levels in different growth stages, and the expression level of the ANXA2 gene was the highest at metaphase (rapid growing period). ANXA2 gene may promote the cell proliferation, and the finding suggested Anxa2 as an important candidate for regulating the growth and development of deer antler.

Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

PubMed

Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

2017-08-01

The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

Filling reference gaps via assembling DNA barcodes using high-throughput sequencing-moving toward barcoding the world.

PubMed

Liu, Shanlin; Yang, Chentao; Zhou, Chengran; Zhou, Xin

2017-12-01

Over the past decade, biodiversity researchers have dedicated tremendous efforts to constructing DNA reference barcodes for rapid species registration and identification. Although analytical cost for standard DNA barcoding has been significantly reduced since early 2000, further dramatic reduction in barcoding costs is unlikely because Sanger sequencing is approaching its limits in throughput and chemistry cost. Constraints in barcoding cost not only led to unbalanced barcoding efforts around the globe, but also prevented high-throughput sequencing (HTS)-based taxonomic identification from applying binomial species names, which provide crucial linkages to biological knowledge. We developed an Illumina-based pipeline, HIFI-Barcode, to produce full-length Cytochrome c oxidase subunit I (COI) barcodes from pooled polymerase chain reaction amplicons generated by individual specimens. The new pipeline generated accurate barcode sequences that were comparable to Sanger standards, even for different haplotypes of the same species that were only a few nucleotides different from each other. Additionally, the new pipeline was much more sensitive in recovering amplicons at low quantity. The HIFI-Barcode pipeline successfully recovered barcodes from more than 78% of the polymerase chain reactions that didn't show clear bands on the electrophoresis gel. Moreover, sequencing results based on the single molecular sequencing platform Pacbio confirmed the accuracy of the HIFI-Barcode results. Altogether, the new pipeline can provide an improved solution to produce full-length reference barcodes at about one-tenth of the current cost, enabling construction of comprehensive barcode libraries for local fauna, leading to a feasible direction for DNA barcoding global biomes. © The Authors 2017. Published by Oxford University Press.

Beta-ketoacyl-acyl carrier protein synthase IV: a key enzyme for regulation of medium-chain fatty acid synthesis in Cuphea lanceolata seeds.

PubMed

Schütt, Burkhardt Siegfried; Abbadi, Amine; Loddenkötter, Brigitte; Brummel, Monika; Spener, Friedrich

2002-09-01

With the aim of elucidating the mechanisms involved in the biosynthesis of medium-chain fatty acids in Cuphea lanceolata Ait., a crop accumulating up to 90% decanoic acid in seed triacylglycerols, cDNA clones of a beta-ketoacyl-acyl carrier protein (ACP) synthase IV (clKAS IV, EC 2.3.1.41) were isolated from C. lanceolata seed embryos. The amino acid sequence deduced from clKAS IV cDNA showed 80% identity to other plant KAS II-type enzymes, 55% identity towards plant KAS I and over 90% towards other Cuphea KAS IV-type sequences. Recombinant clKAS IV was functionally overexpressed in Escherichia coli, and substrate specificity of purified enzyme showed strong preference for elongation of short-chain and medium-chain acyl-ACPs (C4- to C10-ACP) with nearly equal activity. Further elongation steps were catalysed with distinctly less activity. Moreover, short- and medium-chain acyl-ACPs exerted a chain-length-specific and concentration-dependent substrate inhibition of clKAS IV. Based on these findings a regulatory mechanism for medium-chain fatty acid synthesis in C. lanceolata is presented.

Peptide/protein-polymer conjugates: synthetic strategies and design concepts.

PubMed

Gauthier, Marc A; Klok, Harm-Anton

2008-06-21

This feature article provides a compilation of tools available for preparing well-defined peptide/protein-polymer conjugates, which are defined as hybrid constructs combining (i) a defined number of peptide/protein segments with uniform chain lengths and defined monomer sequences (primary structure) with (ii) a defined number of synthetic polymer chains. The first section describes methods for post-translational, or direct, introduction of chemoselective handles onto natural or synthetic peptides/proteins. Addressed topics include the residue- and/or site-specific modification of peptides/proteins at Arg, Asp, Cys, Gln, Glu, Gly, His, Lys, Met, Phe, Ser, Thr, Trp, Tyr and Val residues and methods for producing peptides/proteins containing non-canonical amino acids by peptide synthesis and protein engineering. In the second section, methods for introducing chemoselective groups onto the side-chain or chain-end of synthetic polymers produced by radical, anionic, cationic, metathesis and ring-opening polymerization are described. The final section discusses convergent and divergent strategies for covalently assembling polymers and peptides/proteins. An overview of the use of chemoselective reactions such as Heck, Sonogashira and Suzuki coupling, Diels-Alder cycloaddition, Click chemistry, Staudinger ligation, Michael's addition, reductive alkylation and oxime/hydrazone chemistry for the convergent synthesis of peptide/protein-polymer conjugates is given. Divergent approaches for preparing peptide/protein-polymer conjugates which are discussed include peptide synthesis from synthetic polymer supports, polymerization from peptide/protein macroinitiators or chain transfer agents and the polymerization of peptide side-chain monomers.

Detection of human Pneumocystis carinii by the polymerase chain reaction.

PubMed

Becker-Hapak, M; Liberator, P; Graves, D

1991-01-01

Oligonucleotide primers were prepared from a clone (B12) which has been shown to be a repetitive sequence in the rat P. carinii genome. Polymerase chain reaction was employed to amplify both rat and human P. carinii DNA. The detection limit of the assay was approximately 600 ng of total nucleic acid. Amplification products from both the rat and human isolates (ca. 780 bp) were characterized by denaturing gradient gel electrophoresis after digestion with Sau3A. No amplification products were obtained when DNA from the following potential pulmonary pathogens were used in identical reactions: Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Mycobacterium avium-intracellulare and cytomegalovirus. In a blind study using the B12 primers, P. carinii DNA was successfully amplified in clinical samples which were positive by direct immunofluorescence assay (IFA) as well as in some specimens not identified by direct IFA.

Amplification and sequence analysis of partial bacterial 16S ribosomal RNA gene in gallbladder bile from patients with primary biliary cirrhosis.

PubMed

Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y

2000-07-01

The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the patients with primary biliary cirrhosis at an advanced stage.

Nanosilver-based surface-enhanced Raman spectroscopic determination of DNA methyltransferase activity through real-time hybridization chain reaction.

PubMed

Hu, Ping Ping; Liu, Hui; Zhen, Shu Jun; Li, Chun Mei; Huang, Cheng Zhi

2015-11-15

In this manuscript, a nanosilver enhanced SERS strategy was successfully constructed for the determination of DNA methyltransferase activity in soulution combined with hybridization chain reaction (HCR). The proposed method was mainly on the basis of excellent separation ability of magnetic microparticles (MMPs), HCR as signal amplification unit and assembled AgNPs as enhancement substrate. In the presence of M. SssI MTase, the duplex sequence (5'-CCGG-3') tethered to MMPs was methylated, which cannot be cleaved by HpaII endonuclease. The resulted DNA skeleton captured on MMPs then triggered the HCR reaction, generated a polymerized and extended symmetrical sequence, in which more biotin terminal was available for the conjugation of AgNPs-SA, leading to significantly amplified SERS response. When it was used to analyze M. SssI activity, a linear equation ∆ISERS=1215.32+446.80 cM.SssI was obtained with the M. SssI activity ranged from 0.1 to 10.0 U with the correlation coefficient (r(2)) of 0.97. The most important advantage of this method is the combination of SERS and HCR in solution for the first time and its good selectivity, which enabled the detection of even one-base mismatched sequence. The new assay method holds great promising application to be a versatile platform for sensitive, high-throughput detection, and the screening of new anticancer drugs on DNA MTase. Copyright © 2015 Elsevier B.V. All rights reserved.

Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

PubMed

Bridge, Julia A

2017-01-01

The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

Gemi: PCR Primers Prediction from Multiple Alignments

PubMed Central

Sobhy, Haitham; Colson, Philippe

2012-01-01

Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117

The complete mitochondrial genome of Lota lota (Gadiformes: Gadidae) from the Burqin River in China.

PubMed

Lu, Zhichuang; Zhang, Nan; Song, Na; Gao, Tianxiang

2016-05-01

In this study, the complete mitochondrial genome (mitogenome) sequence of Lota lota has been determined by long polymerase chain reaction and primer walking methods. The mitogenome is a circular molecule of 16,519 bp in length and contains 37 mitochondrial genes including 13 protein-coding genes, 2 ribosomal RNA (rRNA), 22 transfer RNA (tRNA) and a control region as other bony fishes. Within the control region, we identified the termination-associated sequence domain (TAS), the central conserved sequence block domains (CSB-F and CSB-D), and the conserved sequence block domains (CSB-1, CSB-2 and CSB-3).

Recombination of polynucleotide sequences using random or defined primers

DOEpatents

Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.

2000-01-01

A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

Recombination of polynucleotide sequences using random or defined primers

DOEpatents

Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.

2001-01-01

A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

Accurate multiplex polony sequencing of an evolved bacterial genome.

PubMed

Shendure, Jay; Porreca, Gregory J; Reppas, Nikos B; Lin, Xiaoxia; McCutcheon, John P; Rosenbaum, Abraham M; Wang, Michael D; Zhang, Kun; Mitra, Robi D; Church, George M

2005-09-09

We describe a DNA sequencing technology in which a commonly available, inexpensive epifluorescence microscope is converted to rapid nonelectrophoretic DNA sequencing automation. We apply this technology to resequence an evolved strain of Escherichia coli at less than one error per million consensus bases. A cell-free, mate-paired library provided single DNA molecules that were amplified in parallel to 1-micrometer beads by emulsion polymerase chain reaction. Millions of beads were immobilized in a polyacrylamide gel and subjected to automated cycles of sequencing by ligation and four-color imaging. Cost per base was roughly one-ninth as much as that of conventional sequencing. Our protocols were implemented with off-the-shelf instrumentation and reagents.

Fluorescent signatures for variable DNA sequences

PubMed Central

Rice, John E.; Reis, Arthur H.; Rice, Lisa M.; Carver-Brown, Rachel K.; Wangh, Lawrence J.

2012-01-01

Life abounds with genetic variations writ in sequences that are often only a few hundred nucleotides long. Rapid detection of these variations for identification of genetic diseases, pathogens and organisms has become the mainstay of molecular science and medicine. This report describes a new, highly informative closed-tube polymerase chain reaction (PCR) strategy for analysis of both known and unknown sequence variations. It combines efficient quantitative amplification of single-stranded DNA targets through LATE-PCR with sets of Lights-On/Lights-Off probes that hybridize to their target sequences over a broad temperature range. Contiguous pairs of Lights-On/Lights-Off probes of the same fluorescent color are used to scan hundreds of nucleotides for the presence of mutations. Sets of probes in different colors can be combined in the same tube to analyze even longer single-stranded targets. Each set of hybridized Lights-On/Lights-Off probes generates a composite fluorescent contour, which is mathematically converted to a sequence-specific fluorescent signature. The versatility and broad utility of this new technology is illustrated in this report by characterization of variant sequences in three different DNA targets: the rpoB gene of Mycobacterium tuberculosis, a sequence in the mitochondrial cytochrome C oxidase subunit 1 gene of nematodes and the V3 hypervariable region of the bacterial 16 s ribosomal RNA gene. We anticipate widespread use of these technologies for diagnostics, species identification and basic research. PMID:22879378

Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

PubMed

Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

2014-03-01

The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

Development of a Novel, Rapid Multiplex Polymerase Chain Reaction Assay for the Detection and Differentiation of Salmonella enterica Serovars Enteritidis and Typhimurium Using Ultra-Fast Convection Polymerase Chain Reaction.

PubMed

Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee

2017-10-01

Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.

Rapid identification of fungal pathogens in BacT/ALERT, BACTEC, and BBL MGIT media using polymerase chain reaction and DNA sequencing of the internal transcribed spacer regions.

PubMed

Pryce, Todd M; Palladino, Silvano; Price, Diane M; Gardam, Dianne J; Campbell, Peter B; Christiansen, Keryn J; Murray, Ronan J

2006-04-01

We report a direct polymerase chain reaction/sequence (d-PCRS)-based method for the rapid identification of clinically significant fungi from 5 different types of commercial broth enrichment media inoculated with clinical specimens. Media including BacT/ALERT FA (BioMérieux, Marcy l'Etoile, France) (n = 87), BACTEC Plus Aerobic/F (Becton Dickinson, Microbiology Systems, Sparks, MD) (n = 16), BACTEC Peds Plus/F (Becton Dickinson) (n = 15), BACTEC Lytic/10 Anaerobic/F (Becton Dickinson) (n = 11) bottles, and BBL MGIT (Becton Dickinson) (n = 11) were inoculated with specimens from 138 patients. A universal DNA extraction method was used combining a novel pretreatment step to remove PCR inhibitors with a column-based DNA extraction kit. Target sequences in the noncoding internal transcribed spacer regions of the rRNA gene were amplified by PCR and sequenced using a rapid (24 h) automated capillary electrophoresis system. Using sequence alignment software, fungi were identified by sequence similarity with sequences derived from isolates identified by upper-level reference laboratories or isolates defined as ex-type strains. We identified Candida albicans (n = 14), Candida parapsilosis (n = 8), Candida glabrata (n = 7), Candida krusei (n = 2), Scedosporium prolificans (n = 4), and 1 each of Candida orthopsilosis, Candida dubliniensis, Candida kefyr, Candida tropicalis, Candida guilliermondii, Saccharomyces cerevisiae, Cryptococcus neoformans, Aspergillus fumigatus, Histoplasma capsulatum, and Malassezia pachydermatis by d-PCRS analysis. All d-PCRS identifications from positive broths were in agreement with the final species identification of the isolates grown from subculture. Earlier identification of fungi using d-PCRS may facilitate prompt and more appropriate antifungal therapy.

Morphological and molecular identification of nasopharyngeal bot fly larvae infesting red deer (Cervus elaphus) in Austria.

PubMed

Leitner, Natascha; Schwarzmann, Laurin; Zittra, Carina; Palmieri, Nicola; Eigner, Barbara; Otranto, Domenico; Glawischnig, Walter; Fuehrer, Hans-Peter

2016-11-01

Nasopharyngeal myiases are caused by larvae of bot flies (Diptera: Oestridae), which have evolved a high specificity for their hosts. Bot flies (n = 916) were collected from 137 (57.6 %) out of 238 red deer (Cervus elaphus) hunted in Vorarlberg and Tyrol (Western Austria). After being stored in 75 % ethanol, larvae were identified to species level and developmental stage using morphological and morphometric keys. Larvae were also molecularly characterized by polymerase chain reaction (PCR) amplification and partial sequencing of the mitochondrial cytochrome oxidase subunit I gene. Morphological and molecular analysis allowed identification of larvae as Cephenemyia auribarbis and Pharyngomyia picta. Genetic variations were also examined within the specimens collected in both geographical locations.

Custom-Designed Molecular Scissors for Site-Specific Manipulation of the Plant and Mammalian Genomes

NASA Astrophysics Data System (ADS)

Kandavelou, Karthikeyan; Chandrasegaran, Srinivasan

Zinc finger nucleases (ZFNs) are custom-designed molecular scissors, engineered to cut at specific DNA sequences. ZFNs combine the zinc finger proteins (ZFPs) with the nonspecific cleavage domain of the FokI restriction enzyme. The DNA-binding specificity of ZFNs can be easily altered experimentally. This easy manipulation of the ZFN recognition specificity enables one to deliver a targeted double-strand break (DSB) to a genome. The targeted DSB stimulates local gene targeting by several orders of magnitude at that specific cut site via homologous recombination (HR). Thus, ZFNs have become an important experimental tool to make site-specific and permanent alterations to genomes of not only plants and mammals but also of many other organisms. Engineering of custom ZFNs involves many steps. The first step is to identify a ZFN site at or near the chosen chromosomal target within the genome to which ZFNs will bind and cut. The second step is to design and/or select various ZFP combinations that will bind to the chosen target site with high specificity and affinity. The DNA coding sequence for the designed ZFPs are then assembled by polymerase chain reaction (PCR) using oligonucleotides. The third step is to fuse the ZFP constructs to the FokI cleavage domain. The ZFNs are then expressed as proteins by using the rabbit reticulocyte in vitro transcription/translation system and the protein products assayed for their DNA cleavage specificity.

[Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

PubMed

Wang, F; Zhang, Y Q; Ding, J; Yu, L X

2017-10-18

To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

Dual phase multiplex polymerase chain reaction

DOEpatents

Pemov, Alexander [Charlottesville, VA; Bavykin, Sergei [Darien, IL

2008-10-07

Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

Real-time reverse transcription-polymerase chain reaction assays for identification of wild poliovirus 1 & 3.

PubMed

Sharma, Deepa K; Nalavade, Uma P; Deshpande, Jagadish M

2015-10-01

The poliovirus serotype identification and intratypic differentiation by real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay is suitable for serotype mixtures but not for intratypic mixtures of wild and vaccine poliovirus strains. This study was undertaken to develop wild poliovirus 1 and 3 (WPV1 and WPV3) specific rRT-PCR assays for use. Specific primers and probes for rRT-PCR were designed based on VP1 sequences of WPV1 and WPV3 isolated in India since 2000. The specificity of the rRT-PCR assays was evaluated using WPV1 and WPV3 of different genetic lineages, non-polio enteroviruses (NPEVs) and mixtures of wild/wild and wild/Sabin vaccine strains. The sensitivity of the assays was determined by testing serial 10-fold dilutions of wild poliovirus 1 and 3 stock suspensions of known titre. No cross-reactivity with Sabin strains, intertypic wild poliovirus isolates or 27 types of NPEVs across all the four Enterovirus species was found for both the wild poliovirus 1 and 3 rRT-PCR assays. All WPV1 and WPV3 strains isolated since 2000 were successfully amplified. The rRT-PCR assays detected 10 4.40 CCID 50 /ml of WPV1 and 10 4.00 CCID 50 /ml of WPV3, respectively either as single isolate or mixture with Sabin vaccine strains or intertypic wild poliovirus. rRT-PCR assays for WPV1 and WPV3 have been validated to detect all the genetic variations of the WPV1 and WPV3 isolated in India for the last decade. When used in combination with the current rRT-PCR assay testing was complete for confirmation of the presence of wild poliovirus in intratypic mixtures.

A Study of Mercury Methylation Genetics: Qualitative and Quantitative Analysis of hgcAB in Pure Culture

NASA Astrophysics Data System (ADS)

Christensen, G. A.; Wymore, A. M.; King, A. J.; Podar, M.; Hurt, R. A., Jr.; Santillan, E. F. U.; Gilmour, C. C.; Brandt, C. C.; Brown, S. D.; Palumbo, A. V.; Elias, D. A.

2015-12-01

Two proteins (HgcA and HgcB) have been determined to be essential for mercury (Hg)-methylation and either one alone is not sufficient for this process. Detection and quantification of these genes to determine at risk environments is critical. Universal degenerate polymerase chain reaction (PCR) primers spanning hgcAB were developed to ascertain organismal diversity and validate that both genes were present as an established prerequisite for Hg-methylation. To confirm this approach, an extensive set of pure cultures with published genomes (including methylators and non-methylators: 13 Deltaproteobacteria, 9 Firmicutes, and 10 methanogenic Archaea) were assayed with the newly designed universal hgcAB primer set. A single band within an agarose gel was observed for the majority of the cultures with known hgcAB and confirmed via Sanger sequencing. For environmental applications, once the potential for Hg-methylation is established from PCR amplification with the universal hgcAB primer set, quantification of clade-specific hgcAB gene abundance is desirable. We developed quantitative polymerase chain reaction (qPCR) degenerate primers targeting hgcA from each of the three dominate clades (Deltaproteobacteria, Firmicutes and methanogenic Archaea) known to be associated with anaerobic Hg-methylation. The qPCR primers amplify virtually all hgcA positive cultures overall and are specific for their designed clade. Finally, to ensure the procedure is robust and sensitive in complex environmental matrices, cells from all clades were mixed in different combinations and ratios to assess qPCR primer specificity. The development and validation of these high fidelity quantitative molecular tools now allows for rapid and accurate risk management assessment in any environment.

Evaluation of the PCR method for identification of Bifidobacterium species.

PubMed

Youn, S Y; Seo, J M; Ji, G E

2008-01-01

Bifidobacterium species are known for their beneficial effects on health and their wide use as probiotics. Although various polymerase chain reaction (PCR) methods for the identification of Bifidobacterium species have been published, the reliability of these methods remains open to question. In this study, we evaluated 37 previously reported PCR primer sets designed to amplify 16S rDNA, 23S rDNA, intergenic spacer regions, or repetitive DNA sequences of various Bifidobacterium species. Ten of 37 experimental primer sets showed specificity for B. adolescentis, B. angulatum, B. pseudocatenulatum, B. breve, B. bifidum, B. longum, B. longum biovar infantis and B. dentium. The results suggest that published Bifidobacterium primer sets should be re-evaluated for both reproducibility and specificity for the identification of Bifidobacterium species using PCR. Improvement of existing PCR methods will be needed to facilitate identification of other Bifidobacterium strains, such as B. animalis, B. catenulatum, B. thermophilum and B. subtile.

MYCOBACTERIUM GENAVENSE IN AN AFRICAN PENGUIN (SPHENISCUS DEMERSUS).

PubMed

Krause, Kristian J; Reavill, Drury; Weldy, Scott H; Bradway, Daniel S

2015-12-01

A 19-yr-old female African penguin (Spheniscus demersus) presented with labored breathing and anorexia. Radiographs revealed soft-tissue density lesions in the left lung fields and fluid in the right. The penguin died during the night. Postmortem examination demonstrated multiple granulomas in the lungs and air sacs. The right coelom was filled with opaque fluid. Histopathology of the lung, liver, kidney, and spleen identified Mycobacterium as a primary disease etiology. Large numbers of acid fast-positive, rod-shaped bacteria were recognized on tissue staining. Mycobacterium genavense was detected by polymerase chain reaction (PCR) using primers specific for the species. Further confirmation of M. genavense was accomplished using PCR with universal Mycobacterium spp. primers followed by sequencing of the amplicon obtained. To our knowledge, this is the first reported case of mycobacteriosis-and specifically M. genavense -in an African penguin. This case also demonstrates the similarities of presentation between the more commonly suspected and encountered aspergillosis and mycobacteriosis.

Detection of human papillomaviruses by polymerase chain reaction and ligation reaction on universal microarray.

PubMed

Ritari, Jarmo; Hultman, Jenni; Fingerroos, Rita; Tarkkanen, Jussi; Pullat, Janne; Paulin, Lars; Kivi, Niina; Auvinen, Petri; Auvinen, Eeva

2012-01-01

Sensitive and specific detection of human papillomaviruses (HPV) in cervical samples is a useful tool for the early diagnosis of epithelial neoplasia and anogenital lesions. Recent studies support the feasibility of HPV DNA testing instead of cytology (Pap smear) as a primary test in population screening for cervical cancer. This is likely to be an option in the near future in many countries, and it would increase the efficiency of screening for cervical abnormalities. We present here a microarray test for the detection and typing of 15 most important high-risk HPV types and two low risk types. The method is based on type specific multiplex PCR amplification of the L1 viral genomic region followed by ligation detection reaction where two specific ssDNA probes, one containing a fluorescent label and the other a flanking ZipCode sequence, are joined by enzymatic ligation in the presence of the correct HPV PCR product. Human beta-globin is amplified in the same reaction to control for sample quality and adequacy. The genotyping capacity of our approach was evaluated against Linear Array test using cervical samples collected in transport medium. Altogether 14 out of 15 valid samples (93%) gave concordant results between our test and Linear Array. One sample was HPV56 positive in our test and high-risk positive in Hybrid Capture 2 but remained negative in Linear Array. The preliminary results suggest that our test has accurate multiple HPV genotyping capability with the additional advantages of generic detection format, and potential for high-throughput screening.

ATYPICAL CHLAMYDIACEAE IN WILD POPULATIONS OF HAWKS ( BUTEO SPP.) IN CALIFORNIA.

PubMed

Luján-Vega, Charlene; Hawkins, Michelle G; Johnson, Christine K; Briggs, Christopher; Vennum, Chris; Bloom, Peter H; Hull, Joshua M; Cray, Carolyn; Pesti, Denise; Johnson, Lisa; Ciembor, Paula; Ritchie, Branson R

2018-03-01

Chlamydiaceae bacteria infect many vertebrate hosts, and previous reports based on polymerase chain reaction (PCR) assays and serologic assays that are prone to cross-reaction among chlamydial organisms have been used to describe the prevalence of either DNA fragments or antibodies to Chlamydia spp. in wild raptorial populations. This study reports the PCR-based prevalence of Chlamydiaceae DNA that does not 100% match any avian or mammalian Chlamydiaceae in wild populations of hawks in California Buteo species. In this study, multimucosal swab samples ( n = 291) for quantitative PCR (qPCR) and plasma ( n = 78) for serology were collected from wild hawks. All available plasma samples were negative for antibodies using a C. psittaci-specific elementary body agglutination test (EBA; n = 78). For IgY antibodies all 51 available samples were negative using the indirect immunofluorescent assay. The overall prevalence of Chlamydiaceae DNA detection in wild Buteo species sampled was 1.37% (4/291) via qPCR-based analysis. Two fledgling Swainson's hawks ( Buteo swainsoni) and two juvenile red-tailed hawks ( Buteo jamaicensis) were positive by qPCR-based assay for an atypical chlamydial sequence that did not 100% match any known C. psittaci genotype. Positive swab samples from these four birds were sequenced based on the ompA gene and compared by high-resolution melt analysis with all known avian and mammalian Chlamydiaceae. The amplicon sequence did not 100% match any known avian chlamydial sequence; however, it was most similar (98.6%) to C. psittaci M56, a genotype that is typically found in muskrats and hares. Culture and full genome sequence analysis of Chlamydia spp. isolated from diseased hawks will be necessary to classify this organism and to better understand its epizootiology and potential health impact on wild Buteo populations in California.

The Application of Next-Generation Sequencing for Mutation Detection in Autosomal-Dominant Hereditary Hearing Impairment.

PubMed

Gürtler, Nicolas; Röthlisberger, Benno; Ludin, Katja; Schlegel, Christoph; Lalwani, Anil K

2017-07-01

Identification of the causative mutation using next-generation sequencing in autosomal-dominant hereditary hearing impairment, as mutation analysis in hereditary hearing impairment by classic genetic methods, is hindered by the high heterogeneity of the disease. Two Swiss families with autosomal-dominant hereditary hearing impairment. Amplified DNA libraries for next-generation sequencing were constructed from extracted genomic DNA, derived from peripheral blood, and enriched by a custom-made sequence capture library. Validated, pooled libraries were sequenced on an Illumina MiSeq instrument, 300 cycles and paired-end sequencing. Technical data analysis was performed with SeqMonk, variant analysis with GeneTalk or VariantStudio. The detection of mutations in genes related to hearing loss by next-generation sequencing was subsequently confirmed using specific polymerase-chain-reaction and Sanger sequencing. Mutation detection in hearing-loss-related genes. The first family harbored the mutation c.5383+5delGTGA in the TECTA-gene. In the second family, a novel mutation c.2614-2625delCATGGCGCCGTG in the WFS1-gene and a second mutation TCOF1-c.1028G>A were identified. Next-generation sequencing successfully identified the causative mutation in families with autosomal-dominant hereditary hearing impairment. The results helped to clarify the pathogenic role of a known mutation and led to the detection of a novel one. NGS represents a feasible approach with great potential future in the diagnostics of hereditary hearing impairment, even in smaller labs.

Identification of Forensic Samples via Mitochondrial DNA in the Undergraduate Biochemistry Laboratory

NASA Astrophysics Data System (ADS)

Millard, Julie T.; Pilon, André M.

2003-04-01

A recent forensic approach for identification of unknown biological samples is mitochondrial DNA (mtDNA) sequencing. We describe a laboratory exercise suitable for an undergraduate biochemistry course in which the polymerase chain reaction is used to amplify a 440 base pair hypervariable region of human mtDNA from a variety of "crime scene" samples (e.g., teeth, hair, nails, cigarettes, envelope flaps, toothbrushes, and chewing gum). Amplification is verified via agarose gel electrophoresis and then samples are subjected to cycle sequencing. Sequence alignments are made via the program CLUSTAL W, allowing students to compare samples and solve the "crime."

Ultrasensitive Single Fluorescence-Labeled Probe-Mediated Single Universal Primer-Multiplex-Droplet Digital Polymerase Chain Reaction for High-Throughput Genetically Modified Organism Screening.

PubMed

Niu, Chenqi; Xu, Yuancong; Zhang, Chao; Zhu, Pengyu; Huang, Kunlun; Luo, Yunbo; Xu, Wentao

2018-05-01

As genetically modified (GM) technology develops and genetically modified organisms (GMOs) become more available, GMOs face increasing regulations and pressure to adhere to strict labeling guidelines. A singleplex detection method cannot perform the high-throughput analysis necessary for optimal GMO detection. Combining the advantages of multiplex detection and droplet digital polymerase chain reaction (ddPCR), a single universal primer-multiplex-ddPCR (SUP-M-ddPCR) strategy was proposed for accurate broad-spectrum screening and quantification. The SUP increases efficiency of the primers in PCR and plays an important role in establishing a high-throughput, multiplex detection method. Emerging ddPCR technology has been used for accurate quantification of nucleic acid molecules without a standard curve. Using maize as a reference point, four heterologous sequences ( 35S, NOS, NPTII, and PAT) were selected to evaluate the feasibility and applicability of this strategy. Surprisingly, these four genes cover more than 93% of the transgenic maize lines and serve as preliminary screening sequences. All screening probes were labeled with FAM fluorescence, which allows the signals from the samples with GMO content and those without to be easily differentiated. This fiveplex screening method is a new development in GMO screening. Utilizing an optimal amplification assay, the specificity, limit of detection (LOD), and limit of quantitation (LOQ) were validated. The LOD and LOQ of this GMO screening method were 0.1% and 0.01%, respectively, with a relative standard deviation (RSD) < 25%. This method could serve as an important tool for the detection of GM maize from different processed, commercially available products. Further, this screening method could be applied to other fields that require reliable and sensitive detection of DNA targets.

Evaluation of the LTQ-Orbitrap mass spectrometer for the analysis of polymerase chain reaction products.

PubMed

Manduzio, Hélène; Ezan, Eric; Fenaille, François

2010-12-30

We have investigated the potential and robustness of the off-line coupling of polymerase chain reaction (PCR) with electrospray ionization mass spectrometry (ESI-MS), for further applications in the screening of single-nucleotide polymorphisms (SNPs). This was based on recently reported data demonstrating that anion-exchange solid-phase extraction was the most efficient technique for efficiently desalting PCR products, with a recovery of ∼70%. Results showed that this purification approach efficiently removes almost all the chemicals commonly added to PCR buffers. ESI-MS analysis of a model 114-bp PCR product performed on the LTQ-Orbitrap instrument demonstrated that detection limits in the nM range along with an average mass measurement uncertainty of 9.15 ± 7.11 ppm can be routinely obtained using an external calibration. The PCR/ESI-MS platform was able to detect just a few copies of a targeted oligonucleotide. However, it was shown that if two PCR products are present in a mixture in a ratio higher than 10 to 1, the lower abundance one might not be reproducibly detected. Applications to SNPs demonstrated that an LTQ-Orbitrap with a resolution of 30 000 (at m/z 400) easily identified a single (A ↔ G) switch, i.e. a 16 Da difference, in binary mixtures of ∼ 35 kDa PCR products. Complementary experiments also showed that the combination of endonucleases and ESI-MS could be used to confirm base composition and sequence, and thus to screen for unknown polymorphisms in specific sequences. For example, a single (T ↔ A) switch (9 Da mass difference) was successfully identified in a 114-bp PCR product. Copyright © 2010 John Wiley & Sons, Ltd.

Detection of Babesia bovis carrier cattle by using polymerase chain reaction amplification of parasite DNA.

PubMed Central

Fahrimal, Y; Goff, W L; Jasmer, D P

1992-01-01

Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that occur in peripheral blood. However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginale, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytchrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. Images PMID:1624551

Sequence analysis of dolphin ferritin H and L subunits and possible iron-dependent translational control of dolphin ferritin gene

PubMed Central

Takaesu, Azusa; Watanabe, Kiyotaka; Takai, Shinji; Sasaki, Yukako; Orino, Koichi

2008-01-01

Background Iron-storage protein, ferritin plays a central role in iron metabolism. Ferritin has dual function to store iron and segregate iron for protection of iron-catalyzed reactive oxygen species. Tissue ferritin is composed of two kinds of subunits (H: heavy chain or heart-type subunit; L: light chain or liver-type subunit). Ferritin gene expression is controlled at translational level in iron-dependent manner or at transcriptional level in iron-independent manner. However, sequencing analysis of marine mammalian ferritin subunits has not yet been performed fully. The purpose of this study is to reveal cDNA-derived amino acid sequences of cetacean ferritin H and L subunits, and demonstrate the possibility of expression of these subunits, especially H subunit, by iron. Methods Sequence analyses of cetacean ferritin H and L subunits were performed by direct sequencing of polymerase chain reaction (PCR) fragments from cDNAs generated via reverse transcription-PCR of leukocyte total RNA prepared from blood samples of six different dolphin species (Pseudorca crassidens, Lagenorhynchus obliquidens, Grampus griseus, Globicephala macrorhynchus, Tursiops truncatus, and Delphinapterus leucas). The putative iron-responsive element sequence in the 5'-untranslated region of the six different dolphin species was revealed by direct sequencing of PCR fragments obtained using leukocyte genomic DNA. Results Dolphin H and L subunits consist of 182 and 174 amino acids, respectively, and amino acid sequence identities of ferritin subunits among these dolphins are highly conserved (H: 99–100%, (99→98) ; L: 98–100%). The conserved 28 bp IRE sequence was located -144 bp upstream from the initiation codon in the six different dolphin species. Conclusion These results indicate that six different dolphin species have conserved ferritin sequences, and suggest that these genes are iron-dependently expressed. PMID:18954429

Evidence of West Nile virus infection in Nepal.

PubMed

Rutvisuttinunt, Wiriya; Chinnawirotpisan, Piyawan; Klungthong, Chonticha; Shrestha, Sanjaya Kumar; Thapa, Amod Bahadur; Pant, Arjun; Yingst, Samuel L; Yoon, In-Kyu; Fernandez, Stefan; Pavlin, Julie A

2014-11-27

Acute febrile illness is common among those seeking medical care and is frequently treated empirically with the underlying illness remaining undiagnosed in resource-poor countries. A febrile illness study was conducted 2009-2010 to identify known and unknown pathogens circulating in Nepal. Study methods included diagnostic testing and preliminary ELISA screening of acute and convalescent samples for diseases both known and unknown to be circulating in Nepal, including West Nile virus (WNV). The molecular assays including Polymerase Chain Reaction (PCR), Sanger sequencing and ultra deep sequencing on MiSeq Illumina Platform were conducted to further confirm the presence of WNV. The study enrolled 2,046 patients presenting undifferentiated febrile illness with unknown etiology. Sera from 14 out of 2,046 patients were tested positive for west nile virus (WNV) by nested Reverse Transcription-Polymerase Chain Reaction (RT-PCR). Only two out of 14 cases were confirmed for the presence of WNV by sequencing and identified as WNV lineage 1 phylogentically. The two patients were adult males with fever and no neurological symptoms from Kathmandu and Bharatpur, Nepal. Two out of 2,046 serum samples contained fragments of WNV genome resembling WNV lineage 1, which is evidence of the continued spread of WNV which should be considered a possible illness cause in Nepal.

PCR Cloning of Partial "nbs" Sequences from Grape ("Vitis aestivalis" Michx)

ERIC Educational Resources Information Center

Chang, Ming-Mei; DiGennaro, Peter; Macula, Anthony

2009-01-01

Plants defend themselves against pathogens via the expressions of disease resistance (R) genes. Many plant R gene products contain the characteristic nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. There are highly conserved motifs within the NBS domain which could be targeted for polymerase chain reaction (PCR) cloning of R…

'Candidatus Phytoplasma sudamericanum' a novel taxon from diseased passion fruit (Passiflora edulis f. flavicarpa Deg.)

USDA-ARS?s Scientific Manuscript database

Symptoms of abnormal proliferation of shoots resulting in formation of witches’ broom growths were observed in diseased plants of passion fruit (Passiflora edulis f. flavicarpa Deg.) in Brazil. RFLP analysis of 16S rRNA gene sequences amplified in polymerase chain reactions containing template DNAs...

cDNA encoding a polypeptide including a hevein sequence

DOEpatents

Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

Phylogeographic patterns of Armillaria ostoyae in the western United States

Treesearch

J. W. Hanna; N. B. Klopfenstein; M. -S. Kim; G. I. McDonald; J. A. Moore

2007-01-01

Nuclear ribosomal DNA regions (i.e. large subunit, internal transcribed spacer, 5.8S and intergenic spacer) were sequenced using a direct-polymerase chain reaction method from Armillaria ostoyae genets collected from the western USA. Many of the A. ostoyae genets contained heterogeneity among rDNA repeats, indicating intragenomic variation and likely intraspecific...

[Prevalence of Bartonella henselae in blood donors and risk of blood transmission in Chile].

PubMed

Núñez, M Antonieta; Contreras, Karla; Depix, M Soledad; Geoffroy, Enrique; Villagra, Nicolás; Mellado, Sandra; Salinas, Ana M

2017-12-01

Bartonella henselae is the causal agent of cat scratch disease in immunocompetent persons and bacterial angiomatosis in immunocompromised patients. In Chile, the prevalence of antibodies against B. henselae in healthy children and adolescents is 13.3%, in persons with occupational risk 60.5%, and in cats 85.6%. There are no published data regarding the seroprevalence in blood donors in our country, so determining if B. henselae is present in the blood of donors at the time of donation is very important, since this microorganism can survive up to 35 days in the red blood cells stored in a blood bank at 4 °C. To determine the prevalence of B. henselae in blood donors. 140 donor blood samples were analyzed to detect the presence of B. henselae, using the polymerase chain reaction technique. 13.6% of the blood donors with positive polymerase chain reaction for B. henselae were obtained. The sequence of the amplified fragments showed an identity of over 98% with respect to B. henselae reference sequences. The risk of blood transmission is due to a country with high B. henselae infection.

A HIV-1 heterosexual transmission chain in Guangzhou, China: a molecular epidemiological study.

PubMed

Han, Zhigang; Leung, Tommy W C; Zhao, Jinkou; Wang, Ming; Fan, Lirui; Li, Kai; Pang, Xinli; Liang, Zhenbo; Lim, Wilina W L; Xu, Huifang

2009-09-25

We conducted molecular analyses to confirm four clustering HIV-1 infections (Patient A, B, C & D) in Guangzhou, China. These cases were identified by epidemiological investigation and suspected to acquire the infection through a common heterosexual transmission chain. Env C2V3V4 region, gag p17/p24 junction and partial pol gene of HIV-1 genome from serum specimens of these infected cases were amplified by reverse transcription polymerase chain reaction (RT-PCR) and nucleotide sequenced. Phylogenetic analyses indicated that their viral nucleotide sequences were significantly clustered together (bootstrap value is 99%, 98% and 100% in env, gag and pol tree respectively). Evolutionary distance analysis indicated that their genetic diversities of env, gag and pol genes were significantly lower than non-clustered controls, as measured by unpaired t-test (env gene comparison: p < 0.005; gag gene comparison: p < 0.005; pol gene comparison: p < 0.005). Epidemiological results and molecular analyses consistently illustrated these four cases represented a transmission chain which dispersed in the locality through heterosexual contact involving commercial sex worker.

Microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse-transcription polymerase chain reaction for the rapid detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens.

PubMed

Jia, Ruan; Chengjun, Sun; Heng, Chen; Chen, Zhou; Yuanqian, Li; Yongxin, Li

2015-07-01

Enterovirus 71 and Coxsackievirus A16 are the main pathogens causing hand-foot-mouth disease. In this paper, microchip capillary electrophoresis with laser-induced fluorescence combined with one-step duplex reverse transcript-polymerase chain reaction has been developed for the detection of Enterovirus 71 and Coxsackievirus A16 in throat swab specimens. The specific reverse transcription-polymerase chain reaction amplicons labeled with SYBR Orange were separated by microchip capillary electrophoresis and detected by laser induced fluorescence detector within 7 min. The intraday and interday relative standard deviation of migration time for DNA Marker was in the range of 1.36-2.94 and 2.78-3.96%, respectively. The detection limits were as low as 2.06 × 10(3) copies/mL for Enterovirus 71 and 5 × 10(3) copies/mL for Coxsackievirus A16. No cross-reactivity was observed with rotavirus, astrovirus, norovirus, and adenovirus, which showed good specificity of the method. This assay was validated using 100 throat swab specimens that were detected by real-time reverse-transcript polymerase chain reaction in parallel and the two methods produced the same results. This study provided a rapid, sensitive and specific method for the detection of Enterovirus 71 and Coxsackievirus A16, which make a contribution to significant time and cost saving for the identification and treatment of patients. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Illegitimate transcription: transcription of any gene in any cell type.

PubMed Central

Chelly, J; Concordet, J P; Kaplan, J C; Kahn, A

1989-01-01

Using in vitro amplification of cDNA by the polymerase chain reaction, we have detected spliced transcripts of various tissue-specific genes (genes for anti-Müllerian hormone, beta-globin, aldolase A, and factor VIIIc) in human nonspecific cells, such as fibroblasts, hepatoma cells, and lymphoblasts. In rats, erythroid- and liver-type pyruvate kinase transcripts were also detected in brain, lung, and muscle. The abundance of these "illegitimate" transcripts is very low; yet, their existence and the possibility of amplifying them by the cDNA polymerase chain reaction provide a powerful tool to analyze pathological transcripts of any tissue-specific gene by using any accessible cell. Images PMID:2495532

Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

PubMed Central

Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

2013-01-01

Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

Detection of monoclonal immunoglobulin heavy chain gene rearrangement (FR3) in Thai malignant lymphoma by High Resolution Melting curve analysis.

PubMed

Kummalue, Tanawan; Chuphrom, Anchalee; Sukpanichanant, Sanya; Pongpruttipan, Tawatchai; Sukpanichanant, Sathien

2010-05-19

Malignant lymphoma, especially non-Hodgkin lymphoma, is one of the most common hematologic malignancies in Thailand. The diagnosis of malignant lymphoma is often problematic, especially in early stages of the disease. Detection of antigen receptor gene rearrangement including T cell receptor (TCR) and immunoglobulin heavy chain (IgH) by polymerase chain reaction followed by heteroduplex has currently become standard whereas fluorescent fragment analysis (GeneScan) has been used for confirmation test. In this study, three techniques had been compared: thermocycler polymerase chain reaction (PCR) followed by heteroduplex and polyacrylamide gel electrophoresis, GeneScan analysis, and real time PCR with High Resolution Melting curve analysis (HRM). The comparison was carried out with DNA extracted from paraffin embedded tissues diagnosed as B- cell non-Hodgkin lymphoma. Specific PCR primers sequences for IgH gene variable region 3, including fluorescence labeled IgH primers were used and results were compared with HRM. In conclusion, the detection IgH gene rearrangement by HRM in the LightCycler System showed potential for distinguishing monoclonality from polyclonality in B-cell non-Hodgkin lymphoma. Malignant lymphoma, especially non-Hodgkin lymphoma, is one of the most common hematologic malignancies in Thailand. The incidence rate as reported by Ministry of Public Health is 3.1 per 100,000 population in female whereas the rate in male is 4.5 per 100,000 population 1. At Siriraj Hospital, the new cases diagnosed as malignant lymphoma were 214.6 cases/year 2. The diagnosis of malignant lymphoma is often problematic, especially in early stages of the disease. Therefore, detection of antigen receptor gene rearrangement including T cell receptor (TCR) and immunoglobulin heavy chain (IgH) by polymerase chain reaction (PCR) assay has recently become a standard laboratory test for discrimination of reactive from malignant clonal lymphoproliferation 34. Analyzing DNA extracted from formalin-fixed, paraffin-embedded tissues by multiplex PCR techniques is more rapid, accurate and highly sensitive. Measuring the size of the amplicon from PCR analysis could be used to diagnose malignant lymphoma with monoclonal pattern showing specific and distinct bands detected on acrylamide gel electrophoresis. However, this technique has some limitations and some patients might require a further confirmation test such as GeneScan or fragment analysis 56.GeneScan technique or fragment analysis reflects size and peak of DNA by using capillary gel electrophoresis. This technique is highly sensitive and can detect 0.5-1% of clonal lymphoid cells. It measures the amplicons by using various fluorescently labeled primers at forward or reverse sides and a specific size standard. Using a Genetic Analyzer machine and GeneMapper software (Applied Bioscience, USA), the monoclonal pattern revealed one single, sharp and high peak at the specific size corresponding to acrylamide gel pattern, whereas the polyclonal pattern showed multiple and small peak condensed at the same size standard. This technique is the most sensitive and accurate technique; however, it usually requires high technical experience and is also of high cost 7. Therefore, rapid and more cost effective technique are being sought.LightCycler PCR performs the diagnostic detection of amplicon via melting curve analysis within 2 hours with the use of a specific dye 89. This dye consists of two types: one known as SYBR-Green I which is non specific and the other named as High Resolution Melting analysis (HRM) which is highly sensitive, more accurate and stable. Several reports demonstrated that this new instrument combined with DNA intercalating dyes can be used to discriminate sequence changes in PCR amplicon without manual handling of PCR product 1011. Therefore, current investigations using melting curve analysis are being developed 1213.In this study, three different techniques were compared to evaluate the suitability of LightCycler PCR with HRM as the clonal diagnostic tool for IgH gene rearrangement in B-cell non-Hogdkin lymphoma, i.e. thermocycler PCR followed by heteroduplex analysis and PAGE, GeneScan analysis and LightCycler PCR with HRM.

Mutations in TET2 and DNMT3A genes are associated with changes in global and gene-specific methylation in acute myeloid leukemia.

PubMed

Ponciano-Gómez, Alberto; Martínez-Tovar, Adolfo; Vela-Ojeda, Jorge; Olarte-Carrillo, Irma; Centeno-Cruz, Federico; Garrido, Efraín

2017-10-01

Acute myeloid leukemia is characterized by its high biological and clinical heterogeneity, which represents an important barrier for a precise disease classification and accurate therapy. While epigenetic aberrations play a pivotal role in acute myeloid leukemia pathophysiology, molecular signatures such as change in the DNA methylation patterns and genetic mutations in enzymes needed to the methylation process can also be helpful for classifying acute myeloid leukemia. Our study aims to unveil the relevance of DNMT3A and TET2 genes in global and specific methylation patterns in acute myeloid leukemia. Peripheral blood samples from 110 untreated patients with acute myeloid leukemia and 15 healthy control individuals were collected. Global 5-methylcytosine and 5-hydroxymethylcytosine in genomic DNA from peripheral blood leukocytes were measured by using the MethylFlashTM Quantification kits. DNMT3A and TET2 expression levels were evaluated by real-time quantitative polymerase chain reaction. The R882A hotspot of DNMT3A and exons 6-10 of TET2 were amplified by polymerase chain reaction and sequenced using the Sanger method. Methylation patterns of 16 gene promoters were evaluated by pyrosequencing after treating DNA with sodium bisulfite, and their transcriptional products were measured by real-time quantitative polymerase chain reaction.Here, we demonstrate altered levels of 5-methylcytosine and 5-hydroxymethylcytosine and highly variable transcript levels of DNMT3A and TET2 in peripheral blood leukocytes from acute myeloid leukemia patients. We found a mutation prevalence of 2.7% for DNMT3A and 11.8% for TET2 in the Mexican population with this disease. The average overall survival of acute myeloid leukemia patients with DNMT3A mutations was only 4 months. In addition, we showed that mutations in DNMT3A and TET2 may cause irregular DNA methylation patterns and transcriptional expression levels in 16 genes known to be involved in acute myeloid leukemia pathogenesis. Our findings suggest that alterations in DNMT3A and TET2 may be associated with acute myeloid leukemia prognosis. Furthermore, alterations in these enzymes affect normal methylation patterns in acute myeloid leukemia- specific genes, which in turn, may influence patient survival.

Noninvasive Antenatal Determination of Fetal Blood Group Using Next-Generation Sequencing

PubMed Central

Rieneck, Klaus; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

2016-01-01

Hemolytic disease of the fetus and newborn (HDFN) is a condition characterized by a decreased lifespan of fetal red blood cells caused by maternally produced allospecific antibodies transferred to the fetus during pregnancy. The antibodies bind to the corresponding blood group antigens on fetal red blood cells and induce hemolysis. Cell-free DNA derived from the conceptus circulates in maternal blood. Using next-generation sequencing (NGS), it can be determined if this cell-free fetal DNA encodes the corresponding blood group antigen that is the target of the maternal allospecific antibodies. This determination carries no risk to the fetus. It is important to determine if the fetus is at risk of hemolysis to enable timely intervention. Many tests for blood groups are based solely on the presence or absence of a single nucleotide polymorphism (SNP). Antenatal determination of fetal blood group by NGS analysis holds advantages over polymerase chain reaction (PCR) determination based on allele specific amplification. PMID:26511760

Negative Enrichment and Isolation of Circulating Tumor Cells for Whole Genome Amplification.

PubMed

Kanwar, Nisha; Done, Susan J

2017-01-01

Circulating tumor cells (CTCs) are a rare population of cells found in the peripheral blood of patients with many types of cancer such as breast, prostate, colon, and lung cancers. Higher numbers of these cells in blood are associated with a poorer prognosis of patients. Genomic profiling of CTCs would help characterize markers specific for the identification of these cells in blood, and also define genomic alterations that give these cells a metastatic advantage over other cells in the primary tumor. Here, we describe an immunomagnetic method to enrich CTCs from the blood of patients with breast cancer, followed by single-cell laser capture microdissection to isolate single CTCs. Whole genome amplification of isolated CTCs allows for many downstream applications to be performed to aide in their characterization, such as whole genome or exome sequencing, Single Nucleotide Polymorphism (SNP) and copy number analysis, and targeted sequencing or quantitative Polymerase Chain Reaction (qPCR) for genomic analyses.

Direct detection of a BRAF mutation in total RNA from melanoma cells using cantilever arrays

NASA Astrophysics Data System (ADS)

Huber, F.; Lang, H. P.; Backmann, N.; Rimoldi, D.; Gerber, Ch.

2013-02-01

Malignant melanoma, the deadliest form of skin cancer, is characterized by a predominant mutation in the BRAF gene. Drugs that target tumours carrying this mutation have recently entered the clinic. Accordingly, patients are routinely screened for mutations in this gene to determine whether they can benefit from this type of treatment. The current gold standard for mutation screening uses real-time polymerase chain reaction and sequencing methods. Here we show that an assay based on microcantilever arrays can detect the mutation nanomechanically without amplification in total RNA samples isolated from melanoma cells. The assay is based on a BRAF-specific oligonucleotide probe. We detected mutant BRAF at a concentration of 500 pM in a 50-fold excess of the wild-type sequence. The method was able to distinguish melanoma cells carrying the mutation from wild-type cells using as little as 20 ng µl-1 of RNA material, without prior PCR amplification and use of labels.

Isolation of a hyperthermophilic archaeum predicted by in situ RNA analysis.

PubMed

Huber, R; Burggraf, S; Mayer, T; Barns, S M; Rossnagel, P; Stetter, K O

1995-07-06

A variety of hyperthermophilic bacteria and archaea have been isolated from high-temperature environments by plating and serial dilutions. However, these techniques allow only the small percentage of organisms able to form colonies, or those that are predominant within environmental samples, to be obtained in pure culture. Recently, in situ 16S ribosomal RNA analyses of samples from the Obsidian hot pool at Yellowstone National Park, Wyoming, revealed a variety of archaeal sequences, which were all different from those of previously isolated species. This suggests substantial diversity of archaea with so far unknown morphological, physiological and biochemical features, which may play an important part within high-temperature ecosystems. Here we describe a procedure to obtain pure cultures of unknown organisms harbouring specific 16S rRNA sequences identified previously within the environment. It combines visual recognition of single cells by phylogenetic staining and cloning by 'optical tweezers'. Our result validates polymerase chain reaction data on the existence of large archael communities.

Identifying Novel Helix–Loop–Helix Genes in Caenorhabditis elegans through a Classroom Demonstration of Functional Genomics

PubMed Central

Griffin, Vernetta; McMiller, Tracee; Jones, Erika; Johnson, Casonya M.

2003-01-01

A 14-week, undergraduate-level Genetics and Population Biology course at Morgan State University was modified to include a demonstration of functional genomics in the research laboratory. Students performed a rudimentary sequence analysis of the Caenorhabditis elegans genome and further characterized three sequences that were predicted to encode helix–loop–helix proteins. Students then used reverse transcription–polymerase chain reaction to determine which of the three genes is normally expressed in C. elegans. At the end of this laboratory activity, students were 1) to demonstrate a rudimentary knowledge of bioinformatics, including the ability to differentiate between “having” a gene and “expressing” a gene, and 2) to understand basic approaches to functional genomics, including one specific technique for assaying for gene expression. It was also anticipated that students would increase their skills at effectively communicating their research activities through written and/or oral presentation. This article describes the laboratory activity and the assessment of the effectiveness of the activity. PMID:12822036

Novel germline SDHD deletion associated with an unusual sympathetic head and neck paraganglioma.

PubMed

Cadiñanos, Juan; Llorente, José L; de la Rosa, Jorge; Villameytide, José A; Illán, Rafael; Durán, Noelia S; Murias, Eduardo; Cabanillas, Rubén

2011-08-01

Paragangliomas (PGLs) are rare tumors arising either from sympathetic or parasympathetic-associated chromaffin tissue. PGLs can occur either sporadically or as part of a hereditary syndrome. Sympathetic head and neck PGLs are extremely rare tumors and only a few cases have been reported to date. We report the pedigree of a patient with a head and neck PGL arising from the right sympathetic trunk. SDHD mutation analysis was performed using standard sequencing, multiplex ligation-dependent probe amplification, chromosome 11-specific comparative genome hybridization, and long-range/short-range polymerase chain reaction (PCR) approaches. A previously unreported chromosome 11q deletion encompassing 5 annotated genes (SDHD, DLAT, PIH1D2, C11Orf57, and TIMM8B) was detected in the proband. PGL families considered "mutation-negative" may be attributable to large gene deletions not detectable by standard sequencing methods. Therefore, deletion analysis should be offered to families or individuals at risk for hereditary PGLs. Copyright © 2010 Wiley Periodicals, Inc.

Visceral pentastomiasis caused by Armillifer armillatus in a captive striped hyena (Hyaena hyaena) in Chiang Mai Night Safari, Thailand.

PubMed

Dechkajorn, Sakorn; Nomsiri, Raksiri; Boonsri, Kittikorn; Sripakdee, Duanghatai; Sukontason, Kabkaew L; Wannasan, Anchalee; Chailangkarn, Sasisophin; Tiwananthagorn, Saruda

2016-02-01

Visceral pentastomiasis (porocephalosis) caused by Armillifer armillatus larvae was incidentally diagnosed in a female striped hyena (Hyaena hyaena) of unknown age which died unexpectedly in 2013. The hyena had been imported from Tanzania 8years earlier and have been since then in a zoo in Chiang Mai, northern Thailand. Pathological examination revealed visceral nymph migrans of pentastomes throughout the intestine, liver, diaphragm, omentum and mesentery, spleen, kidneys, and urinary bladder. Polymerase chain reaction and sequencing that targeted the pentastomid-specific 18S rRNA gene determined 100% identity with reference sequence for A. armillatus, suggesting that its ova can infect the hyena to serve as an intermediate host for the parasite. Further studies to identify the source of infection, its risk factors, and host range for A. armillatus are important to determine its zoonotic potential and to better prevent and manage the disease to protect animal and human health. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Microsatellite diversity of isolates of the parasitic nematode Haemonchus contortus.

PubMed

Otsen, M; Plas, M E; Lenstra, J A; Roos, M H; Hoekstra, R

2000-09-01

The alarming development of anthelmintic resistance in important gastrointestinal nematode parasites of man and live-stock is caused by selection for specific genotypes. In order to provide genetic tools to study the nematode populations and the consequences of anthelmintic treatment, we isolated and sequenced 59 microsatellites of the sheep and goat parasite Haemonchus contortus. These microsatellites consist typically of 2-10 tandems CA/GT repeats that are interrupted by sequences of 1-10 bp. A predominant cause of the imperfect structure of the microsatellites appeared mutations of G/C bp in the tandem repeat. About 44% of the microsatellites were associated with the HcREP1 direct repeat, and it was demonstrated that a generic HcREP1 primer could be used to amplify HcREP1-associated microsatellites. Thirty microsatellites could be typed by polymerase chain reaction (PCR) of which 27 were polymorphic. A number of these markers were used to detect genetic contamination of an experimental inbred population. The microsatellites may also contribute to the genetic mapping of drug resistance genes.

Failure to detect genomic material of HTLV-I or HTLV-II in mononuclear cells of Italian patients with multiple sclerosis and chronic progressive myelopathy.

PubMed

Merelli, E; Sola, P; Marasca, R; Salati, R; Torelli, G

1993-01-01

To contribute to the undecided question if a retrovirus of the human T-cell lymphotropic virus (HTLV) family may be involved in the development of multiple sclerosis (MS), we investigated by the polymerase chain reaction (PCR) the presence of HTLV-I and HTLV-II sequences in the peripheral blood mononuclear cell DNAs from 30 patients affected by MS and 15 by chronic progressive myelopathy. Moreover a control group of 14 blood donors was examined. All these patients were devoid of anti-HTLV-I antibody in the serum and cerebrospinal fluid at ELISA. For the PCR, primers and probes specific for the tax region common to HTLV-I and HTLV-II, for the pol region of HTLV-I, and for the pol region of HTLV-II were used. In spite of the high sensitivity of the technique used, the three groups of subjects were negative for HTLV-I and HTLV-II genomic sequences.

Characterization of lettuce big-vein associated virus and Mirafiori lettuce big-vein virus infecting lettuce in Saudi Arabia.

PubMed

Umar, M; Amer, M A; Al-Saleh, M A; Al-Shahwan, I M; Shakeel, M T; Zakri, A M; Katis, N I

2017-07-01

During 2014 and 2015, 97 lettuce plants that showed big-vein-disease-like symptoms and seven weed plants were collected from the Riyadh region. DAS-ELISA revealed that 25% and 9% of the lettuce plants were singly infected with LBVaV and MiLBVV, respectively, whereas 63% had a mixed infection with both viruses. The results were confirmed by multiplex reverse transcription polymerase chain reaction using primers specific for LBVaV and MiLBVV. LBVaV and MiLBVV were also detected in Sonchus oleraceus and Eruca sativa, respectively. The nucleotide sequence of LBVaV and MiLBVV Saudi isolates ranged from 94.3-100%, and their similarities to isolates with sequences in the GenBank database ranged from 93.9 to 99.6% and 93.8 to 99.3%, respectively. Olpidium sp. was present in the roots of lettuce plants with big-vein disease and it was shown to facilitate transmission of both viruses.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

PubMed

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

2014-04-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

PubMed Central

McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

2014-01-01

A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

Specific primers design based on the superoxide dismutase b gene for Trypanosoma cruzi as a screening tool: Validation method using strains from Colombia classified according to their discrete typing unit.

PubMed

Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde

2014-11-01

To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

A PCR primer bank for quantitative gene expression analysis.

PubMed

Wang, Xiaowei; Seed, Brian

2003-12-15

Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.

PubMed

Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V

2017-02-15

Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.

Development and in-house validation of the event-specific qualitative and quantitative PCR detection methods for genetically modified cotton MON15985.

PubMed

Jiang, Lingxi; Yang, Litao; Rao, Jun; Guo, Jinchao; Wang, Shu; Liu, Jia; Lee, Seonghun; Zhang, Dabing

2010-02-01

To implement genetically modified organism (GMO) labeling regulations, an event-specific analysis method based on the junction sequence between exogenous integration and host genomic DNA has become the preferential approach for GMO identification and quantification. In this study, specific primers and TaqMan probes based on the revealed 5'-end junction sequence of GM cotton MON15985 were designed, and qualitative and quantitative polymerase chain reaction (PCR) assays were established employing the designed primers and probes. In the qualitative PCR assay, the limit of detection (LOD) was 0.5 g kg(-1) in 100 ng total cotton genomic DNA, corresponding to about 17 copies of haploid cotton genomic DNA, and the LOD and limit of quantification (LOQ) for quantitative PCR assay were 10 and 17 copies of haploid cotton genomic DNA, respectively. Furthermore, the developed quantitative PCR assays were validated in-house by five different researchers. Also, five practical samples with known GM contents were quantified using the developed PCR assay in in-house validation, and the bias between the true and quantification values ranged from 2.06% to 12.59%. This study shows that the developed qualitative and quantitative PCR methods are applicable for the identification and quantification of GM cotton MON15985 and its derivates.

Accurate, simple, and inexpensive assays to diagnose F8 gene inversion mutations in hemophilia A patients and carriers.

PubMed

Dutta, Debargh; Gunasekera, Devi; Ragni, Margaret V; Pratt, Kathleen P

2016-12-27

The most frequent mutations resulting in hemophilia A are an intron 22 or intron 1 gene inversion, which together cause ∼50% of severe hemophilia A cases. We report a simple and accurate RNA-based assay to detect these mutations in patients and heterozygous carriers. The assays do not require specialized equipment or expensive reagents; therefore, they may provide useful and economic protocols that could be standardized for central laboratory testing. RNA is purified from a blood sample, and reverse transcription nested polymerase chain reaction (RT-NPCR) reactions amplify DNA fragments with the F8 sequence spanning the exon 22 to 23 splice site (intron 22 inversion test) or the exon 1 to 2 splice site (intron 1 inversion test). These sequences will be amplified only from F8 RNA without an intron 22 or intron 1 inversion mutation, respectively. Additional RT-NPCR reactions are then carried out to amplify the inverted sequences extending from F8 exon 19 to the first in-frame stop codon within intron 22 or a chimeric transcript containing F8 exon 1 and the VBP1 gene. These latter 2 products are produced only by individuals with an intron 22 or intron 1 inversion mutation, respectively. The intron 22 inversion mutations may be further classified (eg, as type 1 or type 2, reflecting the specific homologous recombination sites) by the standard DNA-based "inverse-shifting" PCR assay if desired. Efficient Bcl I and T4 DNA ligase enzymes that cleave and ligate DNA in minutes were used, which is a substantial improvement over previous protocols that required overnight incubations. These protocols can accurately detect F8 inversion mutations via same-day testing of patient samples.

Coding and decoding libraries of sequence-defined functional copolymers synthesized via photoligation

PubMed Central

Zydziak, Nicolas; Konrad, Waldemar; Feist, Florian; Afonin, Sergii; Weidner, Steffen; Barner-Kowollik, Christopher

2016-01-01

Designing artificial macromolecules with absolute sequence order represents a considerable challenge. Here we report an advanced light-induced avenue to monodisperse sequence-defined functional linear macromolecules up to decamers via a unique photochemical approach. The versatility of the synthetic strategy—combining sequential and modular concepts—enables the synthesis of perfect macromolecules varying in chemical constitution and topology. Specific functions are placed at arbitrary positions along the chain via the successive addition of monomer units and blocks, leading to a library of functional homopolymers, alternating copolymers and block copolymers. The in-depth characterization of each sequence-defined chain confirms the precision nature of the macromolecules. Decoding of the functional information contained in the molecular structure is achieved via tandem mass spectrometry without recourse to their synthetic history, showing that the sequence information can be read. We submit that the presented photochemical strategy is a viable and advanced concept for coding individual monomer units along a macromolecular chain. PMID:27901024

Coding and decoding libraries of sequence-defined functional copolymers synthesized via photoligation.

PubMed

Zydziak, Nicolas; Konrad, Waldemar; Feist, Florian; Afonin, Sergii; Weidner, Steffen; Barner-Kowollik, Christopher

2016-11-30

Designing artificial macromolecules with absolute sequence order represents a considerable challenge. Here we report an advanced light-induced avenue to monodisperse sequence-defined functional linear macromolecules up to decamers via a unique photochemical approach. The versatility of the synthetic strategy-combining sequential and modular concepts-enables the synthesis of perfect macromolecules varying in chemical constitution and topology. Specific functions are placed at arbitrary positions along the chain via the successive addition of monomer units and blocks, leading to a library of functional homopolymers, alternating copolymers and block copolymers. The in-depth characterization of each sequence-defined chain confirms the precision nature of the macromolecules. Decoding of the functional information contained in the molecular structure is achieved via tandem mass spectrometry without recourse to their synthetic history, showing that the sequence information can be read. We submit that the presented photochemical strategy is a viable and advanced concept for coding individual monomer units along a macromolecular chain.

Multisite analytic performance studies of a real-time polymerase chain reaction assay for the detection of BRAF V600E mutations in formalin-fixed, paraffin-embedded tissue specimens of malignant melanoma.

PubMed

Anderson, Steven; Bloom, Kenneth J; Vallera, Dino U; Rueschoff, Josef; Meldrum, Cliff; Schilling, Robert; Kovach, Barbara; Lee, Ju Ruey-Jiuan; Ochoa, Pam; Langland, Rachel; Halait, Harkanwal; Lawrence, H Jeffrey; Dugan, Michael C

2012-11-01

A polymerase chain reaction-based companion diagnostic (cobas 4800 BRAF V600 Mutation Test) was recently approved by the US Food and Drug Administration to select patients with BRAF-mutant metastatic melanoma for treatment with the BRAF inhibitor vemurafenib. (1) To compare the analytic performance of the cobas test to Sanger sequencing by using screening specimens from phase II and phase III trials of vemurafenib, and (2) to assess the reproducibility of the cobas test at different testing sites. Specimens from 477 patients were used to determine positive and negative percent agreements between the cobas test and Sanger sequencing for detecting V600E (1799T>A) mutations. Specimens were evaluated with a massively parallel pyrosequencing method (454) to resolve discordances between polymerase chain reaction and Sanger results. Reproducibility of the cobas test was assessed at 3 sites by using 3 reagent lots and an 8-member panel of melanoma samples. A valid cobas result was obtained for all eligible patients. Sanger sequencing had a failure rate of 9.2% (44 of 477). For the remaining 433 specimens, positive percent agreement was 96.4% (215 of 223) and negative percent agreement, 80% (168 of 210). Among 42 cobas mutation-positive/Sanger V600E-negative specimens, 17 were V600E positive and 24 were V600K positive by 454. The cobas test detected 70% of V600K mutations. In the reproducibility study, a correct interpretation was made for 100% of wild-type specimens and specimens with greater than 5% mutant alleles; V600E mutations were detected in 90% of specimens with less than 5% mutant alleles. The cobas test (1) had a lower assay failure rate than that of Sanger, (2) was more sensitive in detecting V600E mutations, (3) detected most V600K mutations, and (4) was highly reproducible.

Identification of hemoglobin variants by top-down mass spectrometry using selected diagnostic product ions.

PubMed

Coelho Graça, Didia; Hartmer, Ralf; Jabs, Wolfgang; Beris, Photis; Clerici, Lorella; Stoermer, Carsten; Samii, Kaveh; Hochstrasser, Denis; Tsybin, Yury O; Scherl, Alexander; Lescuyer, Pierre

2015-04-01

Hemoglobin disorder diagnosis is a complex procedure combining several analytical steps. Due to the lack of specificity of the currently used protein analysis methods, the identification of uncommon hemoglobin variants (proteoforms) can become a hard task to accomplish. The aim of this work was to develop a mass spectrometry-based approach to quickly identify mutated protein sequences within globin chain variants. To reach this goal, a top-down electron transfer dissociation mass spectrometry method was developed for hemoglobin β chain analysis. A diagnostic product ion list was established with a color code strategy allowing to quickly and specifically localize a mutation in the hemoglobin β chain sequence. The method was applied to the analysis of rare hemoglobin β chain variants and an (A)γ-β fusion protein. The results showed that the developed data analysis process allows fast and reliable interpretation of top-down electron transfer dissociation mass spectra by nonexpert users in the clinical area.

Specific and Modular Binding Code for Cytosine Recognition in Pumilio/FBF (PUF) RNA-binding Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dong, Shuyun; Wang, Yang; Cassidy-Amstutz, Caleb

2011-10-28

Pumilio/fem-3 mRNA-binding factor (PUF) proteins possess a recognition code for bases A, U, and G, allowing designed RNA sequence specificity of their modular Pumilio (PUM) repeats. However, recognition side chains in a PUM repeat for cytosine are unknown. Here we report identification of a cytosine-recognition code by screening random amino acid combinations at conserved RNA recognition positions using a yeast three-hybrid system. This C-recognition code is specific and modular as specificity can be transferred to different positions in the RNA recognition sequence. A crystal structure of a modified PUF domain reveals specific contacts between an arginine side chain and themore » cytosine base. We applied the C-recognition code to design PUF domains that recognize targets with multiple cytosines and to generate engineered splicing factors that modulate alternative splicing. Finally, we identified a divergent yeast PUF protein, Nop9p, that may recognize natural target RNAs with cytosine. This work deepens our understanding of natural PUF protein target recognition and expands the ability to engineer PUF domains to recognize any RNA sequence.« less

Prognostic value of deep sequencing method for minimal residual disease detection in multiple myeloma

PubMed Central

Lahuerta, Juan J.; Pepin, François; González, Marcos; Barrio, Santiago; Ayala, Rosa; Puig, Noemí; Montalban, María A.; Paiva, Bruno; Weng, Li; Jiménez, Cristina; Sopena, María; Moorhead, Martin; Cedena, Teresa; Rapado, Immaculada; Mateos, María Victoria; Rosiñol, Laura; Oriol, Albert; Blanchard, María J.; Martínez, Rafael; Bladé, Joan; San Miguel, Jesús; Faham, Malek; García-Sanz, Ramón

2014-01-01

We assessed the prognostic value of minimal residual disease (MRD) detection in multiple myeloma (MM) patients using a sequencing-based platform in bone marrow samples from 133 MM patients in at least very good partial response (VGPR) after front-line therapy. Deep sequencing was carried out in patients in whom a high-frequency myeloma clone was identified and MRD was assessed using the IGH-VDJH, IGH-DJH, and IGK assays. The results were contrasted with those of multiparametric flow cytometry (MFC) and allele-specific oligonucleotide polymerase chain reaction (ASO-PCR). The applicability of deep sequencing was 91%. Concordance between sequencing and MFC and ASO-PCR was 83% and 85%, respectively. Patients who were MRD– by sequencing had a significantly longer time to tumor progression (TTP) (median 80 vs 31 months; P < .0001) and overall survival (median not reached vs 81 months; P = .02), compared with patients who were MRD+. When stratifying patients by different levels of MRD, the respective TTP medians were: MRD ≥10−3 27 months, MRD 10−3 to 10−5 48 months, and MRD <10−5 80 months (P = .003 to .0001). Ninety-two percent of VGPR patients were MRD+. In complete response patients, the TTP remained significantly longer for MRD– compared with MRD+ patients (131 vs 35 months; P = .0009). PMID:24646471

Presence and Expression of Microbial Genes Regulating Soil Nitrogen Dynamics Along the Tanana River Successional Sequence

NASA Astrophysics Data System (ADS)

Boone, R. D.; Rogers, S. L.

2004-12-01

We report on work to assess the functional gene sequences for soil microbiota that control nitrogen cycle pathways along the successional sequence (willow, alder, poplar, white spruce, black spruce) on the Tanana River floodplain, Interior Alaska. Microbial DNA and mRNA were extracted from soils (0-10 cm depth) for amoA (ammonium monooxygenase), nifH (nitrogenase reductase), napA (nitrate reductase), and nirS and nirK (nitrite reductase) genes. Gene presence was determined by amplification of a conserved sequence of each gene employing sequence specific oligonucleotide primers and Polymerase Chain Reaction (PCR). Expression of the genes was measured via nested reverse transcriptase PCR amplification of the extracted mRNA. Amplified PCR products were visualized on agarose electrophoresis gels. All five successional stages show evidence for the presence and expression of microbial genes that regulate N fixation (free-living), nitrification, and nitrate reduction. We detected (1) nifH, napA, and nirK presence and amoA expression (mRNA production) for all five successional stages and (2) nirS and amoA presence and nifH, nirK, and napA expression for early successional stages (willow, alder, poplar). The results highlight that the existing body of previous process-level work has not sufficiently considered the microbial potential for a nitrate economy and free-living N fixation along the complete floodplain successional sequence.

Subacute Sclerosing Panencephalitis in an Infant: Diagnostic Role of Viral Genome Analysis

PubMed Central

Baram, Tallie Z.; Gonzalez-Gomez, Ignacio; Xie, Zong-De; Yao, Dapeng; Gilles, Floyd H.; Nelson, Marvin D.; Nguyen, Hahn T.; Peters, Julius

2013-01-01

Subacute sclerosing panencephalitis (SSPE) is related to “defective” measles virus or vaccination, though an association with parainfluenza viruses has been reported. SSPE is characterized by a slow, erratic course and elevated cerebrospinal fluid measles titers. An immunocompetent, vaccinated infant, with onset of symptoms in parainfiuenza virus season and a catastrophic course is described. Cerebrospinal fluid titers were negative, but postmortem brain had typical SSPE lesions. Patient brain-derived RNA, subjected to reverse transcription followed by polymerase chain reaction yielded polymerase chain reaction products with measles virus but not parainfluenza virus genes. The sequenced fragment revealed multiple mutations, typical for SSPE. SSPE can thus present in infants, with short latency and no cerebrospinal fluid antibodies. Viral genomic analysis may be diagnostic, permitting early therapy. PMID:8024248

Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

PubMed

Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

2016-05-01

For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

A family of glycoproteins (GP55), which inhibit neurite outgrowth, are members of the Ig superfamily and are related to OBCAM, neurotrimin, LAMP and CEPU-1.

PubMed

Wilson, D J; Kim, D S; Clarke, G A; Marshall-Clarke, S; Moss, D J

1996-12-01

We have previously identified a glycosylphosphatidylinositol-linked glycoprotein of 55 kDa (GP55) which inhibits neurite outgrowth. We now provide evidence that GP55, isolated from adult chick brain, consists of at least two bands, both of which are active, i.e., block outgrowth of neurites from chick dorsal root ganglion neurons. An antiserum raised against the adult proteins reverses the inhibition and preliminary experiments suggest that GP55 is restricted to the nervous system, increases during development from very low levels at embryonic day 10 and is most abundant after hatching. Immunofluorescence reveals that GP55 is expressed on neurons cultured from an embryonic day 14 chick brain but is barely detectable on embryonic day 10 dorsal root ganglion neurons or embryonic day 8 forebrain neurons; the neurons which respond to substrate-bound GP55. Peptide sequencing revealed considerable homology with OBCAM, a protein previously identified on the basis of binding opiates. Nested polymerase chain reaction using primers to the OBCAM sequence and internal primers to GP55 peptides produced two different polymerase chain reaction fragments with homology to OBCAM. A full length clone (E19S) corresponding to one polymerase chain reaction product and a partial length clone (E14S) corresponding to the second have been isolated from an embryonic chick brain library. Both are members of the immunoglobulin superfamily and have (or are expected to have) three C2 domains. E19S has 90% homology with LAMP at the amino acid level. This sequence only partially matches the peptides from the adult protein and hence is probably not a major component of the adult proteins. E14S (GP55-A) has 83% homology to OBCAM at the amino acid level over the region sequenced. The sequence matches several of the peptides from the adult protein and is hence likely to correspond to a major component of the adult proteins. Thus members of the GP55 family are related to OBCAM, neurotrimin, LAMP and a recently discovered chick protein CEPU-1. Our results suggest molecules within this family are capable of acting as cell adhesion molecules and inhibitors of neurite outgrowth.

Study of the Characteristics of Elementary Processes in a Chain Hydrogen Burning Reaction in Oxygen

NASA Astrophysics Data System (ADS)

Bychkov, M. E.; Petrushevich, Yu. V.; Starostin, A. N.

2017-12-01

The characteristics of possible chain explosive hydrogen burning reactions in an oxidizing medium are calculated on the potential energy surface. Specifically, reactions H2 + O2 → H2O + O, H2 + O2 → HO2 + H, and H2 + O2 → OH + OH are considered. Special attention is devoted to the production of a pair of fast highly reactive OH radicals. Because of the high activation threshold, this reaction is often excluded from the known kinetic scheme of hydrogen burning. However, a spread in estimates of kinetic characteristics and a disagreement between theoretical predictions with experimental results suggest that the kinetic scheme should be refined.

Sex determination in goat by amplification of the HMG box using duplex PCR.

PubMed

Shi, Lei; Yue, Wenbin; Ren, Youshe; Lei, Fulin; Zhao, Junxing

2008-05-01

The objective of this study was to obtain a fast, accurate and reliable method of determining the sex of goat embryos prior to implantation through amplification of the high-motility-group (HMG) box of the sex-determining region of the Y chromosome (SRY) gene of the goats. Goat specific primers were designed for duplex polymerase chain reaction (PCR). As an internal control gene, the goat beta-action gene sequence was simultaneously amplified together with the HMG box of goat SRY gene. Males showed both 1 SRY band and 1 beta-action band, but only 1 beta-action band was present in the agarose gel electrophoresis of females. The result indicated that the goat HMG-box sequence motif of SRY was male specific. Afterward, the optimized PCR procedure was applied in 30 embryo biopsies and the biopsied embryos were transferred into 30 recipient female goats. The sex of the 13 kids proved anatomically corresponded to the sex determined by PCR (100% accuracy). Thus, this study showed that this duplex PCR method can be applied to sex the goat pre-implantation embryos and to manipulate the sex ratio of offspring in goat breeding programs.

[Cytomegalovirus (CMV) infection in infants may result intractable stridor].

PubMed

Kashiwagi, Y; Kawashima, H; Takekuma, K; Hoshika, A; Nozaki-Renaud, J

2000-08-01

We found ten cases of human cytomegalovirus (CMV) infection who were intractable stridor. Their symptoms were not improved by the treatment with aminophyllin nor beta stimulants. They were admitted repeatedly complaining of stridor, fever and diarrhea. In two cases, the immunological findings showed a decrease of bacterial sterilizing activity of the neutrophils. Additionally, blood count showed leukocytosis more than 15,000/ul in all cases. Total serum IgE and specific IgE antibodies to many antigens were not elevated. Transaminase was elevated. Chest X-p findings of interstitial pneumonia or atelectasis continued for a long time in some cases. Virological examinations revealed high concentrations of specific IgM or CF antibodies against CMV in all cases. CMV DNA in saliva were examined by polymerase chain reaction (PCR) with primer sets for the immediate early (IE) region of CMV and showed positive in seven cases. CMV in bronchoalveolar lavage (BAL) was isolated in two cases, and CMV PCR in BAL was positive in three cases. The sequence of the CMV-PCR products showed almost same sequence except one point mutation in bp 1203. We considered that CMV infections in infants may induce stridor for a long period.

Isolation and characterization of 21 novel expressed DNA sequences from the distal region of human chromosome 4p

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ishida, Yoshikazu; Hadano, Shinji; Nagayama, Tomiko

1994-07-15

The authors have established an approach to the isolation of expressed DNA sequences from a defined region of the human chromosome. The method relies on the direct screening of cDNA libraries using pooled single-copy microclones generated by a laser chromosome microdissection in conjunction with a single unique primer polymerase chain reaction (SUP-PCR) procedure. They applied this method to the distal region of human chromosome 4p (4p15-4pter), which contains the Huntington disease (HD) and the Wolf-Hirschhorn syndrome (WHS) loci. Twenty-one nonoverlapping and region-specific cDNA clones encoding novel genes were isolated in this manner. Ten of 21 clones were subregionally assigned tomore » 4p16.1-4pter, and the remainder mapped to the region proximal to 4p16.1. Northern blot and reverse transcription followed by the PCR (RT-PCR) analysis revealed that 16 of these 21 clones detected transcripts in total RNA from human tissues. The method is applicable to other chromosomal regions and is a powerful approach to the isolation of region-specific cDNA clones. 44 refs., 3 figs., 3 tabs.« less

Affordable hands-on DNA sequencing and genotyping: an exercise for teaching DNA analysis to undergraduates.

PubMed

Shah, Kushani; Thomas, Shelby; Stein, Arnold

2013-01-01

In this report, we describe a 5-week laboratory exercise for undergraduate biology and biochemistry students in which students learn to sequence DNA and to genotype their DNA for selected single nucleotide polymorphisms (SNPs). Students use miniaturized DNA sequencing gels that require approximately 8 min to run. The students perform G, A, T, C Sanger sequencing reactions. They prepare and run the gels, perform Southern blots (which require only 10 min), and detect sequencing ladders using a colorimetric detection system. Students enlarge their sequencing ladders from digital images of their small nylon membranes, and read the sequence manually. They compare their reads with the actual DNA sequence using BLAST2. After mastering the DNA sequencing system, students prepare their own DNA from a cheek swab, polymerase chain reaction-amplify a region of their DNA that encompasses a SNP of interest, and perform sequencing to determine their genotype at the SNP position. A family pedigree can also be constructed. The SNP chosen by the instructor was rs17822931, which is in the ABCC11 gene and is the determinant of human earwax type. Genotypes at the rs178229931 site vary in different ethnic populations. © 2013 by The International Union of Biochemistry and Molecular Biology.

The detection of T-Nos, a genetic element present in GMOs, by cross-priming isothermal amplification with real-time fluorescence.

PubMed

Zhang, Fang; Wang, Liu; Fan, Kai; Wu, Jian; Ying, Yibin

2014-05-01

An isothermal cross-priming amplification (CPA) assay for Agrobacterium tumefaciens nopaline synthase terminator (T-Nos) was established and investigated in this work. A set of six specific primers, recognizing eight distinct regions on the T-Nos sequence, was designed. The CPA assay was performed at a constant temperature, 63 °C, and detected by real-time fluorescence. The results indicated that real-time fluorescent CPA had high specificity, and the limit of detection was 1.06 × 10(3) copies of rice genomic DNA, which could be detected in 40 min. Comparison of real-time fluorescent CPA and conventional polymerase chain reaction (PCR) was also performed. Results revealed that real-time fluorescent CPA had a comparable sensitivity to conventional real-time PCR and had taken a shorter time. In addition, different contents of genetically modified (GM)-contaminated rice seed powder samples were detected for practical application. The result showed real-time fluorescent CPA could detect 0.5 % GM-contaminated samples at least, and the whole reaction could be finished in 35 min. Real-time fluorescent CPA is sensitive enough to monitor labeling systems and provides an attractive method for the detection of GMO.

The diagnosis of microorganism involved in infective endocarditis (IE) by polymerase chain reaction (PCR) and real-time PCR: A systematic review.

PubMed

Faraji, Reza; Behjati-Ardakani, Mostafa; Moshtaghioun, Seyed Mohammad; Kalantar, Seyed Mehdi; Namayandeh, Seyedeh Mahdieh; Soltani, Mohammadhossien; Emami, Mahmood; Zandi, Hengameh; Firoozabadi, Ali Dehghani; Kazeminasab, Mahmood; Ahmadi, Nastaran; Sarebanhassanabadi, Mohammadtaghi

2018-02-01

Broad-range bacterial rDNA polymerase chain reaction (PCR) followed by sequencing may be identified as the etiology of infective endocarditis (IE) from surgically removed valve tissue; therefore, we reviewed the value of molecular testing in identifying organisms' DNA in the studies conducted until 2016. We searched Google Scholar, Scopus, ScienceDirect, Cochrane, PubMed, and Medline electronic databases without any time limitations up to December 2016 for English studies reporting microorganisms involved in infective endocarditis microbiology using PCR and real-time PCR. Most studies were prospective. Eleven out of 12 studies used valve tissue samples and blood cultures while only 1 study used whole blood. Also, 10 studies used the molecular method of PCR while 2 studies used real-time PCR. Most studies used 16S rDNA gene as the target gene. The bacteria were identified as the most common microorganisms involved in infective endocarditis. Streptococcus spp. and Staphylococcus spp. were, by far, the most predominant bacteria detected. In all studies, PCR and real-time PCR identified more pathogens than blood and tissue cultures; moreover, the sensitivity and specificity of PCR and real-time PCR were more than cultures in most of the studies. The highest sensitivity and specificity were 96% and 100%, respectively. The gram positive bacteria were the most frequent cause of infective endocarditis. The molecular methods enjoy a greater sensitivity compared to the conventional blood culture methods; yet, they are applicable only to the valve tissue of the patients undergoing cardiac valve surgery. Copyright © 2017. Published by Elsevier Taiwan.

Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

PubMed

Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

2011-12-01

Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

Condensing enzymes from Cuphea wrightii associated with medium chain fatty acid biosynthesis.

PubMed

Slabaugh, M B; Leonard, J M; Knapp, S J

1998-03-01

Seed oils of most Cuphea species contain > 90% medium chain (C8-C14) fatty acids. Thioesterases with specificity for these substrates are important determinants of the medium chain phenotype. The role of condensing enzymes, however, has not been investigated. cDNA clones encoding beta-ketoacyl-acyl carrier protein (ACP) synthase (KAS) were isolated from C. wrightii, a C10/C12-producing species. Deduced amino acid sequences of four unique clones were approximately 60% identical to plant KAS I sequences and approximately 75% identical to a distinct class of KAS sequences recently identified in castor and barley. A 46 kDa protein that was observed only in developing and mature seed was detected using antiserum directed against recombinant Cuphea KAS protein. The 46 kDa protein was abundant in developing seeds of six medium chain-producing Cuphea species but barely detected in one long chain-producing species. A 48 kDa protein identified immunologically as KAS I was expressed in both medium and long chain-producing Cuphea species and was detected in all tissues tested. In in vitro assays, extracts from C. wrightii and C. viscosissima developing embryos were unable to extend fatty acid chains beyond C10 following treatment with 10 microns cerulenin, a potent inhibitor of KAS I. However, a C. viscosissima mutant, cpr-1, whose seed oils are deficient in caprate relative to wild type, was impaired in extension of C8 to C10 in this assay and Western analysis revealed a specific deficiency in 46 kDa KAS in cpr-1 embryos. These results implicate cerulenin-resistant condensing activity in production of medium chain fatty acids in Cuphea.

Filling reference gaps via assembling DNA barcodes using high-throughput sequencing—moving toward barcoding the world

PubMed Central

Zhou, Chengran

2017-01-01

Abstract Over the past decade, biodiversity researchers have dedicated tremendous efforts to constructing DNA reference barcodes for rapid species registration and identification. Although analytical cost for standard DNA barcoding has been significantly reduced since early 2000, further dramatic reduction in barcoding costs is unlikely because Sanger sequencing is approaching its limits in throughput and chemistry cost. Constraints in barcoding cost not only led to unbalanced barcoding efforts around the globe, but also prevented high-throughput sequencing (HTS)–based taxonomic identification from applying binomial species names, which provide crucial linkages to biological knowledge. We developed an Illumina-based pipeline, HIFI-Barcode, to produce full-length Cytochrome c oxidase subunit I (COI) barcodes from pooled polymerase chain reaction amplicons generated by individual specimens. The new pipeline generated accurate barcode sequences that were comparable to Sanger standards, even for different haplotypes of the same species that were only a few nucleotides different from each other. Additionally, the new pipeline was much more sensitive in recovering amplicons at low quantity. The HIFI-Barcode pipeline successfully recovered barcodes from more than 78% of the polymerase chain reactions that didn’t show clear bands on the electrophoresis gel. Moreover, sequencing results based on the single molecular sequencing platform Pacbio confirmed the accuracy of the HIFI-Barcode results. Altogether, the new pipeline can provide an improved solution to produce full-length reference barcodes at about one-tenth of the current cost, enabling construction of comprehensive barcode libraries for local fauna, leading to a feasible direction for DNA barcoding global biomes. PMID:29077841