Sample records for chain rotamer sampling

  1. Antibody side chain conformations are position-dependent.

    PubMed

    Leem, Jinwoo; Georges, Guy; Shi, Jiye; Deane, Charlotte M

    2018-04-01

    Side chain prediction is an integral component of computational antibody design and structure prediction. Current antibody modelling tools use backbone-dependent rotamer libraries with conformations taken from general proteins. Here we present our antibody-specific rotamer library, where rotamers are binned according to their immunogenetics (IMGT) position, rather than their local backbone geometry. We find that for some amino acid types at certain positions, only a restricted number of side chain conformations are ever observed. Using this information, we are able to reduce the breadth of the rotamer sampling space. Based on our rotamer library, we built a side chain predictor, position-dependent antibody rotamer swapper (PEARS). On a blind test set of 95 antibody model structures, PEARS had the highest average χ 1 and χ1+2 accuracy (78.7% and 64.8%) compared to three leading backbone-dependent side chain predictors. Our use of IMGT position, rather than backbone ϕ/ψ, meant that PEARS was more robust to errors in the backbone of the model structure. PEARS also achieved the lowest number of side chain-side chain clashes. PEARS is freely available as a web application at http://opig.stats.ox.ac.uk/webapps/pears. © 2018 Wiley Periodicals, Inc.

  2. A protein-dependent side-chain rotamer library.

    PubMed

    Bhuyan, Md Shariful Islam; Gao, Xin

    2011-12-14

    Protein side-chain packing problem has remained one of the key open problems in bioinformatics. The three main components of protein side-chain prediction methods are a rotamer library, an energy function and a search algorithm. Rotamer libraries summarize the existing knowledge of the experimentally determined structures quantitatively. Depending on how much contextual information is encoded, there are backbone-independent rotamer libraries and backbone-dependent rotamer libraries. Backbone-independent libraries only encode sequential information, whereas backbone-dependent libraries encode both sequential and locally structural information. However, side-chain conformations are determined by spatially local information, rather than sequentially local information. Since in the side-chain prediction problem, the backbone structure is given, spatially local information should ideally be encoded into the rotamer libraries. In this paper, we propose a new type of backbone-dependent rotamer library, which encodes structural information of all the spatially neighboring residues. We call it protein-dependent rotamer libraries. Given any rotamer library and a protein backbone structure, we first model the protein structure as a Markov random field. Then the marginal distributions are estimated by the inference algorithms, without doing global optimization or search. The rotamers from the given library are then re-ranked and associated with the updated probabilities. Experimental results demonstrate that the proposed protein-dependent libraries significantly outperform the widely used backbone-dependent libraries in terms of the side-chain prediction accuracy and the rotamer ranking ability. Furthermore, without global optimization/search, the side-chain prediction power of the protein-dependent library is still comparable to the global-search-based side-chain prediction methods.

  3. Molprobity's ultimate rotamer-library distributions for model validation.

    PubMed

    Hintze, Bradley J; Lewis, Steven M; Richardson, Jane S; Richardson, David C

    2016-09-01

    Here we describe the updated MolProbity rotamer-library distributions derived from an order-of-magnitude larger and more stringently quality-filtered dataset of about 8000 (vs. 500) protein chains, and we explain the resulting changes and improvements to model validation as seen by users. To include only side-chains with satisfactory justification for their given conformation, we added residue-specific filters for electron-density value and model-to-density fit. The combined new protocol retains a million residues of data, while cleaning up false-positive noise in the multi- χ datapoint distributions. It enables unambiguous characterization of conformational clusters nearly 1000-fold less frequent than the most common ones. We describe examples of local interactions that favor these rare conformations, including the role of authentic covalent bond-angle deviations in enabling presumably strained side-chain conformations. Further, along with favored and outlier, an allowed category (0.3-2.0% occurrence in reference data) has been added, analogous to Ramachandran validation categories. The new rotamer distributions are used for current rotamer validation in MolProbity and PHENIX, and for rotamer choice in PHENIX model-building and refinement. The multi-dimensional χ distributions and Top8000 reference dataset are freely available on GitHub. These rotamers are termed "ultimate" because data sampling and quality are now fully adequate for this task, and also because we believe the future of conformational validation should integrate side-chain with backbone criteria. Proteins 2016; 84:1177-1189. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  4. Generating intrinsically disordered protein conformational ensembles from a Markov chain

    NASA Astrophysics Data System (ADS)

    Cukier, Robert I.

    2018-03-01

    Intrinsically disordered proteins (IDPs) sample a diverse conformational space. They are important to signaling and regulatory pathways in cells. An entropy penalty must be payed when an IDP becomes ordered upon interaction with another protein or a ligand. Thus, the degree of conformational disorder of an IDP is of interest. We create a dichotomic Markov model that can explore entropic features of an IDP. The Markov condition introduces local (neighbor residues in a protein sequence) rotamer dependences that arise from van der Waals and other chemical constraints. A protein sequence of length N is characterized by its (information) entropy and mutual information, MIMC, the latter providing a measure of the dependence among the random variables describing the rotamer probabilities of the residues that comprise the sequence. For a Markov chain, the MIMC is proportional to the pair mutual information MI which depends on the singlet and pair probabilities of neighbor residue rotamer sampling. All 2N sequence states are generated, along with their probabilities, and contrasted with the probabilities under the assumption of independent residues. An efficient method to generate realizations of the chain is also provided. The chain entropy, MIMC, and state probabilities provide the ingredients to distinguish different scenarios using the terminologies: MoRF (molecular recognition feature), not-MoRF, and not-IDP. A MoRF corresponds to large entropy and large MIMC (strong dependence among the residues' rotamer sampling), a not-MoRF corresponds to large entropy but small MIMC, and not-IDP corresponds to low entropy irrespective of the MIMC. We show that MorFs are most appropriate as descriptors of IDPs. They provide a reasonable number of high-population states that reflect the dependences between neighbor residues, thus classifying them as IDPs, yet without very large entropy that might lead to a too high entropy penalty.

  5. Hidden regularity and universal classification of fast side chain motions in proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rajeshwar, Rajitha; Smith, Jeremy C.; Krishnam, Marimuthu

    Proteins display characteristic dynamical signatures that appear to be universal across all proteins regardless of topology and size. Here, we systematically characterize the universal features of fast side chain motions in proteins by examining the conformational energy surfaces of individual residues obtained using enhanced sampling molecular dynamics simulation (618 free energy surfaces obtained from 0.94 s MD simulation). The side chain conformational free energy surfaces obtained using the adaptive biasing force (ABF) method for a set of eight proteins with different molecular weights and secondary structures are used to determine the methyl axial NMR order parameters (O axis 2), populationsmore » of side chain rotamer states (ρ), conformational entropies (S conf), probability fluxes, and activation energies for side chain inter-rotameric transitions. The free energy barriers separating side chain rotamer states range from 0.3 to 12 kcal/mol in all proteins and follow a trimodal distribution with an intense peak at ~5 kcal/mol and two shoulders at ~3 and ~7.5 kcal/mol, indicating that some barriers are more favored than others by proteins to maintain a balance between their conformational stability and flexibility. The origin and the influences of the trimodal barrier distribution on the distribution of O axis 2 and the side chain conformational entropy are discussed. A hierarchical grading of rotamer states based on the conformational free energy barriers, entropy, and probability flux reveals three distinct classes of side chains in proteins. A unique nonlinear correlation is established between O axis 2 and the side chain rotamer populations (ρ). In conclusion, the apparent universality in O axis 2 versus correlation, trimodal barrier distribution, and distinct characteristics of three classes of side chains observed among all proteins indicates a hidden regularity (or commonality) in the dynamical heterogeneity of fast side chain motions in proteins.« less

  6. Side-chain mobility in the folded state of Myoglobin

    NASA Astrophysics Data System (ADS)

    Lammert, Heiko; Onuchic, Jose

    We study the accessibility of alternative side-chain rotamer configurations in the native state of Myoglobin, using an all-atom structure-based model. From long, unbiased simulation trajectories we determine occupancies of rotameric states and also estimate configurational and vibrational entropies. Direct sampling of the full native-state dynamics, enabled by the simple model, reveals facilitation of side-chain motions by backbone dynamics. Correlations between different dihedral angles are quantified and prove to be weak. We confirm global trends in the mobilities of side-chains, following burial and also the chemical character of residues. Surface residues loose little configurational entropy upon folding; side-chains contribute significantly to the entropy of the folded state. Mobilities of buried side-chains vary strongly with temperature. At ambient temperature, individual side-chains in the core of the protein gain substantial access to alternative rotamers, with occupancies that are likely observable experimentally. Finally, the dynamics of buried side-chains may be linked to the internal pockets, available to ligand gas molecules in Myoglobin.

  7. How accurately do force fields represent protein side chain ensembles?

    PubMed

    Petrović, Dušan; Wang, Xue; Strodel, Birgit

    2018-05-23

    Although the protein backbone is the most fundamental part of the structure, the fine-tuning of side-chain conformations is important for protein function, for example, in protein-protein and protein-ligand interactions, and also in enzyme catalysis. While several benchmarks testing the performance of protein force fields for side chain properties have already been published, they often considered only a few force fields and were not tested against the same experimental observables; hence, they are not directly comparable. In this work, we explore the ability of twelve force fields, which are different flavors of AMBER, CHARMM, OPLS, or GROMOS, to reproduce average rotamer angles and rotamer populations obtained from extensive NMR studies of the 3 J and residual dipolar coupling constants for two small proteins: ubiquitin and GB3. Based on a total of 196 μs sampling time, our results reveal that all force fields identify the correct side chain angles, while the AMBER and CHARMM force fields clearly outperform the OPLS and GROMOS force fields in estimating rotamer populations. The three best force fields for representing the protein side chain dynamics are AMBER 14SB, AMBER 99SB*-ILDN, and CHARMM36. Furthermore, we observe that the side chain ensembles of buried amino acid residues are generally more accurately represented than those of the surface exposed residues. This article is protected by copyright. All rights reserved. © 2018 Wiley Periodicals, Inc.

  8. MCCE2: improving protein pKa calculations with extensive side chain rotamer sampling.

    PubMed

    Song, Yifan; Mao, Junjun; Gunner, M R

    2009-11-15

    Multiconformation continuum electrostatics (MCCE) explores different conformational degrees of freedom in Monte Carlo calculations of protein residue and ligand pK(a)s. Explicit changes in side chain conformations throughout a titration create a position dependent, heterogeneous dielectric response giving a more accurate picture of coupled ionization and position changes. The MCCE2 methods for choosing a group of input heavy atom and proton positions are described. The pK(a)s calculated with different isosteric conformers, heavy atom rotamers and proton positions, with different degrees of optimization are tested against a curated group of 305 experimental pK(a)s in 33 proteins. QUICK calculations, with rotation around Asn and Gln termini, sampling His tautomers and torsion minimum hydroxyls yield an RMSD of 1.34 with 84% of the errors being <1.5 pH units. FULL calculations adding heavy atom rotamers and side chain optimization yield an RMSD of 0.90 with 90% of the errors <1.5 pH unit. Good results are also found for pK(a)s in the membrane protein bacteriorhodopsin. The inclusion of extra side chain positions distorts the dielectric boundary and also biases the calculated pK(a)s by creating more neutral than ionized conformers. Methods for correcting these errors are introduced. Calculations are compared with multiple X-ray and NMR derived structures in 36 soluble proteins. Calculations with X-ray structures give significantly better pK(a)s. Results with the default protein dielectric constant of 4 are as good as those using a value of 8. The MCCE2 program can be downloaded from http://www.sci.ccny.cuny.edu/~mcce. 2009 Wiley Periodicals, Inc.

  9. MolProbity’s Ultimate Rotamer-Library Distributions for Model Validation

    PubMed Central

    Hintze, Bradley J.; Lewis, Steven M.; Richardson, Jane S.; Richardson, David C.

    2016-01-01

    Here we describe the updated MolProbity rotamer-library distributions derived from an order-of-magnitude larger and more stringently quality-filtered dataset of about 8000 (vs. 500) protein chains, and we explain the resulting changes and improvements to model validation as seen by users. To include only sidechains with satisfactory justification for their given conformation, we added residue-specific filters for electron-density value and model-to-density fit. The combined new protocol retains a million residues of data, while cleaning up false-positive noise in the multi-χ datapoint distributions. It enables unambiguous characterization of conformational clusters nearly 1000-fold less frequent than the most common ones. We describe examples of local interactions that favor these rare conformations, including the role of authentic covalent bond-angle deviations in enabling presumably strained sidechain conformations. Further, along with favored and outlier, an allowed category (0.3% to 2.0% occurrence in reference data) has been added, analogous to Ramachandran validation categories. The new rotamer distributions are used for current rotamer validation in Mol-Probity and PHENIX, and for rotamer choice in PHENIX model-building and refinement. The multi-dimensional χ distributions and Top8000 reference dataset are freely available on GitHub. These rotamers are termed “ultimate” because data sampling and quality are now fully adequate for this task, and also because we believe the future of conformational validation should integrate sidechain with backbone criteria. PMID:27018641

  10. Residues with similar hexagon neighborhoods share similar side-chain conformations.

    PubMed

    Li, Shuai Cheng; Bu, Dongbo; Li, Ming

    2012-01-01

    We present in this study a new approach to code protein side-chain conformations into hexagon substructures. Classical side-chain packing methods consist of two steps: first, side-chain conformations, known as rotamers, are extracted from known protein structures as candidates for each residue; second, a searching method along with an energy function is used to resolve conflicts among residues and to optimize the combinations of side chain conformations for all residues. These methods benefit from the fact that the number of possible side-chain conformations is limited, and the rotamer candidates are readily extracted; however, these methods also suffer from the inaccuracy of energy functions. Inspired by threading and Ab Initio approaches to protein structure prediction, we propose to use hexagon substructures to implicitly capture subtle issues of energy functions. Our initial results indicate that even without guidance from an energy function, hexagon structures alone can capture side-chain conformations at an accuracy of 83.8 percent, higher than 82.6 percent by the state-of-art side-chain packing methods.

  11. Optimization of rotamers prior to template minimization improves stability predictions made by computational protein design.

    PubMed

    Davey, James A; Chica, Roberto A

    2015-04-01

    Computational protein design (CPD) predictions are highly dependent on the structure of the input template used. However, it is unclear how small differences in template geometry translate to large differences in stability prediction accuracy. Herein, we explored how structural changes to the input template affect the outcome of stability predictions by CPD. To do this, we prepared alternate templates by Rotamer Optimization followed by energy Minimization (ROM) and used them to recapitulate the stability of 84 protein G domain β1 mutant sequences. In the ROM process, side-chain rotamers for wild-type (WT) or mutant sequences are optimized on crystal or nuclear magnetic resonance (NMR) structures prior to template minimization, resulting in alternate structures termed ROM templates. We show that use of ROM templates prepared from sequences known to be stable results predominantly in improved prediction accuracy compared to using the minimized crystal or NMR structures. Conversely, ROM templates prepared from sequences that are less stable than the WT reduce prediction accuracy by increasing the number of false positives. These observed changes in prediction outcomes are attributed to differences in side-chain contacts made by rotamers in ROM templates. Finally, we show that ROM templates prepared from sequences that are unfolded or that adopt a nonnative fold result in the selective enrichment of sequences that are also unfolded or that adopt a nonnative fold, respectively. Our results demonstrate the existence of a rotamer bias caused by the input template that can be harnessed to skew predictions toward sequences displaying desired characteristics. © 2014 The Protein Society.

  12. Improved packing of protein side chains with parallel ant colonies.

    PubMed

    Quan, Lijun; Lü, Qiang; Li, Haiou; Xia, Xiaoyan; Wu, Hongjie

    2014-01-01

    The accurate packing of protein side chains is important for many computational biology problems, such as ab initio protein structure prediction, homology modelling, and protein design and ligand docking applications. Many of existing solutions are modelled as a computational optimisation problem. As well as the design of search algorithms, most solutions suffer from an inaccurate energy function for judging whether a prediction is good or bad. Even if the search has found the lowest energy, there is no certainty of obtaining the protein structures with correct side chains. We present a side-chain modelling method, pacoPacker, which uses a parallel ant colony optimisation strategy based on sharing a single pheromone matrix. This parallel approach combines different sources of energy functions and generates protein side-chain conformations with the lowest energies jointly determined by the various energy functions. We further optimised the selected rotamers to construct subrotamer by rotamer minimisation, which reasonably improved the discreteness of the rotamer library. We focused on improving the accuracy of side-chain conformation prediction. For a testing set of 442 proteins, 87.19% of X1 and 77.11% of X12 angles were predicted correctly within 40° of the X-ray positions. We compared the accuracy of pacoPacker with state-of-the-art methods, such as CIS-RR and SCWRL4. We analysed the results from different perspectives, in terms of protein chain and individual residues. In this comprehensive benchmark testing, 51.5% of proteins within a length of 400 amino acids predicted by pacoPacker were superior to the results of CIS-RR and SCWRL4 simultaneously. Finally, we also showed the advantage of using the subrotamers strategy. All results confirmed that our parallel approach is competitive to state-of-the-art solutions for packing side chains. This parallel approach combines various sources of searching intelligence and energy functions to pack protein side chains. It provides a frame-work for combining different inaccuracy/usefulness objective functions by designing parallel heuristic search algorithms.

  13. Correlation of tryptophan fluorescence intensity decay parameters with sup 1 H NMR-determined rotamer conformations: (tryptophan sup 2 )oxytocin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ross, J.B.A.; Schwartz, G.P.; Laws, W.R.

    1992-02-18

    While the fluorescence decay kinetics of tyrosine model compounds can be explained in terms of heterogeneity derived from the three ground-state {chi}{sup 1} rotamers, a similar correlation has yet to be directly observed for a tryptophan residue. In addition, the asymmetric indole ring might also lead to heterogeneity from {chi}{sup 2} rotations. In this paper, the time-resolved and steady-state fluorescence properties of (tryptophan{sup 2})oxytocin at pH 3 are presented and compared with {sup 1}H NMR results. According to the unrestricted analyses of individual fluorescence decay curves taken as a function of emission wavelength-independent decay constants, only three exponential terms aremore » required. In addition, the preexponential weighting factors (amplitudes) have the same relative relationship (weights) as the {sup 1}H NMR-determined {chi}{sup 1} rotamer populations of the indole side chain. {sup 15}N was used in heteronuclear coupling experiments to confirm the rotamer assignments. Inclusion of a linked function restricting the decay amplitudes to the {chi}{sup 1} rotamer populations in the individual decay curve analyses and in the global analysis confirms this correlation. According to qualitative nuclear Overhauser data, there are two {chi}{sup 2} populations.« less

  14. Fitmunk: improving protein structures by accurate, automatic modeling of side-chain conformations.

    PubMed

    Porebski, Przemyslaw Jerzy; Cymborowski, Marcin; Pasenkiewicz-Gierula, Marta; Minor, Wladek

    2016-02-01

    Improvements in crystallographic hardware and software have allowed automated structure-solution pipelines to approach a near-`one-click' experience for the initial determination of macromolecular structures. However, in many cases the resulting initial model requires a laborious, iterative process of refinement and validation. A new method has been developed for the automatic modeling of side-chain conformations that takes advantage of rotamer-prediction methods in a crystallographic context. The algorithm, which is based on deterministic dead-end elimination (DEE) theory, uses new dense conformer libraries and a hybrid energy function derived from experimental data and prior information about rotamer frequencies to find the optimal conformation of each side chain. In contrast to existing methods, which incorporate the electron-density term into protein-modeling frameworks, the proposed algorithm is designed to take advantage of the highly discriminatory nature of electron-density maps. This method has been implemented in the program Fitmunk, which uses extensive conformational sampling. This improves the accuracy of the modeling and makes it a versatile tool for crystallographic model building, refinement and validation. Fitmunk was extensively tested on over 115 new structures, as well as a subset of 1100 structures from the PDB. It is demonstrated that the ability of Fitmunk to model more than 95% of side chains accurately is beneficial for improving the quality of crystallographic protein models, especially at medium and low resolutions. Fitmunk can be used for model validation of existing structures and as a tool to assess whether side chains are modeled optimally or could be better fitted into electron density. Fitmunk is available as a web service at http://kniahini.med.virginia.edu/fitmunk/server/ or at http://fitmunk.bitbucket.org/.

  15. Improved packing of protein side chains with parallel ant colonies

    PubMed Central

    2014-01-01

    Introduction The accurate packing of protein side chains is important for many computational biology problems, such as ab initio protein structure prediction, homology modelling, and protein design and ligand docking applications. Many of existing solutions are modelled as a computational optimisation problem. As well as the design of search algorithms, most solutions suffer from an inaccurate energy function for judging whether a prediction is good or bad. Even if the search has found the lowest energy, there is no certainty of obtaining the protein structures with correct side chains. Methods We present a side-chain modelling method, pacoPacker, which uses a parallel ant colony optimisation strategy based on sharing a single pheromone matrix. This parallel approach combines different sources of energy functions and generates protein side-chain conformations with the lowest energies jointly determined by the various energy functions. We further optimised the selected rotamers to construct subrotamer by rotamer minimisation, which reasonably improved the discreteness of the rotamer library. Results We focused on improving the accuracy of side-chain conformation prediction. For a testing set of 442 proteins, 87.19% of X1 and 77.11% of X12 angles were predicted correctly within 40° of the X-ray positions. We compared the accuracy of pacoPacker with state-of-the-art methods, such as CIS-RR and SCWRL4. We analysed the results from different perspectives, in terms of protein chain and individual residues. In this comprehensive benchmark testing, 51.5% of proteins within a length of 400 amino acids predicted by pacoPacker were superior to the results of CIS-RR and SCWRL4 simultaneously. Finally, we also showed the advantage of using the subrotamers strategy. All results confirmed that our parallel approach is competitive to state-of-the-art solutions for packing side chains. Conclusions This parallel approach combines various sources of searching intelligence and energy functions to pack protein side chains. It provides a frame-work for combining different inaccuracy/usefulness objective functions by designing parallel heuristic search algorithms. PMID:25474164

  16. Side-chain conformation at the selectivity filter shapes the permeation free-energy landscape of an ion channel.

    PubMed

    Harpole, Tyler J; Grosman, Claudio

    2014-08-05

    On the basis of single-channel currents recorded from the muscle nicotinic acetylcholine receptor (AChR), we have recently hypothesized that the conformation adopted by the glutamate side chains at the first turn of the pore-lining α-helices is a key determinant of the rate of ion permeation. In this paper, we set out to test these ideas within a framework of atomic detail and stereochemical rigor by conducting all-atom molecular dynamics and Brownian dynamics simulations on an extensively validated model of the open-channel muscle AChR. Our simulations provided ample support to the notion that the different rotamers of these glutamates partition into two classes that differ markedly in their ability to catalyze ion conduction, and that the conformations of the four wild-type glutamates are such that two of them "fall" in each rotamer class. Moreover, the simulations allowed us to identify the mm (χ(1) ≅ -60°; χ(2) ≅ -60°) and tp (χ(1) ≅ 180°; χ(2) ≅ +60°) rotamers as the likely conduction-catalyzing conformations of the AChR's selectivity-filter glutamates. More generally, our work shows an example of how experimental benchmarks can guide molecular simulations into providing a type of structural and mechanistic insight that seems otherwise unattainable.

  17. Modeling and experimental assessment of a buried Leu–Ile mutation in dengue envelope domain III

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kulkarni, Manjiri R.; Numoto, Nobutaka; Ito, Nobutoshi

    Envelope protein domain III (ED3) of the dengue virus is important for both antibody binding and host cell interaction. Here, we focused on how a L387I mutation in the protein core could take place in DEN4 ED3, but cannot be accommodated in DEN3 ED3 without destabilizing its structure. To this end, we modeled a DEN4-L387I structure using the Penultimate Rotamer Library and taking the DEN4 ED3 main-chain as a fixed template. We found that three out of seven Ile{sup 387} conformers fit in DEN4 ED3 without introducing the severe atomic clashes that are observed when DEN3 serotype’s ED3 is usedmore » as a template. A more extensive search using 273 side-chain rotamers of the residues surrounding Ile{sup 387} confirmed this prediction. In order to assess the prediction, we determined the crystal structure of DEN4-L387I at 2 Å resolution. Ile{sup 387} indeed adopted one of the three predicted rotamers. Altogether, this study demonstrates that the effects of single mutations are to a large extent successfully predicted by systematically modeling the side-chain structures of the mutated as well as those of its surrounding residues using fixed main-chain structures and assessing inter-atomic steric clashes. More accurate and reliable predictions require considering sub-angstrom main-chain deformation, which remains a challenging task. - Highlights: • We mutated L387I of DEN4 ED3 and examined its effects on structure and stability. • We modeled the side-chain of Ile{sup 387} using DEN4 ED3's structure as a template. • We determined the crystal structure of DEN4-L387I and confirmed the modeling. • Side-chain repacking occurring around Ile{sup 387} involved >3 inter-connected residues. • These results explained why L387I mutation in DEN4 ED3 conserves thermostability.« less

  18. Side-chain conformational space analysis (SCSA): A multi conformation-based QSAR approach for modeling and prediction of protein-peptide binding affinities

    NASA Astrophysics Data System (ADS)

    Zhou, Peng; Chen, Xiang; Shang, Zhicai

    2009-03-01

    In this article, the concept of multi conformation-based quantitative structure-activity relationship (MCB-QSAR) is proposed, and based upon that, we describe a new approach called the side-chain conformational space analysis (SCSA) to model and predict protein-peptide binding affinities. In SCSA, multi-conformations (rather than traditional single-conformation) have received much attention, and the statistical average information on multi-conformations of side chains is determined using self-consistent mean field theory based upon side chain rotamer library. Thereby, enthalpy contributions (including electrostatic, steric, hydrophobic interaction and hydrogen bond) and conformational entropy effects to the binding are investigated in terms of occurrence probability of residue rotamers. Then, SCSA was applied into the dataset of 419 HLA-A*0201 binding peptides, and nonbonding contributions of each position in peptide ligands are well determined. For the peptides, the hydrogen bond and electrostatic interactions of the two ends are essential to the binding specificity, van der Waals and hydrophobic interactions of all the positions ensure strong binding affinity, and the loss of conformational entropy at anchor positions partially counteracts other favorable nonbonding effects.

  19. Side-chain conformation of the M2 transmembrane peptide proton channel of influenza a virus from 19F solid-state NMR.

    PubMed

    Luo, Wenbin; Mani, Rajeswari; Hong, Mei

    2007-09-13

    The M2 transmembrane peptide (M2TMP) of the influenza A virus forms a tetrameric helical bundle that acts as a proton-selective channel important in the viral life cycle. The side-chain conformation of the peptide is largely unknown and is important for elucidating the proton-conducting mechanism and the channel stability. Using a 19F spin diffusion NMR technique called CODEX, we have measured the oligomeric states and interhelical side chain-side chain 19F-19F distances at several residues using singly fluorinated M2TMP bound to DMPC bilayers. 19F CODEX data at a key residue of the proton channel, Trp41, confirm the tetrameric state of the peptide and yield a nearest-neighbor interhelical distance of approximately 11 A under both neutral and acidic pH. Since the helix orientation is precisely known from previous 15N NMR experiments and the backbone channel diameter has a narrow allowed range, this 19F distance constrains the Trp41 side-chain conformation to t90 (chi1 approximately 180 degrees , chi2 approximately 90 degrees ). This Trp41 rotamer, combined with a previously measured 15N-13C distance between His37 and Trp411, suggests that the His37 rotamer is t-160. The implication of the proposed (His37, Trp41) rotamers to the gating mechanism of the M2 proton channel is discussed. Binding of the antiviral drug amantadine to the peptide does not affect the F-F distance at Trp41. Interhelical 19F-19F distances are also measured at residues 27 and 38, each mutated to 4-19F-Phe. For V27F-M2TMP, the 19F-19F distances suggest a mixture of dimers and tetramers, whereas the L38F-M2TMP data indicate two tetramers of different sizes, suggesting side chain conformational heterogeneity at this lipid-facing residue. This work shows that 19F spin diffusion NMR is a valuable tool for determining long-range intermolecular distances that shed light on the mechanism of action and conformational heterogeneity of membrane protein oligomers.

  20. A Bayesian Approach for Determining Protein Side-Chain Rotamer Conformations Using Unassigned NOE Data

    PubMed Central

    Zeng, Jianyang; Roberts, Kyle E.; Zhou, Pei

    2011-01-01

    Abstract A major bottleneck in protein structure determination via nuclear magnetic resonance (NMR) is the lengthy and laborious process of assigning resonances and nuclear Overhauser effect (NOE) cross peaks. Recent studies have shown that accurate backbone folds can be determined using sparse NMR data, such as residual dipolar couplings (RDCs) or backbone chemical shifts. This opens a question of whether we can also determine the accurate protein side-chain conformations using sparse or unassigned NMR data. We attack this question by using unassigned nuclear Overhauser effect spectroscopy (NOESY) data, which records the through-space dipolar interactions between protons nearby in three-dimensional (3D) space. We propose a Bayesian approach with a Markov random field (MRF) model to integrate the likelihood function derived from observed experimental data, with prior information (i.e., empirical molecular mechanics energies) about the protein structures. We unify the side-chain structure prediction problem with the side-chain structure determination problem using unassigned NMR data, and apply the deterministic dead-end elimination (DEE) and A* search algorithms to provably find the global optimum solution that maximizes the posterior probability. We employ a Hausdorff-based measure to derive the likelihood of a rotamer or a pairwise rotamer interaction from unassigned NOESY data. In addition, we apply a systematic and rigorous approach to estimate the experimental noise in NMR data, which also determines the weighting factor of the data term in the scoring function derived from the Bayesian framework. We tested our approach on real NMR data of three proteins: the FF Domain 2 of human transcription elongation factor CA150 (FF2), the B1 domain of Protein G (GB1), and human ubiquitin. The promising results indicate that our algorithm can be applied in high-resolution protein structure determination. Since our approach does not require any NOE assignment, it can accelerate the NMR structure determination process. PMID:21970619

  1. ROTAS: a rotamer-dependent, atomic statistical potential for assessment and prediction of protein structures.

    PubMed

    Park, Jungkap; Saitou, Kazuhiro

    2014-09-18

    Multibody potentials accounting for cooperative effects of molecular interactions have shown better accuracy than typical pairwise potentials. The main challenge in the development of such potentials is to find relevant structural features that characterize the tightly folded proteins. Also, the side-chains of residues adopt several specific, staggered conformations, known as rotamers within protein structures. Different molecular conformations result in different dipole moments and induce charge reorientations. However, until now modeling of the rotameric state of residues had not been incorporated into the development of multibody potentials for modeling non-bonded interactions in protein structures. In this study, we develop a new multibody statistical potential which can account for the influence of rotameric states on the specificity of atomic interactions. In this potential, named "rotamer-dependent atomic statistical potential" (ROTAS), the interaction between two atoms is specified by not only the distance and relative orientation but also by two state parameters concerning the rotameric state of the residues to which the interacting atoms belong. It was clearly found that the rotameric state is correlated to the specificity of atomic interactions. Such rotamer-dependencies are not limited to specific type or certain range of interactions. The performance of ROTAS was tested using 13 sets of decoys and was compared to those of existing atomic-level statistical potentials which incorporate orientation-dependent energy terms. The results show that ROTAS performs better than other competing potentials not only in native structure recognition, but also in best model selection and correlation coefficients between energy and model quality. A new multibody statistical potential, ROTAS accounting for the influence of rotameric states on the specificity of atomic interactions was developed and tested on decoy sets. The results show that ROTAS has improved ability to recognize native structure from decoy models compared to other potentials. The effectiveness of ROTAS may provide insightful information for the development of many applications which require accurate side-chain modeling such as protein design, mutation analysis, and docking simulation.

  2. Improved modeling of side-chain--base interactions and plasticity in protein--DNA interface design.

    PubMed

    Thyme, Summer B; Baker, David; Bradley, Philip

    2012-06-08

    Combinatorial sequence optimization for protein design requires libraries of discrete side-chain conformations. The discreteness of these libraries is problematic, particularly for long, polar side chains, since favorable interactions can be missed. Previously, an approach to loop remodeling where protein backbone movement is directed by side-chain rotamers predicted to form interactions previously observed in native complexes (termed "motifs") was described. Here, we show how such motif libraries can be incorporated into combinatorial sequence optimization protocols and improve native complex recapitulation. Guided by the motif rotamer searches, we made improvements to the underlying energy function, increasing recapitulation of native interactions. To further test the methods, we carried out a comprehensive experimental scan of amino acid preferences in the I-AniI protein-DNA interface and found that many positions tolerated multiple amino acids. This sequence plasticity is not observed in the computational results because of the fixed-backbone approximation of the model. We improved modeling of this diversity by introducing DNA flexibility and reducing the convergence of the simulated annealing algorithm that drives the design process. In addition to serving as a benchmark, this extensive experimental data set provides insight into the types of interactions essential to maintain the function of this potential gene therapy reagent. Published by Elsevier Ltd.

  3. Protein side chain conformation predictions with an MMGBSA energy function.

    PubMed

    Gaillard, Thomas; Panel, Nicolas; Simonson, Thomas

    2016-06-01

    The prediction of protein side chain conformations from backbone coordinates is an important task in structural biology, with applications in structure prediction and protein design. It is a difficult problem due to its combinatorial nature. We study the performance of an "MMGBSA" energy function, implemented in our protein design program Proteus, which combines molecular mechanics terms, a Generalized Born and Surface Area (GBSA) solvent model, with approximations that make the model pairwise additive. Proteus is not a competitor to specialized side chain prediction programs due to its cost, but it allows protein design applications, where side chain prediction is an important step and MMGBSA an effective energy model. We predict the side chain conformations for 18 proteins. The side chains are first predicted individually, with the rest of the protein in its crystallographic conformation. Next, all side chains are predicted together. The contributions of individual energy terms are evaluated and various parameterizations are compared. We find that the GB and SA terms, with an appropriate choice of the dielectric constant and surface energy coefficients, are beneficial for single side chain predictions. For the prediction of all side chains, however, errors due to the pairwise additive approximation overcome the improvement brought by these terms. We also show the crucial contribution of side chain minimization to alleviate the rigid rotamer approximation. Even without GB and SA terms, we obtain accuracies comparable to SCWRL4, a specialized side chain prediction program. In particular, we obtain a better RMSD than SCWRL4 for core residues (at a higher cost), despite our simpler rotamer library. Proteins 2016; 84:803-819. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  4. Correlation of conformational heterogeneity of the tryptophyl side chain and time-resolved fluorescence intensity decay kinetics

    NASA Astrophysics Data System (ADS)

    Laws, William R.; Ross, J. B. Alexander

    1992-04-01

    The time-resolved fluorescence properties of a tryptophan residue should be useful for probing protein structure, function, and dynamics. To date, however, the non-single exponential fluorescence intensity decay kinetics for numerous peptides and proteins having a single tryptophan residue have not been adequately explained. Many possibilities have been considered and include: (1) contributions from the 1La and 1Lb states of indole; (2) excited-state hydrogen exchange; and (3) environmental heterogeneity from (chi) 1 and (chi) 2 rotamers. In addition, it has been suggested that generally many factors contribute to the decay and a distribution of probabilities may be more appropriate. Two recent results support multiple species due to conformational heterogeneity as the major contributor to complex kinetics. First, a rotationally constrained tryptophan analogue has fluorescence intensity decay kinetics that can be described by the sum of two exponentials with amplitudes comparable to the relative populations of the two rotational isomers. Second, the multiple exponentials observed for tyrosine-containing model compounds and peptides correlate with the (chi) 1 rotamer populations independently determined by 1H NMR. We now report similar correlations between rotamer populations and fluorescence intensity decay kinetics for a tryptophan analogue of oxytocin. It appears for this compound that either (chi) 2 rotations do not appreciably alter the indole environment, (chi) 2 rotations are rapid enough to average the observed dependence, or only one of two possible (chi) 2 populations is associated with each (chi) 1 rotamer.

  5. Role of Tryptophan Side Chain Dynamics on the Trp-Cage Mini-Protein Folding Studied by Molecular Dynamics Simulations

    PubMed Central

    Kannan, Srinivasaraghavan; Zacharias, Martin

    2014-01-01

    The 20 residue Trp-cage mini-protein is one of smallest proteins that adopt a stable folded structure containing also well-defined secondary structure elements. The hydrophobic core is arranged around a single central Trp residue. Despite several experimental and simulation studies the detailed folding mechanism of the Trp-cage protein is still not completely understood. Starting from fully extended as well as from partially folded Trp-cage structures a series of molecular dynamics simulations in explicit solvent and using four different force fields was performed. All simulations resulted in rapid collapse of the protein to on average relatively compact states. The simulations indicate a significant dependence of the speed of folding to near-native states on the side chain rotamer state of the central Trp residue. Whereas the majority of intermediate start structures with the central Trp side chain in a near-native rotameric state folded successfully within less than 100 ns only a fraction of start structures reached near-native folded states with an initially non-native Trp side chain rotamer state. Weak restraining of the Trp side chain dihedral angles to the state in the folded protein resulted in significant acceleration of the folding both starting from fully extended or intermediate conformations. The results indicate that the side chain conformation of the central Trp residue can create a significant barrier for controlling transitions to a near native folded structure. Similar mechanisms might be of importance for the folding of other protein structures. PMID:24563686

  6. Improved Modeling of Side-Chain–Base Interactions and Plasticity in Protein–DNA Interface Design

    PubMed Central

    Thyme, Summer B.; Baker, David; Bradley, Philip

    2012-01-01

    Combinatorial sequence optimization for protein design requires libraries of discrete side-chain conformations. The discreteness of these libraries is problematic, particularly for long, polar side chains, since favorable interactions can be missed. Previously, an approach to loop remodeling where protein backbone movement is directed by side-chain rotamers predicted to form interactions previously observed in native complexes (termed “motifs”) was described. Here, we show how such motif libraries can be incorporated into combinatorial sequence optimization protocols and improve native complex recapitulation. Guided by the motif rotamer searches, we made improvements to the underlying energy function, increasing recapitulation of native interactions. To further test the methods, we carried out a comprehensive experimental scan of amino acid preferences in the I-AniI protein–DNA interface and found that many positions tolerated multiple amino acids. This sequence plasticity is not observed in the computational results because of the fixed-backbone approximation of the model. We improved modeling of this diversity by introducing DNA flexibility and reducing the convergence of the simulated annealing algorithm that drives the design process. In addition to serving as a benchmark, this extensive experimental data set provides insight into the types of interactions essential to maintain the function of this potential gene therapy reagent. PMID:22426128

  7. Functional modulation of a protein folding landscape via side-chain distortion

    PubMed Central

    Kelch, Brian A.; Salimi, Neema L.; Agard, David A.

    2012-01-01

    Ultrahigh-resolution (< 1.0 Å) structures have revealed unprecedented and unexpected details of molecular geometry, such as the deformation of aromatic rings from planarity. However, the functional utility of such energetically costly strain is unknown. The 0.83 Å structure of α-lytic protease (αLP) indicated that residues surrounding a conserved Phe side-chain dictate a rotamer which results in a ∼6° distortion along the side-chain, estimated to cost 4 kcal/mol. By contrast, in the closely related protease Streptomyces griseus Protease B (SGPB), the equivalent Phe adopts a different rotamer and is undistorted. Here, we report that the αLP Phe side-chain distortion is both functional and conserved in proteases with large pro regions. Sequence analysis of the αLP serine protease family reveals a bifurcation separating those sequences expected to induce distortion and those that would not, which correlates with the extent of kinetic stability. Structural and folding kinetics analyses of family members suggest that distortion of this side-chain plays a role in increasing kinetic stability within the αLP family members that use a large Pro region. Additionally, structural and kinetic folding studies of mutants demonstrate that strain alters the folding free energy landscape by destabilizing the transition state (TS) relative to the native state (N). Although side-chain distortion comes at a cost of foldability, it suppresses the rate of unfolding, thereby enhancing kinetic stability and increasing protein longevity under harsh extracellular conditions. This ability of a structural distortion to enhance function is unlikely to be unique to αLP family members and may be relevant in other proteins exhibiting side-chain distortions. PMID:22635267

  8. Modeling side-chains using molecular dynamics improve recognition of binding region in CAPRI targets.

    PubMed

    Camacho, Carlos J

    2005-08-01

    The CAPRI-II experiment added an extra level of complexity to the problem of predicting protein-protein interactions by including 5 targets for which participants had to build or complete the 3-dimensional (3D) structure of either the receptor or ligand based on the structure of a close homolog. In this article, we describe how modeling key side-chains using molecular dynamics (MD) in explicit solvent improved the recognition of the binding region of a free energy- based computational docking method. In particular, we show that MD is able to predict with relatively high accuracy the rotamer conformation of the anchor side-chains important for molecular recognition as suggested by Rajamani et al. (Proc Natl Acad Sci USA 2004;101:11287-11292). As expected, the conformations are some of the most common rotamers for the given residue, while latch side-chains that undergo induced fit upon binding are forced into less common conformations. Using these models as starting conformations in conjunction with the rigid-body docking server ClusPro and the flexible docking algorithm SmoothDock, we produced valuable predictions for 6 of the 9 targets in CAPRI-II, missing only the 3 targets that underwent significant structural rearrangements upon binding. We also show that our free energy- based scoring function, consisting of the sum of van der Waals, Coulombic electrostatic with a distance-dependent dielectric, and desolvation free energy successfully discriminates the nativelike conformation of our submitted predictions. The latter emphasizes the critical role that thermodynamics plays on our methodology, and validates the generality of the algorithm to predict protein interactions.

  9. Simulation of spin label structure and its implication in molecular characterization

    PubMed Central

    Fajer, Piotr; Fajer, Mikolai; Zawrotny, Michael; Yang, Wei

    2016-01-01

    Interpretation of EPR from spin labels in terms of structure and dynamics requires knowledge of label behavior. General strategies were developed for simulation of labels used in EPR of proteins. The criteria for those simulations are: (a) exhaustive sampling of rotamer space; (b) consensus of results independent of starting points; (c) inclusion of entropy. These criteria are satisfied only when the number of transitions in any dihedral angle exceeds 100 and the simulation maintains thermodynamic equilibrium. Methods such as conventional MD do not efficiently cross energetic barriers, Simulated Annealing, Monte Carlo or popular Rotamer Library methodologies are potential energy based and ignore entropy (in addition to their specific shortcomings: environment fluctuations, fixed environment or electrostatics). Simulated Scaling method, avoids above flaws by modulating the forcefields between 0 (allowing crossing energy barriers) and full potential (sampling minima). Spin label diffuses on this surface while remaining in thermodynamic equilibrium. Simulations show that: (a) single conformation is rare, often there are 2–4 populated rotamers; (b) position of the NO varies up to 16Å. These results illustrate necessity for caution when interpreting EPR signals in terms of molecular structure. For example the 10–16Å distance change in DEER should not be interpreted as a large conformational change, it can well be a flip about Cα -Cβ bond. Rigorous exploration of possible rotamer structures of a spin label is paramount in signal interpretation. We advocate use of bifunctional labels, which motion is restricted 10,000-fold and the NO position is restricted to 2–5Å. PMID:26478501

  10. High-resolution protein design with backbone freedom.

    PubMed

    Harbury, P B; Plecs, J J; Tidor, B; Alber, T; Kim, P S

    1998-11-20

    Recent advances in computational techniques have allowed the design of precise side-chain packing in proteins with predetermined, naturally occurring backbone structures. Because these methods do not model protein main-chain flexibility, they lack the breadth to explore novel backbone conformations. Here the de novo design of a family of alpha-helical bundle proteins with a right-handed superhelical twist is described. In the design, the overall protein fold was specified by hydrophobic-polar residue patterning, whereas the bundle oligomerization state, detailed main-chain conformation, and interior side-chain rotamers were engineered by computational enumerations of packing in alternate backbone structures. Main-chain flexibility was incorporated through an algebraic parameterization of the backbone. The designed peptides form alpha-helical dimers, trimers, and tetramers in accord with the design goals. The crystal structure of the tetramer matches the designed structure in atomic detail.

  11. Rotamer-Specific Photoisomerization of Difluorostilbenes from Transient Absorption and Transient Raman Spectroscopy.

    PubMed

    Quick, M; Dobryakov, A L; Ioffe, I N; Berndt, F; Mahrwald, R; Ernsting, N P; Kovalenko, S A

    2018-01-25

    Photoisomerization of 2,2'-, 3,3'-, and 4,4'-difluorostilbene (F2, F3, F4, respectively) in n-hexane, perfluoro-n-hexane, and acetonitrile is studied with broadband transient absorption (TA) and femtosecond stimulated Raman (FSR) spectroscopy and by DFT/TDDFT calculations. F2 and F3 possess three rotamers (rotational isomers) each, while F4 has one single conformation only. These differences are reflected in TA and FSR spectra. Thus F4 reveals a monoexponential decay of TA with τ 1 = 172 ps in n-hexane, as expected for a single species. For F2 and F3, the decays are biexponential in all solvents, corresponding to two distinctly discerned rotamers or rotamer fractions. Specifically, for F2 in n-hexane, τ 1 = 357 ps (83%) and τ 2 = 62 ps (17%), and for F3 in the same solvent, τ 1 = 222 ps (57%), and τ 2 = 81 ps (43%). The weights in brackets agree with theoretically estimated ground-state abundances of the rotamers. Furthermore, a global fit of the TA and FSR data allows us to extract the spectra of the pure rotamers. The Raman spectra of S 0 and S 1 are in qualitative agreement with calculations.

  12. The role of side chain conformational flexibility in surface recognition by Tenebrio molitor antifreeze protein

    PubMed Central

    Daley, Margaret E.; Sykes, Brian D.

    2003-01-01

    Two-dimensional nuclear magnetic resonance spectroscopy was used to investigate the flexibility of the threonine side chains in the β-helical Tenebrio molitor antifreeze protein (TmAFP) at low temperatures. From measurement of the 3Jαβ 1H-1H scalar coupling constants, the χ1 angles and preferred rotamer populations can be calculated. It was determined that the threonines on the ice-binding face of the protein adopt a preferred rotameric conformation at near freezing temperatures, whereas the threonines not on the ice-binding face sample many rotameric states. This suggests that TmAFP maintains a preformed ice-binding conformation in solution, wherein the rigid array of threonines that form the AFP-ice interface matches the ice crystal lattice. A key factor in binding to the ice surface and inhibition of ice crystal growth appears to be the close surface-to-surface complementarity between the AFP and crystalline ice, and the lack of an entropic penalty associated with freezing out motions in a flexible ligand. PMID:12824479

  13. Automated side-chain model building and sequence assignment by template matching.

    PubMed

    Terwilliger, Thomas C

    2003-01-01

    An algorithm is described for automated building of side chains in an electron-density map once a main-chain model is built and for alignment of the protein sequence to the map. The procedure is based on a comparison of electron density at the expected side-chain positions with electron-density templates. The templates are constructed from average amino-acid side-chain densities in 574 refined protein structures. For each contiguous segment of main chain, a matrix with entries corresponding to an estimate of the probability that each of the 20 amino acids is located at each position of the main-chain model is obtained. The probability that this segment corresponds to each possible alignment with the sequence of the protein is estimated using a Bayesian approach and high-confidence matches are kept. Once side-chain identities are determined, the most probable rotamer for each side chain is built into the model. The automated procedure has been implemented in the RESOLVE software. Combined with automated main-chain model building, the procedure produces a preliminary model suitable for refinement and extension by an experienced crystallographer.

  14. Matrix isolation FT-IR and theoretical DFT/B3LYP spectrum of 1-naphthol.

    PubMed

    Muzomwe, Mayawila; Boeckx, Bram; Maes, Guido; Kasende, Okuma E

    2013-05-01

    The FT-IR spectrum of 1-Naphthol isolated in an argon matrix is performed and compared to the infrared spectra calculated at the DFT (B3LYP)/6-31+G(d) level for cis-1-Naphthol and trans-1-Naphthol rotamers in order to clarify the existence of both rotamers in the standard temperature. Comparison of the computed and the experimental matrix spectra reveals the presence in 1-Naphthol argon matrices in the standard temperature of both cis and trans rotameric forms of 1-Naphthol, the last predominating. The relative stability of the trans-1-Naphthol rotamer has also been supported by a fit comparison between the difference of predicted total energy (ETC) of both rotamers of 0.00195 a.u. corresponding to 5.12 kJ mol(-1) and the variation of the standard free Gibbs energy of rotamerization (ΔGr°) of 5.06 kJ mol(-1). Almost all 51 active vibrational modes of 1-Naphthol have been assigned. The stretching vibration of the OH group (νOH) appears to be the unique vibrational mode distinguishing the cis-1-NpOH rotamer from the trans-1-NpOH rotamer in FT-IR spectrum. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Exhaustive rotamer search of the 4C1 conformation of α- and β-d-galactopyranose.

    PubMed

    Del Vigo, Enrique A; Marino, Carla; Stortz, Carlos A

    2017-08-07

    An exhaustive search approach was used to establish all possible rotamers of α- and β-d-galactopyranose using DFT at the B3LYP/6-311+G** and M06-2X/6-311+G** levels, both in vacuum calculations, and including two variants of continuum solvent models as PCM and SMD to simulate water solutions. Free energies were also calculated. MM3 was used as the starting point for calculations, using a dielectric constant of 1.5 for vacuum modeling, and 80 for water solution modeling. For the vacuum calculations, out of the theoretically possible 729 rotamers, only about a hundred rendered stable minima, highly stabilized by hydrogen bonding and scattered in a ca. 14 kcal/mol span. The rotamer with a clockwise arrangement of hydrogen bonds was the most stable for the α-anomer, whereas that with a counterclockwise arrangement was the most stable for the β-anomer. Free energy calculations, and especially solvent modeling, tend to flatten the potential energy surface. With PCM, the total range of energies was reduced to 9-10 kcal/mol (α-anomer) or 7-8 kcal/mol (β-anomer). These figures fall to 4.5-6 kcal/mol using SMD. At the same time, the total number of possible rotamers increases dramatically to about 300 with PCM, and to 400 with SMD. Both models show a divergent behavior: PCM tends to underestimate the effect of solvent, thus rendering as the most stable many common rotamers with vacuum calculations, and giving underestimations of populations of β-anomers and gt rotamers in the equilibrium. On the other hand, SMD gives a better estimation of the solvent effect, yielding correct populations of gt rotamers, but more β-anomers than expected by the experimental values. The best agreement is observed when the functional M06-2X is combined with SMD. Both DFT models show minimal geometrical differences between the optimized conformers. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Structure of a designed, right-handed coiled-coil tetramer containing all biological amino acids

    PubMed Central

    Sales, Mark; Plecs, Joseph J.; Holton, James M.; Alber, Tom

    2007-01-01

    The previous design of an unprecedented family of two-, three-, and four-helical, right-handed coiled coils utilized nonbiological amino acids to efficiently pack spaces in the oligomer cores. Here we show that a stable, right-handed parallel tetrameric coiled coil, called RH4B, can be designed entirely using biological amino acids. The X-ray crystal structure of RH4B was determined to 1.1 Å resolution using a designed metal binding site to coordinate a single Yb2+ ion per 33-amino acid polypeptide chain. The resulting experimental phases were particularly accurate, and the experimental electron density map provided an especially clear, unbiased view of the molecule. The RH4B structure closely matched the design, with equivalent core rotamers and an overall root-mean-square deviation for the N-terminal repeat of the tetramer of 0.24 Å. The clarity and resolution of the electron density map, however, revealed alternate rotamers and structural differences between the three sequence repeats in the molecule. These results suggest that the RH4B structure populates an unanticipated variety of structures. PMID:17766380

  17. Structure of a designed, right-handed coiled-coil tetramer containing all biological amino acids.

    PubMed

    Sales, Mark; Plecs, Joseph J; Holton, James M; Alber, Tom

    2007-10-01

    The previous design of an unprecedented family of two-, three-, and four-helical, right-handed coiled coils utilized nonbiological amino acids to efficiently pack spaces in the oligomer cores. Here we show that a stable, right-handed parallel tetrameric coiled coil, called RH4B, can be designed entirely using biological amino acids. The X-ray crystal structure of RH4B was determined to 1.1 Angstrom resolution using a designed metal binding site to coordinate a single Yb(2+) ion per 33-amino acid polypeptide chain. The resulting experimental phases were particularly accurate, and the experimental electron density map provided an especially clear, unbiased view of the molecule. The RH4B structure closely matched the design, with equivalent core rotamers and an overall root-mean-square deviation for the N-terminal repeat of the tetramer of 0.24 Angstrom. The clarity and resolution of the electron density map, however, revealed alternate rotamers and structural differences between the three sequence repeats in the molecule. These results suggest that the RH4B structure populates an unanticipated variety of structures.

  18. Finding the global minimum: a fuzzy end elimination implementation

    NASA Technical Reports Server (NTRS)

    Keller, D. A.; Shibata, M.; Marcus, E.; Ornstein, R. L.; Rein, R.

    1995-01-01

    The 'fuzzy end elimination theorem' (FEE) is a mathematically proven theorem that identifies rotameric states in proteins which are incompatible with the global minimum energy conformation. While implementing the FEE we noticed two different aspects that directly affected the final results at convergence. First, the identification of a single dead-ending rotameric state can trigger a 'domino effect' that initiates the identification of additional rotameric states which become dead-ending. A recursive check for dead-ending rotameric states is therefore necessary every time a dead-ending rotameric state is identified. It is shown that, if the recursive check is omitted, it is possible to miss the identification of some dead-ending rotameric states causing a premature termination of the elimination process. Second, we examined the effects of removing dead-ending rotameric states from further considerations at different moments of time. Two different methods of rotameric state removal were examined for an order dependence. In one case, each rotamer found to be incompatible with the global minimum energy conformation was removed immediately following its identification. In the other, dead-ending rotamers were marked for deletion but retained during the search, so that they influenced the evaluation of other rotameric states. When the search was completed, all marked rotamers were removed simultaneously. In addition, to expand further the usefulness of the FEE, a novel method is presented that allows for further reduction in the remaining set of conformations at the FEE convergence. In this method, called a tree-based search, each dead-ending pair of rotamers which does not lead to the direct removal of either rotameric state is used to reduce significantly the number of remaining conformations. In the future this method can also be expanded to triplet and quadruplet sets of rotameric states. We tested our implementation of the FEE by exhaustively searching ten protein segments and found that the FEE identified the global minimum every time. For each segment, the global minimum was exhaustively searched in two different environments: (i) the segments were extracted from the protein and exhaustively searched in the absence of the surrounding residues; (ii) the segments were exhaustively searched in the presence of the remaining residues fixed at crystal structure conformations. We also evaluated the performance of the method for accurately predicting side chain conformations. We examined the influence of factors such as type and accuracy of backbone template used, and the restrictions imposed by the choice of potential function, parameterization and rotamer database. Conclusions are drawn on these results and future prospects are given.

  19. Effect of Freezing Conditions on Distances and Their Distributions Derived from Double Electron Electron Resonance (DEER): A Study of Doubly-Spin-Labeled T4 Lysozyme

    PubMed Central

    Georgieva, Elka R.; Roy, Aritro S.; Grigoryants, Vladimir M.; Borbat, Petr P.; Earle, Keith A.; Scholes, Charles P.; Freed, Jack H.

    2012-01-01

    Pulsed dipolar ESR spectroscopy, DEER and DQC, require frozen samples. An important issue in the biological application of this technique is how the freezing rate and concentration of cryoprotectant could possibly affect the conformation of biomacromolecule and/or spin-label. We studied in detail the effect of these experimental variables on the distance distributions obtained by DEER from a series of doubly spin-labeled T4 lysozyme mutants. We found that the rate of sample freezing affects mainly the ensemble of spin-label rotamers, but the distance maxima remain essentially unchanged. This suggests that proteins frozen in a regular manner in liquid nitrogen faithfully maintain the distance-dependent structural properties in solution. We compared the results from rapidly freeze-quenched (≤100 μs) samples to those from commonly shock-frozen (slow freeze, 1s or longer) samples. For all the mutants studied we obtained inter-spin distance distributions, which were broader for rapidly frozen samples than for slowly frozen ones. We infer that rapid freezing trapped a larger ensemble of spin label rotamers; whereas, on the time-scale of slower freezing the protein and spin-label achieve a population showing fewer low-energy conformers. We used glycerol as a cryoprotectant in concentrations of 10% and 30% by weight. With 10% glycerol and slow freezing, we observed an increased slope of background signals, which in DEER is related to increased local spin concentration, in this case due to insufficient solvent vitrification, and therefore protein aggregation. This effect was considerably suppressed in slowly frozen samples containing 30% glycerol and rapidly frozen samples containing 10% glycerol. The assignment of bimodal distributions to tether rotamers as opposed to protein conformations is aided by comparing results using MTSL and 4-Bromo MTSL spin-labels. The latter usually produce narrower distance distributions. PMID:22341208

  20. Unifying the microscopic picture of His-containing turns: from gas phase model peptides to crystallized proteins.

    PubMed

    Sohn, Woon Yong; Habka, Sana; Gloaguen, Eric; Mons, Michel

    2017-07-14

    The presence in crystallized proteins of a local anchoring between the side chain of a His residue, located in the central position of a γ- or β-turn, and its local main chain environment, was assessed by the comparison of protein structures with relevant isolated model peptides. Gas phase laser spectroscopy, combined with relevant quantum chemistry methods, was used to characterize the γ- and β-turn structures in these model peptides. A conformer-selective NH stretch infrared study provided evidence for the formation in vacuo of two types of short-range H-bonded motifs, labelled ε-6 δ and δ- δ 7/π H , bridging the His side chain (in its gauche+ rotamer) to the neighbouring NH(i) and CO(i) sites of the backbone; each side chain-backbone motif was found to be specific of the tautomer (ε or δ) adopted by the His side chain in its neutral form. A close comparison between β- and γ-turns, selected from the Protein Data Bank, and the gas phase models demonstrated that a significant proportion of the gauche+ His rotamer distribution of proteins was well described by the corresponding gas phase H-bonded structures. This is consistent with the persistence of local 6 δ and δ 7/π H intramolecular interactions in proteins, emphasizing the relevance of gas phase data to secondary structures that are poorly accessible to solvents, e.g., in the case of a specific compact topology (Xxx-His β-turns). Deviations from the gas phase structures were also observed, mainly in His-Xxx β-turns, and assigned to solvent accessible turn structures. They were well accounted for by theoretical models of microhydrated turns, in which a few solvent molecules take over the gas phase motifs, constituting a water-mediated local anchoring of the His side chain to the backbone. Finally, the present gas phase benchmark models also pinpointed weaknesses in the protein structure determination by X-ray diffraction analysis; in particular, besides the lack of tautomer information, inaccuracies in the description of imidazole ring flip rotamerism were identified.

  1. Acid-base titration of melanocortin peptides: evidence of Trp rotational conformers interconversion.

    PubMed

    Fernandez, Roberto M; Vieira, Renata F F; Nakaie, Clóvis R; Lamy, M Teresa; Ito, Amando S

    2005-01-01

    Tryptophantime-resolved fluorescence was used to monitor acid-base titration properties of alpha-melanocyte stimulating hormone (alpha-MSH) and the biologically more potent analog [Nle4, D-Phe7]alpha -MSH (NDP-MSH), labeled or not with the paramagnetic amino acid probe 2,2,6,6-tetramthylpiperidine-N-oxyl-4-amino-4-carboxylic acid (Toac). Global analysis of fluorescence decay profiles measured in the pH range between 2.0 and 11.0 showed that, for each peptide, the data could be well fitted to three lifetimes whose values remained constant. The less populated short lifetime component changed little with pH and was ascribed to Trp g+ chi1 rotamer, in which electron transfer deactivation predominates over fluorescence. The long and intermediate lifetime preexponential factors interconverted along that pH interval and the result was interpreted as due to interconversion between Trp g- and trans chi1 rotamers, driven by conformational changes promoted by modifications in the ionization state of side-chain residues. The differences in the extent of interconversion in alpha-MSH and NDP-MSH are indicative of structural differences between the peptides, while titration curves suggest structural similarities between each peptide and its Toac-labeled species, in aqueous solution. Though less sensitive than fluorescence, the Toac electron spin resonance (ESR) isotropic hyperfine splitting parameter can also monitor the titration of side-chain residues located relatively far from the probe. Copyright (c) 2005 Wiley Periodicals, Inc.

  2. Reactive intermediates in 4He nanodroplets: Infrared laser Stark spectroscopy of dihydroxycarbene

    NASA Astrophysics Data System (ADS)

    Broderick, Bernadette M.; McCaslin, Laura; Moradi, Christopher P.; Stanton, John F.; Douberly, Gary E.

    2015-04-01

    Singlet dihydroxycarbene ( HO C ̈ OH ) is produced via pyrolytic decomposition of oxalic acid, captured by helium nanodroplets, and probed with infrared laser Stark spectroscopy. Rovibrational bands in the OH stretch region are assigned to either trans,trans- or trans,cis-rotamers on the basis of symmetry type, nuclear spin statistical weights, and comparisons to electronic structure theory calculations. Stark spectroscopy provides the inertial components of the permanent electric dipole moments for these rotamers. The dipole components for trans, trans- and trans, cis-rotamers are (μa, μb) = (0.00, 0.68(6)) and (1.63(3), 1.50(5)), respectively. The infrared spectra lack evidence for the higher energy cis,cis-rotamer, which is consistent with a previously proposed pyrolytic decomposition mechanism of oxalic acid and computations of HO C ̈ OH torsional interconversion and tautomerization barriers.

  3. Reactive intermediates in 4He nanodroplets: Infrared laser Stark spectroscopy of dihydroxycarbene

    DOE PAGES

    Broderick, Bernadette M.; McCaslin, Laura; Moradi, Christopher P.; ...

    2015-04-14

    Singlet dihydroxycarbene (HOmore » $$\\ddot C$$OH) is produced via pyrolytic decomposition of oxalic acid, captured by helium nanodroplets, and probed with infrared laser Stark spectroscopy. Rovibrational bands in the OH stretch region are assigned to either trans, trans-or trans, cis-rotamers on the basis of symmetry type, nuclear spin statistical weights, and comparisons to electronic structure theory calculations. Stark spectroscopy provides the inertial components of the permanent electric dipole moments for these rotamers. The dipole components for trans, trans-and trans, cis-rotamers are (μ a, μ b) = (0.00,0.68(6)) and (1.63(3), 1.50(5)), respectively. The infrared spectra lack evidence for the higher energy cis,cis-rotamer, which is consistent with a previously proposed pyrolytic decomposition mechanism of oxalic acid and computations of HO$$\\ddot C$$OH torsional interconversion and tautomerization barriers.« less

  4. Simulation vs. Reality: A Comparison of In Silico Distance Predictions with DEER and FRET Measurements

    PubMed Central

    Klose, Daniel; Klare, Johann P.; Grohmann, Dina; Kay, Christopher W. M.; Werner, Finn; Steinhoff, Heinz-Jürgen

    2012-01-01

    Site specific incorporation of molecular probes such as fluorescent- and nitroxide spin-labels into biomolecules, and subsequent analysis by Förster resonance energy transfer (FRET) and double electron-electron resonance (DEER) can elucidate the distance and distance-changes between the probes. However, the probes have an intrinsic conformational flexibility due to the linker by which they are conjugated to the biomolecule. This property minimizes the influence of the label side chain on the structure of the target molecule, but complicates the direct correlation of the experimental inter-label distances with the macromolecular structure or changes thereof. Simulation methods that account for the conformational flexibility and orientation of the probe(s) can be helpful in overcoming this problem. We performed distance measurements using FRET and DEER and explored different simulation techniques to predict inter-label distances using the Rpo4/7 stalk module of the M. jannaschii RNA polymerase. This is a suitable model system because it is rigid and a high-resolution X-ray structure is available. The conformations of the fluorescent labels and nitroxide spin labels on Rpo4/7 were modeled using in vacuo molecular dynamics simulations (MD) and a stochastic Monte Carlo sampling approach. For the nitroxide probes we also performed MD simulations with explicit water and carried out a rotamer library analysis. Our results show that the Monte Carlo simulations are in better agreement with experiments than the MD simulations and the rotamer library approach results in plausible distance predictions. Because the latter is the least computationally demanding of the methods we have explored, and is readily available to many researchers, it prevails as the method of choice for the interpretation of DEER distance distributions. PMID:22761805

  5. Multivariate Analyses of Quality Metrics for Crystal Structures in the PDB Archive.

    PubMed

    Shao, Chenghua; Yang, Huanwang; Westbrook, John D; Young, Jasmine Y; Zardecki, Christine; Burley, Stephen K

    2017-03-07

    Following deployment of an augmented validation system by the Worldwide Protein Data Bank (wwPDB) partnership, the quality of crystal structures entering the PDB has improved. Of significance are improvements in quality measures now prominently displayed in the wwPDB validation report. Comparisons of PDB depositions made before and after introduction of the new reporting system show improvements in quality measures relating to pairwise atom-atom clashes, side-chain torsion angle rotamers, and local agreement between the atomic coordinate structure model and experimental electron density data. These improvements are largely independent of resolution limit and sample molecular weight. No significant improvement in the quality of associated ligands was observed. Principal component analysis revealed that structure quality could be summarized with three measures (Rfree, real-space R factor Z score, and a combined molecular geometry quality metric), which can in turn be reduced to a single overall quality metric readily interpretable by all PDB archive users. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. A combinatorial approach to protein docking with flexible side chains.

    PubMed

    Althaus, Ernst; Kohlbacher, Oliver; Lenhof, Hans-Peter; Müller, Peter

    2002-01-01

    Rigid-body docking approaches are not sufficient to predict the structure of a protein complex from the unbound (native) structures of the two proteins. Accounting for side chain flexibility is an important step towards fully flexible protein docking. This work describes an approach that allows conformational flexibility for the side chains while keeping the protein backbone rigid. Starting from candidates created by a rigid-docking algorithm, we demangle the side chains of the docking site, thus creating reasonable approximations of the true complex structure. These structures are ranked with respect to the binding free energy. We present two new techniques for side chain demangling. Both approaches are based on a discrete representation of the side chain conformational space by the use of a rotamer library. This leads to a combinatorial optimization problem. For the solution of this problem, we propose a fast heuristic approach and an exact, albeit slower, method that uses branch-and-cut techniques. As a test set, we use the unbound structures of three proteases and the corresponding protein inhibitors. For each of the examples, the highest-ranking conformation produced was a good approximation of the true complex structure.

  7. Repacking the Core of T4 lysozyme by automated design.

    PubMed

    Mooers, Blaine H M; Datta, Deepshikha; Baase, Walter A; Zollars, Eric S; Mayo, Stephen L; Matthews, Brian W

    2003-09-19

    Automated protein redesign, as implemented in the program ORBIT, was used to redesign the core of phage T4 lysozyme. A total of 26 buried or partially buried sites in the C-terminal domain were allowed to vary both their sequence and side-chain conformation while the backbone and non-selected side-chains remained fixed. A variant with seven substitutions ("Core-7") was identified as having the most favorable energy. The redesign experiment was repeated with a penalty for the presence of methionine residues. In this case the redesigned protein ("Core-10") had ten amino acid changes. The two designed proteins, as well as the constituent single mutants, and several single-site revertants were over-expressed in Escherichia coli, purified, and subjected to crystallographic and thermal analyses. The thermodynamic and structural data show that some repacking was achieved although neither redesigned protein was more stable than the wild-type protein. The use of the methionine penalty was shown to be effective. Several of the side-chain rotamers in the predicted structure of Core-10 differ from those observed. Rather than changing to new rotamers predicted by the design process, side-chains tend to maintain conformations similar to those seen in the native molecule. In contrast, parts of the backbone change by up to 2.8A relative to both the designed structure and wild-type. Water molecules that are present within the lysozyme molecule were removed during the design process. In the redesigned protein the resultant cavities were, to some degree, re-occupied by side-chain atoms. In the observed structure, however, water molecules were still bound at or near their original sites. This suggests that it may be preferable to leave such water molecules in place during the design procedure. The results emphasize the specificity of the packing that occurs within the core of a typical protein. While point substitutions within the core are tolerated they almost always result in a loss of stability. Likewise, combinations of substitutions may also be tolerated but usually destabilize the protein. Experience with T4 lysozyme suggests that a general core repacking methodology with retention or enhancement of stability may be difficult to achieve without provision for shifts in the backbone.

  8. Scoring of Side-Chain Packings: An Analysis of Weight Factors and Molecular Dynamics Structures.

    PubMed

    Colbes, Jose; Aguila, Sergio A; Brizuela, Carlos A

    2018-02-26

    The protein side-chain packing problem (PSCPP) is a central task in computational protein design. The problem is usually modeled as a combinatorial optimization problem, which consists of searching for a set of rotamers, from a given rotamer library, that minimizes a scoring function (SF). The SF is a weighted sum of terms, that can be decomposed in physics-based and knowledge-based terms. Although there are many methods to obtain approximate solutions for this problem, all of them have similar performances and there has not been a significant improvement in recent years. Studies on protein structure prediction and protein design revealed the limitations of current SFs to achieve further improvements for these two problems. In the same line, a recent work reported a similar result for the PSCPP. In this work, we ask whether or not this negative result regarding further improvements in performance is due to (i) an incorrect weighting of the SFs terms or (ii) the constrained conformation resulting from the protein crystallization process. To analyze these questions, we (i) model the PSCPP as a bi-objective combinatorial optimization problem, optimizing, at the same time, the two most important terms of two SFs of state-of-the-art algorithms and (ii) performed a preprocessing relaxation of the crystal structure through molecular dynamics to simulate the protein in the solvent and evaluated the performance of these two state-of-the-art SFs under these conditions. Our results indicate that (i) no matter what combination of weight factors we use the current SFs will not lead to better performances and (ii) the evaluated SFs will not be able to improve performance on relaxed structures. Furthermore, the experiments revealed that the SFs and the methods are biased toward crystallized structures.

  9. Entropy and enthalpy of interaction between amino acid side chains in nanopores

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vaitheeswaran, S., E-mail: vaithee05@gmail.com; Thirumalai, D.; Department of Chemistry and Biochemistry, University of Maryland, College Park, Maryland 20742

    2014-12-14

    Understanding the stabilities of proteins in nanopores requires a quantitative description of confinement induced interactions between amino acid side chains. We use molecular dynamics simulations to study the nature of interactions between the side chain pairs ALA-PHE, SER-ASN, and LYS-GLU in bulk water and in water-filled nanopores. The temperature dependence of the bulk solvent potentials of mean force and the interaction free energies in cylindrical and spherical nanopores is used to identify the corresponding entropic and enthalpic components. The entropically stabilized hydrophobic interaction between ALA and PHE in bulk water is enthalpically dominated upon confinement depending on the relative orientationsmore » between the side chains. In the case of SER-ASN, hydrogen bonded configurations that are similar in bulk water are thermodynamically distinct in a cylindrical pore, thus making rotamer distributions different from those in the bulk. Remarkably, salt bridge formation between LYS-GLU is stabilized by entropy in contrast to the bulk. Implications of our findings for confinement-induced alterations in protein stability are briefly outlined.« less

  10. Systematic and efficient side chain optimization for molecular docking using a cheapest-path procedure.

    PubMed

    Schumann, Marcel; Armen, Roger S

    2013-05-30

    Molecular docking of small-molecules is an important procedure for computer-aided drug design. Modeling receptor side chain flexibility is often important or even crucial, as it allows the receptor to adopt new conformations as induced by ligand binding. However, the accurate and efficient incorporation of receptor side chain flexibility has proven to be a challenge due to the huge computational complexity required to adequately address this problem. Here we describe a new docking approach with a very fast, graph-based optimization algorithm for assignment of the near-optimal set of residue rotamers. We extensively validate our approach using the 40 DUD target benchmarks commonly used to assess virtual screening performance and demonstrate a large improvement using the developed side chain optimization over rigid receptor docking (average ROC AUC of 0.693 vs. 0.623). Compared to numerous benchmarks, the overall performance is better than nearly all other commonly used procedures. Furthermore, we provide a detailed analysis of the level of receptor flexibility observed in docking results for different classes of residues and elucidate potential avenues for further improvement. Copyright © 2013 Wiley Periodicals, Inc.

  11. Biological and Structural Characterization of Rotamers of C-C Chemokine Receptor Type 5 (CCR5) Inhibitor GSK214096.

    PubMed

    Kazmierski, Wieslaw M; Danehower, Susan; Duan, Maosheng; Ferris, Robert G; Elitzin, Vassil; Minick, Douglas; Sharp, Matthew; Stewart, Eugene; Villeneuve, Manon

    2014-12-11

    We recently reported the discovery of preclinical CCR5 inhibitor GSK214096, 1 (J. Med. Chem. 2011, 54, 756). Detailed characterization of 1 revealed that it exists as a mixture of four separable atropisomers A-D. The two slow-interconverting pairs of rotamers A + B and C + D were separated and further characterized. HIV and CCR5-mediated chemotaxis data strongly suggest that the antiviral potency of 1 is due to rotamers A + B and not C + D. Furthermore, integrated UV, vibrational circular dichroism VCD and computational approach allowed to determine the M chirality in C + D (and P chirality in A + B). These findings imply additional avenues to be pursued toward new CCR5 antagonists.

  12. Direct Determination of Site-Specific Noncovalent Interaction Strengths of Proteins from NMR-Derived Fast Side Chain Motional Parameters.

    PubMed

    Rajeshwar T, Rajitha; Krishnan, Marimuthu

    2017-05-25

    A novel approach to accurately determine residue-specific noncovalent interaction strengths (ξ) of proteins from NMR-measured fast side chain motional parameters (O axis 2 ) is presented. By probing the environmental sensitivity of side chain conformational energy surfaces of individual residues of a diverse set of proteins, the microscopic connections between ξ, O axis 2 , conformational entropy (S conf ), conformational barriers, and rotamer stabilities established here are found to be universal among proteins. The results reveal that side chain flexibility and conformational entropy of each residue decrease with increasing ξ and that for each residue type there exists a critical range of ξ, determined primarily by the mean side chain conformational barriers, within which flexibility of any residue can be reversibly tuned from highly flexible (with O axis 2 ∼ 0) to highly restricted (with O axis 2 ∼ 1) by increasing ξ by ∼3 kcal/mol. Beyond this critical range of ξ, both side chain flexibility and conformational entropy are insensitive to ξ. The interrelationships between conformational dynamics, conformational entropy, and noncovalent interactions of protein side chains established here open up new avenues to probe perturbation-induced (for example, ligand-binding, temperature, pressure) changes in fast side chain dynamics and thermodynamics of proteins by comparing their conformational energy surfaces in the native and perturbed states.

  13. Conformational isomerism of phenolic procyanidins: preferred conformations in organic solvents and water

    Treesearch

    Tsutomu Hatano; Richard W. Hemingway

    1997-01-01

    NMR studies of catechin-{4α→8)-epicatechin (I) and catechin-{4α→8)-catechin (2) provided complete assignment of the proton and carbon resonances for both the more extended and compact conformers in the free phenolic form. When 1 is in organic solvents, the more extended rotamer is preferred over the more compact rotamer (10:7), but...

  14. 3d interaction homology: The structurally known rotamers of tyrosine derive from a surprisingly limited set of information-rich hydropathic interaction environments described by maps.

    PubMed

    Ahmed, Mostafa H; Koparde, Vishal N; Safo, Martin K; Neel Scarsdale, J; Kellogg, Glen E

    2015-06-01

    Sidechain rotamer libraries are obtained through exhaustive statistical analysis of existing crystallographic structures of proteins and have been applied in multiple aspects of structural biology, for example, crystallography of relatively low-resolution structures, in homology model building and in biomolecular NMR. Little is known, however, about the driving forces that lead to the preference or suitability of one rotamer over another. Construction of 3D hydropathic interaction maps for nearly 30,000 tyrosines reveals the environment around each, in terms of hydrophobic (π-π stacking, etc.) and polar (hydrogen bonding, etc.) interactions. After partitioning the tyrosines into backbone-dependent (ϕ, ψ) bins, a map similarity metric based on the correlation coefficient was applied to each map-map pair to build matrices suitable for clustering with k-means. The first bin (-200° ≤ ϕ < -155°; -205° ≤ ψ < -160°), representing 631 tyrosines, reduced to 14 unique hydropathic environments, with most diversity arising from favorable hydrophobic interactions with many different residue partner types. Polar interactions for tyrosine include surprisingly ubiquitous hydrogen bonding with the phenolic OH and a handful of unique environments surrounding the tyrosine backbone. The memberships of all but one of the 14 environments are dominated (>50%) by a single χ(1)/χ(2) rotamer. The last environment has weak or no interactions with the tyrosine ring and its χ(1)/χ(2) rotamer is indeterminate, which is consistent with it being composed of mostly surface residues. Each tyrosine residue attempts to fulfill its hydropathic valence and thus, structural water molecules are seen in a variety of roles throughout protein structure. © 2015 Wiley Periodicals, Inc.

  15. Improved side-chain torsion potentials for the Amber ff99SB protein force field

    PubMed Central

    Lindorff-Larsen, Kresten; Piana, Stefano; Palmo, Kim; Maragakis, Paul; Klepeis, John L; Dror, Ron O; Shaw, David E

    2010-01-01

    Recent advances in hardware and software have enabled increasingly long molecular dynamics (MD) simulations of biomolecules, exposing certain limitations in the accuracy of the force fields used for such simulations and spurring efforts to refine these force fields. Recent modifications to the Amber and CHARMM protein force fields, for example, have improved the backbone torsion potentials, remedying deficiencies in earlier versions. Here, we further advance simulation accuracy by improving the amino acid side-chain torsion potentials of the Amber ff99SB force field. First, we used simulations of model alpha-helical systems to identify the four residue types whose rotamer distribution differed the most from expectations based on Protein Data Bank statistics. Second, we optimized the side-chain torsion potentials of these residues to match new, high-level quantum-mechanical calculations. Finally, we used microsecond-timescale MD simulations in explicit solvent to validate the resulting force field against a large set of experimental NMR measurements that directly probe side-chain conformations. The new force field, which we have termed Amber ff99SB-ILDN, exhibits considerably better agreement with the NMR data. Proteins 2010. © 2010 Wiley-Liss, Inc. PMID:20408171

  16. MCCE analysis of the pKas of introduced buried acids and bases in staphylococcal nuclease.

    PubMed

    Gunner, M R; Zhu, Xuyu; Klein, Max C

    2011-12-01

    The pK(a)s of 96 acids and bases introduced into buried sites in the staphylococcal nuclease protein (SNase) were calculated using the multiconformation continuum electrostatics (MCCE) program and the results compared with experimental values. The pK(a)s are obtained by Monte Carlo sampling of coupled side chain protonation and position as a function of pH. The dependence of the results on the protein dielectric constant (ε(prot)) in the continuum electrostatics analysis and on the Lennard-Jones non-electrostatics parameters was evaluated. The pK(a)s of the introduced residues have a clear dependence on ε(prot,) whereas native ionizable residues do not. The native residues have electrostatic interactions with other residues in the protein favoring ionization, which are larger than the desolvation penalty favoring the neutral state. Increasing ε(prot) scales both terms, which for these residues leads to small changes in pK(a). The introduced residues have a larger desolvation penalty and negligible interactions with residues in the protein. For these residues, changing ε(prot) has a large influence on the calculated pK(a). An ε(prot) of 8-10 and a Lennard-Jones scaling of 0.25 is best here. The X-ray crystal structures of the mutated proteins are found to provide somewhat better results than calculations carried out on mutations made in silico. Initial relaxation of the in silico mutations by Gromacs and extensive side chain rotamer sampling within MCCE can significantly improve the match with experiment. Copyright © 2011 Wiley-Liss, Inc.

  17. NMSim web server: integrated approach for normal mode-based geometric simulations of biologically relevant conformational transitions in proteins.

    PubMed

    Krüger, Dennis M; Ahmed, Aqeel; Gohlke, Holger

    2012-07-01

    The NMSim web server implements a three-step approach for multiscale modeling of protein conformational changes. First, the protein structure is coarse-grained using the FIRST software. Second, a rigid cluster normal-mode analysis provides low-frequency normal modes. Third, these modes are used to extend the recently introduced idea of constrained geometric simulations by biasing backbone motions of the protein, whereas side chain motions are biased toward favorable rotamer states (NMSim). The generated structures are iteratively corrected regarding steric clashes and stereochemical constraint violations. The approach allows performing three simulation types: unbiased exploration of conformational space; pathway generation by a targeted simulation; and radius of gyration-guided simulation. On a data set of proteins with experimentally observed conformational changes, the NMSim approach has been shown to be a computationally efficient alternative to molecular dynamics simulations for conformational sampling of proteins. The generated conformations and pathways of conformational transitions can serve as input to docking approaches or more sophisticated sampling techniques. The web server output is a trajectory of generated conformations, Jmol representations of the coarse-graining and a subset of the trajectory and data plots of structural analyses. The NMSim webserver, accessible at http://www.nmsim.de, is free and open to all users with no login requirement.

  18. Selected cis- and trans-3-fluorostyrene rotamers studied by two-color resonant two-photon mass-analyzed threshold ionization spectroscopy

    NASA Astrophysics Data System (ADS)

    Wu, Pei Ying; Tzeng, Wen Bih

    2015-10-01

    We applied two-color resonant two-photon ionization and mass-analyzed threshold ionization techniques to record the vibronic, photoionization efficiency, and cation spectra of the selected rotamers of 3-fluorostyrene. The adiabatic ionization energies of cis- and trans-3-fluorostyrene were determined to be 69 960 ± 5 and 69 856 ± 5 cm-1, respectively. Cation vibrations 10a, 15, 6b, and 12 of both rotamers have been found to have frequencies of 218, 404, 452, and 971 cm-1, respectively. This finding shows that the relative orientation of the vinyl group with respect to the F atom does not affect these vibrations of the 3-fluorostyrene cation. Our one-dimensional potential energy surface calculations support that the cis-trans isomerization of 3-fluorostyrene does not occur under the present experimental conditions.

  19. Mimicry by asx- and ST-turns of the four main types of beta-turn in proteins.

    PubMed

    Duddy, William J; Nissink, J Willem M; Allen, Frank H; Milner-White, E James

    2004-11-01

    Hydrogen-bonded beta-turns in proteins occur in four categories: type I (the most common), type II, type II', and type I'. Asx-turns resemble beta-turns, in that both have an NH. . .OC hydrogen bond forming a ring of 10 atoms. Serine and threonine side chains also commonly form hydrogen-bonded turns, here called ST-turns. Asx-turns and ST-turns can be categorized into four classes, based on side chain rotamers and the conformation of the central turn residue, which are geometrically equivalent to the four types of beta-turns. We propose asx- and ST-turns be named using the type I, II, I', and II' beta-turn nomenclature. Using this, the frequency of occurrence of both asx- and ST-turns is: type II' > type I > type II > type I', whereas for beta-turns it is type I > type II > type I' > type II'. Almost all type II asx-turns occur as a recently described three residue feature named an asx-nest.

  20. Mimicry by asx- and ST-turns of the four main types of β-turn in proteins

    PubMed Central

    Duddy, William J.; Nissink, J. Willem M.; Allen, Frank H.; Milner-White, E. James

    2004-01-01

    Hydrogen-bonded β-turns in proteins occur in four categories: type I (the most common), type II, type II’, and type I’. Asx-turns resemble β-turns, in that both have an NH. . .OC hydrogen bond forming a ring of 10 atoms. Serine and threonine side chains also commonly form hydrogen-bonded turns, here called ST-turns. Asx-turns and ST-turns can be categorized into four classes, based on side chain rotamers and the conformation of the central turn residue, which are geometrically equivalent to the four types of β-turns. We propose asx- and ST-turns be named using the type I, II, I’, and II’ β-turn nomenclature. Using this, the frequency of occurrence of both asx- and ST-turns is: type II’ > type I > type II > type I’, whereas for β-turns it is type I > type II > type I’ > type II’. Almost all type II asx-turns occur as a recently described three residue feature named an asx-nest. PMID:15459339

  1. The role of tachysterol in vitamin D photosynthesis - a non-adiabatic molecular dynamics study

    NASA Astrophysics Data System (ADS)

    Cisneros, Cecilia; Thompson, Travis; Baluyot, Noel; Smith, Adam C.; Tapavicza, Enrico

    To investigate the role of tachysterol in the photophysical/chemical regulation of vitamin D photosynthesis, we studied its electronic absorption properties and excited state dynamics using time-dependent density functional theory (TDDFT), coupled cluster theory (CC2), and non-adiabatic molecular dynamics. In excellent agreement with experiments, the simulated electronic spectrum shows a broad absorption band covering the spectra of the other vitamin D photoisomers. The broad band stems from the spectral overlap of four different ground state rotamers. After photoexcitation, the first excited singlet state (S1) decays within 882 fs. The S1 dynamics is characterized by a strong twisting of the central double bond. 96% of all trajectories relax without chemical transformation to the ground state. In 2.3 % of the trajectories we observed [1,5]-sigmatropic hydrogen shift forming the partly deconjugated toxisterol D1. 1.4 % previtamin D formation is observed via hula-twist double bond isomerization. We find a strong dependence between photoreactivity and dihedral angle conformation: hydrogen shift only occurs in cEc and cEt rotamers and double bond isomerization occurs mainly in cEc rotamers. Our study confirms the hypothesis that cEc rotamers are more prone to previtamin D formation than other isomers. We also observe the formation of a cyclobutene-toxisterol in the hot ground state (0.7 %). Due to its strong absorption and unreactive behavior, tachysterol acts mainly as a sun shield suppressing previtamin D formation. Tachysterol shows stronger toxisterol formation than previtamin D. Absorption of low energy UV light by the cEc rotamer can lead to previtamin D formation. Our study reinforces a recent hypothesis that tachysterol can act as a previtamin D source when only low energy ultraviolet light is available, as it is the case in winter or in the morning and evening hours of the day.

  2. Investigating the ground-state rotamers of n-propylperoxy radical.

    PubMed

    Hoobler, Preston R; Turney, Justin M; Schaefer, Henry F

    2016-11-07

    The n-propylperoxy radical has been described as a molecule of critical importance to studies of low temperature combustion. Ab initio methods were used to study this three-carbon alkylperoxy radical, normal propylperoxy. Reliable CCSD(T) (coupled-cluster theory, incorporating single, double, and perturbative triple)/ANO0 geometries were predicted for the molecule's five rotamers. For each rotamer, energetic predictions were made using basis sets as large as the cc-pV5Z in conjunction with coupled cluster levels of theory up to CCSDT(Q). Along with the extrapolations, corrections for relativistic effects, zero-point vibrational energies, and diagonal Born-Oppenheimer corrections were used to further refine energies. The results indicate that the lowest conformer is the gauche-gauche (GG) rotamer followed by the gauche-trans (0.12 kcal mol -1 above GG), trans-gauche (0.44 kcal mol -1 ), gauche'-gauche (0.47 kcal mol -1 ), and trans-trans (0.57 kcal mol -1 ). Fundamental vibrational frequencies were obtained using second-order vibrational perturbation theory. This is the first time anharmonic frequencies have been computed for this system. The most intense IR features include all but one of the C-H stretches. The O-O fundamental (1063 cm -1 for the GG structure) also has a significant IR intensity, 19.6 km mol -1 . The anharmonicity effects on the potential energy surface were also used to compute vibrationally averaged r g,0K bond lengths, accounting for zero-point vibrations present within the molecule.

  3. Investigating the ground-state rotamers of n-propylperoxy radical

    NASA Astrophysics Data System (ADS)

    Hoobler, Preston R.; Turney, Justin M.; Schaefer, Henry F.

    2016-11-01

    The n-propylperoxy radical has been described as a molecule of critical importance to studies of low temperature combustion. Ab initio methods were used to study this three-carbon alkylperoxy radical, normal propylperoxy. Reliable CCSD(T) (coupled-cluster theory, incorporating single, double, and perturbative triple)/ANO0 geometries were predicted for the molecule's five rotamers. For each rotamer, energetic predictions were made using basis sets as large as the cc-pV5Z in conjunction with coupled cluster levels of theory up to CCSDT(Q). Along with the extrapolations, corrections for relativistic effects, zero-point vibrational energies, and diagonal Born-Oppenheimer corrections were used to further refine energies. The results indicate that the lowest conformer is the gauche-gauche (GG) rotamer followed by the gauche-trans (0.12 kcal mol-1 above GG), trans-gauche (0.44 kcal mol-1), gauche'-gauche (0.47 kcal mol-1), and trans-trans (0.57 kcal mol-1). Fundamental vibrational frequencies were obtained using second-order vibrational perturbation theory. This is the first time anharmonic frequencies have been computed for this system. The most intense IR features include all but one of the C-H stretches. The O-O fundamental (1063 cm-1 for the GG structure) also has a significant IR intensity, 19.6 km mol-1. The anharmonicity effects on the potential energy surface were also used to compute vibrationally averaged rg,0K bond lengths, accounting for zero-point vibrations present within the molecule.

  4. Laser Spectroscopy of Vinyl Alcohol Embedded in Helium Droplets

    NASA Astrophysics Data System (ADS)

    Bunn, Hayley; Raston, Paul; Douberly, Gary E.

    2017-06-01

    Vinyl alcohol has two rotameric forms, known as syn- and anti-vinyl alcohol, where syn is the most stable. While both have been investigated by microwave and far-infrared spectroscopy, only the syn rotamer has been investigated by mid-infrared spectroscopy. This is due to the low anti rotamer population (15%) at room temperature, in addition to the closeness in proximity of the mid-infrared bands between the rotamers; this results in overlapping bands that are dominated by syn-vinyl alcohol absorptions. In this investigation we increase the anti-vinyl alcohol population to 40% by using a high temperature "pyrolysis" source, and eliminate the spectral overlap by recording the spectra at low temperature in helium nanodroplets. We observe a number of bands of both rotamers in the OH, CH, and CO stretching regions that display rotational substructure. A highlight of this work is the observation of a Fermi dyad in the OH stretching region of anti-vinyl alcohol. Anharmonic frequency calculations suggest that this is due to a near degeneracy of the OH stretching state (νb{1}) with a triple combination involving νb{7}, νb{8}, and νb{9}. M. Rodler, J. Mol. Spec. 114, 23 (1985);S. Saito, Chem. Phys. Lett. 42, 3 (1976) H. Bunn, R. Hudson, A. S. Gentleman, and P. L. Raston, ACS Earth Space Chem. DOI: 10.1021/acsearthspacechem.6b00008 (2017) D-L Joo, A. J. Merer, D. J. Clouthier, J. Mol. Spec. 197, 68 (1999)

  5. O-Acetyl Side-Chains in Monosaccharides: Redundant NMR Spin-Couplings and Statistical Models for Acetate Ester Conformational Analysis.

    PubMed

    Turney, Toby; Pan, Qingfeng; Sernau, Luke; Carmichael, Ian; Zhang, Wenhui; Wang, Xiaocong; Woods, Robert J; Serianni, Anthony S

    2017-01-12

    α- and β-d-glucopyranose monoacetates 1-3 were prepared with selective 13 C enrichment in the O-acetyl side-chain, and ensembles of 13 C- 1 H and 13 C- 13 C NMR spin-couplings (J-couplings) were measured involving the labeled carbons. Density functional theory (DFT) was applied to a set of model structures to determine which J-couplings are sensitive to rotation of the ester bond θ. Eight J-couplings ( 1 J CC , 2 J CH , 2 J CC , 3 J CH , and 3 J CC ) were found to be sensitive to θ, and four equations were parametrized to allow quantitative interpretations of experimental J-values. Inspection of J-coupling ensembles in 1-3 showed that O-acetyl side-chain conformation depends on molecular context, with flanking groups playing a dominant role in determining the properties of θ in solution. To quantify these effects, ensembles of J-couplings containing four values were used to determine the precision and accuracy of several 2-parameter statistical models of rotamer distributions across θ in 1-3. The statistical method used to generate these models has been encoded in a newly developed program, MA'AT, which is available for public use. These models were compared to O-acetyl side-chain behavior observed in a representative sample of crystal structures, and in molecular dynamics (MD) simulations of O-acetylated model structures. While the functional form of the model had little effect on the precision of the calculated mean of θ in 1-3, platykurtic models were found to give more precise estimates of the width of the distribution about the mean (expressed as circular standard deviations). Validation of these 2-parameter models to interpret ensembles of redundant J-couplings using the O-acetyl system as a test case enables future extension of the approach to other flexible elements in saccharides, such as glycosidic linkage conformation.

  6. Tautomers of Gas-Phase Erythrose and Their Interconversion Reactions: Insights from High-Level ab Initio Study.

    PubMed

    Szczepaniak, Marek; Moc, Jerzy

    2015-11-05

    D-Erythrose is a C4 monosaccharide with a biological and potential astrobiological relevance. We have investigated low-energy structures of d-erythrose and their interconversion in the gas phase with the highest-level calculations up-to-date. We have identified a number of structurally distinct furanose and open-chain isomers and predicted α ↔ α and β ↔ β furanose interconversion pathways involving the O-H rotamers. We have estimated relative Gibbs free energies of the erythrose species based on the CCSD(T)/aug-cc-pVTZ electronic energies and MP2/aug-cc-pVTZ vibrational frequencies. By using natural bond orbital theory we have also quantified a stabilization of erythrose conformers and interconversion transition states by intramolecular H-bonds.

  7. Far-Infrared Spectroscopy of Anti-Vinyl Alcohol

    NASA Astrophysics Data System (ADS)

    Raston, Paul; Bunn, Hayley

    2016-06-01

    Vinyl alcohol can exist in two rotameric forms, known as syn- and anti- vinyl alcohol, where syn is the most stable. Both rotamers have been observed in the interstellar medium towards Sagittarius B2(N) making them of particular astrophysical importance. Vinyl alcohol has been subject to various spectroscopic investigations, however, the anti rotamer has only been obsvered in the microwave region. We report the high resolution (0.001 wn) FTIR spectrum of anti-vinyl alcohol collected at the infrared beamline facility of the Australian Synchrotron. Vinyl alcohol was produced via the pyrolysis of 2-chloroethanol at 900°C, and its far infrared spectrum reveals the presence of the strong νb{15} fundamental and hot band of anti-vinyl alcohol. Rotational and centrifugal distortion constants of this higher energy rotamer have since been determined for the νb{15} and 2νb{15} states, and the ground state constants have been refined. B. E. Turner, A. J. Apponi, ApJ 561, 207 (2001) M. Rodler, J. Mol. Spec. 114, 23 (1985) D-L Joo, et al., J. Mol. Spec. 197, 68 (1999)

  8. Crystal structures of three 3,4,5-tri-meth-oxy-benzamide-based derivatives.

    PubMed

    Gomes, Ligia R; Low, John Nicolson; Oliveira, Catarina; Cagide, Fernando; Borges, Fernanda

    2016-05-01

    The crystal structures of three benzamide derivatives, viz. N-(6-hy-droxy-hex-yl)-3,4,5-tri-meth-oxy-benzamide, C16H25NO5, (1), N-(6-anilinohex-yl)-3,4,5-tri-meth-oxy-benzamide, C22H30N2O4, (2), and N-(6,6-di-eth-oxy-hex-yl)-3,4,5-tri-meth-oxy-benzamide, C20H33NO6, (3), are described. These compounds differ only in the substituent at the end of the hexyl chain and the nature of these substituents determines the differences in hydrogen bonding between the mol-ecules. In each mol-ecule, the m-meth-oxy substituents are virtually coplanar with the benzyl ring, while the p-meth-oxy substituent is almost perpendicular. The carbonyl O atom of the amide rotamer is trans related with the amidic H atom. In each structure, the benzamide N-H donor group and O acceptor atoms link the mol-ecules into C(4) chains. In 1, a terminal -OH group links the mol-ecules into a C(3) chain and the combined effect of the C(4) and C(3) chains is a ribbon made up of screw related R 2 (2)(17) rings in which the ⋯O-H⋯ chain lies in the centre of the ribbon and the tri-meth-oxy-benzyl groups forms the edges. In 2, the combination of the benzamide C(4) chain and the hydrogen bond formed by the terminal N-H group to an O atom of the 4-meth-oxy group link the mol-ecules into a chain of R 2 (2)(17) rings. In 3, the mol-ecules are linked only by C(4) chains.

  9. Interactive comparison and remediation of collections of macromolecular structures.

    PubMed

    Moriarty, Nigel W; Liebschner, Dorothee; Klei, Herbert E; Echols, Nathaniel; Afonine, Pavel V; Headd, Jeffrey J; Poon, Billy K; Adams, Paul D

    2018-01-01

    Often similar structures need to be compared to reveal local differences throughout the entire model or between related copies within the model. Therefore, a program to compare multiple structures and enable correction any differences not supported by the density map was written within the Phenix framework (Adams et al., Acta Cryst 2010; D66:213-221). This program, called Structure Comparison, can also be used for structures with multiple copies of the same protein chain in the asymmetric unit, that is, as a result of non-crystallographic symmetry (NCS). Structure Comparison was designed to interface with Coot(Emsley et al., Acta Cryst 2010; D66:486-501) and PyMOL(DeLano, PyMOL 0.99; 2002) to facilitate comparison of large numbers of related structures. Structure Comparison analyzes collections of protein structures using several metrics, such as the rotamer conformation of equivalent residues, displays the results in tabular form and allows superimposed protein chains and density maps to be quickly inspected and edited (via the tools in Coot) for consistency, completeness and correctness. © 2017 The Protein Society.

  10. Protein Side-Chain Resonance Assignment and NOE Assignment Using RDC-Defined Backbones without TOCSY Data3

    PubMed Central

    Zeng, Jianyang; Zhou, Pei; Donald, Bruce Randall

    2011-01-01

    One bottleneck in NMR structure determination lies in the laborious and time-consuming process of side-chain resonance and NOE assignments. Compared to the well-studied backbone resonance assignment problem, automated side-chain resonance and NOE assignments are relatively less explored. Most NOE assignment algorithms require nearly complete side-chain resonance assignments from a series of through-bond experiments such as HCCH-TOCSY or HCCCONH. Unfortunately, these TOCSY experiments perform poorly on large proteins. To overcome this deficiency, we present a novel algorithm, called NASCA (NOE Assignment and Side-Chain Assignment), to automate both side-chain resonance and NOE assignments and to perform high-resolution protein structure determination in the absence of any explicit through-bond experiment to facilitate side-chain resonance assignment, such as HCCH-TOCSY. After casting the assignment problem into a Markov Random Field (MRF), NASCA extends and applies combinatorial protein design algorithms to compute optimal assignments that best interpret the NMR data. The MRF captures the contact map information of the protein derived from NOESY spectra, exploits the backbone structural information determined by RDCs, and considers all possible side-chain rotamers. The complexity of the combinatorial search is reduced by using a dead-end elimination (DEE) algorithm, which prunes side-chain resonance assignments that are provably not part of the optimal solution. Then an A* search algorithm is employed to find a set of optimal side-chain resonance assignments that best fit the NMR data. These side-chain resonance assignments are then used to resolve the NOE assignment ambiguity and compute high-resolution protein structures. Tests on five proteins show that NASCA assigns resonances for more than 90% of side-chain protons, and achieves about 80% correct assignments. The final structures computed using the NOE distance restraints assigned by NASCA have backbone RMSD 0.8 – 1.5 Å from the reference structures determined by traditional NMR approaches. PMID:21706248

  11. Rotational Isomers, Intramolecular Hydrogen Bond, and IR Spectra of o-Vinylphenol Homologs

    NASA Astrophysics Data System (ADS)

    Glazunov, V. P.; Berdyshev, D. V.; Balaneva, N. N.; Radchenko, O. S.; Novikov, V. L.

    2018-03-01

    The ν(OH) stretching-mode bands in solution IR spectra of five o-vinylphenol (o-VPh) homologs in the slightly polar solvents CCl4 and n-hexane were studied. Several rotamers with free OH groups were found in solutions of o-VPh and its methyl-substituted derivatives in n-hexane. The proportion of rotamers in o-VPh homologs with intramolecular hydrogen bonds (IHBs) O-H...π varied from 22 to 97% in the gas and cyclohexane according to B3LYP/cc-pVTZ calculations. The theoretically estimated effective enthalpies -ΔH of their IHBs varied in the range 0.20-2.24 kcal/mol.

  12. A normal mode-based geometric simulation approach for exploring biologically relevant conformational transitions in proteins.

    PubMed

    Ahmed, Aqeel; Rippmann, Friedrich; Barnickel, Gerhard; Gohlke, Holger

    2011-07-25

    A three-step approach for multiscale modeling of protein conformational changes is presented that incorporates information about preferred directions of protein motions into a geometric simulation algorithm. The first two steps are based on a rigid cluster normal-mode analysis (RCNMA). Low-frequency normal modes are used in the third step (NMSim) to extend the recently introduced idea of constrained geometric simulations of diffusive motions in proteins by biasing backbone motions of the protein, whereas side-chain motions are biased toward favorable rotamer states. The generated structures are iteratively corrected regarding steric clashes and stereochemical constraint violations. The approach allows performing three simulation types: unbiased exploration of conformational space; pathway generation by a targeted simulation; and radius of gyration-guided simulation. When applied to a data set of proteins with experimentally observed conformational changes, conformational variabilities are reproduced very well for 4 out of 5 proteins that show domain motions, with correlation coefficients r > 0.70 and as high as r = 0.92 in the case of adenylate kinase. In 7 out of 8 cases, NMSim simulations starting from unbound structures are able to sample conformations that are similar (root-mean-square deviation = 1.0-3.1 Å) to ligand bound conformations. An NMSim generated pathway of conformational change of adenylate kinase correctly describes the sequence of domain closing. The NMSim approach is a computationally efficient alternative to molecular dynamics simulations for conformational sampling of proteins. The generated conformations and pathways of conformational transitions can serve as input to docking approaches or as starting points for more sophisticated sampling techniques.

  13. A combined binding mechanism of nonionic ethoxylated surfactants to bovine serum albumin revealed by fluorescence and circular dichroism.

    PubMed

    Iovescu, Alina; Băran, Adriana; Stîngă, Gabriela; Cantemir-Leontieş, Anca Ruxandra; Maxim, Monica Elisabeta; Anghel, Dan Florin

    2015-12-01

    The study systematically investigates aqueous mixtures of fixed bovine serum albumin (BSA) and various ethoxylated nonionic surfactants belonging to a homologous series or not. Mono-disperse tetra-(C12E4), hexa-(C12E6) and octa-ethyleneglycol mono-n-dodecyl ether (C12E8), and poly-disperse eicosa-ethyleneglycol mono-n-tetradecyl ether (C14EO20) are respectively employed. Fluorescence and circular dichroism measurements are performed at surfactant/protein molar ratios (rm)s lower and higher than one. We aim to get new insights into the binding mechanism of these species and to differentiate among the interaction abilities of these surfactants. The relative magnitude of the binding thermodynamic parameters by fluorescence, and the increase of α-helix prove that hydrogen bonding drives the interaction next to the hydrophobic attraction. C12En (n=4,6,8) develop more H bonds with the albumin than C14EO20 owing to a zigzag conformation of their short ethyleneoxide chains. Among the homologous surfactants, C12E6 has a slightly stronger interaction with BSA due to a maximal number of H bonds at a minimal hindering. Static fluorescence and dynamic fluorescence indicate an inter-conversion between the tryptophan (Trp) rotamers which happens around the surfactants critical micellar concentration. For C14EO20, the meander conformation of the polar group determines a less evident conversion of the Trp rotamers and smaller α-helix rise. Binding isotherms of the homologous surfactants and the fluorescence quenching mechanism by C12E6 are also provided. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Template based protein structure modeling by global optimization in CASP11.

    PubMed

    Joo, Keehyoung; Joung, InSuk; Lee, Sun Young; Kim, Jong Yun; Cheng, Qianyi; Manavalan, Balachandran; Joung, Jong Young; Heo, Seungryong; Lee, Juyong; Nam, Mikyung; Lee, In-Ho; Lee, Sung Jong; Lee, Jooyoung

    2016-09-01

    For the template-based modeling (TBM) of CASP11 targets, we have developed three new protein modeling protocols (nns for server prediction and LEE and LEER for human prediction) by improving upon our previous CASP protocols (CASP7 through CASP10). We applied the powerful global optimization method of conformational space annealing to three stages of optimization, including multiple sequence-structure alignment, three-dimensional (3D) chain building, and side-chain remodeling. For more successful fold recognition, a new alignment method called CRFalign was developed. It can incorporate sensitive positional and environmental dependence in alignment scores as well as strong nonlinear correlations among various features. Modifications and adjustments were made to the form of the energy function and weight parameters pertaining to the chain building procedure. For the side-chain remodeling step, residue-type dependence was introduced to the cutoff value that determines the entry of a rotamer to the side-chain modeling library. The improved performance of the nns server method is attributed to successful fold recognition achieved by combining several methods including CRFalign and to the current modeling formulation that can incorporate native-like structural aspects present in multiple templates. The LEE protocol is identical to the nns one except that CASP11-released server models are used as templates. The success of LEE in utilizing CASP11 server models indicates that proper template screening and template clustering assisted by appropriate cluster ranking promises a new direction to enhance protein 3D modeling. Proteins 2016; 84(Suppl 1):221-232. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  15. Intramolecular hydrogen bonding in myricetin and myricitrin. Quantum chemical calculations and vibrational spectroscopy

    NASA Astrophysics Data System (ADS)

    Vojta, Danijela; Dominković, Katarina; Miljanić, Snežana; Spanget-Larsen, Jens

    2017-03-01

    The molecular structures of myricetin (3,3‧,4‧,5,5‧,7-hexahydroxyflavone; MCE) and myricitrin (myricetin 3-O-rhamnoside; MCI) are investigated by quantum chemical calculations (B3LYP/6-311G**). Two preferred molecular rotamers of MCI are predicted, corresponding to different conformations of the O-rhamnoside subunit. The rotamers are characterized by different hydrogen bonded cross-links between the hydroxy groups of the rhamnoside substituent and the parent MCE moiety. The predicted OH stretching frequencies are compared with vibrational spectra of MCE and MCI recorded for the sake of this investigation (IR and Raman). In addition, a reassignment of the Cdbnd O stretching bands is suggested.

  16. Cost Function Network-based Design of Protein-Protein Interactions: predicting changes in binding affinity.

    PubMed

    Viricel, Clément; de Givry, Simon; Schiex, Thomas; Barbe, Sophie

    2018-02-20

    Accurate and economic methods to predict change in protein binding free energy upon mutation are imperative to accelerate the design of proteins for a wide range of applications. Free energy is defined by enthalpic and entropic contributions. Following the recent progresses of Artificial Intelligence-based algorithms for guaranteed NP-hard energy optimization and partition function computation, it becomes possible to quickly compute minimum energy conformations and to reliably estimate the entropic contribution of side-chains in the change of free energy of large protein interfaces. Using guaranteed Cost Function Network algorithms, Rosetta energy functions and Dunbrack's rotamer library, we developed and assessed EasyE and JayZ, two methods for binding affinity estimation that ignore or include conformational entropic contributions on a large benchmark of binding affinity experimental measures. If both approaches outperform most established tools, we observe that side-chain conformational entropy brings little or no improvement on most systems but becomes crucial in some rare cases. as open-source Python/C ++ code at sourcesup.renater.fr/projects/easy-jayz. thomas.schiex@inra.fr and sophie.barbe@insa-toulouse.fr. Supplementary data are available at Bioinformatics online.

  17. Loss of conformational entropy in protein folding calculated using realistic ensembles and its implications for NMR-based calculations

    PubMed Central

    Baxa, Michael C.; Haddadian, Esmael J.; Jumper, John M.; Freed, Karl F.; Sosnick, Tobin R.

    2014-01-01

    The loss of conformational entropy is a major contribution in the thermodynamics of protein folding. However, accurate determination of the quantity has proven challenging. We calculate this loss using molecular dynamic simulations of both the native protein and a realistic denatured state ensemble. For ubiquitin, the total change in entropy is TΔSTotal = 1.4 kcal⋅mol−1 per residue at 300 K with only 20% from the loss of side-chain entropy. Our analysis exhibits mixed agreement with prior studies because of the use of more accurate ensembles and contributions from correlated motions. Buried side chains lose only a factor of 1.4 in the number of conformations available per rotamer upon folding (ΩU/ΩN). The entropy loss for helical and sheet residues differs due to the smaller motions of helical residues (TΔShelix−sheet = 0.5 kcal⋅mol−1), a property not fully reflected in the amide N-H and carbonyl C=O bond NMR order parameters. The results have implications for the thermodynamics of folding and binding, including estimates of solvent ordering and microscopic entropies obtained from NMR. PMID:25313044

  18. Crystal structures of three 3,4,5-tri­meth­oxy­benzamide-based derivatives

    PubMed Central

    Gomes, Ligia R.; Low, John Nicolson; Oliveira, Catarina; Cagide, Fernando; Borges, Fernanda

    2016-01-01

    The crystal structures of three benzamide derivatives, viz. N-(6-hy­droxy­hex­yl)-3,4,5-tri­meth­oxy­benzamide, C16H25NO5, (1), N-(6-anilinohex­yl)-3,4,5-tri­meth­oxy­benzamide, C22H30N2O4, (2), and N-(6,6-di­eth­oxy­hex­yl)-3,4,5-tri­meth­oxy­benzamide, C20H33NO6, (3), are described. These compounds differ only in the substituent at the end of the hexyl chain and the nature of these substituents determines the differences in hydrogen bonding between the mol­ecules. In each mol­ecule, the m-meth­oxy substituents are virtually coplanar with the benzyl ring, while the p-meth­oxy substituent is almost perpendicular. The carbonyl O atom of the amide rotamer is trans related with the amidic H atom. In each structure, the benzamide N—H donor group and O acceptor atoms link the mol­ecules into C(4) chains. In 1, a terminal –OH group links the mol­ecules into a C(3) chain and the combined effect of the C(4) and C(3) chains is a ribbon made up of screw related R 2 2(17) rings in which the ⋯O—H⋯ chain lies in the centre of the ribbon and the tri­meth­oxy­benzyl groups forms the edges. In 2, the combination of the benzamide C(4) chain and the hydrogen bond formed by the terminal N—H group to an O atom of the 4-meth­oxy group link the mol­ecules into a chain of R 2 2(17) rings. In 3, the mol­ecules are linked only by C(4) chains. PMID:27308017

  19. Progress in protein-protein docking: atomic resolution predictions in the CAPRI experiment using RosettaDock with an improved treatment of side-chain flexibility.

    PubMed

    Schueler-Furman, Ora; Wang, Chu; Baker, David

    2005-08-01

    RosettaDock uses real-space Monte Carlo minimization (MCM) on both rigid-body and side-chain degrees of freedom to identify the lowest free energy docked arrangement of 2 protein structures. An improved version of the method that uses gradient-based minimization for off-rotamer side-chain optimization and includes information from unbound structures was used to create predictions for Rounds 4 and 5 of CAPRI. First, large numbers of independent MCM trajectories were carried out and the lowest free energy docked configurations identified. Second, new trajectories were started from these lowest energy structures to thoroughly sample the surrounding conformation space, and the lowest energy configurations were submitted as predictions. For all cases in which there were no significant backbone conformational changes, a small number of very low-energy configurations were identified in the first, global search and subsequently found to be close to the center of the basin of attraction in the free energy landscape in the second, local search. Following the release of the experimental coordinates, it was found that the centers of these free energy minima were remarkably close to the native structures in not only the rigid-body orientation but also the detailed conformations of the side-chains. Out of 8 targets, the lowest energy models had interface root-mean-square deviations (RMSDs) less than 1.1 A from the correct structures for 6 targets, and interface RMSDs less than 0.4 A for 3 targets. The predictions were top submissions to CAPRI for Targets 11, 12, 14, 15, and 19. The close correspondence of the lowest free energy structures found in our searches to the experimental structures suggests that our free energy function is a reasonable representation of the physical chemistry, and that the real space search with full side-chain flexibility to some extent solves the protein-protein docking problem in the absence of significant backbone conformational changes. On the other hand, the approach fails when there are significant backbone conformational changes as the steric complementarity of the 2 proteins cannot be modeled without incorporating backbone flexibility, and this is the major goal of our current work.

  20. Prediction of TF target sites based on atomistic models of protein-DNA complexes

    PubMed Central

    Angarica, Vladimir Espinosa; Pérez, Abel González; Vasconcelos, Ana T; Collado-Vides, Julio; Contreras-Moreira, Bruno

    2008-01-01

    Background The specific recognition of genomic cis-regulatory elements by transcription factors (TFs) plays an essential role in the regulation of coordinated gene expression. Studying the mechanisms determining binding specificity in protein-DNA interactions is thus an important goal. Most current approaches for modeling TF specific recognition rely on the knowledge of large sets of cognate target sites and consider only the information contained in their primary sequence. Results Here we describe a structure-based methodology for predicting sequence motifs starting from the coordinates of a TF-DNA complex. Our algorithm combines information regarding the direct and indirect readout of DNA into an atomistic statistical model, which is used to estimate the interaction potential. We first measure the ability of our method to correctly estimate the binding specificities of eight prokaryotic and eukaryotic TFs that belong to different structural superfamilies. Secondly, the method is applied to two homology models, finding that sampling of interface side-chain rotamers remarkably improves the results. Thirdly, the algorithm is compared with a reference structural method based on contact counts, obtaining comparable predictions for the experimental complexes and more accurate sequence motifs for the homology models. Conclusion Our results demonstrate that atomic-detail structural information can be feasibly used to predict TF binding sites. The computational method presented here is universal and might be applied to other systems involving protein-DNA recognition. PMID:18922190

  1. Combining EPR spectroscopy and X-ray crystallography to elucidate the structure and dynamics of conformationally constrained spin labels in T4 lysozyme single crystals.

    PubMed

    Consentius, Philipp; Gohlke, Ulrich; Loll, Bernhard; Alings, Claudia; Heinemann, Udo; Wahl, Markus C; Risse, Thomas

    2017-08-09

    Electron paramagnetic resonance (EPR) spectroscopy in combination with site-directed spin labeling is used to investigate the structure and dynamics of conformationally constrained spin labels in T4 lysozyme single crystals. Within a single crystal, the oriented ensemble of spin bearing moieties results in a strong angle dependence of the EPR spectra. A quantitative description of the EPR spectra requires the determination of the unit cell orientation with respect to the sample tube and the orientation of the spin bearing moieties within the crystal lattice. Angle dependent EPR spectra were analyzed by line shape simulations using the stochastic Liouville equation approach developed by Freed and co-workers and an effective Hamiltonian approach. The gain in spectral information obtained from the EPR spectra of single crystalline samples taken at different frequencies, namely the X-band and Q-band, allows us to discriminate between motional models describing the spectra of isotropic solutions similarly well. In addition, it is shown that the angle dependent single crystal spectra allow us to identify two spin label rotamers with very similar side chain dynamics. These results demonstrate the utility of single crystal EPR spectroscopy in combination with spectral line shape simulation techniques to extract valuable dynamic information not readily available from the analysis of isotropic systems. In addition, it will be shown that the loss of electron density in high resolution diffraction experiments at room temperature does not allow us to conclude that there is significant structural disorder in the system.

  2. Isolation and identification of flavonoids, including flavone rotamers, from the herbal drug 'Crataegi folium cum flore' (hawthorn).

    PubMed

    Rayyan, S; Fossen, T; Solheim Nateland, H; Andersen, O M

    2005-01-01

    Twelve flavonoids, including seven flavones, four flavonols and one flavanone, were isolated from methanolic extract of the herbal drug 'Crataegi folium cum flore' (hawthorn leaves and flowers) by a combination of CC (over Amberlite XAD-7 and Sephadex LH-20) and preparative HPLC. Their structures, including that of the novel flavonol 8-methoxykaempferol 3-O-(6"-malonyl-beta-glucopyranoside), were elucidated by homo- and heteronuclear NMR and electrospray/MS. The 1H- and 13C-NMR of all compounds, including rotameric pairs of five flavone C-glycosides, were assigned. The presence and relative proportion of each rotamer was shown by various NMR experiments, including two-dimensional nuclear Overhauser and exchange spectroscopy, to depend on solvent, linkage position and structure of the C-glycosyl substituent.

  3. Single-Point Mutation with a Rotamer Library Toolkit: Toward Protein Engineering.

    PubMed

    Pottel, Joshua; Moitessier, Nicolas

    2015-12-28

    Protein engineers have long been hard at work to harness biocatalysts as a natural source of regio-, stereo-, and chemoselectivity in order to carry out chemistry (reactions and/or substrates) not previously achieved with these enzymes. The extreme labor demands and exponential number of mutation combinations have induced computational advances in this domain. The first step in our virtual approach is to predict the correct conformations upon mutation of residues (i.e., rebuilding side chains). For this purpose, we opted for a combination of molecular mechanics and statistical data. In this work, we have developed automated computational tools to extract protein structural information and created conformational libraries for each amino acid dependent on a variable number of parameters (e.g., resolution, flexibility, secondary structure). We have also developed the necessary tool to apply the mutation and optimize the conformation accordingly. For side-chain conformation prediction, we obtained overall average root-mean-square deviations (RMSDs) of 0.91 and 1.01 Å for the 18 flexible natural amino acids within two distinct sets of over 3000 and 1500 side-chain residues, respectively. The commonly used dihedral angle differences were also evaluated and performed worse than the state of the art. These two metrics are also compared. Furthermore, we generated a family-specific library for kinases that produced an average 2% lower RMSD upon side-chain reconstruction and a residue-specific library that yielded a 17% improvement. Ultimately, since our protein engineering outlook involves using our docking software, Fitted/Impacts, we applied our mutation protocol to a benchmarked data set for self- and cross-docking. Our side-chain reconstruction does not hinder our docking software, demonstrating differences in pose prediction accuracy of approximately 2% (RMSD cutoff metric) for a set of over 200 protein/ligand structures. Similarly, when docking to a set of over 100 kinases, side-chain reconstruction (using both general and biased conformation libraries) had minimal detriment to the docking accuracy.

  4. Investigating the Ground-State Rotamers of n-Propylperoxy Radical

    DOE PAGES

    Hoobler, Preston Reece; Turney, Justin Matthew; Schaefer III, Henry

    2016-11-01

    The n-propylperoxy radical has been described as a molecule of critical importance to studies of low temperature combustion. Ab initio methods were used to study this three-carbon alkylperoxy radical, normal propylperoxy. Reliable CCSD(T)/ANO0 geometries were predicted for the molecule's five rotamers. For each rotamer, energetic predictions were made using basis sets as large as the cc-pV5Z in conjunction with coupled cluster levels of theory up to CCSDT(Q). Along with the extrapolations, corrections for relativistic effects, zero-point vibrational energies, and diagonal Born--Oppenheimer corrections were used to further refine energies. The results indicate that the lowest conformer is the gauche-gauche (GG) rotamermore » followed by the gauche-trans (0.12 kcal mol^-1 above GG), trans-gauche (0.44 kcal mol^-1), gauche'-gauche (0.47 kcal mol^-1), and trans-trans (0.57 kcal mol^-1). Fundamental vibrational frequencies were obtained using second-order vibrational perturbation theory (VPT2). This is the first time anharmonic frequencies have been computed for this system. The most intense IR features include all but one of the C-H stretches. The O-O fundamental (1063 cm^-1 for the GG structure) also has a significant IR intensity, 19.6 km mol^-1. The anharmonicity effects on the potential energy surface were also used to compute vibrationally averaged r_g,0 K bond lengths, accounting for zero-point vibrations present within the molecule.« less

  5. Gas-phase infrared spectra of vinyl selenol and vinyl tellurol.

    PubMed

    Benidar, Abdessamad; Khater, Brahim; Guillemin, Jean-Claude; Gámez, José A; Yáñez, Manuel

    2009-11-19

    The infrared spectra (3500-500 cm(-1)) of gaseous vinyl selenol and vinyl tellurol have been recorded at 0.1 cm(-1) resolution. For the latter the spectra were obtained at room temperature, but for the former a temperature of -40 degrees C was required because of the chemical instability of vinyl selenol at room temperature. To compensate the very weak vapor pressure of vinyl tellurol at room temperature, a long optical path up to 136 m was necessary to record its spectrum. B3LYP density functional theory (DFT) calculations have been performed to assign the different absorption bands. Since an unambiguous assignment of the absorption bands requires a precise knowledge on the relative abundance of the syn and gauche rotamers of these compounds, their relative energies and their anharmonic vibrational frequencies were obtained using a very extended Def2-QZVP basis set. Two rotamers, the syn, which is planar, and a nonplanar gauche, were found to be local minima for both compounds. The gauche rotamer presents two degenerate conformers, which differ by the position of the SeH (TeH) hydrogen atom above or below the molecular plane. Our theoretical results are in good agreement with the main features of the experimental spectra. Fundamental bands and some combination bands of vinyl selenol and vinyl tellurol were assigned and compared with those of vinyl alcohol and vinyl thiol, whose spectra had been reported previously in the literature.

  6. Gas-Phase Infrared Spectra of Vinyl Selenol and Vinyl Tellurol

    NASA Astrophysics Data System (ADS)

    Benidar, Abdessamad; Khater, Brahim; Guillemin, Jean-Claude; Gámez, José A.; Yáñez, Manuel

    2009-10-01

    The infrared spectra (3500-500 cm-1) of gaseous vinyl selenol and vinyl tellurol have been recorded at 0.1 cm-1 resolution. For the latter the spectra were obtained at room temperature, but for the former a temperature of -40 °C was required because of the chemical instability of vinyl selenol at room temperature. To compensate the very weak vapor pressure of vinyl tellurol at room temperature, a long optical path up to 136 m was necessary to record its spectrum. B3LYP density functional theory (DFT) calculations have been performed to assign the different absorption bands. Since an unambiguous assignment of the absorption bands requires a precise knowledge on the relative abundance of the syn and gauche rotamers of these compounds, their relative energies and their anharmonic vibrational frequencies were obtained using a very extended Def2-QZVP basis set. Two rotamers, the syn, which is planar, and a nonplanar gauche, were found to be local minima for both compounds. The gauche rotamer presents two degenerate conformers, which differ by the position of the SeH (TeH) hydrogen atom above or below the molecular plane. Our theoretical results are in good agreement with the main features of the experimental spectra. Fundamental bands and some combination bands of vinyl selenol and vinyl tellurol were assigned and compared with those of vinyl alcohol and vinyl thiol, whose spectra had been reported previously in the literature.

  7. Infrared spectra of cyanoacetaldehyde (NCCH2CHO): a potential prebiotic compound of astrochemical interest.

    PubMed

    Benidar, Abdessamad; Georges, Robert; Guillemin, Jean-Claude; Mó, Otilia; Yáñez, Manuel

    2013-08-26

    Cyanoacetaldehyde (NC-CH2CH=O) and its isomer, cyanovinylalcohol (NC-CH=CH-OH), as possible components of the interstellar medium, comets, or planetary atmospheres, exist in equilibrium in the gas phase, although the latter compound is very much in the minority (2%). The recording and analysis of the gas-phase infrared spectrum of the former compound within the 4000-500 cm(-1) spectroscopic range and the potential presence of the latter isomer, which could be vital for their detection in these media, are reported. CCSD(T) and G4 high-level ab initio methods, as well as density functional theory calculations, predict the existence of two stable rotamers of cyanoacetaldehyde. The global minimum has a structure with an unusual O-C-C-C dihedral angle (150°) that falls between the antiperiplanar (180°) and anticlinal forms (120°). The second rotamer, which is about 4.0 kJ mol(-1) less stable in terms of free energy, has a planar structure that corresponds to the synperiplanar form (O-C-C-C dihedral angle: 0°). The absorption vibrational bands of the two aldehyde rotamers that are present in the mixture lead to a spectrum with a very complex structure in the region of deformation movements, in which several low-intensity bands overlap. A complete and unambiguous assignment of the experimental spectrum has been achieved by using the calculated harmonic and anharmonic vibrational frequencies. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Architecture of the synaptotagmin–SNARE machinery for neuronal exocytosis

    DOE PAGES

    Zhou, Qiangjun; Lai, Ying; Bacaj, Taulant; ...

    2015-08-17

    Synaptotagmin-1 and neuronal SNARE proteins have central roles in evoked synchronous neurotransmitter release; however, it is unknown how they cooperate to trigger synaptic vesicle fusion. We report atomic-resolution crystal structures of Ca 2+- and Mg 2+-bound complexes between synaptotagmin-1 and the neuronal SNARE complex, one of which was determined with diffraction data from an X-ray free-electron laser, leading to an atomic-resolution structure with accurate rotamer assignments for many side chains. The structures reveal several interfaces, including a large, specific, Ca 2+-independent and conserved interface. Tests of this interface by mutagenesis suggest that it is essential for Ca 2+-triggered neurotransmitter releasemore » in mouse hippocampal neuronal synapses and for Ca 2+-triggered vesicle fusion in a reconstituted system. Lastly, we propose that this interface forms before Ca 2+ triggering, moves en bloc as Ca 2+ influx promotes the interactions between synaptotagmin-1 and the plasma membrane, and consequently remodels the membrane to promote fusion, possibly in conjunction with other interfaces.« less

  9. The introduction of strain and its effects on the structure and stability of T4 lysozyme.

    PubMed

    Liu, R; Baase, W A; Matthews, B W

    2000-01-07

    In order to try to better understand the role played by strain in the structure and stability of a protein a series of "small-to-large" mutations was made within the core of T4 lysozyme. Three different alanine residues, one involved in backbone contacts, one in side-chain contacts, and the third adjacent to a small cavity, were each replaced with subsets of the larger residues, Val, Leu, Ile, Met, Phe and Trp. As expected, the protein is progressively destabilized as the size of the introduced side-chain becomes larger. There does, however, seem to be a limit to the destabilization, suggesting that a protein of a given size may be capable of maintaining only a certain amount of strain. The changes in stability vary greatly from site to site. Substitution of larger residues for both Ala42 and Ala98 substantially destabilize the protein, even though the primary contacts in one case are predominantly with side-chain atoms and in the other with backbone. The results suggest that it is neither practical nor meaningful to try to separate the effects of introduced strain on side-chains from the effects on the backbone. Substitutions at Ala129 are much less destabilizing than at sites 42 or 98. This is most easily understood in terms of the pre-existing cavity, which provides partial space to accommodate the introduced side-chains. Crystal structures were obtained for a number of the mutants. These show that the changes in structure to accommodate the introduced side-chains usually consist of essentially rigid-body displacements of groups of linked atoms, achieved through relatively small changes in torsion angles. On rare occasions, a side-chain close to the site of substitution may change to a different rotamer. When such rotomer changes occur, they permit the structure to dissipate strain by a response that is plastic rather than elastic. In one case, a surface loop moves 1.2 A, not in direct response to a mutation, but in an interaction mediated via an intermolecular contact. It illustrates how the structure of a protein can be modified by crystal contacts. Copyright 2000 Academic Press.

  10. Photochemistry of furyl- and thienyldiazomethanes: spectroscopic characterization of triplet 3-thienylcarbene.

    PubMed

    Pharr, Caroline R; Kopff, Laura A; Bennett, Brian; Reid, Scott A; McMahon, Robert J

    2012-04-11

    Photolysis (λ > 543 nm) of 3-thienyldiazomethane (1), matrix isolated in Ar or N(2) at 10 K, yields triplet 3-thienylcarbene (13) and α-thial-methylenecyclopropene (9). Carbene 13 was characterized by IR, UV/vis, and EPR spectroscopy. The conformational isomers of 3-thienylcarbene (s-E and s-Z) exhibit an unusually large difference in zero-field splitting parameters in the triplet EPR spectrum (|D/hc| = 0.508 cm(-1), |E/hc| = 0.0554 cm(-1); |D/hc| = 0.579 cm(-1), |E/hc| = 0.0315 cm(-1)). Natural Bond Orbital (NBO) calculations reveal substantially differing spin densities in the 3-thienyl ring at the positions adjacent to the carbene center, which is one factor contributing to the large difference in D values. NBO calculations also reveal a stabilizing interaction between the sp orbital of the carbene carbon in the s-Z rotamer of 13 and the antibonding σ orbital between sulfur and the neighboring carbon-an interaction that is not observed in the s-E rotamer of 13. In contrast to the EPR spectra, the electronic absorption spectra of the rotamers of triplet 3-thienylcarbene (13) are indistinguishable under our experimental conditions. The carbene exhibits a weak electronic absorption in the visible spectrum (λ(max) = 467 nm) that is characteristic of triplet arylcarbenes. Although studies of 2-thienyldiazomethane (2), 3-furyldiazomethane (3), or 2-furyldiazomethane (4) provided further insight into the photochemical interconversions among C(5)H(4)S or C(5)H(4)O isomers, these studies did not lead to the spectroscopic detection of the corresponding triplet carbenes (2-thienylcarbene (11), 3-furylcarbene (23), or 2-furylcarbene (22), respectively). © 2012 American Chemical Society

  11. Identification of four rotamers of m-methoxystyrene by resonant two-photon ionization and mass analyzed threshold ionization spectroscopy

    NASA Astrophysics Data System (ADS)

    Xu, Yanqi; Tzeng, Sheng Yuan; Shivatare, Vidya; Takahashi, Kaito; Zhang, Bing; Tzeng, Wen Bih

    2015-03-01

    We report the vibronic and cation spectra of four rotamers of m-methoxystyrene, recorded by using the two-color resonant two-photon ionization and mass-analyzed threshold ionization techniques. The excitation energies of the S1← S0 electronic transition are found to be 32 767, 32 907, 33 222, and 33 281 cm-1, and the corresponding adiabatic ionization energies are 65 391, 64 977, 65 114, and 64 525 cm-1 for these isomeric species. Most of the observed active vibrations in the electronically excited S1 and cationic ground D0 states involve in-plane ring deformation and substituent-sensitive bending motions. It is found that the relative orientation of the methoxyl with respect to the vinyl group does not influence the vibrational frequencies of the ring-substituent bending modes. The two dimensional potential energy surface calculations support our experimental finding that the isomerization is restricted in the S1 and D0 states.

  12. Unexpected Rotamerism at the Origin of a Chessboard Supramolecular Assembly of Ruthenium Phthalocyanine.

    PubMed

    Mattioli, Giuseppe; Larciprete, Rosanna; Alippi, Paola; Bonapasta, Aldo Amore; Filippone, Francesco; Lacovig, Paolo; Lizzit, Silvano; Paoletti, Anna Maria; Pennesi, Giovanna; Ronci, Fabio; Zanotti, Gloria; Colonna, Stefano

    2017-11-16

    We have investigated the formation and the properties of ultrathin films of ruthenium phthalocyanine (RuPc) 2 vacuum deposited on graphite by scanning tunneling microscopy and synchrotron photoemission spectroscopy measurements, interpreted in close conjunction with ab initio simulations. Thanks to its unique dimeric structure connected by a direct Ru-Ru bond, (RuPc) 2 can be found in two stable rotameric forms separated by a low-energy barrier. Such isomerism leads to a peculiar organization of the molecules in flat, horizontal layers on the graphite surface, characterized by a chessboard-like alternation of the two rotamers. Moreover, the molecules are vertically connected to form π-stacked columnar pillars of akin rotamers, compatible with the high conductivity measured in (RuPc) 2 powders. Such features yield an unprecedented supramolecular assembly of phthalocyanine films, which could open interesting perspectives toward the realization of new architectures of organic electronic devices. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Peptide crystal simulations reveal hidden dynamics

    PubMed Central

    Janowski, Pawel A.; Cerutti, David S.; Holton, James; Case, David A.

    2013-01-01

    Molecular dynamics simulations of biomolecular crystals at atomic resolution have the potential to recover information on dynamics and heterogeneity hidden in the X-ray diffraction data. We present here 9.6 microseconds of dynamics in a small helical peptide crystal with 36 independent copies of the unit cell. The average simulation structure agrees with experiment to within 0.28 Å backbone and 0.42 Å all-atom rmsd; a model refined against the average simulation density agrees with the experimental structure to within 0.20 Å backbone and 0.33 Å all-atom rmsd. The R-factor between the experimental structure factors and those derived from this unrestrained simulation is 23% to 1.0 Å resolution. The B-factors for most heavy atoms agree well with experiment (Pearson correlation of 0.90), but B-factors obtained by refinement against the average simulation density underestimate the coordinate fluctuations in the underlying simulation where the simulation samples alternate conformations. A dynamic flow of water molecules through channels within the crystal lattice is observed, yet the average water density is in remarkable agreement with experiment. A minor population of unit cells is characterized by reduced water content, 310 helical propensity and a gauche(−) side-chain rotamer for one of the valine residues. Careful examination of the experimental data suggests that transitions of the helices are a simulation artifact, although there is indeed evidence for alternate valine conformers and variable water content. This study highlights the potential for crystal simulations to detect dynamics and heterogeneity in experimental diffraction data, as well as to validate computational chemistry methods. PMID:23631449

  14. Identifying the elusive link between amino acid sequence and charge selectivity in pentameric ligand-gated ion channels.

    PubMed

    Cymes, Gisela D; Grosman, Claudio

    2016-10-10

    Among neurotransmitter-gated ion channels, the superfamily of pentameric ligand-gated ion channels (pLGICs) is unique in that its members display opposite permeant-ion charge selectivities despite sharing the same structural fold. Although much effort has been devoted to the identification of the mechanism underlying the cation-versus-anion selectivity of these channels, a careful analysis of past work reveals that discrepancies exist, that different explanations for the same phenomenon have often been put forth, and that no consensus view has yet been reached. To elucidate the molecular basis of charge selectivity for the superfamily as a whole, we performed extensive mutagenesis and electrophysiological recordings on six different cation-selective and anion-selective homologs from vertebrate, invertebrate, and bacterial origin. We present compelling evidence for the critical involvement of ionized side chains-whether pore-facing or buried-rather than backbone atoms and propose a mechanism whereby not only their charge sign but also their conformation determines charge selectivity. Insertions, deletions, and residue-to-residue mutations involving nonionizable residues in the intracellular end of the pore seem to affect charge selectivity by changing the rotamer preferences of the ionized side chains in the first turn of the M2 α-helices. We also found that, upon neutralization of the charged residues in the first turn of M2, the control of charge selectivity is handed over to the many other ionized side chains that decorate the pore. This explains the long-standing puzzle as to why the neutralization of the intracellular-mouth glutamates affects charge selectivity to markedly different extents in different cation-selective pLGICs.

  15. Template-free modeling by LEE and LEER in CASP11.

    PubMed

    Joung, InSuk; Lee, Sun Young; Cheng, Qianyi; Kim, Jong Yun; Joo, Keehyoung; Lee, Sung Jong; Lee, Jooyoung

    2016-09-01

    For the template-free modeling of human targets of CASP11, we utilized two of our modeling protocols, LEE and LEER. The LEE protocol took CASP11-released server models as the input and used some of them as templates for 3D (three-dimensional) modeling. The template selection procedure was based on the clustering of the server models aided by a community detection method of a server-model network. Restraining energy terms generated from the selected templates together with physical and statistical energy terms were used to build 3D models. Side-chains of the 3D models were rebuilt using target-specific consensus side-chain library along with the SCWRL4 rotamer library, which completed the LEE protocol. The first success factor of the LEE protocol was due to efficient server model screening. The average backbone accuracy of selected server models was similar to that of top 30% server models. The second factor was that a proper energy function along with our optimization method guided us, so that we successfully generated better quality models than the input template models. In 10 out of 24 cases, better backbone structures than the best of input template structures were generated. LEE models were further refined by performing restrained molecular dynamics simulations to generate LEER models. CASP11 results indicate that LEE models were better than the average template models in terms of both backbone structures and side-chain orientations. LEER models were of improved physical realism and stereo-chemistry compared to LEE models, and they were comparable to LEE models in the backbone accuracy. Proteins 2016; 84(Suppl 1):118-130. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  16. Density Functional Study of the Infrared Spectrum of Glucose and Glucose Monohydrates in the OH Stretch Region

    USDA-ARS?s Scientific Manuscript database

    Density functional theory (DFT) has been used to calculate the structures and infrared spectra of glucose and glucose monohydrates. Both the alpha and beta anomers were studied, with all possible combinations of hydroxymethyl rotamer (gg, gt, or tg) and hydroxyl orientation (clockwise or counter-cl...

  17. Photoinduced ICT vs. excited rotamer intercoversion in two quadrupolar polyaromatic N-methylpyridinium cations.

    PubMed

    Cesaretti, A; Carlotti, B; Elisei, F; Fortuna, C G; Spalletti, A

    2018-01-24

    The excited state dynamics of two quadrupolar polyaromatic N-methylpyridinium cations have been fully investigated in order to acquire detailed information on their photo-induced behavior. The two molecules are symmetric push-pull compounds having a D-π-A + -π-D motif, with the same electron-acceptor central unit (A = N-methylpyridinium) and two distinctive electron-donor polyaromatic side groups (D), namely naphthyl and pyrenyl substituents. Both molecules undergo charge transfer during the absorption, as revealed by a significant solvatochromism exhibited with solvent polarity, but the fate of their excited state was found to be markedly different. The careful analysis of the data gathered from femtosecond-resolved fluorescence up-conversion and transient absorption experiments, supported by DFT quantum mechanical calculations and temperature-dependent stationary measurements, shows the leading role of intramolecular charge transfer, assisted by symmetry breaking, in the pyrenyl derivative and that of rotamer interconversion in the naphthtyl one. Both excited state processes are controlled by the viscosity rather than polarity of the solvent, and they occur during inertial solvation in low-viscous media and lengthening up to tens of picoseconds in highly viscous solvents.

  18. Guaranteed Discrete Energy Optimization on Large Protein Design Problems.

    PubMed

    Simoncini, David; Allouche, David; de Givry, Simon; Delmas, Céline; Barbe, Sophie; Schiex, Thomas

    2015-12-08

    In Computational Protein Design (CPD), assuming a rigid backbone and amino-acid rotamer library, the problem of finding a sequence with an optimal conformation is NP-hard. In this paper, using Dunbrack's rotamer library and Talaris2014 decomposable energy function, we use an exact deterministic method combining branch and bound, arc consistency, and tree-decomposition to provenly identify the global minimum energy sequence-conformation on full-redesign problems, defining search spaces of size up to 10(234). This is achieved on a single core of a standard computing server, requiring a maximum of 66GB RAM. A variant of the algorithm is able to exhaustively enumerate all sequence-conformations within an energy threshold of the optimum. These proven optimal solutions are then used to evaluate the frequencies and amplitudes, in energy and sequence, at which an existing CPD-dedicated simulated annealing implementation may miss the optimum on these full redesign problems. The probability of finding an optimum drops close to 0 very quickly. In the worst case, despite 1,000 repeats, the annealing algorithm remained more than 1 Rosetta unit away from the optimum, leading to design sequences that could differ from the optimal sequence by more than 30% of their amino acids.

  19. Spectra and structure of organophosphorus compounds. LI. IR and Raman spectra, conformational stability, barriers to internal rotation, vibrational assignment, and ab initio calculations of n-propylphosphine

    NASA Astrophysics Data System (ADS)

    Durig, J. R.; Gounev, T. K.; Lee, M. S.; Little, T. S.

    1994-10-01

    The Raman (3100 to 50 cm -1) and IR (3100 to 50 cm -1) spectra of gaseous and solid n-propylphosphine, C 3H 7PH 2, and the corresponding P- d2 isotopomer have been recorded. Additionally, the Raman spectra of the liquids have been obtained with qualitative depolarization ratios. From these data, all five possible conformers have been identified in the fluid states and the trans-trans conformer is shown to be the most stable rotamer in both the gaseous and liquid states and it is the only conformer present in the solid. The first trans refers to the orientation of the lone pair to the ethylene group (rotation around the PC bond) whereas the second trans refers to the orientation of the methyl group relative to the PC bond (rotation around the -CH 2CH 2 bond). The next most stable conformer is the gauche-trans rotamer where the enthalpy difference has been determined from variable-temperature Raman studies to be 140 ± 5 cm -1 (400 ± 14 cal mol -1) for the vapor and 351 ± 20 cm -1 (1004 ± 57 cal mol -1) for the liquid. The other three conformers have nearly the same stabilities but significantly higher energies than the two more stable rotamers. From the far-IR data and relative conformer stabilities, some of the coefficients of the potential function governing conformer interconversion are estimated. A complete vibrational assignment is proposed for the trans-trans conformer and for the fundamentals for most of the heavy atom motions for the other conformers. The conformational stabilities, barriers to internal rotation, and fundamental vibrational frequencies which have been determined experimentally are compared to those obtained from ab initio calculations employing the RHF/3-21G* and/or RHF/6-31G* basis sets. Additionally, the conformational stabilities and structural parameters have been determined with the 6-31G* basis set with electron correlation at the MP2 level. These results are compared with the corresponding quantities for some similar molecules.

  20. Boosting protein stability with the computational design of β-sheet surfaces.

    PubMed

    Kim, Doo Nam; Jacobs, Timothy M; Kuhlman, Brian

    2016-03-01

    β-sheets often have one face packed against the core of the protein and the other facing solvent. Mutational studies have indicated that the solvent-facing residues can contribute significantly to protein stability, and that the preferred amino acid at each sequence position is dependent on the precise structure of the protein backbone and the identity of the neighboring amino acids. This suggests that the most advantageous methods for designing β-sheet surfaces will be approaches that take into account the multiple energetic factors at play including side chain rotamer preferences, van der Waals forces, electrostatics, and desolvation effects. Here, we show that the protein design software Rosetta, which models these energetic factors, can be used to dramatically increase protein stability by optimizing interactions on the surfaces of small β-sheet proteins. Two design variants of the β-sandwich protein from tenascin were made with 7 and 14 mutations respectively on its β-sheet surfaces. These changes raised the thermal midpoint for unfolding from 45°C to 64°C and 74°C. Additionally, we tested an empirical approach based on increasing the number of potential salt bridges on the surfaces of the β-sheets. This was not a robust strategy for increasing stability, as three of the four variants tested were unfolded. © 2016 The Protein Society.

  1. Electron transfer flavoprotein domain II orientation monitored using double electron-electron resonance between an enzymatically reduced, native FAD cofactor, and spin labels

    PubMed Central

    Swanson, Michael A; Kathirvelu, Velavan; Majtan, Tomas; Frerman, Frank E; Eaton, Gareth R; Eaton, Sandra S

    2011-01-01

    Human electron transfer flavoprotein (ETF) is a soluble mitochondrial heterodimeric flavoprotein that links fatty acid β-oxidation to the main respiratory chain. The crystal structure of human ETF bound to medium chain acyl-CoA dehydrogenase indicates that the flavin adenine dinucleotide (FAD) domain (αII) is mobile, which permits more rapid electron transfer with donors and acceptors by providing closer access to the flavin and allows ETF to accept electrons from at least 10 different flavoprotein dehydrogenases. Sequence homology is high and low-angle X-ray scattering is identical for Paracoccus denitrificans (P. denitrificans) and human ETF. To characterize the orientations of the αII domain of P. denitrificans ETF, distances between enzymatically reduced FAD and spin labels in the three structural domains were measured by double electron-electron resonance (DEER) at X- and Q-bands. An FAD to spin label distance of 2.8 ± 0.15 nm for the label in the FAD-containing αII domain (A210C) agreed with estimates from the crystal structure (3.0 nm), molecular dynamics simulations (2.7 nm), and rotamer library analysis (2.8 nm). Distances between the reduced FAD and labels in αI (A43C) were between 4.0 and 4.5 ± 0.35 nm and for βIII (A111C) the distance was 4.3 ± 0.15 nm. These values were intermediate between estimates from the crystal structure of P. denitrificans ETF and a homology model based on substrate-bound human ETF. These distances suggest that the αII domain adopts orientations in solution that are intermediate between those which are observed in the crystal structures of free ETF (closed) and ETF bound to a dehydrogenase (open). PMID:21308847

  2. A Markov Random Field Framework for Protein Side-Chain Resonance Assignment

    NASA Astrophysics Data System (ADS)

    Zeng, Jianyang; Zhou, Pei; Donald, Bruce Randall

    Nuclear magnetic resonance (NMR) spectroscopy plays a critical role in structural genomics, and serves as a primary tool for determining protein structures, dynamics and interactions in physiologically-relevant solution conditions. The current speed of protein structure determination via NMR is limited by the lengthy time required in resonance assignment, which maps spectral peaks to specific atoms and residues in the primary sequence. Although numerous algorithms have been developed to address the backbone resonance assignment problem [68,2,10,37,14,64,1,31,60], little work has been done to automate side-chain resonance assignment [43, 48, 5]. Most previous attempts in assigning side-chain resonances depend on a set of NMR experiments that record through-bond interactions with side-chain protons for each residue. Unfortunately, these NMR experiments have low sensitivity and limited performance on large proteins, which makes it difficult to obtain enough side-chain resonance assignments. On the other hand, it is essential to obtain almost all of the side-chain resonance assignments as a prerequisite for high-resolution structure determination. To overcome this deficiency, we present a novel side-chain resonance assignment algorithm based on alternative NMR experiments measuring through-space interactions between protons in the protein, which also provide crucial distance restraints and are normally required in high-resolution structure determination. We cast the side-chain resonance assignment problem into a Markov Random Field (MRF) framework, and extend and apply combinatorial protein design algorithms to compute the optimal solution that best interprets the NMR data. Our MRF framework captures the contact map information of the protein derived from NMR spectra, and exploits the structural information available from the backbone conformations determined by orientational restraints and a set of discretized side-chain conformations (i.e., rotamers). A Hausdorff-based computation is employed in the scoring function to evaluate the probability of side-chain resonance assignments to generate the observed NMR spectra. The complexity of the assignment problem is first reduced by using a dead-end elimination (DEE) algorithm, which prunes side-chain resonance assignments that are provably not part of the optimal solution. Then an A* search algorithm is used to find a set of optimal side-chain resonance assignments that best fit the NMR data. We have tested our algorithm on NMR data for five proteins, including the FF Domain 2 of human transcription elongation factor CA150 (FF2), the B1 domain of Protein G (GB1), human ubiquitin, the ubiquitin-binding zinc finger domain of the human Y-family DNA polymerase Eta (pol η UBZ), and the human Set2-Rpb1 interacting domain (hSRI). Our algorithm assigns resonances for more than 90% of the protons in the proteins, and achieves about 80% correct side-chain resonance assignments. The final structures computed using distance restraints resulting from the set of assigned side-chain resonances have backbone RMSD 0.5 - 1.4 Å and all-heavy-atom RMSD 1.0 - 2.2 Å from the reference structures that were determined by X-ray crystallography or traditional NMR approaches. These results demonstrate that our algorithm can be successfully applied to automate side-chain resonance assignment and high-quality protein structure determination. Since our algorithm does not require any specific NMR experiments for measuring the through-bond interactions with side-chain protons, it can save a significant amount of both experimental cost and spectrometer time, and hence accelerate the NMR structure determination process.

  3. Proton-bound dimers of nitrogen heterocyclic molecules: Substituent effects on the structures and binding energies of homodimers of diazine, triazine, and fluoropyridine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Attah, Isaac K.; Platt, Sean P.; Meot-Ner, Michael

    2014-03-21

    The bonding energies of proton-bound homodimers BH{sup +}B were measured by ion mobility equilibrium studies and calculated at the DFT B3LYP/6-311++G{sup **} level, for a series of nitrogen heterocyclic molecules (B) with electron-withdrawing in-ring N and on-ring F substituents. The binding energies (ΔH°{sub dissoc}) of the proton-bound dimers (BH{sup +}B) vary significantly, from 29.7 to 18.1 kcal/mol, decreasing linearly with decreasing the proton affinity of the monomer (B). This trend differs significantly from the constant binding energies of most homodimers of other organic nitrogen and oxygen bases. The experimentally measured ΔH°{sub dissoc} for (1,3-diazine){sub 2}H{sup +}, i.e., (pyrimidine){sub 2}H{sup +}more » and (3-F-pyridine){sub 2}H{sup +} are 22.7 and 23.0 kcal/mol, respectively. The measured ΔH°{sub dissoc} for the pyrimidine{sup ·+}(3-F-pyridine) radical cation dimer (19.2 kcal/mol) is signifcantly lower than that of the proton-bound homodimers of pyrimidine and 3-F-pyridine, reflecting the stronger interaction in the ionic H-bond of the protonated dimers. The calculated binding energies for (1,2-diazine){sub 2}H{sup +}, (pyridine){sub 2}H{sup +}, (2-F-pyridine){sub 2}H{sup +}, (3-F-pyridine){sub 2}H{sup +}, (2,6-di-F-pyridine){sub 2}H{sup +}, (4-F-pyridine){sub 2}H{sup +}, (1,3-diazine){sub 2}H{sup +}, (1,4-diazine){sub 2}H{sup +}, (1,3,5-triazine){sub 2}H{sup +}, and (pentafluoropyridine){sub 2}H{sup +} are 29.7, 24.9, 24.8, 23.3, 23.2, 23.0, 22.4, 21.9, 19.3, and 18.1 kcal/mol, respectively. The electron-withdrawing substituents form internal dipoles whose electrostatic interactions contribute to both the decreased proton affinities of (B) and the decreased binding energies of the protonated dimers BH{sup +}B. The bonding energies also vary with rotation about the hydrogen bond, and they decrease in rotamers where the internal dipoles of the components are aligned efficiently for inter-ring repulsion. For compounds substituted at the 3 or 4 (meta or para) positions, the lowest energy rotamers are T-shaped with the planes of the two rings rotated by 90° about the hydrogen bond, while the planar rotamers are weakened by repulsion between the ortho hydrogen atoms of the two rings. Conversely, in ortho-substituted (1,2-diazine){sub 2}H{sup +} and (2-F-pyridine){sub 2}H{sup +}, attractive interactions between the ortho (C–H) hydrogen atoms of one ring and the electronegative ortho atoms (N or F) of the other ring are stabilizing, and increase the protonated dimer binding energies by up to 4 kcal/mol. In all of the dimers, rotation about the hydrogen bond can involve a 2–4 kcal/mol barrier due to the relative energies of the rotamers.« less

  4. Conformational analyses of 2,3-dihydroxypropanoic acid as a function of solvent and ionization state as determined by NMR spectroscopy.

    PubMed

    Drake, Michael D; Harsha, Alex K; Terterov, Sergei; Roberts, John D

    2006-03-01

    Vicinal (1)H--(1)H coupling constants were used to determine the conformational preferences of 2,3-dihydroxypropanoic acid (1) (DL-glyceric acid) in various solvents and its different carboxyl ionization states. The stereospecific assignments of J(12) and J(13) were confirmed through the point-group substitution of the C-3 hydrogen with deuterium, yielding rac-(2SR,3RS)-[3-(2)H]-1, and the observation of only J(13) in the (1)H NMR spectra. While hydrogen bonding and steric strain may be expected to drive the conformational equilibrium, their role is overshadowed by a profound gauche effect between the vicinal hydroxyl groups that mimics other substituted ethanes, such as 1,2-ethanediol and 1,2-difluoroethane. At low pH, the conformational equilibrium is heavily weighted toward the gauche-hydroxyl rotamers with a range of 81% in DMSO-d(6) to 92% in tert-butyl alcohol-d(10). At high pH, the equilibrium exhibits a larger dependence upon the polarity and solvating capability of the medium, although the gauche effect still dominates in D(2)O, 1,4-dioxane-d(8), methanol-d(4), and ethanol-d(6) (96, 89, 85, and 83% gauche-hydroxyls respectively). The observed preference for the gauche-hydroxyl rotamers is believed to stem primarily from hyperconjugative sigma(C--H) --> sigma*(C--OH) interactions.

  5. Advances in methods to characterize ligand-induced ionic lock and rotamer toggle molecular switch in G protein-coupled receptors.

    PubMed

    Xie, Xiang-Qun; Chowdhury, Ananda

    2013-01-01

    Structural biology of GPCRs has made significant progress upon recently developed technologies for GPCRs expression/purification and elucidation of GPCRs crystal structures. The crystal structures provide a snapshot of the receptor structural disposition of GPCRs itself or with cocrystallized ligands, and the results are congruent with biophysical and computer modeling studies reported about GPCRs conformational and dynamics flexibility, regulated activation, and the various stabilizing interactions, such as "molecular switches." The molecular switches generally constitute the most conserved domains within a particular GPCR superfamily. Often agonist-induced receptor activation proceeds by the disruption of majority of these interactions, while antagonist and inverse agonist act as blockers and structural stabilizers, respectively. Several elegant studies, particularly for the β2AR, have demonstrated the relationship between ligand structure, receptor conformational changes, and corresponding pharmacological outcomes. Thus, it is of great importance to understand GPCRs activation related to cell signaling pathways. Herein, we summarize the steps to produce functional GPCRs, generate suitably fluorescent labeled GPCRs and the procedure to use that to understand if ligand-induced activation can proceed by activation of the GPCRs via ionic lock switch and/or rotamer toggle switch mechanisms. Such understanding of ligand structure and mechanism of receptor activation will provide great insight toward uncovering newer pathways of GPCR activation and aid in structure-based drug design. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoobler, Preston Reece; Turney, Justin Matthew; Schaefer III, Henry

    The n-propylperoxy radical has been described as a molecule of critical importance to studies of low temperature combustion. Ab initio methods were used to study this three-carbon alkylperoxy radical, normal propylperoxy. Reliable CCSD(T)/ANO0 geometries were predicted for the molecule's five rotamers. For each rotamer, energetic predictions were made using basis sets as large as the cc-pV5Z in conjunction with coupled cluster levels of theory up to CCSDT(Q). Along with the extrapolations, corrections for relativistic effects, zero-point vibrational energies, and diagonal Born--Oppenheimer corrections were used to further refine energies. The results indicate that the lowest conformer is the gauche-gauche (GG) rotamermore » followed by the gauche-trans (0.12 kcal mol^-1 above GG), trans-gauche (0.44 kcal mol^-1), gauche'-gauche (0.47 kcal mol^-1), and trans-trans (0.57 kcal mol^-1). Fundamental vibrational frequencies were obtained using second-order vibrational perturbation theory (VPT2). This is the first time anharmonic frequencies have been computed for this system. The most intense IR features include all but one of the C-H stretches. The O-O fundamental (1063 cm^-1 for the GG structure) also has a significant IR intensity, 19.6 km mol^-1. The anharmonicity effects on the potential energy surface were also used to compute vibrationally averaged r_g,0 K bond lengths, accounting for zero-point vibrations present within the molecule.« less

  7. Exploring the parameter space of the coarse-grained UNRES force field by random search: selecting a transferable medium-resolution force field.

    PubMed

    He, Yi; Xiao, Yi; Liwo, Adam; Scheraga, Harold A

    2009-10-01

    We explored the energy-parameter space of our coarse-grained UNRES force field for large-scale ab initio simulations of protein folding, to obtain good initial approximations for hierarchical optimization of the force field with new virtual-bond-angle bending and side-chain-rotamer potentials which we recently introduced to replace the statistical potentials. 100 sets of energy-term weights were generated randomly, and good sets were selected by carrying out replica-exchange molecular dynamics simulations of two peptides with a minimal alpha-helical and a minimal beta-hairpin fold, respectively: the tryptophan cage (PDB code: 1L2Y) and tryptophan zipper (PDB code: 1LE1). Eight sets of parameters produced native-like structures of these two peptides. These eight sets were tested on two larger proteins: the engrailed homeodomain (PDB code: 1ENH) and FBP WW domain (PDB code: 1E0L); two sets were found to produce native-like conformations of these proteins. These two sets were tested further on a larger set of nine proteins with alpha or alpha + beta structure and found to locate native-like structures of most of them. These results demonstrate that, in addition to finding reasonable initial starting points for optimization, an extensive search of parameter space is a powerful method to produce a transferable force field. Copyright 2009 Wiley Periodicals, Inc.

  8. Microwave spectrum, conformational properties, and dipole moment of cyclopropylmethyl isocyanide (C3H5CH2NC).

    PubMed

    Samdal, Svein; Møllendal, Harald; Guillemin, Jean-Claude

    2013-06-20

    The microwave spectrum of cyclopropylmethyl isocyanide, C3H5CH2NC, has been investigated in the 25-75 GHz spectral range. The spectra of two conformers were assigned. The H-C-C-N chain of atoms is antiperiplanar in the conformer denoted ap and synclinal in the sc rotamer. The sc conformer tends to be slightly more stable than the ap form. The internal energy difference was determined to be Eap - Esc = 0.2(7) kJ/mol from relative intensity measurements. The spectra of the ground vibrational state and six vibrationally excited states belonging to two different normal vibrations were assigned for sc. The frequencies of these two modes were determined by relative intensity measurements. The dipole moment of this conformer was determined to be μa = 12.16(6), μb = 5.91(4), μc = 0 (preset), and μtot = 13.52(6) × 10(-30) C m [4.05 (2) debye]. The spectra of the ground and of two vibrationally excited states belonging to the torsion and lowest bending vibration were assigned for ap. The microwave work was supported by quantum chemical calculations at the CCSD/cc-pVTZ and B3LYP/cc-pVTZ levels of theory. Most, but not all, of the theoretical predictions are in good agreement with experiment.

  9. An Amino Acid Code to Define a Protein’s Tertiary Packing Surface

    PubMed Central

    Fraga, Keith J.; Joo, Hyun; Tsai, Jerry

    2015-01-01

    One difficult aspect of the protein-folding problem is characterizing the non-specific interactions that define packing in protein tertiary structure. To better understand tertiary structure, this work extends the knob-socket model by classifying the interactions of a single knob residue packed into a set of contiguous sockets, or a pocket made up of 4 or more residues. The knob-socket construct allows for a symbolic two-dimensional mapping of pockets. The two-dimensional mapping of pockets provides a simple method to investigate the variety of pocket shapes in order to understand the geometry of protein tertiary surfaces. The diversity of pocket geometries can be organized into groups of pockets that share a common core, which suggests that some interactions in pockets are ancillary to packing. Further analysis of pocket geometries displays a preferred configuration that is right-handed in α-helices and left-handed in β-sheets. The amino acid composition of pockets illustrates the importance of non-polar amino acids in packing as well as position specificity. As expected, all pocket shapes prefer to pack with hydrophobic knobs; however, knobs are not selective for the pockets they pack. Investigating side-chain rotamer preferences for certain pocket shapes uncovers no strong correlations. These findings allow a simple vocabulary based on knobs and sockets to describe protein tertiary packing that supports improved analysis, design and prediction of protein structure. PMID:26575337

  10. Quantum Chemical and Physicochemical Studies of Oximes (Prophylactics against and Reactivators of Phosphorylated AChE).

    DTIC Science & Technology

    1984-10-25

    crystal structure of nicotinic acid ,. and we used the ether bridge from the crystal structure of dimethyl ether. We are investigating various rotamers...observations were made: - The titration curve (after the subtraction of the blank curve) shows only one titrable group, i.e. the oxime moiety. - The...subtraction of the blank curve, shows two titrable groups, i.e. the two oxime moieties. The results are as follows: Temperature Conditions PKa pK2

  11. TCR-contacting residues orientation and HLA-DRβ* binding preference determine long-lasting protective immunity against malaria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alba, Martha P.; Suarez, Carlos F.; Universidad del Rosario, Bogotá D. C.

    Fully-protective, long-lasting, immunological (FPLLI) memory against Plasmodium falciparum malaria regarding immune protection-inducing protein structures (IMPIPS) vaccinated into monkeys previously challenged and re-challenged 60 days later with a lethal Aotus monkey-adapted P. falciparum strain was found to be associated with preferential high binding capacity to HLA-DRβ1* allelic molecules of the major histocompatibility class II (MHC-II), rather than HLA-DRβ3*, β4*, β5* alleles. Complete PPII{sub L} 3D structure, a longer distance (26.5 Å ± 1.5 Å) between residues perfectly fitting into HLA-DRβ1*PBR pockets 1 and 9, a gauche{sup −} rotamer orientation in p8 TCR-contacting polar residue and a larger volume of polar p2 residues was also found. Thismore » data, in association with previously-described p3 and p7 apolar residues having gauche{sup +} orientation to form a perfect MHC-II-peptide-TCR complex, determines the stereo-electronic and topochemical characteristics associated with FPLLI immunological memory. - Highlights: • Stereo-electronic and topochemical rules associated with FPLLI immunological memory. • Presence of very high long-lasting antibody titres against Plasmodium falciparum Spz. • Protective memory induction associated with a binding capacity to HLA-DRβ1*. • gauche{sup −} rotamer orientation in p8 polar residue is related to is related to immunological memory.« less

  12. Peptidomimetic Escape Mechanisms Arise via Genetic Diversity in the Ligand-Binding Site of the Hepatitis C Virus NS3/4A Serine Protease

    PubMed Central

    Welsch, Christoph; Shimakami, Tetsuro; Hartmann, Christoph; Yang, Yan; Domingues, Francisco S.; Lengauer, Thomas; Zeuzem, Stefan; Lemon, Stanley M.

    2011-01-01

    Background & Aims It is a challenge to develop direct-acting antiviral agents (DAAs) that target the NS3/4A protease of hepatitis C virus (HCV) because resistant variants develop. Ketoamide compounds, designed to mimic the natural protease substrate, have been developed as inhibitors. However, clinical trials have revealed rapid selection of resistant mutants, most of which are considered to be pre-existing variants. Methods We identified residues near the ketoamide-binding site in X-ray structures of the genotype 1a protease, co-crystallized with boceprevir or a telaprevir-like ligand, and then identified variants at these positions in 219 genotype 1 sequences from a public database. We used side-chain modeling to assess the potential effects of these variants on the interaction between ketoamide and the protease, and compared these results with the phenotypic effects on ketoamide resistance, RNA replication capacity, and infectious virus yields in a cell culture model of infection. Results Thirteen natural binding-site variants with potential for ketoamide resistance were identified at 10 residues in the protease, near the ketoamide binding site. Rotamer analysis of amino acid side-chain conformations indicated that 2 variants (R155K and D168G) could affect binding of telaprevir more than boceprevir. Measurements of antiviral susceptibility in cell culture studies were consistent with this observation. Four variants (Q41H, I132V, R155K, and D168G) caused low-to-moderate levels of ketoamide resistance; 3 of these were highly fit (Q41H, I132V, and R155K). Conclusions Using a comprehensive sequence and structure-based analysis, we showed how natural variation in the HCV protease NS3/4A sequences might affect susceptibility to first-generation DAAs. These findings increase our understanding of the molecular basis of ketoamide resistance among naturally existing viral variants. PMID:22155364

  13. Electron transfer flavoprotein domain II orientation monitored using double electron-electron resonance between an enzymatically reduced, native FAD cofactor, and spin labels.

    PubMed

    Swanson, Michael A; Kathirvelu, Velavan; Majtan, Tomas; Frerman, Frank E; Eaton, Gareth R; Eaton, Sandra S

    2011-03-01

    Human electron transfer flavoprotein (ETF) is a soluble mitochondrial heterodimeric flavoprotein that links fatty acid β-oxidation to the main respiratory chain. The crystal structure of human ETF bound to medium chain acyl-CoA dehydrogenase indicates that the flavin adenine dinucleotide (FAD) domain (αII) is mobile, which permits more rapid electron transfer with donors and acceptors by providing closer access to the flavin and allows ETF to accept electrons from at least 10 different flavoprotein dehydrogenases. Sequence homology is high and low-angle X-ray scattering is identical for Paracoccus denitrificans (P. denitrificans) and human ETF. To characterize the orientations of the αII domain of P. denitrificans ETF, distances between enzymatically reduced FAD and spin labels in the three structural domains were measured by double electron-electron resonance (DEER) at X- and Q-bands. An FAD to spin label distance of 2.8 ± 0.15 nm for the label in the FAD-containing αII domain (A210C) agreed with estimates from the crystal structure (3.0 nm), molecular dynamics simulations (2.7 nm), and rotamer library analysis (2.8 nm). Distances between the reduced FAD and labels in αI (A43C) were between 4.0 and 4.5 ± 0.35 nm and for βIII (A111C) the distance was 4.3 ± 0.15 nm. These values were intermediate between estimates from the crystal structure of P. denitrificans ETF and a homology model based on substrate-bound human ETF. These distances suggest that the αII domain adopts orientations in solution that are intermediate between those which are observed in the crystal structures of free ETF (closed) and ETF bound to a dehydrogenase (open). Copyright © 2011 The Protein Society.

  14. Conformational properties of chiral tobacco alkaloids by DFT calculations and vibrational circular dichroism: (-)-S-anabasine.

    PubMed

    Rodríguez Ortega, P G; Montejo, M; Márquez, F; López González, J J

    2015-07-01

    A thorough DFT and MM study of the conformational landscape, molecular and electronic structures of (-)-S-anabasine is reported aimed to reveal the mechanism controlling its conformational preference. Although the conformational flexibility and diversity of this system is quite extensive, only two structures are populated both in gas-phase and solution (CCl4 and DMSO). NBO-aided electronic structure analyses performed for the eight conformers representing minima in the potential energy surface of (-)-S-anabasine indicate that both steric and electrostatic factors are determinant in the conformational distribution of the sample in gas phase. Nonetheless, hyperconjugative effects are the key force tipping the balance in the conformational equilibrium between the two main rotamers. Increasing the polarity of the medium (using the IEF-PCM formalism) barely affect the conformational energy profile, although a slight increase in the theoretical population of those structures more affected by electrostatic interactions is predicted. The validity of the theoretical models and calculated conformers populations are endorsed by the accurate reproduction of the IR and VCD spectra (recorded in pure liquid and in CCl4 solution) of the sample (that have been firstly recorded and assigned in the present work) which are consistent with the occurrence of a 2:1 conformational ratio. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Design and Conformational Analysis of Peptoids Containing N-Hydroxy Amides Reveals a Unique Sheet-Like Secondary Structure

    PubMed Central

    Crapster, J. Aaron; Stringer, Joseph R.; Guzei, Ilia A.; Blackwell, Helen E.

    2011-01-01

    N-hydroxy amides can be found in many naturally occurring and synthetic compounds and are known to act as both strong proton donors and chelators of metal cations. We have initiated studies of peptoids, or N-substituted glycines, that contain N-hydroxy amide side chains to investigate the potential effects of these functional groups on peptoid backbone amide rotamer equilibria and local conformations. We reasoned that the propensity of these functional groups to participate in hydrogen bonding could be exploited to enforce intramolecular or intermolecular interactions that yield new peptoid structures. Here, we report the design, synthesis, and detailed conformational analysis of a series of model N-hydroxy peptoids. These peptoids were readily synthesized, and their structures were analyzed in solution by 1D and 2D NMR and in the solid-state by X-ray crystallography. The N-hydroxy amides were found to strongly favor trans conformations with respect to the peptoid backbone in chloroform. More notably, unique sheet-like structures held together via intermolecular hydrogen bonds were observed in the X-ray crystal structures of an N-hydroxy amide peptoid dimer, which to our knowledge represent the first structure of this type reported for peptoids. These results suggest that the N-hydroxy amide can be utilized to control both local backbone geometries and longer-range intermolecular interactions in peptoids, and represents a new functional group in the peptoid design toolbox. PMID:22180908

  16. GRID: a high-resolution protein structure refinement algorithm.

    PubMed

    Chitsaz, Mohsen; Mayo, Stephen L

    2013-03-05

    The energy-based refinement of protein structures generated by fold prediction algorithms to atomic-level accuracy remains a major challenge in structural biology. Energy-based refinement is mainly dependent on two components: (1) sufficiently accurate force fields, and (2) efficient conformational space search algorithms. Focusing on the latter, we developed a high-resolution refinement algorithm called GRID. It takes a three-dimensional protein structure as input and, using an all-atom force field, attempts to improve the energy of the structure by systematically perturbing backbone dihedrals and side-chain rotamer conformations. We compare GRID to Backrub, a stochastic algorithm that has been shown to predict a significant fraction of the conformational changes that occur with point mutations. We applied GRID and Backrub to 10 high-resolution (≤ 2.8 Å) crystal structures from the Protein Data Bank and measured the energy improvements obtained and the computation times required to achieve them. GRID resulted in energy improvements that were significantly better than those attained by Backrub while expending about the same amount of computational resources. GRID resulted in relaxed structures that had slightly higher backbone RMSDs compared to Backrub relative to the starting crystal structures. The average RMSD was 0.25 ± 0.02 Å for GRID versus 0.14 ± 0.04 Å for Backrub. These relatively minor deviations indicate that both algorithms generate structures that retain their original topologies, as expected given the nature of the algorithms. Copyright © 2012 Wiley Periodicals, Inc.

  17. The 1,5-H-shift in 1-butoxy: A case study in the rigorous implementation of transition state theory for a multirotamer system

    NASA Astrophysics Data System (ADS)

    Vereecken, Luc; Peeters, Jozef

    2003-09-01

    The rigorous implementation of transition state theory (TST) for a reaction system with multiple reactant rotamers and multiple transition state conformers is discussed by way of a statistical rate analysis of the 1,5-H-shift in 1-butoxy radicals, a prototype reaction for the important class of H-shift reactions in atmospheric chemistry. Several approaches for deriving a multirotamer TST expression are treated: oscillator versus (hindered) internal rotor models; distinguishable versus indistinguishable atoms; and direct count methods versus degeneracy factors calculated by (simplified) direct count methods or from symmetry numbers and number of enantiomers, where applicable. It is shown that the various treatments are fully consistent, even if the TST expressions themselves appear different. The 1-butoxy H-shift reaction is characterized quantum chemically using B3LYP-DFT; the performance of this level of theory is compared to other methods. Rigorous application of the multirotamer TST methodology in an harmonic oscillator approximation based on this data yields a rate coefficient of k(298 K,1 atm)=1.4×105 s-1, and an Arrhenius expression k(T,1 atm)=1.43×1011 exp(-8.17 kcal mol-1/RT) s-1, which both closely match the experimental recommendations in the literature. The T-dependence is substantially influenced by the multirotamer treatment, as well as by the tunneling and fall-off corrections. The present results are compared to those of simplified TST calculations based solely on the properties of the lowest energy 1-butoxy rotamer.

  18. Vibrational entropy of a protein: large differences between distinct conformations.

    PubMed

    Goethe, Martin; Fita, Ignacio; Rubi, J Miguel

    2015-01-13

    In this article, it is investigated whether vibrational entropy (VE) is an important contribution to the free energy of globular proteins at ambient conditions. VE represents the major configurational-entropy contribution of these proteins. By definition, it is an average of the configurational entropies of the protein within single minima of the energy landscape, weighted by their occupation probabilities. Its large part originates from thermal motion of flexible torsion angles giving rise to the finite peak widths observed in torsion angle distributions. While VE may affect the equilibrium properties of proteins, it is usually neglected in numerical calculations as its consideration is difficult. Moreover, it is sometimes believed that all well-packed conformations of a globular protein have similar VE anyway. Here, we measure explicitly the VE for six different conformations from simulation data of a test protein. Estimates are obtained using the quasi-harmonic approximation for three coordinate sets, Cartesian, bond-angle-torsion (BAT), and a new set termed rotamer-degeneracy lifted BAT coordinates by us. The new set gives improved estimates as it overcomes a known shortcoming of the quasi-harmonic approximation caused by multiply populated rotamer states, and it may serve for VE estimation of macromolecules in a very general context. The obtained VE values depend considerably on the type of coordinates used. However, for all coordinate sets we find large entropy differences between the conformations, of the order of the overall stability of the protein. This result may have important implications on the choice of free energy expressions used in software for protein structure prediction, protein design, and NMR refinement.

  19. Rapid computational identification of the targets of protein kinase inhibitors.

    PubMed

    Rockey, William M; Elcock, Adrian H

    2005-06-16

    We describe a method for rapidly computing the relative affinities of an inhibitor for all individual members of a family of homologous receptors. The approach, implemented in a new program, SCR, models inhibitor-receptor interactions in full atomic detail with an empirical energy function and includes an explicit account of flexibility in homology-modeled receptors through sampling of libraries of side chain rotamers. SCR's general utility was demonstrated by application to seven different protein kinase inhibitors: for each inhibitor, relative binding affinities with panels of approximately 20 protein kinases were computed and compared with experimental data. For five of the inhibitors (SB203580, purvalanol B, imatinib, H89, and hymenialdisine), SCR provided excellent reproduction of the experimental trends and, importantly, was capable of identifying the targets of inhibitors even when they belonged to different kinase families. The method's performance in a predictive setting was demonstrated by performing separate training and testing applications, and its key assumptions were tested by comparison with a number of alternative approaches employing the ligand-docking program AutoDock (Morris et al. J. Comput. Chem. 1998, 19, 1639-1662). These comparison tests included using AutoDock in nondocking and docking modes and performing energy minimizations of inhibitor-kinase complexes with the molecular mechanics code GROMACS (Berendsen et al. Comput. Phys. Commun. 1995, 91, 43-56). It was found that a surprisingly important aspect of SCR's approach is its assumption that the inhibitor be modeled in the same orientation for each kinase: although this assumption is in some respects unrealistic, calculations that used apparently more realistic approaches produced clearly inferior results. Finally, as a large-scale application of the method, SB203580, purvalanol B, and imatinib were screened against an almost full complement of 493 human protein kinases using SCR in order to identify potential new targets; the predicted targets of SB203580 were compared with those identified in recent proteomics-based experiments. These kinome-wide screens, performed within a day on a small cluster of PCs, indicate that explicit computation of inhibitor-receptor binding affinities has the potential to promote rapid discovery of new therapeutic targets for existing inhibitors.

  20. Synthesis of chlorophyll-a derivatives methylated in the 3-vinyl group and their intrinsic site energy.

    PubMed

    Tamiaki, Hitoshi; Tsuji, Kazuki; Kuno, Masaki; Kimura, Yuki; Watanabe, Hiroaki; Miyatake, Tomohiro

    2016-07-01

    Wittig reaction of methyl pyropheophorbide-d possessing the 3-formyl group gave readily methyl pyropheophorbides-a bearing a variety of 3-alkenyl groups as semi-synthetic models of chlorophyll-a. The 3-substituents rotated around the C3-C3(1) bond from the coplanar conformation with the chlorin π-system, moving the redmost visible absorption maxima to a shorter wavelength. The model experiments showed that natural chlorophyll-a carrying the 3-vinyl group would take a similar rotamer to control its intrinsic site energy. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. How water interacts with halogenated anesthetics: the rotational spectrum of isoflurane-water.

    PubMed

    Gou, Qian; Feng, Gang; Evangelisti, Luca; Vallejo-López, Montserrat; Spada, Lorenzo; Lesarri, Alberto; Cocinero, Emilio J; Caminati, Walther

    2014-02-10

    The rotational spectra of several isotopologues of the 1:1 complex between the inhaled anesthetic isoflurane and water have been recorded and analyzed by using Fourier transform microwave spectroscopy. The rotational spectrum showed a single rotamer, corresponding to the configuration in which the most stable conformer of isolated isoflurane is linked to the water molecule through an almost linear C-H⋅⋅⋅O weak hydrogen bond. All transitions display a hyperfine structure due to the (35)Cl (or (37)Cl) nuclear quadrupole effects. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Unit and internal chain profile of African rice (Oryza glaberrima) amylopectin.

    PubMed

    Gayin, Joseph; Abdel-Aal, El-Sayed M; Manful, John; Bertoft, Eric

    2016-02-10

    High-performance anion-exchange chromatography was used to study the unit chain profiles of amylopectins and their φ,β-limit dextrins from two African rice (Oryza glaberrima) accessions-TOG 12440 and IRGC 103759. The samples were compared with two Asian rice (Oryza sativa) samples (cv Koshihikari and cv WITA 4) and one O. sativa × O. glaberrima cross (NERICA 4). The ratio of short:long chains ranged between 12.1 and 13.8, and the ratio of A:B-chains was ∼ 1.0 in all samples. A significant difference was observed in the distribution of internal chains with regards to the proportion of short "fingerprint" B-chains (Bfp-chains), which in the φ,β-limit dextrins have a degree of polymerization (DP) 3-7. The African rice starches and NERICA 4 had higher levels of Bfp-chains, but the major group of short B-chains (DP 8-25) was similar to that of the Asian rice samples. The average chain length (CL), internal chain length (ICL), and total internal chain length (TICL) were similar in all samples. However, the external chain length (ECL) was longer in the African rice samples and NERICA 4. ECL correlated positively and significantly (p<0.05) with gelatinization transition temperatures and enthalpy suggesting differences between the two rice types in cooking properties. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. An ultrafast spectroscopic and quantum mechanical investigation of multiple emissions in push-pull pyridinium derivatives bearing different electron donors.

    PubMed

    Carlotti, B; Benassi, E; Cesaretti, A; Fortuna, C G; Spalletti, A; Barone, V; Elisei, F

    2015-08-28

    A joint experimental and theoretical approach, involving state-of-the-art femtosecond fluorescence up-conversion measurements and quantum mechanical computations including vibronic effects, was employed to get a deep insight into the excited state dynamics of two cationic dipolar chromophores (Donor-π-Acceptor(+)) where the electron deficient portion is a N-methyl pyridinium and the electron donor a trimethoxyphenyl or a pyrene, respectively. The ultrafast spectroscopic investigation, and the time resolved area normalised emission spectra in particular, revealed a peculiar multiple emissive behaviour and allowed the distinct emitting states to be remarkably distinguished from solvation dynamics, occurring in water in a similar timescale. The two and three emissions experimentally detected for the trimethoxyphenyl and pyrene derivatives, respectively, were associated with specific local emissive minima in the potential energy surface of S1 on the ground of quantum-mechanical calculations. A low polar and planar Locally Excited (LE) state together with a highly polar and Twisted Intramolecular Charge Transfer (TICT) state is identified to be responsible for the dual emission of the trimethoxyphenyl compound. Interestingly, the more complex photobehaviour of the pyrenyl derivative was explained considering the contribution to the fluorescence coming not only from the LE and TICT states but also from a nearly Planar Intramolecular Charge Transfer (PICT) state, with both the TICT and the PICT generated from LE by progressive torsion around the quasi-single bond between the methylpyridinium and the ethene bridge. These findings point to an interconversion between rotamers for the pyrene compound taking place in its excited state against the Non-equilibrated Excited Rotamers (NEER) principle.

  4. Influence of Glu/Arg, Asp/Arg, and Glu/Lys Salt Bridges on α-Helical Stability and Folding Kinetics.

    PubMed

    Meuzelaar, Heleen; Vreede, Jocelyne; Woutersen, Sander

    2016-06-07

    Using a combination of ultraviolet circular dichroism, temperature-jump transient-infrared spectroscopy, and molecular dynamics simulations, we investigate the effect of salt bridges between different types of charged amino-acid residue pairs on α-helix folding. We determine the stability and the folding and unfolding rates of 12 alanine-based α-helical peptides, each of which has a nearly identical composition containing three pairs of positively and negatively charged residues (either Glu(-)/Arg(+), Asp(-)/Arg(+), or Glu(-)/Lys(+)). Within each set of peptides, the distance and order of the oppositely charged residues in the peptide sequence differ, such that they have different capabilities of forming salt bridges. Our results indicate that stabilizing salt bridges (in which the interacting residues are spaced and ordered such that they favor helix formation) speed up α-helix formation by up to 50% and slow down the unfolding of the α-helix, whereas salt bridges with an unfavorable geometry have the opposite effect. Comparing the peptides with different types of charge pairs, we observe that salt bridges between side chains of Glu(-) and Arg(+) are most favorable for the speed of folding, probably because of the larger conformational space of the salt-bridging Glu(-)/Arg(+) rotamer pairs compared to Asp(-)/Arg(+) and Glu(-)/Lys(+). We speculate that the observed impact of salt bridges on the folding kinetics might explain why some proteins contain salt bridges that do not stabilize the final, folded conformation. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  5. Targeting Neuroblastoma Cell Surface Proteins: Recommendations for Homology Modeling of hNET, ALK, and TrkB.

    PubMed

    Haddad, Yazan; Heger, Zbyněk; Adam, Vojtech

    2017-01-01

    Targeted therapy is a promising approach for treatment of neuroblastoma as evident from the large number of targeting agents employed in clinical practice today. In the absence of known crystal structures, researchers rely on homology modeling to construct template-based theoretical structures for drug design and testing. Here, we discuss three candidate cell surface proteins that are suitable for homology modeling: human norepinephrine transporter (hNET), anaplastic lymphoma kinase (ALK), and neurotrophic tyrosine kinase receptor 2 (NTRK2 or TrkB). When choosing templates, both sequence identity and structure quality are important for homology modeling and pose the first of many challenges in the modeling process. Homology modeling of hNET can be improved using template models of dopamine and serotonin transporters instead of the leucine transporter (LeuT). The extracellular domains of ALK and TrkB are yet to be exploited by homology modeling. There are several idiosyncrasies that require direct attention throughout the process of model construction, evaluation and refinement. Shifts/gaps in the alignment between the template and target, backbone outliers and side-chain rotamer outliers are among the main sources of physical errors in the structures. Low-conserved regions can be refined with loop modeling method. Residue hydrophobicity, accessibility to bound metals or glycosylation can aid in model refinement. We recommend resolving these idiosyncrasies as part of "good modeling practice" to obtain highest quality model. Decreasing physical errors in protein structures plays major role in the development of targeting agents and understanding of chemical interactions at the molecular level.

  6. Assignments of /sup 1/H nuclear magnetic resonances of the cystyl, asparaginyl, and aromatic residues of arginine vasopressin in D/sub 2/O. A comparison with lysine vasopressin and oxytocin in terms of solution conformation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wyssbrod, H.R.; Fischman, A.J.; Live, D.H.

    1979-07-18

    The resonances of the C/sup ..cap alpha../ and C/sup ..beta../ protons of the cystyl, asparaginyl, and aromatic residues of (8-arginine)vasopressin (AVP) in D/sub 2/O at pD 3.8 and 20/sup 0/C were assigned in a rigorous manner by the use of isotopic isomers of AVP that contain specific replacements of protons by deuterons and by comparison of /sup 1/H NMR characteristics of AVP to those of (8-lysine)vasopressin (LVP) and oxytocin (OT). Although there is extensive overlap of resonances of C/sup ..beta../ protons even at 360 MHz, all of the chemical shifts of these protons and most of the couplings between themmore » and their vicinal C/sup ..cap alpha../ protons could be determined, at least to a first approximation. It was concluded that the cyclic moieties (residues 1-6) of AVP, LVP, and OT possess essentially the same overall backbone conformation, and that the side-chain conformation - or rotamer populations - about the C/sup ..cap alpha../-C/sup ..beta../ bonds of the cystyl residue (positions 1 and 6), the tyrosyl residue (position 2), and the asparaginyl residue (position 5) are similar. This study indicates that selective replacements of C/sup ..beta../ protons by deuterons are necessary to improve the accuracy of coupling constants extracted from 360-MHz spectra of a AVP for use in conformational analysis.« less

  7. A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.

    PubMed

    Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat

    2016-12-01

    To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.

  8. SAChES: Scalable Adaptive Chain-Ensemble Sampling.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Swiler, Laura Painton; Ray, Jaideep; Ebeida, Mohamed Salah

    We present the development of a parallel Markov Chain Monte Carlo (MCMC) method called SAChES, Scalable Adaptive Chain-Ensemble Sampling. This capability is targed to Bayesian calibration of com- putationally expensive simulation models. SAChES involves a hybrid of two methods: Differential Evo- lution Monte Carlo followed by Adaptive Metropolis. Both methods involve parallel chains. Differential evolution allows one to explore high-dimensional parameter spaces using loosely coupled (i.e., largely asynchronous) chains. Loose coupling allows the use of large chain ensembles, with far more chains than the number of parameters to explore. This reduces per-chain sampling burden, enables high-dimensional inversions and the usemore » of computationally expensive forward models. The large number of chains can also ameliorate the impact of silent-errors, which may affect only a few chains. The chain ensemble can also be sampled to provide an initial condition when an aberrant chain is re-spawned. Adaptive Metropolis takes the best points from the differential evolution and efficiently hones in on the poste- rior density. The multitude of chains in SAChES is leveraged to (1) enable efficient exploration of the parameter space; and (2) ensure robustness to silent errors which may be unavoidable in extreme-scale computational platforms of the future. This report outlines SAChES, describes four papers that are the result of the project, and discusses some additional results.« less

  9. Structural Basis for Parathyroid Hormone-related Protein Binding to the Parathyroid Hormone Receptor and Design of Conformation-selective Peptides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pioszak, Augen A.; Parker, Naomi R.; Gardella, Thomas J.

    2009-12-01

    Parathyroid hormone (PTH) and PTH-related protein (PTHrP) are two related peptides that control calcium/phosphate homeostasis and bone development, respectively, through activation of the PTH/PTHrP receptor (PTH1R), a class B G protein-coupled receptor. Both peptides hold clinical interest for their capacities to stimulate bone formation. PTH and PTHrP display different selectivity for two distinct PTH1R conformations, but how their binding to the receptor differs is unclear. The high resolution crystal structure of PTHrP bound to the extracellular domain (ECD) of PTH1R reveals that PTHrP binds as an amphipathic {alpha}-helix to the same hydrophobic groove in the ECD as occupied by PTH,more » but in contrast to a straight, continuous PTH helix, the PTHrP helix is gently curved and C-terminally 'unwound.' The receptor accommodates the altered binding modes by shifting the side chain conformations of two residues within the binding groove: Leu-41 and Ile-115, the former acting as a rotamer toggle switch to accommodate PTH/PTHrP sequence divergence, and the latter adapting to the PTHrP curvature. Binding studies performed with PTH/PTHrP hybrid ligands having reciprocal exchanges of residues involved in different contacts confirmed functional consequences for the altered interactions and enabled the design of altered PTH and PTHrP peptides that adopt the ECD-binding mode of the opposite peptide. Hybrid peptides that bound the ECD poorly were selective for the G protein-coupled PTH1R conformation. These results establish a molecular model for better understanding of how two biologically distinct ligands can act through a single receptor and provide a template for designing better PTH/PTHrP therapeutics.« less

  10. A conformational study of protonated noradrenaline by UV-UV and IR dip double resonance laser spectroscopy combined with an electrospray and a cold ion trap method.

    PubMed

    Wako, Hiromichi; Ishiuchi, Shun-Ichi; Kato, Daichi; Féraud, Géraldine; Dedonder-Lardeux, Claude; Jouvet, Christophe; Fujii, Masaaki

    2017-05-03

    The conformer-selected ultraviolet (UV) and infrared (IR) spectra of protonated noradrenaline were measured using an electrospray/cryogenic ion trap technique combined with photo-dissociation spectroscopy. By comparing the UV photo dissociation (UVPD) spectra with the UV-UV hole burning (HB) spectra, it was found that five conformers coexist under ultra-cold conditions. Based on the spectral features of the IR dip spectra of each conformer, two different conformations on the amine side chain were identified. Three conformers (group I) were assigned to folded and others (group II) to extended structures by comparing the observed IR spectra with the calculated ones. Observation of the significantly less-stable extended conformers strongly suggests that the extended structures are dominant in solution and are detected in the gas phase by kinetic trapping. The conformers in each group are assignable to rotamers of OH orientations in the catechol ring. By comparing the UV-UV HB spectra and the calculated Franck-Condon spectra obtained by harmonic vibrational analysis of the S 1 state, with the aid of relative stabilization energies of each conformer in the S 0 state, the absolute orientations of catechol OHs of the observed five conformers were successfully determined. It was found that the 0-0 transition of one folded conformer is red-shifted by about 1000 cm -1 from the others. The significant red-shift was explained by a large contribution of the πσ* state to S 1 in the conformer in which an oxygen atom of the meta-OH group is close to the ammonium group.

  11. Parallel Computational Protein Design.

    PubMed

    Zhou, Yichao; Donald, Bruce R; Zeng, Jianyang

    2017-01-01

    Computational structure-based protein design (CSPD) is an important problem in computational biology, which aims to design or improve a prescribed protein function based on a protein structure template. It provides a practical tool for real-world protein engineering applications. A popular CSPD method that guarantees to find the global minimum energy solution (GMEC) is to combine both dead-end elimination (DEE) and A* tree search algorithms. However, in this framework, the A* search algorithm can run in exponential time in the worst case, which may become the computation bottleneck of large-scale computational protein design process. To address this issue, we extend and add a new module to the OSPREY program that was previously developed in the Donald lab (Gainza et al., Methods Enzymol 523:87, 2013) to implement a GPU-based massively parallel A* algorithm for improving protein design pipeline. By exploiting the modern GPU computational framework and optimizing the computation of the heuristic function for A* search, our new program, called gOSPREY, can provide up to four orders of magnitude speedups in large protein design cases with a small memory overhead comparing to the traditional A* search algorithm implementation, while still guaranteeing the optimality. In addition, gOSPREY can be configured to run in a bounded-memory mode to tackle the problems in which the conformation space is too large and the global optimal solution cannot be computed previously. Furthermore, the GPU-based A* algorithm implemented in the gOSPREY program can be combined with the state-of-the-art rotamer pruning algorithms such as iMinDEE (Gainza et al., PLoS Comput Biol 8:e1002335, 2012) and DEEPer (Hallen et al., Proteins 81:18-39, 2013) to also consider continuous backbone and side-chain flexibility.

  12. Pyrrolizine-1,3-dione.

    PubMed

    McNab, Hamish; Montgomery, James; Parsons, Simon; Tredgett, David G

    2010-10-07

    Pyrrolizine-1,3-dione 4 was made by oxidation of the alcohol 2 using pyridinium chlorochromate. The dione 4 shows ketone properties (e.g. formation of DNP derivative 11) and, in common with other pyrrolizinones, the lactam unit is readily ring-opened by methanol under basic conditions. The active methylene unit of 4 couples readily with diazonium salts to provide the hydrazone 15 whose structure was confirmed by X-ray crystallography. The 'Meldrumsated' derivative 18 exists exclusively as the tautomer 18F; flash vacuum pyrolysis (FVP) of 18 at 700 degrees C gives the pyronopyrrolizine 20 exclusively. Reaction of 4 with DMF acetal gives the dimethylaminomethylene derivative 22 which exists as a mixture of rotamers at room temperature.

  13. Characterization of the binding of 8-anilinonaphthalene sulphonate to rat class Mu GST M1-1

    PubMed Central

    Kinsley, Nichole; Sayed, Yasien; Armstrong, Richard N.; Dirr, Heini W.

    2008-01-01

    Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulphonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5–30 °C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a ΔCp of −80 ± 4 cal K−1 mol−1 indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins. PMID:18703268

  14. Chain of custody; recommendations for acceptance and analysis of evidentiary geochemical samples

    USGS Publications Warehouse

    Murphy, Christine M.; Briggs, Paul H.; Adrian, Betty M.; Wilson, Steve A.; Hageman, Phil L.; Theodorakos, Pete M.

    1997-01-01

    Personnel from the Analytical Chemistry Services Group (ACSG), Mineral Resource Survey Program, formed a team to determine the policies for acceptance and analysis of geochemical samples. This team contacted law enforcement agencies that handle litigious samples, laboratories that work with samples of special nature, and the Solicitor General, Department of the Interior. Using the knowledge from these agencies as well as the expertise of ACSG personnel, sample control routine procedures, sample control evidentiary procedures, personnel policy governing chain-of-custody samples, and the general polices governing physical security of chain-of custody samples have been enacted.

  15. The simulation of UV spectroscopy and electronic analysis of temozolomide and dacarbazine chemical decomposition to their metabolites.

    PubMed

    Khalilian, M Hossein; Mirzaei, Saber; Taherpour, Avat Arman

    2016-11-01

    The electronic features of anti-tumor agent, temozolomide, and its degradation products (MTIC and metabolite AIC) have been traced by means of UV absorption spectroscopy in vacuo and aqueous media. For comparison, electronic spectra of related structures and drugs (e.g., dacarbazine) were also investigated. These investigations were carried out using time-dependent density functional theory (TD-DFT) method while the conductor like screening model (COSMO) were applied for the inclusion of solvent effects in electronic spectra. From functional benchmarking, two methods; B3LYP and O3LYP were selected among several other methods with 6-311+G(2d,p) basis set aiming to get the best results in accord with the experimental values. An assessment of the obtained spectra has shown that O3LYP functional gives a mean absolute error (MAE) from experimental absorption peaks of 4.3 nm compared to the 7.2 nm MAE value at B3LYP level in aqueous media. Furthermore, since the structural and tautomeric conformers affect the electronic spectra, conformational preferences have been analyzed in temozolomide, dacarbazine, and their related structures. Temozolomide structure possesses two rotamers that differ in the orientation of carboxamide moiety with a small energy difference (energy difference of 1.39 kcal mol -1 in vacuo and 0.35 kcal mol -1 in aqueous media at B3LYP/6-311++G(2df,3pd). The more stable and meta-stable TMZ rotamer have shown their absorption maxima at 329-334 nm, respectively, at O3LYP level in aqueous media. Applying statistical calculation according to Boltzmann population formula at 25 °C and computed weighed mean estimates the λ max of temozolomide at 331 nm, which is in notable agreement with the experimental value (330 nm). Moreover, molecular orbital composition analysis has been conducted in order to interpret these findings. Graphical Abstract Temozolomide and dacarbazine.

  16. A rotamer energy level study of sulfuric acid.

    PubMed

    Partanen, Lauri; Pesonen, Janne; Sjöholm, Elina; Halonen, Lauri

    2013-10-14

    It is a common approach in quantum chemical calculations for polyatomic molecules to rigidly constrain some of the degrees of freedom in order to make the calculations computationally feasible. However, the presence of the rigid constraints also affects the kinetic energy operator resulting in the frozen mode correction, originally derived by Pesonen [J. Chem. Phys. 139, 144310 (2013)]. In this study, we compare the effects of this correction to several different approximations to the kinetic energy operator used in the literature, in the specific case of the rotamer energy levels of sulfuric acid. The two stable conformers of sulfuric acid are connected by the rotations of the O-S-O-H dihedral angles and possess C2 and Cs symmetry in the order of increasing energy. Our results show that of the models tested, the largest differences with the frozen mode corrected values were obtained by simply omitting the passive degrees of freedom. For the lowest 17 excited states, this inappropriate treatment introduces an increase of 9.6 cm(-1) on average, with an increase of 8.7 cm(-1) in the zero-point energies. With our two-dimensional potential energy surface calculated at the CCSD(T)-F12a/VDZ-F12 level, we observe a radical shift in the density of states compared to the harmonic picture, combined with an increase in zero point energy. Thus, we conclude that the quantum mechanical inclusion of the different conformers of sulfuric acid have a significant effect on its vibrational partition function, suggesting that it will also have an impact on the computational values of the thermodynamic properties of any reactions where sulfuric acid plays a role. Finally, we also considered the effect of the anharmonicities for the other vibrational degrees of freedom with a VSCF-calculation at the DF-MP2-F12/VTZ-F12 level of theory but found that the inclusion of the other conformer had the more important effect on the vibrational partition function.

  17. Action of Molecular Switches in GPCRs - Theoretical and Experimental Studies

    PubMed Central

    Trzaskowski, B; Latek, D; Yuan, S; Ghoshdastider, U; Debinski, A; Filipek, S

    2012-01-01

    G protein coupled receptors (GPCRs), also called 7TM receptors, form a huge superfamily of membrane proteins that, upon activation by extracellular agonists, pass the signal to the cell interior. Ligands can bind either to extracellular N-terminus and loops (e.g. glutamate receptors) or to the binding site within transmembrane helices (Rhodopsin-like family). They are all activated by agonists although a spontaneous auto-activation of an empty receptor can also be observed. Biochemical and crystallographic methods together with molecular dynamics simulations and other theoretical techniques provided models of the receptor activation based on the action of so-called “molecular switches” buried in the receptor structure. They are changed by agonists but also by inverse agonists evoking an ensemble of activation states leading toward different activation pathways. Switches discovered so far include the ionic lock switch, the 3-7 lock switch, the tyrosine toggle switch linked with the nPxxy motif in TM7, and the transmission switch. The latter one was proposed instead of the tryptophan rotamer toggle switch because no change of the rotamer was observed in structures of activated receptors. The global toggle switch suggested earlier consisting of a vertical rigid motion of TM6, seems also to be implausible based on the recent crystal structures of GPCRs with agonists. Theoretical and experimental methods (crystallography, NMR, specific spectroscopic methods like FRET/BRET but also single-molecule-force-spectroscopy) are currently used to study the effect of ligands on the receptor structure, location of stable structural segments/domains of GPCRs, and to answer the still open question on how ligands are binding: either via ensemble of conformational receptor states or rather via induced fit mechanisms. On the other hand the structural investigations of homo- and heterodimers and higher oligomers revealed the mechanism of allosteric signal transmission and receptor activation that could lead to design highly effective and selective allosteric or ago-allosteric drugs. PMID:22300046

  18. Action of molecular switches in GPCRs--theoretical and experimental studies.

    PubMed

    Trzaskowski, B; Latek, D; Yuan, S; Ghoshdastider, U; Debinski, A; Filipek, S

    2012-01-01

    G protein coupled receptors (GPCRs), also called 7TM receptors, form a huge superfamily of membrane proteins that, upon activation by extracellular agonists, pass the signal to the cell interior. Ligands can bind either to extracellular N-terminus and loops (e.g. glutamate receptors) or to the binding site within transmembrane helices (Rhodopsin-like family). They are all activated by agonists although a spontaneous auto-activation of an empty receptor can also be observed. Biochemical and crystallographic methods together with molecular dynamics simulations and other theoretical techniques provided models of the receptor activation based on the action of so-called "molecular switches" buried in the receptor structure. They are changed by agonists but also by inverse agonists evoking an ensemble of activation states leading toward different activation pathways. Switches discovered so far include the ionic lock switch, the 3-7 lock switch, the tyrosine toggle switch linked with the nPxxy motif in TM7, and the transmission switch. The latter one was proposed instead of the tryptophan rotamer toggle switch because no change of the rotamer was observed in structures of activated receptors. The global toggle switch suggested earlier consisting of a vertical rigid motion of TM6, seems also to be implausible based on the recent crystal structures of GPCRs with agonists. Theoretical and experimental methods (crystallography, NMR, specific spectroscopic methods like FRET/BRET but also single-molecule-force-spectroscopy) are currently used to study the effect of ligands on the receptor structure, location of stable structural segments/domains of GPCRs, and to answer the still open question on how ligands are binding: either via ensemble of conformational receptor states or rather via induced fit mechanisms. On the other hand the structural investigations of homoand heterodimers and higher oligomers revealed the mechanism of allosteric signal transmission and receptor activation that could lead to design highly effective and selective allosteric or ago-allosteric drugs.

  19. Comparison of chain sampling plans with single and double sampling plans

    NASA Technical Reports Server (NTRS)

    Stephens, K. S.; Dodge, H. F.

    1976-01-01

    The efficiency of chain sampling is examined through matching of operating characteristics (OC) curves of chain sampling plans (ChSP) with single and double sampling plans. In particular, the operating characteristics of some ChSP-0, 3 and 1, 3 as well as ChSP-0, 4 and 1, 4 are presented, where the number pairs represent the first and the second cumulative acceptance numbers. The fact that the ChSP procedure uses cumulative results from two or more samples and that the parameters can be varied to produce a wide variety of operating characteristics raises the question whether it may be possible for such plans to provide a given protection with less inspection than with single or double sampling plans. The operating ratio values reported illustrate the possibilities of matching single and double sampling plans with ChSP. It is shown that chain sampling plans provide improved efficiency over single and double sampling plans having substantially the same operating characteristics.

  20. Femtosecond dynamics of a non-steroidal anti-inflammatory drug (piroxicam) in solution: The involvement of twisting motion

    NASA Astrophysics Data System (ADS)

    Gil, Michał; Douhal, Abderrazzak

    2008-06-01

    In this contribution, we report on fast and ultrafast dynamics of a non-steroidal anti-inflammatory drug, piroxicam (PX), in methyl acetate (MAC) and triacetin (TAC), two solvents of different viscosities. The enol form of PX undergoes a femtosecond (shorter than 100 fs) electronically excited state intramolecular proton-transfer reaction to produce keto tautomers. These structures exhibit an internal twisting motion to generate keto rotamers in ˜2-5 ps, a time being longer in TAC. The transient absorption/emission spectrum is very broad indicating that the potential-energy surface at the electronically excited state is very flat, and reflecting the involvement of several coordinates along which the wavepacket of the fs-produced structures evolve.

  1. Synthesis and dynamic NMR study of ketenimines derived from tert-butyl isocyanide, alkyl 2-arylamino-2-oxo-acetates, and dialkyl acetylenedicarboxylates.

    PubMed

    Yavari, Issa; Nasiri, Farough; Djahaniani, Horieh

    2004-01-01

    The adduct produced in the reaction between tert-butyl isocyanide and dialkyl acetylenedicarboxylates was trapped by alkyl 2-arylamino-2-oxo-acetates. When the aryl group is 2-methyl-6-nitrophenyl or 2,6-di-isopropylphenyl, the product exists as two stable rotamers at room temperature as a result of restricted rotation around the Ar-N single bond. When the aryl group is 1-naphthyl or 8-quinolinyl, dynamic NMR effects are observed in the 1H NMR spectra. The calculated free-energy of activation for interconversion of the rotational isomers in 1-naphthyl and 8-quinolinyl derivatives amounts to about 99+/-2 and 68.5+/-2 kJ mol(-1), respectively.

  2. Molecular basis of proton uptake in single and double mutants of cytochrome c oxidase

    NASA Astrophysics Data System (ADS)

    Henry, Rowan M.; Caplan, David; Fadda, Elisa; Pomès, Régis

    2011-06-01

    Cytochrome c oxidase, the terminal enzyme of the respiratory chain, utilizes the reduction of dioxygen into water to pump protons across the mitochondrial inner membrane. The principal pathway of proton uptake into the enzyme, the D channel, is a 2.5 nm long channel-like cavity named after a conserved, negatively charged aspartic acid (D) residue thought to help recruiting protons to its entrance (D132 in the first subunit of the S. sphaeroides enzyme). The single-point mutation of D132 to asparagine (N), a neutral residue, abolishes enzyme activity. Conversely, replacing conserved N139, one-third into the D channel, by D, induces a decoupled phenotype, whereby oxygen reduction proceeds but not proton pumping. Intriguingly, the double mutant D132N/N139D, which conserves the charge of the D channel, restores the wild-type phenotype. We use molecular dynamics simulations and electrostatic calculations to examine the structural and physical basis for the coupling of proton pumping and oxygen chemistry in single and double N139D mutants. The potential of mean force for the conformational isomerization of N139 and N139D side chains reveals the presence of three rotamers, one of which faces the channel entrance. This out-facing conformer is metastable in the wild-type and in the N139D single mutant, but predominant in the double mutant thanks to the loss of electrostatic repulsion with the carboxylate group of D132. The effects of mutations and conformational isomerization on the pKa of E286, an essential proton-shuttling residue located at the top of the D channel, are shown to be consistent with the electrostatic control of proton pumping proposed recently (Fadda et al 2008 Biochim. Biophys. Acta 1777 277-84). Taken together, these results suggest that preserving the spatial distribution of charges at the entrance of the D channel is necessary to guarantee both the uptake and the relay of protons to the active site of the enzyme. These findings highlight the interplay of long-range electrostatic forces and local structural fluctuations in the control of proton movement and provide a physical explanation for the restoration of proton pumping activity in the double mutant.

  3. Correcting false positive medium-chain acyl-CoA dehydrogenase deficiency results from newborn screening; synthesis, purification, and standardization of branched-chain C8 acylcarnitines for use in their selective and accurate absolute quantitation by UHPLC-MS/MS.

    PubMed

    Minkler, Paul E; Stoll, Maria S K; Ingalls, Stephen T; Hoppel, Charles L

    2017-04-01

    While selectively quantifying acylcarnitines in thousands of patient samples using UHPLC-MS/MS, we have occasionally observed unidentified branched-chain C8 acylcarnitines. Such observations are not possible using tandem MS methods, which generate pseudo-quantitative acylcarnitine "profiles". Since these "profiles" select for mass alone, they cannot distinguish authentic signal from isobaric and isomeric interferences. For example, some of the samples containing branched-chain C8 acylcarnitines were, in fact, expanded newborn screening false positive "profiles" for medium-chain acyl-CoA dehydrogenase deficiency (MCADD). Using our fast, highly selective, and quantitatively accurate UHPLC-MS/MS acylcarnitine determination method, we corrected the false positive tandem MS results and reported the sample results as normal for octanoylcarnitine (the marker for MCADD). From instances such as these, we decided to further investigate the presence of branched-chain C8 acylcarnitines in patient samples. To accomplish this, we synthesized and chromatographically characterized several branched-chain C8 acylcarnitines (in addition to valproylcarnitine): 2-methylheptanoylcarnitine, 6-methylheptanoylcarnitine, 2,2-dimethylhexanoylcarnitine, 3,3-dimethylhexanoylcarnitine, 3,5-dimethylhexanoylcarnitine, 2-ethylhexanoylcarnitine, and 2,4,4-trimethylpentanoylcarnitine. We then compared their behavior with branched-chain C8 acylcarnitines observed in patient samples and demonstrated our ability to chromographically resolve, and thus distinguish, octanoylcarnitine from branched-chain C8 acylcarnitines, correcting false positive MCADD results from expanded newborn screening. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Challenges to Recruiting Population Representative Samples of Female Sex Workers in China Using Respondent Driven Sampling1

    PubMed Central

    Merli, M. Giovanna; Moody, James; Smith, Jeffrey; Li, Jing; Weir, Sharon; Chen, Xiangsheng

    2014-01-01

    We explore the network coverage of a sample of female sex workers (FSWs) in China recruited through Respondent Drive Sampling (RDS) as part of an effort to evaluate the claim of RDS of population representation with empirical data. We take advantage of unique information on the social networks of FSWs obtained from two overlapping studies --RDS and a venue-based sampling approach (PLACE) -- and use an exponential random graph modeling (ERGM) framework from local networks to construct a likely network from which our observed RDS sample is drawn. We then run recruitment chains over this simulated network to assess the assumption that the RDS chain referral process samples participants in proportion to their degree and the extent to which RDS satisfactorily covers certain parts of the network. We find evidence that, contrary to assumptions, RDS oversamples low degree nodes and geographically central areas of the network. Unlike previous evaluations of RDS which have explored the performance of RDS sampling chains on a non-hidden population, or the performance of simulated chains over previously mapped realistic social networks, our study provides a robust, empirically grounded evaluation of the performance of RDS chains on a real-world hidden population. PMID:24834869

  5. Inulin-enriched dairy desserts: physicochemical and sensory aspects.

    PubMed

    González-Tomás, L; Bayarri, S; Costell, E

    2009-09-01

    The aim of this work was to study how adding inulin of different average chain lengths (long-chain, native, and short-chain inulin) at a concentration of 7.5% (wt/wt) would affect the physicochemical and sensory characteristics of starch-based dairy desserts formulated with either skim or whole milk. The results have shown that the effect of adding 7.5% inulin of different average chain length can give rise to products with different rheological behavior and different sensory characteristics. The skim milk sample with long-chain inulin and the whole milk sample without inulin showed similar flow behavior. Both samples were perceived to have the same creaminess and consistency intensity, but addition of long-chain inulin increased roughness intensity and, consequently, the sensory quality could be negatively affected. The information obtained may be of great interest in designing new products with nutritional and sensory characteristics that meet consumer demands.

  6. Effect of the different chain transfer agents on molecular weight and optical properties of poly(methyl methacrylate)

    NASA Astrophysics Data System (ADS)

    Çetinkaya, Onur; Demirci, Gökhan; Mergo, Paweł

    2017-08-01

    Investigation of molecular weight and optical properties of poly(methyl metacrylate) (PMMA) polymerized in house with different chain transfer agents was studied. Isopropyl alcohol (IPA), n-butyl mercaptan (nBMC) and pentamethyl disilane (PMDS) were used as chain transfer agents. The molecular weight (Mw) of PMMA samples were measured by Ostwald viscometer. Mw of bulk polymer samples were decreased with increase the concentration of chain transfer agents (CTA). Since reactivity of used CTAs is not same, molecular weights of samples which were produced with different type of CTA but same concentration of CTA was varied. Higher concentration of n-BMC showed higher scattering. Transmission of samples could not be correlated with different concentration of CTA. Refractive index of samples was not affected by concentration of CTA nevertheless higher molecular weight of CTA showed higher refractive index.

  7. NHEXAS PHASE I MARYLAND STUDY--STANDARD OPERATING PROCEDURE FOR CHAIN-OF-CUSTODY AND SAMPLE TRACKING (G04)

    EPA Science Inventory

    The purpose of the SOP is to establish the normal procedures for ensuring data chain-of-custody and data tracking. The chain-of-custody form included in this SOP is the standard form to be used for all data collected in the field. Keywords: samples; custody; records.

    The Nat...

  8. Tautomerism in cytosine and uracil: an experimental and theoretical core level spectroscopic study.

    PubMed

    Feyer, Vitaliy; Plekan, Oksana; Richter, Robert; Coreno, Marcello; Vall-llosera, Gemma; Prince, Kevin C; Trofimov, Alexander B; Zaytseva, Irina L; Moskovskaya, Tatyana E; Gromov, Evgeniy V; Schirmer, Jochen

    2009-05-14

    The O, N, and C 1s core level photoemission spectra of the nucleobases cytosine and uracil have been measured in the vapor phase, and the results have been interpreted via theoretical calculations. Our calculations accurately predict the relative binding energies of the core level features observed in the experimental photoemission results and provide a full assignment. In agreement with previous work, a single tautomer of uracil is populated at 405 K, giving rise to relatively simple spectra. At 450 K, three tautomers of cytosine, one of which may consist of two rotamers, are identified, and their populations are determined. This resolves inconsistencies between recent laser studies of this molecule in which the rare imino-oxo tautomer was not observed and older microwave spectra in which it was reported.

  9. Infrared laser Stark spectroscopy of hydroxymethoxycarbene in 4He nanodroplets

    DOE PAGES

    Broderick, Bernadette M.; Moradi, Christopher P.; Douberly, Gary E.

    2015-09-07

    Hydroxymethoxycarbene, CH 3OCOH, was produced via pyrolysis of monomethyl oxalate and subsequently isolated in 4He nanodroplets. Infrared laser spectroscopy reveals two rotationally resolved a,b-hybrid bands in the OH-stretch region, which are assigned to trans, trans- and cis, trans-rotamers. Stark spectroscopy of the trans, trans-OH stretch band provides the a-axis inertial component of the dipole moment, namely μ a = 0.62(7) D. Here, the computed equilibrium dipole moment agrees well with the expectation value determined from experiment, consistent with a semi-rigid CH 3OCOH backbone computed via a potential energy scan at the B3LYP/cc-pVTZ level of theory, which reveals substantial conformer interconversionmore » barriers of ≈17 kcal/mol.« less

  10. Pure Rotational Spectroscopy of Vinyl Mercaptan

    NASA Astrophysics Data System (ADS)

    Martin-Drumel, Marie-Aline; Zingsheim, Oliver; Thorwirth, Sven; Müller, Holger S. P.; Lewen, Frank; Schlemmer, Stephan

    2014-06-01

    Vinyl mercaptan (ethenethiol, CH_2=CHSH) exists in the gas phase in two distinct rotameric forms, syn (planar) and anti (quasi-planar in the ground vibrational state). The microwave spectra of these two isomers were investigated previously, however not exceeding frequencies of about 65 GHz. In the present investigation, the pure rotational spectra of both species have been investigated at millimeter wavelengths. Vinyl mercaptan was produced in a radiofrequency discharge through a constant flow of ethanedithiol at low pressure. Both syn and anti rotamers were observed and new extensive sets of molecular parameters were obtained. Owing to its close structural relationship to vinyl alcohol and the astronomical abundance of complex sulfur-bearing molecules, vinyl mercaptan is a plausible candidate for future radio astronomical searches. M. Tanimoto et al. J. Mol. Spectrosc. 78, 95--105 & 106--119 (1979)

  11. Honest Importance Sampling with Multiple Markov Chains

    PubMed Central

    Tan, Aixin; Doss, Hani; Hobert, James P.

    2017-01-01

    Importance sampling is a classical Monte Carlo technique in which a random sample from one probability density, π1, is used to estimate an expectation with respect to another, π. The importance sampling estimator is strongly consistent and, as long as two simple moment conditions are satisfied, it obeys a central limit theorem (CLT). Moreover, there is a simple consistent estimator for the asymptotic variance in the CLT, which makes for routine computation of standard errors. Importance sampling can also be used in the Markov chain Monte Carlo (MCMC) context. Indeed, if the random sample from π1 is replaced by a Harris ergodic Markov chain with invariant density π1, then the resulting estimator remains strongly consistent. There is a price to be paid however, as the computation of standard errors becomes more complicated. First, the two simple moment conditions that guarantee a CLT in the iid case are not enough in the MCMC context. Second, even when a CLT does hold, the asymptotic variance has a complex form and is difficult to estimate consistently. In this paper, we explain how to use regenerative simulation to overcome these problems. Actually, we consider a more general set up, where we assume that Markov chain samples from several probability densities, π1, …, πk, are available. We construct multiple-chain importance sampling estimators for which we obtain a CLT based on regeneration. We show that if the Markov chains converge to their respective target distributions at a geometric rate, then under moment conditions similar to those required in the iid case, the MCMC-based importance sampling estimator obeys a CLT. Furthermore, because the CLT is based on a regenerative process, there is a simple consistent estimator of the asymptotic variance. We illustrate the method with two applications in Bayesian sensitivity analysis. The first concerns one-way random effects models under different priors. The second involves Bayesian variable selection in linear regression, and for this application, importance sampling based on multiple chains enables an empirical Bayes approach to variable selection. PMID:28701855

  12. Honest Importance Sampling with Multiple Markov Chains.

    PubMed

    Tan, Aixin; Doss, Hani; Hobert, James P

    2015-01-01

    Importance sampling is a classical Monte Carlo technique in which a random sample from one probability density, π 1 , is used to estimate an expectation with respect to another, π . The importance sampling estimator is strongly consistent and, as long as two simple moment conditions are satisfied, it obeys a central limit theorem (CLT). Moreover, there is a simple consistent estimator for the asymptotic variance in the CLT, which makes for routine computation of standard errors. Importance sampling can also be used in the Markov chain Monte Carlo (MCMC) context. Indeed, if the random sample from π 1 is replaced by a Harris ergodic Markov chain with invariant density π 1 , then the resulting estimator remains strongly consistent. There is a price to be paid however, as the computation of standard errors becomes more complicated. First, the two simple moment conditions that guarantee a CLT in the iid case are not enough in the MCMC context. Second, even when a CLT does hold, the asymptotic variance has a complex form and is difficult to estimate consistently. In this paper, we explain how to use regenerative simulation to overcome these problems. Actually, we consider a more general set up, where we assume that Markov chain samples from several probability densities, π 1 , …, π k , are available. We construct multiple-chain importance sampling estimators for which we obtain a CLT based on regeneration. We show that if the Markov chains converge to their respective target distributions at a geometric rate, then under moment conditions similar to those required in the iid case, the MCMC-based importance sampling estimator obeys a CLT. Furthermore, because the CLT is based on a regenerative process, there is a simple consistent estimator of the asymptotic variance. We illustrate the method with two applications in Bayesian sensitivity analysis. The first concerns one-way random effects models under different priors. The second involves Bayesian variable selection in linear regression, and for this application, importance sampling based on multiple chains enables an empirical Bayes approach to variable selection.

  13. Molecular structure of quinoa starch.

    PubMed

    Li, Guantian; Zhu, Fan

    2017-02-20

    Quinoa starch has very small granules with unique properties. However, the molecular structure of quinoa starch remains largely unknown. In this study, composition and amylopectin molecular structure of 9 quinoa starch samples were characterised by chromatographic techniques. In particular, the amylopectin internal molecular structure, represented by φ, β-limit dextrins (LDs), was explored. Great variations in the composition and molecular structures were recorded among samples. Compared with other amylopectins, quinoa amylopectin showed a high ratio of short chain to long chains (mean:14.6) and a high percentage of fingerprint A-chains (A fp ) (mean:10.4%). The average chain length, external chain length, and internal chain length of quinoa amylopectin were 16.6, 10.6, and 5.00 glucosyl residues, respectively. Pearson correlation and principal component analysis revealed some inherent correlations among structural parameters and a similarity of different samples. Overall, quinoa amylopectins are structurally similar to that from starches with A-type polymorph such as oat and amaranth starches. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

  15. Sampling rare fluctuations of discrete-time Markov chains

    NASA Astrophysics Data System (ADS)

    Whitelam, Stephen

    2018-03-01

    We describe a simple method that can be used to sample the rare fluctuations of discrete-time Markov chains. We focus on the case of Markov chains with well-defined steady-state measures, and derive expressions for the large-deviation rate functions (and upper bounds on such functions) for dynamical quantities extensive in the length of the Markov chain. We illustrate the method using a series of simple examples, and use it to study the fluctuations of a lattice-based model of active matter that can undergo motility-induced phase separation.

  16. Sampling rare fluctuations of discrete-time Markov chains.

    PubMed

    Whitelam, Stephen

    2018-03-01

    We describe a simple method that can be used to sample the rare fluctuations of discrete-time Markov chains. We focus on the case of Markov chains with well-defined steady-state measures, and derive expressions for the large-deviation rate functions (and upper bounds on such functions) for dynamical quantities extensive in the length of the Markov chain. We illustrate the method using a series of simple examples, and use it to study the fluctuations of a lattice-based model of active matter that can undergo motility-induced phase separation.

  17. Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.

    PubMed

    Chen, Y T; Mercer, G O; Chen, Y

    1993-11-01

    Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.

  18. The multichannel n-propyl + O2 reaction surface: Definitive theory on a model hydrocarbon oxidation mechanism

    NASA Astrophysics Data System (ADS)

    Bartlett, Marcus A.; Liang, Tao; Pu, Liang; Schaefer, Henry F.; Allen, Wesley D.

    2018-03-01

    The n-propyl + O2 reaction is an important model of chain branching reactions in larger combustion systems. In this work, focal point analyses (FPAs) extrapolating to the ab initio limit were performed on the n-propyl + O2 system based on explicit quantum chemical computations with electron correlation treatments through coupled cluster single, double, triple, and perturbative quadruple excitations [CCSDT(Q)] and basis sets up to cc-pV5Z. All reaction species and transition states were fully optimized at the rigorous CCSD(T)/cc-pVTZ level of theory, revealing some substantial differences in comparison to the density functional theory geometries existing in the literature. A mixed Hessian methodology was implemented and benchmarked that essentially makes the computations of CCSD(T)/cc-pVTZ vibrational frequencies feasible and thus provides critical improvements to zero-point vibrational energies for the n-propyl + O2 system. Two key stationary points, n-propylperoxy radical (MIN1) and its concerted elimination transition state (TS1), were located 32.7 kcal mol-1 and 2.4 kcal mol-1 below the reactants, respectively. Two competitive β-hydrogen transfer transition states (TS2 and TS2') were found separated by only 0.16 kcal mol-1, a fact unrecognized in the current combustion literature. Incorporating TS2' in master equation (ME) kinetic models might reduce the large discrepancy of 2.5 kcal mol-1 between FPA and ME barrier heights for TS2. TS2 exhibits an anomalously large diagonal Born-Oppenheimer correction (ΔDBOC = 1.71 kcal mol-1), which is indicative of a nearby surface crossing and possible nonadiabatic reaction dynamics. The first systematic conformational search of three hydroperoxypropyl (QOOH) intermediates was completed, uncovering a total of 32 rotamers lying within 1.6 kcal mol-1 of their respective lowest-energy minima. Our definitive energetics for stationary points on the n-propyl + O2 potential energy surface provide key benchmarks for future studies of hydrocarbon oxidation.

  19. Scientific Benchmarks for Guiding Macromolecular Energy Function Improvement

    PubMed Central

    Leaver-Fay, Andrew; O’Meara, Matthew J.; Tyka, Mike; Jacak, Ron; Song, Yifan; Kellogg, Elizabeth H.; Thompson, James; Davis, Ian W.; Pache, Roland A.; Lyskov, Sergey; Gray, Jeffrey J.; Kortemme, Tanja; Richardson, Jane S.; Havranek, James J.; Snoeyink, Jack; Baker, David; Kuhlman, Brian

    2013-01-01

    Accurate energy functions are critical to macromolecular modeling and design. We describe new tools for identifying inaccuracies in energy functions and guiding their improvement, and illustrate the application of these tools to improvement of the Rosetta energy function. The feature analysis tool identifies discrepancies between structures deposited in the PDB and low energy structures generated by Rosetta; these likely arise from inaccuracies in the energy function. The optE tool optimizes the weights on the different components of the energy function by maximizing the recapitulation of a wide range of experimental observations. We use the tools to examine three proposed modifications to the Rosetta energy function: improving the unfolded state energy model (reference energies), using bicubic spline interpolation to generate knowledge based torisonal potentials, and incorporating the recently developed Dunbrack 2010 rotamer library (Shapovalov and Dunbrack, 2011). PMID:23422428

  20. Cytotoxic Amides from Fruits of Kawakawa, Macropiper excelsum.

    PubMed

    Lei, Jeremy; Burgess, Elaine J; Richardson, Alistair T B; Hawkins, Bill C; Baird, Sarah K; Smallfield, Bruce M; van Klink, John W; Perry, Nigel B

    2015-08-01

    Cytotoxic amides have been isolated from the fruits of the endemic New Zealand medicinal plant kawakawa, Macropiper excelsum (Piperaceae). The main amide was piperchabamide A and this is the first report of this rare compound outside the genus Piper. Eleven other amides were purified including two new compounds with the unusual 3,4-dihydro-1(2H)-pyridinyl group. The new compounds were fully characterized by 2D NMR spectroscopy, which showed a slow exchange between two rotamers about the amide bond, and they were chemically synthesized. In view of the antitumor activity of the related piperlongumine, all of these amides plus four synthetic analogs were tested for cytotoxicity. The most active was the piperine homolog piperdardine, with an IC50 of 14 µM against HT 29 colon cancer cells. Georg Thieme Verlag KG Stuttgart · New York.

  1. Does size really matter? A sensitivity analysis of number of seeds in a respondent-driven sampling study of gay, bisexual and other men who have sex with men in Vancouver, Canada.

    PubMed

    Lachowsky, Nathan John; Sorge, Justin Tyler; Raymond, Henry Fisher; Cui, Zishan; Sereda, Paul; Rich, Ashleigh; Roth, Eric A; Hogg, Robert S; Moore, David M

    2016-11-16

    Respondent-driven sampling (RDS) is an increasingly used peer chain-recruitment method to sample "hard-to-reach" populations for whom there are no reliable sampling frames. Implementation success of RDS varies; one potential negative factor being the number of seeds used. We conducted a sensitivity analysis on estimates produced using data from an RDS study of gay, bisexual and other men who have sex with men (GBMSM) aged ≥16 years living in Vancouver, Canada. Participants completed a questionnaire on demographics, sexual behavior and substance use. For analysis, we used increasing seed exclusion criteria, starting with all participants and subsequently removing unproductive seeds, chains of ≤1 recruitment waves, and chains of ≤2 recruitment waves. We calculated estimates for three different outcomes (HIV serostatus, condomless anal intercourse with HIV discordant/unknown status partner, and injecting drugs) using three different RDS weighting procedures: RDS-I, RDS-II, and RDS-SS. We also assessed seed dependence with bottleneck analyses and convergence plots. Statistical differences between RDS estimators were assessed through simulation analysis. Overall, 719 participants were recruited, which included 119 seeds and a maximum of 16 recruitment waves (mean chain length = 1.7). The sample of >0 recruitment waves removed unproductive seeds (n = 50/119, 42.0%), resulting in 69 chains (mean length = 3.0). The sample of >1 recruitment waves removed 125 seeds or recruits (17.4% of overall sample), resulting in 37 chains (mean length = 4.8). The final sample of >2 recruitment waves removed a further 182 seeds or recruits (25.3% of overall sample), resulting in 25 chains (mean length = 6.1). Convergence plots and bottleneck analyses of condomless anal intercourse with HIV discordant/unknown status partner and injecting drugs outcomes were satisfactory. For these two outcomes, regardless of seed exclusion criteria used, the crude proportions fell within 95% confidence intervals of all RDS-weighted estimates. Significant differences between the three RDS estimators were not observed. Within a sample of GBMSM in Vancouver, Canada, this RDS study suggests that when equilibrium and homophily are met, although potentially costly and time consuming, analysis is not negatively affected by large numbers of unproductive or lowly productive seeds.

  2. High sensitivity of positrons to oxygen vacancies and to copper-oxygen chain disorder in YBa2Cu3O(7-x)

    NASA Astrophysics Data System (ADS)

    von Stetten, E. C.; Berko, S.; Li, X. S.; Lee, R. R.; Brynestad, J.

    1988-05-01

    Temperature-dependent positron-electron momentum densities have been studied by two-dimensional angular correlation of annihilation radiation from 10 to 320 K in YBa2Cu3O(7-x) samples. The positron ground-state charge density, computed by the linearized augmented-plane-wave method, indicates that in YBa2Cu3O7 delocalized positrons sample preferentially the linear copper-oxygen chains. Positron localization due to disorder in these chains is invoked to explain the striking differences observed between superconducting (x = about 0.02) and nonsuperconducting (x = about 0.70) samples.

  3. Development of a sampling method for the simultaneous monitoring of straight-chain alkanes, straight-chain saturated carbonyl compounds and monoterpenes in remote areas.

    PubMed

    Detournay, Anaïs; Sauvage, Stéphane; Locoge, Nadine; Gaudion, Vincent; Leonardis, Thierry; Fronval, Isabelle; Kaluzny, Pascal; Galloo, Jean-Claude

    2011-04-01

    Studies have shown that biogenic compounds, long chain secondary compounds and long lifetime anthropogenic compounds are involved in the formation of organic aerosols in both polluted areas and remote places. This work aims at developing an active sampling method to monitor these compounds (i.e. 6 straight-chain saturated aldehydes from C6 to C11; 8 straight-chain alkanes from C9 to C16; 6 monoterpenes: α-pinene, β-pinene, camphene, limonene, α-terpinene, & γ-terpinene; and 5 aromatic compounds: toluene, ethylbenzene, meta-, para- and ortho-xylenes) in remote areas. Samples are collected onto multi-bed sorbent cartridges at 200 mL min(-1) flow rate, using the automatic sampler SyPAC (TERA-Environnement, Crolles, France). No breakthrough was observed for sampling volumes up to 120 L (standard mixture at ambient temperature, with a relative humidity of 75%). As ozone has been shown to alter the samples (losses of 90% of aldehydes and up to 95% of terpenes were observed), the addition of a conditioned manganese dioxide (MnO(2)) scrubber to the system has been validated (full recovery of the affected compounds for a standard mixture at 50% relative humidity--RH). Samples are first thermodesorbed and then analysed by GC/FID/MS. This method allows suitable detection limits (from 2 ppt for camphene to 13 ppt for octanal--36 L sampled), and reproducibility (from 1% for toluene to 22% for heptanal). It has been successfully used to determine the diurnal variation of the target compounds (six 3 h samples a day) during winter and summer measurement campaigns at a remote site in the south of France.

  4. Share2Quit: Web-Based Peer-Driven Referrals for Smoking Cessation

    PubMed Central

    2013-01-01

    Background Smoking is the number one preventable cause of death in the United States. Effective Web-assisted tobacco interventions are often underutilized and require new and innovative engagement approaches. Web-based peer-driven chain referrals successfully used outside health care have the potential for increasing the reach of Internet interventions. Objective The objective of our study was to describe the protocol for the development and testing of proactive Web-based chain-referral tools for increasing the access to Decide2Quit.org, a Web-assisted tobacco intervention system. Methods We will build and refine proactive chain-referral tools, including email and Facebook referrals. In addition, we will implement respondent-driven sampling (RDS), a controlled chain-referral sampling technique designed to remove inherent biases in chain referrals and obtain a representative sample. We will begin our chain referrals with an initial recruitment of former and current smokers as seeds (initial participants) who will be trained to refer current smokers from their social network using the developed tools. In turn, these newly referred smokers will also be provided the tools to refer other smokers from their social networks. We will model predictors of referral success using sample weights from the RDS to estimate the success of the system in the targeted population. Results This protocol describes the evaluation of proactive Web-based chain-referral tools, which can be used in tobacco interventions to increase the access to hard-to-reach populations, for promoting smoking cessation. Conclusions Share2Quit represents an innovative advancement by capitalizing on naturally occurring technology trends to recruit smokers to Web-assisted tobacco interventions. PMID:24067329

  5. Interpretation Difficulties of Serum Immunofixation Test in Immunoglobulin D Multiple Myeloma with Hidden Lambda Light Chains.

    PubMed

    Biaz, A; Uwingabiye, J; Rachid, A; Dami, A; Bouhsain, S; Ouzzif, Z; Idrissi, S El Machtani

    2018-06-01

    We report a case of immunoglobulin (Ig) D myeloma with hidden lambda light chains in a patient whose immunofixation test was very difficult to interpret: the IgD reacts with the anti-δ heavy chain antiserum but does not react with anti-lambda antiserum. The band in the D heavy chain lane is unmatched in light chain lanes and the band in lambda light chain lane migrates higher. To distinguish between heavy chain disease and immunoglobulin with "hidden" light chains, the sample was exposed to a very high concentration of anti-lambda and anti-kappa antisera for 48 hours. The serum immunofixation test of the sample treated with anti-lambda showed a decrease in the intensity of the band corresponding to D heavy chain lane as well as the modification of its mobility confirming the presence of IgD with the hidden lambda light chains. The IgD myeloma with hidden light chains remains a rare entity, hence the interest of sensitizing health professionals to be vigilant and ensure a good diagnosis. The proposed technique is useful, simple, reliable, and less laborious than those previous reported in the literature. Medical laboratories using Sebia-Hydrasys® system should be aware of the described phenomenon in order to avoid identifying an IgD myeloma as a delta heavy chain disease.

  6. Generalization bounds of ERM-based learning processes for continuous-time Markov chains.

    PubMed

    Zhang, Chao; Tao, Dacheng

    2012-12-01

    Many existing results on statistical learning theory are based on the assumption that samples are independently and identically distributed (i.i.d.). However, the assumption of i.i.d. samples is not suitable for practical application to problems in which samples are time dependent. In this paper, we are mainly concerned with the empirical risk minimization (ERM) based learning process for time-dependent samples drawn from a continuous-time Markov chain. This learning process covers many kinds of practical applications, e.g., the prediction for a time series and the estimation of channel state information. Thus, it is significant to study its theoretical properties including the generalization bound, the asymptotic convergence, and the rate of convergence. It is noteworthy that, since samples are time dependent in this learning process, the concerns of this paper cannot (at least straightforwardly) be addressed by existing methods developed under the sample i.i.d. assumption. We first develop a deviation inequality for a sequence of time-dependent samples drawn from a continuous-time Markov chain and present a symmetrization inequality for such a sequence. By using the resultant deviation inequality and symmetrization inequality, we then obtain the generalization bounds of the ERM-based learning process for time-dependent samples drawn from a continuous-time Markov chain. Finally, based on the resultant generalization bounds, we analyze the asymptotic convergence and the rate of convergence of the learning process.

  7. Hepatitis E Virus in Pork Food Chain, United Kingdom, 2009–2010

    PubMed Central

    Berto, Alessandra; Martelli, Francesca; Grierson, Sylvia

    2012-01-01

    We investigated contamination by hepatitis E virus (HEV) in the pork production chain in the United Kingdom. We detected HEV in pig liver samples in a slaughterhouse, in surface samples from a processing plant, and in pork sausages and surface samples at point of sale. Our findings provide evidence for possible foodborne transmission of HEV during pork production. PMID:22840183

  8. Genetic Relatedness Among Shiga Toxin-Producing Escherichia coli Isolated Along the Animal Food Supply Chain and in Gastroenteritis Cases in Qatar Using Multilocus Sequence Typing.

    PubMed

    Palanisamy, Srikanth; Chang, YuChen; Scaria, Joy; Penha Filho, Rafael Antonio Casarin; Peters, Kenlyn E; Doiphode, Sanjay H; Sultan, Ali; Mohammed, Hussni O

    2017-06-01

    Pathogenic Escherichia coli has been listed among the most important bacteria associated with foodborne illnesses around the world. We investigated the genetic relatedness among Shiga toxin-producing E. coli (STEC) isolated along the animal food supply chain and from humans diagnosed with gastroenteritis in Qatar. Samples were collected from different sources along the food supply chain and from patients admitted to the hospital with complaints of gastroenteritis. All samples were screened for the presence of E. coli O157:H7 and non-O157 STEC using a combination of bacterial enrichment and molecular detection techniques. A proportional sampling approach was used to select positive samples from each source for further multilocus sequence typing (MLST) analysis. Seven housekeeping genes described for STEC were amplified by polymerase chain reaction, sequenced, and analyzed by MLST. Isolates were characterized by allele composition, sequence type (ST) and assessed for epidemiologic relationship within and among different sources. Nei's genetic distance was calculated at the allele level between sample pools in each site downstream. E. coli O157:H7 occurred at a higher rate in slaughterhouse and retail samples than at the farm or in humans in our sampling. The ST171, an ST common to enterotoxigenic E. coli and atypical enteropathogenic E. coli, was the most common ST (15%) in the food supply chain. None of the genetic distances among the different sources was statistically significant. Enterohemorrhagic E. coli pathogenic strains are present along the supply chain at different levels and with varying relatedness. Clinical isolates were the most diverse, as expected, considering the polyclonal diversity in the human microbiota. The high occurrence of these food adulterants among the farm products suggests that implementation of sanitary measures at that level might reduce the risk of human exposure.

  9. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  10. Real-space refinement in PHENIX for cryo-EM and crystallography

    DOE PAGES

    Afonine, Pavel V.; Poon, Billy K.; Read, Randy J.; ...

    2018-06-01

    This work describes the implementation of real-space refinement in the phenix.real_space_refine program from the PHENIX suite. The use of a simplified refinement target function enables very fast calculation, which in turn makes it possible to identify optimal data-restraint weights as part of routine refinements with little runtime cost. Refinement of atomic models against low-resolution data benefits from the inclusion of as much additional information as is available. In addition to standard restraints on covalent geometry, phenix.real_space_refine makes use of extra information such as secondary-structure and rotamer-specific restraints, as well as restraints or constraints on internal molecular symmetry. The re-refinement ofmore » 385 cryo-EM-derived models available in the Protein Data Bank at resolutions of 6 Å or better shows significant improvement of the models and of the fit of these models to the target maps.« less

  11. Real-space refinement in PHENIX for cryo-EM and crystallography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Afonine, Pavel V.; Poon, Billy K.; Read, Randy J.

    This work describes the implementation of real-space refinement in the phenix.real_space_refine program from the PHENIX suite. The use of a simplified refinement target function enables very fast calculation, which in turn makes it possible to identify optimal data-restraint weights as part of routine refinements with little runtime cost. Refinement of atomic models against low-resolution data benefits from the inclusion of as much additional information as is available. In addition to standard restraints on covalent geometry, phenix.real_space_refine makes use of extra information such as secondary-structure and rotamer-specific restraints, as well as restraints or constraints on internal molecular symmetry. The re-refinement ofmore » 385 cryo-EM-derived models available in the Protein Data Bank at resolutions of 6 Å or better shows significant improvement of the models and of the fit of these models to the target maps.« less

  12. SHARPEN-systematic hierarchical algorithms for rotamers and proteins on an extended network.

    PubMed

    Loksha, Ilya V; Maiolo, James R; Hong, Cheng W; Ng, Albert; Snow, Christopher D

    2009-04-30

    Algorithms for discrete optimization of proteins play a central role in recent advances in protein structure prediction and design. We wish to improve the resources available for computational biologists to rapidly prototype such algorithms and to easily scale these algorithms to many processors. To that end, we describe the implementation and use of two new open source resources, citing potential benefits over existing software. We discuss CHOMP, a new object-oriented library for macromolecular optimization, and SHARPEN, a framework for scaling CHOMP scripts to many computers. These tools allow users to develop new algorithms for a variety of applications including protein repacking, protein-protein docking, loop rebuilding, or homology model remediation. Particular care was taken to allow modular energy function design; protein conformations may currently be scored using either the OPLSaa molecular mechanical energy function or an all-atom semiempirical energy function employed by Rosetta. (c) 2009 Wiley Periodicals, Inc.

  13. Theoretical study of γ-aminobutyric acid conformers: Intramolecular interactions and ionization energies

    NASA Astrophysics Data System (ADS)

    Wang, Ke-Dong; Wang, Mei-Ting; Meng, Ju

    2014-10-01

    Allowing for all combinations of internal single-bond rotamers, 1,296 unique trial structures of γ-Aminobutyric acid (GABA) are obtained. All of these structures are optimized at the M06-2X level of theory and a total of 68 local minimal conformers are found. The nine low-lying conformers are used for further studies. According to the calculated relative Gibbs free energies at M06-2X level of theory, we find that the dispersion is important for the relative energy of GABA. The intramolecular hydrogen bonds and hyperconjugative interaction and their effects on the conformational stability are studied. The results show that both of them have great influence on the conformers. The vertical ionization energies (VIE) are calculated and match the experimental data well. The results show that the neutral GABA in the gas phase is a multi-conformer system and at least four conformations exist.

  14. Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

    EPA Science Inventory

    The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

  15. Salmonella, Escherichia coli and Enterobacteriaceae in the peanut supply chain: From farm to table.

    PubMed

    Nascimento, M S; Carminati, J A; Silva, I C R N; Silva, D L; Bernardi, A O; Copetti, M V

    2018-03-01

    Due to recent foodborne outbreaks, peanuts have been considered a potential risk for Salmonella transmission. For this reason, the aim of this study was to determine the prevalence and contamination load of Salmonella, Escherichia coli and Enterobacteriaceae throughout the peanut supply chain in Brazil. Samples of peanuts and peanut-containing processed products from post-harvest (n=129), secondary processing (n=185) and retail market (n=100) were analyzed. The results showed high Enterobacteriaceae counts in the post-harvest samples. At the end of the secondary processing, 16% of the samples remained contaminated by this group of microorganisms. Six peanut samples from primary production and one sample of peanut butter were tested positive for E. coli while Salmonella was detected in nine samples (2.2%): six from post-harvest, two from the initial stage of the secondary processing and one from retail. The Salmonella counts ranged between 0.004 and 0.092MPN/g and five serotypes were identified (Muenster, Miami, Javiana, Oranienburg, Glostrup). The results demonstrated a high prevalence of Enterobacteriaceae and low prevalence of E. coli throughout the peanut supply chain. Furthermore, it was verified that peanuts may become contaminated by Salmonella during different stages of the supply chain, especially at post-harvest. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Dynamics Sampling in Transition Pathway Space.

    PubMed

    Zhou, Hongyu; Tao, Peng

    2018-01-09

    The minimum energy pathway contains important information describing the transition between two states on a potential energy surface (PES). Chain-of-states methods were developed to efficiently calculate minimum energy pathways connecting two stable states. In the chain-of-states framework, a series of structures are generated and optimized to represent the minimum energy pathway connecting two states. However, multiple pathways may exist connecting two existing states and should be identified to obtain a full view of the transitions. Therefore, we developed an enhanced sampling method, named as the direct pathway dynamics sampling (DPDS) method, to facilitate exploration of a PES for multiple pathways connecting two stable states as well as addition minima and their associated transition pathways. In the DPDS method, molecular dynamics simulations are carried out on the targeting PES within a chain-of-states framework to directly sample the transition pathway space. The simulations of DPDS could be regulated by two parameters controlling distance among states along the pathway and smoothness of the pathway. One advantage of the chain-of-states framework is that no specific reaction coordinates are necessary to generate the reaction pathway, because such information is implicitly represented by the structures along the pathway. The chain-of-states setup in a DPDS method greatly enhances the sufficient sampling in high-energy space between two end states, such as transition states. By removing the constraint on the end states of the pathway, DPDS will also sample pathways connecting minima on a PES in addition to the end points of the starting pathway. This feature makes DPDS an ideal method to directly explore transition pathway space. Three examples demonstrate the efficiency of DPDS methods in sampling the high-energy area important for reactions on the PES.

  17. CTEPP STANDARD OPERATING PROCEDURE FOR MAINTAINING AND RECORDING ELECTRONIC CHAIN-OF-CUSTODY (SOP-4.11)

    EPA Science Inventory

    The method for maintaining and recording electronic Chain-of-Custody (CoC) Records for CTEPP samples is summarized in this SOP. The CoC Records that will be logged electronically include the creation of a sample's identification code, bar code labels, and hard-copy CoC document...

  18. Measurement of stable isotopic enrichment and concentration of long-chain fatty acyl-carnitines in tissue by HPLC-MS.

    PubMed

    Sun, Dayong; Cree, Melanie G; Zhang, Xiao-Jun; Bøersheim, Elisabet; Wolfe, Robert R

    2006-02-01

    We have developed a new method for the simultaneous measurements of stable isotopic tracer enrichments and concentrations of individual long-chain fatty acyl-carnitines in muscle tissue using ion-pairing high-performance liquid chromatography-electrospray ionization quadrupole mass spectrometry in the selected ion monitoring (SIM) mode. Long-chain fatty acyl-carnitines were extracted from frozen muscle tissue samples by acetonitrile/methanol. Baseline separation was achieved by reverse-phase HPLC in the presence of the volatile ion-pairing reagent heptafluorobutyric acid. The SIM capability of a single quadrupole mass analyzer allows further separation of the ions of interest from the sample matrixes, providing very clean total and selected ion chromatograms that can be used to calculate the stable isotopic tracer enrichment and concentration of long-chain fatty acyl-carnitines in a single analysis. The combination of these two separation techniques greatly simplifies the sample preparation procedure and increases the detection sensitivity. Applying this protocol to biological muscle samples proves it to be a very sensitive, accurate, and precise analytical tool.

  19. Distribution of volatile branched-chain fatty acids in various lamb tissues.

    PubMed

    Brennand, C P; Lindsay, R C

    1992-01-01

    Volatile fatty acids (C4-C11) including even-, odd-, and branched-chain members in lamb tissues were quantitatively analyzed. Volatile branched-chain fatty acids (BCFA) were more concentrated in subcutaneous adipose tissue samples (rump, shoulder, breast) than in perinepheric adipose or muscle tissues. Perinepheric adipose tissue contained relatively high quantities of n-chain, even-numbered fatty acids and very low levels of BCFA. Greater variation existed in fatty acid profiles among similar subcutaneous adipose tissues from different lambs than between samples of adipose tissue from different carcass sites from a given lamb sample. 4-Methyl- and 4-ethyloctanoic acids were present at concentrations greatly above threshold levels in all lamb fats tested, and thus upon hydrolysis would contribute species-related flavors to lamb. 4-Methylnonanoic concentrations in lamb fats ranged from nondetectable to greater than the threshold level, and therefore this compound would not always contribute to the species-related flavors of lamb. Lean meat samples contained very low concentrations of 4-methyl- and 4-ethyloctanoic acids. Copyright © 1992. Published by Elsevier Ltd.

  20. Wildfire rehabilitation success with and without chaining on the Henry Mountains, Utah

    Treesearch

    Cristina Juran; Bruce A. Roundy; James N. Davis

    2008-01-01

    We sampled unchained and chained areas in 2004 and 2005 on the Henry Mountains that had been aerially seeded after the Bulldog Fire of 2003. Establishment of seeded grasses was high on unchained and chained areas although chaining increased seeded grass establishment on some sites. Western yarrow established well on unchained areas. Initially, high seedling emergence...

  1. Molecular structure of starches from maize mutants deficient in starch synthase III.

    PubMed

    Zhu, Fan; Bertoft, Eric; Källman, Anna; Myers, Alan M; Seetharaman, Koushik

    2013-10-16

    Molecular structures of starches from dull1 maize mutants deficient in starch synthase III (SSIII) with a common genetic background (W64A) were characterized and compared with the wild type. Amylose content with altered structure was higher in the nonwaxy mutants (25.4-30.2%) compared to the wild type maize (21.5%) as revealed by gel permeation chromatography. Superlong chains of the amylopectin component were found in all nonwaxy samples. Unit chain length distribution of amylopectins and their φ,β-limit dextrins (reflecting amylopectin internal structure) from dull1 mutants were also characterized by anion-exchange chromatography after debranching. Deficiency of SSIII led to an increased amount of short chains (DP ≤36 in amylopectin), whereas the content of long chains decreased from 8.4% to between 3.1 and 3.7% in both amylopectin and φ,β-limit dextrins. Moreover, both the external and internal chain lengths decreased, suggesting a difference in their cluster structures. Whereas the molar ratio of A:B-chains was similar in all samples (1.1-1.2), some ratios of chain categories were affected by the absence of SSIII, notably the ratio of "fingerprint" A-chains to "clustered" A-chains. This study highlighted the relationship between SSIII and the internal molecular structure of maize starch.

  2. Assessing significance in a Markov chain without mixing.

    PubMed

    Chikina, Maria; Frieze, Alan; Pegden, Wesley

    2017-03-14

    We present a statistical test to detect that a presented state of a reversible Markov chain was not chosen from a stationary distribution. In particular, given a value function for the states of the Markov chain, we would like to show rigorously that the presented state is an outlier with respect to the values, by establishing a [Formula: see text] value under the null hypothesis that it was chosen from a stationary distribution of the chain. A simple heuristic used in practice is to sample ranks of states from long random trajectories on the Markov chain and compare these with the rank of the presented state; if the presented state is a [Formula: see text] outlier compared with the sampled ranks (its rank is in the bottom [Formula: see text] of sampled ranks), then this observation should correspond to a [Formula: see text] value of [Formula: see text] This significance is not rigorous, however, without good bounds on the mixing time of the Markov chain. Our test is the following: Given the presented state in the Markov chain, take a random walk from the presented state for any number of steps. We prove that observing that the presented state is an [Formula: see text]-outlier on the walk is significant at [Formula: see text] under the null hypothesis that the state was chosen from a stationary distribution. We assume nothing about the Markov chain beyond reversibility and show that significance at [Formula: see text] is best possible in general. We illustrate the use of our test with a potential application to the rigorous detection of gerrymandering in Congressional districting.

  3. Unique Aspects of the Structure and Dynamics of Elementary Iβ Cellulose Microfibrils Revealed by Computational Simulations1[OPEN

    PubMed Central

    Oehme, Daniel P.; Downton, Matthew T.; Doblin, Monika S.; Wagner, John; Gidley, Michael J.; Bacic, Antony

    2015-01-01

    The question of how many chains an elementary cellulose microfibril contains is critical to understanding the molecular mechanism(s) of cellulose biosynthesis and regulation. Given the hexagonal nature of the cellulose synthase rosette, it is assumed that the number of chains must be a multiple of six. We present molecular dynamics simulations on three different models of Iβ cellulose microfibrils, 18, 24, and 36 chains, to investigate their structure and dynamics in a hydrated environment. The 36-chain model stays in a conformational space that is very similar to the initial crystalline phase, while the 18- and 24-chain models sample a conformational space different from the crystalline structure yet similar to conformations observed in recent high-temperature molecular dynamics simulations. Major differences in the conformations sampled between the different models result from changes to the tilt of chains in different layers, specifically a second stage of tilt, increased rotation about the O2-C2 dihedral, and a greater sampling of non-TG exocyclic conformations, particularly the GG conformation in center layers and GT conformation in solvent-exposed exocyclic groups. With a reinterpretation of nuclear magnetic resonance data, specifically for contributions made to the C6 peak, data from the simulations suggest that the 18- and 24-chain structures are more viable models for an elementary cellulose microfibril, which also correlates with recent scattering and diffraction experimental data. These data inform biochemical and molecular studies that must explain how a six-particle cellulose synthase complex rosette synthesizes microfibrils likely comprised of either 18 or 24 chains. PMID:25786828

  4. Assessing significance in a Markov chain without mixing

    PubMed Central

    Chikina, Maria; Frieze, Alan; Pegden, Wesley

    2017-01-01

    We present a statistical test to detect that a presented state of a reversible Markov chain was not chosen from a stationary distribution. In particular, given a value function for the states of the Markov chain, we would like to show rigorously that the presented state is an outlier with respect to the values, by establishing a p value under the null hypothesis that it was chosen from a stationary distribution of the chain. A simple heuristic used in practice is to sample ranks of states from long random trajectories on the Markov chain and compare these with the rank of the presented state; if the presented state is a 0.1% outlier compared with the sampled ranks (its rank is in the bottom 0.1% of sampled ranks), then this observation should correspond to a p value of 0.001. This significance is not rigorous, however, without good bounds on the mixing time of the Markov chain. Our test is the following: Given the presented state in the Markov chain, take a random walk from the presented state for any number of steps. We prove that observing that the presented state is an ε-outlier on the walk is significant at p=2ε under the null hypothesis that the state was chosen from a stationary distribution. We assume nothing about the Markov chain beyond reversibility and show that significance at p≈ε is best possible in general. We illustrate the use of our test with a potential application to the rigorous detection of gerrymandering in Congressional districting. PMID:28246331

  5. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  6. Facile analysis of contents and compositions of the chondroitin sulfate/dermatan sulfate hybrid chain in shark and ray tissues.

    PubMed

    Takeda, Naoko; Horai, Sawako; Tamura, Jun-ichi

    2016-04-07

    The chondroitin sulfate (CS)/dermatan sulfate (DS) hybrid chain was extracted from specific tissues of several kinds of sharks and rays. The contents and sulfation patterns of the CS/DS hybrid chain were precisely analyzed by digestion with chondroitinases ABC and AC. All samples predominantly contained the A- and C-units. Furthermore, all samples characteristically contained the D-unit. Species-specific differences were observed in the contents of the CS/DS hybrid chain, which were the highest in Mako and Blue sharks and Sharpspine skates, but were lower in Hammerhead sharks. Marked differences were observed in the ratio of the C-unit/A-unit between sharks and rays. The contents of the CS/DS hybrid chain and the ratio of the C-unit/A-unit may be related to an oxidative stress-decreasing ability. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Microscopic theory of light-induced deformation in amorphous side-chain azobenzene polymers.

    PubMed

    Toshchevikov, V; Saphiannikova, M; Heinrich, G

    2009-04-16

    We propose a microscopic theory of light-induced deformation of side-chain azobenzene polymers taking into account the internal structure of polymer chains. Our theory is based on the fact that interaction of chromophores with the polarized light leads to the orientation anisotropy of azobenzene macromolecules which is accompanied by the appearance of mechanical stress. It is the first microscopic theory which provides the value of the light-induced stress larger than the yield stress. This result explains a possibility for the inscription of surface relief gratings in glassy side-chain azobenzene polymers. For some chemical architectures, elongation of a sample demonstrates a nonmonotonic behavior with the light intensity and can change its sign (a stretched sample starts to be uniaxially compressed), in agreement with experiments. Using a viscoplastic approach, we show that the irreversible strain of a sample, which remains after the light is switched off, decreases with increasing temperature and can disappear at certain temperature below the glass transition temperature. This theoretical prediction is also confirmed by recent experiments.

  8. Thermal Analysis of Brazing Seal and Sterilizing Technique to Break Contamination Chain for Mars Sample Return

    NASA Technical Reports Server (NTRS)

    Bao, Xiaoqi; Badescu, Mircea; Bar-Cohen, Yoseph

    2015-01-01

    The potential to return Martian samples to Earth for extensive analysis is in great interest of the planetary science community. It is important to make sure the mission would securely contain any microbes that may possibly exist on Mars so that they would not be able to cause any adverse effects on Earth's environment. A brazing sealing and sterilizing technique has been proposed to break the Mars-to-Earth contamination chain. Thermal analysis of the brazing process was conducted for several conceptual designs that apply the technique. Control of the increase of the temperature of the Martian samples is a challenge. The temperature profiles of the Martian samples being sealed in the container were predicted by finite element thermal models. The results show that the sealing and sterilization process can be controlled such that the samples' temperature is maintained below the potentially required level, and that the brazing technique is a feasible approach to break the contamination chain.

  9. Analysis of AISI 304 Tensile Strength as an Anchor Chain of Mooring System

    NASA Astrophysics Data System (ADS)

    Hamidah, I.; Wati, R.; Hamdani, R. A.

    2018-05-01

    The background of this research is the use of mild steel (i.e., St37) as anchor chain that works on the corrosive environment of seawater which is possible to decrease its tensile strength. The longer soaked in seawater, the more significant the lowering of its tensile strength. Anchor chain needs to be designed by considering its tensile strength and corrosion resistance, so it’s able to support mooring system well. The primary purpose of this research is obtaining the decreasing of stainless steel 304 (AISI 304) tensile strength which is corroded by seawater as anchor chain of the mooring system. It is also essential to obtain the lifetime of AISI304 and St37 as anchor chain with the same load, the corrosion rate of AISI 304, and St 37 in seawater. The method which was employed in this research is an experiment with four pieces of stainless steel AISI 304, and of St 37 corrosion testing samples, six pieces of stainless steel 304, and six pieces of St 37 for tensile testing samples. The result of this research shows that seawater caused stainless steel AISI 304 as anchor chain has decreased of tensile strength about 1.68 % during four weeks. Also, it indicates that AISI 304 as anchor chain has a lifetime about 130 times longer than St 37. Further, we found that the corrosion rate of stainless steel 304 in seawater is 0.2042 mpy in outstanding category, while the St 37 samples reached up to 27.0247 mpy ranked as fair category. This result recommends that AISI 304 more excellence than St 37 as anchor chain of the mooring system.

  10. Unique aspects of the structure and dynamics of elementary Iβ cellulose microfibrils revealed by computational simulations.

    PubMed

    Oehme, Daniel P; Downton, Matthew T; Doblin, Monika S; Wagner, John; Gidley, Michael J; Bacic, Antony

    2015-05-01

    The question of how many chains an elementary cellulose microfibril contains is critical to understanding the molecular mechanism(s) of cellulose biosynthesis and regulation. Given the hexagonal nature of the cellulose synthase rosette, it is assumed that the number of chains must be a multiple of six. We present molecular dynamics simulations on three different models of Iβ cellulose microfibrils, 18, 24, and 36 chains, to investigate their structure and dynamics in a hydrated environment. The 36-chain model stays in a conformational space that is very similar to the initial crystalline phase, while the 18- and 24-chain models sample a conformational space different from the crystalline structure yet similar to conformations observed in recent high-temperature molecular dynamics simulations. Major differences in the conformations sampled between the different models result from changes to the tilt of chains in different layers, specifically a second stage of tilt, increased rotation about the O2-C2 dihedral, and a greater sampling of non-TG exocyclic conformations, particularly the GG conformation in center layers and GT conformation in solvent-exposed exocyclic groups. With a reinterpretation of nuclear magnetic resonance data, specifically for contributions made to the C6 peak, data from the simulations suggest that the 18- and 24-chain structures are more viable models for an elementary cellulose microfibril, which also correlates with recent scattering and diffraction experimental data. These data inform biochemical and molecular studies that must explain how a six-particle cellulose synthase complex rosette synthesizes microfibrils likely comprised of either 18 or 24 chains. © 2015 American Society of Plant Biologists. All Rights Reserved.

  11. Simultaneous analysis of perfluoroalkyl and polyfluoroalkyl substances including ultrashort-chain C2 and C3 compounds in rain and river water samples by ultra performance convergence chromatography.

    PubMed

    Yeung, Leo W Y; Stadey, Christopher; Mabury, Scott A

    2017-11-03

    An analytical method using ultra performance convergence chromatography (UPC 2 ) coupled to a tandem mass spectrometer operated in negative electrospray mode was developed to measure perfluoroalkyl and polyfluoroalkyl substances (PFASs) including the ultrashort-chain PFASs (C2-C3). Compared to the existing liquid chromatography tandem mass spectrometry method using an ion exchange column, the new method has a lower detection limit (0.4pg trifluoroacetate (TFA) on-column), narrower peak width (3-6s), and a shorter run time (8min). Using the same method, different classes of PFASs (e.g., perfluoroalkyl sulfonates (PFSAs) and perfluorinated carboxylates (PFCAs), perfluorinated phosphonates (PFPAs) and phosphinates (PFPiAs), polyfluoroalkyl phosphate diesters (diPAPs)) can be measured in a single analysis. Rain (n=2) and river water (n=2) samples collected in Toronto, ON, were used for method validation and application. Results showed that short-chain PFAS (C2-C7 PFCAs and C4 PFSA) contributed to over 80% of the detectable PFASs in rain samples and the C2-C3 PFASs alone accounted for over 40% of the total. Reports on environmental levels of these ultrashort-chain PFASs are relatively scarce. Relatively large contribution of these ultrashort-chain PFASs to the total PFASs indicate the need to include the measurement of short-chain PFASs, especially C2 and C3 PFASs, in environmental monitoring. The sources of TFA and other short-chain PFASs in the environment are not entirely clear. The newly developed analytical method may help further investigation on the sources and the environmental levels of these ultrashort-chain PFASs. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Bayesian inversion of seismic and electromagnetic data for marine gas reservoir characterization using multi-chain Markov chain Monte Carlo sampling

    NASA Astrophysics Data System (ADS)

    Ren, Huiying; Ray, Jaideep; Hou, Zhangshuan; Huang, Maoyi; Bao, Jie; Swiler, Laura

    2017-12-01

    In this study we developed an efficient Bayesian inversion framework for interpreting marine seismic Amplitude Versus Angle and Controlled-Source Electromagnetic data for marine reservoir characterization. The framework uses a multi-chain Markov-chain Monte Carlo sampler, which is a hybrid of DiffeRential Evolution Adaptive Metropolis and Adaptive Metropolis samplers. The inversion framework is tested by estimating reservoir-fluid saturations and porosity based on marine seismic and Controlled-Source Electromagnetic data. The multi-chain Markov-chain Monte Carlo is scalable in terms of the number of chains, and is useful for computationally demanding Bayesian model calibration in scientific and engineering problems. As a demonstration, the approach is used to efficiently and accurately estimate the porosity and saturations in a representative layered synthetic reservoir. The results indicate that the seismic Amplitude Versus Angle and Controlled-Source Electromagnetic joint inversion provides better estimation of reservoir saturations than the seismic Amplitude Versus Angle only inversion, especially for the parameters in deep layers. The performance of the inversion approach for various levels of noise in observational data was evaluated - reasonable estimates can be obtained with noise levels up to 25%. Sampling efficiency due to the use of multiple chains was also checked and was found to have almost linear scalability.

  13. An evaluation of cold chain system for vaccines in Bangalore.

    PubMed

    Sudarshan, M K; Sundar, M; Girish, N; Narendra, S; Patel, N G

    1994-01-01

    The cold chain plays a major role in the universal immunization programme which helps in preventing against six major killer diseases in children. We collected 144 study samples randomly from different parts of Bangalore to know the training status of personnel, refrigeration facilities, storage, monitoring and potency of vaccines. It was observed that 6.6% of general practitioners were trained under Universal Immunization Programme, monitoring was not satisfactory, and two of the OPV samples from medical practitioners had an unsatisfactory titre dose. Comprehensive orientation/training on cold chain is essential for medical practitioners and other professionals.

  14. Nondestructive Quantitative Sampling for Freshwater Mussels in Variable Substrate Streams

    Treesearch

    John B. Richardson; Winston Paul Smith

    1994-01-01

    Unionidmussels were sampled in the Big South Fork of the Cumberland River, Tennessee and Kentucky, from July to October 1988 with a chain grid of10 l-m2 quadrats. The chain grid was used to define 100-m2 areas along the stream bed by repeatedly moving the10-m2 rectangle upstream. Within each100-m

  15. Chain sampling plan (ChSP-1) for desired acceptable quality level (AQL) and limiting quality level (LQL)

    NASA Astrophysics Data System (ADS)

    Raju, C.; Vidya, R.

    2017-11-01

    Chain Sampling Plan is widely used whenever a small sample attributes plan is required to be used for situations involving destructive products coming out of continuous production process [1, 2]. This paper presents a procedure for the construction and selection of a ChSP-1 by attributes inspection based on membership functions [3]. A procedure using search technique is developed for obtaining the parameters of single sampling plan for a given set of AQL and LQL values. A sample of tables providing ChSP-1 plans for various combinations of AQL and LQL values are presented [4].

  16. Chain Assembly and Disassembly Processes Differently Affect the Conformational Space of Ubiquitin Chains.

    PubMed

    Kniss, Andreas; Schuetz, Denise; Kazemi, Sina; Pluska, Lukas; Spindler, Philipp E; Rogov, Vladimir V; Husnjak, Koraljka; Dikic, Ivan; Güntert, Peter; Sommer, Thomas; Prisner, Thomas F; Dötsch, Volker

    2018-02-06

    Ubiquitination is the most versatile posttranslational modification. The information is encoded by linkage type as well as chain length, which are translated by ubiquitin binding domains into specific signaling events. Chain topology determines the conformational space of a ubiquitin chain and adds an additional regulatory layer to this ubiquitin code. In particular, processes that modify chain length will be affected by chain conformations as they require access to the elongation or cleavage sites. We investigated conformational distributions in the context of chain elongation and disassembly using pulsed electron-electron double resonance spectroscopy in combination with molecular modeling. Analysis of the conformational space of diubiquitin revealed conformational selection or remodeling as mechanisms for chain recognition during elongation or hydrolysis, respectively. Chain elongation to tetraubiquitin increases the sampled conformational space, suggesting that a high intrinsic flexibility of K48-linked chains may contribute to efficient proteasomal degradation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Molecular design of boronic acid-functionalized squarylium cyanine dyes for multiple discriminant analysis of sialic acid in biological samples: selectivity toward monosaccharides controlled by different alkyl side chain lengths.

    PubMed

    Ouchi, Kazuki; Colyer, Christa L; Sebaiy, Mahmoud; Zhou, Jin; Maeda, Takeshi; Nakazumi, Hiroyuki; Shibukawa, Masami; Saito, Shingo

    2015-02-03

    We designed a new series of boronic acid-functionalized squarylium cyanine dyes (SQ-BA) with different lengths of alkyl chain residues, suitable for multiple discriminant analysis (MDA) of sialic acid (Neu5Ac) in biological samples. The SQ-BA dyes form aggregates based on hydrophobic interactions, which result in quenched fluorescence in aqueous solutions. When the boronic acid binds with saccharides, the fluorescence intensity increases as a result of dissociation to the emissive monomeric complex. We inferred that different dye aggregate structures (H-aggregates and J-aggregates) were induced depending on the alkyl chain length, so that monosaccharides would be recognized in different ways (especially, multipoint interaction with J-aggregates). A distinctive emission enhancement of SQ-BA dyes with shorter-alkyl-chains in the presence of Neu5Ac was observed (2.4-fold fluorescence enhancement; with formation constant 10(1.7) M(-1)), with no such enhancement for SQ-BA dyes with longer-alkyl-chain. In addition, various enhancement factors for other monosaccharides were observed depending on the alkyl chain length. Detailed thermodynamic and NMR studies of the SQ-BA complexes revealed the unique recognition mechanism: the dye aggregate with a shorter-alkyl-chain causes the slipped parallel structure and forms a stable 2:1 complex with Neu5Ac, as distinct from longer-alkyl-chain dyes, which form a 1:1 monomeric complex. MDA using the four SQ-BA dyes was performed for human urine samples, resulting in the successful discrimination between normal and abnormal Neu5Ac levels characteristic of disease. Thus, we successfully controlled various responses to similar monosaccharides with a novel approach that chemically modified not the boronic acid moiety itself but the length of the alkyl chain residue attached to the dye in order to generate specificity.

  18. Unit and internal chain profiles of maca amylopectin.

    PubMed

    Zhang, Ling; Li, Guantian; Yao, Weirong; Zhu, Fan

    2018-03-01

    Unit chain length distributions of amylopectin and its φ, β-limit dextrins, which reflect amylopectin internal structure from three maca starches, were determined by high-performance anion-exchange chromatography with pulsed amperometric detection after debranching, and the samples were compared with maize starch. The amylopectins exhibited average chain lengths ranging from 16.72 to 17.16, with ranges of total internal chain length, external chain length, and internal chain length of the maca amylopectins at 12.49 to 13.68, 11.24 to 11.89, and 4.27 to 4.48. The average chain length, external chain length, internal chain length, and total internal chain length were comparable in three maca amylopectins. Amylopectins of the three maca genotypes studied here presented no significant differences in their unit chain length profiles, but did show significant differences in their internal chain profiles. Additional genetic variations between different maca genotypes need to be studied to provide unit- and internal chain profiles of maca amylopectin. Copyright © 2017. Published by Elsevier Ltd.

  19. Selective and directional actuation of elastomer films using chained magnetic nanoparticles

    NASA Astrophysics Data System (ADS)

    Mishra, Sumeet R.; Dickey, Michael D.; Velev, Orlin D.; Tracy, Joseph B.

    2016-01-01

    We report selective and directional actuation of elastomer films utilizing magnetic anisotropy introduced by chains of Fe3O4 magnetic nanoparticles (MNPs). Under uniform magnetic fields or field gradients, dipolar interactions between the MNPs favor magnetization along the chain direction and cause selective lifting. This mechanism is described using a simple model.We report selective and directional actuation of elastomer films utilizing magnetic anisotropy introduced by chains of Fe3O4 magnetic nanoparticles (MNPs). Under uniform magnetic fields or field gradients, dipolar interactions between the MNPs favor magnetization along the chain direction and cause selective lifting. This mechanism is described using a simple model. Electronic supplementary information (ESI) available: Two videos for actuation while rotating the sample, experimental details of nanoparticle synthesis, polymer composite preparation, and alignment and bending studies, details of the theoretical model of actuation, and supplemental figures for understanding the behavior of rotating samples and results from modelling. See DOI: 10.1039/c5nr07410j

  20. Light chain typing of immunoglobulins in small samples of biological material

    PubMed Central

    Rádl, J.

    1970-01-01

    A method is described for the typing of the light chains of immunoglobulins in small samples of sera or external secretions and without their previous isolation. It consists of immunoelectrophoresis in agar plates which contain specific antisera against one of the light chain types. All immunoglobulins of this type are thus selected by precipitation in the central area during the electrophoretic phase. Immunoglobulins of the opposite light chain type diffuse through the agar and react with the class specific antisera from the troughs. This results in the precipitin lines as in conventional immunoelectrophoresis. This technique has proved most useful for typing heterogenous or homogeneous immunoglobulins in normal and low concentration. The antisera used for incorporation in the agar should fulfil special requirements. They should contain a high level of antibodies against common surface determinants of the immunoglobulin light chains. The further possibilities of this immunoselection technique for typing different protein mixtures is discussed. ImagesFIG. 1FIG. 2FIG. 3FIG. 4FIG. 5FIG. 6 PMID:4098592

  1. Screening of short- and medium-chain chlorinated paraffins in selected riverine sediments and sludge from the Czech Republic.

    PubMed

    Pribylová, Petra; Klánová, Jana; Holoubek, Ivan

    2006-11-01

    Wide distribution of chlorinated paraffins in the environment has already been demonstrated in several studies; however, information about their levels in the Central Europe is still very limited. First study focused on the SCCP contamination of the Czech aquatic environment have been performed recently, and its results motivated the authors to analyze sediments from a wide set of the Czech rivers in order to obtain more detailed information. Thirty-six sediment samples from eleven rivers and five drainage vents neighboring the chemical factories were analyzed; special attention was paid to the industrial areas. For the first time in the Czech Republic, medium-chain in addition to short-chain chlorinated paraffins were analyzed using GC-ECNI-MS. Chlorinated paraffins were detected in sediment samples on the concentration levels up to 347 ngg(-1) for short-chain chlorinated paraffins, and 5575 ngg(-1) for medium-chain chlorinated paraffins. Average chlorination degree of SCCPs was 65%.

  2. Microbial alteration of normal alkane δ13C and δD in sedimentary archives

    NASA Astrophysics Data System (ADS)

    Brittingham, A.; Hren, M. T.; Hartman, G.

    2016-12-01

    Long-carbon chain normal alkanes (e.g. C25-C33) are produced by a wide range of terrestrial plants and commonly preserved in ancient sediments. These serve as a potential paleoclimate proxy because their hydrogen (δD) and carbon (δ13C) isotope values reflect the combined effect of plant-specific species effects and responses to environmental conditions. While these are commonly believed to remain unaltered at low burial temperatures (e.g. <150°C), there is still uncertainty around the role microbes play during the breakdown of these compounds in stored sediment and the potential risk for isotopic alteration. We analyzed two sets of identical samples to assess the role of microbial and other degradation process on the hydrogen and carbon isotope composition of these compounds. The first set of sediment samples were collected in the summer of 2011 from central Armenia, a region with continental climate, and allowed to sit in sealed bags at room temperature for three years. A second and identical set was collected in 2014 and frozen immediately. Stored samples showed high amounts of medium chain length n-alkanes (C19-C26), produced by microorganisms, which were absent from the samples that were collected in 2014 and frozen immediately after sampling. Along with the presence of medium chain length n-alkanes, the average chain length of n-alkanes from C25-C33 decreased significantly in all 2011 samples. Storage of the samples over three years resulted in altered δD and δ13C values of C29 and C31 n-alkanes. While δD values were heavier relative to the control by 4-25‰, δ13C values were mostly lighter (maximum change of -4.2‰ in C29 and -2.9‰ in C31). DNA analysis of the soil showed Rhodococcus and Aeromicrobium, genera that contain multiple coding regions for alkane degrading enzymes CYP153 and AlkB, increased by an order of magnitude during sample storage (from 0.7% to 7.5% of bacteria present). The proliferation of alkane degrading bacteria, combined with the large changes of long-chain n-alkane isotope values, suggest that bacteria may play a larger role than previously expected in altering the measured δD and δ13C values of long-chain n-alkanes during storage. This poses a potentially significant issue for all manner of samples that are not stored frozen, including a variety of sedimentary cores.

  3. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    PubMed

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  4. Multi-chain Markov chain Monte Carlo methods for computationally expensive models

    NASA Astrophysics Data System (ADS)

    Huang, M.; Ray, J.; Ren, H.; Hou, Z.; Bao, J.

    2017-12-01

    Markov chain Monte Carlo (MCMC) methods are used to infer model parameters from observational data. The parameters are inferred as probability densities, thus capturing estimation error due to sparsity of the data, and the shortcomings of the model. Multiple communicating chains executing the MCMC method have the potential to explore the parameter space better, and conceivably accelerate the convergence to the final distribution. We present results from tests conducted with the multi-chain method to show how the acceleration occurs i.e., for loose convergence tolerances, the multiple chains do not make much of a difference. The ensemble of chains also seems to have the ability to accelerate the convergence of a few chains that might start from suboptimal starting points. Finally, we show the performance of the chains in the estimation of O(10) parameters using computationally expensive forward models such as the Community Land Model, where the sampling burden is distributed over multiple chains.

  5. Bayesian inversion of seismic and electromagnetic data for marine gas reservoir characterization using multi-chain Markov chain Monte Carlo sampling

    DOE PAGES

    Ren, Huiying; Ray, Jaideep; Hou, Zhangshuan; ...

    2017-10-17

    In this paper we developed an efficient Bayesian inversion framework for interpreting marine seismic Amplitude Versus Angle and Controlled-Source Electromagnetic data for marine reservoir characterization. The framework uses a multi-chain Markov-chain Monte Carlo sampler, which is a hybrid of DiffeRential Evolution Adaptive Metropolis and Adaptive Metropolis samplers. The inversion framework is tested by estimating reservoir-fluid saturations and porosity based on marine seismic and Controlled-Source Electromagnetic data. The multi-chain Markov-chain Monte Carlo is scalable in terms of the number of chains, and is useful for computationally demanding Bayesian model calibration in scientific and engineering problems. As a demonstration, the approach ismore » used to efficiently and accurately estimate the porosity and saturations in a representative layered synthetic reservoir. The results indicate that the seismic Amplitude Versus Angle and Controlled-Source Electromagnetic joint inversion provides better estimation of reservoir saturations than the seismic Amplitude Versus Angle only inversion, especially for the parameters in deep layers. The performance of the inversion approach for various levels of noise in observational data was evaluated — reasonable estimates can be obtained with noise levels up to 25%. Sampling efficiency due to the use of multiple chains was also checked and was found to have almost linear scalability.« less

  6. Bayesian inversion of seismic and electromagnetic data for marine gas reservoir characterization using multi-chain Markov chain Monte Carlo sampling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ren, Huiying; Ray, Jaideep; Hou, Zhangshuan

    In this paper we developed an efficient Bayesian inversion framework for interpreting marine seismic Amplitude Versus Angle and Controlled-Source Electromagnetic data for marine reservoir characterization. The framework uses a multi-chain Markov-chain Monte Carlo sampler, which is a hybrid of DiffeRential Evolution Adaptive Metropolis and Adaptive Metropolis samplers. The inversion framework is tested by estimating reservoir-fluid saturations and porosity based on marine seismic and Controlled-Source Electromagnetic data. The multi-chain Markov-chain Monte Carlo is scalable in terms of the number of chains, and is useful for computationally demanding Bayesian model calibration in scientific and engineering problems. As a demonstration, the approach ismore » used to efficiently and accurately estimate the porosity and saturations in a representative layered synthetic reservoir. The results indicate that the seismic Amplitude Versus Angle and Controlled-Source Electromagnetic joint inversion provides better estimation of reservoir saturations than the seismic Amplitude Versus Angle only inversion, especially for the parameters in deep layers. The performance of the inversion approach for various levels of noise in observational data was evaluated — reasonable estimates can be obtained with noise levels up to 25%. Sampling efficiency due to the use of multiple chains was also checked and was found to have almost linear scalability.« less

  7. Calculation of a fluctuating entropic force by phase space sampling.

    PubMed

    Waters, James T; Kim, Harold D

    2015-07-01

    A polymer chain pinned in space exerts a fluctuating force on the pin point in thermal equilibrium. The average of such fluctuating force is well understood from statistical mechanics as an entropic force, but little is known about the underlying force distribution. Here, we introduce two phase space sampling methods that can produce the equilibrium distribution of instantaneous forces exerted by a terminally pinned polymer. In these methods, both the positions and momenta of mass points representing a freely jointed chain are perturbed in accordance with the spatial constraints and the Boltzmann distribution of total energy. The constraint force for each conformation and momentum is calculated using Lagrangian dynamics. Using terminally pinned chains in space and on a surface, we show that the force distribution is highly asymmetric with both tensile and compressive forces. Most importantly, the mean of the distribution, which is equal to the entropic force, is not the most probable force even for long chains. Our work provides insights into the mechanistic origin of entropic forces, and an efficient computational tool for unbiased sampling of the phase space of a constrained system.

  8. Analysis of Medium-Chain-Length Polyhydroxyalkanoate-Producing Bacteria in Activated Sludge Samples Enriched by Aerobic Periodic Feeding.

    PubMed

    Lee, Sun Hee; Kim, Jae Hee; Chung, Chung-Wook; Kim, Do Young; Rhee, Young Ha

    2018-04-01

    Analysis of mixed microbial populations responsible for the production of medium-chain-length polyhydroxyalkanoates (MCL-PHAs) under periodic substrate feeding in a sequencing batch reactor (SBR) was conducted. Regardless of activated sludge samples and the different MCL alkanoic acids used as the sole external carbon substrate, denaturing gradient gel electrophoresis analysis indicated that Pseudomonas aeruginosa was the dominant bacterium enriched during the SBR process. Several P. aeruginosa strains were isolated from the enriched activated sludge samples. The isolates were subdivided into two groups, one that produced only MCL-PHAs and another that produced both MCL- and short-chain-length PHAs. The SBR periodic feeding experiments with five representative MCL-PHA-producing Pseudomonas species revealed that P. aeruginosa has an advantage over other species that enables it to become dominant in the bacterial community.

  9. Data Analysis Recipes: Using Markov Chain Monte Carlo

    NASA Astrophysics Data System (ADS)

    Hogg, David W.; Foreman-Mackey, Daniel

    2018-05-01

    Markov Chain Monte Carlo (MCMC) methods for sampling probability density functions (combined with abundant computational resources) have transformed the sciences, especially in performing probabilistic inferences, or fitting models to data. In this primarily pedagogical contribution, we give a brief overview of the most basic MCMC method and some practical advice for the use of MCMC in real inference problems. We give advice on method choice, tuning for performance, methods for initialization, tests of convergence, troubleshooting, and use of the chain output to produce or report parameter estimates with associated uncertainties. We argue that autocorrelation time is the most important test for convergence, as it directly connects to the uncertainty on the sampling estimate of any quantity of interest. We emphasize that sampling is a method for doing integrals; this guides our thinking about how MCMC output is best used. .

  10. Effect of Backbone Chemistry on the Structure of Polyurea Films Deposited by Molecular Layer Deposition

    DOE PAGES

    Bergsman, David S.; Closser, Richard G.; Tassone, Christopher J.; ...

    2017-01-01

    An experimental investigation into the growth of polyurea films by molecular layer deposition was performed by examining trends in the growth rate, crystallinity, and orientation of chains as a function of backbone flexibility. Growth curves obtained for films containing backbones of aliphatic and phenyl groups indicate that an increase in backbone flexibility leads to a reduction in growth rate from 4 to 1 Å/cycle. Crystallinity measurements collected using grazing incidence X-ray diffraction and Fourier transform infrared spectroscopy suggest that some chains form paracrystalline, out-of-plane stacks of polymer segments with packing distances ranging from 4.4 to 3.7 Å depending on themore » monomer size. Diffraction intensity is largely a function of the homogeneity of the backbone. Near-edge X-ray absorption fine structure measurements for thin and thick samples show an average chain orientation of ~25° relative to the substrate across all samples, suggesting that changes in growth rate are not caused by differences in chain angle but instead may be caused by differences in the frequency of chain terminations. In conclusion, these results suggest a model of molecular layer deposition-based chain growth in which films consist of a mixture of upward growing chains and horizontally aligned layers of paracrystalline polymer segments.« less

  11. Bayesian inversion of seismic and electromagnetic data for marine gas reservoir characterization using multi-chain Markov chain Monte Carlo sampling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ren, Huiying; Ray, Jaideep; Hou, Zhangshuan

    In this study we developed an efficient Bayesian inversion framework for interpreting marine seismic amplitude versus angle (AVA) and controlled source electromagnetic (CSEM) data for marine reservoir characterization. The framework uses a multi-chain Markov-chain Monte Carlo (MCMC) sampler, which is a hybrid of DiffeRential Evolution Adaptive Metropolis (DREAM) and Adaptive Metropolis (AM) samplers. The inversion framework is tested by estimating reservoir-fluid saturations and porosity based on marine seismic and CSEM data. The multi-chain MCMC is scalable in terms of the number of chains, and is useful for computationally demanding Bayesian model calibration in scientific and engineering problems. As a demonstration,more » the approach is used to efficiently and accurately estimate the porosity and saturations in a representative layered synthetic reservoir. The results indicate that the seismic AVA and CSEM joint inversion provides better estimation of reservoir saturations than the seismic AVA-only inversion, especially for the parameters in deep layers. The performance of the inversion approach for various levels of noise in observational data was evaluated – reasonable estimates can be obtained with noise levels up to 25%. Sampling efficiency due to the use of multiple chains was also checked and was found to have almost linear scalability.« less

  12. Molecular weight dependent structure and charge transport in MAPLE-deposited poly(3-hexylthiophene) thin films

    DOE PAGES

    Dong, Ban Xuan; Smith, Mitchell; Strzalka, Joseph; ...

    2018-02-06

    In this work, poly(3-hexylthiophene) (P3HT) films prepared using the matrix-assisted pulsed laser evaporation (MAPLE) technique are shown to possess morphological structures that are dependent on molecular weight (MW). Specifically, the structures of low MW samples of MAPLE-deposited film are composed of crystallites/aggregates embedded within highly disordered environments, whereas those of high MW samples are composed of aggregated domains connected by long polymer chains. Additionally, the crystallite size along the side-chain (100) direction decreases, whereas the conjugation length increases with increasing molecular weight. This is qualitatively similar to the structure of spin-cast films, though the MAPLE-deposited films are more disordered. In-planemore » carrier mobilities in the MAPLE-deposited samples increase with MW, consistent with the notion that longer chains bridge adjacent aggregated domains thereby facilitating more effective charge transport. The carrier mobilities in the MAPLE-deposited simples are consistently lower than those in the solvent-cast samples for all molecular weights, consistent with the shorter conjugation length in samples prepared by this deposition technique.« less

  13. Molecular weight dependent structure and charge transport in MAPLE-deposited poly(3-hexylthiophene) thin films

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dong, Ban Xuan; Smith, Mitchell; Strzalka, Joseph

    In this work, poly(3-hexylthiophene) (P3HT) films prepared using the matrix-assisted pulsed laser evaporation (MAPLE) technique are shown to possess morphological structures that are dependent on molecular weight (MW). Specifically, the structures of low MW samples of MAPLE-deposited film are composed of crystallites/aggregates embedded within highly disordered environments, whereas those of high MW samples are composed of aggregated domains connected by long polymer chains. Additionally, the crystallite size along the side-chain (100) direction decreases, whereas the conjugation length increases with increasing molecular weight. This is qualitatively similar to the structure of spin-cast films, though the MAPLE-deposited films are more disordered. In-planemore » carrier mobilities in the MAPLE-deposited samples increase with MW, consistent with the notion that longer chains bridge adjacent aggregated domains thereby facilitating more effective charge transport. The carrier mobilities in the MAPLE-deposited simples are consistently lower than those in the solvent-cast samples for all molecular weights, consistent with the shorter conjugation length in samples prepared by this deposition technique.« less

  14. Direct and quantitative detection of HIV-1 RNA in human plasma with a branched DNA signal amplification assay.

    PubMed

    Urdea, M S; Wilber, J C; Yeghiazarian, T; Todd, J A; Kern, D G; Fong, S J; Besemer, D; Hoo, B; Sheridan, P J; Kokka, R

    1993-11-01

    To determine the relative effect of sample matrix on the quantitation of HIV RNA in plasma. Two HIV-positive specimens were diluted into five and 10 different HIV-negative plasma samples, respectively. Branched DNA signal amplification technology and reverse-transcriptase polymerase chain reaction were used to measure the viral load. In one sample the viral load by polymerase chain reaction ranged from undetectable to 1.9 x 10(5) copies/ml, and the branched DNA results ranged from 2.6 x 10(4) to 4.2 x 10(4) HIV RNA equivalent/ml. In the other sample the corresponding figures were 6.3 x 10(4) to 5.5 x 10(5) copies/ml and 5.7 x 10(4) to 7.5 x 10(4) HIV RNA equivalents/ml. In contrast to reverse-transcriptase polymerase chain reaction the branched DNA signal amplification assay does not require a separate extraction step or enzymatic amplification of the target. Therefore this measurement is less affected by the sample matrix and the signal generated is directly proportional to the viral load.

  15. Analysis of Multiple Metabolites of Tocopherols and Tocotrienols in Mice and Humans

    PubMed Central

    Zhao, Yang; Lee, Mao-Jung; Cheung, Connie; Ju, Ji-Hyeung; Chen, Yu-Kuo; Liu, Ba; Hu, Long-Qin; Yang, Chung S.

    2010-01-01

    Tocopherols and tocotrienols, collectively known as vitamin E, are essential antioxidant nutrients. The biological fates and metabolite profiles of the different forms are not clearly understood. The objective of this study is to simultaneously analyze the metabolites of different tocopherols and tocotrienols in mouse and human samples. Using HPLC/electrochemical detection and mass spectrometry, 18 tocopherol-derived and 24 tocotrienol-derived side-chain degradation metabolites were identified in fecal samples. Short-chain degradation metabolites, in particular γ- and δ- carboxyethyl hydroxychromans (CEHCs) and carboxymethylbutyl hydroxychromans (CMBHCs) were detected in urine, serum and liver samples, with tocopherols additionally detected in serum and liver samples. The metabolite profiles of tocotrienols and tocopherols were similar, but new tocotrienol metabolites with double bonds were identified. This is the first comprehensive report describing simultaneous analysis of different side-chain metabolites of tocopherols and tocotrienols in mice and humans. Urinary metabolites may serve as useful biomarkers for nutritional assessment of vitamin E. PMID:20222730

  16. Surface Photochemistry: 3,3′-Dialkylthia and Selenocarbocyanine Dyes Adsorbed onto Microcrystalline Cellulose

    PubMed Central

    Vieira Ferreira, Luís F.; Ferreira, Diana P.; Duarte, Paulo; Oliveira, A. S.; Torres, E.; Machado, I. Ferreira; Almeida, P.; Reis, Lucinda V.; Santos, Paulo F.

    2012-01-01

    In this work, thia and selenocarbocyanines with n-alkyl chains of different length, namely with methyl, ethyl, propyl, hexyl and decyl substituents, were studied in homogeneous and heterogeneous media for comparison purposes. For both carbocyanine dyes adsorbed onto microcrystalline cellulose, a remarkable increase in the fluorescence quantum yields and lifetimes were detected, when compared with solution. Contrary to the solution behaviour, where the increase in the n-alkyl chains length increases to a certain extent the fluorescence emission ΦF and τF, on powdered solid samples a decrease of ΦF and τF was observed. The use of an integrating sphere enabled us to obtain absolute ΦF’s for all the powdered samples. The main difference for liquid homogeneous samples is that the increase of the alkyl chain strongly decreases the ΦF values, both for thiacarbocyanines and selenocarbocyanines. A lifetime distribution analysis for the fluorescence of these dyes adsorbed onto microcrystalline cellulose, evidenced location on the ordered and crystalline part of the substrate, as well as on the more disordered region where the lifetime is smaller. The increase of the n-alkyl chains length decreases the photoisomer emission for the dyes adsorbed onto microcrystalline cellulose, as detected for high fluences of the laser excitation, for most samples. PMID:22312274

  17. A Monte-Carlo method which is not based on Markov chain algorithm, used to study electrostatic screening of ion potential

    NASA Astrophysics Data System (ADS)

    Šantić, Branko; Gracin, Davor

    2017-12-01

    A new simple Monte Carlo method is introduced for the study of electrostatic screening by surrounding ions. The proposed method is not based on the generally used Markov chain method for sample generation. Each sample is pristine and there is no correlation with other samples. As the main novelty, the pairs of ions are gradually added to a sample provided that the energy of each ion is within the boundaries determined by the temperature and the size of ions. The proposed method provides reliable results, as demonstrated by the screening of ion in plasma and in water.

  18. Development of a polymerase chain reaction applicable to rapid and sensitive detection of Clonorchis sinensis eggs in human stool samples

    PubMed Central

    Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo

    2013-01-01

    Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334

  19. Association of plasma cell subsets in the bone marrow and free light chain concentrations in the serum of monoclonal gammopathy patients.

    PubMed

    Ayliffe, Michael John; Behrens, Judith; Stern, Simon; Sumar, Nazira

    2012-08-01

    This study investigated bone marrow plasma cell subsets and monoclonal free light chain concentrations in blood of monoclonal gammopathy patients. 54 bone marrow samples were stained by double immunofluorescence to enumerate cellular subsets making either intact monoclonal immunoglobulin or free light chains only. Blood taken at the same time was assayed for free light chains by an automated immunoassay. Patients were assigned to three cellular population categories: single intact monoclonal immunoglobulin (59%), dual monoclonal immunoglobulin and free light chain only (31%), or single free light chain only (9%). The median affected free light chain concentration of each group was 75 mg/l, 903 mg/l and 3320 mg/l, respectively, but with substantial overlap. In myeloma patients the difference in serum free light chain concentrations between patients with free light chain only marrow cells and those without was statistically significant. Serum free light chain levels >600 mg/l result mostly from marrow cells restricted to free light chain production.

  20. Learning In networks

    NASA Technical Reports Server (NTRS)

    Buntine, Wray L.

    1995-01-01

    Intelligent systems require software incorporating probabilistic reasoning, and often times learning. Networks provide a framework and methodology for creating this kind of software. This paper introduces network models based on chain graphs with deterministic nodes. Chain graphs are defined as a hierarchical combination of Bayesian and Markov networks. To model learning, plates on chain graphs are introduced to model independent samples. The paper concludes by discussing various operations that can be performed on chain graphs with plates as a simplification process or to generate learning algorithms.

  1. Protein Structural Information Derived from NMR Chemical Shift with the Neural Network Program TALOS-N

    PubMed Central

    Shen, Yang; Bax, Ad

    2015-01-01

    Summary Chemical shifts are obtained at the first stage of any protein structural study by NMR spectroscopy. Chemical shifts are known to be impacted by a wide range of structural factors and the artificial neural network based TALOS-N program has been trained to extract backbone and sidechain torsion angles from 1H, 15N and 13C shifts. The program is quite robust, and typically yields backbone torsion angles for more than 90% of the residues, and sidechain χ1 rotamer information for about half of these, in addition to reliably predicting secondary structure. The use of TALOS-N is illustrated for the protein DinI, and torsion angles obtained by TALOS-N analysis from the measured chemical shifts of its backbone and 13Cβ nuclei are compared to those seen in a prior, experimentally determined structure. The program is also particularly useful for generating torsion angle restraints, which then can be used during standard NMR protein structure calculations. PMID:25502373

  2. Characterization of some amino acid derivatives of benzoyl isothiocyanate: Crystal structures and theoretical prediction of their reactivity

    NASA Astrophysics Data System (ADS)

    Odame, Felix; Hosten, Eric C.; Betz, Richard; Lobb, Kevin; Tshentu, Zenixole R.

    2015-11-01

    The reaction of benzoyl isothiocyanate with L-serine, L-proline, D-methionine and L-alanine gave 2-[(benzoylcarbamothioyl)amino]-3-hydroxypropanoic acid (I), 1-(benzoylcarbamothioyl)pyrrolidine-2-carboxylic acid (II), 2-[(benzoylcarbamothioyl)amino]-4-(methylsulfanyl)butanoic acid (III) and 2-[(benzoylcarbamothioyl)amino]propanoic acid (IV), respectively. The compounds have been characterized by IR, NMR, microanalyses and mass spectrometry. The crystal structures of all the compounds have also been discussed. Compound II showed rotamers in solution. DFT calculations of the frontier orbitals of the compounds have been carried out to ascertain the groups that contribute to the HOMO and LUMO, and to study their contribution to the reactivity of these compounds. The calculations indicated that the carboxylic acid group in these compounds is unreactive hence making the conversion to benzimidazoles via cyclization on the carboxylic acids impractical. This has been further confirmed by the reaction of compounds I-IV, respectively, with o-phenylene diamine which was unsuccessful but gave compound V.

  3. Packing of sidechains in low-resolution models for proteins.

    PubMed

    Keskin, O; Bahar, I

    1998-01-01

    Atomic level rotamer libraries for sidechains in proteins have been proposed by several groups. Conformations of side groups in coarse-grained models, on the other hand, have not yet been analyzed, although low resolution approaches are the only efficient way to explore global structural features. A residue-specific backbone-dependent library for sidechain isomers, compatible with a coarse-grained model, is proposed. The isomeric states are utilized in packing sidechains of known backbone structures. Sidechain positions are predicted with a root-mean-square deviation (r.m.s.d.) of 2.40 A with respect to crystal structure for 50 test proteins. The rmsd for core residues is 1.60 A and decreases to 1.35 A when conformational correlations and directional effects in inter-residue couplings are considered. An automated method for assigning sidechain positions in coarse-grained model proteins is proposed and made available on the internet; the method accounts satisfactorily for sidechain packing, particularly in the core.

  4. A Comparison of the ab Initio Calculated and Experimental Conformational Energies of Alkylcyclohexanes

    NASA Astrophysics Data System (ADS)

    Freeman, Fillmore; Tsegai, Zufan M.; Kasner, Marc L.; Hehre, Warren J.

    2000-05-01

    Ab initio 6-31G(d) and MP2/6-31G(d)//6-31G(d) methods were used to calculate the energies of the rotamers of the chair conformers of alkylcyclohexanes and trimethylsilylcyclohexane. The MP2/6-31G(d)//6-31G(d) calculated conformational energies ( ? or A values, in kcal/mol) of the alkylcyclohexanes (Me = 1.96; Et = 1.80; Pr = 1.73 iso-Pr = 1.60; t-Bu = 5.45; neo-pent = 1.32) and trimethylsilylcyclohexane (SiMe3 = 2.69) are similar to the experimental values. Plots of the calculated conformational energies for the alkylcyclohexanes and trimethylsilylcyclohexane versus their experimental values are linear (slope = 1.253 and r = .993 for 6-31G(d) and slope = 1.114 and r = .982 for MP2/6-31G(d)//6-31G(d)). The conformational energies are determined primarily by steric effects which include gauche (synclinal) interactions and repulsive nonbonded interactions in both the axial and equatorial conformers.

  5. Influence of the position of the methoxy group on the stabilities of the syn and anti conformers of 4-, 5-, and 6-methoxyindole

    NASA Astrophysics Data System (ADS)

    Wilke, Martin; Brand, Christian; Wilke, Josefin; Schmitt, Michael

    2017-07-01

    Even though the two possible rotamers of methoxy-substituted indoles only differ in the orientation of a methoxy group, this slight geometry change can have a strong influence on the stabilities and further molecular properties of the conformers. In the present study, we evaluate the effect of the methyl group position on the presence of different conformers in molecular beam studies for the systems 4-, 5-, and 6-methoxyindole. By using rotationally resolved electronic Stark spectroscopy in combination with high level ab initio calculations the structures of the observable conformers have been assigned and reasons for the absence of the missing conformers discussed. Thereby, we could show that the relative ground state energies and isomerization barriers for both conformers strongly depend on the position of the methoxy group and are the main explanation for the absence of the syn conformers of 4-, and 5-methoxyindole.

  6. Architecture of the Synaptotagmin-SNARE Machinery for Neuronal Exocytosis

    PubMed Central

    Zhou, Qiangjun; Lai, Ying; Bacaj, Taulant; Zhao, Minglei; Lyubimov, Artem Y.; Uervirojnangkoorn, Monarin; Zeldin, Oliver B.; Brewster, Aaron S.; Sauter, Nicholas K.; Cohen, Aina E.; Soltis, S. Michael; Alonso-Mori, Roberto; Chollet, Matthieu; Lemke, Henrik T.; Pfuetzner, Richard A.; Choi, Ucheor B.; Weis, William I.; Diao, Jiajie; Südhof, Thomas C.; Brunger, Axel T.

    2015-01-01

    Summary Synaptotagmin-1 and neuronal SNARE proteins play key roles in evoked synchronous neurotransmitter release. However, it is unknown how they cooperate to trigger synaptic vesicle fusion. Here we report atomic-resolution crystal structures of Ca2+- and Mg2+-bound complexes between synaptotagmin-1 and the neuronal SNARE complex, one of which was determined with diffraction data from an X-ray free electron laser, leading to an atomic-resolution structure with accurate rotamer assignments for many sidechains. The structures revealed several interfaces, including a large, specific, Ca2+-independent, and conserved interface. Tests of this interface by mutagenesis suggest that it is essential for Ca2+-triggered neurotransmitter release in neuronal synapses and for Ca2+-triggered vesicle fusion in a reconstituted system. We propose that this interface forms prior to Ca2+-triggering, and moves en bloc as Ca2+ influx promotes the interactions between synaptotagmin-1 and the plasma membrane, and consequently remodels the membrane to promote fusion, possibly in conjunction with other interfaces. PMID:26280336

  7. Rotational barriers. 1. 1,2-dihaloethanes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiberg, K.B.; Murcko, M.A.

    1987-06-18

    The rotational barrier about the C-C bond of 1,2-dichloroethane has been calculated by using several basis sets (4-31G, 6-31G*, 6-31+G*, and 6-31++G**) and including electron correlation. Corrections for zero-point energy differences, and the differences in enthalpy change from 0 to 298 K, were made by using the calculated geometries and vibrational frequencies. The trans/gauche energy difference was found to be 1.39 kcal/mol as compared to the observed value, 1.1 +/- 0.1 kcal/mol. The intramolecular interactions in the several rotamers are discussed. The trans/gauche energy difference for 1,2-difluoroethane also was calculated (MP3/6-311++G**) and was found to be 0.76 kcal/mol favoring themore » gauche conformer, again in good agreement with the experimental value of 0.57 +/- 0.09 kcal/mol. The trend in trans/gauche energy differences in the series n-butane, 1,2-dichloroethane, 1,2-difluoroethane is noted.« less

  8. RESPONDENT-DRIVEN SAMPLING AS MARKOV CHAIN MONTE CARLO

    PubMed Central

    GOEL, SHARAD; SALGANIK, MATTHEW J.

    2013-01-01

    Respondent-driven sampling (RDS) is a recently introduced, and now widely used, technique for estimating disease prevalence in hidden populations. RDS data are collected through a snowball mechanism, in which current sample members recruit future sample members. In this paper we present respondent-driven sampling as Markov chain Monte Carlo (MCMC) importance sampling, and we examine the effects of community structure and the recruitment procedure on the variance of RDS estimates. Past work has assumed that the variance of RDS estimates is primarily affected by segregation between healthy and infected individuals. We examine an illustrative model to show that this is not necessarily the case, and that bottlenecks anywhere in the networks can substantially affect estimates. We also show that variance is inflated by a common design feature in which sample members are encouraged to recruit multiple future sample members. The paper concludes with suggestions for implementing and evaluating respondent-driven sampling studies. PMID:19572381

  9. Sources of error in determinations of carnitine and acylcarnitine in plasma.

    PubMed

    Fishlock, R C; Bieber, L L; Snoswell, A M

    1984-02-01

    Radioactive and nonradioactive L-carnitine and acyl-L-carnitine were used to evaluate the washing procedures used during the determination of free, total, short-chain, and long-chain acylcarnitine in human and sheep plasma. The volume of fluid trapped by the protein precipitated by perchloric acid is approximately 24% of the total fluid volume and thus contains 24% of free carnitine and short-chain acylcarnitine. Washing twice with distilled water removes about 25% of the long-chain acylcarnitine along with the trapped free carnitine and short-chain acylcarnitines. Washing the pellet twice with a 60 g/L solution of perchloric acid completely removes the trapped free carnitine and short-chain acylcarnitine but does not remove the bound long-chain acylcarnitines. Thus washing with perchloric acid is essential for accurate measurement of long-chain acylcarnitines in plasma samples.

  10. Serum Free Light Chain Assay and κ/λ Ratio: Performance in Patients With Monoclonal Gammopathy-High False Negative Rate for κ/λ Ratio

    PubMed Central

    Singh, Gurmukh

    2017-01-01

    Background Serum free light chain assay (SFLCA) and κ/λ ratio, and protein electrophoretic methods are used in the diagnosis and monitoring of monoclonal gammopathies. Methods Results for serum free light chains, serum and urine protein electrophoreses and immunofixation electrophoreses in 468 patients with a diagnosis of monoclonal gammopathy were compared. The results of the two methods were graded as concordant, non-concordant or discordant with the established diagnoses to assess the relative performance of the methods. Results of κ/λ ratio in samples with monoclonal protein detectable by electrophoretic methods were also analyzed. Results Protein electrophoreses results were concordant with the established diagnoses significantly more often than κ/λ ratio. The false negative rate for κ/λ ratio was higher than that for electrophoretic methods. κ/λ ratio was falsely negative in about 27% of the 1,860 samples with detectable monoclonal immunoglobulin. The false negative rate was higher in lesions with lambda chains (32%) than those with kappa chains (24%). The false negative rate for κ/λ ratio was over 55% in samples with monoclonal gammopathy of undetermined significance. Even at first encounter, the false negative rates for κ/λ ratios for monoclonal gammopathy of undetermined significance, smoldering myeloma and multiple myeloma were 66.98%, 23.08%, and 30.15%, respectively, with false negative rate for lambda chain lesions being higher. Conclusions Electrophoretic studies of serum and urine are superior to SFLCA and κ/λ ratio. Abnormal κ/λ ratio, per se, is not diagnostic of monoclonal gammopathy. A normal κ/λ ratio does not exclude monoclonal gammopathy. False negative rates for lesions with lambda chain are higher than those for lesions with kappa chains. Electrophoretic studies of urine are underutilized. Clinical usefulness and medical necessity of SFLCA and κ/λ ratio is of questionable value in routine clinical testing. PMID:27924175

  11. Serum Free Light Chain Assay and κ/λ Ratio: Performance in Patients With Monoclonal Gammopathy-High False Negative Rate for κ/λ Ratio.

    PubMed

    Singh, Gurmukh

    2017-01-01

    Serum free light chain assay (SFLCA) and κ/λ ratio, and protein electrophoretic methods are used in the diagnosis and monitoring of monoclonal gammopathies. Results for serum free light chains, serum and urine protein electrophoreses and immunofixation electrophoreses in 468 patients with a diagnosis of monoclonal gammopathy were compared. The results of the two methods were graded as concordant, non-concordant or discordant with the established diagnoses to assess the relative performance of the methods. Results of κ/λ ratio in samples with monoclonal protein detectable by electrophoretic methods were also analyzed. Protein electrophoreses results were concordant with the established diagnoses significantly more often than κ/λ ratio. The false negative rate for κ/λ ratio was higher than that for electrophoretic methods. κ/λ ratio was falsely negative in about 27% of the 1,860 samples with detectable monoclonal immunoglobulin. The false negative rate was higher in lesions with lambda chains (32%) than those with kappa chains (24%). The false negative rate for κ/λ ratio was over 55% in samples with monoclonal gammopathy of undetermined significance. Even at first encounter, the false negative rates for κ/λ ratios for monoclonal gammopathy of undetermined significance, smoldering myeloma and multiple myeloma were 66.98%, 23.08%, and 30.15%, respectively, with false negative rate for lambda chain lesions being higher. Electrophoretic studies of serum and urine are superior to SFLCA and κ/λ ratio. Abnormal κ/λ ratio, per se , is not diagnostic of monoclonal gammopathy. A normal κ/λ ratio does not exclude monoclonal gammopathy. False negative rates for lesions with lambda chain are higher than those for lesions with kappa chains. Electrophoretic studies of urine are underutilized. Clinical usefulness and medical necessity of SFLCA and κ/λ ratio is of questionable value in routine clinical testing.

  12. Molecular weight kinetics and chain scission models for dextran polymers during ultrasonic degradation.

    PubMed

    Pu, Yuanyuan; Zou, Qingsong; Hou, Dianzhi; Zhang, Yiping; Chen, Shan

    2017-01-20

    Ultrasonic degradation of six dextran samples with different initial molecular weights (IMW) has been performed to investigate the degradation behavior and chain scission mechanism of dextrans. The weight-average molecular weight (Mw) and polydispersity index (D value) were monitored by High Performance Gel Permeation Chromatography (HPGPC). Results showed that Mw and D value decreased with increasing ultrasonic time, resulting in a more homologous dextran solution with lower molecular weight. A significant degradation occurred in dextrans with higher IMW, particularly at the initial stage of the ultrasonic treatment. The Malhotra model was found to well describe the molecular weight kinetics for all dextran samples. Experimental data was fitted into two chain scission models to study dextran chain scission mechanism and the model performance was compared. Results indicated that the midpoint scission model agreed well with experimental results, with a linear regression factor of R 2 >0.99. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Marathon: An Open Source Software Library for the Analysis of Markov-Chain Monte Carlo Algorithms

    PubMed Central

    Rechner, Steffen; Berger, Annabell

    2016-01-01

    We present the software library marathon, which is designed to support the analysis of sampling algorithms that are based on the Markov-Chain Monte Carlo principle. The main application of this library is the computation of properties of so-called state graphs, which represent the structure of Markov chains. We demonstrate applications and the usefulness of marathon by investigating the quality of several bounding methods on four well-known Markov chains for sampling perfect matchings and bipartite graphs. In a set of experiments, we compute the total mixing time and several of its bounds for a large number of input instances. We find that the upper bound gained by the famous canonical path method is often several magnitudes larger than the total mixing time and deteriorates with growing input size. In contrast, the spectral bound is found to be a precise approximation of the total mixing time. PMID:26824442

  14. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

    PubMed

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

    2014-03-01

    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

  15. Optimized nested Markov chain Monte Carlo sampling: theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Coe, Joshua D; Shaw, M Sam; Sewell, Thomas D

    2009-01-01

    Metropolis Monte Carlo sampling of a reference potential is used to build a Markov chain in the isothermal-isobaric ensemble. At the endpoints of the chain, the energy is reevaluated at a different level of approximation (the 'full' energy) and a composite move encompassing all of the intervening steps is accepted on the basis of a modified Metropolis criterion. By manipulating the thermodynamic variables characterizing the reference system we maximize the average acceptance probability of composite moves, lengthening significantly the random walk made between consecutive evaluations of the full energy at a fixed acceptance probability. This provides maximally decorrelated samples ofmore » the full potential, thereby lowering the total number required to build ensemble averages of a given variance. The efficiency of the method is illustrated using model potentials appropriate to molecular fluids at high pressure. Implications for ab initio or density functional theory (DFT) treatment are discussed.« less

  16. Critical behaviour in DOPC/DPPC/cholesterol mixtures: static (2)H NMR line shapes near the critical point.

    PubMed

    Davis, James H; Schmidt, Miranda L

    2014-05-06

    Static (2)H NMR spectroscopy is used to study the critical behavior of mixtures of 1,2-dioleoyl-phosphatidylcholine/1,2-dipalmitoyl-phosphatidylcholine (DPPC)/cholesterol in molar proportion 37.5:37.5:25 using either chain perdeuterated DPPC-d62 or chain methyl deuterated DPPC-d6. The temperature dependence of the first moment of the (2)H spectrum of the sample made with DPPC-d62 and of the quadrupolar splittings of the chain-methyl-labeled DPPC-d6 sample are directly related to the temperature dependence of the critical order parameter η, which scales as [Formula: see text] near the critical temperature. Analysis of the data reveals that for the chain perdeuterated sample, the value of Tc is 301.51 ± 0.1 K, and that of the critical exponent, βc = 0.391 ± 0.02. The line shape analysis of the methyl labeled (d6) sample gives Tc = 303.74 ± 0.07 K and βc = 0.338 ± 0.009. These values obtained for βc are in good agreement with the predictions of a three-dimensional Ising model. The difference in critical temperature between the two samples having nominally the same molar composition arises because of the lowering of the phase transition temperature that occurs due to the perdeuteration of the DPPC. Copyright © 2014 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  17. A novel sputum transport solution eliminates cold chain and supports routine tuberculosis testing in Nepal.

    PubMed

    Maharjan, Bhagwan; Shrestha, Bhabana; Weirich, Alexandra; Stewart, Andrew; Kelly-Cirino, Cassandra D

    2016-12-01

    This preliminary study evaluated the transport reagent OMNIgene SPUTUM (OMS) in a real-world, resource-limited setting: a zonal hospital and national tuberculosis (TB) reference laboratory, Nepal. The objectives were to: (1) assess the performance of OMS for transporting sputum from peripheral sites without cold chain stabilization; and (2) compare with Nepal's standard of care (SOC) for Mycobacterium tuberculosis smear and culture diagnostics. Sixty sputa were manually split into a SOC sample (airline-couriered to the laboratory, conventional processing) and an OMS sample (OMS added at collection, no cold chain transport or processing). Smear microscopy and solid culture were performed. Transport was 0-8days. Forty-one samples (68%) were smear-positive using both methods. Of the OMS cultures, 37 (62%) were positive, 22 (36%) were negative, and one (2%) was contaminated. Corresponding SOC results were 32 (53%), 21 (35%), and seven (12%). OMS "rescued" six (i.e., missed using SOC) compared with one rescue using SOC. Of smear-positives, six SOC samples produced contaminated cultures whereas only one OMS sample was contaminated. OMS reduced culture contamination from 12% to 2%, and improved TB detection by 9%. The results suggest that OMS could perform well as a no cold chain, long-term transport solution for smear and culture testing. The findings provide a basis for larger feasibility studies. Copyright © 2016 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.

  18. Protein side chain rotational isomerization: A minimum perturbation mapping study

    NASA Astrophysics Data System (ADS)

    Haydock, Christopher

    1993-05-01

    A theory of the rotational isomerization of the indole side chain of tryptophan-47 of variant-3 scorpion neurotoxin is presented. The isomerization potential energy, entropic part of the isomerization free energy, isomer probabilities, transition state theory reaction rates, and indole order parameters are calculated from a minimum perturbation mapping over tryptophan-47 χ1×χ2 torsion space. A new method for calculating the fluorescence anisotropy from molecular dynamics simulations is proposed. The method is based on an expansion that separates transition dipole orientation from chromophore dynamics. The minimum perturbation potential energy map is inverted and applied as a bias potential for a 100 ns umbrella sampling simulation. The entropic part of the isomerization free energy as calculated by minimum perturbation mapping and umbrella sampling are in fairly close agreement. Throughout, the approximation is made that two glutamine and three tyrosine side chains neighboring tryptophan-47 are truncated at the Cβ atom. Comparison with the previous combination thermodynamic perturbation and umbrella sampling study suggests that this truncated neighbor side chain approximation leads to at least a qualitatively correct theory of tryptophan-47 rotational isomerization in the wild type variant-3 scorpion neurotoxin. Analysis of van der Waals interactions in a transition state region indicates that for the simulation of barrier crossing trajectories a linear combination of three specially defined dihedral angles will be superior to a simple side chain dihedral reaction coordinate.

  19. Geochemical Evolution of the Louisville Seamount Chain

    NASA Astrophysics Data System (ADS)

    Vanderkluysen, L.; Mahoney, J. J.; Koppers, A. A.; Lonsdale, P. F.

    2007-12-01

    The Louisville seamount chain is a 4300 km long chain of submarine volcanoes in the southwestern Pacific that is commonly thought to represent a hotspot track. It spans an ~80 Myr age range, comparable to that of the Hawaiian-Emperor chain (Koppers et al., G-cubed, 5 (6), 2004). The few previously dredged igneous samples are dominantly basaltic and alkalic, and have been inferred to represent post-shield volcanism (Hawkins et al., AGU Monograph, 43, 235, 1987). Their isotope and trace element signatures suggest an unusually homogenous mantle source (Cheng et al., AGU Monograph, 43, 283, 1987). Dredging in 2006, during the AMAT02RR cruise of the R.V. Revelle, was carried out in the hope of recovering both shield and post-shield samples and of exploring the geochemical evolution of the chain. Igneous rocks were recovered from 33 stations on 23 seamounts covering some 47 Myr of the chain's history. Our study, focusing on the major and trace element and Sr, Nd and Pb isotopic characteristics of these samples, shows that all are alkalic basalts, basanites and tephrites containing normative nepheline. Variations in major and trace elements appear to be controlled predominantly by variable extents of melting and fractional crystallization, with little influence from mantle source heterogeneity. Indeed, age-corrected isotopic values define only a narrow range, in agreement with long-term source homogeneity relative to the scale of melting; e.g., ɛNd varies from +4.1 to +5.7, 206Pb/204Pb from 19.048 to 19.281, and 87Sr/86Sr from 0.70362 to 0.70398. These values broadly fall within the fields of the proposed "C" or "FOZO" mantle end-members. However, small variations are present, with less radiogenic Nd and Pb isotope ratios at the older, western end of the chain, defining a trend toward a broadly EM2-like composition. Although some workers have postulated that the Louisville hotspot was the source of the ~120 Myr Ontong Java Plateau, our samples are isotopically distinct from any known Ontong Java compositions.

  20. Predictors of chain acquisition among independent dialysis facilities.

    PubMed

    Pozniak, Alyssa S; Hirth, Richard A; Banaszak-Holl, Jane; Wheeler, John R C

    2010-04-01

    To determine the predictors of chain acquisition among independent dialysis providers. Retrospective facility-level data combined from CMS Cost Reports, Medical Evidence Forms, Annual Facility Surveys, and claims for 1996-2003. Independent dialysis facilities' probability of acquisition by a dialysis chain (overall and by chain size) was estimated using a discrete time hazard rate model, controlling for financial and clinical performance, practice patterns, market factors, and other facility characteristics. The sample includes all U.S. freestanding dialysis facilities that report not being chain affiliated for at least 1 year between 1997 and 2003. Above-average costs and better quality outcomes are significant determinants of dialysis chain acquisition. Facilities in larger markets were more likely to be acquired by a chain. Furthermore, small dialysis chains have different acquisition strategies than large chains. Dialysis chains appear to employ a mix of turn-around and cream-skimming strategies. Poor financial health is a predictor of chain acquisition as in other health care sectors, but the increased likelihood of chain acquisition among higher quality facilities is unique to the dialysis industry. Significant differences among predictors of acquisition by small and large chains reinforce the importance of using a richer classification for chain status.

  1. Determination of alkylbenzenesulfonate surfactants in groundwater using macroreticular resins and carbon-13 nuclear magnetic resonance spectrometry

    USGS Publications Warehouse

    Thurman, E.M.; Willoughby, T.; Barber, L.B.; Thorn, K.A.

    1987-01-01

    Alkylbenzenesulfonate surfactants were determined in groundwater at concentrations as low as 0.3 mg/L. The method uses XAD-8 resin for concentration, followed by elution with methanol, separation of anionic and nonionic surfactants by anion exchange, quantitation by titration, and identification by 13C nuclear magnetic resonance spectrometry. Laboratory standards and field samples containing straight-chain and branched-chain alkylbenzenesulfonates, sodium dodecyl sulfate, and alkylbenzene ethoxylates were studied. The XAD-8 extraction of surfactants from groundwater was completed in the field, which simplified sample preservation and reduced the cost of transporting samples.

  2. Salmonella serotype distribution in the Dutch broiler supply chain.

    PubMed

    van Asselt, E D; Thissen, J T N M; van der Fels-Klerx, H J

    2009-12-01

    Salmonella serotype distribution can give insight in contamination routes and persistence along a production chain. Therefore, it is important to determine not only Salmonella prevalence but also to specify the serotypes involved at the different stages of the supply chain. For this purpose, data from a national monitoring program in the Netherlands were used to estimate the serotype distribution and to determine whether this distribution differs for the available sampling points in the broiler supply chain. Data covered the period from 2002 to 2005, all slaughterhouses (n = 22), and the following 6 sampling points: departure from hatchery, arrival at the farm, departure from the farm, arrival at the slaughterhouse, departure from the slaughterhouse, and end of processing. Furthermore, retail data for 2005 were used for comparison with slaughterhouse data. The following serotypes were followed throughout the chain: Salmonella Enteritidis, Salmonella Typhimurium, Salmonella Paratyphi B var. Java (Salmonella Java), Salmonella Infantis, Salmonella Virchow, and Salmonella Mbandaka. Results showed that serotype distribution varied significantly throughout the supply chain (P < 0.05). Main differences were found at the farm and at the slaughterhouse (within one stage), and least differences were found between departure from one stage and arrival at the next stage. The most prominent result was the increase of Salmonella Java at farm level. This serotype remained the most prominent pathogen throughout the broiler supply chain up to the retail phase.

  3. Spectroscopic characterization of the quantum wires in titanosilicates ETS-4 and ETS-10

    NASA Astrophysics Data System (ADS)

    Yilmaz, Bilge; Warzywoda, Juliusz; Sacco, Albert, Jr.

    2006-08-01

    Titanosilicates ETS-4 and ETS-10 contain octahedrally coordinated monatomic semiconductor \\cdots \\mathrm {Ti} -O-Ti-O-\\mathrm {Ti}\\cdots (titania) chains in their frameworks. Titania chains are isolated from one another by a siliceous matrix. Thus, these chains can be regarded as one-dimensional nanostructures, i.e., 'quantum wires'. Diffuse reflectance UV-vis (DR-UV-vis) spectroscopy analysis demonstrated a significant blue-shift of the optical absorption edge (>60 nm) for both ETS-4 and ETS-10 compared to bulk titania. This blue-shift is consistent with the hypothesis that the titania chains in ETS-4 and ETS-10 are acting as quantum wires. A broad range of ETS-4 and ETS-10 samples with diverse crystallo-chemical characteristics was prepared. The DR-UV-vis and Raman spectra of various ETS-4 and ETS-10 samples exhibited different characteristics, which were hypothesized to be related to the titania chain 'quality'. Detailed investigation of the spectroscopic bands associated with the titania chains in ETS-4 was performed for the first time. The 'quality' of these titania chains/quantum wires in ETS-4 and ETS-10 was correlated with the crystal growth mechanisms of these materials. Comparison of the growth mechanisms and the spectroscopic behaviour for ETS-4 and ETS-10 suggests that the control of 'quantum wire quality' via hydrothermal synthesis is possible in ETS-4 but would be difficult in ETS-10.

  4. Connectivity patterns and rotamer states of nucleobases determine acid-base properties of metalated purine quartets.

    PubMed

    Lüth, Marc Sven; Freisinger, Eva; Kampf, Gunnar; Garijo Anorbe, Marta; Griesser, Rolf; Operschall, Bert P; Sigel, Helmut; Lippert, Bernhard

    2015-07-01

    Potentiometric pH titrations and pD dependent (1)H NMR spectroscopy have been applied to study the acidification of the exocyclic amino group of adenine (A) model nucleobases (N9 position blocked by alkyl groups) when carrying trans-a2Pt(II) (with a=NH3 or CH3NH2) entities both at N1 and N7 positions. As demonstrated, in trinuclear complexes containing central A-Pt-A units, it depends on the connectivity pattern of the adenine bases (N7/N7 or N1/N1) and their rotamer states (head-head or head-tail), how large the acidifying effect is. Specifically, a series of trinuclear complexes with (A-N7)-Pt-(N7-A) and (A-N1)-Pt-(N1-A) cross-linking patterns and terminal 9-alkylguanine ligands (9MeGH, 9EtGH) have been analyzed in this respect, and it is shown that, for example, the 9MeA ligands in trans-,trans-,trans-[Pt(NH3)2(N7-9MeA-N1)2{Pt(NH3)2(9EtGH-N7)}2](ClO4)6·6H2O (4a) and trans-,trans-,trans-[Pt(NH3)2(N7-9EtA-N1)2{Pt(CH3NH2)2(9-MeGH-N7)}2](ClO4)6·3H2O (4b) are more acidic, by ca. 1.3 units (first pKa), than the linkage isomer trans-,trans-,trans-[Pt(CH3NH2)2(N1-9MeA-N7)2{Pt(NH3)2(9MeGH-N7)}2](NO3)6·6.25H2O (1b). Overall, acidifications in these types of complexes amount to 7-9 units, bringing the pKa values of such adenine ligands in the best case close to the physiological pH range. Comparison with pKa values of related trinuclear Pt(II) complexes having different co-ligands at the Pt ions, confirms this picture and supports our earlier proposal that the close proximity of the exocyclic amino groups in a head-head arrangement of (A-N7)-Pt-(N7-A), and the stabilization of the resulting N6H(-)⋯H2N6 unit, is key to this difference. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. High-Throughput Quantitative Lipidomics Analysis of Nonesterified Fatty Acids in Human Plasma.

    PubMed

    Christinat, Nicolas; Morin-Rivron, Delphine; Masoodi, Mojgan

    2016-07-01

    We present a high-throughput, nontargeted lipidomics approach using liquid chromatography coupled to high-resolution mass spectrometry for quantitative analysis of nonesterified fatty acids. We applied this method to screen a wide range of fatty acids from medium-chain to very long-chain (8 to 24 carbon atoms) in human plasma samples. The method enables us to chromatographically separate branched-chain species from their straight-chain isomers as well as separate biologically important ω-3 and ω-6 polyunsaturated fatty acids. We used 51 fatty acid species to demonstrate the quantitative capability of this method with quantification limits in the nanomolar range; however, this method is not limited only to these fatty acid species. High-throughput sample preparation was developed and carried out on a robotic platform that allows extraction of 96 samples simultaneously within 3 h. This high-throughput platform was used to assess the influence of different types of human plasma collection and preparation on the nonesterified fatty acid profile of healthy donors. Use of the anticoagulants EDTA and heparin has been compared with simple clotting, and only limited changes have been detected in most nonesterified fatty acid concentrations.

  6. Prevalence of Salmonella in the broiler supply chain in The Netherlands.

    PubMed

    Van Der Fels-Klerx, H J; Jacobs-Reitsma, W F; Van Brakel, R; Van Der Voet, H; Van Asselt, E D

    2008-10-01

    This article presents detailed information on Salmonella prevalence throughout the broiler supply chain in The Netherlands, based on results from a national monitoring program. Data were collected during the period 2002 through 2005 and from six sampling points in the chain, covering hatchery up to and including processing. Trends in Salmonella prevalence over years and seasons were analyzed as well as the effect of slaughterhouse capacity on these trends. In addition, correlations between the occurrence of Salmonella at the various sampling points were calculated. The results showed a decreasing trend of Salmonella prevalence from 2002 through 2005 at all sampling points. A seasonal effect on the occurrence of Salmonella was found at the broiler farm, with a higher prevalence during the third and fourth quarter of the year (July through December). The higher the capacity of the slaughterhouse, the lower Salmonella prevalence on arrival at the slaughterhouse and the higher the prevalence at the end of slaughter and the end of processing. The detailed insights obtained in this study could be used to focus future field and experimental research on the prevention and control of Salmonella in the broiler supply chain. Results presented could also be used in risk assessment studies.

  7. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples.

    PubMed

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I; Cai, Hugh Y

    2014-04-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively.

  8. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

    PubMed Central

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

    2014-01-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

  9. Real-Time Polymerase Chain Reaction for Detection of Schistosoma DNA in Small-Volume Urine Samples Reflects Focal Distribution of Urogenital Schistosomiasis in Primary School Girls in KwaZulu Natal, South Africa

    PubMed Central

    Pillay, Pavitra; Taylor, Myra; Zulu, Siphosenkosi G.; Gundersen, Svein G.; Verweij, Jaco J.; Hoekstra, Pytsje; Brienen, Eric A. T.; Kleppa, Elisabeth; Kjetland, Eyrun F.; van Lieshout, Lisette

    2014-01-01

    Schistosoma haematobium eggs and Schistosoma DNA levels were measured in urine samples from 708 girls recruited from 18 randomly sampled primary schools in South Africa. Microscopic analysis of two 10-mL urine subsamples collected on three consecutive days confirmed high day-to-day variation; 103 (14.5%) girls had positive results at all six examinations, and at least one positive sample was seen in 225 (31.8%) girls. Schistosoma-specific DNA, which was measured in a 200-μL urine subsample by using real-time polymerase chain reaction, was detected in 180 (25.4%) cases, and levels of DNA corresponded significantly with average urine egg excretion. In concordance with microscopic results, polymerase chain reaction results were significantly associated with history of gynecologic symptoms and confirmed highly focal distribution of urogenital schistosomiasis. Parasite-specific DNA detection has a sensitivity comparable to single urine microscopy and could be used as a standardized high-throughput procedure to assess distribution of urogenital schistosomiasis in relatively large study populations by using small sample volumes. PMID:24470560

  10. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  11. Identification and validation of biomarkers of IgV(H) mutation status in chronic lymphocytic leukemia using microfluidics quantitative real-time polymerase chain reaction technology.

    PubMed

    Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R

    2007-09-01

    To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.

  12. Origin, transport and deposition of leaf-wax biomarkers in the Amazon Basin and the adjacent Atlantic

    NASA Astrophysics Data System (ADS)

    Häggi, Christoph; Sawakuchi, André O.; Chiessi, Cristiano M.; Mulitza, Stefan; Mollenhauer, Gesine; Sawakuchi, Henrique O.; Baker, Paul A.; Zabel, Matthias; Schefuß, Enno

    2016-11-01

    Paleoenvironmental studies based on terrigenous biomarker proxies from sediment cores collected close to the mouth of large river systems rely on a proper understanding of the processes controlling origin, transport and deposition of biomarkers. Here, we contribute to the understanding of these processes by analyzing long-chain n-alkanes from the Amazon River system. We use the δD composition of long-chain n-alkanes from river bed sediments from the Amazon River and its major tributaries, as well as marine core-top samples collected off northeastern South America as tracers for different source areas. The δ13C composition of the same compounds is used to differentiate between long-chain n-alkanes from modern forest vegetation and petrogenic organic matter. Our δ13C results show depleted δ13C values (-33 to -36‰) in most samples, indicating a modern forest source for most of the samples. Enriched values (-31 to -33‰) are only found in a few samples poor in organic carbon indicating minor contributions from a fossil petrogenic source. Long-chain n-alkane δD analyses show more depleted values for the western tributaries, the Madeira and Solimões Rivers (-152 to -168‰), while n-alkanes from the lowland tributaries, the Negro, Xingu and Tocantins Rivers (-142 to -154‰), yield more enriched values. The n-alkane δD values thus reflect the mean annual isotopic composition of precipitation, which is most deuterium-depleted in the western Amazon Basin and more enriched in the eastern sector of the basin. Samples from the Amazon estuary show a mixed long-chain n-alkane δD signal from both eastern lowland and western tributaries. Marine core-top samples underlying the Amazon freshwater plume yield δD values similar to those from the Amazon estuary, while core-top samples from outside the plume showed more enriched values. Although the variability in the river bed data precludes quantitative assessment of relative contributions, our results indicate that long-chain n-alkanes from the Amazon estuary and plume represent an integrated signal of different regions of the onshore basin. Our results also imply that n-alkanes are not extensively remineralized during transport and that the signal at the Amazon estuary and plume includes refractory compounds derived from the western sector of the Basin. These findings will aid in the interpretation of plant wax-based records of marine sediment cores collected from the adjacent ocean.

  13. Respondent-driven sampling as Markov chain Monte Carlo.

    PubMed

    Goel, Sharad; Salganik, Matthew J

    2009-07-30

    Respondent-driven sampling (RDS) is a recently introduced, and now widely used, technique for estimating disease prevalence in hidden populations. RDS data are collected through a snowball mechanism, in which current sample members recruit future sample members. In this paper we present RDS as Markov chain Monte Carlo importance sampling, and we examine the effects of community structure and the recruitment procedure on the variance of RDS estimates. Past work has assumed that the variance of RDS estimates is primarily affected by segregation between healthy and infected individuals. We examine an illustrative model to show that this is not necessarily the case, and that bottlenecks anywhere in the networks can substantially affect estimates. We also show that variance is inflated by a common design feature in which the sample members are encouraged to recruit multiple future sample members. The paper concludes with suggestions for implementing and evaluating RDS studies.

  14. Polymerase chain reaction detection of Propionibacterium propionicus and Actinomyces radicidentis in primary and persistent endodontic infections.

    PubMed

    Siqueira, José F; Rôças, Isabela N

    2003-08-01

    Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and persistent endodontic infections. This strengthens the assumption that this bacterial species is an endodontic pathogen associated with different forms of periradicular diseases. In contrast, A radicidentis was only occasionally detected in the patients examined. The role played by this species in endodontic infections remains to be clarified.

  15. [Determination of short chain chlorinated paraffins in polyvinyl chloride plastics by gas chromatography-negative chemical ion/mass spectrometry].

    PubMed

    Xing, Yuanna; Lin, Zhihui; Feng, Anhong; Wang, Xin; Gong, Yemeng; Chen, Zeyong

    2015-02-01

    A novel method was established to determine short chain chlorinated paraffins (SC-CPs) in polyvinyl chloride (PVC) plastics by gas chromatography-negative chemical ion/mass spectrometry (GC-NCI/MS). Ultrasonic extraction was used to extract SCCPs from PVC plastics. The optimal extraction time was 1.5 h, and concentrated sulfuric acid was adopted to purify the extracted solution. Finally, SCCPs in a sample were detected by GC-NCI/MS at 160 C and with methane reagent gas at 1. 5 mL/min. This method was not influenced by medium chain chlorinated paraffins (MCCPs) in the sample, and accurate quantitation was made for SCCPs. Twelve batches of samples were analyzed and SCCPs were detected in each batch with the contents from 0. 3 x 10(2)mg/kg to 3. 5 x 10(4)mg/kg. With respect to European limitation of SC-CPs (1%), four batches of samples did not comply with the European regulation, and they accounted for 33. 3%. Obviously, high SCCPs risk was presented in PVC plastics.

  16. Comparison of Free Light Chain Assays:  Freelite and N Latex in Diagnosis, Monitoring, and Predicting Survival in Light Chain Amyloidosis.

    PubMed

    Mahmood, Shameem; Wassef, Nancy L; Salter, Simon J; Sachchithanantham, Sajitha; Lane, T; Foard, D; Whelan, Carol J; Lachmann, Helen J; Gillmore, Julian D; Hawkins, Philip N; Wechalekar, Ashutosh D

    2016-07-01

    Measurement of serum free light chains (FLCs) is critical in diagnosis, prognosis, and monitoring treatment responses in light chain (AL) amyloidosis. We compare the Freelite assay (polyclonal antibodies to hidden light chain epitopes), which is the current gold standard, with a new assay: a mixture of monoclonal antibodies to light chain epitopes (N Latex). We collected 240 serum samples from 94 consecutive patients with newly diagnosed AL amyloidosis (at least three serial serum samples during the first 6 months) analyzed at the National Amyloidosis Centre, London, from January 2011 to April 2012. Concordance in detecting abnormal light chain components and hematologic response was assessed at 2, 4, and 6 months. The κ and λ clonal light chain involvement was 21% and 79%, respectively, with an abnormal κ/λ ratio or detectable protein in 78.7%. Median κ, λ, and difference in involved and uninvolved FLCs by Freelite and N Latex assays were 17.3 vs 16 mg/L (R(2 ) = 0.91), 48.8 vs 52.6 mg/L (R(2) = 0.52), and 43.2 vs 39.1 mg/L, respectively. Discordant κ/λ ratios at presentation were as follows: 10 of 90 abnormal by Freelite/normal by N Latex and 11 of 90 abnormal by N Latex/normal by Freelite. Both FLC assays show good correlation in detecting the abnormal light chain subtype with discordance in absolute values and thus are not interchangeable. © American Society for Clinical Pathology, 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Assessment of Intrathecal Free Light Chain Synthesis: Comparison of Different Quantitative Methods with the Detection of Oligoclonal Free Light Chains by Isoelectric Focusing and Affinity-Mediated Immunoblotting.

    PubMed

    Zeman, David; Kušnierová, Pavlína; Švagera, Zdeněk; Všianský, František; Byrtusová, Monika; Hradílek, Pavel; Kurková, Barbora; Zapletalová, Olga; Bartoš, Vladimír

    2016-01-01

    We aimed to compare various methods for free light chain (fLC) quantitation in cerebrospinal fluid (CSF) and serum and to determine whether quantitative CSF measurements could reliably predict intrathecal fLC synthesis. In addition, we wished to determine the relationship between free kappa and free lambda light chain concentrations in CSF and serum in various disease groups. We analysed 166 paired CSF and serum samples by at least one of the following methods: turbidimetry (Freelite™, SPAPLUS), nephelometry (N Latex FLC™, BN ProSpec), and two different (commercially available and in-house developed) sandwich ELISAs. The results were compared with oligoclonal fLC detected by affinity-mediated immunoblotting after isoelectric focusing. Although the correlations between quantitative methods were good, both proportional and systematic differences were discerned. However, no major differences were observed in the prediction of positive oligoclonal fLC test. Surprisingly, CSF free kappa/free lambda light chain ratios were lower than those in serum in about 75% of samples with negative oligoclonal fLC test. In about a half of patients with multiple sclerosis and clinically isolated syndrome, profoundly increased free kappa/free lambda light chain ratios were found in the CSF. Our results show that using appropriate method-specific cut-offs, different methods of CSF fLC quantitation can be used for the prediction of intrathecal fLC synthesis. The reason for unexpectedly low free kappa/free lambda light chain ratios in normal CSFs remains to be elucidated. Whereas CSF free kappa light chain concentration is increased in most patients with multiple sclerosis and clinically isolated syndrome, CSF free lambda light chain values show large interindividual variability in these patients and should be investigated further for possible immunopathological and prognostic significance.

  18. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    PubMed

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Microbiological assessment along the fish production chain of the Norwegian pelagic fisheries sector--Results from a spot sampling programme.

    PubMed

    Svanevik, Cecilie Smith; Roiha, Irja Sunde; Levsen, Arne; Lunestad, Bjørn Tore

    2015-10-01

    Microbes play an important role in the degradation of fish products, thus better knowledge of the microbiological conditions throughout the fish production chain may help to optimise product quality and resource utilisation. This paper presents the results of a ten-year spot sampling programme (2005-2014) of the commercially most important pelagic fish species harvested in Norway. Fish-, surface-, and storage water samples were collected from fishing vessels and processing factories. Totally 1,181 samples were assessed with respect to microbiological quality, hygiene and food safety. We introduce a quality and safety assessment scheme for fresh pelagic fish recommending limits for heterotrophic plate counts (HPC), thermos tolerant coliforms, enterococci and Listeria monocytogenes. According to the scheme, in 25 of 41 samplings, sub-optimal conditions were found with respect to quality, whereas in 21 and 9 samplings, samples were not in compliance concerning hygiene and food safety, respectively. The present study has revealed that the quality of pelagic fish can be optimised by improving the hygiene conditions at some critical points at an early phase of the production chain. Thus, the proposed assessment scheme may provide a useful tool for the industry to optimise quality and maintain consumer safety of pelagic fishery products. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. A Novel Protocol to Analyze Short- and Long-Chain Fatty Acids Using Nonaqueous Microchip Capillary Electrophoresis

    NASA Technical Reports Server (NTRS)

    Cable, M. L.; Stockton, A. M.; Mora, Maria F; Willis, P. A.

    2013-01-01

    We propose a new protocol to identify and quantify both short- and long-chain saturated fatty acids in samples of astrobiological interest using non-aqueous microchip capillary electrophoresis (micronNACE) with laser induced fluorescence (LIF).

  1. Assessing cold chain status in a metro city of India: an intervention study.

    PubMed

    Mallik, S; Mandal, P K; Chatterjee, C; Ghosh, P; Manna, N; Chakrabarty, D; Bagchi, S N; Dasgupta, S

    2011-03-01

    Cold chain maintenance is an essential activity to maintain the potency of vaccines and to prevent adverse events following immunization. One baseline study highlighted the unsatisfactory cold chain status in city of Kolkata in India. To assess the changes which occurred in the cold chain status after the intervention undertaken to improve the status and also to assess the awareness of the cold chain handlers regarding cold chain maintenance. Intervention consisted of reorganization of cold chain points and training of health manpower in Kolkata Municipal area regarding immunization and cold chain following the guidelines as laid by Govt of India. Reevaluation of cold chain status was done at 20 institutions selected by stratified systematic random sampling after the intervention. The results were compared with baseline survey. Significant improvement had been observed in correct placing of cold chain equipment, maintenance of stock security, orderly placing of ice packs, diluents and vaccines inside the equipment, temperature recording and maintenance. But awareness and skill of cold chain handlers regarding basics of cold chain maintenance was not satisfactory. The success of intervention included significant improvement of cold chain status including creation of a designated cold chain handler. The gaps lay in non-availability of non-electrical cold chain equipment and separate cold chain room, policy makers should stress. Cold chain handlers need reorientation training regarding heat & cold sensitive vaccines, preventive maintenance and correct contingency plan.

  2. Giardia and Cryptosporidium spp. dissemination during wastewater treatment and comparative detection via immunofluorescence assay (IFA), nested polymerase chain reaction (nested PCR) and loop mediated isothermal amplification (LAMP).

    PubMed

    Gallas-Lindemann, Carmen; Sotiriadou, Isaia; Plutzer, Judit; Noack, Michael J; Mahmoudi, Mohammad Reza; Karanis, Panagiotis

    2016-06-01

    Environmental water samples from the Lower Rhine area in Germany were investigated via immunofluorescence assays (IFAs), nested polymerase chain reaction (nested PCR) and loop-mediated isothermal amplification (LAMP) to detect the presence of Giardia spp. (n=185) and Cryptosporidium spp. (n=227). The samples were concentrated through filtration or flocculation, and oocysts were purified via centrifugation through a sucrose density gradient. For all samples, IFA was performed first, followed by DNA extraction for the nested PCR and LAMP assays. Giardia cysts were detected in 105 samples (56.8%) by IFA, 62 samples (33.5%) by nested PCR and 79 samples (42.7%) by LAMP. Cryptosporidium spp. were detected in 69 samples (30.4%) by IFA, 95 samples (41.9%) by nested PCR and 99 samples (43.6%) by LAMP. According to these results, the three detection methods are complementary for monitoring Giardia and Cryptosporidium in environmental waters. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Chemical Characterization of Dissolved Organic Matter (DOM) in Seawater: Structure, Cycling and the Role of Biology

    DTIC Science & Technology

    2005-02-01

    concentration, excluding hydrocarbons , was less than 2% of the total organic carbon present in the samples, and the samples had not been pre-extracted to...carbon chains that make up the separation phase of the C18 134 column. This carbon chain was most likely generated from petroleum products, and had a...produced, bioaccumulating halogenated organic compound. Environmental Science and Technology 38: 1992-1997. Silfer, J. A., M. H. Engel and S. A

  4. Predictors of Chain Acquisition among Independent Dialysis Facilities

    PubMed Central

    Pozniak, Alyssa S; Hirth, Richard A; Banaszak-Holl, Jane; Wheeler, John R C

    2010-01-01

    Objective To determine the predictors of chain acquisition among independent dialysis providers. Data Sources Retrospective facility-level data combined from CMS Cost Reports, Medical Evidence Forms, Annual Facility Surveys, and claims for 1996–2003. Study Design Independent dialysis facilities' probability of acquisition by a dialysis chain (overall and by chain size) was estimated using a discrete time hazard rate model, controlling for financial and clinical performance, practice patterns, market factors, and other facility characteristics. Data Collection The sample includes all U.S. freestanding dialysis facilities that report not being chain affiliated for at least 1 year between 1997 and 2003. Principal Findings Above-average costs and better quality outcomes are significant determinants of dialysis chain acquisition. Facilities in larger markets were more likely to be acquired by a chain. Furthermore, small dialysis chains have different acquisition strategies than large chains. Conclusions Dialysis chains appear to employ a mix of turn-around and cream-skimming strategies. Poor financial health is a predictor of chain acquisition as in other health care sectors, but the increased likelihood of chain acquisition among higher quality facilities is unique to the dialysis industry. Significant differences among predictors of acquisition by small and large chains reinforce the importance of using a richer classification for chain status. PMID:20148985

  5. Detection of Listeria monocytogenes in ready-to-eat food by Step One real-time polymerase chain reaction.

    PubMed

    Pochop, Jaroslav; Kačániová, Miroslava; Hleba, Lukáš; Lopasovský, L'ubomír; Bobková, Alica; Zeleňáková, Lucia; Stričík, Michal

    2012-01-01

    The aim of this study was to follow contamination of ready-to-eat food with Listeria monocytogenes by using the Step One real time polymerase chain reaction (PCR). We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and MicroSEQ® Listeria monocytogenes Detection Kit for the real-time PCR performance. In 30 samples of ready-to-eat milk and meat products without incubation we detected strains of Listeria monocytogenes in five samples (swabs). Internal positive control (IPC) was positive in all samples. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in ready-to-eat food without incubation.

  6. The Construction and Validation of All-Atom Bulk-Phase Models of Amorphous Polymers Using the TIGER2/TIGER3 Empirical Sampling Method

    PubMed Central

    Li, Xianfeng; Murthy, Sanjeeva; Latour, Robert A.

    2011-01-01

    A new empirical sampling method termed “temperature intervals with global exchange of replicas and reduced radii” (TIGER3) is presented and demonstrated to efficiently equilibrate entangled long-chain molecular systems such as amorphous polymers. The TIGER3 algorithm is a replica exchange method in which simulations are run in parallel over a range of temperature levels at and above a designated baseline temperature. The replicas sampled at temperature levels above the baseline are run through a series of cycles with each cycle containing four stages – heating, sampling, quenching, and temperature level reassignment. The method allows chain segments to pass through one another at elevated temperature levels during the sampling stage by reducing the van der Waals radii of the atoms, thus eliminating chain entanglement problems. Atomic radii are then returned to their regular values and re-equilibrated at elevated temperature prior to quenching to the baseline temperature. Following quenching, replicas are compared using a Metropolis Monte Carlo exchange process for the construction of an approximate Boltzmann-weighted ensemble of states and then reassigned to the elevated temperature levels for additional sampling. Further system equilibration is performed by periodic implementation of the previously developed TIGER2 algorithm between cycles of TIGER3, which applies thermal cycling without radii reduction. When coupled with a coarse-grained modeling approach, the combined TIGER2/TIGER3 algorithm yields fast equilibration of bulk-phase models of amorphous polymer, even for polymers with complex, highly branched structures. The developed method was tested by modeling the polyethylene melt. The calculated properties of chain conformation and chain segment packing agreed well with published data. The method was also applied to generate equilibrated structural models of three increasingly complex amorphous polymer systems: poly(methyl methacrylate), poly(butyl methacrylate), and DTB-succinate copolymer. Calculated glass transition temperature (Tg) and structural parameter profile (S(q)) for each resulting polymer model were found to be in close agreement with experimental Tg values and structural measurements obtained by x-ray diffraction, thus validating that the developed methods provide realistic models of amorphous polymer structure. PMID:21769156

  7. What band rocks the MTB? (Invited)

    NASA Astrophysics Data System (ADS)

    Kind, J.; García-Rubio, I.; Gehring, A. U.

    2013-12-01

    Magnetotactic bacteria (MTB) are a polyphyletic group of bacteria that have been found in marine and lacustrine environments and soils [e.g. 1]. The hallmark of MTB is their intracellular formation of magnetosomes, single-domain ferrimagnetic particles that are aligned in chains. The chain configuration generates a strong magnetic dipole, which is used as magnetic compass to move the MTB into their favorable habit. The term band corresponds to a frequency window of microwaves in the gigahertz (GHz) range. Ferromagnetic resonance (FMR) spectroscopy uses the microwave absorption in a magnetic field to analyze the anisotropy properties and the domain state of magnetic materials. Specific microwave frequency causes absorption in a characteristic magnetic field range. For the investigation of MTB we use S-band (4.02 GHz), X-band (9.47 GHz), and Q-band (34.16 GHz). Experiments on cultured MTB and on sediment samples of Holocene age showed that absorption in X- and Q-band occurs when the sample is in a saturated or nearly saturated state [2, 3]. By contrast, absorption in the S-band appears in lower magnetic fields, where the sample is far from saturation. All FMR spectra show two distinct low-field features that can be assigned to magnetite particles in chains, aligned parallel and perpendicular to the external magnetic field. The detailed separation of the parallel and perpendicular components in the bulk samples is hampered, because of the random orientation of the chains in the sample. The comparison of S-, X-, and Q-band shows that the lower the frequency the better the separation of the components. In the S-band FMR spectroscopy, the separation of chains parallel to the external magnetic field is supported by the internal field of the sample. This field is caused by the remanence that contributes to the external magnetic field to fulfill the resonance condition [3,4]. Considering the different FMR responses, it can be postulated that a lower microwave frequency generally leads to a better resolution of the chain configuration. Finally, for the investigation of geological samples, the application of S-band can be a powerful tool to complement the commonly used X-band FMR spectroscopy, i.e. multiple band rock the MTB. [1] Blakemore R.P., 1975, Magnetotactic bacteria, Science, 190, 377-379 [2] Mastogiacomo G., Fischer H., Garcia-Rubio I., and Gehring A. U., 2010, Ferromagnetic resonance spectroscopic response of magnetic chains in a biological matrix, J. Magn. Magn. Matter, 322, 661-663, doi: 10.1016/j.jmmm.2009.10.035 [3] Gehring A. U., Kind. J., Charilaou M., Garcia-Rubio I., 2011, S-band ferromagnetic resonance spectroscopy and the detection of magnetofossils, J. R. Soc. Interface, 10(80), doi: 10.1098/rsif.2012.0790 [4] Kind J., van Raden U., Garcia-Rubio I., and Gehring A. U., 2012, Rock magnetic techniques complemented by ferromagnetic resonance spectroscopy to analyse a sediment record, Geophys. J. Int., 191, 51-61, doi: 10.1111/j.1365-246X.2012.05620.x

  8. Novel long-chain anteiso-alkanes and anteiso-alkanoic acids in Antarctic rocks colonized by living and fossil cryptoendolithic microorganisms

    NASA Technical Reports Server (NTRS)

    Matsumoto, G. I.; Friedmann, E. I.; Watanuki, K.; Ocampo-Friedmann, R.

    1992-01-01

    Saponified extracts of rock samples colonized by cryptoendolithic microbial communities from the McMurdo Dry Valleys of Southern Victoria Land, Antarctica, were separated into hydrocarbon and fatty acid fractions by silica gel column chromatography. Hydrocarbons and methyl esters of fatty acids were analyzed by capillary gas chromatography-mass spectrometry. Unusually, a suite of long-chain anteiso-alkanes (a-C20 to a-C30) and anteiso-alkanoic acids (a-C20 to a-C30) were detected in many samples, together with straight-chain, branched and/or cyclic and acyclic isoprenoid compounds. These novel compounds are probably derived from unidentified heterotrophic bacteria or symbiotic processes in a unique microbial community in the Antarctic cold desert and suggest the occurrence of a special biosynthetic pathway. Long-chain anteiso-alkanes are probably formed through microbial decarboxylation of corresponding anteiso-alkanoic acids. They may serve as new biomarkers in environmental and geochemical studies.

  9. AML cells have low spare reserve capacity in their respiratory chain that renders them susceptible to oxidative metabolic stress

    PubMed Central

    Sriskanthadevan, Shrivani; Jeyaraju, Danny V.; Chung, Timothy E.; Prabha, Swayam; Xu, Wei; Skrtic, Marko; Jhas, Bozhena; Hurren, Rose; Gronda, Marcela; Wang, Xiaoming; Jitkova, Yulia; Sukhai, Mahadeo A.; Lin, Feng-Hsu; Maclean, Neil; Laister, Rob; Goard, Carolyn A.; Mullen, Peter J.; Xie, Stephanie; Penn, Linda Z.; Rogers, Ian M.; Dick, John E.; Minden, Mark D.

    2015-01-01

    Mitochondrial respiration is a crucial component of cellular metabolism that can become dysregulated in cancer. Compared with normal hematopoietic cells, acute myeloid leukemia (AML) cells and patient samples have higher mitochondrial mass, without a concomitant increase in respiratory chain complex activity. Hence these cells have a lower spare reserve capacity in the respiratory chain and are more susceptible to oxidative stress. We therefore tested the effects of increasing the electron flux through the respiratory chain as a strategy to induce oxidative stress and cell death preferentially in AML cells. Treatment with the fatty acid palmitate induced oxidative stress and cell death in AML cells, and it suppressed tumor burden in leukemic cell lines and primary patient sample xenografts in the absence of overt toxicity to normal cells and organs. These data highlight a unique metabolic vulnerability in AML, and identify a new therapeutic strategy that targets abnormal oxidative metabolism in this malignancy. PMID:25631767

  10. Capillary sample introduction of polymerase chain reaction (PCR) products separated in ultrathin slab gels.

    PubMed

    Bullard, K M; Hietpas, P B; Ewing, A G

    1998-01-01

    Polymerase chain reaction (PCR) amplified short tandem repeat (STR) samples from the HUMVWF locus have been analyzed using a unique sample introduction and separation technique. A single capillary is used to transfer samples onto an ultrathin slab gel (57 microm thin). This ultrathin nondenaturing polyacrylamide gel is used to separate the amplified fragments, and laser-induced fluorescence with ethidium bromide is used for detection. The feasibility of performing STR analysis using this system has been investigated by examining the reproducibility for repeated samples. Reproducibility is examined by comparing the migration of the 14 and 17 HUMVWF alleles on three consecutive separations on the ultrathin slab gel. Using one locus, separations match in migration time with the two alleles 42 s apart for each of the three consecutive separations. This technique shows potential to increase sample throughput in STR analysis techniques although separation resolution still needs to be improved.

  11. Assessment of Cellular Mutagenicity of Americano Coffees from Popular Coffee Chains.

    PubMed

    Liu, Zhen-Shu; Chen, Po-Wen; Wang, Jung-Yu; Kuo, Tai-Chen

    2017-09-01

    Coffee is a popular beverage worldwide, but coffee beans can be contaminated with carcinogens. The Ames Salmonella mutagenicity test is often used for analysis of carcinogens for mutagenicity. However, previous studies have provided controversial data about the direct mutagenicity of coffee beans based on Ames test results. This study was conducted to determine the mutagenicity of popular Americano coffee based on results from the Ames test. Coffee samples without additives that were served by five international coffee chain restaurants were subjected to the analysis using Salmonella Typhimurium tester strains TA98, TA100, and TA1535. The levels of bacterial revertants in samples from coffee chains were lower than the twofold criterion of the control sets, and no significant dose-response effect was observed with or without rat liver enzyme activation. These data indicate that Americano coffees from the selected coffee chains possessed no direct mutagenic activity with or without enzyme activation. These findings suggest a low mutagenic risk from Americano coffees served by the selected coffee chains and support the use of other methods to confirm the nonmutagenicity of coffee products. These results are consistent with most recent epidemiological reports.

  12. RDC-enhanced structure calculation of a β-heptapeptide in methanol.

    PubMed

    Rigling, Carla; Ebert, Marc-Olivier

    2017-07-01

    Residual dipolar couplings (RDCs) are a rich source of structural information that goes beyond the range covered by the nuclear Overhauser effect or scalar coupling constants. They can only be measured in partially oriented samples. RDC studies of peptides in organic solvents have so far been focused on samples in chloroform or DMSO. Here, we show that stretched poly(vinyl acetate) can be used for the partial alignment of a linear β-peptide with proteinogenic side chains in methanol. 1 D CH , 1 D NH , and 2 D HH RDCs were collected with this sample and included as restraints in a simulated annealing calculation. Incorporation of RDCs in the structure calculation process improves the long-range definition in the backbone of the resulting 3 14 -helix and uncovers side-chain mobility. Experimental side-chain RDCs of the central leucine and valine residues are in good agreement with predicted values from a local three-state model. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  13. Usage of DNA Fingerprinting Technology for Quality Control in Molecular Lab Bench Work.

    PubMed

    McIntosh, Linda Y; Lal, Janella E; Qin, Dahui

    2018-01-01

    One of the major quality assurance (QA) goals in many molecular laboratories is to avoid sample pipetting errors on the lab bench; especially when pipetting into multiwell plates. A pipetting error can cause a switch in patient samples, which can lead to recording the wrong results for the patient samples involved. Such pipetting errors are difficult to identify when it happens in lab bench work. DNA fingerprinting is a powerful tool in determining sample identities. Our laboratory has explored the usage of this technology in our QA process and successfully established that DNA fingerprinting can be used to monitor possible sample switch in gene rearrangement lab bench work. We use florescent light to quench the florescence in the gene rearrangement polymerase chain reaction products. After that, DNA fingerprinting technology is used to identify the sample DNA in the gene rearrangement polymerase chain reaction plate. The result is compared with the corresponding patient's blood sample DNA to determine whether there is a sample switch during the lab bench work.

  14. Biotechnical use of polymerase chain reaction for microbiological analysis of biological samples.

    PubMed

    Lantz, P G; Abu al-Soud, W; Knutsson, R; Hahn-Hägerdal, B; Rådström, P

    2000-01-01

    Since its introduction in the mid-80s, polymerase chain reaction (PCR) technology has been recognised as a rapid, sensitive and specific molecular diagnostic tool for the analysis of micro-organisms in clinical, environmental and food samples. Although this technique can be extremely effective with pure solutions of nucleic acids, it's sensitivity may be reduced dramatically when applied directly to biological samples. This review describes PCR technology as a microbial detection method, PCR inhibitors in biological samples and various sample preparation techniques that can be used to facilitate PCR detection, by either separating the micro-organisms from PCR inhibitors and/or by concentrating the micro-organisms to detectable concentrations. Parts of this review are updated and based on a doctoral thesis by Lantz [1] and on a review discussing methods to overcome PCR inhibition in foods [2].

  15. A Novel Method for Profiling and Quantifying Short- and Medium-Chain Chlorinated Paraffins in Environmental Samples Using Comprehensive Two-Dimensional Gas Chromatography-Electron Capture Negative Ionization High-Resolution Time-of-Flight Mass Spectrometry.

    PubMed

    Xia, Dan; Gao, Lirong; Zheng, Minghui; Tian, Qichang; Huang, Huiting; Qiao, Lin

    2016-07-19

    Chlorinated paraffins (CPs) are complex technical mixtures containing thousands of isomers. Analyzing CPs in environmental matrices is extremely challenging. CPs have broad, unresolved profiles when analyzed by one-dimensional gas chromatography (GC). Comprehensive two-dimensional GC (GC×GC) can separate CPs with a high degree of orthogonality. A novel method for simultaneously profiling and quantifying short- and medium-chain CPs, using GC×GC coupled with electron capture negative ionization high-resolution time-of-flight mass spectrometry, was developed. The method allowed 48 CP formula congener groups to be analyzed highly selectively in one injection through accurate mass measurements of the [M - Cl](-) ions in full scan mode. The correlation coefficients (R(2)) for the linear calibration curves for different chlorine contents were 0.982 for short-chain CPs and 0.945 for medium-chain CPs. The method was successfully used to determine CPs in sediment and fish samples. By using this method, with enhanced chromatographic separation and high mass resolution, interferences between CP congeners and other organohalogen compounds, such as toxaphene, are minimized. New compounds, with the formulas C9H14Cl6 and C9H13Cl7, were found in sediment and biological samples for the first time. The method was shown to be a powerful tool for the analysis of CPs in environmental samples.

  16. Combined urea-thin layer chromatography and silver nitrate-thin layer chromatography for micro separation and determination of hard-to-detect branched chain fatty acids in natural lipids.

    PubMed

    Yan, Yuanyuan; Wang, Xingguo; Liu, Yijun; Xiang, Jingying; Wang, Xiaosan; Zhang, Huijun; Yao, Yunping; Liu, Ruijie; Zou, Xiaoqiang; Huang, Jianhua; Jin, Qingzhe

    2015-12-18

    A simple, fast and efficient procedure was developed for micro separation and enrichment of branched chain fatty acids (BCFA) from natural products using successive thin layer chromatography (TLC) technique coupling novel urea-TLC with AgNO3-TLC, which rely on the formation of urea adduction and AgNO3 bonding in methanol. These natural lipids contain a significant amount of straight chain fatty acids (FA). Fresh and fast urea-TLC and AgNO3-TLC plate making techniques were developed with more even coating and less coating material contamination before being utilized for separation. Goat milk fat was used as a model. Various experimental parameters that affect urea-TLC and AgNO3-TLC separation of BCFA were investigated and optimized, including coating of urea, concentration of original oil sample, mobile phase and sample application format. High efficiency of removal of straight chain FA was achieved with a low amount of sample in an easy and fast way. A total BCFA mix with much higher purity than previous studies was successfully achieved. The developed method has also been applied for the concentration and analysis of BCFA in cow milk fat and Anchovy oil. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Effect of short chain inulin on the rheological and sensory characteristics of reduced fat set coconut milk yoghurt.

    PubMed

    Adegoke, Samuel Chetachukwu; Thongraung, Chakree; Yupanqui, Chutha Takahashi

    2018-06-23

    The effect of short-chain inulin on the rheological and sensory properties of reduced fat set coconut milk yoghurt was studied with whole fat coconut milk yoghurt as reference. The concentration of short-chain inulin was varied at 0, 5, 10, 15, and 20% w/v respectively. All the yoghurt samples displayed higher elastic modulus G' than viscous modulus G". However, 15% inulin yoghurt had the highest value for G' & G". The 15 and 20% inulin yoghurts displayed high yield stress (1036.7 ± 2.39 & 368.23 ± 0.30 Pa). Addition threshold of 15% was established, beyond this level there was a significant decrease in the yield stress, firmness, cohesiveness and consistency values of the reduced fat yoghurts. Using Pearson correlation analysis, no correlation was observed between firmness and yield stress, Similarly, there was significant correlation between the yield stress and instrumental viscosity r = 0.957; p < 0.01. Furthermore, all yoghurt samples displayed strain thinning behavior except whole fat yoghurt. Carbohydrate was affected by inulin incorporation. Addition of short chain inulin improved sensorial characteristics such as taste, and flavor, but did not display significant difference in color and odor of yoghurt samples. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  18. Occurrence of thermotolerant Campylobacter spp. at different stages of the poultry meat supply chain in Argentina.

    PubMed

    Zbrun, M V; Romero-Scharpen, A; Olivero, C; Rossler, E; Soto, L P; Rosmini, M R; Sequeira, G J; Signorini, M L; Frizzo, L S

    2013-11-01

    The objectives of this study were to investigate the occurrence and concentration of thermotolerant Campylobacter spp. at different stages of the poultry meat supply chain in Argentina. Three integrated poultry companies were sampled. Each supply chain was considered at different stages from the reproductive farm to chicken meat at a retail market. The stages sampled were: (a) hens from breeder flocks, (b) eggs in the incubator, (c) broiler chickens in flocks (aged <1 week and >5 weeks), (d) chickens at a slaughterhouse, and (e) chicken meat at a retail market. The chickens sampled along each supply chain were in the same batch. Samples collected were: (a) cloacal samples from hens and chickens on the farms, (b) fertile eggs, (c) feed, water and litter from flocks, (d) chicken carcasses from the slaughterhouse and retail market, and (e) caeca and livers from the slaughterhouse. Samples obtained were examined for Campylobacter spp. The isolates were biotyped and the genus and species identified by PCR. Campylobacter spp. on chicken carcasses at slaughterhouse and retail market were enumerated. The highest proportions of Campylobacter positive samples were observed in carcasses at retail (25/30, 83.3%) and faecal samples from breeding hens (27/45, 60.0%). Only 3.3% (3/90) samples collected from broiler chickens aged <1 week were positive, but the percentage of positive samples had risen to 28.9% (26/90) by the end of the rearing period. The proportions of Campylobacter positive carcasses and caecal contents at the slaughterhouse were both 33.3% (10 of 30 samples each). The concentration of Campylobacter contamination observed on carcasses at retail markets ranged from no bacteria/carcass to 3.71 log10 cfu/carcass. The data obtained provide essential information for future quantitative risk assessments aiming to estimate the probability of a person contracting campylobacteriosis following consumption of broiler meat in Argentina. The proportions of Campylobacter-positive samples found in this preliminary study indicate that a large proportion of the cases of human gastroenteritis in Argentina may be due to this pathogen. Human cases of gastroenteritis should be studied in greater detail and measures should be developed to reduce the proportion of poultry products that are contaminated by Campylobacter species.

  19. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  20. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  1. Exploring Mass Perception with Markov Chain Monte Carlo

    ERIC Educational Resources Information Center

    Cohen, Andrew L.; Ross, Michael G.

    2009-01-01

    Several previous studies have examined the ability to judge the relative mass of objects in idealized collisions. With a newly developed technique of psychological Markov chain Monte Carlo sampling (A. N. Sanborn & T. L. Griffiths, 2008), this work explores participants; perceptions of different collision mass ratios. The results reveal…

  2. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  3. Health risks posed to infants in rural China by exposure to short- and medium-chain chlorinated paraffins in breast milk.

    PubMed

    Xia, Dan; Gao, Li-Rong; Zheng, Ming-Hui; Li, Jing-Guang; Zhang, Lei; Wu, Yong-Ning; Qiao, Lin; Tian, Qi-Chang; Huang, Hui-Ting; Liu, Wen-Bin; Su, Gui-Jin; Liu, Guo-Rui

    2017-06-01

    Chlorinated paraffins (CPs) are complex mixtures of synthetic chemicals found widely in environmental matrices. Short-chain CPs (SCCPs) are candidate persistent organic pollutants under the Stockholm Convention. There should be great concern about human exposure to SCCPs. Data on CP concentrations in human breast milk is scarce. This is the first study in which background SCCP and medium-chain CP (MCCP) body burdens in the general rural population of China have been estimated and health risks posed to nursing infants by CPs in breast milk assessed. The concentrations of 48 SCCP and MCCP formula congeners were determined in 24 pooled human milk samples produced from 1412 individual samples from eight provinces in 2007 and 16 provinces in 2011. The samples were analyzed by comprehensive two-dimensional gas chromatography electron capture negative ionization high-resolution time-of-flight mass spectrometry. The median SCCP and MCCP concentrations were 303 and 35.7ngg -1 lipid weight, respectively, for the 2007 samples and 360 and 45.4ngg -1 lipid weight, respectively, for the 2011 samples. The C 10 and C 14 homologs were the dominant CP carbon-chain-length groups, contributing 51% and 82% of the total SCCP and MCCP concentrations, respectively. There are probably multiple CP sources to the general Chinese population and numerous exposure pathways. The median estimated daily SCCP and MCCP intakes for nursing infants were 1310 and 152ngkg -1 d -1 , respectively, in 2007 and 1520 and 212ngkg -1 d -1 , respectively, in 2011. SCCPs do not currently pose significant risks to infants in China. However, it is necessary to continuously monitor CP concentrations and health risks because CP concentrations in Chinese human breast milk are increasing. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Diagnosis of ocular toxoplasmosis by two polymerase chain reaction (PCR) examinations: qualitative multiplex and quantitative real-time.

    PubMed

    Sugita, Sunao; Ogawa, Manabu; Inoue, Shizu; Shimizu, Norio; Mochizuki, Manabu

    2011-09-01

    To establish a two-step polymerase chain reaction (PCR) diagnostic system for ocular toxoplasmosis. A total of 13 ocular fluid samples (11 aqueous humor and 2 vitreous fluid) were collected from 13 patients with clinically suspected ocular toxoplasmosis. Ten ocular samples from other uveitis patients and 20 samples from subjects without ocular inflammation were used as controls. Two polymerase chain reaction (PCR) methods, i.e., qualitative multiplex PCR and quantitative real-time PCR, were used to measure the toxoplasma genome (T. gondii B1 gene). Qualitative multiplex PCR detected T. gondii B1 gene in the ocular fluids of 11 out of 13 patients with clinically suspected ocular toxoplasmosis. In real-time PCR, we detected high copy numbers of T. gondii DNA (5.1 × 10(2)-2.1 × 10(6) copies/mL) in a total of 10 patients (10/13, 77%). Only ocular toxoplasmosis scar lesions were observed in the three real-time PCR-negative patients. PCR assay results for the samples from the two control groups were all negative. The two-step PCR examination to detect toxoplasma DNA is a useful tool for diagnosing ocular toxoplasmosis.

  5. Convectively driven PCR thermal-cycling

    DOEpatents

    Benett, William J.; Richards, James B.; Milanovich, Fred P.

    2003-07-01

    A polymerase chain reaction system provides an upper temperature zone and a lower temperature zone in a fluid sample. Channels set up convection cells in the fluid sample and move the fluid sample repeatedly through the upper and lower temperature zone creating thermal cycling.

  6. Validation of a polymerase chain reaction aided transcript titration assay (PATTY) for topoisomerase II in lung cancer samples.

    PubMed

    Dingemans, A M; Van Ark-Otte, J; Smit, E F; Postmus, P E; Giaccone, G

    This report describes the validation of a polymerase chain reaction aided transcript titration assay (PATTY) for tumor samples. The results obtained with the PATTY were compared to those of RNase protection in a set of 7 human lung cancer cell lines and in 23 non-small cell lung cancer samples derived from resected patients. Whereas between PATTY and RNase protection assay a good correlation was observed in the cell lines (r = 0.74, p = 0.057), no correlation was observed within the tumor samples (r = 0.06, p = 0.78). This was also the case when only tumors with a high percentage of tumor cells (> 90%) were selected. Although PATTY is a valuable tool to measure mRNA expression in cell lines, our results caution the use of PATTY in human tumor samples without proper validation. The possible causes of these results are discussed.

  7. Recombinase polymerase amplification-based assay to diagnose Giardia in stool samples.

    PubMed

    Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

    2015-03-01

    Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. © The American Society of Tropical Medicine and Hygiene.

  8. Recombinase Polymerase Amplification-Based Assay to Diagnose Giardia in Stool Samples

    PubMed Central

    Crannell, Zachary Austin; Cabada, Miguel Mauricio; Castellanos-Gonzalez, Alejandro; Irani, Ayesha; White, Arthur Clinton; Richards-Kortum, Rebecca

    2015-01-01

    Giardia duodenalis is one of the most commonly identified parasites in stool samples. Although relatively easy to treat, giardiasis can be difficult to detect as it presents similar to other diarrheal diseases. Here, we present a recombinase polymerase amplification-based Giardia (RPAG) assay to detect the presence of Giardia in stool samples. The RPAG assay was characterized on the bench top using stool samples spiked with Giardia cysts where it showed a limit-of-detection nearly as low as the gold standard polymerase chain reaction assay. The RPAG assay was then tested in the highlands of Peru on 104 stool samples collected from the surrounding communities where it showed 73% sensitivity and 95% specificity against a polymerase chain reaction and microscopy composite gold standard. Further improvements in clinical sensitivity will be needed for the RPAG assay to have clinical relevance. PMID:25510713

  9. Verification of clinical samples, positive in AMPLICOR Neisseria gonorrhoeae polymerase chain reaction, by 16S rRNA and gyrA compared with culture.

    PubMed

    Airell, Asa; Lindbäck, Emma; Ataker, Ferda; Pörnull, Kirsti Jalakas; Wretlind, Bengt

    2005-06-01

    We compared 956 samples for AMPLICOR Neisseria gonorrhoeae polymerase chain reaction (PCR) (Roche) with species verification using the 16S rRNA gene to verification using gyrA gene. Control was the culture method. The gyrA verification uses pyrosequencing of the quinolone resistance-determining region of gyrA. Of 52 samples with optical density >/=0.2 in PCR, 27 were negative in culture, two samples from pharynx were false negative in culture and four samples from pharynx were false positives in verification with 16S rRNA. Twenty-five samples showed growth of gonococci, 18 of the corresponding PCR samples were verified by both methods; three urine samples were positive only in gyrA ; and one pharynx specimen was positive only in 16S rRNA. Three samples were lost. We conclude that AMPLICOR N. gonorrhoeae PCR with verification in gyrA gene can be considered as a diagnostic tool in populations with low prevalence of gonorrhoea and that pharynx specimens should not be analysed by PCR.

  10. Energy Minimization of Discrete Protein Titration State Models Using Graph Theory.

    PubMed

    Purvine, Emilie; Monson, Kyle; Jurrus, Elizabeth; Star, Keith; Baker, Nathan A

    2016-08-25

    There are several applications in computational biophysics that require the optimization of discrete interacting states, for example, amino acid titration states, ligand oxidation states, or discrete rotamer angles. Such optimization can be very time-consuming as it scales exponentially in the number of sites to be optimized. In this paper, we describe a new polynomial time algorithm for optimization of discrete states in macromolecular systems. This algorithm was adapted from image processing and uses techniques from discrete mathematics and graph theory to restate the optimization problem in terms of "maximum flow-minimum cut" graph analysis. The interaction energy graph, a graph in which vertices (amino acids) and edges (interactions) are weighted with their respective energies, is transformed into a flow network in which the value of the minimum cut in the network equals the minimum free energy of the protein and the cut itself encodes the state that achieves the minimum free energy. Because of its deterministic nature and polynomial time performance, this algorithm has the potential to allow for the ionization state of larger proteins to be discovered.

  11. Photodissociation Spectroscopy of Cold Protonated Synephrine: Surprising Differences between IR-UV Hole-Burning and IR Photodissociation Spectroscopy of the O-H and N-H Modes.

    PubMed

    Nieuwjaer, N; Desfrançois, C; Lecomte, F; Manil, B; Soorkia, S; Broquier, M; Grégoire, G

    2018-04-19

    We report the UV and IR photofragmentation spectroscopies of protonated synephrine in a cryogenically cooled Paul trap. Single (UV or IR) and double (UV-UV and IR-UV) resonance spectroscopies have been performed and compared to quantum chemistry calculations, allowing the assignment of the lowest-energy conformer with two rotamers depending on the orientation of the phenol hydroxyl (OH) group. The IR-UV hole burning spectrum exhibits the four expected vibrational modes in the 3 μm region, i.e., the phenol OH, C β -OH, and two NH 2 + stretches. The striking difference is that, among these modes, only the free phenol OH mode is active through IRPD. The protonated amino group acts as a proton donor in the internal hydrogen bond and displays large frequency shifts upon isomerization expected during the multiphoton absorption process, leading to the so-called IRMPD transparency. More interestingly, while the C β -OH is a proton acceptor group with moderate frequency shift for the different conformations, this mode is still inactive through IRPD.

  12. Antiprotozoal and antimicrobial compounds from the plant pathogen Septoria pistaciarum.

    PubMed

    Kumarihamy, Mallika; Khan, Shabana I; Jacob, Melissa; Tekwani, Babu L; Duke, Stephen O; Ferreira, Daneel; Nanayakkara, N P Dhammika

    2012-05-25

    Four new 1,4-dihydroxy-5-phenyl-2-pyridinone alkaloids, 17-hydroxy-N-(O-methyl)septoriamycin A (1), 17-acetoxy-N-(O-methyl)septoriamycin A (2), 13-(S)-hydroxy-N-(O-methyl)septoriamycin A (3), and 13-(R)-hydroxy-N-(O-methyl)septoriamycin A (4), together with the known compounds (+)-cercosporin (5), (+)-14-O-acetylcercosporin (6), (+)-di-O-acetylcercosporin (7), lumichrome, and brassicasterol, were isolated from an ethyl acetate extract of a culture medium of Septoria pistaciarum. Methylation of septoriamycin A (8) with diazomethane yielded three di-O-methyl analogues, two of which existed as mixtures of rotamers. We previously reported antimalarial activity of septoriamycin A. This compound also exhibited significant activity against Leishmania donovani promastigotes. Compounds 5-7 showed moderate in vitro activity against L. donovani promastigotes and chloroquine-sensitive (D6) and -resistant (W2) strains of Plasmodium falciparum, whereas compound 5 was fairly active against methicillin-sensitive and methicillin-resistant strains of Staphylococcus aureus. Compounds 5-7 also displayed moderate phytotoxic activity against both a dicot (lettuce, Lactuca sativa) and a monocot (bentgrass, Agrostis stolonifera) and cytotoxicity against a panel of cell lines.

  13. Energy Minimization of Discrete Protein Titration State Models Using Graph Theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Purvine, Emilie AH; Monson, Kyle E.; Jurrus, Elizabeth R.

    There are several applications in computational biophysics which require the optimization of discrete interacting states; e.g., amino acid titration states, ligand oxidation states, or discrete rotamer angles. Such optimization can be very time-consuming as it scales exponentially in the number of sites to be optimized. In this paper, we describe a new polynomial-time algorithm for optimization of discrete states in macromolecular systems. This algorithm was adapted from image processing and uses techniques from discrete mathematics and graph theory to restate the optimization problem in terms of maximum flow-minimum cut graph analysis. The interaction energy graph, a graph in which verticesmore » (amino acids) and edges (interactions) are weighted with their respective energies, is transformed into a flow network in which the value of the minimum cut in the network equals the minimum free energy of the protein, and the cut itself encodes the state that achieves the minimum free energy. Because of its deterministic nature and polynomial-time performance, this algorithm has the potential to allow for the ionization state of larger proteins to be discovered.« less

  14. Energy Minimization of Discrete Protein Titration State Models Using Graph Theory

    PubMed Central

    Purvine, Emilie; Monson, Kyle; Jurrus, Elizabeth; Star, Keith; Baker, Nathan A.

    2016-01-01

    There are several applications in computational biophysics which require the optimization of discrete interacting states; e.g., amino acid titration states, ligand oxidation states, or discrete rotamer angles. Such optimization can be very time-consuming as it scales exponentially in the number of sites to be optimized. In this paper, we describe a new polynomial-time algorithm for optimization of discrete states in macromolecular systems. This algorithm was adapted from image processing and uses techniques from discrete mathematics and graph theory to restate the optimization problem in terms of “maximum flow-minimum cut” graph analysis. The interaction energy graph, a graph in which vertices (amino acids) and edges (interactions) are weighted with their respective energies, is transformed into a flow network in which the value of the minimum cut in the network equals the minimum free energy of the protein, and the cut itself encodes the state that achieves the minimum free energy. Because of its deterministic nature and polynomial-time performance, this algorithm has the potential to allow for the ionization state of larger proteins to be discovered. PMID:27089174

  15. CHARMM Drude Polarizable Force Field for Aldopentofuranoses and Methyl-aldopentofuranosides

    PubMed Central

    Jana, Madhurima; MacKerell, Alexander D.

    2015-01-01

    An empirical all-atom CHARMM polarizable force filed for aldopentofuranoses and methyl-aldopentofuranosides based on the classical Drude oscillator is presented. A single electrostatic model is developed for eight different diastereoisomers of aldopentofuranoses by optimizing the existing electrostatic and bonded parameters as transferred from ethers, alcohols and hexopyranoses to reproduce quantum mechanical (QM) dipole moments, furanose-water interaction energies and conformational energies. Optimization of selected electrostatic and dihedral parameters was performed to generate a model for methyl-aldopentofuranosides. Accuracy of the model was tested by reproducing experimental data for crystal intramolecular geometries and lattice unit cell parameters, aqueous phase densities, and ring pucker and exocyclic rotamer populations as obtained from NMR experiments. In most cases the model is found to reproduce both QM data and experimental observables in an excellent manner, while for the remainder the level of agreement is in the satisfactory regimen. In aqueous phase simulations the monosaccharides have significantly enhanced dipoles as compared to the gas phase. The final model from this study is transferrable for future studies on carbohydrates and can be used with the existing CHARMM Drude polarizable force field for biomolecules. PMID:26018564

  16. Arylhydrazone derivatives of naproxen as new analgesic and anti-inflammatory agents: Design, synthesis and molecular docking studies.

    PubMed

    Azizian, Homa; Mousavi, Zahra; Faraji, Hamidreza; Tajik, Mohammad; Bagherzadeh, Kowsar; Bayat, Peyman; Shafiee, Abbas; Almasirad, Ali

    2016-06-01

    A series of new arylidenehydrazone derivatives of naproxen were synthesized and evaluated for their analgesic and anti-inflammatory activities. Some of the synthesized analogues showed comparable activities when compared against naproxen for their analgesic and anti-inflammatory properties. 2-(6-methoxy-2-naphthyl)-N'-[(pyridine-4-yl)methylene]propanoic acid hydrazide 4j was found to be the most active analgesic agent. 2-(6-methoxy-2-naphthyl)-N'-[4-nitrobenzylidene]propanoic acid hydrazide 4g showed highest anti-inflammatory activity in comparison to the naproxen. Molecular modeling study of the synthesized compounds suggested that the designed molecules were well located and bound to the COX-1 and COX-2 active sites. Compound 4g showed the highest selectivity for COX-2 (RCOX-2/COX-1=1.94) and higher affinity rather than naproxen in COX-2 active site (RCOX-2/naproxen=1.28). Moreover, the structural analyses confirmed that the E-ap rotamer is the preferred structure for the arylidenehydrazone derivatives. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Small differences in amylopectin fine structure may explain large functional differences of starch.

    PubMed

    Bertoft, Eric; Annor, George A; Shen, Xinyu; Rumpagaporn, Pinthip; Seetharaman, Koushik; Hamaker, Bruce R

    2016-04-20

    Four amylose-free waxy rice starches were found to give rise to gels with clearly different morphology after storage for seven days at 4°C. The thermal and rheological properties of these gels were also different. This was remarkable in light of the subtle differences in the molecular structure of the amylopectin in the samples. Addition of iodine to the amylopectin samples suggested that not only external chains, but also the internal chains of amylopectin, could form helical inclusion complexes. It is suggested that these internal helical segments participate in the retrogradation of amylopectin, thereby stabilising the gels through double helical structures with external chains of adjacent molecules. Albeit few in number, such interactions appear to have important influences on starch functional properties. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Assessment of Intrathecal Free Light Chain Synthesis: Comparison of Different Quantitative Methods with the Detection of Oligoclonal Free Light Chains by Isoelectric Focusing and Affinity-Mediated Immunoblotting

    PubMed Central

    Kušnierová, Pavlína; Švagera, Zdeněk; Všianský, František; Byrtusová, Monika; Hradílek, Pavel; Kurková, Barbora; Zapletalová, Olga; Bartoš, Vladimír

    2016-01-01

    Objectives We aimed to compare various methods for free light chain (fLC) quantitation in cerebrospinal fluid (CSF) and serum and to determine whether quantitative CSF measurements could reliably predict intrathecal fLC synthesis. In addition, we wished to determine the relationship between free kappa and free lambda light chain concentrations in CSF and serum in various disease groups. Methods We analysed 166 paired CSF and serum samples by at least one of the following methods: turbidimetry (Freelite™, SPAPLUS), nephelometry (N Latex FLC™, BN ProSpec), and two different (commercially available and in-house developed) sandwich ELISAs. The results were compared with oligoclonal fLC detected by affinity-mediated immunoblotting after isoelectric focusing. Results Although the correlations between quantitative methods were good, both proportional and systematic differences were discerned. However, no major differences were observed in the prediction of positive oligoclonal fLC test. Surprisingly, CSF free kappa/free lambda light chain ratios were lower than those in serum in about 75% of samples with negative oligoclonal fLC test. In about a half of patients with multiple sclerosis and clinically isolated syndrome, profoundly increased free kappa/free lambda light chain ratios were found in the CSF. Conclusions Our results show that using appropriate method-specific cut-offs, different methods of CSF fLC quantitation can be used for the prediction of intrathecal fLC synthesis. The reason for unexpectedly low free kappa/free lambda light chain ratios in normal CSFs remains to be elucidated. Whereas CSF free kappa light chain concentration is increased in most patients with multiple sclerosis and clinically isolated syndrome, CSF free lambda light chain values show large interindividual variability in these patients and should be investigated further for possible immunopathological and prognostic significance. PMID:27846293

  19. Gregg T. Beckham | NREL

    Science.gov Websites

    Molecular Dynamics, and a suite of free energy methods such as MD Umbrella Sampling, Equilibrium Path chain on the crystal surface, and the degree of crystallinity in the substrate. We have used free energy shows the free energy results for edge, middle, and corner chains for all four types of cellulose. All

  20. An affine microsphere approach to modeling strain-induced crystallization in rubbery polymers

    NASA Astrophysics Data System (ADS)

    Nateghi, A.; Dal, H.; Keip, M.-A.; Miehe, C.

    2018-01-01

    Upon stretching a natural rubber sample, polymer chains orient themselves in the direction of the applied load and form crystalline regions. When the sample is retracted, the original amorphous state of the network is restored. Due to crystallization, properties of rubber change considerably. The reinforcing effect of the crystallites stiffens the rubber and increases the crack growth resistance. It is of great importance to understand the mechanism leading to strain-induced crystallization. However, limited theoretical work has been done on the investigation of the associated kinetics. A key characteristic observed in the stress-strain diagram of crystallizing rubber is the hysteresis, which is entirely attributed to strain-induced crystallization. In this work, we propose a micromechanically motivated material model for strain-induced crystallization in rubbers. Our point of departure is constructing a micromechanical model for a single crystallizing polymer chain. Subsequently, a thermodynamically consistent evolution law describing the kinetics of crystallization on the chain level is proposed. This chain model is then incorporated into the affine microsphere model. Finally, the model is numerically implemented and its performance is compared to experimental data.

  1. Arrangement at the nanoscale: Effect on magnetic particle hyperthermia

    NASA Astrophysics Data System (ADS)

    Myrovali, E.; Maniotis, N.; Makridis, A.; Terzopoulou, A.; Ntomprougkidis, V.; Simeonidis, K.; Sakellari, D.; Kalogirou, O.; Samaras, T.; Salikhov, R.; Spasova, M.; Farle, M.; Wiedwald, U.; Angelakeris, M.

    2016-11-01

    In this work, we present the arrangement of Fe3O4 magnetic nanoparticles into 3D linear chains and its effect on magnetic particle hyperthermia efficiency. The alignment has been performed under a 40 mT magnetic field in an agarose gel matrix. Two different sizes of magnetite nanoparticles, 10 and 40 nm, have been examined, exhibiting room temperature superparamagnetic and ferromagnetic behavior, in terms of DC magnetic field, respectively. The chain formation is experimentally visualized by scanning electron microscopy images. A molecular Dynamics anisotropic diffusion model that outlines the role of intrinsic particle properties and inter-particle distances on dipolar interactions has been used to simulate the chain formation process. The anisotropic character of the aligned samples is also reflected to ferromagnetic resonance and static magnetometry measurements. Compared to the non-aligned samples, magnetically aligned ones present enhanced heating efficiency increasing specific loss power value by a factor of two. Dipolar interactions are responsible for the chain formation of controllable density and thickness inducing shape anisotropy, which in turn enhances magnetic particle hyperthermia efficiency.

  2. Smart management of sample dilution using an artificial neural network to achieve streamlined processes and saving resources: the automated nephelometric testing of serum free light chain as case study.

    PubMed

    Ialongo, Cristiano; Pieri, Massimo; Bernardini, Sergio

    2017-02-01

    Saving resources is a paramount issue for the modern laboratory, and new trainable as well as smart technologies can be used to allow the automated instrumentation to manage samples more efficiently in order to achieve streamlined processes. In this regard the serum free light chain (sFLC) testing represents an interesting challenge, as it usually causes using a number of assays before achieving an acceptable result within the analytical range. An artificial neural network based on the multi-layer perceptron (MLP-ANN) was used to infer the starting dilution status of sFLC samples based on the information available through the laboratory information system (LIS). After the learning phase, the MLP-ANN simulation was applied to the nephelometric testing routinely performed in our laboratory on a BN ProSpec® System analyzer (Siemens Helathcare) using the N Latex FLC kit. The MLP-ANN reduced the serum kappa free light chain (κ-FLC) and serum lambda free light chain (λ-FLC) wasted tests by 69.4% and 70.8% with respect to the naïve stepwise dilution scheme used by the automated analyzer, and by 64.9% and 66.9% compared to a "rational" dilution scheme based on a 4-step dilution. Although it was restricted to follow-up samples, the MLP-ANN showed good predictive performance, which alongside the possibility to implement it in any automated system, made it a suitable solution for achieving streamlined laboratory processes and saving resources.

  3. CTEPP STANDARD OPERATING PROCEDURE FOR HANDLING SAMPLE AND DATA CUSTODY (SOP-2.26)

    EPA Science Inventory

    This SOP describes the method for handling sample custody. A standardized Chain-of-Custody (CoC) Record is used to document the sample/data custody. Each participant is assigned one CoC Record for the samples/data collected at their home and/or day care center.

  4. Home Health Chains and Practice Patterns: Evidence of 2008 Medicare Reimbursement Revision.

    PubMed

    Huang, Sean Shenghsiu; Kim, Hyunjee

    2017-10-01

    Home health agencies (HHAs) are known to exploit the Medicare reimbursement schedule by targeting a specific number of therapy visits. These targeting behaviors cause unnecessary medical spending. The Centers for Medicare & Medicaid Services estimates that during fiscal year 2015, Medicare made more than $10 billion in improper payments to HHAs. Better understanding of heterogeneous gaming behaviors among HHAs can inform policy makers to more effectively oversee the home health care industry. This article aims to study how home health chains adjust and adopt new targeting behaviors as compared to independent agencies under the new reimbursement schedule. The analytic data are constructed from: (1) 5% randomly sampled Medicare home health claim data, and (2) HHA chain information extracted from the Medicare Cost Report. The study period spans from 2007 to 2010, and the sample includes 7800 unique HHAs and 380,118 treatment episodes. A multivariate regression model is used to determine whether chain and independent agencies change their practice patterns and adopt different targeting strategies after the revision of the reimbursement schedule in 2008. This study finds that independent agencies are more likely to target 6 and 14 visits, while chain agencies are more likely to target 20 visits. Such a change of practice patterns is more significant among for-profit HHAs. The authors expect these findings to inform policy makers that organizational structures, especially the combination of for-profit status and chain affiliation, should be taken into the consideration when detecting medical fraud and designing the reimbursement schedule.

  5. Occurrence, bioaccumulation and long-range transport of short-chain chlorinated paraffins on the Fildes Peninsula at King George Island, Antarctica.

    PubMed

    Li, Huijuan; Fu, Jianjie; Zhang, Aiqian; Zhang, Qinghua; Wang, Yawei

    2016-09-01

    As a candidate persistent organic pollutant of the Stockholm Convention, short-chain chlorinated paraffins (SCCPs) have recently received particular attention. In this study, we investigated, for the first time, the concentrations of SCCPs in biota samples collected from the Fildes Peninsula at King George Island and Ardley Island, Antarctica. The concentrations of SCCPs ranged from 3.5 to 256.6ng/g (dry weight, dw), with a mean of 76.6±61.8ng/g dw, which was lower than those detected in mid- and low-latitude regions. The long-range transport behaviour of SCCPs was confirmed by both the detection of SCCPs in Antarctic remote areas and their special congener profiles. Short carbon chain (C10) congeners predominated in the Antarctic samples, which accounted for 56.1% of the total SCCP contamination. Such enrichment of C10 congeners indicated the high potential for the long-range transport of shorter chain congeners. In addition, SCCPs tended to be enriched in the species with high lipid contents. The biomagnification potential of SCCPs was found between Archeogastropoda (Agas) and Neogastropoda (Ngas), and the biomagnification factors of shorter chain congeners of SCCPs were higher than that of the longer chain ones. Considering that the endemic species in polar regions may be sensitive and vulnerable to the adverse effects of environmental contaminants, more attention should be paid on the bioaccumulation and toxicological risks of SCCPs in polar environments. Copyright © 2016. Published by Elsevier Ltd.

  6. The quantification of short-chain chlorinated paraffins in sediment samples using comprehensive two-dimensional gas chromatography with μECD detection.

    PubMed

    Muscalu, Alina M; Morse, Dave; Reiner, Eric J; Górecki, Tadeusz

    2017-03-01

    The analysis of persistent organic pollutants in environmental samples is a challenge due to the very large number of compounds with varying chemical and physical properties. Chlorinated paraffins (CPs) are complex mixtures of chlorinated n-alkanes with varying chain lengths (C 10 to C 30 ) and degree of chlorination (30 to 70% by weight). Their physical-chemical properties make these compounds persistent in the environment and able to bioaccumulate in living organisms. Comprehensive two-dimensional gas chromatography (GC × GC) coupled with micro-electron capture detection (μECD) was used to separate and quantify short-chain chlorinated paraffins (SCCP) in sediment samples. Distinct ordered bands were observed in the GC × GC chromatograms pointing to group separation. Using the Classification function of the ChromaTOF software, summary tables were generated to determine total area counts to set up multilevel-calibration curves for different technical mixes. Fortified sediment samples were analyzed by GC × GC-μECD with minimal extraction and cleanup. Recoveries ranged from 120 to 130%. To further validate the proposed method for the analysis of SCCPs, the laboratory participated in interlaboratory studies for the analysis of standards and sediment samples. The results showed recoveries between 75 and 95% and z-score values <2, demonstrating that the method is suitable for the analysis of SCCPs in soil/sediment samples. Graphical abstract Quantification of SCCPs by 2D-GC-μECD.

  7. Transmission and control of Salmonella in the pig feed chain: a conceptual model.

    PubMed

    Binter, Claudia; Straver, Judith Maria; Häggblom, Per; Bruggeman, Geert; Lindqvist, Per-Anders; Zentek, Jürgen; Andersson, Mats Gunnar

    2011-03-01

    Infected breeder pigs and contaminated feed represent potential sources of Salmonella introduction to fattening pig herds and may thereby cause human infections acquired via consumption of contaminated pork. Modelling approaches such as quantitative microbial risk assessment could improve the design of strategies for control and tracing of Salmonella in the feed chain. However, the construction of such models requires a thorough understanding of the dynamics of the feed chain, including production processes, microbial processes and transport logistics. The present article illustrates a conceptual model of Salmonella in the pig feed chain and explores the possibilities for quantitative modelling including identifying major gaps in data. Information was collected from peer-reviewed scientific journals, official documents and reports and by means of interviews with experts from authorities and the feed industry. Data on prevalence of Salmonella in different parts of the feed chain are difficult to compare as observed prevalence may be biased by variations in sampling procedures as well as limitations of the detection methods. There are almost no data on numbers of Salmonella in commodities of the feed chain, which often makes it difficult to evaluate risks, intervention strategies and sampling plans in a quantitative manner. Tracing the source of Salmonella contamination is hampered by the risk of cross-contamination as well as various mixing and partitioning events along the supply chain, which sometimes makes it impossible to trace the origin of a lot back to a batch or producer. Available information points to contaminated feed materials, animal vectors and persistent contamination of production environments as important sources of Salmonella in feed production. Technological procedures such as hydrothermal or acid treatment can be used to control Salmonella in feed production. However, a large fraction of pig feed is produced without decontamination procedures. Prevention of recontamination and control of moisture throughout the chain are thus critical factors for controlling Salmonella in feed production. To verify successful control it is necessary to have monitoring strategies able to detect low levels of Salmonella heterogeneously distributed in large volumes of feed and feed material in bulk. Experience from monitoring programs and research investigations indicates that sampling of dust and sweepings from control points along the production line is an efficient strategy to gain an indication of Salmonella contamination. Copyright © 2010 Elsevier B.V. All rights reserved.

  8. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

    PubMed Central

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-01-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  9. Genetic correlations of mid-infrared-predicted milk fatty acid groups with milk production traits.

    PubMed

    Fleming, A; Schenkel, F S; Malchiodi, F; Ali, R A; Mallard, B; Sargolzaei, M; Jamrozik, J; Johnston, J; Miglior, F

    2018-05-01

    The objective of this research was to estimate the genetic correlations between milk mid-infrared-predicted fatty acid groups and production traits in first-parity Canadian Holsteins. Contents of short-chain, medium-chain, long-chain, saturated, and unsaturated fatty acid groupings in milk samples can be predicted using mid-infrared spectral data for cows enrolled in milk recording programs. Predicted fatty acid group contents were obtained for 49,127 test-day milk samples from 10,029 first-parity Holstein cows in 810 herds. Milk yield, fat and protein yield, fat and protein percentage, fat-to-protein ratio, and somatic cell score were also available for these test days. Genetic parameters were estimated for the fatty acid groups and production traits using multiple-trait random regression test day models by Bayesian methods via Gibbs sampling. Three separate 8- or 9-trait analyses were performed, including the 5 fatty acid groups with different combinations of the production traits. Posterior standard deviations ranged from <0.001 to 0.01. Average daily genetic correlations were negative and similar to each other for the fatty acid groups with milk yield (-0.62 to -0.59) and with protein yield (-0.32 to -0.25). Weak and positive average daily genetic correlations were found between somatic cell score and the fatty acid groups (from 0.25 to 0.36). Stronger genetic correlations with fat yield, fat and protein percentage, and fat-to-protein ratio were found with medium-chain and saturated fatty acid groups compared with those with long-chain and unsaturated fatty acid groups. Genetic correlations were very strong between the fatty acid groups and fat percentage, ranging between 0.88 for unsaturated and 0.99 for saturated fatty acids. Daily genetic correlations from 5 to 305 d in milk with milk, protein yield and percentage, and somatic cell score traits showed similar patterns for all fatty acid groups. The daily genetic correlations with fat yield at the beginning of lactation were decreasing for long-chain and unsaturated fatty acid groups and increasing for short-chain fatty acids. Genetic correlations between fat percentage and fatty acids were increasing at the beginning of lactation for short- and medium-chain and saturated fatty acids, but slightly decreasing for long-chain and unsaturated fatty acid groups. These results can be used in defining fatty acid traits and breeding objectives. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  10. Characterization of the Microbial Community in Indoor Environments: a Chemical-Analytical Approach

    PubMed Central

    Sebastian, Aleksandra; Larsson, Lennart

    2003-01-01

    An integrated procedure is presented whereby gas chromatography-ion trap mass spectrometry is used to determine chemical markers of gram-negative bacterial lipopolysaccharide (3-hydroxy fatty acids with 10 to 18 carbon atoms), gram-positive bacteria (branched-chain fatty acids with 15 and 17 carbon atoms), bacterial peptidoglycan (muramic acid), and fungal biomass (ergosterol) in samples of settled house dust. A hydrolysate of 13C-labeled cyanobacterial cells is used as an internal standard for the first three markers. These analyses require two dust samples, one for 3-OH fatty acids, branched-chain fatty acids, and muramic acid and another for ergosterol. The method may be used to characterize microbial communities in environmental samples. PMID:12788704

  11. [Applying competitive polymerase chain reaction to the detection of hepatitis B virus DNA].

    PubMed

    Wang, Ling; Yang, Peng; Li, Shuang-qing; Xu, Shu-hui; Cao, Gui-qun; Zhang, Fa-qiang; Zhang, Mei-xia; Chen, Qing-ying; Xia, Qing-jie; Liu, Kai; Tang, Fang; Zhang, Yuan-zheng

    2004-11-01

    To reduce the rate of accidental false negative result in the HBV DNA PCR test on clinical serum samples. A competitive polymerase chain reaction (C-PCR) was used to decrease the false negative ratio. In the C-PCR, a constructed inner control DNA was added for co-amplification with the HBV target DNA. In a 20 microl C-PCR system, about 60 to 200 copies of inner control DNA could give apparent co-amplification signal band after electrophoresis on a 2% agarose gel. Five of 120 samples of clinical serum (4.2%) could not be amplified. C-PCR has the advantage of yielding information on false negative in the HBV DNA PCR assay of clinical serum samples.

  12. Spectra and structure of small ring molecules. XLV. Microwave, infrared, and Raman spectra, conformational stability, dipole moment and vibrational assignment of cyclobutylcarboxaldehyde

    NASA Astrophysics Data System (ADS)

    Durig, J. R.; Badawi, H. M.

    1990-12-01

    The microwave spectrum of cyclobutylcarboxaldehyde, c-C 4H 7CHO, has been recorded from 12.4 to 39.0 GHz. Two sets of a-type R-branch transitions were observed and assigned, on the basis of the rigid rotor model, to the equatorial-trans and the equatorial-gauche conformers. The rotational constants for the ground state for the equatorial-trans conformer are: A=9653.70 ± 0.47, B=2224.15 ± 0.01 and C=1986.68 ± 0.01 MHz. The lines for the first excited state of the asymmetric torsion for the equatorial-trans conformer have also been identified and assigned and, from relative intensity measurements, the frequency of the asymmetric torsion of this conformer is estimated to be 71 ± 10 cm -1. For the equatorial-gauche conformer in addition to the R-branch assignments, Q-branch assignments have been made for b- and c-type transitions for the ground state. The rotational constants for this conformer are: A=8108.08 ± 0.05, B=2554.89 ± 0.01, and C=2215.78 ± 0.01 MHz. From the Stark effect the dipole moment components for both conformers were determined. For the equatorial-trans conformer the dipole moment components were determined to be: &|μ a&| = 1.65 ± 0.01 D, &|μ b&|=0.00 (by symmetry), &|μ c&|=1.23 ± 0.01 &|μ t&|=2.06 ± 0.01 D. For the equatorial-gauge conformer the dipole moment components were determined to be: &|μ a&|=2.03 ± &|μ b&|=1.52 ± 0.04, &|μ c&|=0.83 ± 0.06 and &|μ t&|=2.66 ± 0.02 D. The infrared (3500-30 cm -1 and Raman have been recorded for the gaseous and solid states of cyclobutylcarboxaldehyde. Additionally, the Raman spectrum of the liquid phase has been recorded and qualitative depolarization values have been obtained. From variable temperature measurements of the microwave and Raman spectra, for the gaseous and liquid phases, respectively, the equatorial-gauche conformer was found to be thermodynamically preferred for the gas phase; however, it is the equatorial-trans rotamer which is most stable in the liquid. Furthermore, the only conformation present in the annealed solid is the equatorial-trans rotamer. From these data a complete vibrational assignment is proposed. The observed splitting of many of the fundamentals in the solid state indicates that there are at least two molecules per primitive cell. These results are compared to similar quantities in some related molecules.

  13. Diagnostic reference range of κ/λ free light chain ratio to screen for Bence Jones proteinuria is not significantly influenced by GFR.

    PubMed

    Schmidt-Hieltjes, Yvonne; Elshof, Clemens; Roovers, Lian; Ruinemans-Koerts, Janneke

    2016-05-01

    The aim of our study was to analyse whether the κ/λ free light chain ratio reference range for screening for Bence Jones proteinuria should be dependent on the estimated glomerular filtration rate (eGFR). The serum κ/λ free light chain ratio, eGFR, serum M-protein and Bence Jones protein were measured in 544 patients for whom Bence Jones protein analysis was ordered. In the population of patients without Bence Jones proteinuria or a M-protein (n = 402), there is no gradual increase in κ/λ free light chain ratio with diminishing eGFR. The κ/λ free light chain ratio in this group was 0.56-1.86 (95% interval). With this diagnostic reference range of the κ/λ ratio, 105 of the 110 patients with Bence Jones protein could be identified correctly. Only five patients with Bence Jones proteinuria (<0.17 g/L) were missed, without diagnostic or therapeutic consequences. In 36 patients (6.6%), an abnormal κ/λ free light chain ratio was measured without the presence of Bence Jones proteinuria. A κ/λ free light chain ratio in serum can be used safely and efficiently to select urine samples which should be analysed for Bence Jones proteinuria with an electrophoresis/immunofixation technique. Using this diagnostic reference range, the number of urine samples which should be analysed by electrophoresis/immunofixation could be reduced by 74%. The diagnostic reference interval can be determined best in a group of patients for whom Bence Jones analysis is indicated. For calculation of this reference range, the eGFR value does not need to be taken into account. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. The Line Islands revisited: New 40Ar/39Ar geochronologic evidence for episodes of volcanism due to lithospheric extension

    NASA Astrophysics Data System (ADS)

    Davis, A. S.; Gray, L. B.; Clague, D. A.; Hein, J. R.

    2002-03-01

    New 40Ar/39Ar ages of mineral separates and whole rock samples from nine volcanic edifices in the northern Line Islands region, between latitudes 20°N and 6°N, are incompatible with single or multiple hot spot models. Instead, two major episodes of volcanism, each lasting ~5 Ma and separated by ~8 Ma, occurred synchronously over long distances, not just along the main chain but also at nonaligned edifices. Volcanism during the older episode (81-86 Ma) extended over a distance of at least 1200 km along the eastern part of the complex seamount chain. Volcanism during the younger episode (68-73 Ma) was concentrated in the western part of the chain and may have extended over a distance of >4000 km. Chemical analyses of 68 samples represent a compositionally diverse suite, including tholeiitic, transitional, and alkalic basalt, strongly alkalic basanite and nephelinite, and alkalic differentiates ranging from hawaiite to trachyte. The most diverse assemblage of rocks was recovered from a cross-trending seamount chain south of Johnston Atoll. Although compositions of rocks from the two volcanic episodes overlap, compositions from the younger episode generally are more alkalic and include a larger proportion of highly differentiated compositions. None of the samples from the older episode, but many from the younger one, contain hydrous mineral phases such as amphibole and biotite. Extensive coeval volcanism along major segments of the chain is compatible with decompressional melting of heterogeneous mantle due to diffuse lithospheric extension along pre-existing zones of weakness. Episodes of volcanism are probably related to broad upwarping of the Superswell region in the eastern South Pacific, where these lavas originated.

  15. Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.

    PubMed

    Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T

    1997-09-01

    In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.

  16. Physico-chemical characteristics of burfi prepared by using medium chain triglyceride rich margarines.

    PubMed

    Tiwari, Shipra; Chetana, Ramakrishna; Puttaraju, Shashikala; Khatoon, Sakina

    2014-01-01

    Medium chain triglyceride rich margarines were prepared using palm, coconut oil blends in the ratio of 80:20 (Margarine 1) and 60:40 (Margarine 2). The margarines were used to prepare burfi and compared with products prepared using commercial margarine, ghee and butter. The physicochemical characteristics such as texture, color, free fatty acid, peroxide value, saponification value, unsaponifiable matter and fatty acid composition of oils, fats and margarines were carried out. Results showed that 11.0 and 21.9% of medium chain triglycerides were present in margarine 1 and 2 respectively. The texture, colour, moisture content, peroxide value and sensory evaluation were carried out for the burfi samples. Laboratory prepared margarines improved the textural quality of burfi compared to commercial margarine, ghee and butter. The sensory analyses of the burfi samples revealed that burfi prepared from margarine 1 was more acceptable compared to commercial margarine.

  17. The relationship among the resiliency practices in supply chain, financial performance, and competitive advantage in manufacturing firms in Indonesia and Sierra Leone

    NASA Astrophysics Data System (ADS)

    Musa, I.; Nyoman Pujawan, I.

    2018-04-01

    Current supply chain management (SCM) has become a potentially treasured way of safeguarding competitive advantage and improving organizational performance since competition is no longer between organizations, but among supply chains. This research conceptualizes and develops four resiliency practices (Flexibility, Redundancy, Collaboration and Agility) and tests the relationships between organizations’ financial performance and competitive advantage in manufacturing firms. The study involves manufacturing firms in Indonesia and Sierra Leone. The study used stratified random sampling to pick a sample size of 95 manufacturing firms, which represented different industrial sectors. The respondents were mainly managers of different manufacturing companies. The relationships proposed in the conceptual framework were tested using correlation analysis. The results indicate that higher levels of resilience practices in manufacturing firms can lead to enhanced competitive advantage and improved financial performance.

  18. Detection of putative oral pathogens in acute periradicular abscesses by 16S rDNA-directed polymerase chain reaction.

    PubMed

    Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

    2001-03-01

    A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods, Treponema denticola, and Actinobacillus actinomycetemcomitans in acute periradicular abscesses. Pus was collected by aspiration from 10 cases diagnosed as acute abscesses of endodontic origin. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detecting black-pigmented anaerobes in 80% of the examined abscesses. Porphyromonas endodontalis was found in 70%, T. denticola in 50%, Porphyromonas gingivalis in 40%, and Prevotella intermedia in 10% of the cases. P. gingivalis was always found associated with P. endodontalis. Prevotella nigrescens and A. actinomycetemcomitans were not found in any pus sample. The high prevalence of P. endodontalis, T. denticola, and P. gingivalis suggests that they can play an important role in the etiology of acute periradicular abscesses.

  19. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  20. Comparison of the One- and Bi-Direction Chained Equipercentile Equating

    ERIC Educational Resources Information Center

    Oh, Hyeonjoo; Moses, Tim

    2012-01-01

    This study investigated differences between two approaches to chained equipercentile (CE) equating (one- and bi-direction CE equating) in nearly equal groups and relatively unequal groups. In one-direction CE equating, the new form is linked to the anchor in one sample of examinees and the anchor is linked to the reference form in the other…

  1. Early Understandings of Simple Food Chains: A Learning Progression for the Preschool Years

    ERIC Educational Resources Information Center

    Allen, Michael

    2017-01-01

    Aspects of preschoolers' ecological understandings were explored in a cross-age, quantitative study that utilised a sample of seventy-five 3- to 5-year-old children. Specifically, their concepts of feeding relationships were determined by presenting physical models of three-step food chains during structured interviews. A majority of children,…

  2. Modeling Radioactive Decay Chains with Branching Fraction Uncertainties

    DTIC Science & Technology

    2013-03-01

    moments methods with transmutation matrices. Uncertainty from both half-lives and branching fractions is carried through these calculations by Monte...moment methods, method for sampling from normal distributions for half- life uncertainty, and use of transmutation matrices were leveraged. This...distributions for half-life and branching fraction uncertainties, building decay chains and generating the transmutation matrix (T-matrix

  3. Recovery of Graded Response Model Parameters: A Comparison of Marginal Maximum Likelihood and Markov Chain Monte Carlo Estimation

    ERIC Educational Resources Information Center

    Kieftenbeld, Vincent; Natesan, Prathiba

    2012-01-01

    Markov chain Monte Carlo (MCMC) methods enable a fully Bayesian approach to parameter estimation of item response models. In this simulation study, the authors compared the recovery of graded response model parameters using marginal maximum likelihood (MML) and Gibbs sampling (MCMC) under various latent trait distributions, test lengths, and…

  4. Information Entropy Production of Maximum Entropy Markov Chains from Spike Trains

    NASA Astrophysics Data System (ADS)

    Cofré, Rodrigo; Maldonado, Cesar

    2018-01-01

    We consider the maximum entropy Markov chain inference approach to characterize the collective statistics of neuronal spike trains, focusing on the statistical properties of the inferred model. We review large deviations techniques useful in this context to describe properties of accuracy and convergence in terms of sampling size. We use these results to study the statistical fluctuation of correlations, distinguishability and irreversibility of maximum entropy Markov chains. We illustrate these applications using simple examples where the large deviation rate function is explicitly obtained for maximum entropy models of relevance in this field.

  5. n-Alkane adsorption to polar silica surfaces.

    PubMed

    Brindza, Michael R; Ding, Feng; Fourkas, John T; Walker, Robert A

    2010-03-21

    The structures of medium-length n-alkane species (C(8)-C(11)) adsorbed to a hydrophilic silica/vapor interface were examined using vibrational sum frequency spectroscopy. Experiments sampling out-of-plane orientation show a clear pattern in vibrational band intensities that implies chains having primarily all-trans conformations lying flat along the interface. Further analysis shows that the methylene groups of the alkane chains have their local symmetry axes directed into and away from the surface. Spectra acquired under different polarization conditions interlock to reinforce this picture of interfacial structure and organization. Variation in signal intensities with chain length suggests that correlation between adsorbed monomers weakens with increasing chain length. This result stands in contrast with alkane behavior at neat liquid/vapor interfaces where longer length alkanes show considerably more surface induced ordering than short chain alkanes.

  6. Metastates in Mean-Field Models with Random External Fields Generated by Markov Chains

    NASA Astrophysics Data System (ADS)

    Formentin, M.; Külske, C.; Reichenbachs, A.

    2012-01-01

    We extend the construction by Külske and Iacobelli of metastates in finite-state mean-field models in independent disorder to situations where the local disorder terms are a sample of an external ergodic Markov chain in equilibrium. We show that for non-degenerate Markov chains, the structure of the theorems is analogous to the case of i.i.d. variables when the limiting weights in the metastate are expressed with the aid of a CLT for the occupation time measure of the chain. As a new phenomenon we also show in a Potts example that for a degenerate non-reversible chain this CLT approximation is not enough, and that the metastate can have less symmetry than the symmetry of the interaction and a Gaussian approximation of disorder fluctuations would suggest.

  7. Pilot study of the utility and acceptability of tampon sampling for the diagnosis of Neisseria gonorrhoeae and Chlamydia trachomatis infections by duplex realtime polymerase chain reaction in United Kingdom sex workers.

    PubMed

    Kimmitt, P T; Tabrizi, S N; Crosatti, M; Garland, S M; Schober, P C; Rajakumar, K; Chapman, C A

    2010-04-01

    We aimed to evaluate the acceptability of self-collected tampon samples for the screening of female sex workers for sexually transmitted infections. We recruited 65 sex workers, and 63 agreed to provide tampon samples. The tampon samples were processed by realtime polymerase chain reaction (PCR) targeting Neisseria gonorrhoeae and Chlamydia trachomatis. Urethral and endocervical swabs were also obtained from 61 of 63 participants and tested using culture (N. gonorrhoeae) and the BD ProbeTec strand displacement amplification (SDA) (C. trachomatis) assay. Tampon sampling was preferred by 95% of the women and all favoured being tested away from genitourinary medicine clinics; the most common reasons cited were avoidance of embarrassment (40%) and convenience (30%). Besides near-universal acceptability of tampon sampling, the tampon sampling-PCR approach described in this study appeared to have enhanced sensitivity compared with conventional testing, suggesting the possibility of a residual hidden burden of N. gonorrhoeae and/or C. trachomatis genital infections in UK female sex workers.

  8. Five years' experience of classical swine fever polymerase chain reaction ring trials in France.

    PubMed

    Po, F; Le Dimna, M; Le Potier, M F

    2011-12-01

    Since 2004, the French National Reference Laboratory for classical swine fever (CSF) has conducted an annual proficiency test (PT) to evaluate the ability of local veterinary laboratories to perform real-time polymerase chain reaction (PCR) for CSF virus. The results of five years of testing (2004-2008) are described here. The PT was conducted under blind conditions on 20 samples. The same batch of samples was used for all five years. The number of laboratories that analysed the samples increased from four in 2004 to 13 in 2008. The results of the PT showed the following: cross-contamination between samples and deficiencies in RNA preparation can occur even in experienced laboratories; sample homogeneity should be checked carefully before selection; samples stored at-80 degrees C for several years remain stable; and poor shipment conditions do not damage the samples with regard to detection of CSF virus genome. These results will enable redesign of the panel to improve the overall quality of the PT, which will encourage laboratories to check and improve their PCR procedures and expertise. This is an excellent way to determine laboratory performance.

  9. An Efficient MCMC Algorithm to Sample Binary Matrices with Fixed Marginals

    ERIC Educational Resources Information Center

    Verhelst, Norman D.

    2008-01-01

    Uniform sampling of binary matrices with fixed margins is known as a difficult problem. Two classes of algorithms to sample from a distribution not too different from the uniform are studied in the literature: importance sampling and Markov chain Monte Carlo (MCMC). Existing MCMC algorithms converge slowly, require a long burn-in period and yield…

  10. Respondent-Driven Sampling with Hard-to-Reach Emerging Adults: An Introduction and Case Study with Rural African Americans

    ERIC Educational Resources Information Center

    Kogan, Steven M.; Wejnert, Cyprian; Chen, Yi-fu; Brody, Gene H.; Slater, LaTrina M.

    2011-01-01

    Obtaining representative samples from populations of emerging adults who do not attend college is challenging for researchers. This article introduces respondent-driven sampling (RDS), a method for obtaining representative samples of hard-to-reach but socially interconnected populations. RDS combines a prescribed method for chain referral with a…

  11. The parallel reaction monitoring method contributes to a highly sensitive polyubiquitin chain quantification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsuchiya, Hikaru; Tanaka, Keiji, E-mail: tanaka-kj@igakuken.or.jp; Saeki, Yasushi, E-mail: saeki-ys@igakuken.or.jp

    2013-06-28

    Highlights: •The parallel reaction monitoring method was applied to ubiquitin quantification. •The ubiquitin PRM method is highly sensitive even in biological samples. •Using the method, we revealed that Ufd4 assembles the K29-linked ubiquitin chain. -- Abstract: Ubiquitylation is an essential posttranslational protein modification that is implicated in a diverse array of cellular functions. Although cells contain eight structurally distinct types of polyubiquitin chains, detailed function of several chain types including K29-linked chains has remained largely unclear. Current mass spectrometry (MS)-based quantification methods are highly inefficient for low abundant atypical chains, such as K29- and M1-linked chains, in complex mixtures thatmore » typically contain highly abundant proteins. In this study, we applied parallel reaction monitoring (PRM), a quantitative, high-resolution MS method, to quantify ubiquitin chains. The ubiquitin PRM method allows us to quantify 100 attomole amounts of all possible ubiquitin chains in cell extracts. Furthermore, we quantified ubiquitylation levels of ubiquitin-proline-β-galactosidase (Ub-P-βgal), a historically known model substrate of the ubiquitin fusion degradation (UFD) pathway. In wild-type cells, Ub-P-βgal is modified with ubiquitin chains consisting of 21% K29- and 78% K48-linked chains. In contrast, K29-linked chains are not detected in UFD4 knockout cells, suggesting that Ufd4 assembles the K29-linked ubiquitin chain(s) on Ub-P-βgal in vivo. Thus, the ubiquitin PRM is a novel, useful, quantitative method for analyzing the highly complicated ubiquitin system.« less

  12. Sixteen-week analysis of unaltered elastomeric chain relating in-vitro force degradation with in-vivo extraction space tooth movement.

    PubMed

    Evans, Kristin S; Wood, Cory M; Moffitt, Allen H; Colgan, John A; Holman, J Kevin; Marshall, Steven D; Pope, D Spencer; Sample, Lew B; Sherman, Stephen L; Sinclair, Peter M; Trulove, Tim S

    2017-04-01

    The purposes of this study were to evaluate whether unaltered elastomeric chain can continue to move teeth for 16 weeks and to relate it to the amount of force remaining for the same batch of elastomeric chains. The in-vivo portion of the study had a sample of 30 paired extraction space sites from 22 subjects who were measured for closure of the space every 28 days. The altered side elastomeric chain served as the control and was replaced at 28-day intervals whereas the experimental side remained unaltered. In the in-vitro portion of the study, 100 each of 2-unit and 3-unit segments of the same batch of elastomeric chains were placed in a water bath, and the force was measured for 20 of each segment length at the 28-day measurement points. Statistically significant amounts of space closure occurred at both the altered and unaltered sites at all measurement time points. The mean space closure at the altered sites was minimally greater than that observed at the paired unaltered sites. The mean differences of space closure between the altered and unaltered sites ranged from a minimum of -0.05 mm at 4 weeks to a maximum of -0.14 mm at 8 weeks. The elastomeric chain force degraded rapidly by 4 weeks but continued a gradual diminution of force to 86 g at 16 weeks. Unaltered elastomeric chain continued to move teeth into extraction spaces for 16 weeks in this sample from both statistically and clinically significant standpoints. There were minimal and statistically insignificant differences in the mean space closure measurements between the paired altered and unaltered sites. The elastomeric chain force at 16 weeks was less than 100 g, yet at the same time point, teeth continued to move clinically. Copyright © 2016 American Association of Orthodontists. Published by Elsevier Inc. All rights reserved.

  13. Per- and polyfluoroalkyl substances and fluorinated alternatives in urine and serum by on-line solid phase extraction-liquid chromatography-tandem mass spectrometry.

    PubMed

    Kato, Kayoko; Kalathil, Akil A; Patel, Ayesha M; Ye, Xiaoyun; Calafat, Antonia M

    2018-06-14

    Per- and polyfluoroalkyl substances (PFAS), man-made chemicals with variable length carbon chains containing the perfluoroalkyl moiety (C n F 2n+1 -), are used in many commercial applications. Since 1999-2000, several long-chain PFAS, including perfluorooctane sulfonate (PFOS) and perfluorooctanoate (PFOA), have been detected at trace levels in the blood of most participants of the National Health and Nutrition Examination Survey (NHANES)-representative samples of the U.S. general population-while short-chain PFAS have not. Lower detection frequencies and concentration ranges may reflect lower exposure to short-chain PFAS than to PFOS or PFOA or that, in humans, short-chain PFAS efficiently eliminate in urine. We developed on-line solid phase extraction-HPLC-isotope dilution-MS/MS methods for the quantification in 50 μL of urine or serum of 15 C 3 -C 11 PFAS (C 3 only in urine), and three fluorinated alternatives used as PFOA or PFOS replacements: GenX (ammonium salt of 2,3,3,3,-tetrafluoro-2-(1,1,2,2,3,3,3-heptafluoropropoxy)-propanoate, also known as HFPO-DA), ADONA (ammonium salt of 4,8-dioxa-3H-perfluorononanoate), and 9Cl-PF3ONS (9-chlorohexadecafluoro-3-oxanonane-1-sulfonate), main component of F53-B. Limit of detection for all analytes was 0.1 ng/mL. To validate the method, we analyzed 50 commercial urine/serum paired samples collected in 2016 from U.S. volunteers with no known exposure to the chemicals. In serum, detection frequency and concentration patterns agreed well with those from NHANES. By contrast, except for perfluorobutanoate, we did not detect long-chain or short-chain PFAS in urine. Also, we did not detect fluorinated alternatives in either urine or serum. Together, these results suggest limited exposure to both short-chain PFAS and select fluorinated alternatives in this convenience population. Copyright © 2018. Published by Elsevier Ltd.

  14. Asbestiform minerals in ophiolitic rocks of Calabria (southern Italy).

    PubMed

    Campopiano, Antonella; Olori, Angelo; Spadafora, Alessandra; Rosaria Bruno, Maria; Angelosanto, Federica; Iannò, Antonino; Casciardi, Stefano; Giardino, Renato; Conte, Maurizio; Oranges, Teresa; Iavicoli, Sergio

    2018-03-22

    Ophiolitic rocks cropping on Calabria territory, southern Italy, can hold asbestiform minerals potentially harmful for human health. The aim of this work was to detect the fibrous phases of ophiolites along the Coastal Chain of northern Calabria and southern part of the Sila massif. Above 220 massive samples were collected in the study areas and analyzed using optical and electron microscopy, X-ray diffractometry, and Fourier transform infra-red spectrometry. The main fibrous constituent belonged to tremolite-actinolite series followed by fibrous antigorite that becomes more abundant in the samples collected in Reventino Mount surroundings. Results highlighted that serpentinites samples mainly consisted of antigorite and minor chrysotile. Samples collected along the coastal chain of northern Calabria did not hold fibrous materials. The results will be useful for Italian natural occurrences of asbestos (NOA) mapping in order to avoid an unintentional exposition by human activity or weathering processes.

  15. Separation and screening of short-chain chlorinated paraffins in environmental samples using comprehensive two-dimensional gas chromatography with micro electron capture detection.

    PubMed

    Xia, Dan; Gao, Lirong; Zhu, Shuai; Zheng, Minghui

    2014-11-01

    Short-chain chlorinated paraffins (SCCPs) are highly complex technical mixtures with thousands of isomers and numerous homologs. They are classified as priority candidate persistent organic pollutants under the Stockholm Convention for their persistence, bioaccumulation, and toxicity. Analyzing SCCPs is challenging because of the complexity of the mixtures. Chromatograms of SCCPs acquired using one-dimensional (1D) gas chromatography (GC) contain a large characteristic "peak" with a broad and unresolved profile. Comprehensive two-dimensional GC (GC×GC) shows excellent potential for separating complex mixtures. In this study, GC×GC coupled with micro electron capture detection (μECD) was used to separate and screen SCCPs. The chromatographic parameters, including the GC column types, oven temperature program, and modulation period, were systematically optimized. The SCCP congeners were separated into groups using a DM-1 column connected to a BPX-50 column. The SCCP congeners in technical mixtures were separated according to the number of chlorine substituents for a given carbon chain length and according to the number of carbon atoms plus chlorine atoms for different carbon chain lengths. A fish tissue sample was analyzed to illustrate the feasibility of the GC×GC-μECD method in analyzing biological samples. Over 1,500 compounds were identified in the fish extract, significantly more than were identified using 1D GC. The detection limits for five selected SCCP congeners were between 1 and 5 pg/L using the GC×GC method, and these were significantly lower than those achieved using 1D GC. This method is a good choice for analysis of SCCPs in environmental samples, exhibiting good separation and good sensitivity.

  16. Enumeration of Ring–Chain Tautomers Based on SMIRKS Rules

    PubMed Central

    2015-01-01

    A compound exhibits (prototropic) tautomerism if it can be represented by two or more structures that are related by a formal intramolecular movement of a hydrogen atom from one heavy atom position to another. When the movement of the proton is accompanied by the opening or closing of a ring it is called ring–chain tautomerism. This type of tautomerism is well observed in carbohydrates, but it also occurs in other molecules such as warfarin. In this work, we present an approach that allows for the generation of all ring–chain tautomers of a given chemical structure. Based on Baldwin’s Rules estimating the likelihood of ring closure reactions to occur, we have defined a set of transform rules covering the majority of ring–chain tautomerism cases. The rules automatically detect substructures in a given compound that can undergo a ring–chain tautomeric transformation. Each transformation is encoded in SMIRKS line notation. All work was implemented in the chemoinformatics toolkit CACTVS. We report on the application of our ring–chain tautomerism rules to a large database of commercially available screening samples in order to identify ring–chain tautomers. PMID:25158156

  17. Sampled-data chain-observer design for a class of delayed nonlinear systems

    NASA Astrophysics Data System (ADS)

    Kahelras, M.; Ahmed-Ali, T.; Giri, F.; Lamnabhi-Lagarrigue, F.

    2018-05-01

    The problem of observer design is addressed for a class of triangular nonlinear systems with not-necessarily small delay and sampled output measurements. One more difficulty is that the system state matrix is dependent on the un-delayed output signal which is not accessible to measurement, making existing observers inapplicable. A new chain observer, composed of m elementary observers in series, is designed to compensate for output sampling and arbitrary large delays. The larger the time-delay the larger the number m. Each elementary observer includes an output predictor that is conceived to compensate for the effects of output sampling and a fractional delay. The predictors are defined by first-order ordinary differential equations (ODEs) much simpler than those of existing predictors which involve both output and state predictors. Using a small gain type analysis, sufficient conditions for the observer to be exponentially convergent are established in terms of the minimal number m of elementary observers and the maximum sampling interval.

  18. Multiplex polymerase chain reaction detection of black-pigmented bacteria in infections of endodontic origin.

    PubMed

    Seol, Jung-Hwan; Cho, Byung-Hoon; Chung, Chong-Pyoung; Bae, Kwang-Shik

    2006-02-01

    The purpose of this study was to detect the presence of Porphyromonas endodontalis, P. gingivalis, Prevotella intermedia, P. nigrescens, and P. tannerae from clinical samples using multiplex polymerase chain reactions (PCR). Two different multiplex PCR protocols were used (one for the two Porphyromonas species and the other for the three Prevotella species), each one using a primer pair specific for each target species. The results were compared to those of the conventional culture procedures. Microbial samples were taken aseptically from 40 infected root canals and abscesses from patients. Samples were cultured in an anaerobic condition for conventional identification using a Rapid ID 32 A kit. Multiplex PCR was processed using the DNA extracted from each sample. At least one of the five species of black-pigmented bacteria (BPB) were detected in 65% (26 of 40) of the samples using multiplex PCR, and in 15% (6 of 40) using the conventional culture procedures. Multiplex PCR was more rapid, sensitive, specific, and effective in detecting BPB than the conventional culture procedures.

  19. Hepatitis E Virus in Pork Production Chain in Czech Republic, Italy, and Spain, 2010

    PubMed Central

    Di Bartolo, Ilaria; Diez-Valcarce, Marta; Vasickova, Petra; Kralik, Petr; Hernandez, Marta; Angeloni, Giorgia; Ostanello, Fabio; Bouwknegt, Martijn; Rodríguez-Lázaro, David; Pavlik, Ivo

    2012-01-01

    We evaluated the prevalence of hepatitis E virus (HEV) in the pork production chain in Czech Republic, Italy, and Spain during 2010. A total of 337 fecal, liver, and meat samples from animals at slaughterhouses were tested for HEV by real-time quantitative PCR. Overall, HEV was higher in Italy (53%) and Spain (39%) than in Czech Republic (7.5%). HEV was detected most frequently in feces in Italy (41%) and Spain (39%) and in liver (5%) and meat (2.5%) in Czech Republic. Of 313 sausages sampled at processing and point of sale, HEV was detected only in Spain (6%). HEV sequencing confirmed only g3 HEV strains. Indicator virus (porcine adenovirus) was ubiquitous in fecal samples and absent in liver samples and was detected in 1 slaughterhouse meat sample. At point of sale, we found porcine adenovirus in sausages (1%–2%). The possible dissemination of HEV and other fecal viruses through pork production demands containment measures. PMID:22840221

  20. Actinomyces israelii in radicular cysts: a molecular study.

    PubMed

    Gomes, Nathália Rodrigues; Diniz, Marina Gonçalves; Pereira, Thais Dos Santos Fontes; Estrela, Carlos; de Macedo Farias, Luiz; de Andrade, Bruno Augusto Benevenuto; Gomes, Carolina Cavaliéri; Gomez, Ricardo Santiago

    2017-05-01

    To investigate whether the microscopic filamentous aggregates observed in radicular cysts are associated with the molecular identification of Actinomyces israelii. Moreover, to verify whether this bacterium can be detected in radicular cyst specimens not presenting aggregates. Microscopic colonies suggestive of Actinomyces were found in 8 out of 279 radicular cyst samples (case group). The case and control groups (n = 12; samples without filamentous colonies) were submitted to the semi-nested polymerase chain reaction to test the presence of A israelii. DNA sequencing was performed to validate polymerase chain reaction results. Two and 3 samples in the case and control groups, respectively, did not present a functional genomic DNA template and were excluded from the study. A israelii was identified in all samples of the case group and in 3 out of 9 samples of the control group. Although A israelii is more commonly identified in radicular cysts presenting filamentous aggregates, it also appears to be detected in radicular cysts without this microscopic finding. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Determination of nonylphenol and short-chained nonylphenol ethoxylates in drain water from an agricultural area.

    PubMed

    Zgoła-Grześkowiak, Agnieszka; Grześkowiak, Tomasz; Rydlichowski, Robert; Łukaszewski, Zenon

    2009-04-01

    Water samples from agricultural drains were tested for the presence of nonylphenol and nonylphenol mono- and diethoxylates. The analytes belong to biodegradation products of long-chained nonylphenol ethoxylates, which are used as additives in pesticide formulations. Quantification of these analytes was performed by HPLC with fluorescence detection after isolation by using multi-capillary polytetrafluoroethylene (PTFE) trap extraction. This newly developed technique allowed obtaining about 90% recovery of these analytes in synthetic samples and several percent lower recovery in real samples. Also, no additional sample cleaning was needed before chromatographic analysis. The limit of quantitation for all the analytes was 0.1 microg L(-1). The nonylphenol, nonylphenol mono- and diethoxylates were detected at the concentrations ranging from 0.5 to 6.0 microg L(-1), from 0.2 to 0.7 microg L(-1) and from below 0.02 to 0.4 microg L(-1), respectively. Concentrations of nonylphenol and its derivatives were higher in samples taken in spring than in summer.

  2. Alkyl chain interaction at the surface of room temperature ionic liquids: systematic variation of alkyl chain length (R = C(1)-C(4), C(8)) in both cation and anion of [RMIM][R-OSO(3)] by sum frequency generation and surface tension.

    PubMed

    Santos, Cherry S; Baldelli, Steven

    2009-01-29

    The gas-liquid interface of halide-free 1,3-dialkylimidazolium alkyl sulfates [RMIM][R-OSO(3)] with R chain length from C(1)-C(4) and C(8) has been studied systematically using the surface-specific sum frequency generation (SFG) vibrational spectroscopy and surface tension measurements. From the SFG spectra, vibrational modes from the methyl group of both cation and anion are observed for all ionic liquid samples considered in the present study. These results suggest the presence of both ions at the gas-liquid interface, which is further supported by surface tension measurements. Surface tension data show a decreasing trend as the alkyl chain in the imidazolium cation is varied from methyl to butyl chain, with a specific anion. A similar trend is observed when the alkyl chain of the anion is modified and the cation is fixed.

  3. Phenotyping polyclonal kappa and lambda light chain molecular mass distributions in patient serum using mass spectrometry.

    PubMed

    Barnidge, David R; Dasari, Surendra; Ramirez-Alvarado, Marina; Fontan, Adrian; Willrich, Maria A V; Tschumper, Renee C; Jelinek, Diane F; Snyder, Melissa R; Dispenzieri, Angela; Katzmann, Jerry A; Murray, David L

    2014-11-07

    We previously described a microLC-ESI-Q-TOF MS method for identifying monoclonal immunoglobulins in serum and then tracking them over time using their accurate molecular mass. Here we demonstrate how the same methodology can be used to identify and characterize polyclonal immunoglobulins in serum. We establish that two molecular mass distributions observed by microLC-ESI-Q-TOF MS are from polyclonal kappa and lambda light chains using a combination of theoretical molecular masses from gene sequence data and the analysis of commercially available purified polyclonal IgG kappa and IgG lambda from normal human serum. A linear regression comparison of kappa/lambda ratios for 74 serum samples (25 hypergammaglobulinemia, 24 hypogammaglobulinemia, 25 normal) determined by microflowLC-ESI-Q-TOF MS and immunonephelometry had a slope of 1.37 and a correlation coefficient of 0.639. In addition to providing kappa/lambda ratios, the same microLC-ESI-Q-TOF MS analysis can determine the molecular mass for oligoclonal light chains observed above the polyclonal background in patient samples. In 2 patients with immune disorders and hypergammaglobulinemia, we observed a skewed polyclonal molecular mass distribution which translated into biased kappa/lambda ratios. Mass spectrometry provides a rapid and simple way to combine the polyclonal kappa/lambda light chain abundance ratios with the identification of dominant monoclonal as well as oligoclonal light chain immunoglobulins. We anticipate that this approach to evaluating immunoglobulin light chains will lead to improved understanding of immune deficiencies, autoimmune diseases, and antibody responses.

  4. Detection of the value of consecutive serum total light chain (sTLC) in patients diagnosed with diffuse large B cell lymphoma.

    PubMed

    Zhai, Linzhu; Zhao, Yuanyuan; Peng, Songguo; Zhu, Ke; Yu, Rongjian; Chen, Hailong; Lin, Tongyu; Lin, Lizhu

    2016-12-01

    There are limited data on serum total light chain (sTLC) in lymphoma and its relative role on the outcome of diffuse large B cell lymphoma (DLBCL) patients. Blood samples from 46 cases newly diagnosed with DLBCL were collected consecutively during chemotherapy to detect sTLC, IgG, IgA, and IgM levels. Clinical data and survival outcomes were analyzed according to the results of sTLC measurements. In summary, 22 patients (47.8 %) had abnormal k or λ light chain, respectively, and 6 patients (13.0 %) had both abnormal k and λ light chains before chemotherapy. Patients with elevated k light chain more frequently displayed multiple extra-nodal organ involvement (P = 0.01) and had an inferior overall survival (OS) (P = 0.041) and progression-free survival (PFS) (P = 0.044) compared to patients with normal level of k light chain. Furthermore, patients with elevated level of both k and λ also exhibited significant association with shorter OS (P = 0.002) and PFS (P = 0.009). Both elevated k alone and concurrent elevated k and λ had independent adverse effects on PFS (P = 0.031 and P = 0.019, respectively). sTLC level was reduced gradually by treatment in this study and reached the lowest point after the fourth cycle of chemotherapy, which was consistent with the disease behavior during chemotherapy. Considering the small sample size of this study, these results should be confirmed in a larger prospective study.

  5. Joint modelling rationale for chained equations

    PubMed Central

    2014-01-01

    Background Chained equations imputation is widely used in medical research. It uses a set of conditional models, so is more flexible than joint modelling imputation for the imputation of different types of variables (e.g. binary, ordinal or unordered categorical). However, chained equations imputation does not correspond to drawing from a joint distribution when the conditional models are incompatible. Concurrently with our work, other authors have shown the equivalence of the two imputation methods in finite samples. Methods Taking a different approach, we prove, in finite samples, sufficient conditions for chained equations and joint modelling to yield imputations from the same predictive distribution. Further, we apply this proof in four specific cases and conduct a simulation study which explores the consequences when the conditional models are compatible but the conditions otherwise are not satisfied. Results We provide an additional “non-informative margins” condition which, together with compatibility, is sufficient. We show that the non-informative margins condition is not satisfied, despite compatible conditional models, in a situation as simple as two continuous variables and one binary variable. Our simulation study demonstrates that as a consequence of this violation order effects can occur; that is, systematic differences depending upon the ordering of the variables in the chained equations algorithm. However, the order effects appear to be small, especially when associations between variables are weak. Conclusions Since chained equations is typically used in medical research for datasets with different types of variables, researchers must be aware that order effects are likely to be ubiquitous, but our results suggest they may be small enough to be negligible. PMID:24559129

  6. A strategy for co-translational folding studies of ribosome-bound nascent chain complexes using NMR spectroscopy.

    PubMed

    Cassaignau, Anaïs M E; Launay, Hélène M M; Karyadi, Maria-Evangelia; Wang, Xiaolin; Waudby, Christopher A; Deckert, Annika; Robertson, Amy L; Christodoulou, John; Cabrita, Lisa D

    2016-08-01

    During biosynthesis on the ribosome, an elongating nascent polypeptide chain can begin to fold, in a process that is central to all living systems. Detailed structural studies of co-translational protein folding are now beginning to emerge; such studies were previously limited, at least in part, by the inherently dynamic nature of emerging nascent chains, which precluded most structural techniques. NMR spectroscopy is able to provide atomic-resolution information for ribosome-nascent chain complexes (RNCs), but it requires large quantities (≥10 mg) of homogeneous, isotopically labeled RNCs. Further challenges include limited sample working concentration and stability of the RNC sample (which contribute to weak NMR signals) and resonance broadening caused by attachment to the large (2.4-MDa) ribosomal complex. Here, we present a strategy to generate isotopically labeled RNCs in Escherichia coli that are suitable for NMR studies. Uniform translational arrest of the nascent chains is achieved using a stalling motif, and isotopically labeled RNCs are produced at high yield using high-cell-density E. coli growth conditions. Homogeneous RNCs are isolated by combining metal affinity chromatography (to isolate ribosome-bound species) with sucrose density centrifugation (to recover intact 70S monosomes). Sensitivity-optimized NMR spectroscopy is then applied to the RNCs, combined with a suite of parallel NMR and biochemical analyses to cross-validate their integrity, including RNC-optimized NMR diffusion measurements to report on ribosome attachment in situ. Comparative NMR studies of RNCs with the analogous isolated proteins permit a high-resolution description of the structure and dynamics of a nascent chain during its progressive biosynthesis on the ribosome.

  7. Measurement of chain tilt angle in fully hydrated bilayers of gel phase lecithins.

    PubMed Central

    Tristram-Nagle, S; Zhang, R; Suter, R M; Worthington, C R; Sun, W J; Nagle, J F

    1993-01-01

    The tilt angle theta tilt of the hydrocarbon chains has been determined for fully hydrated gel phase of a series of saturated lecithins. Oriented samples were prepared on glass substrates and hydrated with supersaturated water vapor. Evidence for full hydration was the same intensity pattern of the low angle lamellar peaks and the same lamellar repeat D as unoriented multilamellar vesicles. Tilting the sample permitted observation of all the wide angle arcs necessary to verify the theoretical diffraction pattern corresponding to tilting of the chains towards nearest neighbors. The length of the scattering unit corresponds to two hydrocarbon chains, requiring each bilayer to scatter coherently rather than each monolayer. For DPPC, theta tilt was determined to be 32.0 +/- 0.5 degrees at 19 degrees C, slightly larger than previous direct determinations and considerably smaller than the value required by recent gravimetric measurements. This new value allows more accurate determinations of a variety of structural parameters, such as area per lipid molecule, A = 47.2 +/- 0.5 A2, and number of water molecules of hydration, nw = 11.8 +/- 0.7. As the chain length n of the lipids was increased from 16 to 20 carbons, the parameters A and nw remained constant, suggesting that the headgroup packing is at its excluded volume limit for this range. However, theta tilt increased by 3 degrees and the chain area Ac decreased by 0.5 A2. This behavior is explained in terms of a competition between a bulk free energy term and a finite or end effect term. Images FIGURE 6 FIGURE 7 PMID:8494973

  8. The effect of polymer architecture on the interdiffusion in thin polymer films

    NASA Astrophysics Data System (ADS)

    Caglayan, Ayse; Yuan, Guangcui; Satija, Sushil K.; Uhrig, David; Hong, Kunlun; Akgun, Bulent

    Branched polymer chains have been traditionally used in industrial applications as additives. Recently they have found applications in electrochromic displays, lithography, biomedical coatings and targeting multidrug resistant bacteria. In some of these applications where they are confined in thin layers, it is important to understand the relation between the mobility and polymer chain architecture to optimize the processing conditions. Earlier interdiffusion measurements on linear and cyclic polymer chains demonstrated the key role of chain architecture on mobility. We have determined the vertical diffusion coefficients of the star polystyrene chains in thin films as a function of number of polymer arms, molecular weight per arm, and film thickness using neutron reflectivity (NR) and compare our results with linear chains of identical total molecular weight. Bilayer samples of 4-arm and 8-arm protonated polystyrenes (hPS) and deuterated polystyrenes (dPS) were used to elucidate the effect of polymer chain architecture on polymer diffusion. NR measurements indicate that the mobility of polymer chains in thin films get faster as the number of polymer arms increases and the arm molecular weight decreases. Both star polymers showed faster interdiffusion compared to their linear analog. Diffusion coefficient of branched PS chains has a weak dependence on the film thickness.

  9. Short- and medium-chain chlorinated paraffins in air and soil of subtropical terrestrial environment in the pearl river delta, South China: distribution, composition, atmospheric deposition fluxes, and environmental fate.

    PubMed

    Wang, Yan; Li, Jun; Cheng, Zhineng; Li, Qilu; Pan, Xiaohui; Zhang, Ruijie; Liu, Di; Luo, Chunling; Liu, Xiang; Katsoyiannis, Athanasios; Zhang, Gan

    2013-03-19

    Research on the environmental fate of short- and medium-chain chlorinated paraffins (SCCPs and MCCPs) in highly industrialized subtropical areas is still scarce. Air, soil, and atmospheric deposition process in the Pearl River Delta of South China were investigated, and the average SCCP and MCCP concentrations were 5.2 μg/sampler (17.69 ng/m(3)) and 4.1 μg/sampler for passive air samples, 18.3 and 59.3 ng/g for soil samples, and 5.0 and 5.3 μg/(m(2)d) for deposition samples, respectively. Influenced by primary sources and the properties of chlorinated paraffins (CPs), a gradient trend of concentrations and a fractionation of composition from more to less industrialized areas were discovered. Intense seasonal variations with high levels in summer air and winter deposition samples indicated that the air and deposition CP levels were controlled mainly by the vapor and particle phase, respectively. Complex environmental processes like volatilization and fractionation resulted in different CP profiles in different environment matrixes and sampling locations, with C(10-11) C(l6-7) and C(14) C(l6-7), C(10-12) C(l6-7) and C(14) C(l6-8), and C(11-12) C(l6-8) and C(14) C(l7-8) dominating in air, soil, and atmospheric deposition, respectively. Shorter-chain and less chlorinated congeners were enriched in air in the less industrialized areas, while longer-chain and higher chlorinated congeners were concentrated in soil in the more industrialized areas. This is suggesting that the gaseous transport of CPs is the dominant mechanism responsible for the higher concentrations of lighter and likely more mobile CPs in the rural areas.

  10. [Analysis of short-chain chlorinated paraffins in sediment samples from the mouth of the Daliao River by HRGC/ECNI-LRMS].

    PubMed

    Gao, Yuan; Wang, Cheng; Zhang, Hai-jun; Zou, Li-li; Tian, Yu-zeng; Chen, Ji-ping

    2010-08-01

    An analytical method for quantifying short-chain chlorinated paraffins (SCCPs) by high-resolution gas chromatography/electron capture negative ion low-resolution mass spectrometry (HRGC/ECNI-LRMS) was presented. The cleanup procedure with an acid silica gel column and activated neutral alumina column was optimized to remove the interferences. As illustration of the application of the method to environmental samples, it is found that lower chlorinated C10 and C11 compounds were the main SCCPs compounds in six sediment samples from the mouth of the Daliao River. The concentrations of SCCPs in sediments were determined to be in the range of 64.9-407.0 ng/g and showed a decreasing tendency from the shore to the remote location.

  11. Educational Aspirations: Markov and Poisson Models. Rural Industrial Development Project Working Paper Number 14, August 1971.

    ERIC Educational Resources Information Center

    Kayser, Brian D.

    The fit of educational aspirations of Illinois rural high school youths to 3 related one-parameter mathematical models was investigated. The models used were the continuous-time Markov chain model, the discrete-time Markov chain, and the Poisson distribution. The sample of 635 students responded to questionnaires from 1966 to 1969 as part of an…

  12. An Evaluation of a Markov Chain Monte Carlo Method for the Two-Parameter Logistic Model.

    ERIC Educational Resources Information Center

    Kim, Seock-Ho; Cohen, Allan S.

    The accuracy of the Markov Chain Monte Carlo (MCMC) procedure Gibbs sampling was considered for estimation of item parameters of the two-parameter logistic model. Data for the Law School Admission Test (LSAT) Section 6 were analyzed to illustrate the MCMC procedure. In addition, simulated data sets were analyzed using the MCMC, marginal Bayesian…

  13. Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

    USDA-ARS?s Scientific Manuscript database

    Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

  14. An NCME Instructional Module on Estimating Item Response Theory Models Using Markov Chain Monte Carlo Methods

    ERIC Educational Resources Information Center

    Kim, Jee-Seon; Bolt, Daniel M.

    2007-01-01

    The purpose of this ITEMS module is to provide an introduction to Markov chain Monte Carlo (MCMC) estimation for item response models. A brief description of Bayesian inference is followed by an overview of the various facets of MCMC algorithms, including discussion of prior specification, sampling procedures, and methods for evaluating chain…

  15. Poly- and perfluoroalkyl substances in wastewater: Significance of unknown precursors, manufacturing shifts, and likely AFFF impacts.

    PubMed

    Houtz, Erika F; Sutton, Rebecca; Park, June-Soo; Sedlak, Margaret

    2016-05-15

    In late 2014, wastewater effluent samples were collected from eight treatment plants that discharge to San Francisco (SF) Bay in order to assess poly- and perfluoroalkyl substances (PFASs) currently released from municipal and industrial sources. In addition to direct measurement of twenty specific PFAS analytes, the total concentration of perfluoroalkyl acid (PFAA) precursors was also indirectly measured by adapting a previously developed oxidation assay. Effluent from six municipal treatment plants contained similar amounts of total PFASs, with highest median concentrations of PFHxA (24 ng/L), followed by PFOA (23 ng/L), PFBA (19 ng/L), and PFOS (15 ng/L). Compared to SF Bay municipal wastewater samples collected in 2009, the short chain perfluorinated carboxylates PFBA and PFHxA rose significantly in concentration. Effluent samples from two treatment plants contained much higher levels of PFASs: over two samplings, wastewater from one municipal plant contained an average of 420 ng/L PFOS and wastewater from an airport industrial treatment plant contained 560 ng/L PFOS, 390 ng/L 6:2 FtS, 570 ng/L PFPeA, and 500 ng/L PFHxA. The elevated levels observed in effluent samples from these two plants are likely related to aqueous film forming foam (AFFF) sources impacting their influent; PFASs attributable to both current use and discontinued AFFF formulations were observed. Indirectly measured PFAA precursor compounds accounted for 33%-63% of the total molar concentration of PFASs across all effluent samples and the PFAA precursors indicated by the oxidation assay were predominately short-chained. PFAS levels in SF Bay effluent samples reflect the manufacturing shifts towards shorter chained PFASs while also demonstrating significant impacts from localized usage of AFFF. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. A Degradome-Based Polymerase Chain Reaction to Resolve the Potential of Environmental Samples for 2,4-Dichlorophenol Biodegradation.

    PubMed

    Ibrahim, Eslam S; Kashef, Mona T; Essam, Tamer M; Ramadan, Mohammed A

    2017-12-01

    A clean way to overcome environmental pollution is biodegradation. In this perspective, at the intersection of biodegradation and metagenomics, the degradome is defined as the totality of genes related to the biodegradation of a certain compound. It includes the genetic elements from both culturable and uncultured microorganisms. The possibility of assessing the biodegradation potential of an environmental samples, using a degradome-based polymerase chain reaction, was explored. 2,4-Dichlorophenol (2,4-DCP) was chosen as a model and the use of tfdB gene as a biodegradation marker was confirmed by bioinformatics study of TfdB protein. Five primer pairs were designed for the detection of different tfdB gene families. A total of 16 environmental samples were collected from Egyptian agricultural soils and wastewaters and tested for the presence of 2,4-DCP. The biodegradation capacity of 2,4-DCP was determined, for all isolated consortia, to reach up to 350 mg/l. Metagenomic DNA was extracted directly from the soil samples while successive 2,4-DCP-degrading microbial communities were enriched, with increasing concentrations of 2,4-DCP, then their DNA was extracted. The extracted DNA was tested for the distribution of the tfdB gene using a degradome-based polymerase chain reaction. tfdB-1 and tfdB-2 were detected in 5 and 9 samples, respectively. However, the co-existence of both genes was detected only in five samples. All tfdB positive samples were capable of 2,4-DCP degradation. The developed approach of assessing the potential of different environments for degrading 2,4-DCP was successfully measured in terms of accuracy (81.25%) and specificity (100%).

  17. Crazing of nanocomposites with polymer-tethered nanoparticles

    DOE PAGES

    Meng, Dong; Kumar, Sanat K.; Ge, Ting; ...

    2016-09-07

    The crazing behavior of polymer nanocomposites formed by blending polymer grafted nanoparticles with an entangled polymer melt is studied by molecular dynamics simulations. We focus on the three key differences in the crazing behavior of a composite relative to the pure homopolymer matrix, namely, a lower yield stress, a smaller extension ratio, and a grafted chain length dependent failure stress. The yield behavior is found to be mostly controlled by the local nanoparticle-grafted polymer interfacial energy, with the grafted polymer-polymer matrix interfacial structure being of little to no relevance. Increasing the attraction between nanoparticle core and the grafted polymer inhibitsmore » void nucleation and leads to a higher yield stress. In the craze growth regime, the presence of “grafted chain” sections of ≈100 monomers alters the mechanical response of composite samples, giving rise to smaller extension ratios and higher drawing stresses than for the homopolymer matrix. As a result, the dominant failure mechanism of composite samples depends strongly on the length of the grafted chains, with disentanglement being the dominant mechanism for short chains, while bond breaking is the failure mode for chain lengths >10N e, where N e is the entanglement length.« less

  18. [The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

    PubMed

    Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

    2014-04-01

    The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

  19. Comparison of two derivatization methods for the analysis of short chain fatty acids in the ambient aerosol using GC-MS

    NASA Astrophysics Data System (ADS)

    Kim, G.; Jeon, S.

    2016-12-01

    Fatty acids are one of the important compound classes in the polar organic fraction of ambient aerosols. Among them, short chain fatty acids play a significant role in the atmospheric transformation processes. For short-chain acids, the bottleneck of analysis has been the difficulty of sample preparation due to the high solubility and volatility. To overcome this problem, derivatization of polar organic fraction is widely used with silylation reagents to increase the resolution and sensitivity. Two different derivatization procedures; (1) using the tertbutyldimethylsilyl (TBDMS) derivatization and (2) the headspace-solid phase microextraction (HS-SPME) with in-fiber derivatization are compared using gas chromatography-mass spectrometry (GC-MS). At the second method, simultaneous derivatization and extraction were performed by a poly acrylate (PA) coated fiber doped with pyrenyldiazomethane (PDAM). We investigated the chromatographic property and relative sensitivities of each individual short chain acids according to two different derivatization procedures. For the method validation, the linearity, recovery and method detection limit (MDL) were compared. Also, two derivatization methods were applied to the ambient aerosol samples and evaluated with respect to the effectiveness.

  20. Persistent PlatformsThe DDG 51 Case

    DTIC Science & Technology

    2015-09-30

    Retrieved from http://insidedefense.com Biernacki, P., & Waldorf, D. (1981). Snowball sampling : Problems and techniques of chain referral sampling ...indicators of successful shipbuilding practices (Government Accountability Office [GAO], 2009). This paper uses the “ snowball ” technique of data gathering

  1. A Looping-Based Model for Quenching Repression

    PubMed Central

    Pollak, Yaroslav; Goldberg, Sarah; Amit, Roee

    2017-01-01

    We model the regulatory role of proteins bound to looped DNA using a simulation in which dsDNA is represented as a self-avoiding chain, and proteins as spherical protrusions. We simulate long self-avoiding chains using a sequential importance sampling Monte-Carlo algorithm, and compute the probabilities for chain looping with and without a protrusion. We find that a protrusion near one of the chain’s termini reduces the probability of looping, even for chains much longer than the protrusion–chain-terminus distance. This effect increases with protrusion size, and decreases with protrusion-terminus distance. The reduced probability of looping can be explained via an eclipse-like model, which provides a novel inhibitory mechanism. We test the eclipse model on two possible transcription-factor occupancy states of the D. melanogaster eve 3/7 enhancer, and show that it provides a possible explanation for the experimentally-observed eve stripe 3 and 7 expression patterns. PMID:28085884

  2. Synthesis, Crystal Structure, and Magnetic Properties of the Linear-Chain Cobalt Oxide Sr 5Pb 3CoO 12

    NASA Astrophysics Data System (ADS)

    Yamaura, K.; Huang, Q.; Takayama-Muromachi, E.

    2002-02-01

    The novel spin-chain cobalt oxide Sr5Pb3CoO12 [Poverline6×2m, a=10.1093(2) Å and c=3.562 51(9) Å at 295 K] is reported. A polycrystalline sample of the compound was studied by neutron diffraction (at 6 and 295 K) and magnetic susceptibility measurements (5 to 390 K). The cobalt oxide was found to be analogous to the copper oxide Sr5Pb3CuO12, which is comprised of magnetic-linear chains at an interchain distance of 10 Å. Although the cobalt oxide chains (μeff of 3.64 μB per Co) are substantially antiferromagnetic (θW=-38.8 K), neither low-dimensional magnetism nor long-range ordering has been found; a local-structure disorder in the chains might have an impact on the magnetism. This compound is highly electrically insulating.

  3. Serum neurofilament as a predictor of disease worsening and brain and spinal cord atrophy in multiple sclerosis.

    PubMed

    Barro, Christian; Benkert, Pascal; Disanto, Giulio; Tsagkas, Charidimos; Amann, Michael; Naegelin, Yvonne; Leppert, David; Gobbi, Claudio; Granziera, Cristina; Yaldizli, Özgür; Michalak, Zuzanna; Wuerfel, Jens; Kappos, Ludwig; Parmar, Katrin; Kuhle, Jens

    2018-05-30

    Neuro-axonal injury is a key factor in the development of permanent disability in multiple sclerosis. Neurofilament light chain in peripheral blood has recently emerged as a biofluid marker reflecting neuro-axonal damage in this disease. We aimed at comparing serum neurofilament light chain levels in multiple sclerosis and healthy controls, to determine their association with measures of disease activity and their ability to predict future clinical worsening as well as brain and spinal cord volume loss. Neurofilament light chain was measured by single molecule array assay in 2183 serum samples collected as part of an ongoing cohort study from 259 patients with multiple sclerosis (189 relapsing and 70 progressive) and 259 healthy control subjects. Clinical assessment, serum sampling and MRI were done annually; median follow-up time was 6.5 years. Brain volumes were quantified by structural image evaluation using normalization of atrophy, and structural image evaluation using normalization of atrophy, cross-sectional, cervical spinal cord volumes using spinal cord image analyser (cordial). Results were analysed using ordinary linear regression models and generalized estimating equation modelling. Serum neurofilament light chain was higher in patients with a clinically isolated syndrome or relapsing remitting multiple sclerosis as well as in patients with secondary or primary progressive multiple sclerosis than in healthy controls (age adjusted P < 0.001 for both). Serum neurofilament light chain above the 90th percentile of healthy controls values was an independent predictor of Expanded Disability Status Scale worsening in the subsequent year (P < 0.001). The probability of Expanded Disability Status Scale worsening gradually increased by higher serum neurofilament light chain percentile category. Contrast enhancing and new/enlarging lesions were independently associated with increased serum neurofilament light chain (17.8% and 4.9% increase per lesion respectively; P < 0.001). The higher the serum neurofilament light chain percentile level, the more pronounced was future brain and cervical spinal volume loss: serum neurofilament light chain above the 97.5th percentile was associated with an additional average loss in brain volume of 1.5% (P < 0.001) and spinal cord volume of 2.5% over 5 years (P = 0.009). Serum neurofilament light chain correlated with concurrent and future clinical and MRI measures of disease activity and severity. High serum neurofilament light chain levels were associated with both brain and spinal cord volume loss. Neurofilament light chain levels are a real-time, easy to measure marker of neuro-axonal injury that is conceptually more comprehensive than brain MRI.

  4. DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

    PubMed

    Guthrie, J N; Moriarty, D J; Blackall, L L

    2000-12-15

    A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

  5. Vortex-assisted liquid-liquid microextraction for the rapid screening of short-chain chlorinated paraffins in water.

    PubMed

    Chang, Chia-Yu; Chung, Wu-Hsun; Ding, Wang-Hsien

    2016-01-01

    The rapid screening of trace levels of short-chain chlorinated paraffins in various aqueous samples was performed by a simple and reliable procedure based on vortex-assisted liquid-liquid microextraction combined with gas chromatography and electron capture negative ionization mass spectrometry. The optimal vortex-assisted liquid-liquid microextraction conditions for 20 mL water sample were as follows: extractant 400 μL of dichloromethane; vortex extraction time of 1 min at 2500 × g; centrifugation of 3 min at 5000 × g; and no ionic strength adjustment. Under the optimum conditions, the limit of quantitation was 0.05 μg/L. Precision, as indicated by relative standard deviations, was less than 9% for both intra- and inter-day analysis. Accuracy, expressed as the mean extraction recovery, was above 91%. The vortex-assisted liquid-liquid microextraction with gas chromatography and electron capture negative ionization mass spectrometry method was successfully applied to quantitatively extract short-chain chlorinated paraffins from samples of river water and the effluent of a wastewater treatment plant, and the concentrations ranged from 0.8 to 1.6 μg/L. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Development and accuracy of quantitative real-time polymerase chain reaction assays for detection and quantification of enterotoxigenic Escherichia coli (ETEC) heat labile and heat stable toxin genes in travelers' diarrhea samples.

    PubMed

    Youmans, Bonnie P; Ajami, Nadim J; Jiang, Zhi-Dong; Petrosino, Joseph F; DuPont, Herbert L; Highlander, Sarah K

    2014-01-01

    Enterotoxigenic Escherichia coli (ETEC), the leading bacterial pathogen of travelers' diarrhea, is routinely detected by an established DNA hybridization protocol that is neither sensitive nor quantitative. Quantitative real-time polymerase chain reaction (qPCR) assays that detect the ETEC toxin genes eltA, sta1, and sta2 in clinical stool samples were developed and tested using donor stool inoculated with known quantities of ETEC bacteria. The sensitivity of the qPCR assays is 89%, compared with 22% for the DNA hybridization assay, and the limits of detection are 10,000-fold lower than the DNA hybridization assays performed in parallel. Ninety-three clinical stool samples, previously characterized by DNA hybridization, were tested using the new ETEC qPCR assays. Discordant toxin profiles were observed for 22 samples, notably, four samples originally typed as ETEC negative were ETEC positive. The qPCR assays are unique in their sensitivity and ability to quantify the three toxin genes in clinical stool samples.

  7. Do Nursing Home Chain Size and Proprietary Status Affect Experiences With Care?

    PubMed

    You, Kai; Li, Yue; Intrator, Orna; Stevenson, David; Hirth, Richard; Grabowski, David; Banaszak-Holl, Jane

    2016-03-01

    In 2012, over half of nursing homes were operated by corporate chains. Facilities owned by the largest for-profit chains were reported to have lower quality of care. However, it is unknown how nursing home chain ownerships are related with experiences of care. To study the relationship between nursing home chain characteristics (chain size and profit status) with patients' family member reported ratings on experiences with care. Maryland nursing home care experience reports, the Online Survey, Certification, And Reporting (OSCAR) files, and Area Resource Files are used. Our sample consists of all nongovernmental nursing homes in Maryland from 2007 to 2010. Consumer ratings were reported for: overall care; recommendation of the facility; staff performance; care provided; food and meals; physical environment; and autonomy and personal rights. We identified chain characteristics from OSCAR, and estimated multivariate random effect linear models to test the effects of chain ownership on care experience ratings. Independent nonprofit nursing homes have the highest overall rating score of 8.9, followed by 8.6 for facilities in small nonprofit chains, and 8.5 for independent for-profit facilities. Facilities in small, medium, and large for-profit chains have even lower overall ratings of 8.2, 7.9, and 8.0, respectively. We find similar patterns of differences in terms of recommendation rate, and important areas such as staff communication and quality of care. Evidence suggests that Maryland nursing homes affiliated with large-for-profit and medium-for-profit chains had lower ratings of family reported experience with care.

  8. MC3: Multi-core Markov-chain Monte Carlo code

    NASA Astrophysics Data System (ADS)

    Cubillos, Patricio; Harrington, Joseph; Lust, Nate; Foster, AJ; Stemm, Madison; Loredo, Tom; Stevenson, Kevin; Campo, Chris; Hardin, Matt; Hardy, Ryan

    2016-10-01

    MC3 (Multi-core Markov-chain Monte Carlo) is a Bayesian statistics tool that can be executed from the shell prompt or interactively through the Python interpreter with single- or multiple-CPU parallel computing. It offers Markov-chain Monte Carlo (MCMC) posterior-distribution sampling for several algorithms, Levenberg-Marquardt least-squares optimization, and uniform non-informative, Jeffreys non-informative, or Gaussian-informative priors. MC3 can share the same value among multiple parameters and fix the value of parameters to constant values, and offers Gelman-Rubin convergence testing and correlated-noise estimation with time-averaging or wavelet-based likelihood estimation methods.

  9. Harmonised investigation of the occurrence of human enteric viruses in the leafy green vegetable supply chain in three European countries.

    PubMed

    Kokkinos, P; Kozyra, I; Lazic, S; Bouwknegt, M; Rutjes, S; Willems, K; Moloney, R; de Roda Husman, A M; Kaupke, A; Legaki, E; D'Agostino, M; Cook, N; Rzeżutka, A; Petrovic, T; Vantarakis, A

    2012-12-01

    Numerous outbreaks have been attributed to the consumption of raw or minimally processed leafy green vegetables contaminated with enteric viral pathogens. The aim of the present study was an integrated virological monitoring of the salad vegetables supply chain in Europe, from production, processing and point-of-sale. Samples were collected and analysed in Greece, Serbia and Poland, from 'general' and 'ad hoc' sampling points, which were perceived as critical points for virus contamination. General sampling points were identified through the analysis of background information questionnaires based on HACCP audit principles, and they were sampled during each sampling occasion where as-ad hoc sampling points were identified during food safety fact-finding visits and samples were only collected during the fact-finding visits. Human (hAdV) and porcine (pAdV) adenovirus, hepatitis A (HAV) and E (HEV) virus, norovirus GI and GII (NoV) and bovine polyomavirus (bPyV) were detected by means of real-time (RT-) PCR-based protocols. General samples were positive for hAdV, pAdV, HAV, HEV, NoV GI, NoV GII and bPyV at 20.09 % (134/667), 5.53 % (13/235), 1.32 % (4/304), 3.42 % (5/146), 2 % (6/299), 2.95 % (8/271) and 0.82 % (2/245), respectively. Ad hoc samples were positive for hAdV, pAdV, bPyV and NoV GI at 9 % (3/33), 9 % (2/22), 4.54 % (1/22) and 7.14 % (1/14), respectively. These results demonstrate the existence of viral contamination routes from human and animal sources to the salad vegetable supply chain and more specifically indicate the potential for public health risks due to the virus contamination of leafy green vegetables at primary production.

  10. Probability Sampling Method for a Hidden Population Using Respondent-Driven Sampling: Simulation for Cancer Survivors.

    PubMed

    Jung, Minsoo

    2015-01-01

    When there is no sampling frame within a certain group or the group is concerned that making its population public would bring social stigma, we say the population is hidden. It is difficult to approach this kind of population survey-methodologically because the response rate is low and its members are not quite honest with their responses when probability sampling is used. The only alternative known to address the problems caused by previous methods such as snowball sampling is respondent-driven sampling (RDS), which was developed by Heckathorn and his colleagues. RDS is based on a Markov chain, and uses the social network information of the respondent. This characteristic allows for probability sampling when we survey a hidden population. We verified through computer simulation whether RDS can be used on a hidden population of cancer survivors. According to the simulation results of this thesis, the chain-referral sampling of RDS tends to minimize as the sample gets bigger, and it becomes stabilized as the wave progresses. Therefore, it shows that the final sample information can be completely independent from the initial seeds if a certain level of sample size is secured even if the initial seeds were selected through convenient sampling. Thus, RDS can be considered as an alternative which can improve upon both key informant sampling and ethnographic surveys, and it needs to be utilized for various cases domestically as well.

  11. Sequence-Based Discovery Demonstrates That Fixed Light Chain Human Transgenic Rats Produce a Diverse Repertoire of Antigen-Specific Antibodies.

    PubMed

    Harris, Katherine E; Aldred, Shelley Force; Davison, Laura M; Ogana, Heather Anne N; Boudreau, Andrew; Brüggemann, Marianne; Osborn, Michael; Ma, Biao; Buelow, Benjamin; Clarke, Starlynn C; Dang, Kevin H; Iyer, Suhasini; Jorgensen, Brett; Pham, Duy T; Pratap, Payal P; Rangaswamy, Udaya S; Schellenberger, Ute; van Schooten, Wim C; Ugamraj, Harshad S; Vafa, Omid; Buelow, Roland; Trinklein, Nathan D

    2018-01-01

    We created a novel transgenic rat that expresses human antibodies comprising a diverse repertoire of heavy chains with a single common rearranged kappa light chain (IgKV3-15-JK1). This fixed light chain animal, called OmniFlic, presents a unique system for human therapeutic antibody discovery and a model to study heavy chain repertoire diversity in the context of a constant light chain. The purpose of this study was to analyze heavy chain variable gene usage, clonotype diversity, and to describe the sequence characteristics of antigen-specific monoclonal antibodies (mAbs) isolated from immunized OmniFlic animals. Using next-generation sequencing antibody repertoire analysis, we measured heavy chain variable gene usage and the diversity of clonotypes present in the lymph node germinal centers of 75 OmniFlic rats immunized with 9 different protein antigens. Furthermore, we expressed 2,560 unique heavy chain sequences sampled from a diverse set of clonotypes as fixed light chain antibody proteins and measured their binding to antigen by ELISA. Finally, we measured patterns and overall levels of somatic hypermutation in the full B-cell repertoire and in the 2,560 mAbs tested for binding. The results demonstrate that OmniFlic animals produce an abundance of antigen-specific antibodies with heavy chain clonotype diversity that is similar to what has been described with unrestricted light chain use in mammals. In addition, we show that sequence-based discovery is a highly effective and efficient way to identify a large number of diverse monoclonal antibodies to a protein target of interest.

  12. Speciation of Mercury in Selected Areas of the Petroleum Value Chain.

    PubMed

    Avellan, Astrid; Stegemeier, John P; Gai, Ke; Dale, James; Hsu-Kim, Heileen; Levard, Clément; O'Rear, Dennis; Hoelen, Thomas P; Lowry, Gregory V

    2018-02-06

    Petroleum, natural gas, and natural gas condensate can contain low levels of mercury (Hg). The speciation of Hg can affect its behavior during processing, transport, and storage so efficient and safe management of Hg requires an understanding of its chemical form in oil, gas and byproducts. Here, X-ray absorption spectroscopy was used to determine the Hg speciation in samples of solid residues collected throughout the petroleum value chain including stabilized crude oil residues, sediments from separation tanks and condensate glycol dehydrators, distillation column pipe scale, and biosludge from wastewater treatment. In all samples except glycol dehydrators, metacinnabar (β-HgS) was the primary form of Hg. Electron microscopy on particles from a crude sediment showed nanosized (<100 nm) particles forming larger aggregates, and confirmed the colocalization of Hg and sulfur. In sediments from glycol dehydrators, organic Hg(SR) 2 accounted for ∼60% of the Hg, with ∼20% present as β-HgS and/or Hg(SR) 4 species. β-HgS was the predominant Hg species in refinery biosludge and pipe scale samples. However, the balance of Hg species present in these samples depended on the nature of the crude oil being processed, i.e. sweet (low sulfur crudes) vs sour (higher sulfur crudes). This information on Hg speciation in the petroleum value chain will inform development of better engineering controls and management practices for Hg.

  13. A clinical investigation of force delivery systems for orthodontic space closure.

    PubMed

    Nightingale, C; Jones, S P

    2003-09-01

    To investigate the force retention, and rates of space closure achieved by elastomeric chain and nickel titanium coil springs. Randomized clinical trial. Eastman Dental Hospital, London and Queen Mary's University Hospital, Roehampton, 1998-2000. Twenty-two orthodontic patients, wearing the pre-adjusted edgewise appliance undergoing space closure in opposing quadrants, using sliding mechanics on 0.019 x 0.025-inch posted stainless steel archwires. Medium-spaced elastomeric chain [Durachain, OrthoCare (UK) Ltd., Bradford, UK] and 9-mm nickel titanium coil springs [OrthoCare (UK) Ltd.] were placed in opposing quadrants for 15 patients. Elastomeric chain only was used in a further seven patients. The initial forces on placement and residual forces at the subsequent visit were measured with a dial push-pull gauge [Orthocare (UK) Ltd]. Study models of eight patients were taken before and after space closure, from which measurements were made to establish mean space closure. The forces were measured in grammes and space closure in millimetres. Fifty-nine per cent (31/53) of the elastomeric sample maintained at least 50 per cent of the initial force over a time period of 1-15 weeks. No sample lost all its force, and the mean loss was 47 per cent (range: 0-76 per cent). Nickel titanium coil springs lost force rapidly over 6 weeks, following that force levels plateaued. Forty-six per cent (12/26) maintained at least 50 per cent of their initial force over a time period of 1-22 weeks, and mean force loss was 48 per cent (range: 12-68 per cent). The rate of mean weekly space closure for elastomeric chain was 0.21 mm and for nickel titanium coil springs 0.26 mm. There was no relationship between the initial force applied and rate of space closure. None of the sample failed during the study period giving a 100 per cent response rate. In clinical use, the force retention of elastomeric chain was better than previously concluded. High initial forces resulted in high force decay. Nickel titanium coil springs and elastomeric chain closed spaces at a similar rate.

  14. Suitability of the line intersect method for sampling hardwood logging residues

    Treesearch

    A. Jeff Martin

    1976-01-01

    The line intersect method of sampling logging residues was tested in Appalachian hardwoods and was found to provide unbiased estimates of the volume of residue in cubic feet per acre. Thirty-two chains of sample line were established on each of sixteen 1-acre plots on cutover areas in a variety of conditions. Estimates from these samples were then compared to actual...

  15. Nursing home financial performance: the role of ownership and chain affiliation.

    PubMed

    Weech-Maldonado, Robert; Laberge, Alex; Pradhan, Rohit; Johnson, Christopher E; Yang, Zhou; Hyer, Kathryn

    2012-01-01

    The nursing home industry serves one of the most vulnerable populations, and its financial sustainability is a matter of public concern. However, limited empirical evidence exists on the impact of ownership and chain affiliation on nursing home financial performance. The aim of this study was to examine the joint effects of ownership and chain affiliation on the financial performance of the nursing home industry for the study period 1999-2004 on a national sample of 11,236 nursing homes per year. Data included the Medicare Cost Reports; the Online Survey, Certification, and Reporting file; and the Area Resource File. Dependent variables included operating and total margins. Independent variables included four ownership/chain affiliation combinations: for-profit chain, for-profit independent, not-for-profit chain, and not-for-profit independent. Random effects generalized least square regressions were performed. Results show that for-profit nursing homes delivered better financial performance than not-for-profit facilities did across both operating and total margins. However, the relationship between chain affiliation and financial performance was more nuanced. In the case of operating margin, chain-affiliated facilities delivered superior financial performance irrespective of ownership type; however, in the case of total margin, independents outperformed chain-affiliated facilities among for-profits. Our findings show an interactive effect of ownership and chain affiliation on nursing home financial performance, suggesting the pursuit of different organizational strategies by different ownership/chain affiliation subgroups (for-profit chain, for-profit independent, not-for-profit chain, and not-for-profit independent), with implications for financial performance. For-profit independent nursing homes managed to be the top performing group in terms of overall financial despite the operating financial advantage of for-profit chain-affiliated nursing homes. Similarly, not-for-profit independent nursing homes and not-for-profit chain homes had comparable overall financial performance despite the operating financial advantage of chain homes.

  16. Probabilistic Round Trip Contamination Analysis of a Mars Sample Acquisition and Handling Process Using Markovian Decompositions

    NASA Technical Reports Server (NTRS)

    Hudson, Nicolas; Lin, Ying; Barengoltz, Jack

    2010-01-01

    A method for evaluating the probability of a Viable Earth Microorganism (VEM) contaminating a sample during the sample acquisition and handling (SAH) process of a potential future Mars Sample Return mission is developed. A scenario where multiple core samples would be acquired using a rotary percussive coring tool, deployed from an arm on a MER class rover is analyzed. The analysis is conducted in a structured way by decomposing sample acquisition and handling process into a series of discrete time steps, and breaking the physical system into a set of relevant components. At each discrete time step, two key functions are defined: The probability of a VEM being released from each component, and the transport matrix, which represents the probability of VEM transport from one component to another. By defining the expected the number of VEMs on each component at the start of the sampling process, these decompositions allow the expected number of VEMs on each component at each sampling step to be represented as a Markov chain. This formalism provides a rigorous mathematical framework in which to analyze the probability of a VEM entering the sample chain, as well as making the analysis tractable by breaking the process down into small analyzable steps.

  17. Applications of DART-MS for food quality and safety assurance in food supply chain.

    PubMed

    Guo, Tianyang; Yong, Wei; Jin, Yong; Zhang, Liya; Liu, Jiahui; Wang, Sai; Chen, Qilong; Dong, Yiyang; Su, Haijia; Tan, Tianwei

    2017-03-01

    Direct analysis in real time (DART) represents a new generation of ion source which is used for rapid ionization of small molecules under ambient conditions. The combination of DART and various mass spectrometers allows analyzing multiple food samples with simple or no sample treatment, or in conjunction with prevailing protocolized sample preparation methods. Abundant applications by DART-MS have been reviewed in this paper. The DART-MS strategy applied to food supply chain (FSC), including production, processing, and storage and transportation, provides a comprehensive solution to various food components, contaminants, authenticity, and traceability. Additionally, typical applications available in food analysis by other ambient ionization mass spectrometers were summarized, and fundamentals mainly including mechanisms, devices, and parameters were discussed as well. © 2015 Wiley Periodicals, Inc. Mass Spec Rev. 36:161-187, 2017. © 2015 Wiley Periodicals, Inc.

  18. Polydispersity-Driven Block Copolymer Amphiphile Self-Assembly into Prolate-Spheroid Micelles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schmitt, Andrew L.; Repollet-Pedrosa, Milton H.; Mahanthappa, Mahesh K.

    The aqueous self-assembly behavior of polydisperse poly(ethylene oxide-b-1,4-butadiene-b-ethylene oxide) (OBO) macromolecular triblock amphiphiles is examined to discern the implications of continuous polydispersity in the hydrophobic block on the resulting aqueous micellar morphologies of otherwise monodisperse polymer surfactants. The chain length polydispersity and implicit composition polydispersity of these samples furnishes a distribution of preferred interfacial curvatures, resulting in dilute aqueous block copolymer dispersions exhibiting coexisting spherical and rod-like micelles with vesicles in a single sample with a O weight fraction, w{sub O}, of 0.18. At higher w{sub O} = 0.51-0.68, the peak in the interfacial curvature distribution shifts and we observemore » the formation of only American football-shaped micelles. We rationalize the formation of these anisotropically shaped aggregates based on the intrinsic distribution of preferred curvatures adopted by the polydisperse copolymer amphiphiles and on the relief of core block chain stretching by chain-length-dependent intramicellar segregation.« less

  19. Healing of polymer interfaces: Interfacial dynamics, entanglements, and strength

    NASA Astrophysics Data System (ADS)

    Ge, Ting; Robbins, Mark O.; Perahia, Dvora; Grest, Gary S.

    2014-07-01

    Self-healing of polymer films often takes place as the molecules diffuse across a damaged region, above their melting temperature. Using molecular dynamics simulations we probe the healing of polymer films and compare the results with those obtained for thermal welding of homopolymer slabs. These two processes differ from each other in their interfacial structure since damage leads to increased polydispersity and more short chains. A polymer sample was cut into two separate films that were then held together in the melt state. The recovery of the damaged film was followed as time elapsed and polymer molecules diffused across the interface. The mass uptake and formation of entanglements, as obtained from primitive path analysis, are extracted and correlated with the interfacial strength obtained from shear simulations. We find that the diffusion across the interface is significantly faster in the damaged film compared to welding because of the presence of short chains. Though interfacial entanglements increase more rapidly for the damaged films, a large fraction of these entanglements are near chain ends. As a result, the interfacial strength of the healing film increases more slowly than for welding. For both healing and welding, the interfacial strength saturates as the bulk entanglement density is recovered across the interface. However, the saturation strength of the damaged film is below the bulk strength for the polymer sample. At saturation, cut chains remain near the healing interface. They are less entangled and as a result they mechanically weaken the interface. Chain stiffness increases the density of entanglements, which increases the strength of the interface. Our results show that a few entanglements across the interface are sufficient to resist interfacial chain pullout and enhance the mechanical strength.

  20. Detecting DNA methylation of the BCL2, CDKN2A and NID2 genes in urine using a nested methylation specific polymerase chain reaction assay to predict bladder cancer.

    PubMed

    Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P

    2012-12-01

    Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  1. Simple Physics-Based Analytical Formulas for the Potentials of Mean Force of the Interaction of Amino Acid Side Chains in Water. VII. Charged-Hydrophobic/Polar and Polar-Hydrophobic/Polar Side Chains.

    PubMed

    Makowski, Mariusz; Liwo, Adam; Scheraga, Harold A

    2017-01-19

    The physics-based potentials of side-chain-side-chain interactions corresponding to pairs composed of charged and polar, polar and polar, charged and hydrophobic, and hydrophobic and hydrophobic side chains have been determined. A total of 144 four-dimensional potentials of mean force (PMFs) of all possible pairs of molecules modeling these pairs were determined by umbrella-sampling molecular dynamics simulations in explicit water as functions of distance and orientation, and the analytical expressions were then fitted to the PMFs. Depending on the type of interacting sites, the analytical approximation to the PMF is a sum of terms corresponding to van der Waals interactions and cavity-creation involving the nonpolar sections of the side chains and van der Waals, cavity-creation, and electrostatic (charge-dipole or dipole-dipole) interaction energies and polarization energies involving the charged or polar sections of the side chains. The model used in this work reproduces all features of the interacting pairs. The UNited RESidue force field with the new side-chain-side-chain interaction potentials was preliminarily tested with the N-terminal part of the B-domain of staphylococcal protein A (PDBL 1BDD ; a three-α-helix bundle) and UPF0291 protein YnzC from Bacillus subtilis (PDB: 2HEP ; an α-helical hairpin).

  2. Optimal Conditions for the Asymmetric Polymerase Chain Reaction for Detecting Food Pathogenic Bacteria Using a Personal SPR Sensor.

    PubMed

    Nagai, Haruka; Tomioka, Kanji; Okumura, Shiro

    2018-06-26

    We have been developing quick and simple system for detecting food-poisoning bacteria using a combination of an asymmetric PCR and a portable surface plasmon resonance (SPR) sensor. The system would be suitable for point-of-care detection of food-poisoning bacteria in the field of food industry. In this study, we established a novel method for quantifying the amplified forward (F) and reverse (R) chains of Staphylococcus aureus separately by high-performance liquid chromatography (HPLC). The concentration of single-stranded DNA amplicon excessively amplified, which is crucial for the system, could be calculated as the difference between those of the F- and R-chains. For the R-chain, a correction based on the F-chain concentration in the sample was used to obtain a more accurate value, because the determination of the R-chain concentration was affected by that of the coexisting F-chain. The concentration values were also determined by fluorescence imaging for electrophoresis gels of amplicons with FITC- or Cy5-conjugated primers, and they were in good agreement with the values by the HPLC. The measured concentration of the single-strand F-chain correlated well with the value of the SPR response against the probe that was a complementary sequence of the F-chain, immobilized on the sensor chip of the SPR sensor.

  3. U.S.-MEXICO BORDER PROGRAM ARIZONA BORDER STUDY--STANDARD OPERATING PROCEDURE FOR TRACKING SYSTEM (UA-D-28.0)

    EPA Science Inventory

    The Arizona Border Study used a system that tracks what occurs to a sample and provides the status of that sample at any given time. In essence, the tracking system provides an electronic chain of custody record for each sample as it moves through the project. This is achieved ...

  4. NHEXAS PHASE I ARIZONA STUDY--STANDARD OPERATING PROCEDURE FOR TRACKING SYSTEM (UA-D-28.0)

    EPA Science Inventory

    The NHEXAS Arizona project designed a system that tracks what occurs to a sample and provides the status of that sample at any given time. In essence, the tracking system provides an electronic chain of custody record for each sample as it moves through the project. This is ach...

  5. Improving the elasticity and cytophilicity of biodegradable polyurethane by changing chain extender.

    PubMed

    Zhang, Changhong; Zhang, Ning; Wen, Xuejun

    2006-11-01

    Two types of biodegradable polyurethanes (PUs) were synthesized from methylene di-p-phenyl-diisocyanate (MDI), polycaprolactone diol (PCL-diol), and chain extenders of either butanediol (BD) or 2,2'-(methylimino)diethanol (MIDE). The effects of two types of chain extenders on the degradation, mechanical properties, hydrophilicity, and cytophilicity of PUs were evaluated. In vitro degradation studies showed that PU containing MIDE has a higher degradation rate than PU synthesized using BD as a chain extender. Mechanical testing on dry and wet samples demonstrated that PU containing MIDE has a much higher elongation in the elastic region than PU containing BD. PU containing MIDE is more hydrophilic and retains more liquid during in vitro culture. Furthermore, preliminary cytocompatibility studies showed that both types of degradable PU are nontoxic, and fibroblasts adhere better and proliferate faster on MIDE containing PU than BD containing PU. To compare the cytocompatibility and degradation behaviors of the synthesized PU with existing FDA approved biocompatible material, polylactide (PLA), with a similar degradation rate, was used as negative control. Two types of PU were shown to have similar cytocompatibility and degradation behaviors as those of the PLA material. To verify the effectiveness of the cytotoxicity assay, latex was used as a positive control. Latex samples showed toxicity to cultured cells as expected. In conclusion, by changing the type of chain extender used during the synthesis of degradable PUs, the degradation rate, mechanical properties, hydrophilicity, and cytophilicity can be adjusted for different tissue engineering applications. (c) 2006 Wiley Periodicals, Inc.

  6. Development and characterization of a whole-cell bioluminescent sensor for bioavailable middle-chain alkanes in contaminated groundwater samples.

    PubMed Central

    Sticher, P; Jaspers, M C; Stemmler, K; Harms, H; Zehnder, A J; van der Meer, J R

    1997-01-01

    A microbial whole-cell biosensor was developed, and its potential to measure water-dissolved concentrations of middle-chain-length alkanes and some related compounds by bioluminescence was characterized. The biosensor strain Escherichia coli DH5 alpha(pGEc74, pJAMA7) carried the regulatory gene alkS from Pseudomonas oleovorans and a transcriptional fusion of PalkB from the same strain with the promoterless luciferase luxAB genes from Vibrio harveyi on two separately introduced plasmids. In standardized assays, the biosensor cells were readily inducible with octane, a typical inducer of the alk system. Light emission after induction periods of more than 15 min correlated well with octane concentration. In well-defined aqueous samples, there was a linear relationship between light output and octane concentrations between 24 and 100 nM. The biosensor responded to middle-chain-length alkanes but not to alicyclic or aromatic compounds. In order to test its applicability for analyzing environmentally relevant samples, the biosensor was used to detect the bioavailable concentration of alkanes in heating oil-contaminated groundwater samples. By the extrapolation of calibrated light output data to low octane concentrations with a hyperbolic function, a total inducer concentration of about 3 nM in octane equivalents was estimated. The whole-cell biosensor tended to underestimate the alkane concentration in the groundwater samples by about 25%, possibly because of the presence of unknown inhibitors. This was corrected for by spiking the samples with a known amount of an octane standard. Biosensor measurements of alkane concentrations were further verified by comparing them with the results of chemical analyses. PMID:9327569

  7. Characterization of citrus pectin samples extracted under different conditions: influence of acid type and pH of extraction

    PubMed Central

    Kaya, Merve; Sousa, António G.; Crépeau, Marie-Jeanne; Sørensen, Susanne O.; Ralet, Marie-Christine

    2014-01-01

    Background and Aims Pectin is a complex macromolecule, the fine structure of which is influenced by many factors. It is used as a gelling, thickening and emulsifying agent in a wide range of applications, from food to pharmaceutical products. Current industrial pectin extraction processes are based on fruit peel, a waste product from the juicing industry, in which thousands of tons of citrus are processed worldwide every year. This study examines how pectin components vary in relation to the plant source (orange, lemon, lime, grapefruit) and considers the influence of extraction conditions on the chemical and macromolecular characteristics of pectin samples. Methods Citrus peel (orange, lemon, lime and grapefruit) from a commercial supplier was used as raw material. Pectin samples were obtained on a bulk plant scale (kilograms; harsh nitric acid, mild nitric acid and harsh oxalic acid extraction) and on a laboratory scale (grams; mild oxalic acid extraction). Pectin composition (acidic and neutral sugars) and physicochemical properties (molar mass and intrinsic viscosity) were determined. Key Results Oxalic acid extraction allowed the recovery of pectin samples of high molecular weight. Mild oxalic acid-extracted pectins were rich in long homogalacturonan stretches and contained rhamnogalacturonan I stretches with conserved side chains. Nitric acid-extracted pectins exhibited lower molecular weights and contained rhamnogalacturonan I stretches encompassing few and/or short side chains. Grapefruit pectin was found to have short side chains compared with orange, lime and lemon. Orange and grapefruit pectin samples were both particularly rich in rhamnogalacturonan I backbones. Conclusions Structural, and hence macromolecular, variations within the different citrus pectin samples were mainly related to their rhamnogalacturonan I contents and integrity, and, to a lesser extent, to the length of their homogalacturonan domains. PMID:25081519

  8. [First attempts of detecting fetal cells in the maternal circulation].

    PubMed

    Nagy, Gyula Richárd; Bán, Zoltán; Sipos, Ferenc; Fent, János; Oroszné Nagy, Judit; Beke, Artúr; Furész, József; Papp, Zoltán

    2004-10-31

    In prenatal diagnosis there is great interest for noninvasive diagnostic methods. Authors report their first results in detecting fetal cells in the maternal circulation during pregnancy. The aim of the study was to detect fetal gender from maternal peripheral blood samples during pregnancy. Authors have analysed fetal nucleated red blood cells. In 12 cases after a double density Percoll gradient separation they labelled the surface antigens of the cells with anti-glycophorin-A and anti-CD45 fluorescent antibodies, did an intracellular staining of the epsilon haemoglobin chain, and analysed the cells with flow cytometry. The CD45 negative/glycophorin-A positive/epsilon-haemoglobin chain positive cells were considered as fetal cells. Having the results, in another 13 cases magnetic activated cell sorting with CD71 antibody were used as an enrichment step. Authors made an intracellular staining of the epsilon haemoglobin chain, the positive cells were isolated by micromanipulation, and analysed by single cell fluorescent polymerase chain reaction. Primers for the amelogenin gene were used to detect fetal gender. Only the Percoll enrichment step itself is not enough for using the samples for diagnostic molecular-biologic examinations, a following enrichment step is needed. For this the authors used magnetic activated cell sorting with CD71 antibody. With the help of this enrichment step, after the intracellular staining of the epsilon haemoglobin chain the direct micromanipulator isolation of the epsilon haemoglobin chain positive cells could be done. After analysing single cells by fluorescent polymerase chain reaction, in 8 out of the 11 comparable cases the results were similar to those, what was found during the genetic amniocentesis. In 2 cases from this 8, genetic amniocentesis proved Klinefelter syndrome, which they could also confirm with the examination of fetal cells in the maternal circulation. The results of the study suggest that the method described above can be useful in prenatal genetic diagnosis, and improving it could be useful to detect other genetic abnormalities (chromosomal abnormalities, single gene disorders) as well.

  9. Validation of serum free light chain reference ranges in primary care.

    PubMed

    Galvani, Luca; Flanagan, Jane; Sargazi, Mansour; Neithercut, William D

    2016-05-01

    The demand for measurement of serum immunoglobulin free kappa (κ) and lambda (λ) light chains has increased. The κ:λ ratio is used to assist in diagnosis/monitoring of plasma cell disorders. The binding site reference range for serum-free light chain κ:λ ratios of 0.26-1.65 was derived from healthy volunteers. Subsequently, a reference range of 0.37-3.1 for patients with chronic kidney disease has been proposed. Elevated free light chain concentrations and borderline raised free light chain ratios also may be found in polyclonal gammopathies and with other non-renal illnesses. This assessment was conducted to validate the established free light chain reference ranges in individuals from primary care. A total of 130 samples were identified from routine blood samples collected in primary care for routine biochemistry testing and estimated glomerular filtration rate calculation. The median and range of κ:λ ratios found in each estimated glomerular filtration rate group used for chronic kidney disease classification were higher than previously described. This was the case for individuals with normal or essentially normal renal function with estimated glomerular filtration rates>90, (0.58-1.76) and estimated glomerular filtration rate of 60-90 mL/min/1.73 m(2), (0.71-1.93). Individuals with estimated glomerular filtration rate 15-30, (0.72-4.50) and estimated glomerular filtration rate <15 ml/min/1.73 m(2) (0.71-4.95) also had higher values when compared to the current renal reference range of 0.37-3.10. Elevation of free light chain-κ:λ ratios may occur in the absence of a reduced renal function shown by a normal estimated glomerular filtration rate and in the presence of reduced renal function by estimated glomerular filtration rate when comparing results with the established reference ranges. Explanations include choice of analytical systems or the presence of other concurrent non-plasma cell illness. © The Author(s) 2016.

  10. Hereditary folate malabsorption: A positively charged amino acid at position 113 of the proton-coupled folate transporter (PCFT/SLC46A1) is required for folic acid binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lasry, Inbal; Berman, Bluma; Glaser, Fabian

    2009-08-28

    The proton-coupled folate transporter (PCFT/SLC46A1) mediates intestinal folate uptake at acidic pH. Some loss of folic acid (FA) transport mutations in PCFT from hereditary folate malabsorption (HFM) patients cluster in R113, thereby suggesting a functional role for this residue. Herein, unlike non-conservative substitutions, an R113H mutant displayed 80-fold increase in the FA transport Km while retaining parental Vmax, hence indicating a major fall in folate substrate affinity. Furthermore, consistent with the preservation of 9% of parental transport activity, R113H transfectants displayed a substantial decrease in the FA growth requirement relative to mock transfectants. Homology modeling based on the crystal structuresmore » of the Escherichia coli transporter homologues EmrD and glycerol-3-phosphate transporter revealed that the R113H rotamer properly protrudes into the cytoplasmic face of the minor cleft normally occupied by R113. These findings constitute the first demonstration that a basic amino acid at position 113 is required for folate substrate binding.« less

  11. Gaia: automated quality assessment of protein structure models.

    PubMed

    Kota, Pradeep; Ding, Feng; Ramachandran, Srinivas; Dokholyan, Nikolay V

    2011-08-15

    Increasing use of structural modeling for understanding structure-function relationships in proteins has led to the need to ensure that the protein models being used are of acceptable quality. Quality of a given protein structure can be assessed by comparing various intrinsic structural properties of the protein to those observed in high-resolution protein structures. In this study, we present tools to compare a given structure to high-resolution crystal structures. We assess packing by calculating the total void volume, the percentage of unsatisfied hydrogen bonds, the number of steric clashes and the scaling of the accessible surface area. We assess covalent geometry by determining bond lengths, angles, dihedrals and rotamers. The statistical parameters for the above measures, obtained from high-resolution crystal structures enable us to provide a quality-score that points to specific areas where a given protein structural model needs improvement. We provide these tools that appraise protein structures in the form of a web server Gaia (http://chiron.dokhlab.org). Gaia evaluates the packing and covalent geometry of a given protein structure and provides quantitative comparison of the given structure to high-resolution crystal structures. dokh@unc.edu Supplementary data are available at Bioinformatics online.

  12. Use of Crystal Structure Informatics for Defining the Conformational Space Needed for Predicting Crystal Structures of Pharmaceutical Molecules.

    PubMed

    Iuzzolino, Luca; Reilly, Anthony M; McCabe, Patrick; Price, Sarah L

    2017-10-10

    Determining the range of conformations that a flexible pharmaceutical-like molecule could plausibly adopt in a crystal structure is a key to successful crystal structure prediction (CSP) studies. We aim to use conformational information from the crystal structures in the Cambridge Structural Database (CSD) to facilitate this task. The conformations produced by the CSD Conformer Generator are reduced in number by considering the underlying rotamer distributions, an analysis of changes in molecular shape, and a minimal number of molecular ab initio calculations. This method is tested for five pharmaceutical-like molecules where an extensive CSP study has already been performed. The CSD informatics-derived set of crystal structure searches generates almost all the low-energy crystal structures previously found, including all experimental structures. The workflow effectively combines information on individual torsion angles and then eliminates the combinations that are too high in energy to be found in the solid state, reducing the resources needed to cover the solid-state conformational space of a molecule. This provides insights into how the low-energy solid-state and isolated-molecule conformations are related to the properties of the individual flexible torsion angles.

  13. Investigations into the origin of the molecular recognition of several adenosine deaminase inhibitors.

    PubMed

    Gillerman, Irina; Fischer, Bilha

    2011-01-13

    Inhibitors of adenosine deaminase (ADA, EC 3.5.4.4) are potential therapeutic agents for the treatment of various health disorders. Several highly potent inhibitors were previously identified, yet they exhibit unacceptable toxicities. We performed a SAR study involving a series of C2 or C8 substituted purine-riboside analogues with a view to discover less potent inhibitors with a lesser toxicity. We found that any substitution at C8 position of nebularine resulted in total loss of activity toward calf intestinal ADA. However, several 2-substituted-adenosine, 8-aza-adenosine, and nebularine analogues exhibited inhibitory activity. Specifically, 2-Cl-purine riboside, 8-aza-2-thiohexyl adenosine, 2-thiohexyl adenosine, and 2-MeS-purine riboside were found to be competitive inhibitors of ADA with K(i) values of 25, 22, 6, and 3 μM, respectively. We concluded that electronic parameters are not major recognition determinants of ADA but rather steric parameters. A C2 substituent which fits ADA hydrophobic pocket and improves H-bonding with the enzyme makes a good inhibitor. In addition, a gg rotamer about C4'-C5' bond is apparently an important recognition determinant.

  14. Application of cinchona-sulfonate-based chiral zwitterionic ion exchangers for the separation of proline-containing dipeptide rotamers and determination of on-column isomerization parameters from dynamic elution profiles.

    PubMed

    Wernisch, Stefanie; Trapp, Oliver; Lindner, Wolfgang

    2013-09-17

    The interconversion of cis and trans isomers of dipeptides containing C-terminal proline was studied by dynamic chromatography on zwitterionic chiral stationary phases at temperatures ranging from -15°C to +45°C The cis-trans isomers could be separated below 0°C and above 0-10°C plateau formation and peak coalescence phenomena occurred, which is characteristic for a dynamic process at the time-scale of partitioning. At and above room temperature, full coalescence was observed, which allowed separations of enantiomers without interference from interconversion effects. Analysis of the dynamic elution profiles of the interconverting peptides allowed the determination of isomerization rate constants and thermodynamic activation parameters (isomerization enthalpy, entropy and activation energy). In accordance with established results, isomerization rates and thermodynamic parameters were found to depend on the nature of the N-terminal amino acid. Isomerization barriers were only slightly lower than values determined with other methods but significant differences in the relative contributions of the activation enthalpy and entropy as well as isomerization rates pointed toward selector-moderated isomerization dynamics. Copyright © 2013 Elsevier B.V. All rights reserved.

  15. Use of Electronic Hand-held Devices for Collection of Savannah River Site Environmental Data - 13329

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marberry, Hugh; Moore, Winston

    2013-07-01

    Savannah River Nuclear Solutions has begun using Xplore Tablet PC's to collect data in the field for soil samples, groundwater samples, air samples and round sheets at the Savannah River Site (SRS). EPA guidelines for groundwater sampling are incorporated into the application to ensure the sample technician follows the proper protocol. The sample technician is guided through the process for sampling and round sheet data collection by a series of menus and input boxes. Field measurements and well stabilization information are entered into the tablet for uploading into Environmental Restoration Data Management System (ERDMS). The process helps to eliminate inputmore » errors and provides data integrity. A soil sample technician has the ability to collect information about location of sample, field parameter, describe the soil sample, print bottle labels, and print chain of custody for the sample that they have collected. An air sample technician has the ability to provide flow, pressure, hours of operation, print bottle labels and chain of custody for samples they collect. Round sheets are collected using the information provided in the various procedures. The data are collected and uploaded into ERDMS. The equipment used is weather proof and hardened for the field use. Global Positioning System (GPS) capabilities are integrated into the applications to provide the location where samples were collected and to help sample technicians locate wells that are not visited often. (authors)« less

  16. Adaptive sampling in behavioral surveys.

    PubMed

    Thompson, S K

    1997-01-01

    Studies of populations such as drug users encounter difficulties because the members of the populations are rare, hidden, or hard to reach. Conventionally designed large-scale surveys detect relatively few members of the populations so that estimates of population characteristics have high uncertainty. Ethnographic studies, on the other hand, reach suitable numbers of individuals only through the use of link-tracing, chain referral, or snowball sampling procedures that often leave the investigators unable to make inferences from their sample to the hidden population as a whole. In adaptive sampling, the procedure for selecting people or other units to be in the sample depends on variables of interest observed during the survey, so the design adapts to the population as encountered. For example, when self-reported drug use is found among members of the sample, sampling effort may be increased in nearby areas. Types of adaptive sampling designs include ordinary sequential sampling, adaptive allocation in stratified sampling, adaptive cluster sampling, and optimal model-based designs. Graph sampling refers to situations with nodes (for example, people) connected by edges (such as social links or geographic proximity). An initial sample of nodes or edges is selected and edges are subsequently followed to bring other nodes into the sample. Graph sampling designs include network sampling, snowball sampling, link-tracing, chain referral, and adaptive cluster sampling. A graph sampling design is adaptive if the decision to include linked nodes depends on variables of interest observed on nodes already in the sample. Adjustment methods for nonsampling errors such as imperfect detection of drug users in the sample apply to adaptive as well as conventional designs.

  17. Theoretical and Experimental Studies of Functionalized Carbon Nanotubes for Improved Thermal Conductivity

    NASA Astrophysics Data System (ADS)

    Kerr, Alexander; Burt, Timothy; Mullen, Kieran; Glatzhofer, Daniel; Houck, Matthew; Huang, Paul

    The use of carbon nanotubes (CNTs) to improve the thermal conductivity of composite materials is thwarted by their large thermal boundary resistance. We study how to overcome this Kapitza resistance by functionalizing CNTs with mixed molecular chains. Certain configurations of chains improve the transmission of thermal vibrations through our systems by decreasing phonon mismatch between the CNTs and their surrounding matrix. Through the calculation of vibrational normal modes and Green's functions, we develop a variety of computational metrics to compare the thermal conductivity (κ) of our systems. We show how different configurations of attached chains affect the samples' κ values by varying chain identity, chain length, number of chains, and heat driver behavior. We vary the parameters to maximize κ. To validate and optimize these metrics, we perform molecular dynamics simulations for comparison. We also present experimental results of composites enhanced with CNTs and make comparisons to the theory. We observe that some composites are thermally improved with the inclusion of CNTs, while others are scarcely changed, in agreement with theoretical models. This work was supported by NSF Grant DMR-1310407.

  18. Do nursing home chain size and proprietary status affect experiences with care?

    PubMed Central

    You, Kai; Li, Yue; Intrator, Orna; Stevenson, David; Hirth, Richard; Grabowski, David; Banaszak-Holl, Jane

    2015-01-01

    Background In 2012, over half of nursing homes were operated by corporate chains. Facilities owned by the largest for-profit chains were reported to have lower quality of care. However, it is unknown how nursing home chain ownerships are related with experiences of care. Objectives To study the relationship between nursing home chain characteristics (chain size and profit status) with patients' family member reported ratings on experiences with care. Data Sources and Study Design Maryland nursing home care experience reports, the Online Survey, Certification, And Reporting (OSCAR) files, and Area Resource Files are used. Our sample consists of all non-governmental nursing homes in Maryland from 2007 to 2010. Consumer ratings were reported for: overall care; recommendation of the facility; staff performance; care provided; food and meals; physical environment; and autonomy and personal rights. We identified chain characteristics from OSCAR, and estimated multivariate random effect linear models to test the effects of chain ownership on care experience ratings. Results Independent nonprofit nursing homes have the highest overall rating score of 8.9, followed by 8.6 for facilities in small nonprofit chains, and 8.5 for independent for-profit facilities. Facilities in small, medium and large for-profit chains have even lower overall ratings of 8.2, 7.9, and 8.0, respectively. We find similar patterns of differences in terms of recommendation rate, and important areas such as staff communication and quality of care. Conclusions Evidence suggests that Maryland nursing homes affiliated with large- and medium- for-profit chains had lower ratings of family reported experience with care. PMID:26765147

  19. Increase of Long-chain Branching by Thermo-oxidative Treatment of LDPE

    NASA Astrophysics Data System (ADS)

    Rolón-Garrido, Víctor H.; Luo, Jinji; Wagner, Manfred H.

    2011-07-01

    Low-density polyethylene (LDPE) was exposed to thermal and thermo-oxidative treatment at 170 °C, and subsequently characterized by linear-viscoelastic measurements and in uniaxial extension. The Molecular Stress Function (MSF) model was used to quantify the elongational viscosities measured. For the thermally treated samples, exposure times between 2 and 6 hours were applied. Formation of long-chain branching (LCB) was found to occur only during the first two hours of thermal treatment. At longer exposure times, no difference in the level of strain hardening was observed. This was quantified by use of the MSF model: the nonlinear parameter fmax2 increased from fmax2 = 14 for the virgin sample to fmax2 = 22 for the samples thermally treated between 2 and 6 hours. For the thermo-oxidatively treated samples, which were exposed to air during thermal treatment between 30 and 90 minutes, the level of strain hardening increases drastically up to fmax2 = 55 with increasing exposure times from 30 up to 75 min due to LCB formation, and then decreases for an exposure time of 90 minutes due to chain scission dominating LCB formation. The nonlinear parameter β of the MSF model was found to be β = 2 for all samples, indicating that the general type of the random branching structure remains the same under all thermal conditions. Consequently only the parameter fmax2 of the MSF model and the linear-viscoelastic spectra were required to describe quantitatively the experimental observations. The strain hardening index, which is sometimes used to quantify strain hardening, follows accurately the trend of the MSF model parameter fmax2.

  20. The quality of antimalarials available in Yemen

    PubMed Central

    Abdo-Rabbo, Ahmed; Bassili, Amal; Atta, Hoda

    2005-01-01

    Background Malaria has always been a major public health problem in Yemen. Several studies in developing countries have demonstrated ineffective and poor quality drugs including antimalarials. Therefore, quality assessment of antimalarial drugs is of crucial importance. This study aimed to assess the quality of antimalarials (chloroquine and sulfadoxine/pyrimethamine) available in Yemen and to determine whether the quality of these products was related to the level of the distribution chain at which the samples were collected or related to the manufacturers. Methods Four samples from each antimalarial product were collected from each of the various levels of the distribution chain. One sample was kept with the research team. Two were tested at Sana'a and Aden Drug Quality Control Laboratories. The fourth was sent to the Centre for Quality Assurance of Medicines in Potchefstroom, South Africa, for analysis. Quality indicators measured were the content of the active ingredient and dissolution rate (for tablets only) in comparison to standard specifications for these products in the relevant pharmacopoeia. Results The results identified several problems of sub-standard products within the drug distribution chain. They included high and low failures in ingredient content for chloroquine tablets and chloroquine syrup. There was some dissolution failure for chloroquine tablets, and high sulfadoxine/pyrimethamine tablets dissolution failures. Failures with the dissolution of the pyrimethamine were found at most of the collection points. No clear relationship neither between the quality products and the level of the distribution chain, nor between locally manufactured and imported products was observed. Conclusion There are sub-standard antimalarial products circulating within the drug distribution chains in the country, which will have serious implications on the reduced therapeutic effectiveness and on the development of drug resistance. This appears to be due to non-compliance with Good Manufacturing Practice guidelines by manufacturers in the production of the antimalarials. PMID:15987508

  1. Interactions among the branched-chain amino acids and their effects on methionine utilization in growing pigs: effects on plasma amino- and keto-acid concentrations and branched-chain keto-acid dehydrogenase activity.

    PubMed

    Langer, S; Scislowski, P W; Brown, D S; Dewey, P; Fuller, M F

    2000-01-01

    The present experiment was designed to elucidate the mechanism of the methionine-sparing effect of excess branched-chain amino acids (BCAA) reported in the previous paper (Langer & Fuller, 2000). Twelve growing gilts (30-35 kg) were prepared with arterial catheters. After recovery, they received for 7 d a semipurified diet with a balanced amino acid pattern. On the 7th day blood samples were taken before (16 h postabsorptive) and after the morning meal (4 h postprandial). The animals were then divided into three groups and received for a further 7 d a methionine-limiting diet (80% of requirement) (1) without any amino acid excess; (2) with excess leucine (50% over requirement); or (3) with excesses of all three BCAA (leucine, isoleucine, valine, each 50% over the requirement). On the 7th day blood samples were taken as in the first period, after which the animals were killed and liver and muscle samples taken. Plasma amino acid and branched-chain keto acid (BCKA) concentrations in the blood and branched-chain keto-acid dehydrogenase (BCKDH; EC 1.2.4.4) activity in liver and muscle homogenates were determined. Compared with those on the balanced diet, pigs fed on methionine-limiting diets had significantly lower (P < 0.05) plasma methionine concentrations in the postprandial but not in the postabsorptive state. There was no effect of either leucine or a mixture of all three BCAA fed in excess on plasma methionine concentrations. Excess dietary leucine reduced (P < 0.05) the plasma concentrations of isoleucine and valine in both the postprandial and postabsorptive states. Plasma concentrations of the BCKA reflected the changes in the corresponding amino acids. Basal BCKDH activity in the liver and total BCKDH activity in the biceps femoris muscle were significantly (P < 0.05) increased by excesses of leucine or all BCAA.

  2. MOELCULAR SIZE EXCLUSION BY SOIL ORGANIC MATERIALS ESTIMATED FROM THEIR SWELLING IN ORGANIC SOLVENTS

    EPA Science Inventory

    A published method previously developed to measure the swelling characteristics of pow dered coal samples has been adapted for swelling measurements on various peat, pollen, chain, and cellulose samples The swelling of these macromolecular materials is the volumetric manifestatio...

  3. Development of multiplex polymerase chain reaction for detection of Ehrlichia canis, Babesia spp and Hepatozoon canis in canine blood.

    PubMed

    Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada

    2009-01-01

    A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.

  4. Detection of Zaire Ebola virus by real-time reverse transcription-polymerase chain reaction, Sierra Leone, 2014.

    PubMed

    Liu, Licheng; Sun, Yang; Kargbo, Brima; Zhang, Chuntao; Feng, Huahua; Lu, Huijun; Liu, Wenseng; Wang, Chengyu; Hu, Yi; Deng, Yongqiang; Jiang, Jiafu; Kang, Xiaoping; Yang, Honglei; Jiang, Yongqiang; Yang, Yinhui; Kargbo, David; Qian, Jun; Chen, Weijun

    2015-09-15

    During the 2014 Ebola virus disease (EVD) outbreak, a real-time quantitative polymerase chain reaction was established to detect and identify the Zaire Ebola virus. We describe the use of this assay to screen 315 clinical samples from EVD suspected person in Sierra Leone. The detection rate in blood samples was 77.81% (207/266), and there were relatively higher detection rate (79.32% and 81.42%, respectively) during the first two weeks after onset of symptoms. In the two weeks that followed, the detection rate declined to 66.67% and 25.00%, respectively. There was the highest virus load at the first week and then decreased. The detection rate in swab samples was 89.79% (44/49). This may be benefit from the included patients. 46 of 49 swab samples were collected from died patients. Taken together, the results presented here indicate that the assay specifically and sensitively detects Zaire Ebola virus. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Rapid Identification of a Cooling Tower-Associated Legionnaires' Disease Outbreak Supported by Polymerase Chain Reaction Testing of Environmental Samples, New York City, 2014-2015.

    PubMed

    Benowitz, Isaac; Fitzhenry, Robert; Boyd, Christopher; Dickinson, Michelle; Levy, Michael; Lin, Ying; Nazarian, Elizabeth; Ostrowsky, Belinda; Passaretti, Teresa; Rakeman, Jennifer; Saylors, Amy; Shamoonian, Elena; Smith, Terry-Ann; Balter, Sharon

    2018-04-01

    We investigated an outbreak of eight Legionnaires' disease cases among persons living in an urban residential community of 60,000 people. Possible environmental sources included two active cooling towers (air-conditioning units for large buildings) <1 km from patient residences, a market misting system, a community-wide water system used for heating and cooling, and potable water. To support a timely public health response, we used real-time polymerase chain reaction (PCR) to identify Legionella DNA in environmental samples within hours of specimen collection. We detected L. pneumophila serogroup 1 DNA only at a power plant cooling tower, supporting the decision to order remediation before culture results were available. An isolate from a power plant cooling tower sample was indistinguishable from a patient isolate by pulsed-field gel electrophoresis, suggesting the cooling tower was the outbreak source. PCR results were available <1 day after sample collection, and culture results were available as early as 5 days after plating. PCR is a valuable tool for identifying Legionella DNA in environmental samples in outbreak settings.

  6. Diagnosis of duck plague in waterfowl by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Nashold, S.W.; Docherty, D.E.; Brown, S.E.; Knudson, D.L.

    2000-01-01

    A recently developed polymerase chain reaction (PCR) assay was used for diagnosis of duck plague in waterfowl tissues from past and current cases of waterfowl mortality and to identify duck plague virus in combined cloacal/oral-pharyngeal swab samples from healthy mallards (Anas platyrhynchos) after a disease outbreak. The PCR was able to detect viral DNA from all the individual or pooled tissues assayed from 10 waterfowl, including liver and spleen samples from three Muscovy ducks (Cairina moschata domesticus) that did not yield virus isolates. The strong staining intensity of the PCR products from the waterfowl tissues indicated that large amounts of virus were present, even when virus was not isolated. Duck plague DNA was also detected in a cloacal swab sample from a wood duck (Aix sponsa) carcass submitted for diagnosis. The PCR assay identified duck plague DNA in 13 swab samples that produced virus isolates from carrier mallards sampled in 1981 after a duck plague die-off. The duck plague PCR clearly demonstrated the ability to quickly diagnose duck plague in suspect mortality cases and to detect virus shed by carrier waterfowl.

  7. A mechanical comparison of linear and double-looped hung supplemental heavy chain resistance to the back squat: a case study.

    PubMed

    Neelly, Kurt R; Terry, Joseph G; Morris, Martin J

    2010-01-01

    A relatively new and scarcely researched technique to increase strength is the use of supplemental heavy chain resistance (SHCR) in conjunction with plate weights to provide variable resistance to free weight exercises. The purpose of this case study was to determine the actual resistance being provided by a double-looped versus a linear hung SHCR to the back squat exercise. The linear technique simply hangs the chain directly from the bar, whereas the double-looped technique uses a smaller chain to adjust the height of the looped chain. In both techniques, as the squat descends, chain weight is unloaded onto the floor, and as the squat ascends, chain weight is progressively loaded back as resistance. One experienced and trained male weight lifter (age = 33 yr; height = 1.83 m; weight = 111.4 kg) served as the subject. Plate weight was set at 84.1 kg, approximately 50% of the subject's 1 repetition maximum. The SHCR was affixed to load cells, sampling at a frequency of 500 Hz, which were affixed to the Olympic bar. Data were collected as the subject completed the back squat under the following conditions: double-looped 1 chain (9.6 kg), double-looped 2 chains (19.2 kg), linear 1 chain, and linear 2 chains. The double-looped SHCR resulted in a 78-89% unloading of the chain weight at the bottom of the squat, whereas the linear hanging SHCR resulted in only a 36-42% unloading. The double-looped technique provided nearly 2 times the variable resistance at the top of the squat compared with the linear hanging technique, showing that attention must be given to the technique used to hang SHCR.

  8. Chained versus Post-Stratification Equating in a Linear Context: An Evaluation Using Empirical Data. Research Report. ETS RR-10-06

    ERIC Educational Resources Information Center

    Puhan, Gautam

    2010-01-01

    This study used real data to construct testing conditions for comparing results of chained linear, Tucker, and Levine-observed score equatings. The comparisons were made under conditions where the new- and old-form samples were similar in ability and when they differed in ability. The length of the anchor test was also varied to enable examination…

  9. Immunoglobulin heavy and light chains and T-cell receptor beta and gamma chains PCR assessment on cytological samples. A study comparing FTA cards and cryopreserved lymph node fine-needle cytology.

    PubMed

    Peluso, A L; Cozzolino, I; Bottiglieri, A; Lucchese, L; Di Crescenzo, R M; Langella, M; Selleri, C; Zeppa, P

    2017-06-01

    To evaluate and compare the DNA yield and quality extracted from lymph node fine needle cytology (FNC) samples stored on FTA cards to those cryopreserved, and to assess the immunoglobulin heavy and light chains (IGHK) and T-Cell receptor beta and gamma chains (TCRBG) PCR tests. DNA extractions were performed on FNC of 80 non-Hodgkin lymphomas (NHL), four myelomas and 56 benign reactive hyperplasias (BRH) cryopreserved and stored on FTA cards. The JAK2 gene was amplified to assess the DNA integrity and the IGHK/TCRBG clonality status was tested. IGHK monoclonality was found in 99% of B-cell NHL and 100% of myeloma. TCRBG monoclonality was found in 100% of T-cell NHL. TCRBG polyclonality was detected in 97% of B-cell NHL, 100% of myeloma and 96% of BRH. IGHK/TCRBG PCR data were confirmed by histological and/or follow-up controls. No differences were found in the DNA quality between cryopreservation and FTA cards storage methods. IGHK/TCRBG PCR of the lymphoproliferative process on FTA cards is comparable to those cryopreserved. FTA cards can be used to store lymph node FNC for further molecular investigations. © 2016 John Wiley & Sons Ltd.

  10. Use of the polymerase chain reaction to directly detect malaria parasites in blood samples from the Venezuelan Amazon.

    PubMed

    Laserson, K F; Petralanda, I; Hamlin, D M; Almera, R; Fuentes, M; Carrasquel, A; Barker, R H

    1994-02-01

    We have examined the reproducibility, sensitivity, and specificity of detecting Plasmodium falciparum using the polymerase chain reaction (PCR) and the species-specific probe pPF14 under field conditions in the Venezuelan Amazon. Up to eight samples were field collected from each of 48 consenting Amerindians presenting with symptoms of malaria. Sample processing and analysis was performed at the Centro Amazonico para la Investigacion y Control de Enfermedades Tropicales Simon Bolivar. A total of 229 samples from 48 patients were analyzed by PCR methods using four different P. falciparum-specific probes. One P. vivax-specific probe and by conventional microscopy. Samples in which results from PCR and microscopy differed were reanalyzed at a higher sensitivity by microscopy. Results suggest that microscopy-negative, PCR-positive samples are true positives, and that microscopy-positive and PCR-negative samples are true negatives. The sensitivity of the DNA probe/PCR method was 78% and its specificity was 97%. The positive predictive value of the PCR method was 88%, and the negative predictive value was 95%. Through the analysis of multiple blood samples from each individual, the DNA probe/PCR methodology was found to have an inherent reproducibility that was highly statistically significant.

  11. Top-Down Proteomics and Direct Surface Sampling of Neonatal Dried Blood Spots: Diagnosis of Unknown Hemoglobin Variants

    NASA Astrophysics Data System (ADS)

    Edwards, Rebecca L.; Griffiths, Paul; Bunch, Josephine; Cooper, Helen J.

    2012-11-01

    We have previously shown that liquid microjunction surface sampling of dried blood spots coupled with high resolution top-down mass spectrometry may be used for screening of common hemoglobin variants HbS, HbC, and HbD. In order to test the robustness of the approach, we have applied the approach to unknown hemoglobin variants. Six neonatal dried blood spot samples that had been identified as variants, but which could not be diagnosed by current screening methods, were analyzed by direct surface sampling top-down mass spectrometry. Both collision-induced dissociation and electron transfer dissociation mass spectrometry were employed. Four of the samples were identified as β-chain variants: two were heterozygous Hb D-Iran, one was heterozygous Hb Headington, and one was heterozygous Hb J-Baltimore. The fifth sample was identified as the α-chain variant heterozygous Hb Phnom Penh. Analysis of the sixth sample suggested that it did not in fact contain a variant. Adoption of the approach in the clinic would require speed in both data collection and interpretation. To address that issue, we have compared manual data analysis with freely available data analysis software (ProsightPTM). The results demonstrate the power of top-down proteomics for hemoglobin variant analysis in newborn samples.

  12. Observations of Carbon Chain Chemistry in the Envelopes of Low-Mass Protostars

    NASA Technical Reports Server (NTRS)

    Cordiner, M.; Charnley, S.; Buckle, J. V.; Walsh, C.; Millar, T. J.

    2012-01-01

    Observational results are reported from our surveys in the Northern Hemisphere (using the Onsala 20 m telescope) and the Southern Hemisphere (using the Mopra 22 m telescope) to search for 3 mm emission lines from carbon-chain-bearing species and other complex molecules in the envelopes of low-mass protostars. Based on a sample of approximately 60 sources, we find that carbon-chain-bearing species including HC3N (and C4H) are highly abundant in the vicinity of more than half of the observed protostars. The origin and evolution of these species, including their likely incorporation into ices in protoplanetary disks will be discussed

  13. Finite-size effects on the static properties of a single-chain magnet

    NASA Astrophysics Data System (ADS)

    Bogani, L.; Sessoli, R.; Pini, M. G.; Rettori, A.; Novak, M. A.; Rosa, P.; Massi, M.; Fedi, M. E.; Giuntini, L.; Caneschi, A.; Gatteschi, D.

    2005-08-01

    We study the role of defects in the “single-chain magnet” CoPhOMe by inserting a controlled number of diamagnetic impurities. The samples are analyzed with unprecedented accuracy with the particle induced x-ray emission technique, and with ac and dc magnetic measurements. In an external applied field the system shows an unexpected behavior, giving rise to a double peak in the susceptibility. The static thermodynamic properties of the randomly diluted Ising chain with alternating g values are then exactly obtained via a transfer matrix approach. These results are compared to the experimental behavior of CoPhOMe, showing qualitative agreement.

  14. Infectious agent screening in canine blood donors in the United Kingdom.

    PubMed

    Crawford, K; Walton, J; Lewis, D; Tasker, S; Warman, S M

    2013-08-01

    Transfusion of blood products is an important component of veterinary emergency medicine. Donors must be carefully selected to minimise risk of transmission of blood-borne infectious agents. This study was devised to assess the prevalence of such agents in healthy, non-travelled UK dogs screened as prospective donors. Ethylenediaminetetraacetic acid blood samples from dogs donating blood between August 2007 and January 2012 were screened by polymerase chain reaction for haemotropic mycoplasmas, Bartonella, Babesia, Leishmania, Ehrlichia and Anaplasma spp. Dogs with positive or inconclusive results underwent repeat polymerase chain reaction testing. Four of 262 dogs had positive or inconclusive results at initial screening. Repeat polymerase chain reaction testing in each dog was negative, and none of the dogs developed clinical signs of disease. The positive results on initial screening may have represented false positives from sample contamination or amplification of non-target DNA. It is also possible that dogs were infected at initial sampling but successfully cleared infection before repeat testing. The low number of positive results obtained suggests that prevalence of these agents in a population of healthy UK dogs is low and that use of blood products is unlikely to represent a significant risk of transmission of these diseases. © 2013 British Small Animal Veterinary Association.

  15. Efficient optical nonlinear Langmuir-Blodgett films: roles of matrix molecules

    NASA Astrophysics Data System (ADS)

    Ma, Shihong; Lu, Xingze; Liu, Liying; Han, Kui; Wang, Wencheng; Zhang, Zhi-Ming

    1996-10-01

    A novel bifat-chain amphiphilic molecule nitrogencrown (NC) was adopted as an inert material for fabrication of optical nonlinear Langmuir-Blodgett (LB) multilayers. Structural improvement in the Z-type mixed fullerene derivative (C60-Be)/NC LB multilayers samples was realized by insertion of the C60-Be molecules between two hydrophobic chains of the NC molecules. The relatively large third-order susceptibility (chi) (3)xxxx(- 3(omega) ;(omega) ,(omega) ,(omega) ) equals 2.9 multiplied by 10-19 M2V-2 (or 2.1 multiplied by 10-11 esu) was deduced by measuring third harmonic generation (THG) from the C60-Be samples. The second harmonic generation (SHG) intensity increased quadratically with the bilayer number (up to 116 bilayers) in Y-type hemicyanine (HEM)/NC interleaving LB multilayers due to improvement of the structural properties by insertion of the long hydrophobic tail of HEM molecules between two chains of NC molecules. The second-order susceptibility (chi) (2)zxx(-2(omega) ;(omega) ,(omega) ) equals 18 pM V-1 (or 4.35 multiplied by 10-8 esu) was obtained by measuring SHG from the HEM samples. The NC molecule has attractive features as a matrix material in fabrications of LB multilayers made from optically nonlinear materials with hydrophobic long tails or ball-like molecules.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bertholon, François; Harant, Olivier; Bourlon, Bertrand

    This article introduces a joined Bayesian estimation of gas samples issued from a gas chromatography column (GC) coupled with a NEMS sensor based on Giddings Eyring microscopic molecular stochastic model. The posterior distribution is sampled using a Monte Carlo Markov Chain and Gibbs sampling. Parameters are estimated using the posterior mean. This estimation scheme is finally applied on simulated and real datasets using this molecular stochastic forward model.

  17. Application and Comparative Evaluation of Fluorescent Antibody, Immunohistochemistry and Reverse Transcription Polymerase Chain Reaction Tests for the Detection of Rabies Virus Antigen or Nucleic Acid in Brain Samples of Animals Suspected of Rabies in India.

    PubMed

    Prabhu, K Nithin; Isloor, Shrikrishna; Veeresh, B Hanchinal; Rathnamma, Doddamane; Sharada, R; Das, Lekshmi J; Satyanarayana, M L; Hegde, Nagendra R; Rahman, Sira Abdul

    2018-02-28

    Accurate and early diagnosis of animal rabies is critical for undertaking public health measures. Whereas the direct fluorescent antibody (DFA) technique is the recommended test, the more convenient, direct rapid immunochemistry test (dRIT), as well as the more sensitive, reverse transcription polymerase chain reaction (RT-PCR), have recently been employed for the laboratory diagnosis of rabies. We compared the three methods on brain samples from domestic (dog, cat, cattle, buffalo, horse, pig and goat) and wild (leopard, wolf and jackal) animals from various parts of India. Of the 257 samples tested, 167 were positive by all the three tests; in addition, 35 of the 36 decomposed samples were positive by RT-PCR. This is the first study in which such large number of animal samples have been subjected to the three tests simultaneously. The results confirm 100% corroboration between DFA and dRIT, buttress the applicability of dRIT in the simple and rapid diagnosis of rabies in animals, and reaffirm the suitability of RT-PCR for samples unfit for testing either by DFA or dRIT.

  18. Population Education in Science: Some Sample Lessons.

    ERIC Educational Resources Information Center

    United Nations Educational, Scientific, and Cultural Organization, Bangkok (Thailand). Regional Office for Education in Asia and Oceania.

    This science teacher's manual contains nine sample population education lessons adapted from materials produced in several countries in Asia and Oceania. Activities are designed for lower primary through high school students. Included are class discussions, small group activities, and a role-playing situation. Food chains, human dependence upon…

  19. Relationship Between Ebola Virus Real-Time Quantitative Polymerase Chain Reaction-Based Threshold Cycle Value and Virus Isolation From Human Plasma.

    PubMed

    Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F

    2015-10-01

    We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  20. Determination of selected fatty acids in dried sweat spot using gas chromatography with flame ionization detection.

    PubMed

    Kanďár, Roman; Drábková, Petra; Andrlová, Lenka; Kostelník, Adam; Čegan, Alexander

    2016-11-01

    A method is described for the determination of fatty acids in dried sweat spot and plasma samples using gas chromatography with flame ionization detection. Plasma and dried sweat spot samples were obtained from a group of blood donors. The sweat was collected from each volunteer during exercise. Sweat was spotted onto collection paper containing butylated hydroxytoluene. Fatty acids were derivatized with acetyl chloride in methanol to form methyl esters of fatty acids. The fatty acids in dried sweat spot samples treated with butylated hydroxytoluene and stored at -20°C were stable for 3 months. Our results indicate that sweat contains, among fatty acids with short chain, also fatty acids with long chain and unsaturated fatty acids. Linear relationships between percentage content of selected fatty acids in dried sweat spot and plasma were observed. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Raising the PT -transition threshold by strong coupling to neutral chains

    NASA Astrophysics Data System (ADS)

    Agarwal, Kaustubh S.; Pathak, Rajeev K.; Joglekar, Yogesh N.

    2018-04-01

    The PT -symmetry-breaking threshold in discrete realizations of systems with balanced gain and loss is determined by the effective coupling between the gain and loss sites. In one-dimensional chains, this threshold is maximum when the two sites are closest to each other or the farthest. We investigate the fate of this threshold in the presence of parallel, strongly coupled, Hermitian (neutral) chains and find that it is increased by a factor proportional to the number of neutral chains. We present numerical results and analytical arguments for this enhancement. We then consider the effects of adding neutral sites to PT -symmetric dimer and trimer configurations and show that the threshold is more than doubled, or tripled by their presence. Our results provide a surprising way to engineer the PT threshold in experimentally accessible samples.

  2. No implication of Simian virus 40 in pathogenesis of malignant pleural mesothelioma in Slovenia.

    PubMed

    Hmeljak, Julija; Kern, Izidor; Cör, Andrej

    2010-01-01

    Malignant mesothelioma is predominantly caused by asbestos exposure, although the association of Simian virus 40 in its pathogenesis is currently still under debate. Simian virus 40, a DNA rhesus monkey virus with oncogenic properties, accidentally contaminated early batches of polio vaccine in the 1960s. In the 1990s, viral sequences and proteins were discovered in several human tumors, which triggered research to find a link between Simian virus 40 and human cancers, especially malignant mesothelioma. The aim of our study was to establish an effective laboratory procedure for Simian virus 40 detection and to investigate the presence of Simian virus 40 DNA and small t antigen in mesothelioma samples from Slovenian patients. Paraffin-embedded malignant pleural mesothelioma specimens from 103 Slovenian patients were collected and used for total DNA isolation and real-time polymerase chain reaction for Simian virus 40 small t and large T DNA analysis. Special attention was devoted to primer design, good laboratory practice and polymerase chain reaction contamination prevention. Polymerase chain reaction products were sequenced and BLAST aligned. One 5 microm thick paraffin section from each patient's tissue block was stained with hematoxylin and eosin for histological typing and one for immunohistochemical detection of Simian virus 40 small t antigen using a monoclonal antibody against Simian virus 40 (Pab280). SV40-expressing Wi-38 cells were used as positive control in both PCR and immunohistochemistry. In real-time polymerase chain reaction analyses, only 4 samples gave products with primer pairs amplifying small t antigen and were inconsistent and poorly reproducible. BLAST alignment showed no homology with any deposited SV40 sequences. No immunopositive staining for SV40 small t antigen was found in any of the samples. We found no evidence of SV40 presence in tissue samples from 103 Slovenian patients with malignant pleural mesothelioma. Asbestos exposure remains the main risk factor for malignant pleural mesothelioma in Slovenia.

  3. Landscaping the structures of GAVI country vaccine supply chains and testing the effects of radical redesign.

    PubMed

    Lee, Bruce Y; Connor, Diana L; Wateska, Angela R; Norman, Bryan A; Rajgopal, Jayant; Cakouros, Brigid E; Chen, Sheng-I; Claypool, Erin G; Haidari, Leila A; Karir, Veena; Leonard, Jim; Mueller, Leslie E; Paul, Proma; Schmitz, Michelle M; Welling, Joel S; Weng, Yu-Ting; Brown, Shawn T

    2015-08-26

    Many of the world's vaccine supply chains do not adequately provide vaccines, prompting several questions: how are vaccine supply chains currently structured, are these structures closely tailored to individual countries, and should these supply chains be radically redesigned? We segmented the 57 GAVI-eligible countries' vaccine supply chains based on their structure/morphology, analyzed whether these segments correlated with differences in country characteristics, and then utilized HERMES to develop a detailed simulation model of three sample countries' supply chains and explore the cost and impact of various alternative structures. The majority of supply chains (34 of 57) consist of four levels, despite serving a wide diversity of geographical areas and population sizes. These four-level supply chains loosely fall into three clusters [(1) 18 countries relatively more bottom-heavy, i.e., many more storage locations lower in the supply chain, (2) seven with relatively more storage locations in both top and lower levels, and (3) nine comparatively more top-heavy] which do not correlate closely with any of the country characteristics considered. For all three cluster types, our HERMES modeling found that simplified systems (a central location shipping directly to immunization locations with a limited number of Hubs in between) resulted in lower operating costs. A standard four-tier design template may have been followed for most countries and raises the possibility that simpler and more tailored designs may be warranted. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Comparison of the nutrient content of children's menu items at US restaurant chains, 2010-2014.

    PubMed

    Deierlein, Andrea L; Peat, Kay; Claudio, Luz

    2015-08-15

    To determine changes in the nutritional content of children's menu items at U.S. restaurant chains between 2010 and 2014. The sample consisted of 13 sit down and 16 fast-food restaurant chains ranked within the top 50 US chains in 2009. Nutritional information was accessed in June-July 2010 and 2014. Descriptive statistics were calculated for nutrient content of main dishes and side dishes, as well as for those items that were added, removed, or unchanged during the study period. Nutrient content of main dishes did not change significantly between 2010 and 2014. Approximately one-third of main dishes at fast-food restaurant chains and half of main dishes at sit down restaurant chains exceeded the 2010 Dietary Guidelines for Americans recommended levels for sodium, fat, and saturated fat in 2014. Improvements in nutrient content were observed for side dishes. At sit down restaurant chains, added side dishes contained over 50% less calories, fat, saturated fat, and sodium, and were more likely to contain fruits/vegetables compared to removed sides (p < 0.05 for all comparisons). Added side dishes at fast-food restaurant chains contained less saturated fat (p < 0.05). The majority of menu items, especially main dishes, available to children still contain high amounts of calories, fat, saturated fat, and sodium. Efforts must be made by the restaurant industry and policy makers to improve the nutritional content of children's menu items at restaurant chains to align with the Dietary Guidelines for Americans. Additional efforts are necessary to help parents and children make informed choices when ordering at restaurant chains.

  5. IgE reactivity to alpha1 and alpha2 chains of bovine type 1 collagen in children with bovine gelatin allergy.

    PubMed

    Sakaguchi, M; Hori, H; Hattori, S; Irie, S; Imai, A; Yanagida, M; Miyazawa, H; Toda, M; Inouye, S

    1999-09-01

    Anaphylactic reactions to measles, mumps, and rubella vaccines, including gelatin as a stabilizer, have been reported. It had been found that most of these reactions to live vaccines are caused by the bovine gelatin included in these vaccines. Gelatin mainly includes denatured type I collagen, which consists of alpha1 and alpha2 chains. The current study was designed to investigate the IgE reactivity to alpha1 and alpha2 chains of bovine type I collagen in gelatin-sensitive children. Serum samples were taken from 10 children who had anaphylaxis to the vaccines and high levels of specific IgE to bovine gelatin. Bovine type I collagen was isolated from bovine skin and then separated to alpha1 and alpha2 chains by column chromatography. IgE reactivity to denatured type I collagen and its alpha1 and alpha2 chains was analyzed by immunoblotting, ELISA, and histamine release from the mast cells passive sensitized with IgE antibodies in pooled serum of the children. All children had specific IgE to bovine type I collagen. Furthermore, IgE antibodies in their sera reacted with the alpha;2 chain but not with the alpha1 chain. Similarly, the mast cells sensitized with pooled sera in the children showed alpha2 chain-specific histamine release but not alpha1 chain-specific histamine release. In gelatin allergy denatured bovine type I collagen is a major allergen and IgE-binding sites exist in the alpha2 chain of type I collagen.

  6. Chemical characterization of detrital sugar chains with peptides in oceanic surface particulate organic matter

    NASA Astrophysics Data System (ADS)

    Tsukasaki, A.; Nishida, T.; Tanoue, E.

    2016-02-01

    For better understanding of the dynamics of organic matter in the ocean interior, particulate organic matter (POM) in oceanic surface water is a key material as a starting material in food chain and biological carbon pump, and the source of dissolved organic matter. POM consists of a mixture of non-living POM (detritus) and small amount of living POM (organisms). Particulate combined amino acids (PCAAs) are one of the major components of POM and the most important source of nitrogen and carbon for heterotrophic organisms in marine environments. In our previous studies of molecular-level characterization of PCAAs using electrophoretic separation (SDS-PAGE: sodium dodecyl sulfate-polyacrylamide gel electrophoresis) with specific detection of protein/peptide and sugar chains, we reported that most of PCAAs existed as small-sized peptide chains with carbohydrate-rich remnants. Although carbohydrates are one of the major carbon components of POM, the details of molecular-level structures including sugar chains are unknown. In this study, we applied electrophoretic separation for sugar chains (FACE: fluorophore-assisted carbohydrate electrophoresis) to the POM samples collected from the surface water of the Pacific Ocean. The results showed that sugar chains with various degree of polymerization were detected in POM. The possible roles of such sugar chains in marine biogeochemical cycle of organic matter are discussed in the presentation.

  7. Absolute nuclear material assay

    DOEpatents

    Prasad, Manoj K [Pleasanton, CA; Snyderman, Neal J [Berkeley, CA; Rowland, Mark S [Alamo, CA

    2012-05-15

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  8. Absolute nuclear material assay

    DOEpatents

    Prasad, Manoj K [Pleasanton, CA; Snyderman, Neal J [Berkeley, CA; Rowland, Mark S [Alamo, CA

    2010-07-13

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  9. Multiple Myeloma and Its Precursor Disease Among Firefighters Exposed to the World Trade Center Disaster.

    PubMed

    Landgren, Ola; Zeig-Owens, Rachel; Giricz, Orsolya; Goldfarb, David; Murata, Kaznouri; Thoren, Katie; Ramanathan, Lakshmi; Hultcrantz, Malin; Dogan, Ahmet; Nwankwo, George; Steidl, Ulrich; Pradhan, Kith; Hall, Charles B; Cohen, Hillel W; Jaber, Nadia; Schwartz, Theresa; Crowley, Laura; Crane, Michael; Irby, Shani; Webber, Mayris P; Verma, Amit; Prezant, David J

    2018-06-01

    The World Trade Center (WTC) attacks on September 11, 2001, created an unprecedented environmental exposure to known and suspected carcinogens suggested to increase the risk of multiple myeloma. Multiple myeloma is consistently preceded by the precursor states of monoclonal gammopathy of undetermined significance (MGUS) and light-chain MGUS, detectable in peripheral blood. To characterize WTC-exposed firefighters with a diagnosis of multiple myeloma and to conduct a screening study for MGUS and light-chain MGUS. Case series of multiple myeloma in firefighters diagnosed between September 11, 2001, and July 1, 2017, together with a seroprevalence study of MGUS in serum samples collected from Fire Department of the City of New York (FDNY) firefighters between December 2013 and October 2015. Participants included all WTC-exposed FDNY white, male firefighters with a confirmed physician diagnosis of multiple myeloma (n = 16) and WTC-exposed FDNY white male firefighters older than 50 years with available serum samples (n = 781). WTC exposure defined as rescue and/or recovery work at the WTC site between September 11, 2001, and July 25, 2002. Multiple myeloma case information, and age-adjusted and age-specific prevalence rates for overall MGUS (ie, MGUS and light-chain MGUS), MGUS, and light-chain MGUS. Sixteen WTC-exposed white male firefighters received a diagnosis of multiple myeloma after September 11, 2001; median age at diagnosis was 57 years (interquartile range, 50-68 years). Serum/urine monoclonal protein isotype/free light-chain data were available for 14 cases; 7 (50%) had light-chain multiple myeloma. In a subset of 7 patients, myeloma cells were assessed for CD20 expression; 5 (71%) were CD20 positive. In the screening study, we assayed peripheral blood from 781 WTC-exposed firefighters. The age-standardized prevalence rate of MGUS and light-chain MGUS combined was 7.63 per 100 persons (95% CI, 5.45-9.81), 1.8-fold higher than rates from the Olmsted County, Minnesota, white male reference population (relative rate, 1.76; 95% CI, 1.34-2.29). The age-standardized prevalence rate of light-chain MGUS was more than 3-fold higher than in the same reference population (relative rate, 3.13; 95% CI, 1.99-4.93). Environmental exposure to the WTC disaster site is associated with myeloma precursor disease (MGUS and light-chain MGUS) and may be a risk factor for the development of multiple myeloma at an earlier age, particularly the light-chain subtype.

  10. Groundwater sampling methods using glass wool filtration to trace human enteric viruses in Madison, Wisconsin

    USDA-ARS?s Scientific Manuscript database

    Human enteric viruses have been detected in the Madison, Wisconsin deep municipal well system. Earlier projects by the Wisconsin Geological and Natural History Survey (WGNHS) have used glass wool filters to sample groundwater for these viruses directly from the deep municipal wells. Polymerase chain...

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Epstein, N.; Than, K.A. Culp, K.M.

    Alpha-thalassemia (alpha-thal) is characterized by the absence or reduction in synthesis of the alpha-globin chain due to either deletions or other abnormalities involving the alpha-globin genes located on the short arm of chromosome 16. The diploid cells have four alpha chain genes. The deletion of one, two, three or all four of these genes could result in mild to a complete alpha chain deficiency known as the Hydrops fetalis syndrome or alpha-thal-1, which causes fetal death. It is important to develop a sensitive test to detect carriers of alpha-thal-1 trait for genetic counseling. It has recently been observed that themore » presence of minute amounts of zeta-globin chains (0.01-1%) could serve as a biological marker of alpha-thal carriers. Because high sensitivity is required, we constructed a monoclonal antibody-based immunoassay which can be analyzed either by colorimetric or fluorimetric methods. By testing blood samples from individuals of Southeast Asian ancestry, we were able to show that various forms and combinations of deletions or inactivations of two or three alpha-globin genes results in alpha-thalassemia conditions that have elevated levels of the zeta-chain. Sensitivity achieved in these tests was < 0.1% zeta chain, or as low as 5 ng zeta-chain. Data correlate with results from reversed phase HPLC.« less

  12. Feruloylated and nonferuloylated arabino-oligosaccharides from sugar beet pectin selectively stimulate the growth of Bifidobacterium spp. in human fecal in vitro fermentations.

    PubMed

    Holck, Jesper; Lorentzen, Andrea; Vigsnæs, Louise K; Licht, Tine R; Mikkelsen, Jørn D; Meyer, Anne S

    2011-06-22

    The side chains of the rhamnogalacturonan I fraction in sugar beet pectin are particularly rich in arabinan moieties, which may be substituted with feruloyl groups. In this work the arabinan-rich fraction resulting from sugar beet pulp based pectin production was separated by Amberlite XAD hydrophobic interaction and membrane separation into four fractions based on feruloyl substitution and arabino-oligosaccharide chain length: short-chain (DP 2-10) and long-chain (DP 7-14) feruloylated and nonferuloylated arabino-oligosaccharides, respectively. HPAEC, SEC, and MALDI-TOF/TOF analyses of the fractions confirmed the presence of singly and doubly substituted feruloylated arabino-oligosaccharides in the feruloyl-substituted fractions. In vitro microbial fermentation by human fecal samples (n = 6 healthy human volunteers) showed a selective stimulation of bifidobacteria by both the feruloylated and the nonferuloylated long-chain arabino-oligosaccharides to the same extent as the prebiotic fructo-oligosaccharides control. None of the fractions stimulated the growth of the potential pathogen Clostridium difficile in monocultures. This work provides a first report on the separation of potentially bioactive feruloylated arabino-oligosaccharides from sugar beet pulp and an initial indication of the potentially larger bifidogenic effect of relatively long-chain arabino-oligosaccharides as opposed to short-chain arabino-oligosaccharides.

  13. Expression and Functional Properties of an Anti-Triazophos High-Affinity Single-Chain Variable Fragment Antibody with Specific Lambda Light Chain

    PubMed Central

    Liu, Rui; Liang, Xiao; Xiang, Dandan; Guo, Yirong; Liu, Yihua; Zhu, Guonian

    2016-01-01

    Triazophos is a widely used organophosphorous insecticide that has potentially adverse effects to organisms. In the present study, a high-affinity single-chain variable fragment (scFv) antibody with specific lambda light chain was developed for residue monitoring. First, the specific variable regions were correctly amplified from a hybridoma cell line 8C10 that secreted monoclonal antibody (mAb) against triazophos. The regions were then assembled as scFv via splicing by overlap extension polymerase chain reaction. Subsequently, the recombinant anti-triazophos scFv-8C10 was successfully expressed in Escherichia coli strain HB2151 in soluble form, purified through immobilized metal ion affinity chromatography, and verified via Western blot and peptide mass fingerprinting analyses. Afterward, an indirect competitive enzyme-linked immunosorbent assay was established based on the purified anti-triazophos scFv-8C10 antibody. The assay exhibited properties similar to those based on the parent mAb, with a high sensitivity (IC50 of 1.73 ng/mL) to triazophos and no cross reaction for other organophosphorus pesticides; it was reliable in detecting triazophos residues in spiked water samples. Moreover, kinetic measurement using a surface plasmon resonance biosensor indicated that the purified scFv-8C10 antibody had a high affinity of 1.8 × 10−10 M and exhibited good binding stability. Results indicated that the recombinant high-affinity scFv-8C10 antibody was an effective detection material that would be promising for monitoring triazophos residues in environment samples. PMID:27338340

  14. Solubilisation of poorly water-soluble drugs during in vitro lipolysis of medium- and long-chain triacylglycerols.

    PubMed

    Christensen, Janne Ørskov; Schultz, Kirsten; Mollgaard, Birgitte; Kristensen, Henning Gjelstrup; Mullertz, Anette

    2004-11-01

    The partitioning of poorly soluble drugs into an aqueous micellar phase was exploited using an in vitro lipid digestion model, simulating the events taking place during digestion of acylglycerols in the duodenum. The aqueous micellar phase was isolated after ultracentrifugation of samples obtained at different degrees of triacylglycerol hydrolysis. Flupentixol, 1'-[4-[1-(4-fluorophenyl)-1-H-indol-3-yl]-1-butyl]spiro[iso-benzofuran-1(3H), 4' piperidine] (LU 28-179) and probucol were studied. The effect of the alkyl chain length of the triacylglycerol was studied using a medium-chain triacylglycerol (MCT) and a long-chain triacylglycerol (LCT), respectively. In general, an oil solution was used as the lipid source in the model. Samples were analysed in regard to micellar size, lipid composition and drug concentration. During lipolysis, the content of lipolytic products in the aqueous micellar phase increased. The micellar size (R(H) approximately 3 nm) only increased when long-chain lipolytic products were incorporated in the mixed micelles (R(H) approximately 7.8 nm). Flupentixol was quickly transferred to the mixed micelles due to high solubility in this phase (100% released). A tendency towards higher solubilisation of LU 28-179, when it was administered in the LCT (approximately 24% released) compared to when it was administered in the MCT (approximately 15% released) at 70% hydrolysis, and a lagphase was observed. There was no difference in the solubilisation of probucol using MCT or LCT ( approximately 20% released), respectively. Differences in the physicochemical properties of the drugs resulted in differences in their distribution between the phases arising during lipolysis.

  15. DNA motif alignment by evolving a population of Markov chains.

    PubMed

    Bi, Chengpeng

    2009-01-30

    Deciphering cis-regulatory elements or de novo motif-finding in genomes still remains elusive although much algorithmic effort has been expended. The Markov chain Monte Carlo (MCMC) method such as Gibbs motif samplers has been widely employed to solve the de novo motif-finding problem through sequence local alignment. Nonetheless, the MCMC-based motif samplers still suffer from local maxima like EM. Therefore, as a prerequisite for finding good local alignments, these motif algorithms are often independently run a multitude of times, but without information exchange between different chains. Hence it would be worth a new algorithm design enabling such information exchange. This paper presents a novel motif-finding algorithm by evolving a population of Markov chains with information exchange (PMC), each of which is initialized as a random alignment and run by the Metropolis-Hastings sampler (MHS). It is progressively updated through a series of local alignments stochastically sampled. Explicitly, the PMC motif algorithm performs stochastic sampling as specified by a population-based proposal distribution rather than individual ones, and adaptively evolves the population as a whole towards a global maximum. The alignment information exchange is accomplished by taking advantage of the pooled motif site distributions. A distinct method for running multiple independent Markov chains (IMC) without information exchange, or dubbed as the IMC motif algorithm, is also devised to compare with its PMC counterpart. Experimental studies demonstrate that the performance could be improved if pooled information were used to run a population of motif samplers. The new PMC algorithm was able to improve the convergence and outperformed other popular algorithms tested using simulated and biological motif sequences.

  16. Polychlorinated naphthalenes and polychlorinated biphenyls in benthic organisms of a Great Lakes food chain.

    PubMed

    Hanari, N; Kannan, K; Horii, Y; Taniyasu, S; Yamashita, N; Jude, D J; Berg, M B

    2004-07-01

    Invasion of zebra mussels, Dreissena polymorpha, and round gobies, Neogobius melanostomus, into the Great Lakes has altered the food web structure and thereby the pathways of toxic contaminants such as polychlorinated biphenyls (PCBs) and polychlorinated naphthalenes (PCNs). In this study, concentrations of PCNs and PCBs were measured in organisms of a Great Lakes benthic food chain encompassing zebra mussels. PCNs were found in all of the benthic organisms, including phytoplankton, algae, amphipods, zebra mussels, round goby, and smallmouth bass, Micropterus dolomieui. Concentrations of PCNs were greater in samples collected from the Raisin River than in samples from the St. Clair River. Biomagnification factors (BMF) for tetra- through octa-CN congeners in going from algae to zebra mussels from the St. Clair River ranged from 3 to 10. No major biomagnification of PCNs was found in round gobies, when concentrations were related to those in their prey species, zebra mussels. The biomagnification potential of PCNs appears to be similar to that of PCBs in the benthic food chain investigated in this study, despite the fact that PCNs may be metabolized by organisms higher in the food chain. Among several congeners, the BMFs of PCN congeners 35, 42, 43/45, 52/60, 58, and 66/67 were highest in round gobies. PCNs accounted for 1-22% of the total TEQs (toxic equivalents) of PCBs and PCNs in benthic organisms analyzed in this study. PCB congener 126 was the major contributor to TEQs, accounting for 72-99% of the PCB-TEQs in the food chain organisms analyzed.

  17. Replica exchange and expanded ensemble simulations as Gibbs sampling: simple improvements for enhanced mixing.

    PubMed

    Chodera, John D; Shirts, Michael R

    2011-11-21

    The widespread popularity of replica exchange and expanded ensemble algorithms for simulating complex molecular systems in chemistry and biophysics has generated much interest in discovering new ways to enhance the phase space mixing of these protocols in order to improve sampling of uncorrelated configurations. Here, we demonstrate how both of these classes of algorithms can be considered as special cases of Gibbs sampling within a Markov chain Monte Carlo framework. Gibbs sampling is a well-studied scheme in the field of statistical inference in which different random variables are alternately updated from conditional distributions. While the update of the conformational degrees of freedom by Metropolis Monte Carlo or molecular dynamics unavoidably generates correlated samples, we show how judicious updating of the thermodynamic state indices--corresponding to thermodynamic parameters such as temperature or alchemical coupling variables--can substantially increase mixing while still sampling from the desired distributions. We show how state update methods in common use can lead to suboptimal mixing, and present some simple, inexpensive alternatives that can increase mixing of the overall Markov chain, reducing simulation times necessary to obtain estimates of the desired precision. These improved schemes are demonstrated for several common applications, including an alchemical expanded ensemble simulation, parallel tempering, and multidimensional replica exchange umbrella sampling.

  18. Determination of haemolytic and non haemolytic genes profiles of Bacillus cereus strains isolated from food samples by polymerase chain reaction (pcr) technique

    NASA Astrophysics Data System (ADS)

    Jawad, Nisreen; Ahemd, Asmat; Abdullah, Aminah

    2018-04-01

    The aim of this study was to investigate the presence of Bacillus cereus and detection of enterotoxigenic genes in food samples by utilizing a Polymerase Chain Reaction technique (PCR). In this study the providence of B. cereus was carried out to food samples. The B. cereus isolates were investigated for enterotoxigenic gene. The cooked seafood, and raw milk samples were purchased from several restaurants and market in the area of (Bangi, Kajang, Serdang and UKM) Selangor, Malaysia. A total of 60 samples have been analyzed. B. cereus contamination has been formed between 1.4×105 - 3×105 cfu/mL of cooked seafood and raw milk samples. Five colonies have been detected as B. cereus using biochemical test. All B. cereus isolates named BC1 to BC27, were characterized for haemolytic enterotoxin (HBL) complex encoding genes (hblA), non-haemolytic enterotoxin encoding gene (NheA). 10 isolates have been reported to be positive towards hblA and 12 isolates were positive towards NheA. The presence of B. cereus and their enterotoxigenic genes in cooked seafood and raw milk from to food samples obtained may pose a potential risk for public health.

  19. MontePython 3: Parameter inference code for cosmology

    NASA Astrophysics Data System (ADS)

    Brinckmann, Thejs; Lesgourgues, Julien; Audren, Benjamin; Benabed, Karim; Prunet, Simon

    2018-05-01

    MontePython 3 provides numerous ways to explore parameter space using Monte Carlo Markov Chain (MCMC) sampling, including Metropolis-Hastings, Nested Sampling, Cosmo Hammer, and a Fisher sampling method. This improved version of the Monte Python (ascl:1307.002) parameter inference code for cosmology offers new ingredients that improve the performance of Metropolis-Hastings sampling, speeding up convergence and offering significant time improvement in difficult runs. Additional likelihoods and plotting options are available, as are post-processing algorithms such as Importance Sampling and Adding Derived Parameter.

  20. Application of Nitrogen and Carbon Stable Isotopes (δ15N and δ13C) to Quantify Food Chain Length and Trophic Structure

    PubMed Central

    Perkins, Matthew J.; McDonald, Robbie A.; van Veen, F. J. Frank; Kelly, Simon D.; Rees, Gareth; Bearhop, Stuart

    2014-01-01

    Increasingly, stable isotope ratios of nitrogen (δ15N) and carbon (δ13C) are used to quantify trophic structure, though relatively few studies have tested accuracy of isotopic structural measures. For laboratory-raised and wild-collected plant-invertebrate food chains spanning four trophic levels we estimated nitrogen range (NR) using δ15N, and carbon range (CR) using δ13C, which are used to quantify food chain length and breadth of trophic resources respectively. Across a range of known food chain lengths we examined how NR and CR changed within and between food chains. Our isotopic estimates of structure are robust because they were calculated using resampling procedures that propagate variance in sample means through to quantified uncertainty in final estimates. To identify origins of uncertainty in estimates of NR and CR, we additionally examined variation in discrimination (which is change in δ15N or δ13C from source to consumer) between trophic levels and among food chains. δ15N discrimination showed significant enrichment, while variation in enrichment was species and system specific, ranged broadly (1.4‰ to 3.3‰), and importantly, propagated variation to subsequent estimates of NR. However, NR proved robust to such variation and distinguished food chain length well, though some overlap between longer food chains infers a need for awareness of such limitations. δ13C discrimination was inconsistent; generally no change or small significant enrichment was observed. Consequently, estimates of CR changed little with increasing food chain length, showing the potential utility of δ13C as a tracer of energy pathways. This study serves as a robust test of isotopic quantification of food chain structure, and given global estimates of aquatic food chains approximate four trophic levels while many food chains include invertebrates, our use of four trophic level plant-invertebrate food chains makes our findings relevant for a majority of ecological systems. PMID:24676331

  1. The heterogeneity of segmental dynamics of filled EPDM by (1)H transverse relaxation NMR.

    PubMed

    Moldovan, D; Fechete, R; Demco, D E; Culea, E; Blümich, B; Herrmann, V; Heinz, M

    2011-01-01

    Residual second moment of dipolar interactions M(2) and correlation time segmental dynamics distributions were measured by Hahn-echo decays in combination with inverse Laplace transform for a series of unfilled and filled EPDM samples as functions of carbon-black N683 filler content. The fillers-polymer chain interactions which dramatically restrict the mobility of bound rubber modify the dynamics of mobile chains. These changes depend on the filler content and can be evaluated from distributions of M(2). A dipolar filter was applied to eliminate the contribution of bound rubber. In the first approach the Hahn-echo decays were fitted with a theoretical relationship to obtain the average values of the (1)H residual second moment and correlation time <τ(c)>. For the mobile EPDM segments the power-law distribution of correlation function was compared to the exponential correlation function and found inadequate in the long-time regime. In the second approach a log-Gauss distribution for the correlation time was assumed. Furthermore, using an averaged value of the correlation time, the distributions of the residual second moment were determined using an inverse Laplace transform for the entire series of measured samples. The unfilled EPDM sample shows a bimodal distribution of residual second moments, which can be associated to the mobile polymer sub-chains (M(2) ≅ 6.1 rad (2) s(-2)) and the second one associated to the dangling chains M(2) ≅ 5.4 rad(2) s(-2)). By restraining the mobility of bound rubber, the carbon-black fillers induce diversity in the segmental dynamics like the apparition of a distinct mobile component and changes in the distribution of mobile and free-end polymer segments. Copyright © 2010 Elsevier Inc. All rights reserved.

  2. The heterogeneity of segmental dynamics of filled EPDM by 1H transverse relaxation NMR

    NASA Astrophysics Data System (ADS)

    Moldovan, D.; Fechete, R.; Demco, D. E.; Culea, E.; Blümich, B.; Herrmann, V.; Heinz, M.

    2011-01-01

    Residual second moment of dipolar interactions M∼2 and correlation time segmental dynamics distributions were measured by Hahn-echo decays in combination with inverse Laplace transform for a series of unfilled and filled EPDM samples as functions of carbon-black N683 filler content. The fillers-polymer chain interactions which dramatically restrict the mobility of bound rubber modify the dynamics of mobile chains. These changes depend on the filler content and can be evaluated from distributions of M∼2. A dipolar filter was applied to eliminate the contribution of bound rubber. In the first approach the Hahn-echo decays were fitted with a theoretical relationship to obtain the average values of the 1H residual second moment and correlation time <τc>. For the mobile EPDM segments the power-law distribution of correlation function was compared to the exponential correlation function and found inadequate in the long-time regime. In the second approach a log-Gauss distribution for the correlation time was assumed. Furthermore, using an averaged value of the correlation time, the distributions of the residual second moment were determined using an inverse Laplace transform for the entire series of measured samples. The unfilled EPDM sample shows a bimodal distribution of residual second moments, which can be associated to the mobile polymer sub-chains (M∼2≅6.1 rad s) and the second one associated to the dangling chains M∼2≅5.4 rad s). By restraining the mobility of bound rubber, the carbon-black fillers induce diversity in the segmental dynamics like the apparition of a distinct mobile component and changes in the distribution of mobile and free-end polymer segments.

  3. Separating effective high density polyethylene segments from olefin block copolymers using high temperature liquid chromatography with a preloaded discrete adsorption promoting solvent barrier.

    PubMed

    Chatterjee, Tirtha; Rickard, Mark A; Pearce, Eric; Pangburn, Todd O; Li, Yongfu; Lyons, John W; Cong, Rongjuan; deGroot, A Willem; Meunier, David M

    2016-09-23

    Recent advances in catalyst technology have enabled the synthesis of olefin block copolymers (OBC). One type is a "hard-soft" OBC with a high density polyethylene (HDPE) block and a relatively low density polyethylene (VLDPE) block targeted as thermoplastic elastomers. Presently, one of the major challenges is to fractionate HDPE segments from the other components in an experimental OBC sample (block copolymers and VLDPE segments). Interactive high temperature liquid chromatography (HTLC) is ineffective for OBC separation as the HDPE segments and block copolymer chains experience nearly identical enthalpic interactions with the stationary phase and co-elute. In this work we have overcome this challenge by using liquid chromatography under the limiting conditions of desorption (LC LCD). A solvent plug (discrete barrier) is introduced in front of the sample which specifically promotes the adsorption of HDPE segments on the stationary phase (porous graphitic carbon). Under selected thermodynamic conditions, VLDPE segments and block copolymer chains crossed the barrier while HDPE segments followed the pore-included barrier solvent and thus enabled separation. The barrier solvent composition was optimized and the chemical composition of fractionated polymer chains was investigated as a function of barrier solvent strength using an online Fourier-transform infrared (FTIR) detector. Our study revealed that both the HDPE segments as well as asymmetric block copolymer chains (HDPE block length≫VLDPE block length) are retained in the separation and the barrier strength can be tailored to retain a particular composition. At the optimum barrier solvent composition, this method can be applied to separate effective HDPE segments from the other components, which has been demonstrated using an experimental OBC sample. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Escherichia coli O157:H7 outbreak associated with consumption of ground beef, June-July 2002.

    PubMed

    Vogt, Richard L; Dippold, Laura

    2005-01-01

    A case-control and environmental study tested the hypothesis that purchasing and eating ground beef from a specific source was the cause of a cluster of cases of hemolytic uremic syndrome (HUS) and Escherichia coli (E. coli) O157:H7 gastroenteritis. A case-control study comparing risk factors was conducted over the telephone on nine case-patients with 23 selected controls. An environmental investigation was conducted that consisted of reviewing beef handling practices at a specific local supermarket and obtaining ground beef samples from the store and two households with case-patients. The analysis of the case-control study showed that eight case-patients (89%) purchased ground beef at Grocery Chain A compared with four controls who did not develop illness (17%) (matched odds ratio=undefined; 95% confidence interval 2.8, infinity; p=0.006). The environmental investigation showed that Grocery Chain A received meat from Meatpacker A. Laboratory analysis of meat samples from Meatpacker A and Grocery Chain A and stool samples from some patients recovered an identical strain of E. coli O157:H7 according to pulse-field gel electrophoresis. Both the case-control and environmental studies showed that purchasing ground beef at Grocery Chain A, which received ground beef from Meatpacker A, was the major risk factor for illness in eight case-patients; the ninth case-patient was found to be unrelated to the outbreak. Furthermore, meat from Meatpacker A was associated with a nationwide outbreak of E. coli O157:H7 illness that resulted in the second largest recall of beef in U.S. history at the time.

  5. Selective amplification of T-cell receptor variable region species is demonstrable but not essential in early lesions of psoriasis vulgaris: analysis by anchored polymerase chain reaction and hypervariable region size spectratyping.

    PubMed

    Vekony, M A; Holder, J E; Lee, A J; Horrocks, C; Eperon, I C; Camp, R D

    1997-07-01

    Several groups have investigated the role of T cells in the pathogenesis of psoriasis by determination of T-cell receptor (TCR) B-chain variable (V) region usage, both in chronic plaque (psoriasis vulgaris) and guttate forms, with various results. Because there are no data on TCR expression in early psoriasis vulgaris, when specific cellular immune events may be expected to be most pronounced, we have analyzed early lesions (less than 3 wk old) of ten patients, with highly reproducible results. We have developed a highly controlled anchored polymerase chain reaction (PCR) method in which TCR beta chain species are all amplified with the same primer pair and products are quantified by dot blot hybridization with BV family-specific oligonucleotide probes. Overexpression of certain TCR BV genes was observed in the majority of lesional biopsies, but in samples in which the expanded BV family formed more than 10% of total lesional BV (half of the samples analyzed), BV2 and BV6 predominated. The consistency of overexpression of these BV species between patients was much less than in previous studies of TCRBV usage in established chronic plaque psoriasis lesions. Complementarity-determining region 3 (CDR3) size spectratyping demonstrated evidence for selective clonal T cell accumulation in less than half of the lesional samples showing BV expansion. These results indicate that selective amplification of TCRBV species occurs in early psoriasis vulgaris but is not essential to the pathogenic process and may be more important in the maintenance or expansion of chronic lesions.

  6. No evidence of persisting measles virus in peripheral blood mononuclear cells from children with autism spectrum disorder.

    PubMed

    D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J

    2006-10-01

    Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.

  7. Petrology and age of alkalic lava from the Ratak Chain of the Marshall Islands

    USGS Publications Warehouse

    Davis, A.S.; Pringle, M.S.; Pickthorn, L.-B.G.; Clague, D.A.; Schwab, W.C.

    1989-01-01

    Volcanic rock dredged from the flanks of four volcanic edifices in the Ratak chain of the Marshall Islands consist of alkalic lava that erupted above sea level or in shallow water. Compositions of recovered samples are predominantly differentiated alkalic basalt and hawaiite but include strongly alkalic melilitite. Whole rock 40Ar/39Ar total fusion and incremental heating ages of 87.3 ?? 0.6 Ma and 82.2 ?? 1.6 Ma determined for samples from Erikub Seamount and Ratak Guyot, respectively, are within the range predicted by plate rotation models but show no age progression consistent with a simple hot spot model. Variations in isotopic and some incompatible element ratios suggest interisland heterogeneity. -from Authors

  8. Detection and quantification of long chain fatty acids in liquid and solid samples and its relevance to understand anaerobic digestion of lipids.

    PubMed

    Neves, L; Pereira, M A; Mota, M; Alves, M M

    2009-01-01

    A method for long chain fatty acids (LCFA) extraction, identification and further quantification by gas chromatography was developed and its application to liquid and solid samples collected from anaerobic digesters was demonstrated. After validation, the usefulness of this method was demonstrated in a cow manure digester receiving pulses of an industrial effluent containing high lipid content. From the LCFA analysis data it was showed that the conversion of oleic acid, the main LCFA fed to the reactor, by the adapted biomass became faster and more effective along the successive pulses. Conversely, the accumulation of palmitic acid in the solid phase suggests that degradation of this LCFA, under these conditions, is less effective.

  9. Characterization of Y1-xCaxBa2Cu4O8 (x=0.0˜ 0.1) with Double Cu-O Chains by Raman Spectra

    NASA Astrophysics Data System (ADS)

    Kodama, Yasuharu; Tanemura, Sakae; Ikeda, Teruki

    1991-08-01

    Raman spectra of Y1-xCaxBa2Cu4O8 (x=0.0, 0.02, 0.05 and 0.1) ceramic samples synthesized under high oxygen pressure were investigated. Seven clear peaks assigned to Ag modes were observed for the sample with x=0. With increasing x, the peaks at 238 cm-1, 332 cm-1, 430 cm-1 and 590 cm-1 were broadened. The origin of the broadening of the peaks at 238 cm-1 and 590 cm-1 is considered to be the destruction of the double Cu-O chains due to the substitution of Ca for Y.

  10. Dietary exposure to short- and medium-chain chlorinated paraffins in meat and meat products from 20 provinces of China.

    PubMed

    Huang, Huiting; Gao, Lirong; Zheng, Minghui; Li, Jingguang; Zhang, Lei; Wu, Yongning; Wang, Runhua; Xia, Dan; Qiao, Lin; Cui, Lili; Su, Guijin; Liu, Wenbin; Liu, Guorui

    2018-02-01

    Food intake is one of the main pathways of human exposure to chlorinated paraffins (CPs). This study assessed the dietary exposure for the general Chinese population to short-chain chlorinated paraffin (SCCPs) and medium-chain chlorinated paraffins (MCCPs) through meat and meat products. Twenty samples of meat and meat products from 20 Chinese provinces were collected in 2011. As the sampling sites covered about two-thirds of the Chinese population, the meat samples were considered to be representative of the true characteristics of CPs contamination in Chinese meat products. The concentrations of SCCPs and MCCPs in the meat samples were measured using the comprehensive two-dimensional gas chromatography electron capture negative ionization high-resolution time-of-flight mass spectrometry method. Forty-eight SCCP and MCCP homolog groups were detected in the meat samples. The mean SCCP and MCCP concentrations in all meat samples were 129 ± 4.1 ng g -1 wet weight and 5.7 ± 0.59 ng g -1 wet weight, respectively. The concentrations of SCCPs and MCCPs varied in samples from different provinces. The geographical distribution of CP concentrations was similar to the distribution of CPs manufacturing plants in China. The most abundant groups of SCCPs in all samples were C 10-11 Cl 6-7 , and the most abundant groups of MCCPs in most samples were C 14 Cl 7-8 . The possible sources of SCCPs and MCCPs in meat and meat products might be CP-42 and CP-52. The 50th percentile estimated daily intakes of SCCPs and MCCPs through meat consumption for a "standard" Chinese adult male were 0.13 and 0.0047 μg kg -1 bw d -1 , respectively, both much lower than the tolerable daily intakes (TDIs) for SCCPs and MCCPs. This preliminary risk assessment has indicated that the indirect exposure of SCCPs and MCCPs through meat consumption does not pose significant risk to human health in China. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Annealed Importance Sampling Reversible Jump MCMC algorithms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karagiannis, Georgios; Andrieu, Christophe

    2013-03-20

    It will soon be 20 years since reversible jump Markov chain Monte Carlo (RJ-MCMC) algorithms have been proposed. They have significantly extended the scope of Markov chain Monte Carlo simulation methods, offering the promise to be able to routinely tackle transdimensional sampling problems, as encountered in Bayesian model selection problems for example, in a principled and flexible fashion. Their practical efficient implementation, however, still remains a challenge. A particular difficulty encountered in practice is in the choice of the dimension matching variables (both their nature and their distribution) and the reversible transformations which allow one to define the one-to-one mappingsmore » underpinning the design of these algorithms. Indeed, even seemingly sensible choices can lead to algorithms with very poor performance. The focus of this paper is the development and performance evaluation of a method, annealed importance sampling RJ-MCMC (aisRJ), which addresses this problem by mitigating the sensitivity of RJ-MCMC algorithms to the aforementioned poor design. As we shall see the algorithm can be understood as being an “exact approximation” of an idealized MCMC algorithm that would sample from the model probabilities directly in a model selection set-up. Such an idealized algorithm may have good theoretical convergence properties, but typically cannot be implemented, and our algorithms can approximate the performance of such idealized algorithms to an arbitrary degree while not introducing any bias for any degree of approximation. Our approach combines the dimension matching ideas of RJ-MCMC with annealed importance sampling and its Markov chain Monte Carlo implementation. We illustrate the performance of the algorithm with numerical simulations which indicate that, although the approach may at first appear computationally involved, it is in fact competitive.« less

  12. Mesoporous silica nanoparticles functionalized with hyaluronic acid. Effect of the biopolymer chain length on cell internalization.

    PubMed

    Nairi, Valentina; Magnolia, Silvia; Piludu, Marco; Nieddu, Mariella; Caria, Cristian Antonio; Sogos, Valeria; Vallet-Regì, Maria; Monduzzi, Maura; Salis, Andrea

    2018-02-12

    Mesoporous silica nanoparticles (MSNs) were functionalized with amino groups (MSN-NH 2 ) and then with hyaluronic acid, a biocompatible biopolymer which can be recognized by CD44 receptors in tumor cells, to obtain a targeting drug delivery system. To this purpose, three hyaluronic acid samples differing for the molecular weight, namely HA S (8-15 kDa), HA M (30-50 kDa) and HA L (90-130 kDa), were used. The MSN-HA S , MSN-HA M , and MSN-HA L materials were characterized through zeta potential and dynamic light scattering measurements at pH = 7.4 and T = 37 °C to simulate physiological conditions. While zeta potential showed an increasing negative value with the increase of the HA chain length, an anomalous value of the hydrodynamic diameter was observed for MSN-HA L , which was smaller than that of MSN-HA S and MSN-HA M samples. The cellular uptake of MSN-HA samples on HeLa cells at 37 °C was studied by optical and electron microscopy. HA chain length affected significantly the cellular uptake that occurred at a higher extent for MSN-NH 2 and MSN-HA S than for MSN-HA M and MSN-HA L samples. Cellular uptake experiments carried out at 4 °C showed that the internalization process was inhibited for MSN-HA samples but not for MSN-NH 2 . This suggests the occurrence of two different mechanisms of internalization. For MSN-NH 2 the uptake is mainly driven by the attractive electrostatic interaction with membrane phospholipids, while MSN-HA internalization involves CD44 receptors overexpressed in HeLa cells. Copyright © 2018 Elsevier B.V. All rights reserved.

  13. Screening of (-SEA) α-thalassaemia using an immunochromatographic strip assay for the ζ-globin chain in a population with a high prevalence and heterogeneity of haemoglobinopathies.

    PubMed

    Jomoui, Wittaya; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan

    2017-01-01

    The presence of the ζ-globin chain is a good marker of (-- SEA ) α 0 -thalassaemia. We evaluated an immunochromatographic (IC) strip assay for ζ-globin in screening for (-- SEA ) α 0 -thalassaemia in a population with a high prevalence and heterogeneity of haemoglobinopathies. The study was carried out on 300 screen positive blood samples of Thai individuals. The IC strip assay for the ζ-globin chain was performed on all samples. The results were interpreted with thalassaemia genotyping using standard haemoglobin and DNA analyses. Several thalassaemia genotypes were noted. Among the 300 subjects investigated, 79 had a positive IC strip assay for ζ-globin and (-- SEA ) α 0 -thalassaemia was identified in 40 of them. No (-- SEA ) α 0 -thalassaemia was detected in the remaining 39 samples with a positive IC strip test result or in the 221 samples with a negative IC strip test result. Further DNA analysis identified α + -thalassaemia in 25 of the 39 (-- SEA ) α 0 -thalassaemia negative samples. Using this IC strip assay in combination with a conventional screening protocol for (-- SEA ) α 0 -thalassaemia could provide sensitivity and specificity of 100% and 90.4%, respectively. IC strip assay for ζ-globin is simple, rapid and does not require sophisticated equipment. Use of this test in addition to the existing screening protocol could detect potential (-- SEA ) α 0 -thalassaemia leading to a significant reduction in the workload of DNA analysis. This could be used in areas where haemoglobinopathies are prevalent and heterogeneous but molecular testing is not available. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

  14. Shear and elongational rheology of photo-oxidative degraded HDPE and LLDPE

    NASA Astrophysics Data System (ADS)

    Wagner, Manfred Hermann; Zheng, Wang; Wang, Peng; Talamante, Sebastián Ramos; Narimissa, Esmaeil

    2017-05-01

    The effect of photo-oxidative degradation of high-density polyethylene (HDPE) and linear low-density polyethylene (LLDPE) was investigated by linear and non-linear rheological measurements. The linear-viscoelastic rheological measurements were performed at different temperatures, while the elongational viscosity was measured at 170°C and at different strain rates. The rheological data are indicative of structural changes caused by photo-oxidative degradation including formation of long-chain branches (LCB), cross-linking, and chain scission, and they revealed a cyclic and continuing competition between chain scission and LCB/gel formation. These findings are supported by additional FTIR measurements and direct measurements of the gel content of the degraded samples.

  15. Exploring backbone-cation alkyl spacers for multi-cation side chain anion exchange membranes

    NASA Astrophysics Data System (ADS)

    Zhu, Liang; Yu, Xuedi; Hickner, Michael A.

    2018-01-01

    In order to systematically study how the arrangement of cations on the side chain and length of alkyl spacers between cations impact the performance of multi-cation AEMs for alkaline fuel cells, a series of polyphenylene oxide (PPO)-based AEMs with different cationic side chains were synthesized. This work resulted in samples with two or three cations in a side chain pendant to the PPO backbone. More importantly, the length of the spacer between cations varied from 3 methylene (-CH2-) (C3) groups to 8 methylene (C8) groups. The highest conductivity, up to 99 mS/cm in liquid water at room temperature, was observed for the triple-cation side chain AEM with pentyl (C5) or hexyl (C6) spacers. The multi-cation AEMs were found to have decreased water uptake and ionic conductivity when the spacer chains between cations were lengthened from pentyl (C5) or hexyl (C6) to octyl (C8) linking groups. The triple-cation membranes with pentyl (C5) or hexyl (C6) groups between cations showed greatest stability after immersion in 1 M NaOH at 80 °C for 500 h.

  16. Bayesian seismic tomography by parallel interacting Markov chains

    NASA Astrophysics Data System (ADS)

    Gesret, Alexandrine; Bottero, Alexis; Romary, Thomas; Noble, Mark; Desassis, Nicolas

    2014-05-01

    The velocity field estimated by first arrival traveltime tomography is commonly used as a starting point for further seismological, mineralogical, tectonic or similar analysis. In order to interpret quantitatively the results, the tomography uncertainty values as well as their spatial distribution are required. The estimated velocity model is obtained through inverse modeling by minimizing an objective function that compares observed and computed traveltimes. This step is often performed by gradient-based optimization algorithms. The major drawback of such local optimization schemes, beyond the possibility of being trapped in a local minimum, is that they do not account for the multiple possible solutions of the inverse problem. They are therefore unable to assess the uncertainties linked to the solution. Within a Bayesian (probabilistic) framework, solving the tomography inverse problem aims at estimating the posterior probability density function of velocity model using a global sampling algorithm. Markov chains Monte-Carlo (MCMC) methods are known to produce samples of virtually any distribution. In such a Bayesian inversion, the total number of simulations we can afford is highly related to the computational cost of the forward model. Although fast algorithms have been recently developed for computing first arrival traveltimes of seismic waves, the complete browsing of the posterior distribution of velocity model is hardly performed, especially when it is high dimensional and/or multimodal. In the latter case, the chain may even stay stuck in one of the modes. In order to improve the mixing properties of classical single MCMC, we propose to make interact several Markov chains at different temperatures. This method can make efficient use of large CPU clusters, without increasing the global computational cost with respect to classical MCMC and is therefore particularly suited for Bayesian inversion. The exchanges between the chains allow a precise sampling of the high probability zones of the model space while avoiding the chains to end stuck in a probability maximum. This approach supplies thus a robust way to analyze the tomography imaging uncertainties. The interacting MCMC approach is illustrated on two synthetic examples of tomography of calibration shots such as encountered in induced microseismic studies. On the second application, a wavelet based model parameterization is presented that allows to significantly reduce the dimension of the problem, making thus the algorithm efficient even for a complex velocity model.

  17. Expression and mutational analysis of Cip/Kip family in early glottic cancer.

    PubMed

    Kim, D-K; Lee, J H; Lee, O J; Park, C H

    2015-02-01

    Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

  18. Stabilization of non-productive conformations underpins rapid electron transfer to electron-transferring flavoprotein.

    PubMed

    Toogood, Helen S; van Thiel, Adam; Scrutton, Nigel S; Leys, David

    2005-08-26

    Crystal structures of protein complexes with electron-transferring flavoprotein (ETF) have revealed a dual protein-protein interface with one region serving as anchor while the ETF FAD domain samples available space within the complex. We show that mutation of the conserved Glu-165beta in human ETF leads to drastically modulated rates of interprotein electron transfer with both medium chain acyl-CoA dehydrogenase and dimethylglycine dehydrogenase. The crystal structure of free E165betaA ETF is essentially identical to that of wild-type ETF, but the crystal structure of the E165betaA ETF.medium chain acyl-CoA dehydrogenase complex reveals clear electron density for the FAD domain in a position optimal for fast interprotein electron transfer. Based on our observations, we present a dynamic multistate model for conformational sampling that for the wild-type ETF. medium chain acyl-CoA dehydrogenase complex involves random motion between three distinct positions for the ETF FAD domain. ETF Glu-165beta plays a key role in stabilizing positions incompatible with fast interprotein electron transfer, thus ensuring high rates of complex dissociation.

  19. Insights into the structural and physicochemical properties of small granular starches from two hydrophyte duckweeds, Spirodela oligorrhiza and Lemna minor.

    PubMed

    Chen, Lei; Yu, Changjiang; Ma, Yubin; Xu, Hua; Wang, Shumin; Wang, Yu; Liu, Xingxun; Zhou, Gongke

    2016-11-29

    The structure and physicochemical properties of starches from two hydrophyte duckweeds, Spirodela oligorrhiza and Lemna minor, were investigated and compared in this study. The amylose content and average size of starches were determined to be 20.85%, 4.70 μm and 27.77%, 6.17 μm for Spirodela oligorrhiza and Lemna minor, respectively. The average chain length of two duckweed starches was measured to be around DP 28. The chain length distribution was observed to be greatly different from other reported starches for the high proportion of long chains (DP ≥ 37) over 50%. Wide-angle X-ray diffraction profiles of the two starch samples displayed typical B-type diffraction pattern. The gelatinization enthalpy-changes (ΔH gel ) of two starch samples was about 10.40 J/g for two duckweed starches. The present results suggested the potential utilization of small granular starches from duckweed in functional foods and dietary supplement products. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Selective propagation and beam splitting of surface plasmons on metallic nanodisk chains.

    PubMed

    Hu, Yuhui; Zhao, Di; Wang, Zhenghan; Chen, Fei; Xiong, Xiang; Peng, Ruwen; Wang, Mu

    2017-05-01

    Manipulating the propagation of surface plasmons (SPs) on a nanoscale is a fundamental issue of nanophotonics. By using focused electron beam, SPs can be excited with high spatial accuracy. Here we report on the propagation of SPs on a chain of gold nanodisks with cathodoluminescence (CL) spectroscopy. Experimental evidence for the propagation of SPs excited by the focused electron beam is demonstrated. The wavelength of the transmitted SPs depends on the geometrical parameters of the nanodisk chain. Furthermore, we design and fabricate a beam splitter, which selectively transmits SPs of certain wavelengths to a specific direction. By scanning the sample surface point by point and collecting the CL spectra, we obtain the spectral mapping and identify that the chain of the smaller nanodisks can efficiently transport SPs at shorter wavelengths. This Letter provides a unique approach to manipulate in-plane propagation of SPs.

  1. The removal of pyroglutamic acid from monoclonal antibodies without denaturation of the protein chains.

    PubMed

    Werner, William E; Wu, Sylvia; Mulkerrin, Michael

    2005-07-01

    Typically, the removal of pyroglutamate from the protein chains of immunoglobulins with the enzyme pyroglutamate aminopeptidase requires the use of chaotropic and reducing agents, quite often with limited success. This article describes a series of optimization experiments using elevated temperatures and detergents to denature and stabilize the heavy chains of immunoglobulins such that the pyroglutamate at the amino terminal was accessible to enzymatic removal using the thermostable protease isolated from Pyrococcus furiosus. The detergent polysorbate 20 (Tween 20) was used successfully to facilitate the removal of pyroglutamate residues. A one-step digestion was developed using elevated temperatures and polysorbate 20, rather than chaotropic and reducing agents, with sample cleanup and preparation for Edman sequencing performed using a commercial cartridge containing the PVDF membrane. All of the immunoglobulins digested with this method yielded heavy chain sequence, but the extent of deblocking was immunglobulin dependent (typically>50%).

  2. Modeling chain folding in protein-constrained circular DNA.

    PubMed Central

    Martino, J A; Olson, W K

    1998-01-01

    An efficient method for sampling equilibrium configurations of DNA chains binding one or more DNA-bending proteins is presented. The technique is applied to obtain the tertiary structures of minimal bending energy for a selection of dinucleosomal minichromosomes that differ in degree of protein-DNA interaction, protein spacing along the DNA chain contour, and ring size. The protein-bound portions of the DNA chains are represented by tight, left-handed supercoils of fixed geometry. The protein-free regions are modeled individually as elastic rods. For each random spatial arrangement of the two nucleosomes assumed during a stochastic search for the global minimum, the paths of the flexible connecting DNA segments are determined through a numerical solution of the equations of equilibrium for torsionally relaxed elastic rods. The minimal energy forms reveal how protein binding and spacing and plasmid size differentially affect folding and offer new insights into experimental minichromosome systems. PMID:9591675

  3. Transport of triplet excitons along continuous 100 nm polyfluorene chains

    DOE PAGES

    Xi, Liang; Bird, Matthew; Mauro, Gina; ...

    2014-12-03

    Triplet excitons created in poly-2,7-(9,9-dihexyl)fluorene (pF) chains with end trap groups in solution are efficiently transported to and captured by the end groups. The triplets explore the entire lengths of the chains, even for ~100 nm long chains enabling determination of the completeness of end capping. The results show that the chains continuous: they may contain transient barriers or traps, such as those from fluctuations of dihedral angles, but are free of major defects that stop motion of the triplets. Quantitative determinations are aided by the addition of a strong electron donor, TMPD, which removes absorption bands of the end-trappedmore » triplets. For chains having at least one end trap, triplet capture is quantitative on the 1 µs timescale imposed by the use of the donor. Fractions of chains having no end traps were 0.15 for pF samples with anthraquinone (AQ) end traps and 0.063 with naphthylimide (NI) end traps. These determinations agreed with measurements by NMR for short (<40 polymer repeat units (PRU)) chains, where NMR determinations are accurate. The results find no evidence for traps or barriers to transport of triplets, and places limits on the possible presence of defects as impenetrable barriers to less than one per 300 PRU. The present results present a paradigm different from the current consensus, derived from observations of singlet excitons, that conjugated chains are divided into “segments,” perhaps by some kind of defects. For the present pF chains, the segmentation either does not apply to triplet excitons or is transient so that the defects are healed or surmounted in times much shorter than 1 µs. Triplets on chains without end trap groups transfer to chains with end traps on a slower time scale. Rate constants for these bimolecular triplet transfer reactions were found to increase with the length of the accepting chain, as did rate constants for triplet transfer to the chains from small molecules like biphenyl. As a result, a second set of polyfluorenes with 2-butyloctyl side chains was found to have a much lower completeness of end capping.« less

  4. Slice sampling technique in Bayesian extreme of gold price modelling

    NASA Astrophysics Data System (ADS)

    Rostami, Mohammad; Adam, Mohd Bakri; Ibrahim, Noor Akma; Yahya, Mohamed Hisham

    2013-09-01

    In this paper, a simulation study of Bayesian extreme values by using Markov Chain Monte Carlo via slice sampling algorithm is implemented. We compared the accuracy of slice sampling with other methods for a Gumbel model. This study revealed that slice sampling algorithm offers more accurate and closer estimates with less RMSE than other methods . Finally we successfully employed this procedure to estimate the parameters of Malaysia extreme gold price from 2000 to 2011.

  5. Estimating the Effective Sample Size of Tree Topologies from Bayesian Phylogenetic Analyses

    PubMed Central

    Lanfear, Robert; Hua, Xia; Warren, Dan L.

    2016-01-01

    Bayesian phylogenetic analyses estimate posterior distributions of phylogenetic tree topologies and other parameters using Markov chain Monte Carlo (MCMC) methods. Before making inferences from these distributions, it is important to assess their adequacy. To this end, the effective sample size (ESS) estimates how many truly independent samples of a given parameter the output of the MCMC represents. The ESS of a parameter is frequently much lower than the number of samples taken from the MCMC because sequential samples from the chain can be non-independent due to autocorrelation. Typically, phylogeneticists use a rule of thumb that the ESS of all parameters should be greater than 200. However, we have no method to calculate an ESS of tree topology samples, despite the fact that the tree topology is often the parameter of primary interest and is almost always central to the estimation of other parameters. That is, we lack a method to determine whether we have adequately sampled one of the most important parameters in our analyses. In this study, we address this problem by developing methods to estimate the ESS for tree topologies. We combine these methods with two new diagnostic plots for assessing posterior samples of tree topologies, and compare their performance on simulated and empirical data sets. Combined, the methods we present provide new ways to assess the mixing and convergence of phylogenetic tree topologies in Bayesian MCMC analyses. PMID:27435794

  6. Absolute nuclear material assay using count distribution (LAMBDA) space

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prasad, Mano K.; Snyderman, Neal J.; Rowland, Mark S.

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  7. Medical tourism private hospitals: focus India.

    PubMed

    Brotman, Billie Ann

    2010-01-01

    This article examines demand factors for sophisticated medical treatments offered by private hospitals operating in India. Three types of medical tourism exist: Outbound, Inbound, and Intrabound. Increased profitability and positive growth trends by private hospital chains can be attributed to rising domestic income levels within India. Not all of the chains examined were financially solvent. Some of the hospital groups in this sample that advertised directly to potential Inbound medical tourists appear to be experiencing negative cash flows.

  8. Absolute nuclear material assay using count distribution (LAMBDA) space

    DOEpatents

    Prasad, Manoj K [Pleasanton, CA; Snyderman, Neal J [Berkeley, CA; Rowland, Mark S [Alamo, CA

    2012-06-05

    A method of absolute nuclear material assay of an unknown source comprising counting neutrons from the unknown source and providing an absolute nuclear material assay utilizing a model to optimally compare to the measured count distributions. In one embodiment, the step of providing an absolute nuclear material assay comprises utilizing a random sampling of analytically computed fission chain distributions to generate a continuous time-evolving sequence of event-counts by spreading the fission chain distribution in time.

  9. [The role of German official medicines control laboratories in combating counterfeit medicines].

    PubMed

    Wiegard, Andrea; Heuermann, Matthias

    2017-11-01

    An official medicines control laboratory (OMCL) provides an important contribution to combat counterfeit and illegal medicines. The OMCL supports the competent authorities in controlling the quality of authorised medicinal products in the legal supply chain. For detecting counterfeit medicines in the legal supply chain, a risk-based approach in choice of products is conducted. Furthermore, the OMCL analyses suspicious medicines from the illegal supply chain for any other authority. The chemical analysis of a suspicious sample is needed to identify such a sample as a counterfeit medicine. The analytical results are fundamental for the evaluation of the legal status of the product and for the assessment of it's inherent hazard to public health. The global market of illegal medicines is rapidly changing. Therefore a good national and international working liaison and co-operation between laboratories and authorities is obligatory to protect public health. The OMCL provides important knowledge of new trends in counterfeit and illegal medicines. Hence, it is an essential part in surveillance of medicinal products. The efficient networking enables prompt official interventions. Thus, risks for the public health by substandard medicines were reduced. Beside the chemical analysis, the OMCL can help to raise public awareness about counterfeit and illegal medicines. In Germany, the risk of counterfeit medicines reaching patients through the legal supply chain is still low, but the possibility cannot be ignored.

  10. SANS study of deformation and relaxation of a comb-like liquid crystal polymer in the nematic phase

    NASA Astrophysics Data System (ADS)

    Brûlet, A.; Boué, F.; Keller, P.; Davidson, P.; Strazielle, C.; Cotton, J. P.

    1994-06-01

    A comb-like liquid crystal polymer is stretched and quenched after a certain time in the nematic phase. The conformation of the deformed chain is determined using small angle neutron scattering (SANS) as a function of the temperature of stretching, the stretching ratio and the duration of the relaxation. The scattering data are well fitted to junction affine and phantom network models. Some data are even well fitted by a totally affine model that we call “ pseudo affine ” because the only parameter, the stretching ratio, is found to be well below the macroscopic stretching ratio. The latter result, never encountered with amorphous polymers, is attributed to the cooperative effects of the nematic phase. We also note that the form factors of the chain in the underformed sample remain similar in the isotropic, nematic and glassy state ; they correspond to a Gaussian chain. The same samples were studied by wide angle X-ray scattering. On one hand, the orientation of the mesogenic groups is found to be parallel or perpendicular to the stretching direction depending on the stretching temperature. This result is discussed as a function of the presence of smectic fluctuations. On the other hand, longer relaxations at constant elongation ratio do not lead to a disorganization of the mesogenic group orientation whereas the polymer chains are partly relaxed.

  11. Improved Signal Chains for Readout of CMOS Imagers

    NASA Technical Reports Server (NTRS)

    Pain, Bedabrata; Hancock, Bruce; Cunningham, Thomas

    2009-01-01

    An improved generic design has been devised for implementing signal chains involved in readout from complementary metal oxide/semiconductor (CMOS) image sensors and for other readout integrated circuits (ICs) that perform equivalent functions. The design applies to any such IC in which output signal charges from the pixels in a given row are transferred simultaneously into sampling capacitors at the bottoms of the columns, then voltages representing individual pixel charges are read out in sequence by sequentially turning on column-selecting field-effect transistors (FETs) in synchronism with source-follower- or operational-amplifier-based amplifier circuits. The improved design affords the best features of prior source-follower-and operational- amplifier-based designs while overcoming the major limitations of those designs. The limitations can be summarized as follows: a) For a source-follower-based signal chain, the ohmic voltage drop associated with DC bias current flowing through the column-selection FET causes unacceptable voltage offset, nonlinearity, and reduced small-signal gain. b) For an operational-amplifier-based signal chain, the required bias current and the output noise increase superlinearly with size of the pixel array because of a corresponding increase in the effective capacitance of the row bus used to couple the sampled column charges to the operational amplifier. The effect of the bus capacitance is to simultaneously slow down the readout circuit and increase noise through the Miller effect.

  12. Increased myosin heavy chain-beta with atrial expression of ventricular light chain-2 in canine cardiomyopathy.

    PubMed

    Fuller, Geraldine A; Bicer, Sabahattin; Hamlin, Robert L; Yamaguchi, Mamoru; Reiser, Peter J

    2007-10-01

    Dilated cardiomyopathy is a naturally occurring disease in humans and dogs. Human studies have shown increased levels of myosin heavy chain (MHC)-beta in failing ventricles and the left atria (LA) and of ventricular light chain (VLC)-2 in the right atria in dilated cardiomyopathy. This study evaluates the levels of MHC-beta in all heart chambers in prolonged canine right ventricular pacing. In addition, we determined whether levels of VLC2 were altered in these hearts. Failing hearts demonstrated significantly increased levels of MHC-beta in the right atria, right atrial appendage, LA, left atrial appendage (LAA), and right ventricle compared with controls. Significant levels of VLC2 were detected in the right atria of paced hearts. Differences in MHC-beta expression were observed between the LA and the LAA of paced and control dogs. MHC-beta expression was significantly greater in the LA of paced and control dogs compared with their respective LAA. The cardiac myosin isoform shifts in this study were similar to those observed in end-stage human heart failure and more severe than those reported in less prolonged pacing models, supporting the use of this model for further study of end-stage human heart failure. The observation of consistent differences between sampling sites, especially LA versus LAA, indicates the need for rigorous sampling consistency in future studies.

  13. Environmental behaviour of short-chain chlorinated paraffins in aquatic and terrestrial ecosystems of Ny-Ålesund and London Island, Svalbard, in the Arctic.

    PubMed

    Li, Huijuan; Fu, Jianjie; Pan, Wenxiao; Wang, Pu; Li, Yingming; Zhang, Qinghua; Wang, Yawei; Zhang, Aiqian; Liang, Yong; Jiang, Guibin

    2017-07-15

    The environmental behaviour of short-chain chlorinated paraffins (SCCPs) was investigated in both aquatic and terrestrial ecosystems in the Arctic. The mean concentrations of SCCPs in the aquatic and terrestrial samples were 178.9ng/g dry weight (dw) and 157.2ng/g dw, respectively. Short carbon chain (C 10 ) and less-chlorinated (Cl 6 ) congener groups were predominant in the Arctic samples, accounting for 48.6% and 34.8% of the total SCCPs, respectively. The enrichment of lighter SCCP congener groups (i.e., fewer chlorine atoms with shorter carbon chain lengths) indicated that the fractionation process occurred during long-range transport. The biomagnification factor (BMF) was 0.46 from gammarid to cod, which indicated that the SCCPs did not biomagnify between these two species. The soil-vegetation bioaccumulation factor (BAF) of SCCPs was 29.9, and C 13 and Cl 7, 8 congener groups tended to accumulate in the terrestrial vegetation. Regression analysis (BAFs=10.9×#C+5.6×#Cl-125.2, R=0.53, P<0.01) showed that the number of carbon and chlorine atoms influenced the bioaccumulative behaviour of SCCPs and suggested that the number of carbon atoms had a greater influence on the BAFs of SCCPs in the terrestrial ecosystem than did the number of chlorine atoms. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Short-chain chlorinated paraffins (SCCPs) in surface soil from a background area in China: occurrence, distribution, and congener profiles.

    PubMed

    Wang, Xue-Tong; Zhang, Yuan; Miao, Yi; Ma, Ling-Ling; Li, Yuan-Cheng; Chang, Yue-Ya; Wu, Ming-Hong

    2013-07-01

    Short-chain chlorinated paraffins (SCCPs) are extremely complex technical mixtures of polychlorinated n-alkanes with carbon chain lengths from C10 to C13 and chlorine content between 49 and 70%. SCCPs are under consideration for inclusion in the Stockholm Convention on persistent organic pollutants. SCCPs have been used extensively in industrial production, but little is known about the pollution level in soil environment in China. In this study, levels and distribution of SCCPs in soil samples from Chongming Island were analyzed. Concentrations of total SCCPs in soil samples ranged from 0.42 to 420 ng g(-1), with a median of 9.6 ng g(-1). The ubiquitous occurrence of SCCPs in Chongming Island implied that long-range atmospheric transport and soil-air exchange may be the most important pathways for SCCP contamination in the background area. The localized SCCP contamination could be derived from an unidentified source. Hierarchical cluster analysis indicated that C13- and C11-congeners were predominant in most soils and C10- and C12-congeners dominated in the remaining soils. Cl7- and Cl8-congeners were on the average the most dominant chlorine congeners in nearly all soils. Principal component analysis suggested that the separation of even and odd carbon chain congeners occurred during long-range atmospheric transport and aging in soil in the study area.

  15. Microbiological Quality of Seafood Marketed in Taiwan.

    PubMed

    Wong, Hin-Chung; Jiang, Huai-Yu; Lin, Hsu-Yang; Wang, Yu-Ting

    2015-11-01

    Seafood is often associated with foodborne illnesses, and Vibrio parahaemolyticus is the most common pathogen implicated in outbreaks in Taiwan. In this study, the microbiological quality of 300 raw or mixed ready-to-eat (RTE) and other cooking-needed seafood samples was examined. The total aerobic and coliform counts of the RTE samples were significantly higher than those of other cooking-needed samples. On average, 55.8 and 29.7% of the RTE samples failed to meet the local microbiological standards for total aerobic (5 log CFU/g) and coliform (3 log most probable number [MPN] per g), counts respectively; the corresponding percentages for the RTE samples from Taipei City were 9.1 and 18.2%, respectively. The total aerobic and coliform counts in the RTE samples from supermarkets and chain restaurants were significantly lower than those from traditional restaurants. The Vibrio species were more frequently identified in the cooking-needed samples than in RTE samples. Low incidences of V. parahaemolyticus (1.4%), V. vulnificus (1.9%), and V. cholerae (0%) were detected in most RTE samples. High densities of V. parahaemolyticus and V. vulnificus (1,200 MPN/g) were detected in a few RTE samples, only one of which contained toxigenic (tdh(+)) V. parahaemolyticus. The results of this investigation reveal that better hygiene of seafood providers such as chain restaurants, supermarkets, and traditional restaurants in Taipei City would effectively improve the microbiological quality of the seafood. The results will facilitate the establishment of measures for controlling the risks associated with seafood in Taiwan.

  16. Rapid Identification of a Cooling Tower-Associated Legionnaires’ Disease Outbreak Supported by Polymerase Chain Reaction Testing of Environmental Samples, New York City, 2014–2015

    PubMed Central

    Benowitz, Isaac; Fitzhenry, Robert; Boyd, Christopher; Dickinson, Michelle; Levy, Michael; Lin, Ying; Nazarian, Elizabeth; Ostrowsky, Belinda; Passaretti, Teresa; Rakeman, Jennifer; Saylors, Amy; Shamoonian, Elena; Smith, Terry-Ann; Balter, Sharon

    2018-01-01

    We investigated an outbreak of eight Legionnaires’ disease cases among persons living in an urban residential community of 60,000 people. Possible environmental sources included two active cooling towers (air-conditioning units for large buildings) <1 km from patient residences, a market misting system, a community-wide water system used for heating and cooling, and potable water. To support a timely public health response, we used real-time polymerase chain reaction (PCR) to identify Legionella DNA in environmental samples within hours of specimen collection. We detected L. pneumophila serogroup 1 DNA only at a power plant cooling tower, supporting the decision to order remediation before culture results were available. An isolate from a power plant cooling tower sample was indistinguishable from a patient isolate by pulsed-field gel electrophoresis, suggesting the cooling tower was the outbreak source. PCR results were available <1 day after sample collection, and culture results were available as early as 5 days after plating. PCR is a valuable tool for identifying Legionella DNA in environmental samples in outbreak settings. PMID:29780175

  17. Detection of Mycobacterium avium subsp. paratuberculosis in bovine manure using Whatman FTA card technology and Lightcycler real-time PCR.

    PubMed

    Jaravata, Carmela V; Smith, Wayne L; Rensen, Gabriel J; Ruzante, Juliana M; Cullor, James S

    2006-01-01

    A modified forensic DNA extraction and real-time fluorescent polymerase chain reaction assay has been evaluated for the detection of Mycobacterium avium subsp. paratuberculosis (MAP) in bovine fecal samples using primers and fluorescent resonance energy transfer (FRET) probes targeting the IS900 gene sequence of MAP. DNA was successfully extracted from manure samples by utilizing the Whatman FTA card technology, which allows for simple processing and storage of samples at room temperature. The FTA cards were washed and subjected to a Chelex-100 incubation to remove any remaining polymerase chain reaction (PCR) inhibitors and to elute the DNA from the FTA card. This isolated DNA was then subjected to direct real time fluorescent PCR analysis. Detection of MAP DNA from bovine fecal samples spiked with known concentrations of viable MAP cells was obtained. The detection limits of the assay was consistently found to be between 10(2) and 10(4) colony forming units [CFU]/g, with some samples containing as low as 10 CFU/g, yielding positive assay results. This cost-efficient assay allows reporting of results as early as 4 h after fecal collection, which can be particularly useful in highthroughput herd screening.

  18. Detection of Brucella spp. in milk from seronegative cows by real-time polymerase chain reaction in the region of Batna, Algeria

    PubMed Central

    Sabrina, Rabehi; Mossadak, Hamdi Taha; Bakir, Mamache; Asma, Meghezzi; Khaoula, Boushaba

    2018-01-01

    Aim: The aim of this study was to detect Brucella spp. DNA in milk samples collected from seronegative cows using the real-time polymerase chain reaction (PCR) assay for diagnosis of brucellosis in seronegative dairy cows to prevent transmission of disease to humans and to reduce economic losses in animal production. Materials and Methods: In this study, 65 milk samples were investigated for the detection of Brucella spp. The detection of the IS711 gene in all samples was done by real-time PCR assay by comparative cycle threshold method. Results: The results show that of the 65 DNA samples tested, 2 (3.08%) were positive for Brucella infection. The mean cyclic threshold values of IS711 real-time PCR test were 37.97 and 40.48, indicating a positive reaction. Conclusion: The results of the present study indicated that the real-time PCR appears to offer several advantages over serological tests. For this reason, the real-time PCR should be validated on representative numbers of Brucella-infected and free samples before being implemented in routine diagnosis in human and animal brucellosis for controlling this disease. PMID:29657430

  19. Determination of selected quaternary ammonium compounds by liquid chromatography with mass spectrometry. Part II. Application to sediment and sludge samples in Austria.

    PubMed

    Martínez-Carballo, Elena; González-Barreiro, Carmen; Sitka, Andrea; Kreuzinger, Norbert; Scharf, Sigrid; Gans, Oliver

    2007-03-01

    Soxhlet extraction and high-performance liquid chromatography (HPLC) coupled to tandem mass spectrometry detection (MS/MS) was used for the determination of selected quaternary ammonium compounds (QACs) in solid samples. The method was applied for the determination of alkyl benzyl, dialkyl and trialkyl quaternary ammonium compounds in sediment and sludge samples in Austria. The overall method quantification limits range from 0.6 to 3 microg/kg for sediments and from 2 to 5 microg/kg for sewage sludges. Mean recoveries between 67% and 95% are achieved. In general sediments were especially contaminated by C12 chain benzalkonium chloride (BAC-C12) as well as by the long C-chain dialkyldimethylammonium chloride (DDAC-C18) with a maximum concentration of 3.6 mg/kg and 2.1mg/kg, respectively. Maxima of 27 mg/kg for DDAC-C10, 25 mg/kg for BAC-C12 and 23 mg/kg for BAC-C14 were determined for sludge samples. The sums of the 12 selected target compounds range from 22 mg/kg to 103 mg/kg in the sludge samples.

  20. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wilbur, Jeffrey D.; Gomez, Enrique D.; Ellsworth, Mark W.

    A procedure for creating samples that can be repeatedly cycled between weakly aligned and strongly aligned states is described. Poly(styrene-b-isoprene) block copolymer samples were first shear-aligned and then cross-linked using a high energy electron beam. Samples with more than 1.0 cross-links per chain on average showed almost complete recovery of their initial alignment state even after 20 cycles of heating above the order–disorder transition temperature of the un-cross-linked block copolymer. Samples with 1.1 cross-links per chain, which showed over 90% loss of alignment on heating and almost 100% recovery of alignment on cooling, provided the best example of a reversiblemore » aligned-to-unaligned transition. Samples with lower cross-linking densities exhibited irreversible loss of alignment upon heating, while those with higher cross-linking densities exhibited less than 90% loss of alignment upon heating. Alignment was quantified by a technique that we call two color depolarized light scattering (TCDLS), an extension of the traditional depolarized light scattering experiment used to determine the state of order in block copolymers. Qualitative confirmation of our interpretation of TCDLS data was obtained by small-angle X-ray scattering and transmission electron microscopy.« less

  1. USE OF MOLECULAR PROBES TO ASSESS GEOGRAPHIC DISTRIBUTION OF PFIESTERIA SPECIES. (R827084)

    EPA Science Inventory

    We have developed multiple polymerase chain reaction (PCR)-based methods for the
    detection of Pfiesteria sp. in cultures and environmental samples. More than 2,100 water and
    sediment samples from estuarine sites of the U.S. Atlantic and gulf coasts were assayed for the
    p...

  2. (Environmental investigation of ground water contamination at Wright-Patterson Air Force Base, Ohio)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1992-03-01

    This report presents information related to the sampling of ground water at the Wright-Patterson Air Force Base. It is part of an investigation into possible ground water contamination. Information concerns well drilling/construction; x-ray diffraction and sampling; soil boring logs; and chain-of-custody records.

  3. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    PubMed Central

    Atherton, Richard; Bhavnani, Darlene; Calvopiña, Manuel; Vicuña, Yosselin; Cevallos, William; Eisenberg, Joseph

    2013-01-01

    The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay) were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh) gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61%) were classified as assemblage B (26 as BIII and 16 as BIV), 22 (32%) as assemblage A (3 as AI and 19 as AII) and five (7%) as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A. PMID:23827993

  4. Spectroscopic Characteristics of Dissolved Organic Matter in Afforestation Forest Soil of Miyun District, Beijing

    PubMed Central

    Zhao, Chen; Shi, Zong-Hai; Zhong, Jun; Liu, Jian-Guo; Li, Jun-Qing

    2016-01-01

    In this study, soil samples collected from different plain afforestation time (1 year, 4 years, 10 years, 15 years, and 20 years) in Miyun were characterized, including total organic carbon (TOC), total nitrogen (TN), total phosphorus (TP), available K (K+), microbial biomass carbon (MBC), and dissolved organic carbon (DOC). The DOM in the soil samples with different afforestation time was further characterized via DOC, UV-Visible spectroscopy, excitation-emission matrix (EEM) fluorescence spectroscopy, and 1H NMR spectroscopy. The results suggested that the texture of soil sample was sandy. The extracted DOM from soil consisted mainly of aliphatic chains and only a minor aromatic component. It can be included that afforestation can improve the soil quality to some extent, which can be partly reflected from the indexes like TOC, TN, TP, K+, MBC, and DOC. And the characterization of DOM implied that UV humic-like substances were the major fluorophores components in the DOM of the soil samples, which consisted of aliphatic chains and aromatic components with carbonyl, carboxyl, and hydroxyl groups. PMID:27433371

  5. Methylation pattern of IFNG in periapical granulomas and radicular cysts.

    PubMed

    Campos, Kelma; Gomes, Carolina Cavaliéri; de Fátima Correia-Silva, Jeane; Farias, Lucyana Conceição; Fonseca-Silva, Thiago; Bernardes, Vanessa Fátima; Pereira, Cláudia Maria; Gomez, Ricardo Santiago

    2013-04-01

    Interferon-γ plays an important role in the pathogenesis of periapical lesions, and the methylation of IFNG has been associated with transcriptional inactivation. The purpose of the present study was to investigate IFNG promoter methylation in association with gene transcription and protein levels in periapical granulomas and radicular cysts. Methylation-specific polymerase chain reaction was used to assess the DNA methylation pattern of the IFNG gene in 16 periapical granulomas and 13 radicular cyst samples. The transcription levels of IFNG mRNA were verified by quantitative real-time polymerase chain reaction, and protein expression was evaluated by immunohistochemistry. All the periapical lesion samples exhibited partial or total methylation of the IFNG gene. In addition, an increased methylation profile was found in radicular cysts compared with periapical granulomas. Increased IFNG mRNA expression was observed in the partially methylated periapical lesion samples relative to the samples that were completely methylated. The present study provides the first evidence of the possible impact of IFNG methylation on IFNG transcription in periapical lesions. Copyright © 2013 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  6. [Determination of short-chain chlorinated paraffins in ambient air using high-volume sampling combined with high resolutimi gas chromatography-electron capture negative ion-low resolution mass spectrometry].

    PubMed

    Shi, Loimeng; Gao, Yuan; Hou, Xiaohong; Zhang, Haijun; Zhang, Yichi; Chen, Jiping

    2016-02-01

    An analytical method for quantifying short-chain chlorinated paraffins (SCCPs) in ambient air using high-volume sampling combined with high resolution gas chromatography-electron capture negative ion-low resolution mass spectrometry ( HRGC-ECNI-LRMS) was developed. An acidified silica gel column and a basic alumina column were used to optimize the cleanup procedures. The results showed a good linearity (R2>0. 99) between the total response factors and the degree of chlorination of SCCPs in the content range of 58. 1%-63. 3%. The limits of detection (S/N ≥3) and the limits of quantification (S/N ≥ 10) were 4. 2 and 12 µg, respectively. The method detection limit (MDL) for SCCPs was 0. 34 ng/m3 (n = 7). The recoveries of SCCPs in air samples were in the range of 81. 9% to 94. 2%. It is demonstrated that the method is suitable for the quantitative analysis of SCCPs in air samples.

  7. Molecular detection of black-pigmented bacteria in infections of endodontic origin.

    PubMed

    Siqueira, J F; Rôças, I N; Oliveira, J C; Santos, K R

    2001-09-01

    A 16S rDNA-directed polymerase chain reaction method was used to assess the occurrence of four black-pigmented anaerobic rods in root canal infections. Samples were obtained from 54 infected teeth. Ten cases were diagnosed as acute periradicular abscesses. DNA was extracted from the samples and analyzed using a polymerase chain reaction-based identification assay. The method allowed detection of black-pigmented bacteria anaerobes in 59.3% of the examined teeth. Twelve cases yielded more than one black-pigmented species. In general Porphyromonas endodontalis was found in 42.6%, Porphyromonas gingivalis in 27.8%, Prevotella nigrescens in 7.4%, and Prevotella intermedia in 5.6% of the cases. P. endodontalis was found in 70% of the pus samples, P. gingivalis in 40%, and P. intermedia in 10%. P. gingivalis was always found associated with P. endodontalis in abscessed teeth. P. nigrescens was not found in any pus sample. The high prevalence of P. endodontalis and P. gingivalis suggests that they can play an important role in the pathogenesis of periradicular diseases.

  8. Enhancing Electrophoretic Display Lifetime: Thiol-Polybutadiene Evaporation Barrier Property Response to Network Microstructure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cook, Caitlyn Christian

    An evaporation barrier is required to enhance the lifetime of electrophoretic deposition (EPD) displays. As EPD functions on the basis of reversible deposition and resuspension of colloids suspended in a solvent, evaporation of the solvent ultimately leads to device failure. Incorporation of a thiol-polybutadiene elastomer into EPD displays enabled display lifetime surpassing six months in counting and catalyzed rigid display transition into a flexible package. Final flexible display transition to mass production compels an electronic-ink approach to encapsulate display suspension within an elastomer shell. Final thiol-polybutadiene photosensitive resin network microstructure was idealized to be dense, homogeneous, and expose an elasticmore » response to deformation. Research at hand details an approach to understanding microstructural change within display elastomers. Polybutadiene-based resin properties are modified via polymer chain structure, with and without added aromatic urethane methacrylate difunctionality, and in measuring network response to variation in thiol and initiator concentration. Dynamic mechanical analysis results signify that cross-linked segments within a difunctionalized polybutadiene network were on average eight times more elastically active than that of linked segments within a non-functionalized polybutadiene network. Difunctionalized polybutadiene samples also showed a 2.5 times greater maximum elastic modulus than non-functionalized samples. Hybrid polymer composed of both polybutadiene chains encompassed TE-2000 stiffness and B-1000 elasticity for use in encapsulating display suspension. Later experiments measured kinetic and rheological response due to alteration in dithiol cross-linker chain length via real time Fourier transform infrared spectroscopy and real-time dynamic rheology. Distinct differences were discovered between dithiol resin systems, as maximum thiol conversion achieved in short and long chain length dithiols was 86% and 11%, respectively. Oscillatory real-time rheological experiments confirmed a more uniform network to better dissipate applied shear in short chain length dithiol systems, as long chain length dithiols relayed a steep internal stress build-up due to less cross-links and chain entanglements. Thorough understanding of network formation aids the production of a stronger and impermeable elastomeric barrier for preservation of EPD displays.« less

  9. Elevated levels of short carbon-chain PFCAs in breast milk among Korean women: Current status and potential challenges.

    PubMed

    Kang, Habyeong; Choi, Kyungho; Lee, Haeng-Shin; Kim, Do-Hee; Park, Na-Youn; Kim, Sunmi; Kho, Younglim

    2016-07-01

    Breast milks can be contaminated with perfluoroalkyl substances (PFASs). Exposure to PFASs during early stages of life may lead to adverse health effects among breastfed infants. To date, perfluorootanoic acid (PFOA) and perfluorooctane sulfonate (PFOS) have been most frequently measured PFASs in breast milks worldwide. Information on shorter carbon-chain PFASs in breast milk is scarce. In this study, breast milks were sampled from 264 Korean lactating women, and measured for seventeen PFASs, including ten perfluoroalkyl carboxylates (PFCAs), four perfluoroalkyl sulfonates, and three perfluoroalkyl sulfonamides. PFOA and PFOS were detected in 98.5% of the breast milk samples, with median concentrations of 0.072 and 0.050ng/mL, respectively. Perfluoropentanoic acid (PFPeA), perfluorohexanoic acid (PFHxA), and perfluoroheptanoic acid (PFHpA) were detected in higher frequencies, ranging between 67.4% and 81.8%. The concentrations of short carbon-chain PFCAs in breast milk such as PFPeA and PFHxA were the highest ever reported to date, and were comparable to that of PFOS. Concentrations of shorter chain PFCA in breast milk tended to be higher among the women with longer lactation period, while those of PFOA showed the opposite trend, suggesting a possibility that breastfeeding might be an important route of excretion for PFOA among lactating women. Fish consumption and the use of consumer products, e.g., skin care products, cosmetics and non-stick coated cooking utensils, were identified as significant predictors of PFAS concentrations in breast milk. Health risks associated with PFOA and PFOS exposure through breastfeeding were estimated negligible, however, risks of the short carbon-chain PFCAs could not be assessed because of lack of relevant toxicological information. Further efforts for source identification and exposure management measures for shorter chain PFCAs are necessary. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Rapid Diagnosis of Infection in the Critically Ill, a Multicenter Study of Molecular Detection in Bloodstream Infections, Pneumonia, and Sterile Site Infections*

    PubMed Central

    Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn

    2015-01-01

    Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198

  11. Changes in energy content of lunchtime purchases from fast food restaurants after introduction of calorie labelling: cross sectional customer surveys.

    PubMed

    Dumanovsky, Tamara; Huang, Christina Y; Nonas, Cathy A; Matte, Thomas D; Bassett, Mary T; Silver, Lynn D

    2011-07-26

    To assess the impact of fast food restaurants adding calorie labelling to menu items on the energy content of individual purchases. Cross sectional surveys in spring 2007 and spring 2009 (one year before and nine months after full implementation of regulation requiring chain restaurants' menus to contain details of the energy content of all menu items). Setting 168 randomly selected locations of the top 11 fast food chains in New York City during lunchtime hours. 7309 adult customers interviewed in 2007 and 8489 in 2009. Energy content of individual purchases, based on customers' register receipts and on calorie information provided for all items in menus. For the full sample, mean calories purchased did not change from before to after regulation (828 v 846 kcal, P = 0.22), though a modest decrease was shown in a regression model adjusted for restaurant chain, poverty level for the store location, sex of customers, type of purchase, and inflation adjusted cost (847 v 827 kcal, P = 0.01). Three major chains, which accounted for 42% of customers surveyed, showed significant reductions in mean energy per purchase (McDonald's 829 v 785 kcal, P = 0.02; Au Bon Pain 555 v 475 kcal, P<0.001; KFC 927 v 868 kcal, P<0.01), while mean energy content increased for one chain (Subway 749 v 882 kcal, P<0.001). In the 2009 survey, 15% (1288/8489) of customers reported using the calorie information, and these customers purchased 106 fewer kilocalories than customers who did not see or use the calorie information (757 v 863 kcal, P<0.001). Although no overall decline in calories purchased was observed for the full sample, several major chains saw significant reductions. After regulation, one in six lunchtime customers used the calorie information provided, and these customers made lower calorie choices.

  12. Healing of polymer interfaces: Interfacial dynamics, entanglements, and strength

    DOE PAGES

    Ge, Ting; Robbins, Mark O.; Perahia, Dvora; ...

    2014-07-25

    Self-healing of polymer films often takes place as the molecules diffuse across a damaged region, above their melting temperature. Using molecular dynamics simulations we probe the healing of polymer films and compare the results with those obtained for thermal welding of homopolymer slabs. These two processes differ from each other in their interfacial structure since damage leads to increased polydispersity and more short chains. A polymer sample was cut into two separate films that were then held together in the melt state. The recovery of the damaged film was followed as time elapsed and polymer molecules diffused across the interface.more » The mass uptake and formation of entanglements, as obtained from primitive path analysis, are extracted and correlated with the interfacial strength obtained from shear simulations. We find that the diffusion across the interface is signifcantly faster in the damaged film compared to welding because of the presence of short chains. Though interfacial entanglements increase more rapidly for the damaged films, a large fraction of these entanglements are near chain ends. As a result, the interfacial strength of the healing film increases more slowly than for welding. For both healing and welding, the interfacial strength saturates as the bulk entanglement density is recovered across the interface. However, the saturation strength of the damaged film is below the bulk strength for the polymer sample. At saturation, cut chains remain near the healing interface. They are less entangled and as a result they mechanically weaken the interface. When the strength of the interface saturates, the number of interfacial entanglements scales with the corresponding bulk entanglement density. Chain stiffness increases the density of entanglements, which increases the strength of the interface. Our results show that a few entanglements across the interface are sufficient to resist interfacial chain pullout and enhance the mechanical strength.« less

  13. Changes in energy content of lunchtime purchases from fast food restaurants after introduction of calorie labelling: cross sectional customer surveys

    PubMed Central

    Huang, Christina Y; Nonas, Cathy A; Matte, Thomas D; Bassett, Mary T; Silver, Lynn D

    2011-01-01

    Objective To assess the impact of fast food restaurants adding calorie labelling to menu items on the energy content of individual purchases. Design Cross sectional surveys in spring 2007 and spring 2009 (one year before and nine months after full implementation of regulation requiring chain restaurants’ menus to contain details of the energy content of all menu items). Setting 168 randomly selected locations of the top 11 fast food chains in New York City during lunchtime hours. Participants 7309 adult customers interviewed in 2007 and 8489 in 2009. Main outcome measures Energy content of individual purchases, based on customers’ register receipts and on calorie information provided for all items in menus. Results For the full sample, mean calories purchased did not change from before to after regulation (828 v 846 kcal, P=0.22), though a modest decrease was shown in a regression model adjusted for restaurant chain, poverty level for the store location, sex of customers, type of purchase, and inflation adjusted cost (847 v 827 kcal, P=0.01). Three major chains, which accounted for 42% of customers surveyed, showed significant reductions in mean energy per purchase (McDonald’s 829 v 785 kcal, P=0.02; Au Bon Pain 555 v 475 kcal, P<0.001; KFC 927 v 868 kcal, P<0.01), while mean energy content increased for one chain (Subway 749 v 882 kcal, P<0.001). In the 2009 survey, 15% (1288/8489) of customers reported using the calorie information, and these customers purchased 106 fewer kilocalories than customers who did not see or use the calorie information (757 v 863 kcal, P<0.001). Conclusion Although no overall decline in calories purchased was observed for the full sample, several major chains saw significant reductions. After regulation, one in six lunchtime customers used the calorie information provided, and these customers made lower calorie choices. PMID:21791497

  14. Nationwide Distribution of Per- and Polyfluoroalkyl Substances in Outdoor Dust in Mainland China From Eastern to Western Areas.

    PubMed

    Yao, Yiming; Sun, Hongwen; Gan, Zhiwei; Hu, Hongwei; Zhao, Yangyang; Chang, Shuai; Zhou, Qixing

    2016-04-05

    From eastern to western areas, per- and polyfluoroalkyl substances (PFASs) were detected at substantial levels in the outdoor dust across mainland China. Urban samples generally showed higher levels compared with those of rural samples. Compared with neutral PFASs, ionizable PFASs (C4-C12 perfluoroalkyl carboxylic acids and C4/C8 perfluoroalkyl sulfonic acids) were more abundant, with the highest total concentration up to 1.6 × 10(2) ng/g and perfluorooctanoic acid (PFOA) being a predominant analogue. Fluorotelomer alcohols (FTOHs) and polyfluoroalkyl phosphoric acid diesters (DiPAPs) were both detected in most samples with total concentrations of 0.12-32 and 0.030-20 ng/g, respectively. Perfluorooctane sulfonamidoethanols/sulfonamides (FOSE/As) were detected at low frequencies (<30%). In addition to partitioning to organic moiety, specific adsorption onto mineral particles can be important for PFASs to bind onto outdoor dust, especially for short-chain ionizable PFASs. The eastern plain areas were characterized by a higher contribution of long-chain ionizable PFASs; whereas the western high plateau areas were characterized by the dominating contribution of short-chain analogues. The difference suggests that the long-range atmospheric transport potential of PFASs from source regions to the inland is probably limited by the increase in altitude, and different sources from adjacent regions may influence the western border area of China.

  15. Micro-droplet Digital Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Technologies Provide Highly Sensitive and Accurate Detection of Zika Virus.

    PubMed

    Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei

    2018-06-01

    The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8  copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4  copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1  copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.

  16. Estimates and Standard Errors for Ratios of Normalizing Constants from Multiple Markov Chains via Regeneration

    PubMed Central

    Doss, Hani; Tan, Aixin

    2017-01-01

    In the classical biased sampling problem, we have k densities π1(·), …, πk(·), each known up to a normalizing constant, i.e. for l = 1, …, k, πl(·) = νl(·)/ml, where νl(·) is a known function and ml is an unknown constant. For each l, we have an iid sample from πl,·and the problem is to estimate the ratios ml/ms for all l and all s. This problem arises frequently in several situations in both frequentist and Bayesian inference. An estimate of the ratios was developed and studied by Vardi and his co-workers over two decades ago, and there has been much subsequent work on this problem from many different perspectives. In spite of this, there are no rigorous results in the literature on how to estimate the standard error of the estimate. We present a class of estimates of the ratios of normalizing constants that are appropriate for the case where the samples from the πl’s are not necessarily iid sequences, but are Markov chains. We also develop an approach based on regenerative simulation for obtaining standard errors for the estimates of ratios of normalizing constants. These standard error estimates are valid for both the iid case and the Markov chain case. PMID:28706463

  17. Estimates and Standard Errors for Ratios of Normalizing Constants from Multiple Markov Chains via Regeneration.

    PubMed

    Doss, Hani; Tan, Aixin

    2014-09-01

    In the classical biased sampling problem, we have k densities π 1 (·), …, π k (·), each known up to a normalizing constant, i.e. for l = 1, …, k , π l (·) = ν l (·)/ m l , where ν l (·) is a known function and m l is an unknown constant. For each l , we have an iid sample from π l , · and the problem is to estimate the ratios m l /m s for all l and all s . This problem arises frequently in several situations in both frequentist and Bayesian inference. An estimate of the ratios was developed and studied by Vardi and his co-workers over two decades ago, and there has been much subsequent work on this problem from many different perspectives. In spite of this, there are no rigorous results in the literature on how to estimate the standard error of the estimate. We present a class of estimates of the ratios of normalizing constants that are appropriate for the case where the samples from the π l 's are not necessarily iid sequences, but are Markov chains. We also develop an approach based on regenerative simulation for obtaining standard errors for the estimates of ratios of normalizing constants. These standard error estimates are valid for both the iid case and the Markov chain case.

  18. Evaluation of naturally occurring radioactivity across the State of Kuwait using high-resolution gamma-ray spectrometry

    NASA Astrophysics Data System (ADS)

    Bajoga, A. D.; Alazemi, N.; Shams, H.; Regan, P. H.; Bradley, D. A.

    2017-08-01

    A study of natural radioactivity from 90 different soil samples from the state of Kuwait has been carried out to ascertain the NORM concentration values across the country. The calculated activity concentrations were determined from: (i) the decays of the 226Ra, 214Pb and 214Bi members of the 4n+2 decay chain headed by 238U and; (ii) the 228Ac, 212Pb and 208Tl members of the 4n chain headed by 232Th. The study also included evaluations for the 235U decay chain with the 186 keV doublet transition used together with the measured 4n+2 activity concentration values to determine the 235U/238U isotopic ratios for each sample. The values for the arithmetic mean activity concentrations for 90 separate locations across Kuwait as determined in the current work were 17.2, 14.1, and 368 Bq/kg, with standard deviations of 5.2, 3.7 and 90 Bq/kg for the 238U, 232Th and 40K activity concentrations respectively. Measured isotope ratios for 235U/238U give an arithmetic mean value for all of the samples of 0.045±0.003, consistent with that expected for natural uranium. These results indicate no evidence for a radiologically significant dispersion of additional depleted uranium across the entire State of Kuwait from the 1991 Gulf War.

  19. Sampling Long- versus Short-Range Interactions Defines the Ability of Force Fields To Reproduce the Dynamics of Intrinsically Disordered Proteins.

    PubMed

    Mercadante, Davide; Wagner, Johannes A; Aramburu, Iker V; Lemke, Edward A; Gräter, Frauke

    2017-09-12

    Molecular dynamics (MD) simulations have valuably complemented experiments describing the dynamics of intrinsically disordered proteins (IDPs), particularly since the proposal of models to solve the artificial collapse of IDPs in silico. Such models suggest redefining nonbonded interactions, by either increasing water dispersion forces or adopting the Kirkwood-Buff force field. These approaches yield extended conformers that better comply with experiments, but it is unclear if they all sample the same intrachain dynamics of IDPs. We have tested this by employing MD simulations and single-molecule Förster resonance energy transfer spectroscopy to sample the dimensions of systems with different sequence compositions, namely strong and weak polyelectrolytes. For strong polyelectrolytes in which charge effects dominate, all the proposed solutions equally reproduce the expected ensemble's dimensions. For weak polyelectrolytes, at lower cutoffs, force fields abnormally alter intrachain dynamics, overestimating excluded volume over chain flexibility or reporting no difference between the dynamics of different chains. The TIP4PD water model alone can reproduce experimentally observed changes in extensions (dimensions), but not quantitatively and with only weak statistical significance. Force field limitations are reversed with increased interaction cutoffs, showing that chain dynamics are critically defined by the presence of long-range interactions. Force field analysis aside, our study provides the first insights into how long-range interactions critically define IDP dimensions and raises the question of which length range is crucial to correctly sample the overall dimensions and internal dynamics of the large group of weakly charged yet highly polar IDPs.

  20. Synthesis of Programmable Main-chain Liquid-crystalline Elastomers Using a Two-stage Thiol-acrylate Reaction.

    PubMed

    Saed, Mohand O; Torbati, Amir H; Nair, Devatha P; Yakacki, Christopher M

    2016-01-19

    This study presents a novel two-stage thiol-acrylate Michael addition-photopolymerization (TAMAP) reaction to prepare main-chain liquid-crystalline elastomers (LCEs) with facile control over network structure and programming of an aligned monodomain. Tailored LCE networks were synthesized using routine mixing of commercially available starting materials and pouring monomer solutions into molds to cure. An initial polydomain LCE network is formed via a self-limiting thiol-acrylate Michael-addition reaction. Strain-to-failure and glass transition behavior were investigated as a function of crosslinking monomer, pentaerythritol tetrakis(3-mercaptopropionate) (PETMP). An example non-stoichiometric system of 15 mol% PETMP thiol groups and an excess of 15 mol% acrylate groups was used to demonstrate the robust nature of the material. The LCE formed an aligned and transparent monodomain when stretched, with a maximum failure strain over 600%. Stretched LCE samples were able to demonstrate both stress-driven thermal actuation when held under a constant bias stress or the shape-memory effect when stretched and unloaded. A permanently programmed monodomain was achieved via a second-stage photopolymerization reaction of the excess acrylate groups when the sample was in the stretched state. LCE samples were photo-cured and programmed at 100%, 200%, 300%, and 400% strain, with all samples demonstrating over 90% shape fixity when unloaded. The magnitude of total stress-free actuation increased from 35% to 115% with increased programming strain. Overall, the two-stage TAMAP methodology is presented as a powerful tool to prepare main-chain LCE systems and explore structure-property-performance relationships in these fascinating stimuli-sensitive materials.

Top