Effect of relativistic motion on witnessing nonclassicality of quantum states

NASA Astrophysics Data System (ADS)

Checińska, Agata; Lorek, Krzysztof; Dragan, Andrzej

2017-01-01

We show that the operational definition of nonclassicality of a quantum state depends on the motion of the observer. We use the relativistic Unruh-DeWitt detector model to witness nonclassicality of the probed field state. It turns out that the witness based on the properties of the P representation of the quantum state depends on the trajectory of the detector. Inertial and noninertial motion of the device have qualitatively different impact on the performance of the witness.

Detection limit of a VCO based detection chain dedicated to particles recognition and tracking

NASA Astrophysics Data System (ADS)

Coulié, K.; Rahajandraibe, W.; Aziza, H.; Micolau, G.; Vauché, R.

2018-01-01

A particle detection chain based on CMOS-SOI VCO circuit is presented. The solution is used for the recognition and the tracking of a given particle at circuit level. TCAD simulation of the detector has been performed on a 3×3 matrix of diodes based detector for particles recognition and tracking. The current response of the detector has been used for a case study in order to determine the ability of the chain to recognize an alpha particle crossing a 3×3 detection cell. The detection limit of the proposed solution is investigated and discussed in this paper.

A Review of Accelerometry-Based Wearable Motion Detectors for Physical Activity Monitoring

PubMed Central

Yang, Che-Chang; Hsu, Yeh-Liang

2010-01-01

Characteristics of physical activity are indicative of one’s mobility level, latent chronic diseases and aging process. Accelerometers have been widely accepted as useful and practical sensors for wearable devices to measure and assess physical activity. This paper reviews the development of wearable accelerometry-based motion detectors. The principle of accelerometry measurement, sensor properties and sensor placements are first introduced. Various research using accelerometry-based wearable motion detectors for physical activity monitoring and assessment, including posture and movement classification, estimation of energy expenditure, fall detection and balance control evaluation, are also reviewed. Finally this paper reviews and compares existing commercial products to provide a comprehensive outlook of current development status and possible emerging technologies. PMID:22163626

Using the Graphing Calculator--in Two-Dimensional Motion Plots.

ERIC Educational Resources Information Center

Brueningsen, Chris; Bower, William

1995-01-01

Presents a series of simple activities involving generalized two-dimensional motion topics to prepare students to study projectile motion. Uses a pair of motion detectors, each connected to a calculator-based-laboratory (CBL) unit interfaced with a standard graphics calculator, to explore two-dimensional motion. (JRH)

Image deblurring by motion estimation for remote sensing

NASA Astrophysics Data System (ADS)

Chen, Yueting; Wu, Jiagu; Xu, Zhihai; Li, Qi; Feng, Huajun

2010-08-01

The imagery resolution of imaging systems for remote sensing is often limited by image degradation resulting from unwanted motion disturbances of the platform during image exposures. Since the form of the platform vibration can be arbitrary, the lack of priori knowledge about the motion function (the PSF) suggests blind restoration approaches. A deblurring method which combines motion estimation and image deconvolution both for area-array and TDI remote sensing has been proposed in this paper. The image motion estimation is accomplished by an auxiliary high-speed detector and a sub-pixel correlation algorithm. The PSF is then reconstructed from estimated image motion vectors. Eventually, the clear image can be recovered by the Richardson-Lucy (RL) iterative deconvolution algorithm from the blurred image of the prime camera with the constructed PSF. The image deconvolution for the area-array detector is direct. While for the TDICCD detector, an integral distortion compensation step and a row-by-row deconvolution scheme are applied. Theoretical analyses and experimental results show that, the performance of the proposed concept is convincing. Blurred and distorted images can be properly recovered not only for visual observation, but also with significant objective evaluation increment.

Emulating the visual receptive-field properties of MST neurons with a template model of heading estimation

NASA Technical Reports Server (NTRS)

Perrone, J. A.; Stone, L. S.

1998-01-01

We have proposed previously a computational neural-network model by which the complex patterns of retinal image motion generated during locomotion (optic flow) can be processed by specialized detectors acting as templates for specific instances of self-motion. The detectors in this template model respond to global optic flow by sampling image motion over a large portion of the visual field through networks of local motion sensors with properties similar to those of neurons found in the middle temporal (MT) area of primate extrastriate visual cortex. These detectors, arranged within cortical-like maps, were designed to extract self-translation (heading) and self-rotation, as well as the scene layout (relative distances) ahead of a moving observer. We then postulated that heading from optic flow is directly encoded by individual neurons acting as heading detectors within the medial superior temporal (MST) area. Others have questioned whether individual MST neurons can perform this function because some of their receptive-field properties seem inconsistent with this role. To resolve this issue, we systematically compared MST responses with those of detectors from two different configurations of the model under matched stimulus conditions. We found that the characteristic physiological properties of MST neurons can be explained by the template model. We conclude that MST neurons are well suited to support self-motion estimation via a direct encoding of heading and that the template model provides an explicit set of testable hypotheses that can guide future exploration of MST and adjacent areas within the superior temporal sulcus.

Bio-inspired motion detection in an FPGA-based smart camera module.

PubMed

Köhler, T; Röchter, F; Lindemann, J P; Möller, R

2009-03-01

Flying insects, despite their relatively coarse vision and tiny nervous system, are capable of carrying out elegant and fast aerial manoeuvres. Studies of the fly visual system have shown that this is accomplished by the integration of signals from a large number of elementary motion detectors (EMDs) in just a few global flow detector cells. We developed an FPGA-based smart camera module with more than 10,000 single EMDs, which is closely modelled after insect motion-detection circuits with respect to overall architecture, resolution and inter-receptor spacing. Input to the EMD array is provided by a CMOS camera with a high frame rate. Designed as an adaptable solution for different engineering applications and as a testbed for biological models, the EMD detector type and parameters such as the EMD time constants, the motion-detection directions and the angle between correlated receptors are reconfigurable online. This allows a flexible and simultaneous detection of complex motion fields such as translation, rotation and looming, such that various tasks, e.g., obstacle avoidance, height/distance control or speed regulation can be performed by the same compact device.

Rational design and dynamics of self-propelled colloidal bead chains: from rotators to flagella.

PubMed

Vutukuri, Hanumantha Rao; Bet, Bram; van Roij, René; Dijkstra, Marjolein; Huck, Wilhelm T S

2017-12-01

The quest for designing new self-propelled colloids is fuelled by the demand for simple experimental models to study the collective behaviour of their more complex natural counterparts. Most synthetic self-propelled particles move by converting the input energy into translational motion. In this work we address the question if simple self-propelled spheres can assemble into more complex structures that exhibit rotational motion, possibly coupled with translational motion as in flagella. We exploit a combination of induced dipolar interactions and a bonding step to create permanent linear bead chains, composed of self-propelled Janus spheres, with a well-controlled internal structure. Next, we study how flexibility between individual swimmers in a chain can affect its swimming behaviour. Permanent rigid chains showed only active rotational or spinning motion, whereas longer semi-flexible chains showed both translational and rotational motion resembling flagella like-motion, in the presence of the fuel. Moreover, we are able to reproduce our experimental results using numerical calculations with a minimal model, which includes full hydrodynamic interactions with the fluid. Our method is general and opens a new way to design novel self-propelled colloids with complex swimming behaviours, using different complex starting building blocks in combination with the flexibility between them.

Comparative Study of Various Types of Vehicle Detectors

DOT National Transportation Integrated Search

1977-09-01

This report is a comparison between the different types of vehicle detectors and associated equipment. It covers practically all of the presence and motion detectors either being sold commercially or actively researched at this time, and includes rad...

Psilocybin impairs high-level but not low-level motion perception.

PubMed

Carter, Olivia L; Pettigrew, John D; Burr, David C; Alais, David; Hasler, Felix; Vollenweider, Franz X

2004-08-26

The hallucinogenic serotonin(1A&2A) agonist psilocybin is known for its ability to induce illusions of motion in otherwise stationary objects or textured surfaces. This study investigated the effect of psilocybin on local and global motion processing in nine human volunteers. Using a forced choice direction of motion discrimination task we show that psilocybin selectively impairs coherence sensitivity for random dot patterns, likely mediated by high-level global motion detectors, but not contrast sensitivity for drifting gratings, believed to be mediated by low-level detectors. These results are in line with those observed within schizophrenic populations and are discussed in respect to the proposition that psilocybin may provide a model to investigate clinical psychosis and the pharmacological underpinnings of visual perception in normal populations.

The Temporal Tuning of the Drosophila Motion Detectors Is Determined by the Dynamics of Their Input Elements.

PubMed

Arenz, Alexander; Drews, Michael S; Richter, Florian G; Ammer, Georg; Borst, Alexander

2017-04-03

Detecting the direction of motion contained in the visual scene is crucial for many behaviors. However, because single photoreceptors only signal local luminance changes, motion detection requires a comparison of signals from neighboring photoreceptors across time in downstream neuronal circuits. For signals to coincide on readout neurons that thus become motion and direction selective, different input lines need to be delayed with respect to each other. Classical models of motion detection rely on non-linear interactions between two inputs after different temporal filtering. However, recent studies have suggested the requirement for at least three, not only two, input signals. Here, we comprehensively characterize the spatiotemporal response properties of all columnar input elements to the elementary motion detectors in the fruit fly, T4 and T5 cells, via two-photon calcium imaging. Between these input neurons, we find large differences in temporal dynamics. Based on this, computer simulations show that only a small subset of possible arrangements of these input elements maps onto a recently proposed algorithmic three-input model in a way that generates a highly direction-selective motion detector, suggesting plausible network architectures. Moreover, modulating the motion detection system by octopamine-receptor activation, we find the temporal tuning of T4 and T5 cells to be shifted toward higher frequencies, and this shift can be fully explained by the concomitant speeding of the input elements. Copyright © 2017 Elsevier Ltd. All rights reserved.

Single-layer and dual-layer contrast-enhanced mammography using amorphous selenium flat panel detectors

NASA Astrophysics Data System (ADS)

Allec, N.; Abbaszadeh, S.; Karim, K. S.

2011-09-01

The accumulation of injected contrast agents allows the image enhancement of lesions through the use of contrast-enhanced mammography. In this technique, the combination of two acquired images is used to create an enhanced image. There exist several methods to acquire the images to be combined, which include dual energy subtraction using a single detection layer that suffers from motion artifacts due to patient motion between image acquisition. To mitigate motion artifacts, a detector composed of two layers may be used to simultaneously acquire the low and high energy images. In this work, we evaluate both of these methods using amorphous selenium as the detection material to find the system parameters (tube voltage, filtration, photoconductor thickness and relative intensity ratio) leading to the optimal performance. We then compare the performance of the two detectors under the variation of contrast agent concentration, tumor size and dose. The detectability was found to be most comparable at the lower end of the evaluated factors. The single-layer detector not only led to better contrast, due to its greater spectral separation capabilities, but also had lower quantum noise. The single-layer detector was found to have a greater detectability by a factor of 2.4 for a 2.5 mm radius tumor having a contrast agent concentration of 1.5 mg ml-1 in a 4.5 cm thick 50% glandular breast. The inclusion of motion artifacts in the comparison is part of ongoing research efforts.

Single-layer and dual-layer contrast-enhanced mammography using amorphous selenium flat panel detectors.

PubMed

Allec, N; Abbaszadeh, S; Karim, K S

2011-09-21

The accumulation of injected contrast agents allows the image enhancement of lesions through the use of contrast-enhanced mammography. In this technique, the combination of two acquired images is used to create an enhanced image. There exist several methods to acquire the images to be combined, which include dual energy subtraction using a single detection layer that suffers from motion artifacts due to patient motion between image acquisition. To mitigate motion artifacts, a detector composed of two layers may be used to simultaneously acquire the low and high energy images. In this work, we evaluate both of these methods using amorphous selenium as the detection material to find the system parameters (tube voltage, filtration, photoconductor thickness and relative intensity ratio) leading to the optimal performance. We then compare the performance of the two detectors under the variation of contrast agent concentration, tumor size and dose. The detectability was found to be most comparable at the lower end of the evaluated factors. The single-layer detector not only led to better contrast, due to its greater spectral separation capabilities, but also had lower quantum noise. The single-layer detector was found to have a greater detectability by a factor of 2.4 for a 2.5 mm radius tumor having a contrast agent concentration of 1.5 mg ml(-1) in a 4.5 cm thick 50% glandular breast. The inclusion of motion artifacts in the comparison is part of ongoing research efforts.

Seven Experiments to Test the Local Lorentz Invariance of c

NASA Technical Reports Server (NTRS)

Gezari, Daniel Y.

2005-01-01

The speed of light has never been measured directly with a moving detector to test the fundamental assertion of special relativity that c is invariant to motion of the observer. Seven simple experiments are proposed, four of which could test the invariance of c to motion of the detector. Three other observations of moving sources could test Einstein s second postulate and the relativity of stellar aberration. There are lingering concerns that the speed of light may depend on the motion of the observer, after all. This issue can now be resolved by experiment.

Color properties of the motion detectors projecting to the goldfish tectum: I. A color matching study.

PubMed

Maximov, Vadim; Maximova, Elena; Damjanović, Ilija; Maximov, Paul

2014-09-01

Responses of direction-selective and orientation-selective motion detectors were recorded extracellularly from the axon terminals of ganglion cells in the superficial layers of the tectum opticum of immobilized goldfish, Carassius gibelio (Bloch, 1782). Color stripes or edges moving on some color background (presented on the CRT monitor with known emission spectra of its phosphors) served as stimuli. It was shown that stimuli of any color can be more or less matched with the background by varying their intensities what is indicative of color blindness of the motion detectors. Sets of stimuli which matched the background proved to represent planes in the three-dimensional color space of the goldfish. A relative contribution of different types of cones to the spectral sensitivity was estimated according to orientation of the plane of color matches. The spectral sensitivity of any motion detector was shown to be determined mainly by long-wave cones with a weak negative (opponent) contributions of middle-wave and/or short-wave ones. This resulted in reduced sensitivity in the blue-green end of the spectrum, what may be considered as an adaptation to the aquatic environment where, because of the substantial light scattering of a blue-green light, acute vision is possible only in a red region of the spectrum.

The Falling Chain of Hopkins, Tait, Steele and Cayley

ERIC Educational Resources Information Center

Wong, Chun Wa; Youn, Seo Ho; Yasui, Kosuke

2007-01-01

A uniform, flexible and frictionless chain falling link by link from a heap by the edge of a table falls with an acceleration g/3 if the motion is nonconservative, but g/2 if the motion is conservative, g being the acceleration due to gravity. Unable to construct such a falling chain, we use instead higher-dimensional versions of it. A home…

Characterization of selected elementary motion detector cells to image primitives.

PubMed

Benson, Leslie A; Barrett, Steven F; Wright, Cameron H G

2008-01-01

Developing a visual sensing system, complete with motion processing hardware and software would have many applications to current technology. It could be mounted on many autonomous vehicles to provide information about the navigational environment, as well as obstacle avoidance features. Incorporating the motion processing capabilities into the sensor requires a new approach to the algorithm implementation. This research, and that of many others, have turned to nature for inspiration. Elementary motion detector (EMD) cells are involved in a biological preprocessing network to provide information to the motion processing lobes of the house degrees y Musca domestica. This paper describes the response of the photoreceptor inputs to the EMDs. The inputs to the EMD components are tested as they are stimulated with varying image primitives. This is the first of many steps in characterizing the EMD response to image primitives.

Geometric somersaults of a polymer chain through cyclic twisting motions

NASA Astrophysics Data System (ADS)

Yanao, Tomohiro; Hino, Taiko

2017-01-01

This study explores the significance of geometric angle shifts, which we call geometric somersaults, arising from cyclic twisting motions of a polymer chain. A five-bead polymer chain serves as a concise and minimal model of a molecular shaft throughout this study. We first show that this polymer chain can change its orientation about its longitudinal axis largely, e.g., 120∘, under conditions of zero total angular momentum by changing the two dihedral angles in a cyclic manner. This phenomenon is an example of the so-called "falling cat" phenomenon, where a falling cat undergoes a geometric somersault by changing its body shape under conditions of zero total angular momentum. We then extend the geometric somersault of the polymer chain to a noisy and viscous environment, where the polymer chain is steered by external driving forces. This extension shows that the polymer chain can achieve an orientation change keeping its total angular momentum and total external torque fluctuating around zero in a noisy and viscous environment. As an application, we argue that the geometric somersault of the polymer chain by 120∘ may serve as a prototypical and coarse-grained model for the rotary motion of the central shaft of ATP synthase (FOF1 -ATPase). This geometric somersault is in clear contrast to the standard picture for the rotary motion of the central shaft as a rigid body, which generally incurs nonzero total angular momentum and nonzero total external torque. The power profile of the geometric somersault implies a preliminary mechanism for elastic power transmission. The results of this study may be of fundamental interest in twisting and rotary motions of biomolecules.

Role of internal motions and molecular geometry on the NMR relaxation of hydrocarbons

NASA Astrophysics Data System (ADS)

Singer, P. M.; Asthagiri, D.; Chen, Z.; Valiya Parambathu, A.; Hirasaki, G. J.; Chapman, W. G.

2018-04-01

The role of internal motions and molecular geometry on 1H NMR relaxation rates in liquid-state hydrocarbons is investigated using MD (molecular dynamics) simulations of the autocorrelation functions for intramolecular and intermolecular 1H-1H dipole-dipole interactions. The effects of molecular geometry and internal motions on the functional form of the autocorrelation functions are studied by comparing symmetric molecules such as neopentane and benzene to corresponding straight-chain alkanes n-pentane and n-hexane, respectively. Comparison of rigid versus flexible molecules shows that internal motions cause the intramolecular and intermolecular correlation-times to get significantly shorter, and the corresponding relaxation rates to get significantly smaller, especially for longer-chain n-alkanes. Site-by-site simulations of 1H's across the chains indicate significant variations in correlation times and relaxation rates across the molecule, and comparison with measurements reveals insights into cross-relaxation effects. Furthermore, the simulations reveal new insights into the relative strength of intramolecular versus intermolecular relaxation as a function of internal motions, as a function of molecular geometry, and on a site-by-site basis across the chain.

Rapid portal imaging with a high-efficiency, large field-of-view detector.

PubMed

Mosleh-Shirazi, M A; Evans, P M; Swindell, W; Symonds-Tayler, J R; Webb, S; Partridge, M

1998-12-01

The design, construction, and performance evaluation of an electronic portal imaging device (EPID) are described. The EPID has the same imaging geometry as the current mirror-based systems except for the x-ray detection stage, where a two-dimensional (2D) array of 1 cm thick CsI(Tl) detector elements are utilized. The approximately 18% x-ray quantum efficiency of the scintillation detector and its 30 x 40 cm2 field-of-view at the isocenter are greater than other area-imaging EPIDs. The imaging issues addressed are theoretical and measured signal-to-noise ratio, linearity of the imaging chain, influence of frame-summing on image quality and image calibration. Portal images of test objects and a humanoid phantom are used to measure the performance of the system. An image quality similar to the current devices is achieved but with a lower dose. With approximately 1 cGy dose delivered by a 6 MV beam, a 2 mm diam structure of 1.3% contrast and an 18 mm diam object of 0.125% contrast can be resolved without using image-enhancement methods. A spatial resolution of about 2 mm at the isocenter is demonstrated. The capability of the system to perform fast sequential imaging, synchronized with the radiation pulses, makes it suitable for patient motion studies and verification of intensity-modulated beams as well as its application in cone-beam megavoltage computed tomography.

Polymer models of interphase chromosomes

PubMed Central

Vasquez, Paula A; Bloom, Kerry

2014-01-01

Clear organizational patterns on the genome have emerged from the statistics of population studies of fixed cells. However, how these results translate into the dynamics of individual living cells remains unexplored. We use statistical mechanics models derived from polymer physics to inquire into the effects that chromosome properties and dynamics have in the temporal and spatial behavior of the genome. Overall, changes in the properties of individual chains affect the behavior of all other chains in the domain. We explore two modifications of chain behavior: single chain motion and chain-chain interactions. We show that there is not a direct relation between these effects, as increase in motion, doesn’t necessarily translate into an increase on chain interaction. PMID:25482191

Polymer Chain Conformation and Dynamical Confinement in a Model One-Component Nanocomposite

NASA Astrophysics Data System (ADS)

Mark, C.; Holderer, O.; Allgaier, J.; Hübner, E.; Pyckhout-Hintzen, W.; Zamponi, M.; Radulescu, A.; Feoktystov, A.; Monkenbusch, M.; Jalarvo, N.; Richter, D.

2017-07-01

We report a neutron-scattering investigation on the structure and dynamics of a single-component nanocomposite based on SiO2 particles that were grafted with polyisoprene chains at the entanglement limit. By skillful labeling, we access both the monomer density in the corona as well as the conformation of the grafted chains. While the corona profile follows a r-1 power law, the conformation of a grafted chain is identical to that of a chain in a reference melt, implying a high mutual penetration of the coronas from different particles. The brush crowding leads to topological confinement of the chain dynamics: (i) At local scales, the segmental dynamics is unchanged compared to the reference melt, while (ii) at the scale of the chain, the dynamics appears to be slowed down; (iii) by performing a mode analysis in terms of end-fixed Rouse chains, the slower dynamics is tracked to topological confinement within the cone spanned by the adjacent grafts; (iv) by adding 50% matrix chains, the topological confinement sensed by the grafted chain is lifted partially and the apparent chain motion is accelerated. We observe a crossover from pure Rouse motion at short times to topological confined motion beyond the time when the segmental mean squared displacement has reached the distance to the next graft.

Lightweight biometric detection system for human classification using pyroelectric infrared detectors.

PubMed

Burchett, John; Shankar, Mohan; Hamza, A Ben; Guenther, Bob D; Pitsianis, Nikos; Brady, David J

2006-05-01

We use pyroelectric detectors that are differential in nature to detect motion in humans by their heat emissions. Coded Fresnel lens arrays create boundaries that help to localize humans in space as well as to classify the nature of their motion. We design and implement a low-cost biometric tracking system by using off-the-shelf components. We demonstrate two classification methods by using data gathered from sensor clusters of dual-element pyroelectric detectors with coded Fresnel lens arrays. We propose two algorithms for person identification, a more generalized spectral clustering method and a more rigorous example that uses principal component regression to perform a blind classification.

49 CFR 234.265 - Timing relays and timing devices.

Code of Federal Regulations, 2010 CFR

2010-10-01

... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION GRADE CROSSING SIGNAL SYSTEM SAFETY AND STATE ACTION PLANS... devices which perform internal functions associated with motion detectors, motion sensors, and grade...

Motion of spin label side chains in cellular retinol-binding protein: correlation with structure and nearest-neighbor interactions in an antiparallel beta-sheet.

PubMed

Lietzow, Michael A; Hubbell, Wayne L

2004-03-23

A goal in the development of site-directed spin labeling in proteins is to correlate the motion of a nitroxide side chain with local structure, interactions, and dynamics. Significant progress toward this goal has been made using alpha-helical proteins of known structure, and the present study is the first step in a similar exploration of a beta-sheet protein, cellular retinol-binding protein (CRBP). Nitroxide side chains were introduced along both interior and edge strands. At sites in interior strands, the side-chain motion is strongly influenced by interactions with side chains of neighboring strands, giving rise to a rich variety of dynamic modes (weakly ordered, strongly ordered, immobilized) and complex electron paramagnetic resonance spectra that are modulated by strand twist. The interactions giving rise to the dynamic modes are explored using mutagenesis, and the results demonstrate the particular importance of the non-hydrogen-bonded neighbor residue in giving rise to highly ordered states. Along edge strands of the beta-sheet, the motion of the side chain is simple and weakly ordered, resembling that at solvent-exposed surfaces of an alpha-helix. A simple working model is proposed that can account for the wide variety of dynamic modes encountered. Collectively, the results suggest that the nitroxide side chain is an effective probe of side-chain interactions, and that site-directed spin labeling should be a powerful means of monitoring conformational changes that involve changes in beta-sheet topology.

Sequential motion of the ossicular chain measured by laser Doppler vibrometry.

PubMed

Kunimoto, Yasuomi; Hasegawa, Kensaku; Arii, Shiro; Kataoka, Hideyuki; Yazama, Hiroaki; Kuya, Junko; Fujiwara, Kazunori; Takeuchi, Hiromi

2017-12-01

In order to help a surgeon make the best decision, a more objective method of measuring ossicular motion is required. A laser Doppler vibrometer was mounted on a surgical microscope. To measure ossicular chain vibrations, eight patients with cochlear implants were investigated. To assess the motions of the ossicular chain, velocities at five points were measured with tonal stimuli of 1 and 3 kHz, which yielded reproducible results. The sequential amplitude change at each point was calculated with phase shifting from the tonal stimulus. Motion of the ossicular chain was visualized from the averaged results using the graphics application. The head of the malleus and the body of the incus showed synchronized movement as one unit. In contrast, the stapes (incudostapedial joint and posterior crus) moved synchronously in opposite phase to the malleus and incus. The amplitudes at 1 kHz were almost twice those at 3 kHz. Our results show that the malleus and incus unit and the stapes move with a phase difference.

Comparison of different detection methods for persistent multiple hypothesis tracking in wide area motion imagery

NASA Astrophysics Data System (ADS)

Hartung, Christine; Spraul, Raphael; Schuchert, Tobias

2017-10-01

Wide area motion imagery (WAMI) acquired by an airborne multicamera sensor enables continuous monitoring of large urban areas. Each image can cover regions of several square kilometers and contain thousands of vehicles. Reliable vehicle tracking in this imagery is an important prerequisite for surveillance tasks, but remains challenging due to low frame rate and small object size. Most WAMI tracking approaches rely on moving object detections generated by frame differencing or background subtraction. These detection methods fail when objects slow down or stop. Recent approaches for persistent tracking compensate for missing motion detections by combining a detection-based tracker with a second tracker based on appearance or local context. In order to avoid the additional complexity introduced by combining two trackers, we employ an alternative single tracker framework that is based on multiple hypothesis tracking and recovers missing motion detections with a classifierbased detector. We integrate an appearance-based similarity measure, merge handling, vehicle-collision tests, and clutter handling to adapt the approach to the specific context of WAMI tracking. We apply the tracking framework on a region of interest of the publicly available WPAFB 2009 dataset for quantitative evaluation; a comparison to other persistent WAMI trackers demonstrates state of the art performance of the proposed approach. Furthermore, we analyze in detail the impact of different object detection methods and detector settings on the quality of the output tracking results. For this purpose, we choose four different motion-based detection methods that vary in detection performance and computation time to generate the input detections. As detector parameters can be adjusted to achieve different precision and recall performance, we combine each detection method with different detector settings that yield (1) high precision and low recall, (2) high recall and low precision, and (3) best f-score. Comparing the tracking performance achieved with all generated sets of input detections allows us to quantify the sensitivity of the tracker to different types of detector errors and to derive recommendations for detector and parameter choice.

Body Motion and Graphing.

ERIC Educational Resources Information Center

Nemirovsky, Ricardo; Tierney, Cornelia; Wright, Tracy

1998-01-01

Analyzed two children's use of a computer-based motion detector to make sense of symbolic expressions (Cartesian graphs). Found three themes: (1) tool perspectives, efforts to understand graphical responses to body motion; (2) fusion, emergent ways of talking and behaving that merge symbols and referents; and (3) graphical spaces, when changing…

Energy estimation of inclined air showers with help of detector responses

NASA Astrophysics Data System (ADS)

Dedenko, L. G.; Fedorova, G. F.; Fedunin, E. Yu.; Glushkov, A. V.; Kolosov, V. A.; Podgrudkov, D. A.; Pravdin, M. I.; Roganova, T. M.; Sleptsov, I. E.

2004-11-01

The method of groups of muons have been suggested to estimate the detector responses for the inclined giant air shower in terms of quark-gluon string model with the geomagnetic field taken into account. Groups are average numbers of muons of positive or negative sign in small intervals of energy, height production and direction of motion in the atmosphere estimated with help of transport equations. For every group a relativistic equation of motion has been solved with geomagnetic field and ionization losses taken into account. The response of a detector and arrival time for every group which strike a detector has been estimated. The energy of the inclined giant air shower estimated with help of calculated responses and the data observed at the Yakutsk array happens to be above 10 20 eV.

Effects of transients in LIGO suspensions on searches for gravitational waves

NASA Astrophysics Data System (ADS)

Walker, M.; Abbott, T. D.; Aston, S. M.; González, G.; Macleod, D. M.; McIver, J.; Abbott, B. P.; Abbott, R.; Adams, C.; Adhikari, R. X.; Anderson, S. B.; Ananyeva, A.; Appert, S.; Arai, K.; Ballmer, S. W.; Barker, D.; Barr, B.; Barsotti, L.; Bartlett, J.; Bartos, I.; Batch, J. C.; Bell, A. S.; Betzwieser, J.; Billingsley, G.; Birch, J.; Biscans, S.; Biwer, C.; Blair, C. D.; Bork, R.; Brooks, A. F.; Ciani, G.; Clara, F.; Countryman, S. T.; Cowart, M. J.; Coyne, D. C.; Cumming, A.; Cunningham, L.; Danzmann, K.; Da Silva Costa, C. F.; Daw, E. J.; DeBra, D.; DeRosa, R. T.; DeSalvo, R.; Dooley, K. L.; Doravari, S.; Driggers, J. C.; Dwyer, S. E.; Effler, A.; Etzel, T.; Evans, M.; Evans, T. M.; Factourovich, M.; Fair, H.; Fernández Galiana, A.; Fisher, R. P.; Fritschel, P.; Frolov, V. V.; Fulda, P.; Fyffe, M.; Giaime, J. A.; Giardina, K. D.; Goetz, E.; Goetz, R.; Gras, S.; Gray, C.; Grote, H.; Gushwa, K. E.; Gustafson, E. K.; Gustafson, R.; Hall, E. D.; Hammond, G.; Hanks, J.; Hanson, J.; Hardwick, T.; Harry, G. M.; Heintze, M. C.; Heptonstall, A. W.; Hough, J.; Izumi, K.; Jones, R.; Kandhasamy, S.; Karki, S.; Kasprzack, M.; Kaufer, S.; Kawabe, K.; Kijbunchoo, N.; King, E. J.; King, P. J.; Kissel, J. S.; Korth, W. Z.; Kuehn, G.; Landry, M.; Lantz, B.; Lockerbie, N. A.; Lormand, M.; Lundgren, A. P.; MacInnis, M.; Márka, S.; Márka, Z.; Markosyan, A. S.; Maros, E.; Martin, I. W.; Martynov, D. V.; Mason, K.; Massinger, T. J.; Matichard, F.; Mavalvala, N.; McCarthy, R.; McClelland, D. E.; McCormick, S.; McIntyre, G.; Mendell, G.; Merilh, E. L.; Meyers, P. M.; Miller, J.; Mittleman, R.; Moreno, G.; Mueller, G.; Mullavey, A.; Munch, J.; Nuttall, L. K.; Oberling, J.; Oliver, M.; Oppermann, P.; Oram, Richard J.; O'Reilly, B.; Ottaway, D. J.; Overmier, H.; Palamos, J. R.; Paris, H. R.; Parker, W.; Pele, A.; Penn, S.; Phelps, M.; Pierro, V.; Pinto, I.; Principe, M.; Prokhorov, L. G.; Puncken, O.; Quetschke, V.; Quintero, E. A.; Raab, F. J.; Radkins, H.; Raffai, P.; Reid, S.; Reitze, D. H.; Robertson, N. A.; Rollins, J. G.; Roma, V. J.; Romie, J. H.; Rowan, S.; Ryan, K.; Sadecki, T.; Sanchez, E. J.; Sandberg, V.; Savage, R. L.; Schofield, R. M. S.; Sellers, D.; Shaddock, D. A.; Shaffer, T. J.; Shapiro, B.; Shawhan, P.; Shoemaker, D. H.; Sigg, D.; Slagmolen, B. J. J.; Smith, B.; Smith, J. R.; Sorazu, B.; Staley, A.; Strain, K. A.; Tanner, D. B.; Taylor, R.; Thomas, M.; Thomas, P.; Thorne, K. A.; Thrane, E.; Torrie, C. I.; Traylor, G.; Tuyenbayev, D.; Vajente, G.; Valdes, G.; van Veggel, A. A.; Vecchio, A.; Veitch, P. J.; Venkateswara, K.; Vo, T.; Vorvick, C.; Ward, R. L.; Warner, J.; Weaver, B.; Weiss, R.; Weßels, P.; Willke, B.; Wipf, C. C.; Worden, J.; Wu, G.; Yamamoto, H.; Yancey, C. C.; Yu, Hang; Yu, Haocun; Zhang, L.; Zucker, M. E.; Zweizig, J.

2017-12-01

This paper presents an analysis of the transient behavior of the Advanced LIGO (Laser Interferometer Gravitational-wave Observatory) suspensions used to seismically isolate the optics. We have characterized the transients in the longitudinal motion of the quadruple suspensions during Advanced LIGO's first observing run. Propagation of transients between stages is consistent with modeled transfer functions, such that transient motion originating at the top of the suspension chain is significantly reduced in amplitude at the test mass. We find that there are transients seen by the longitudinal motion monitors of quadruple suspensions, but they are not significantly correlated with transient motion above the noise floor in the gravitational wave strain data, and therefore do not present a dominant source of background noise in the searches for transient gravitational wave signals. Using the suspension transfer functions, we compared the transients in a week of gravitational wave strain data with transients from a quadruple suspension. Of the strain transients between 10 and 60 Hz, 84% are loud enough that they would have appeared above the sensor noise in the top stage quadruple suspension monitors if they had originated at that stage at the same frequencies. We find no significant temporal correlation with the suspension transients in that stage, so we can rule out suspension motion originating at the top stage as the cause of those transients. However, only 3.2% of the gravitational wave strain transients are loud enough that they would have been seen by the second stage suspension sensors, and none of them are above the sensor noise levels of the penultimate stage. Therefore, we cannot eliminate the possibility of transient noise in the detectors originating in the intermediate stages of the suspension below the sensing noise.

Motion sensors in mathematics teaching: learning tools for understanding general math concepts?

NASA Astrophysics Data System (ADS)

Urban-Woldron, Hildegard

2015-05-01

Incorporating technology tools into the mathematics classroom adds a new dimension to the teaching of mathematics concepts and establishes a whole new approach to mathematics learning. In particular, gathering data in a hands-on and real-time method helps classrooms coming alive. The focus of this paper is on bringing forward important mathematics concepts such as functions and rate of change with the motion detector. Findings from the author's studies suggest that the motion detector can be introduced from a very early age and used to enliven classes at any level. Using real-world data to present the main functions invites an experimental approach to mathematics and encourages students to engage actively in their learning. By emphasizing learning experiences with computer-based motion detectors and aiming to involve students in mathematical representations of real-world phenomena, six learning activities, which were developed in previous research studies, will be presented. Students use motion sensors to collect physical data that are graphed in real time and then manipulate and analyse them. Because data are presented in an immediately understandable graphical form, students are allowed to take an active role in their learning by constructing mathematical knowledge from observation of the physical world. By utilizing a predict-observe-explain format, students learn about slope, determining slope and distance vs. time graphs through motion-filled activities. Furthermore, exploring the meaning of slope, viewed as the rate of change, students acquire competencies for reading, understanding and interpreting kinematics graphs involving a multitude of mathematical representations. Consequently, the students are empowered to efficiently move among tabular, graphical and symbolic representation to analyse patterns and discover the relationships between different representations of motion. In fact, there is a need for further research to explore how mathematics teachers can integrate motion sensors into their classrooms.

Motions, efforts and actuations in constrained dynamic systems: a multi-link open-chain example

NASA Astrophysics Data System (ADS)

Duke Perreira, N.

1999-08-01

The effort-motion method, which describes the dynamics of open- and closed-chain topologies of rigid bodies interconnected with revolute and prismatic pairs, is interpreted geometrically. Systems are identified for which the simultaneous control of forces and velocities is desirable, and a representative open-chain system is selected for use in the ensuing analysis. Gauge invariant transformations are used to recast the commonly used kinetic and kinematic equations into a dimensional gauge invariant form. Constraint elimination techniques based on singular value decompositions then recast the invariant equations into orthogonal and reciprocal sets of motion and effort equations written in state variable form. The ideal actuation is found that simultaneously achieves the obtainable portions of the desired constraining efforts and motions. The performance is then evaluated of using the actuation closest to the ideal actuation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Jing; Key Laboratory of Low Dimensional Quantum Structures and Quantum Control of Ministry of Education, Hunan Normal University, Changsha, Hunan 410081; Yu, Hongwei, E-mail: hwyu@hunnu.edu.cn

We study the spontaneous excitation of a detector (modeled by a two-level atom) in circular motion coupled nonlinearly to vacuum massless Rarita–Schwinger fields in the ultrarelativistic limit and demonstrate that the spontaneous excitation occurs for ground-state atoms in circular motion in vacuum but the excitation rate is not of a pure thermal form as that of the atoms in linear uniform acceleration. An interesting feature is that terms of odd powers in acceleration appear in the excitation rate whereas in the linear acceleration case there are only terms of even powers present. On the other hand, what makes the presentmore » case unique in comparison to the atom’s coupling to other fields that are previously studied is the appearance of the terms proportional to the seventh and ninth powers of acceleration in the mean rate of change of atomic energy which are absent in the scalar, electromagnetic and Dirac field cases. -- Highlights: •Circular Unruh effect for detector coupled to Rarita–Schwinger field. •Nonlinear coupling between the detector and the fields. •Detector in circular motion does not feel pure thermal bath. •Excitation rate contains terms of odd powers in acceleration.« less

Grating Oriented Line-Wise Filtration (GOLF) for Dual-Energy X-ray CT

NASA Astrophysics Data System (ADS)

Xi, Yan; Cong, Wenxiang; Harrison, Daniel; Wang, Ge

2017-12-01

In medical X-ray Computed Tomography (CT), the use of two distinct X-ray source spectra (energies) allows dose-reduction and material discrimination relative to that achieved with only one source spectrum. Existing dual-energy CT methods include source kVp-switching, double-layer detection, dual-source gantry, and two-pass scanning. Each method suffers either from strong spectral correlation or patient-motion artifacts. To simultaneously address these problems, we propose to improve CT data acquisition with the Grating Oriented Line-wise Filtration (GOLF) method, a novel X-ray filter that is placed between the source and patient. GOLF uses a combination of absorption and filtering gratings that are moved relative to each other and in synchronization with the X-ray tube kVp-switching process and/or the detector view-sampling process. Simulation results show that GOLF can improve the spectral performance of kVp-switching to match that of dual-source CT while avoiding patient motion artifacts and dual imaging chains. Although significant flux is absorbed by this pre-patient filter, the proposed GOLF method is a novel path for cost-effectively extracting dual-energy or multi-energy data and reducing radiation dose with or without kVp switching.

Grating Oriented Line-Wise Filtration (GOLF) for Dual-Energy X-ray CT

PubMed Central

Xi, Yan; Cong, Wenxiang; Harrison, Daniel

2017-01-01

In medical X-ray Computed Tomography (CT), the use of two distinct X-ray source spectra (energies) allows dose-reduction and material discrimination relative to that achieved with only one source spectrum. Existing dual-energy CT methods include source kVp-switching, double-layer detection, dual-source gantry, and two-pass scanning. Each method suffers either from strong spectral correlation or patient-motion artifacts. To simultaneously address these problems, we propose to improve CT data acquisition with the Grating Oriented Line-wise Filtration (GOLF) method, a novel X-ray filter that is placed between the source and patient. GOLF uses a combination of absorption and filtering gratings that are moved relative to each other and in synchronization with the X-ray tube kVp-switching process and/or the detector view-sampling process. Simulation results show that GOLF can improve the spectral performance of kVp-switching to match that of dual-source CT while avoiding patient motion artifacts and dual imaging chains. Although significant flux is absorbed by this pre-patient filter, the proposed GOLF method is a novel path for cost-effectively extracting dual-energy or multi-energy data and reducing radiation dose with or without kVp switching. PMID:29333113

Time Average Holography Study of Human Tympanic Membrane with Altered Middle Ear Ossicular Chain

NASA Astrophysics Data System (ADS)

Cheng, Jeffrey T.; Ravicz, Michael E.; Rosowski, John J.; Hulli, Nesim; Hernandez-Montes, Maria S.; Furlong, Cosme

2009-02-01

Computer-assisted time average holographic interferometry was used to study the vibration of the human tympanic membrane (TM) in cadaveric temporal bones before and after alterations of the ossicular chain. Simultaneous laser Doppler vibrometer measurements of stapes velocity were performed to estimate the conductive hearing loss caused by ossicular alterations. The quantified TM motion described from holographic images was correlated with stapes velocity to define relations between TM motion and stapes velocity in various ossicular disorders. The results suggest that motions of the TM are relatively uncoupled from stapes motion at frequencies above 1000 Hz.

The Kinetic Chain Revisited: New Concepts on Throwing Mechanics and Injury.

PubMed

Chu, Samuel K; Jayabalan, Prakash; Kibler, W Ben; Press, Joel

2016-03-01

The overhead throwing motion is a complex activity that is achieved through activation of the kinetic chain. The kinetic chain refers to the linkage of multiple segments of the body that allows for transfer of forces and motion. The lower extremities and core provide a base of support, generating energy that is transferred eventually through the throwing arm and hand, resulting in release of the ball. The kinetic chain requires optimal anatomy, physiology, and mechanics and is involved in all 6 phases of overhead throwing: windup, stride, arm cocking, acceleration, deceleration, and follow-through. Breaks or deficits in the kinetic chain can lead to injury or decreased performance. Through an understanding of the mechanics and pathomechanics seen in each phase of throwing, the clinician can better evaluate and screen for potential kinetic chain deficits in the overhead throwing athlete. The purpose of this article is to review the biomechanics of the overhead throwing motion, the role of the kinetic chain in throwing, and the clinical evaluation and management of abnormal throwing mechanics and related injuries. Copyright © 2016 American Academy of Physical Medicine and Rehabilitation. Published by Elsevier Inc. All rights reserved.

Chain dynamics and nanoparticle motion in attractive polymer nanocomposites subjected to large deformations.

PubMed

Senses, Erkan; Tyagi, Madhusudan; Natarajan, Bharath; Narayanan, Suresh; Faraone, Antonio

2017-11-08

The effect of large deformation on the chain dynamics in attractive polymer nanocomposites was investigated using neutron scattering techniques. Quasi-elastic neutron backscattering measurements reveal a substantial reduction of polymer mobility in the presence of attractive, well-dispersed nanoparticles. In addition, large deformations are observed to cause a further slowing down of the Rouse rates at high particle loadings, where the interparticle spacings are slightly smaller than the chain dimensions, i.e. in the strongly confined state. No noticeable change, however, was observed for a lightly confined system. The reptation tube diameter, measured by neutron spin echo, remained unchanged after shear, suggesting that the level of chain-chain entanglements is not significantly affected. The shear-induced changes in the interparticle bridging reflect the slow nanoparticle motion measured by X-ray photon correlation spectroscopy. These results provide a first step for understanding how large shear can significantly affect the segmental motion in nanocomposites and open up new opportunities for designing mechanically responsive soft materials.

Chain dynamics and nanoparticle motion in attractive polymer nanocomposites subjected to large deformations

DOE PAGES

Senses, Erkan; Tyagi, Madhusudan; Natarajan, Bharath; ...

2017-09-28

The effect of large deformation on the chain dynamics in attractive polymer nanocomposites was investigated using neutron scattering techniques. Quasielastic neutron backscattering measurements reveal a substantial reduction of polymer mobility in the presence of attractive, well-dispersed nanoparticles. Additionally, large deformations are observed to cause a further slowing down of the Rouse rates at high particle loadings, where the interparticle spacings are slightly smaller than the chain dimensions, i.e. in the strongly confined state. No noticeable change, however, was observed for a lightly confined system. The reptation tube diameter, measured by neutron spin echo, remained unchanged after shear, suggesting that themore » level of chain-chain entanglements is not significantly affected. The shearinduced changes in the interparticle bridging reflects on the slow nanoparticle motion measured by X-ray photon correlation spectroscopy. These results provide a first step for understanding how large shear can significantly affect the segmental motion in nanocomposites and open up new opportunities for designing mechanically responsive soft materials.« less

Chain dynamics and nanoparticle motion in attractive polymer nanocomposites subjected to large deformations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Senses, Erkan; Tyagi, Madhusudan; Natarajan, Bharath

The effect of large deformation on the chain dynamics in attractive polymer nanocomposites was investigated using neutron scattering techniques. Quasielastic neutron backscattering measurements reveal a substantial reduction of polymer mobility in the presence of attractive, well-dispersed nanoparticles. Additionally, large deformations are observed to cause a further slowing down of the Rouse rates at high particle loadings, where the interparticle spacings are slightly smaller than the chain dimensions, i.e. in the strongly confined state. No noticeable change, however, was observed for a lightly confined system. The reptation tube diameter, measured by neutron spin echo, remained unchanged after shear, suggesting that themore » level of chain-chain entanglements is not significantly affected. The shearinduced changes in the interparticle bridging reflects on the slow nanoparticle motion measured by X-ray photon correlation spectroscopy. These results provide a first step for understanding how large shear can significantly affect the segmental motion in nanocomposites and open up new opportunities for designing mechanically responsive soft materials.« less

Design and performance of the readout electronics chain of the Delphi Forward Ring Imaging Cherenkov Detector

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dam, P.; Nielsen, B.S.; Formenti, F.

1992-10-01

In this paper the Front End Readout electronics chain of the Forward Ring Imaging CHerenkov (FRICH) Detector used at the Delphi experiment of the Large Electron Positron (LEP) collider is presented. The system incorporates a wide band low noise preamplifier, mounted in the proximity of the MultiWire Proportional Chamber, an Amplifying-Discriminating-Multiple-xing FASTBUS unit for further signal amplification, discrimination and channel reduction and a LEP Time Digitizer FASTBUS unit for time digitization. The paper gives a general view of the detector and its electronics with particular emphasis on the novel characteristics and capabilities of the system.

Countermine Warfare Analysis

DTIC Science & Technology

1981-06-01

which were Matilda and Valentine tanks fitted with heavy chain flails. As a front-mounted drum rotated, the chains were thrust forward to strike the...Detector, truck-mounted (UAZ-69 or UAZ-469 trucks) mine detector. The mine detection device is fitted to the truck brakes to stop it automati- cally...employed by the Soviets. The plows are controlled separately from inside the tank, and rollers are made up-of multiple discs of various I configurations. A

Limits on uranium and thorium bulk content in GERDA Phase I detectors

NASA Astrophysics Data System (ADS)

Collaboration, Gerda; Agostini, M.; Allardt, M.; Bakalyarov, A. M.; Balata, M.; Barabanov, I.; Baudis, L.; Bauer, C.; Becerici-Schmidt, N.; Bellotti, E.; Belogurov, S.; Belyaev, S. T.; Benato, G.; Bettini, A.; Bezrukov, L.; Bode, T.; Borowicz, D.; Brudanin, V.; Brugnera, R.; Caldwell, A.; Cattadori, C.; Chernogorov, A.; D'Andrea, V.; Demidova, E. V.; di Vacri, A.; Domula, A.; Doroshkevich, E.; Egorov, V.; Falkenstein, R.; Fedorova, O.; Freund, K.; Frodyma, N.; Gangapshev, A.; Garfagnini, A.; Grabmayr, P.; Gurentsov, V.; Gusev, K.; Hakemüller, J.; Hegai, A.; Heisel, M.; Hemmer, S.; Hofmann, W.; Hult, M.; Inzhechik, L. V.; Janicskó Csáthy, J.; Jochum, J.; Junker, M.; Kazalov, V.; Kihm, T.; Kirpichnikov, I. V.; Kirsch, A.; Kish, A.; Klimenko, A.; Kneißl, R.; Knöpfle, K. T.; Kochetov, O.; Kornoukhov, V. N.; Kuzminov, V. V.; Laubenstein, M.; Lazzaro, A.; Lebedev, V. I.; Lehnert, B.; Liao, H. Y.; Lindner, M.; Lippi, I.; Lubashevskiy, A.; Lubsandorzhiev, B.; Lutter, G.; Macolino, C.; Majorovits, B.; Maneschg, W.; Medinaceli, E.; Mingazheva, R.; Misiaszek, M.; Moseev, P.; Nemchenok, I.; Palioselitis, D.; Panas, K.; Pandola, L.; Pelczar, K.; Pullia, A.; Riboldi, S.; Rumyantseva, N.; Sada, C.; Salamida, F.; Salathe, M.; Schmitt, C.; Schneider, B.; Schönert, S.; Schreiner, J.; Schütz, A.-K.; Schulz, O.; Schwingenheuer, B.; Selivanenko, O.; Shevchik, E.; Shirchenko, M.; Simgen, H.; Smolnikov, A.; Stanco, L.; Stepaniuk, M.; Vanhoefer, L.; Vasenko, A. A.; Veresnikova, A.; von Sturm, K.; Wagner, V.; Walter, M.; Wegmann, A.; Wester, T.; Wiesinger, C.; Wojcik, M.; Yanovich, E.; Zhitnikov, I.; Zhukov, S. V.; Zinatulina, D.; Zuber, K.; Zuzel, G.

2017-05-01

Internal contaminations of 238U, 235U and 232Th in the bulk of high purity germanium detectors are potential backgrounds for experiments searching for neutrinoless double beta decay of 76Ge. The data from GERDA Phase I have been analyzed for alpha events from the decay chain of these contaminations by looking for full decay chains and for time correlations between successive decays in the same detector. No candidate events for a full chain have been found. Upper limits on the activities in the range of a few nBq/kg for 226Ra, 227Ac and 228Th, the long-lived daughter nuclides of 238U, 235U and 232Th, respectively, have been derived. With these upper limits a background index in the energy region of interest from 226Ra and 228Th contamination is estimated which satisfies the prerequisites of a future ton scale germanium double beta decay experiment.

Dynamics of two disks settling in a two-dimensional narrow channel: From periodic motion to vertical chain in Oldroyd-B fluid

NASA Astrophysics Data System (ADS)

Pan, Tsorng-Whay; Glowinski, Roland

2016-11-01

In this talk we present a numerical study of the dynamics of two disks settling in a narrow vertical channel filled with an Oldroyd-B fluid. Two kinds of particle dynamics are obtained: (i) periodic interaction between two disks and (ii) the formation of the chain of two disks. For the periodic interaction of two disks, two different motions are obtained: (a) two disks stay far apart and interact is periodically, which is similar to one of the motions of two disks settling in a narrow channel filled with a Newtonian fluid discussed by Aidun & Ding and (b) two disks draft, kiss and break away periodically and the chain is not formed due to not strong enough elastic force. For the formation of two disk chain occurred at higher values of the elasticity number, it is either a tilted chain or a vertical chain. The tilted chain can be obtained for either that the elasticity number is less than the critical value for having the vertical chain or that the Mach number is greater than the critical value for a long body to fall broadside-on, which is consistent with the results for the elliptic particles settling in Oldroyd-B fluids. NSF.

Chain Dynamics in a Dilute Magnetorheological Fluid

NASA Technical Reports Server (NTRS)

Liu, Jing; Hagenbuchle, Martin

1996-01-01

The structure, formation, and dynamics of dilute, mono-dispersive ferrofluid emulsions in an external magnetic field have been investigated using dynamic light scattering techniques. In the absence of the magnetic field, the emulsion particles are randomly distributed and behave like hard spheres in Brownian motion. An applied magnetic field induces a magnetic dipole moment in each particle. Dipolar interactions between particles align them into chains where correlation functions show two decay processes. The short-time decay shows the motion of straight chains as a whole where the apparent chain length increases with the applied magnetic field and the particle volume fraction. Good scaling results are obtained showing that the apparent chain length grows with time following a power law with exponent of 0.6 and depends on the applied field, particle volume fraction, and diffusion constant of the particles. The long-time decay in the correlation function shows oscillation when the chains reach a certain length with time and stiffness with threshold field This result shows that chains not only fluctuate, but move in a periodic motion with a frequency of 364 Hz at lambda = 15. It may suggest the existence of phonons. This work is the first step in the understanding of the structure formation, especially chain coarsening mechanism, of magnetorheological (MR) fluids at higher volume fractions.

On the dynamics of chain systems. [applications in manipulator and human body models

NASA Technical Reports Server (NTRS)

Huston, R. L.; Passerello, C. E.

1974-01-01

A computer-oriented method for obtaining dynamical equations of motion for chain systems is presented. A chain system is defined as an arbitrarily assembled set of rigid bodies such that adjoining bodies have at least one common point and such that closed loops are not formed. The equations of motion are developed through the use of Lagrange's form of d'Alembert's principle. The method and procedure is illustrated with an elementary study of a tripod space manipulator. The method is designed for application with systems such as human body models, chains and cables, and dynamic finite-segment models.

Detector motion method to increase spatial resolution in photon-counting detectors

NASA Astrophysics Data System (ADS)

Lee, Daehee; Park, Kyeongjin; Lim, Kyung Taek; Cho, Gyuseong

2017-03-01

Medical imaging requires high spatial resolution of an image to identify fine lesions. Photon-counting detectors in medical imaging have recently been rapidly replacing energy-integrating detectors due to the former`s high spatial resolution, high efficiency and low noise. Spatial resolution in a photon counting image is determined by the pixel size. Therefore, the smaller the pixel size, the higher the spatial resolution that can be obtained in an image. However, detector redesigning is required to reduce pixel size, and an expensive fine process is required to integrate a signal processing unit with reduced pixel size. Furthermore, as the pixel size decreases, charge sharing severely deteriorates spatial resolution. To increase spatial resolution, we propose a detector motion method using a large pixel detector that is less affected by charge sharing. To verify the proposed method, we utilized a UNO-XRI photon-counting detector (1-mm CdTe, Timepix chip) at the maximum X-ray tube voltage of 80 kVp. A similar spatial resolution of a 55- μm-pixel image was achieved by application of the proposed method to a 110- μm-pixel detector with a higher signal-to-noise ratio. The proposed method could be a way to increase spatial resolution without a pixel redesign when pixels severely suffer from charge sharing as pixel size is reduced.

Emulating the Visual Receptive Field Properties of MST Neurons with a Template Model of Heading Estimation

NASA Technical Reports Server (NTRS)

Perrone, John A.; Stone, Leland S.

1997-01-01

We have previously proposed a computational neural-network model by which the complex patterns of retinal image motion generated during locomotion (optic flow) can be processed by specialized detectors acting as templates for specific instances of self-motion. The detectors in this template model respond to global optic flow by sampling image motion over a large portion of the visual field through networks of local motion sensors with properties similar to neurons found in the middle temporal (MT) area of primate extrastriate visual cortex. The model detectors were designed to extract self-translation (heading), self-rotation, as well as the scene layout (relative distances) ahead of a moving observer, and are arranged in cortical-like heading maps to perform this function. Heading estimation from optic flow has been postulated by some to be implemented within the medial superior temporal (MST) area. Others have questioned whether MST neurons can fulfill this role because some of their receptive-field properties appear inconsistent with a role in heading estimation. To resolve this issue, we systematically compared MST single-unit responses with the outputs of model detectors under matched stimulus conditions. We found that the basic physiological properties of MST neurons can be explained by the template model. We conclude that MST neurons are well suited to support heading estimation and that the template model provides an explicit set of testable hypotheses which can guide future exploration of MST and adjacent areas within the primate superior temporal sulcus.

Microscopic insights into the NMR relaxation based protein conformational entropy meter

PubMed Central

Kasinath, Vignesh; Sharp, Kim A.; Wand, A. Joshua

2013-01-01

Conformational entropy is a potentially important thermodynamic parameter contributing to protein function. Quantitative measures of conformational entropy are necessary for an understanding of its role but have been difficult to obtain. An empirical method that utilizes changes in conformational dynamics as a proxy for changes in conformational entropy has recently been introduced. Here we probe the microscopic origins of the link between conformational dynamics and conformational entropy using molecular dynamics simulations. Simulation of seven pro! teins gave an excellent correlation with measures of side-chain motion derived from NMR relaxation. The simulations show that the motion of methyl-bearing side-chains are sufficiently coupled to that of other side chains to serve as excellent reporters of the overall side-chain conformational entropy. These results tend to validate the use of experimentally accessible measures of methyl motion - the NMR-derived generalized order parameters - as a proxy from which to derive changes in protein conformational entropy. PMID:24007504

Second-order processing of four-stroke apparent motion.

PubMed

Mather, G; Murdoch, L

1999-05-01

In four-stroke apparent motion displays, pattern elements oscillate between two adjacent positions and synchronously reverse in contrast, but appear to move unidirectionally. For example, if rightward shifts preserve contrast but leftward shifts reverse contrast, consistent rightward motion is seen. In conventional first-order displays, elements reverse in luminance contrast (e.g. light elements become dark, and vice-versa). The resulting perception can be explained by responses in elementary motion detectors turned to spatio-temporal orientation. Second-order motion displays contain texture-defined elements, and there is some evidence that they excite second-order motion detectors that extract spatio-temporal orientation following the application of a non-linear 'texture-grabbing' transform by the visual system. We generated a variety of second-order four-stroke displays, containing texture-contrast reversals instead of luminance contrast reversals, and used their effectiveness as a diagnostic test for the presence of various forms of non-linear transform in the second-order motion system. Displays containing only forward or only reversed phi motion sequences were also tested. Displays defined by variation in luminance, contrast, orientation, and size were effective. Displays defined by variation in motion, dynamism, and stereo were partially or wholly ineffective. Results obtained with contrast-reversing and four-stroke displays indicate that only relatively simple non-linear transforms (involving spatial filtering and rectification) are available during second-order energy-based motion analysis.

The motion of throw away detectors relative to the space shuttle

NASA Technical Reports Server (NTRS)

Mullins, L. D.

1975-01-01

The motions of throw away detectors (TAD's) are analyzed using the linearized relative motion equations. The TAD's are to be used in the amps program as diagnostic instruments for making various measurements near the shuttle. The TAD's are ejected from the shuttle in arbitrary directions with small relative velocities (0.1 to 1.0 m/s) their subsequent trajectories relative to the shuttle are analyzed. Initial conditions that are likely to result in recontact between the TAD and the shuttle are identified. The sensitivity of the motion to variations in the initial conditions, possibly resulting from inaccuracy in the ejection mechanism, are analyzed as are effects of atmospheric drag. A targeting method, a method of giving the TAD correct initial conditions such that it will pass through a given point relative to the shuttle at a given time, is developed. The results of many specific cases are presented in graphical form.

Adaptation without parameter change: Dynamic gain control in motion detection

PubMed Central

Borst, Alexander; Flanagin, Virginia L.; Sompolinsky, Haim

2005-01-01

Many sensory systems adapt their input-output relationship to changes in the statistics of the ambient stimulus. Such adaptive behavior has been measured in a motion detection sensitive neuron of the fly visual system, H1. The rapid adaptation of the velocity response gain has been interpreted as evidence of optimal matching of the H1 response to the dynamic range of the stimulus, thereby maximizing its information transmission. Here, we show that correlation-type motion detectors, which are commonly thought to underlie fly motion vision, intrinsically possess adaptive properties. Increasing the amplitude of the velocity fluctuations leads to a decrease of the effective gain and the time constant of the velocity response without any change in the parameters of these detectors. The seemingly complex property of this adaptation turns out to be a straightforward consequence of the multidimensionality of the stimulus and the nonlinear nature of the system. PMID:15833815

50-Ma Initiation of Hawaiian-Emperor Bend Records Major Change in Pacific Plate Motion

NASA Astrophysics Data System (ADS)

Sharp, Warren D.; Clague, David A.

2006-09-01

The Hawaiian-Emperor bend has played a prominent yet controversial role in deciphering past Pacific plate motions and the tempo of plate motion change. New ages for volcanoes of the central and southern Emperor chain define large changes in volcanic migration rate with little associated change in the chain's trend, which suggests that the bend did not form by slowing of the Hawaiian hot spot. Initiation of the bend near Kimmei seamount about 50 million years ago (MA) was coincident with realignment of Pacific spreading centers and early magmatism in western Pacific arcs, consistent with formation of the bend by changed Pacific plate motion.

Experimental determination of field factors (\\Omega _{{{Q}_{\\text{clin}}},{{Q}_{\\text{msr}}}}^{{{f}_{\\text{clin}}},{{f}_{\\text{msr}}}} ) for small radiotherapy beams using the daisy chain correction method

NASA Astrophysics Data System (ADS)

Lárraga-Gutiérrez, José Manuel

2015-08-01

Recently, Alfonso et al proposed a new formalism for the dosimetry of small and non-standard fields. The proposed new formalism is strongly based on the calculation of detector-specific beam correction factors by Monte Carlo simulation methods, which accounts for the difference in the response of the detector between the small and the machine specific reference field. The correct calculation of the detector-specific beam correction factors demands an accurate knowledge of the linear accelerator, detector geometry and composition materials. The present work shows that the field factors in water may be determined experimentally using the daisy chain correction method down to a field size of 1 cm  ×  1 cm for a specific set of detectors. The detectors studied were: three mini-ionization chambers (PTW-31014, PTW-31006, IBA-CC01), three silicon-based diodes (PTW-60018, IBA-SFD and IBA-PFD) and one synthetic diamond detector (PTW-60019). Monte Carlo simulations and experimental measurements were performed for a 6 MV photon beam at 10 cm depth in water with a source-to-axis distance of 100 cm. The results show that the differences between the experimental and Monte Carlo calculated field factors are less than 0.5%—with the exception of the IBA-PFD—for field sizes between 1.5 cm  ×  1.5 cm and 5 cm  ×  5 cm. For the 1 cm  ×  1 cm field size, the differences are within 2%. By using the daisy chain correction method, it is possible to determine measured field factors in water. The results suggest that the daisy chain correction method is not suitable for measurements performed with the IBA-PFD detector. The latter is due to the presence of tungsten powder in the detector encapsulation material. The use of Monte Carlo calculated k{{Q\\text{clin}},{{Q}\\text{msr}}}{{f\\text{clin}},{{f}\\text{msr}}} is encouraged for field sizes less than or equal to 1 cm  ×  1 cm for the dosimeters used in this work.

Quantitative comparison using Generalized Relative Object Detectability (G-ROD) metrics of an amorphous selenium detector with high resolution Microangiographic Fluoroscopes (MAF) and standard flat panel detectors (FPD).

PubMed

Russ, M; Shankar, A; Jain, A; Setlur Nagesh, S V; Ionita, C N; Scott, C; Karim, K S; Bednarek, D R; Rudin, S

2016-02-27

A novel amorphous selenium (a-Se) direct detector with CMOS readout has been designed, and relative detector performance investigated. The detector features include a 25 μ m pixel pitch, and 1000 μ m thick a-Se layer operating at 10V/ μ m bias field. A simulated detector DQE was determined, and used in comparative calculations of the Relative Object Detectability (ROD) family of prewhitening matched-filter (PWMF) observer and non-prewhitening matched filter (NPWMF) observer model metrics to gauge a-Se detector performance against existing high resolution micro-angiographic fluoroscopic (MAF) detectors and a standard flat panel detector (FPD). The PWMF-ROD or ROD metric compares two x-ray imaging detectors in their relative abilities in imaging a given object by taking the integral over spatial frequencies of the Fourier transform of the detector DQE weighted by an object function, divided by the comparable integral for a different detector. The generalized-ROD (G-ROD) metric incorporates clinically relevant parameters (focal-spot size, magnification, and scatter) to show the degradation in imaging performance for detectors that are part of an imaging chain. Preliminary ROD calculations using simulated spheres as the object predicted superior imaging performance by the a-Se detector as compared to existing detectors. New PWMF-G-ROD and NPWMF-G-ROD results still indicate better performance by the a-Se detector in an imaging chain over all sphere sizes for various focal spot sizes and magnifications, although a-Se performance advantages were degraded by focal spot blurring. Nevertheless, the a-Se technology has great potential to provide breakthrough abilities such as visualization of fine details including of neuro-vascular perforator vessels and of small vascular devices.

Quantitative comparison using generalized relative object detectability (G-ROD) metrics of an amorphous selenium detector with high resolution microangiographic fluoroscopes (MAF) and standard flat panel detectors (FPD)

NASA Astrophysics Data System (ADS)

Russ, M.; Shankar, A.; Jain, A.; Setlur Nagesh, S. V.; Ionita, C. N.; Scott, C.; Karim, K. S.; Bednarek, D. R.; Rudin, S.

2016-03-01

A novel amorphous selenium (a-Se) direct detector with CMOS readout has been designed, and relative detector performance investigated. The detector features include a 25μm pixel pitch, and 1000μm thick a-Se layer operating at 10V/μm bias field. A simulated detector DQE was determined, and used in comparative calculations of the Relative Object Detectability (ROD) family of prewhitening matched-filter (PWMF) observer and non-pre-whitening matched filter (NPWMF) observer model metrics to gauge a-Se detector performance against existing high resolution micro-angiographic fluoroscopic (MAF) detectors and a standard flat panel detector (FPD). The PWMF-ROD or ROD metric compares two x-ray imaging detectors in their relative abilities in imaging a given object by taking the integral over spatial frequencies of the Fourier transform of the detector DQE weighted by an object function, divided by the comparable integral for a different detector. The generalized-ROD (G-ROD) metric incorporates clinically relevant parameters (focal- spot size, magnification, and scatter) to show the degradation in imaging performance for detectors that are part of an imaging chain. Preliminary ROD calculations using simulated spheres as the object predicted superior imaging performance by the a-Se detector as compared to existing detectors. New PWMF-G-ROD and NPWMF-G-ROD results still indicate better performance by the a-Se detector in an imaging chain over all sphere sizes for various focal spot sizes and magnifications, although a-Se performance advantages were degraded by focal spot blurring. Nevertheless, the a-Se technology has great potential to provide break- through abilities such as visualization of fine details including of neuro-vascular perforator vessels and of small vascular devices.

Quantitative comparison using Generalized Relative Object Detectability (G-ROD) metrics of an amorphous selenium detector with high resolution Microangiographic Fluoroscopes (MAF) and standard flat panel detectors (FPD)

PubMed Central

Russ, M.; Shankar, A.; Jain, A.; Setlur Nagesh, S. V.; Ionita, C. N.; Scott, C.; Karim, K. S.; Bednarek, D. R.; Rudin, S.

2017-01-01

A novel amorphous selenium (a-Se) direct detector with CMOS readout has been designed, and relative detector performance investigated. The detector features include a 25μm pixel pitch, and 1000μm thick a-Se layer operating at 10V/μm bias field. A simulated detector DQE was determined, and used in comparative calculations of the Relative Object Detectability (ROD) family of prewhitening matched-filter (PWMF) observer and non-prewhitening matched filter (NPWMF) observer model metrics to gauge a-Se detector performance against existing high resolution micro-angiographic fluoroscopic (MAF) detectors and a standard flat panel detector (FPD). The PWMF-ROD or ROD metric compares two x-ray imaging detectors in their relative abilities in imaging a given object by taking the integral over spatial frequencies of the Fourier transform of the detector DQE weighted by an object function, divided by the comparable integral for a different detector. The generalized-ROD (G-ROD) metric incorporates clinically relevant parameters (focal-spot size, magnification, and scatter) to show the degradation in imaging performance for detectors that are part of an imaging chain. Preliminary ROD calculations using simulated spheres as the object predicted superior imaging performance by the a-Se detector as compared to existing detectors. New PWMF-G-ROD and NPWMF-G-ROD results still indicate better performance by the a-Se detector in an imaging chain over all sphere sizes for various focal spot sizes and magnifications, although a-Se performance advantages were degraded by focal spot blurring. Nevertheless, the a-Se technology has great potential to provide breakthrough abilities such as visualization of fine details including of neuro-vascular perforator vessels and of small vascular devices. PMID:28615795

Motion compensation for cone-beam CT using Fourier consistency conditions

NASA Astrophysics Data System (ADS)

Berger, M.; Xia, Y.; Aichinger, W.; Mentl, K.; Unberath, M.; Aichert, A.; Riess, C.; Hornegger, J.; Fahrig, R.; Maier, A.

2017-09-01

In cone-beam CT, involuntary patient motion and inaccurate or irreproducible scanner motion substantially degrades image quality. To avoid artifacts this motion needs to be estimated and compensated during image reconstruction. In previous work we showed that Fourier consistency conditions (FCC) can be used in fan-beam CT to estimate motion in the sinogram domain. This work extends the FCC to 3\\text{D} cone-beam CT. We derive an efficient cost function to compensate for 3\\text{D} motion using 2\\text{D} detector translations. The extended FCC method have been tested with five translational motion patterns, using a challenging numerical phantom. We evaluated the root-mean-square-error and the structural-similarity-index between motion corrected and motion-free reconstructions. Additionally, we computed the mean-absolute-difference (MAD) between the estimated and the ground-truth motion. The practical applicability of the method is demonstrated by application to respiratory motion estimation in rotational angiography, but also to motion correction for weight-bearing imaging of knees. Where the latter makes use of a specifically modified FCC version which is robust to axial truncation. The results show a great reduction of motion artifacts. Accurate estimation results were achieved with a maximum MAD value of 708 μm and 1184 μm for motion along the vertical and horizontal detector direction, respectively. The image quality of reconstructions obtained with the proposed method is close to that of motion corrected reconstructions based on the ground-truth motion. Simulations using noise-free and noisy data demonstrate that FCC are robust to noise. Even high-frequency motion was accurately estimated leading to a considerable reduction of streaking artifacts. The method is purely image-based and therefore independent of any auxiliary data.

The BiPo-3 detector for the measurement of ultra low natural radioactivities of thin materials

NASA Astrophysics Data System (ADS)

Barabash, A. S.; Basharina-Freshville, A.; Birdsall, E.; Blondel, S.; Blot, S.; Bongrand, M.; Boursette, D.; Brudanin, V.; Busto, J.; Caffrey, A. J.; Calvez, S.; Cascella, M.; Cebrián, S.; Cerna, C.; Cesar, J. P.; Chauveau, E.; Chopra, A.; Dafní, T.; De Capua, S.; Duchesneau, D.; Durand, D.; Egorov, V.; Eurin, G.; Evans, J. J.; Fajt, L.; Filosofov, D.; Flack, R.; Garrido, X.; Gómez, H.; Guillon, B.; Guzowski, P.; Holý, K.; Hodák, R.; Huber, A.; Hugon, C.; Iguaz, F. J.; Irastorza, I. G.; Jeremie, A.; Jullian, S.; Kauer, M.; Klimenko, A.; Kochetov, O.; Konovalov, S. I.; Kovalenko, V.; Lang, K.; Lemière, Y.; Le Noblet, T.; Liptak, Z.; Liu, X. R.; Loaiza, P.; Lutter, G.; Luzón, G.; Macko, M.; Mamedov, F.; Marquet, C.; Mauger, F.; Morgan, B.; Mott, J.; Nemchenok, I.; Nomachi, M.; Nova, F.; Ohsumi, H.; Oliviéro, G.; Ortiz de Solórzano, A.; Pahlka, R. B.; Pater, J.; Perrot, F.; Piquemal, F.; Povinec, P.; Přidal, P.; Ramachers, Y. A.; Remoto, A.; Richards, B.; Riddle, C. L.; Rukhadze, E.; Saakyan, R.; Salazar, R.; Sarazin, X.; Shitov, Yu.; Simard, L.; Šimkovic, F.; Smetana, A.; Smolek, K.; Smolnikov, A.; Söldner-Rembold, S.; Soulé, B.; Štekl, I.; Thomas, J.; Timkin, V.; Torre, S.; Tretyak, Vl. I.; Tretyak, V. I.; Umatov, V. I.; Vilela, C.; Vorobel, V.; Waters, D.; Žukauskas, A.

2017-06-01

The BiPo-3 detector, running at the Canfranc Underground Laboratory (Laboratorio Subterr&aposaneo de Canfranc, LSC, Spain) since 2013, is a low-radioactivity detector dedicated to measuring ultra low natural radionuclide contaminations of 208Tl (232Th chain) and 214Bi (238U chain) in thin materials. The total sensitive surface area of the detector is 3.6 m2. The detector has been developed to measure the radiopurity of the selenium double β-decay source foils of the SuperNEMO experiment. In this paper the design and performance of the detector, and results of the background measurements in 208Tl and 214Bi, are presented, and the validation of the BiPo-3 measurement with a calibrated aluminium foil is discussed. Results of the 208Tl and 214Bi activity measurements of the first enriched 82Se foils of the double β-decay SuperNEMO experiment are reported. The sensitivity of the BiPo-3 detector for the measurement of the SuperNEMO 82Se foils is Script A(208Tl) <2 μBq/kg (90% C.L.) and Script A(214Bi) <140 μBq/kg (90% C.L.) after 6 months of measurement.

High-Speed Incoming Infrared Target Detection by Fusion of Spatial and Temporal Detectors

PubMed Central

Kim, Sungho

2015-01-01

This paper presents a method for detecting high-speed incoming targets by the fusion of spatial and temporal detectors to achieve a high detection rate for an active protection system (APS). The incoming targets have different image velocities according to the target-camera geometry. Therefore, single-target detector-based approaches, such as a 1D temporal filter, 2D spatial filter and 3D matched filter, cannot provide a high detection rate with moderate false alarms. The target speed variation was analyzed according to the incoming angle and target velocity. The speed of the distant target at the firing time is almost stationary and increases slowly. The speed varying targets are detected stably by fusing the spatial and temporal filters. The stationary target detector is activated by an almost zero temporal contrast filter (TCF) and identifies targets using a spatial filter called the modified mean subtraction filter (M-MSF). A small motion (sub-pixel velocity) target detector is activated by a small TCF value and finds targets using the same spatial filter. A large motion (pixel-velocity) target detector works when the TCF value is high. The final target detection is terminated by fusing the three detectors based on the threat priority. The experimental results of the various target sequences show that the proposed fusion-based target detector produces the highest detection rate with an acceptable false alarm rate. PMID:25815448

Paramagnetic colloids: Chaotic routes to clusters and molecules

NASA Astrophysics Data System (ADS)

Abdi, Hamed; Soheilian, Rasam; Erb, Randall M.; Maloney, Craig E.

2018-03-01

We present computer simulations and experiments on dilute suspensions of superparamagnetic particles subject to rotating magnetic fields. We focus on chains of four particles and their decay routes to stable structures. At low rates, the chains track the external field. At intermediate rates, the chains break up but perform a periodic (albeit complex) motion. At sufficiently high rates, the chains generally undergo chaotic motion at short times and decay to either closely packed clusters or more dispersed, colloidal molecules at long times. We show that the transition out of the chaotic states can be described as a Poisson process in both simulation and experiment.

Contrast Sensitivity for Motion Detection and Direction Discrimination in Adolescents with Autism Spectrum Disorders and Their Siblings

ERIC Educational Resources Information Center

Koh, Hwan Cui; Milne, Elizabeth; Dobkins, Karen

2010-01-01

The magnocellular (M) pathway hypothesis proposes that impaired visual motion perception observed in individuals with Autism Spectrum Disorders (ASD) might be mediated by atypical functioning of the subcortical M pathway, as this pathway provides the bulk of visual input to cortical motion detectors. To test this hypothesis, we measured luminance…

High-level, but not low-level, motion perception is impaired in patients with schizophrenia.

PubMed

Kandil, Farid I; Pedersen, Anya; Wehnes, Jana; Ohrmann, Patricia

2013-01-01

Smooth pursuit eye movements are compromised in patients with schizophrenia and their first-degree relatives. Although research has demonstrated that the motor components of smooth pursuit eye movements are intact, motion perception has been shown to be impaired. In particular, studies have consistently revealed deficits in performance on tasks specific to the high-order motion area V5 (middle temporal area, MT) in patients with schizophrenia. In contrast, data from low-level motion detectors in the primary visual cortex (V1) have been inconsistent. To differentiate between low-level and high-level visual motion processing, we applied a temporal-order judgment task for motion events and a motion-defined figure-ground segregation task using patients with schizophrenia and healthy controls. Successful judgments in both tasks rely on the same low-level motion detectors in the V1; however, the first task is further processed in the higher-order motion area MT in the magnocellular (dorsal) pathway, whereas the second task requires subsequent computations in the parvocellular (ventral) pathway in visual area V4 and the inferotemporal cortex (IT). These latter structures are supposed to be intact in schizophrenia. Patients with schizophrenia revealed a significantly impaired temporal resolution on the motion-based temporal-order judgment task but only mild impairment in the motion-based segregation task. These results imply that low-level motion detection in V1 is not, or is only slightly, compromised; furthermore, our data restrain the locus of the well-known deficit in motion detection to areas beyond the primary visual cortex.

Spatio-Temporal Constrained Human Trajectory Generation from the PIR Motion Detector Sensor Network Data: A Geometric Algebra Approach

PubMed Central

Yu, Zhaoyuan; Yuan, Linwang; Luo, Wen; Feng, Linyao; Lv, Guonian

2015-01-01

Passive infrared (PIR) motion detectors, which can support long-term continuous observation, are widely used for human motion analysis. Extracting all possible trajectories from the PIR sensor networks is important. Because the PIR sensor does not log location and individual information, none of the existing methods can generate all possible human motion trajectories that satisfy various spatio-temporal constraints from the sensor activation log data. In this paper, a geometric algebra (GA)-based approach is developed to generate all possible human trajectories from the PIR sensor network data. Firstly, the representation of the geographical network, sensor activation response sequences and the human motion are represented as algebraic elements using GA. The human motion status of each sensor activation are labeled using the GA-based trajectory tracking. Then, a matrix multiplication approach is developed to dynamically generate the human trajectories according to the sensor activation log and the spatio-temporal constraints. The method is tested with the MERL motion database. Experiments show that our method can flexibly extract the major statistical pattern of the human motion. Compared with direct statistical analysis and tracklet graph method, our method can effectively extract all possible trajectories of the human motion, which makes it more accurate. Our method is also likely to provides a new way to filter other passive sensor log data in sensor networks. PMID:26729123

Spatio-Temporal Constrained Human Trajectory Generation from the PIR Motion Detector Sensor Network Data: A Geometric Algebra Approach.

PubMed

Yu, Zhaoyuan; Yuan, Linwang; Luo, Wen; Feng, Linyao; Lv, Guonian

2015-12-30

Passive infrared (PIR) motion detectors, which can support long-term continuous observation, are widely used for human motion analysis. Extracting all possible trajectories from the PIR sensor networks is important. Because the PIR sensor does not log location and individual information, none of the existing methods can generate all possible human motion trajectories that satisfy various spatio-temporal constraints from the sensor activation log data. In this paper, a geometric algebra (GA)-based approach is developed to generate all possible human trajectories from the PIR sensor network data. Firstly, the representation of the geographical network, sensor activation response sequences and the human motion are represented as algebraic elements using GA. The human motion status of each sensor activation are labeled using the GA-based trajectory tracking. Then, a matrix multiplication approach is developed to dynamically generate the human trajectories according to the sensor activation log and the spatio-temporal constraints. The method is tested with the MERL motion database. Experiments show that our method can flexibly extract the major statistical pattern of the human motion. Compared with direct statistical analysis and tracklet graph method, our method can effectively extract all possible trajectories of the human motion, which makes it more accurate. Our method is also likely to provides a new way to filter other passive sensor log data in sensor networks.

Comparison of Atom Interferometers and Light Interferometers as Space-Based Gravitational Wave Detectors

NASA Technical Reports Server (NTRS)

Baker, John G.

2012-01-01

We consider a class of proposed gravitational wave detectors based on multiple atomic interferometers separated by large baselines and referenced by common laser systems. We compute the sensitivity limits of these detectors due to intrinsic phase noise of the light sources, non-inertial motion of the light sources, and atomic shot noise and compare them to sensitivity limits for traditional light interferometers. We find that atom interferometers and light interferometers are limited in a nearly identical way by intrinsic phase noise and that both require similar mitigation strategies (e.g. multiple arm instruments) to reach interesting sensitivities. The sensitivity limit from motion of the light sources is slightly different and favors the atom interferometers in the low-frequency limit, although the limit in both cases is severe.

Comparison of atom interferometers and light interferometers as space-based gravitational wave detectors.

PubMed

Baker, John G; Thorpe, J I

2012-05-25

We consider a class of proposed gravitational-wave detectors based on multiple atomic interferometers separated by large baselines and referenced by common laser systems. We compute the sensitivity limits of these detectors due to intrinsic phase noise of the light sources, noninertial motion of the light sources, and atomic shot noise and compare them to sensitivity limits for traditional light interferometers. We find that atom interferometers and light interferometers are limited in a nearly identical way by intrinsic phase noise and that both require similar mitigation strategies (e.g., multiple-arm instruments) to reach interesting sensitivities. The sensitivity limit from motion of the light sources is slightly different and, in principle, favors the atom interferometers in the low-frequency limit, although the limit in both cases is severe.

Effect of Chain Rigidity on the Decoupling of Ion Motion from Segmental Relaxation in Polymerized Ionic Liquids: Ambient and Elevated Pressure Studies

DOE PAGES

Wojnarowska, Zaneta; Feng, Hongbo; Fu, Yao; ...

2017-08-21

Conductivity in polymer electrolytes has been generally discussed with the assumption that the segmental motions control charge transport. However, much less attention has been paid to the mechanism of ion conductivity where the motions of ions are less dependent (decoupled) on segmental dynamics. We present that this phenomenon is observed in ionic materials as they approach their glass transition temperature and becomes essential for design and development of highly conducting solid polymer electrolytes. In this paper, we study the effect of chain rigidity on the decoupling of ion transport from segmental motion in three polymerized ionic liquids (polyILs) containing themore » same cation–anion pair but differing in flexibility of the polymer backbones and side groups. Analysis of dielectric and rheology data reveals that decoupling is strong in vinyl-based rigid polymers while almost negligible in novel siloxane-based flexible polyILs. To explain this behavior, we investigated ion and chain dynamics at ambient and elevated pressure. Our results suggest that decoupling has a direct relationship to the frustration in chain packing and free volume. Finally, these conclusions are also supported by coarse-grained molecular dynamics simulations.« less

Effect of Chain Rigidity on the Decoupling of Ion Motion from Segmental Relaxation in Polymerized Ionic Liquids: Ambient and Elevated Pressure Studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wojnarowska, Zaneta; Feng, Hongbo; Fu, Yao

Conductivity in polymer electrolytes has been generally discussed with the assumption that the segmental motions control charge transport. However, much less attention has been paid to the mechanism of ion conductivity where the motions of ions are less dependent (decoupled) on segmental dynamics. We present that this phenomenon is observed in ionic materials as they approach their glass transition temperature and becomes essential for design and development of highly conducting solid polymer electrolytes. In this paper, we study the effect of chain rigidity on the decoupling of ion transport from segmental motion in three polymerized ionic liquids (polyILs) containing themore » same cation–anion pair but differing in flexibility of the polymer backbones and side groups. Analysis of dielectric and rheology data reveals that decoupling is strong in vinyl-based rigid polymers while almost negligible in novel siloxane-based flexible polyILs. To explain this behavior, we investigated ion and chain dynamics at ambient and elevated pressure. Our results suggest that decoupling has a direct relationship to the frustration in chain packing and free volume. Finally, these conclusions are also supported by coarse-grained molecular dynamics simulations.« less

The IASI detection chain

NASA Astrophysics Data System (ADS)

Nicol, Patrick; Fleury, Joel; Le Naour, Claire; Bernard, Frédéric

2017-11-01

IASI (Infrared Atmospheric Sounding Interferometer) is an infrared atmospheric sounder. It will provide meteorologist and scientific community with atmospheric spectra. The instrument is composed of a Fourier transform spectrometer and an associated infrared imager. The presentation will describe the spectrometer detection chain architecture, composed by three different detectors cooled in a passive cryo-cooler (so called CBS : Cold Box Subsystem) and associated analog electronics up to digital conversion. It will mainly focus on design choices with regards to environment constraints, implemented technologies, and associated performances. CNES is leading the IASI program in collaboration with EUMETSAT. The instrument Prime is ALCATEL SPACE responsible, notably, of the detection chain architecture. SAGEM SA provides the detector package (so called CAU : Cold Acquisition Unit).

The IASI detection chain

NASA Astrophysics Data System (ADS)

Nicol, Patrick; Fleury, Joel; Bernard, Frédéric

2004-06-01

IASI (Infrared Atmospheric Sounding Interferometer) is an infrared atmospheric sounder. It will provide meteorologist and scientific community with atmospheric spectra. The instrument is composed of a Fourier transform spectrometer and an associated infrared imager. The presentation will describe the spectrometer detection chain architecture, composed by three different detectors cooled in a passive cryo-cooler (so called CBS : Cold Box Subsystem) and associated analog electronics up to digital conversion. It will mainly focus on design choices with regards to environment constraints, implemented technologies, and associated performances . CNES is leading the IASI program in collaboration with EUMETSAT. The instrument Prime is ALCATEL SPACE responsible, notably, of the detection chain architecture. SAGEM SA provides the detector package (so called CAU: Cold Acquisition Unit).

Looking at Op Art from a computational viewpoint.

PubMed

Zanker, Johannes M

2004-01-01

Arts history tells an exciting story about repeated attempts to represent features that are crucial for the understanding of our environment and which, at the same time, go beyond the inherently two-dimensional nature of a flat painting surface: depth and motion. In the twentieth century, Op artists such as Bridget Riley began to experiment with simple black and white patterns that do not represent motion in an artistic way but actually create vivid dynamic illusions in static pictures. The cause of motion illusions in such paintings is still a matter of debate. The role of involuntary eye movements in this phenomenon is studied here with a computational approach. The possible consequences of shifting the retinal image of synthetic wave gratings, dubbed as 'riloids', were analysed by a two-dimensional array of motion detectors (2DMD model), which generates response maps representing the spatial distribution of motion signals generated by such a stimulus. For a two-frame sequence reflecting a saccadic displacement, these motion signal maps contain extended patches in which local directions change only little. These directions, however, do not usually precisely correspond to the direction of pattern displacement that can be expected from the geometry of the curved gratings as an instance of the so-called 'aperture problem'. The patchy structure of the simulated motion detector response to the displacement of riloids resembles the motion illusion, which is not perceived as a coherent shift of the whole pattern but as a wobbling and jazzing of ill-defined regions. Although other explanations are not excluded, this might support the view that the puzzle of Op Art motion illusions could potentially have an almost trivial solution in terms of small involuntary eye movement leading to image shifts that are picked up by well-known motion detectors in the early visual system. This view can have further consequences for our understanding of how the human visual system usually compensates for eye movements, in order to let us perceive a stable world despite continuous image shifts generated by gaze instability.

Refinement of motion correction strategies for lower-cost CT for under-resourced regions of the world

NASA Astrophysics Data System (ADS)

Wells, Jered R.; Segars, W. Paul; Kigongo, Christopher J. N.; Dobbins, James T., III

2011-03-01

This paper describes a recently developed post-acquisition motion correction strategy for application to lower-cost computed tomography (LCCT) for under-resourced regions of the world. Increased awareness regarding global health and its challenges has encouraged the development of more affordable healthcare options for underserved people worldwide. In regions such as sub-Saharan Africa, intermediate level medical facilities may serve millions with inadequate or antiquated equipment due to financial limitations. In response, the authors have proposed a LCCT design which utilizes a standard chest x-ray examination room with a digital flat panel detector (FPD). The patient rotates on a motorized stage between the fixed cone-beam source and FPD, and images are reconstructed using a Feldkamp algorithm for cone-beam scanning. One of the most important proofs-of-concept in determining the feasibility of this system is the successful correction of undesirable motion. A 3D motion correction algorithm was developed in order to correct for potential patient motion, stage instabilities and detector misalignments which can all lead to motion artifacts in reconstructed images. Motion will be monitored by the radiographic position of fiducial markers to correct for rigid body motion in three dimensions. Based on simulation studies, projection images corrupted by motion were re-registered with average errors of 0.080 mm, 0.32 mm and 0.050 mm in the horizontal, vertical and depth dimensions, respectively. The overall absence of motion artifacts in motion-corrected reconstructions indicates that reasonable amounts of motion may be corrected using this novel technique without significant loss of image quality.

The Mathematics of Motion, Sensors, and the Introduction of Function to Eight Graders in Brazil.

ERIC Educational Resources Information Center

Borba, Marcelo C.; Scheffer, Nilce Fatima

This paper describes how 8th grade students are using CBR, a motion detector linked to a graphing calculator, as a way of generating mathematical ideas regarding the motions concepts that surround their action. Students were previously introduced to the calculators in the classroom and teaching experiments were then carried out afterwards with a…

The Complex Structure of Receptive Fields in the Middle Temporal Area

PubMed Central

Richert, Micah; Albright, Thomas D.; Krekelberg, Bart

2012-01-01

Neurons in the middle temporal area (MT) are often viewed as motion detectors that prefer a single direction of motion in a single region of space. This assumption plays an important role in our understanding of visual processing, and models of motion processing in particular. We used extracellular recordings in area MT of awake, behaving monkeys (M. mulatta) to test this assumption with a novel reverse correlation approach. Nearly half of the MT neurons in our sample deviated significantly from the classical view. First, in many cells, direction preference changed with the location of the stimulus within the receptive field. Second, the spatial response profile often had multiple peaks with apparent gaps in between. This shows that visual motion analysis in MT has access to motion detectors that are more complex than commonly thought. This complexity could be a mere byproduct of imperfect development, but can also be understood as the natural consequence of the non-linear, recurrent interactions among laterally connected MT neurons. An important direction for future research is to investigate whether these in homogeneities are advantageous, how they can be incorporated into models of motion detection, and whether they can provide quantitative insight into the underlying effective connectivity. PMID:23508640

Radiography by selective detection of scatter field velocity components

NASA Technical Reports Server (NTRS)

Dugan, Edward T. (Inventor); Jacobs, Alan M. (Inventor); Shedlock, Daniel (Inventor)

2007-01-01

A reconfigurable collimated radiation detector, system and related method includes at least one collimated radiation detector. The detector has an adjustable collimator assembly including at least one feature, such as a fin, optically coupled thereto. Adjustments to the adjustable collimator selects particular directions of travel of scattered radiation emitted from an irradiated object which reach the detector. The collimated detector is preferably a collimated detector array, where the collimators are independently adjustable. The independent motion capability provides the capability to focus the image by selection of the desired scatter field components. When an array of reconfigurable collimated detectors is provided, separate image data can be obtained from each of the detectors and the respective images cross-correlated and combined to form an enhanced image.

The surprising dynamics of a chain on a pulley: lift off and snapping

PubMed Central

Audoly, Basile

2016-01-01

The motion of weights attached to a chain or string moving on a frictionless pulley is a classic problem of introductory physics used to understand the relationship between force and acceleration. Here, we consider the dynamics of the chain when one of the weights is removed and, thus, one end is pulled with constant acceleration. This simple change has dramatic consequences for the ensuing motion: at a finite time, the chain ‘lifts off’ from the pulley, and the free end subsequently accelerates faster than the end that is pulled. Eventually, the chain undergoes a dramatic reversal of curvature reminiscent of the crack or snap, of a whip. We combine experiments, numerical simulations and theoretical arguments to explain key aspects of this dynamical problem. PMID:27436987

The surprising dynamics of a chain on a pulley: lift off and snapping.

PubMed

Brun, P-T; Audoly, Basile; Goriely, Alain; Vella, Dominic

2016-06-01

The motion of weights attached to a chain or string moving on a frictionless pulley is a classic problem of introductory physics used to understand the relationship between force and acceleration. Here, we consider the dynamics of the chain when one of the weights is removed and, thus, one end is pulled with constant acceleration. This simple change has dramatic consequences for the ensuing motion: at a finite time, the chain 'lifts off' from the pulley, and the free end subsequently accelerates faster than the end that is pulled. Eventually, the chain undergoes a dramatic reversal of curvature reminiscent of the crack or snap, of a whip. We combine experiments, numerical simulations and theoretical arguments to explain key aspects of this dynamical problem.

Nanoprobe diffusion in entangled polymer solutions: Linear vs. unconcatenated ring chains

NASA Astrophysics Data System (ADS)

Nahali, Negar; Rosa, Angelo

2018-05-01

We employ large-scale molecular dynamics computer simulations to study the problem of nanoprobe diffusion in entangled solutions of linear polymers and unknotted and unconcatenated circular (ring) polymers. By tuning both the diameter of the nanoprobe and the density of the solution, we show that nanoprobes of diameter smaller than the entanglement distance (tube diameter) of the solution display the same (Rouse-like) behavior in solutions of both polymer architectures. Instead, nanoprobes with larger diameters appear to diffuse markedly faster in solutions of rings than in solutions of linear chains. Finally, by analysing the distribution functions of spatial displacements, we find that nanoprobe motion in rings' solutions shows both Gaussian and ergodic behaviors, in all regimes considered, while, in solutions of linear chains, nanoprobes exceeding the size of the tube diameter show a transition to non-Gaussian and non-ergodic motion. Our results emphasize the role of chain architecture in the motion of nanoprobes dispersed in polymer solutions.

Skyhook gravitational-wave detector

NASA Astrophysics Data System (ADS)

Braginskii, V. B.; Thorne, K. S.

1985-08-01

A new and more sensitive type of earth-orbiting gravitational wave detector, called a 'skyhook', which would operate in the 10-100 mHz band, is proposed. The skyhook would consist of two masses, one on each end of a long thin cable with a spring at its center. As it orbits the earth, the cable wold be stretched radially by the earth's tidal gravitational field. Gravitational waves would pull the masses apart and push them together in an oscillatory fashion. Their motion would be transmitted to the spring by the cable, and a sensor would monitor the spring's resulting motion.

On the Piezoelectric Detection of Guided Ultrasonic Waves

PubMed Central

2017-01-01

In order to quantify the wave motion of guided ultrasonic waves, the characteristics of piezoelectric detectors, or ultrasonic transducers and acoustic emission sensors, have been evaluated systematically. Such guided waves are widely used in structural health monitoring and nondestructive evaluation, but methods of calibrating piezoelectric detectors have been inadequate. This study relied on laser interferometry for the base displacement measurement of bar waves, from which eight different guided wave test set-ups are developed with known wave motion using piezoelectric transmitters. Both plates and bars of 12.7 and 6.4 mm thickness were used as wave propagation media. The upper frequency limit was 2 MHz. Output of guided wave detectors were obtained on the test set-ups and their receiving sensitivities were characterized and averaged. While each sensitivity spectrum was noisy for a detector, the averaged spectrum showed a good convergence to a unique receiving sensitivity. Twelve detectors were evaluated and their sensitivity spectra determined in absolute units. Generally, these showed rapidly dropping sensitivity with increasing frequency due to waveform cancellation on their sensing areas. This effect contributed to vastly different sensitivities to guided wave and to normally incident wave for each one of the 12 detectors tested. Various other effects are discussed and recommendations on methods of implementing the approach developed are provided. PMID:29156579

Five-dimensional motion compensation for respiratory and cardiac motion with cone-beam CT of the thorax region

NASA Astrophysics Data System (ADS)

Sauppe, Sebastian; Hahn, Andreas; Brehm, Marcus; Paysan, Pascal; Seghers, Dieter; Kachelrieß, Marc

2016-03-01

We propose an adapted method of our previously published five-dimensional (5D) motion compensation (MoCo) algorithm1, developed for micro-CT imaging of small animals, to provide for the first time motion artifact-free 5D cone-beam CT (CBCT) images from a conventional flat detector-based CBCT scan of clinical patients. Image quality of retrospectively respiratory- and cardiac-gated volumes from flat detector CBCT scans is deteriorated by severe sparse projection artifacts. These artifacts further complicate motion estimation, as it is required for MoCo image reconstruction. For high quality 5D CBCT images at the same x-ray dose and the same number of projections as todays 3D CBCT we developed a double MoCo approach based on motion vector fields (MVFs) for respiratory and cardiac motion. In a first step our already published four-dimensional (4D) artifact-specific cyclic motion-compensation (acMoCo) approach is applied to compensate for the respiratory patient motion. With this information a cyclic phase-gated deformable heart registration algorithm is applied to the respiratory motion-compensated 4D CBCT data, thus resulting in cardiac MVFs. We apply these MVFs on double-gated images and thereby respiratory and cardiac motion-compensated 5D CBCT images are obtained. Our 5D MoCo approach processing patient data acquired with the TrueBeam 4D CBCT system (Varian Medical Systems). Our double MoCo approach turned out to be very efficient and removed nearly all streak artifacts due to making use of 100% of the projection data for each reconstructed frame. The 5D MoCo patient data show fine details and no motion blurring, even in regions close to the heart where motion is fastest.

Age-Distance Relations along the Hawaiian-Emperor Volcanic Chain: History and Current Status

NASA Astrophysics Data System (ADS)

Clague, D. A.

2016-12-01

The increase in age with distance along the Hawaiian-Emperor volcanic chain is a key parameter in models of plate motions and mantle dynamics. Wilson (1963) proposed that the Hawaiian Islands formed sequentially as the Pacific Plate migrated over a hot spot in the Earth's mantle based on the inferred increase in age of the Islands to the west. Morgan (1971) proposed that Wilson's hot spot was a geographically fixed mantle plume originating at the core-mantle boundary, and that the orientation and age-distance relations of the chain provided a measure of absolute plate motion with the bend between the Hawaiian and Emperor chains reflecting a major change in motion of the Pacific Plate at 40 Ma. Defining and refining the age relations along the two chains has taken decades due largely to the remoteness of most of the chain, the difficulties in dating altered submarine lavas, and the presence of glacial debris as far south as 42°25'N in the Emperor Seamounts. Ocean drilling program legs 55 and 197 focused on the age and paleolatitude of Emperor Seamounts. Many of the early ages are K-Ar dates. Later dates are Ar/Ar incremental heating extractions of whole-rocks or, more recently still, of clean mineral separates that yield accurate and precise dates (e.g., Sharp and Clague, 2006). Many reported ages have ill-defined errors, especially those of tholeiitic shield lavas. Over-interpretation of the collected age data seemed to indicate coeval volcanism along large segments of the chain, instead of recognizing the errors inherent in many of the determined ages. Subsequent work, such as at Gardner Pinnacles, has eliminated some of these apparent non-linear age relations. The bend is now recognized as a gradual transition in orientation that occurred between 50 and 42 Ma (Sharp & Clague, 2006); it likely resulted from the collision of India and Eurasia that precipitated a worldwide chain reaction of relative and absolute plate motion changes (Dalrymple & Clague, 1976).

Neural mechanisms underlying sensitivity to reverse-phi motion in the fly

PubMed Central

Meier, Matthias; Serbe, Etienne; Eichner, Hubert; Borst, Alexander

2017-01-01

Optical illusions provide powerful tools for mapping the algorithms and circuits that underlie visual processing, revealing structure through atypical function. Of particular note in the study of motion detection has been the reverse-phi illusion. When contrast reversals accompany discrete movement, detected direction tends to invert. This occurs across a wide range of organisms, spanning humans and invertebrates. Here, we map an algorithmic account of the phenomenon onto neural circuitry in the fruit fly Drosophila melanogaster. Through targeted silencing experiments in tethered walking flies as well as electrophysiology and calcium imaging, we demonstrate that ON- or OFF-selective local motion detector cells T4 and T5 are sensitive to certain interactions between ON and OFF. A biologically plausible detector model accounts for subtle features of this particular form of illusory motion reversal, like the re-inversion of turning responses occurring at extreme stimulus velocities. In light of comparable circuit architecture in the mammalian retina, we suggest that similar mechanisms may apply even to human psychophysics. PMID:29261684

Neural mechanisms underlying sensitivity to reverse-phi motion in the fly.

PubMed

Leonhardt, Aljoscha; Meier, Matthias; Serbe, Etienne; Eichner, Hubert; Borst, Alexander

2017-01-01

Optical illusions provide powerful tools for mapping the algorithms and circuits that underlie visual processing, revealing structure through atypical function. Of particular note in the study of motion detection has been the reverse-phi illusion. When contrast reversals accompany discrete movement, detected direction tends to invert. This occurs across a wide range of organisms, spanning humans and invertebrates. Here, we map an algorithmic account of the phenomenon onto neural circuitry in the fruit fly Drosophila melanogaster. Through targeted silencing experiments in tethered walking flies as well as electrophysiology and calcium imaging, we demonstrate that ON- or OFF-selective local motion detector cells T4 and T5 are sensitive to certain interactions between ON and OFF. A biologically plausible detector model accounts for subtle features of this particular form of illusory motion reversal, like the re-inversion of turning responses occurring at extreme stimulus velocities. In light of comparable circuit architecture in the mammalian retina, we suggest that similar mechanisms may apply even to human psychophysics.

Earthquake early warning using P-waves that appear after initial S-waves

NASA Astrophysics Data System (ADS)

Kodera, Y.

2017-12-01

As measures for underprediction for large earthquakes with finite faults and overprediction for multiple simultaneous earthquakes, Hoshiba (2013), Hoshiba and Aoki (2015), and Kodera et al. (2016) proposed earthquake early warning (EEW) methods that directly predict ground motion by computing the wave propagation of observed ground motion. These methods are expected to predict ground motion with a high accuracy even for complicated scenarios because these methods do not need source parameter estimation. On the other hand, there is room for improvement in their rapidity because they predict strong motion prediction mainly based on the observation of S-waves and do not explicitly use P-wave information available before the S-waves. In this research, we propose a real-time P-wave detector to incorporate P-wave information into these wavefield-estimation approaches. P-waves within a few seconds from the P-onsets are commonly used in many existing EEW methods. In addition, we focus on P-waves that may appear in the later part of seismic waves. Kurahashi and Irikura (2013) mentioned that P-waves radiated from strong motion generation areas (SMGAs) were recognizable after S-waves of the initial rupture point in the 2011 off the Pacific coast of Tohoku earthquake (Mw 9.0) (the Tohoku-oki earthquake). Detecting these P-waves would enhance the rapidity of prediction for the peak ground motion generated by SMGAs. We constructed a real-time P-wave detector that uses a polarity analysis. Using acceleration records in boreholes of KiK-net (band-pass filtered around 0.5-10 Hz with site amplification correction), the P-wave detector performed the principal component analysis with a sliding window of 4 s and calculated P-filter values (e.g. Ross and Ben-Zion, 2014). The application to the Tohoku-oki earthquake (Mw 9.0) showed that (1) peaks of P-filter that corresponded to SMGAs appeared in several stations located near SMGAs and (2) real-time seismic intensities (Kunugi et al., 2013) reached the local maximum several seconds after the P-filter peaks appeared. These findings indicate that the proposed P-wave detector allows wavefield-estimation approaches to predict the peak ground motion of SMGAs with a certain lead time.

Structure and dynamics of ionic micelles: MD simulation and neutron scattering study.

PubMed

Aoun, B; Sharma, V K; Pellegrini, E; Mitra, S; Johnson, M; Mukhopadhyay, R

2015-04-16

Fully atomistic molecular dynamics (MD) simulations have been carried out on sodium dodecyl sulfate (SDS), an anionic micelle, and three cationic (CnTAB; n = 12, 14, 16) micelles, investigating the effects of size, the form of the headgroup, and chain length. They have been used to analyze neutron scattering data. MD simulations confirm the dynamical model of global motion of the whole micelle, segmental motion (headgroup and alkyl chain), and fast torsional motion associated with the surfactants that is used to analyze the experimental data. It is found that the solvent surrounding the headgroups results in their significant mobility, which exceeds that of the tails on the nanosecond time scale. The middle of the chain is found to be least mobile, consolidating the micellar configuration. This dynamical feature is similar for all the ionic micelles investigated and therefore independent of headgroup form and charge and chain length. Diffusion constants for global and segmental motion of the different micelles are consistent with experimentally obtained values as well as known structural features. This work provides a more realistic model of micelle dynamics and offers new insight into the strongly fluctuating surface of micelles which is important in understanding micelle dispersion and related functionality, like drug delivery.

Observations of barium ion jets in the magnetosphere using Doppler imaging systems and very sensitive imaging systems using imaging photon detectors

NASA Technical Reports Server (NTRS)

Rees, D.; Conboy, J.; Heinz, W.; Heppner, J. P.

1985-01-01

Observations of four shaped charge releases from rockets launched from Alaska are described. Results demonstrate that imaging and Doppler imaging instruments, based on exploiting the imaging photon detector, provide additional insight into the motion and development of low intensity targets such as the fast ion jets produced by shaped charge releases. It is possible to trace the motion of fast ion jets to very great distances, of the order of 50,000 km, outward along the Earth's magnetic field, when the conditions are suitable for the outward (upward) motion and/or acceleration of such ion jets. It is shown that ion jets, which fade below the lower sensitivity threshold of previous instruments, do not always disappear. There is no evidence of an abrupt field-aligned shear-type acceleration.

A Bond-Fluctuation Model of Translational Dynamics of Chain-like Particles through Mucosal Scaffolds.

PubMed

Bajd, Franci; Serša, Igor

2018-06-05

Mucus scaffolds represent one of the most common barriers in targeted drug delivery and can remarkably reduce the outcome of pharmacological therapies. An efficient transport of drug particles through a mucus barrier is a precondition for an efficient drug delivery. Understanding the transport mechanism is particularly important for treatment of disorders such as cystic fibrosis. These are characterized by an onset of high-density mucus scaffolds imposing an increased steric filtering. In this study, we employed the bond-fluctuation model to analyze the effect of steric interactions on slowing the translational dynamics of compound chain-like particles traversing through scaffolds of different configurations (regular isotropic and anisotropic versus irregular random). The model, which accounts for both the geometry-imposed steric interaction as well as the intrachain steric interaction between the chain subunits, yields a transient subdiffusive motional pattern persists between the short-time and long-time Gaussian diffusion limits. The motion is analyzed in terms of a mean-squared displacement, diffusion coefficient, and radius of gyration. With higher levels of restriction or larger particles, the subdiffusive motional regime persists longer. The study also demonstrates that an important feature of the motion is also geometry-induced chain accommodation. The presented model is generic and could also be applied to studying the translational dynamics of other particles with more complex architecture such as dendrites or chain-decorated nanoparticles. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Dependence of Ion Dynamics on the Polymer Chain Length in Poly(ethylene oxide)-Based Polymer Electrolytes.

PubMed

Chattoraj, Joyjit; Knappe, Marisa; Heuer, Andreas

2015-06-04

It is known from experiments that in the polymer electrolyte system, which contains poly(ethylene oxide) chains (PEO), lithium-cations (Li(+)), and bis(trifluoromethanesulfonyl)imide-anions (TFSI(-)), the cation and the anion diffusion and the ionic conductivity exhibit a similar chain-length dependence: with increasing chain length, they start dropping steadily, and later, they saturate to constant values. These results are surprising because Li-cations are strongly correlated with the polymer chains, whereas TFSI-anions do not have such bonding. To understand this phenomenon, we perform molecular dynamics simulations of this system for four different polymer chain lengths. The diffusion results obtained from our simulations display excellent agreement with the experimental data. The cation transport model based on the Rouse dynamics can successfully quantify the Li-diffusion results, which correlates Li diffusion with the polymer center-of-mass motion and the polymer segmental motion. The ionic conductivity as a function of the chain length is then estimated based on the chain-length-dependent ion diffusion, which shows a temperature-dependent deviation for short chain lengths. We argue that in the first regime, counterion correlations modify the conductivity, whereas for the long chains, the system behaves as a strong electrolyte.

The Tympanic Membrane Motion in Forward and Reverse Middle-Ear Sound Transmission

NASA Astrophysics Data System (ADS)

Cheng, Jeffrey Tao; Harrington, Ellery; Horwitz, Rachelle; Furlong, Cosme; Rosowski, John J.

2011-11-01

Sound-induced displacement of the tympanic membrane (TM) is the first stage in the forward transformation of environmental sound to sound within the inner ear, while displacement of the TM induced by mechanical motions of the ossicular chain is the last stage in the reverse transformation of sound generated within the inner ear to clinically valuable otoacoustic emissions (OAEs). In this study, we use stroboscopic holographic interferometry to study motions of the human cadaveric TM evoked by both forward and reverse stimuli. During forward acoustic stimulation, pure tones from 500 to 10000 Hz are used to stimulate the TM, while reverse stimulation is produced by direct mechanical stimulation of the ossicular chain. The TM surface motions in response to both forward and reverse stimuli show differences and similarities, including the modal motion patterns at specific frequencies as well as the presence and directions of traveling waves on the TM surface.

Getting NuSTAR on target: predicting mast motion

NASA Astrophysics Data System (ADS)

Forster, Karl; Madsen, Kristin K.; Miyasaka, Hiromasa; Craig, William W.; Harrison, Fiona A.; Rana, Vikram R.; Markwardt, Craig B.; Grefenstette, Brian W.

2016-07-01

The Nuclear Spectroscopic Telescope Array (NuSTAR) is the first focusing high energy (3-79 keV) X-ray observatory operating for four years from low Earth orbit. The X-ray detector arrays are located on the spacecraft bus with the optics modules mounted on a flexible mast of 10.14m length. The motion of the telescope optical axis on the detectors during each observation is measured by a laser metrology system and matches the pre-launch predictions of the thermal flexing of the mast as the spacecraft enters and exits the Earths shadow each orbit. However, an additional motion of the telescope field of view was discovered during observatory commissioning that is associated with the spacecraft attitude control system and an additional flexing of the mast correlated with the Solar aspect angle for the observation. We present the methodology developed to predict where any particular target coordinate will fall on the NuSTAR detectors based on the Solar aspect angle at the scheduled time of an observation. This may be applicable to future observatories that employ optics deployed on extendable masts. The automation of the prediction system has greatly improved observatory operations efficiency and the reliability of observation planning.

Getting NuSTAR on Target: Predicting Mast Motion

NASA Technical Reports Server (NTRS)

Forster, Karl; Madsen, Kristin K.; Miyasaka, Hiroshima; Craig, William W.; Harrison, Fiona A.; Rana, Vikram R.; Markwardt, Craig B.; Grenfenstette, Brian W.

2017-01-01

The Nuclear Spectroscopic Telescope Array (NuSTAR) is the first focusing high energy (3-79 keV) X-ray observatory operating for four years from low Earth orbit. The X-ray detector arrays are located on the spacecraft bus with the optics modules mounted on a flexible mast of 10.14m length. The motion of the telescope optical axis on the detectors during each observation is measured by a laser metrology system and matches the pre-launch predictions of the thermal flexing of the mast as the spacecraft enters and exits the Earths shadow each orbit. However, an additional motion of the telescope field of view was discovered during observatory commissioning that is associated with the spacecraft attitude control system and an additional flexing of the mast correlated with the Solar aspect angle for the observation. We present the methodology developed to predict where any particular target coordinate will fall on the NuSTAR detectors based on the Solar aspect angle at the scheduled time of an observation. This may be applicable to future observatories that employ optics deployed on extendable masts. The automation of the prediction system has greatly improved observatory operations efficiency and the reliability of observation planning.

Dynamics and conformations of PEO chains chemically bonded on silica: comparison between 1H and 2H NMR.

PubMed

Tajouri, T; Hommel, H

2007-06-01

1H NMR was used to study the motion of monomer units in a layer of poly(ethylene oxide) chains grafted on silica. First, the dependence of the relaxation times on the grafting ratios is discussed qualitatively from a phenomenological point of view. Next, the NMR line narrowing effect by high-speed rotation is observed in the same samples with different grafting ratios. The magic angle spinning technique permits determination of two correlation times for each grafting ratio: tau(c) characteristic of an environment with a fast motion and tau(l) characteristic of an environment with a slow motion. In addition, the dynamics of these grafted chains are investigated by deuterium NMR (2H NMR), which is sensitive to the anisotropy of molecular motion. The evolution has been studied for two extreme grafting ratios and each time as a function of temperature. The anisotropy is more marked at low temperatures and for a low grafting ratio. The results are consistent with the 1H NMR relaxation times measured as a function of temperature. Copyright 2007 John Wiley & Sons, Ltd.

Unfolding Neutron Spectrum with Markov Chain Monte Carlo at MIT Research Reactor with He-3 Neutral Current Detectors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leder, A.; Anderson, A. J.; Billard, J.

2018-02-02

The Ricochet experiment seeks to measure Coherent (neutral-current) Elastic Neutrino-Nucleus Scattering (CEνNS) using dark-matter-style detectors with sub-keV thresholds placed near a neutrino source, such as the MIT (research) Reactor (MITR), which operates at 5.5 MW generating approximately 2.2 × 1018 ν/second in its core. Currently, Ricochet is characterizing the backgrounds at MITR, the main component of which comes in the form of neutrons emitted from the core simultaneous with the neutrino signal. To characterize this background, we wrapped Bonner cylinders around a 32He thermal neutron detector, whose data was then unfolded via a Markov Chain Monte Carlo (MCMC) to produce a neutron energymore » spectrum across several orders of magnitude. We discuss the resulting spectrum and its implications for deploying Ricochet at the MITR site as well as the feasibility of reducing this background level via the addition of polyethylene shielding around the detector setup.« less

Unfolding neutron spectrum with Markov Chain Monte Carlo at MIT research Reactor with He-3 Neutral Current Detectors

NASA Astrophysics Data System (ADS)

Leder, A.; Anderson, A. J.; Billard, J.; Figueroa-Feliciano, E.; Formaggio, J. A.; Hasselkus, C.; Newman, E.; Palladino, K.; Phuthi, M.; Winslow, L.; Zhang, L.

2018-02-01

The Ricochet experiment seeks to measure Coherent (neutral-current) Elastic Neutrino-Nucleus Scattering (CEνNS) using dark-matter-style detectors with sub-keV thresholds placed near a neutrino source, such as the MIT (research) Reactor (MITR), which operates at 5.5 MW generating approximately 2.2 × 1018 ν/second in its core. Currently, Ricochet is characterizing the backgrounds at MITR, the main component of which comes in the form of neutrons emitted from the core simultaneous with the neutrino signal. To characterize this background, we wrapped Bonner cylinders around a 32He thermal neutron detector, whose data was then unfolded via a Markov Chain Monte Carlo (MCMC) to produce a neutron energy spectrum across several orders of magnitude. We discuss the resulting spectrum and its implications for deploying Ricochet at the MITR site as well as the feasibility of reducing this background level via the addition of polyethylene shielding around the detector setup.

Comparative Sensitivities of Gravitational Wave Detectors Based on Atom Interferometers and Light Interferometers

NASA Technical Reports Server (NTRS)

Baker, John G.; Thorpe, J. I.

2012-01-01

We consider a class of proposed gravitational wave detectors based on multiple atomic interferometers separated by large baselines and referenced by common laser systems. We compute the sensitivity limits of these detectors due to intrinsic phase noise of the light sources, non-inertial motion of the light sources, and atomic shot noise and compare them to sensitivity limits for traditional light interferometers. We find that atom interferometers and light interferometers are limited in a nearly identical way by intrinsic phase noise and that both require similar mitigation strategies (e.g. multiple arm instruments) to reach interesting sensitivities. The sensitivity limit from motion of the light sources is slightly different and favors the atom interferometers in the low-frequency limit, although the limit in both cases is severe. Whether this potential advantage outweighs the additional complexity associated with including atom interferometers will require further study.

Rigid-body transformation of list-mode projection data for respiratory motion correction in cardiac PET.

PubMed

Livieratos, L; Stegger, L; Bloomfield, P M; Schafers, K; Bailey, D L; Camici, P G

2005-07-21

High-resolution cardiac PET imaging with emphasis on quantification would benefit from eliminating the problem of respiratory movement during data acquisition. Respiratory gating on the basis of list-mode data has been employed previously as one approach to reduce motion effects. However, it results in poor count statistics with degradation of image quality. This work reports on the implementation of a technique to correct for respiratory motion in the area of the heart at no extra cost for count statistics and with the potential to maintain ECG gating, based on rigid-body transformations on list-mode data event-by-event. A motion-corrected data set is obtained by assigning, after pre-correction for detector efficiency and photon attenuation, individual lines-of-response to new detector pairs with consideration of respiratory motion. Parameters of respiratory motion are obtained from a series of gated image sets by means of image registration. Respiration is recorded simultaneously with the list-mode data using an inductive respiration monitor with an elasticized belt at chest level. The accuracy of the technique was assessed with point-source data showing a good correlation between measured and true transformations. The technique was applied on phantom data with simulated respiratory motion, showing successful recovery of tracer distribution and contrast on the motion-corrected images, and on patient data with C15O and 18FDG. Quantitative assessment of preliminary C15O patient data showed improvement in the recovery coefficient at the centre of the left ventricle.

"I remember when we stayed still and the computer still made lines": Young children's invented and conventional representations of motion

NASA Astrophysics Data System (ADS)

Kahn, Jason

This dissertation concerns kindergarteners' and second graders' invented representations of motion, their interactions with conventional representations of motion built from the child's movement in front of a motion detector and using real-time graphing tools, and any changes in the invented representations that this interaction brings about. We have known for several decades that advanced learners (high school aged and beyond) struggle with physics concepts of motion and sometimes Cartesian graph-based representations of motion. Little has been known about how younger students approach the same concepts. In this study, eighteen children (10 kindergarteners and eight second graders) completed a three-hour clinical interview spread out evenly over three weeks. In the first and last interviews, the child was asked to produce external representations of movement and interpret conventional distance and time graphs of motion. In the second interview the children interacted with a motion detector and real-time graphing tools in a semi-self-directed format. Qualitative and quantitative results are presented and discussed. Qualitative data shows that children are adroit at representing motion and their productions are systematic and purposeful. Children produce drawings that both give context to the physical environment around them and also redescribe the drawn environment, meaning that they provide a potential audience with information otherwise imperceptible, by making certain implicit aspects more explicit. Second graders quickly appropriate the Cartesian graph during the intervention, though at times misinterpret the meaning associated with slope. Children correctly associate slope with direction, but at times misattribute sign of slope (positive or negative) and its corresponding direction (i.e. some children do not ascribe positive slope with motion away from a point of reference, but toward it). Kindergarteners showed a range of experiences during the intervention, one of the students showed a near mastery in interpretation of a Cartesian graph as a representation of motion, while another vehemently resisted graph as a representation of motion. Quantitative data gives a mechanism for comparing pre- and post-assessment productions. Both kindergarten and second grade students provide richer post-assessment representations, with kindergarteners more likely to include a figurative point of reference in the post-assessment and second graders including more explicit information about speed. The implications of this study are that invented representations of motion are a powerful tool for providing insights into children's thinking. The motion detector and real-time graphing tool can be used as early as kindergarten to help children build resources in their representations of motion; second grade students could find the same benefit and potentially begin to build conventional ideas about graphing and movement.

Quantum parameter estimation in the Unruh–DeWitt detector model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hao, Xiang, E-mail: xhao@phas.ubc.ca; Pacific Institute of Theoretical Physics, Department of Physics and Astronomy, University of British Columbia, 6224 Agriculture Rd., Vancouver B.C., Canada V6T 1Z1; Wu, Yinzhong

2016-09-15

Relativistic effects on the precision of quantum metrology for particle detectors, such as two-level atoms are studied. The quantum Fisher information is used to estimate the phase sensitivity of atoms in non-inertial motions or in gravitational fields. The Unruh–DeWitt model is applicable to the investigation of the dynamics of a uniformly accelerated atom weakly coupled to a massless scalar vacuum field. When a measuring device is in the same relativistic motion as the atom, the dynamical behavior of quantum Fisher information as a function of Rindler proper time is obtained. It is found out that monotonic decrease in phase sensitivitymore » is characteristic of dynamics of relativistic quantum estimation. The origin of the decay of quantum Fisher information is the thermal bath that the accelerated detector finds itself in due to the Unruh effect. To improve relativistic quantum metrology, we reasonably take into account two reflecting plane boundaries perpendicular to each other. The presence of the reflecting boundary can shield the detector from the thermal bath in some sense.« less

Study of ordered hadron chains with the ATLAS detector

NASA Astrophysics Data System (ADS)

Aaboud, M.; Aad, G.; Abbott, B.; Abdinov, O.; Abeloos, B.; Abidi, S. H.; Abouzeid, O. S.; Abraham, N. L.; Abramowicz, H.; Abreu, H.; Abreu, R.; Abulaiti, Y.; Acharya, B. S.; Adachi, S.; Adamczyk, L.; Adelman, J.; Adersberger, M.; Adye, T.; Affolder, A. A.; Afik, Y.; Agatonovic-Jovin, T.; Agheorghiesei, C.; Aguilar-Saavedra, J. A.; Ahlen, S. P.; Ahmadov, F.; Aielli, G.; Akatsuka, S.; Akerstedt, H.; Åkesson, T. P. A.; Akilli, E.; Akimov, A. V.; Alberghi, G. L.; Albert, J.; Albicocco, P.; Alconada Verzini, M. J.; Alderweireldt, S. C.; Aleksa, M.; Aleksandrov, I. N.; Alexa, C.; Alexander, G.; Alexopoulos, T.; Alhroob, M.; Ali, B.; Aliev, M.; Alimonti, G.; Alison, J.; Alkire, S. P.; Allbrooke, B. M. M.; Allen, B. W.; Allport, P. P.; Aloisio, A.; Alonso, A.; Alonso, F.; Alpigiani, C.; Alshehri, A. A.; Alstaty, M. I.; Alvarez Gonzalez, B.; Álvarez Piqueras, D.; Alviggi, M. G.; Amadio, B. T.; Amaral Coutinho, Y.; Amelung, C.; Amidei, D.; Amor Dos Santos, S. P.; Amoroso, S.; Amundsen, G.; Anastopoulos, C.; Ancu, L. S.; Andari, N.; Andeen, T.; Anders, C. F.; Anders, J. K.; Anderson, K. J.; Andreazza, A.; Andrei, V.; Angelidakis, S.; Angelozzi, I.; Angerami, A.; Anisenkov, A. V.; Anjos, N.; Annovi, A.; Antel, C.; Antonelli, M.; Antonov, A.; Antrim, D. J.; Anulli, F.; Aoki, M.; Aperio Bella, L.; Arabidze, G.; Arai, Y.; Araque, J. P.; Araujo Ferraz, V.; Arce, A. T. H.; Ardell, R. E.; Arduh, F. A.; Arguin, J.-F.; Argyropoulos, S.; Arik, M.; Armbruster, A. J.; Armitage, L. J.; Arnaez, O.; Arnold, H.; Arratia, M.; Arslan, O.; Artamonov, A.; Artoni, G.; Artz, S.; Asai, S.; Asbah, N.; Ashkenazi, A.; Asquith, L.; Assamagan, K.; Astalos, R.; Atkinson, M.; Atlay, N. B.; Augsten, K.; Avolio, G.; Axen, B.; Ayoub, M. K.; Azuelos, G.; Baas, A. E.; Baca, M. J.; Bachacou, H.; Bachas, K.; Backes, M.; Bagnaia, P.; Bahmani, M.; Bahrasemani, H.; Baines, J. T.; Bajic, M.; Baker, O. K.; Baldin, E. M.; Balek, P.; Balli, F.; Balunas, W. K.; Banas, E.; Bandyopadhyay, A.; Banerjee, Sw.; Bannoura, A. A. E.; Barak, L.; Barberio, E. L.; Barberis, D.; Barbero, M.; Barillari, T.; Barisits, M.-S.; Barkeloo, J. T.; Barklow, T.; Barlow, N.; Barnes, S. L.; Barnett, B. M.; Barnett, R. M.; Barnovska-Blenessy, Z.; Baroncelli, A.; Barone, G.; Barr, A. J.; Barranco Navarro, L.; Barreiro, F.; Barreiro Guimarães da Costa, J.; Bartoldus, R.; Barton, A. E.; Bartos, P.; Basalaev, A.; Bassalat, A.; Bates, R. L.; Batista, S. J.; Batley, J. R.; Battaglia, M.; Bauce, M.; Bauer, F.; Bawa, H. S.; Beacham, J. B.; Beattie, M. D.; Beau, T.; Beauchemin, P. H.; Bechtle, P.; Beck, H. P.; Beck, H. C.; Becker, K.; Becker, M.; Becot, C.; Beddall, A. J.; Beddall, A.; Bednyakov, V. A.; Bedognetti, M.; Bee, C. P.; Beermann, T. A.; Begalli, M.; Begel, M.; Behr, J. K.; Bell, A. S.; Bella, G.; Bellagamba, L.; Bellerive, A.; Bellomo, M.; Belotskiy, K.; Beltramello, O.; Belyaev, N. L.; Benary, O.; Benchekroun, D.; Bender, M.; Bendtz, K.; Benekos, N.; Benhammou, Y.; Benhar Noccioli, E.; Benitez, J.; Benjamin, D. P.; Benoit, M.; Bensinger, J. R.; Bentvelsen, S.; Beresford, L.; Beretta, M.; Berge, D.; Bergeaas Kuutmann, E.; Berger, N.; Beringer, J.; Berlendis, S.; Bernard, N. R.; Bernardi, G.; Bernius, C.; Bernlochner, F. U.; Berry, T.; Berta, P.; Bertella, C.; Bertoli, G.; Bertolucci, F.; Bertram, I. A.; Bertsche, C.; Bertsche, D.; Besjes, G. J.; Bessidskaia Bylund, O.; Bessner, M.; Besson, N.; Betancourt, C.; Bethani, A.; Bethke, S.; Bevan, A. J.; Beyer, J.; Bianchi, R. M.; Biebel, O.; Biedermann, D.; Bielski, R.; Bierwagen, K.; Biesuz, N. V.; Biglietti, M.; Billoud, T. R. V.; Bilokon, H.; Bindi, M.; Bingul, A.; Bini, C.; Biondi, S.; Bisanz, T.; Bittrich, C.; Bjergaard, D. M.; Black, J. E.; Black, K. M.; Blair, R. E.; Blazek, T.; Bloch, I.; Blocker, C.; Blue, A.; Blum, W.; Blumenschein, U.; Blunier, S.; Bobbink, G. J.; Bobrovnikov, V. S.; Bocchetta, S. S.; Bocci, A.; Bock, C.; Boehler, M.; Boerner, D.; Bogavac, D.; Bogdanchikov, A. G.; Bohm, C.; Boisvert, V.; Bokan, P.; Bold, T.; Boldyrev, A. S.; Bolz, A. E.; Bomben, M.; Bona, M.; Boonekamp, M.; Borisov, A.; Borissov, G.; Bortfeldt, J.; Bortoletto, D.; Bortolotto, V.; Boscherini, D.; Bosman, M.; Bossio Sola, J. D.; Boudreau, J.; Bouffard, J.; Bouhova-Thacker, E. V.; Boumediene, D.; Bourdarios, C.; Boutle, S. K.; Boveia, A.; Boyd, J.; Boyko, I. R.; Bracinik, J.; Brandt, A.; Brandt, G.; Brandt, O.; Bratzler, U.; Brau, B.; Brau, J. E.; Breaden Madden, W. D.; Brendlinger, K.; Brennan, A. J.; Brenner, L.; Brenner, R.; Bressler, S.; Briglin, D. L.; Bristow, T. M.; Britton, D.; Britzger, D.; Brochu, F. M.; Brock, I.; Brock, R.; Brooijmans, G.; Brooks, T.; Brooks, W. K.; Brosamer, J.; Brost, E.; Broughton, J. H.; Bruckman de Renstrom, P. A.; Bruncko, D.; Bruni, A.; Bruni, G.; Bruni, L. S.; Brunt, Bh; Bruschi, M.; Bruscino, N.; Bryant, P.; Bryngemark, L.; Buanes, T.; Buat, Q.; Buchholz, P.; Buckley, A. G.; Budagov, I. A.; Buehrer, F.; Bugge, M. K.; Bulekov, O.; Bullock, D.; Burch, T. J.; Burdin, S.; Burgard, C. D.; Burger, A. M.; Burghgrave, B.; Burka, K.; Burke, S.; Burmeister, I.; Burr, J. T. P.; Busato, E.; Büscher, D.; Büscher, V.; Bussey, P.; Butler, J. M.; Buttar, C. M.; Butterworth, J. M.; Butti, P.; Buttinger, W.; Buzatu, A.; Buzykaev, A. R.; Cabrera Urbán, S.; Caforio, D.; Cairo, V. M.; Cakir, O.; Calace, N.; Calafiura, P.; Calandri, A.; Calderini, G.; Calfayan, P.; Callea, G.; Caloba, L. P.; Calvente Lopez, S.; Calvet, D.; Calvet, S.; Calvet, T. P.; Camacho Toro, R.; Camarda, S.; Camarri, P.; Cameron, D.; Caminal Armadans, R.; Camincher, C.; Campana, S.; Campanelli, M.; Camplani, A.; Campoverde, A.; Canale, V.; Cano Bret, M.; Cantero, J.; Cao, T.; Capeans Garrido, M. D. M.; Caprini, I.; Caprini, M.; Capua, M.; Carbone, R. M.; Cardarelli, R.; Cardillo, F.; Carli, I.; Carli, T.; Carlino, G.; Carlson, B. T.; Carminati, L.; Carney, R. M. D.; Caron, S.; Carquin, E.; Carrá, S.; Carrillo-Montoya, G. D.; Casadei, D.; Casado, M. P.; Casolino, M.; Casper, D. W.; Castelijn, R.; Castillo Gimenez, V.; Castro, N. F.; Catinaccio, A.; Catmore, J. R.; Cattai, A.; Caudron, J.; Cavaliere, V.; Cavallaro, E.; Cavalli, D.; Cavalli-Sforza, M.; Cavasinni, V.; Celebi, E.; Ceradini, F.; Cerda Alberich, L.; Cerqueira, A. S.; Cerri, A.; Cerrito, L.; Cerutti, F.; Cervelli, A.; Cetin, S. A.; Chafaq, A.; Chakraborty, D.; Chan, S. K.; Chan, W. S.; Chan, Y. L.; Chang, P.; Chapman, J. D.; Charlton, D. G.; Chau, C. C.; Chavez Barajas, C. A.; Che, S.; Cheatham, S.; Chegwidden, A.; Chekanov, S.; Chekulaev, S. V.; Chelkov, G. A.; Chelstowska, M. A.; Chen, C.; Chen, H.; Chen, J.; Chen, S.; Chen, S.; Chen, X.; Chen, Y.; Cheng, H. C.; Cheng, H. J.; Cheplakov, A.; Cheremushkina, E.; Cherkaoui El Moursli, R.; Cheu, E.; Cheung, K.; Chevalier, L.; Chiarella, V.; Chiarelli, G.; Chiodini, G.; Chisholm, A. S.; Chitan, A.; Chiu, Y. H.; Chizhov, M. V.; Choi, K.; Chomont, A. R.; Chouridou, S.; Chow, Y. S.; Christodoulou, V.; Chu, M. C.; Chudoba, J.; Chuinard, A. J.; Chwastowski, J. J.; Chytka, L.; Ciftci, A. K.; Cinca, D.; Cindro, V.; Cioara, I. A.; Ciocca, C.; Ciocio, A.; Cirotto, F.; Citron, Z. H.; Citterio, M.; Ciubancan, M.; Clark, A.; Clark, B. L.; Clark, M. R.; Clark, P. J.; Clarke, R. N.; Clement, C.; Coadou, Y.; Cobal, M.; Coccaro, A.; Cochran, J.; Colasurdo, L.; Cole, B.; Colijn, A. P.; Collot, J.; Colombo, T.; Conde Muiño, P.; Coniavitis, E.; Connell, S. H.; Connelly, I. A.; Constantinescu, S.; Conti, G.; Conventi, F.; Cooke, M.; Cooper-Sarkar, A. M.; Cormier, F.; Cormier, K. J. R.; Corradi, M.; Corriveau, F.; Cortes-Gonzalez, A.; Cortiana, G.; Costa, G.; Costa, M. J.; Costanzo, D.; Cottin, G.; Cowan, G.; Cox, B. E.; Cranmer, K.; Crawley, S. J.; Creager, R. A.; Cree, G.; Crépé-Renaudin, S.; Crescioli, F.; Cribbs, W. A.; Cristinziani, M.; Croft, V.; Crosetti, G.; Cueto, A.; Cuhadar Donszelmann, T.; Cukierman, A. R.; Cummings, J.; Curatolo, M.; Cúth, J.; Czekierda, S.; Czodrowski, P.; D'Amen, G.; D'Auria, S.; D'Eramo, L.; D'Onofrio, M.; da Cunha Sargedas de Sousa, M. J.; da Via, C.; Dabrowski, W.; Dado, T.; Dai, T.; Dale, O.; Dallaire, F.; Dallapiccola, C.; Dam, M.; Dandoy, J. R.; Daneri, M. F.; Dang, N. P.; Daniells, A. C.; Dann, N. S.; Danninger, M.; Dano Hoffmann, M.; Dao, V.; Darbo, G.; Darmora, S.; Dassoulas, J.; Dattagupta, A.; Daubney, T.; Davey, W.; David, C.; Davidek, T.; Davis, D. R.; Davison, P.; Dawe, E.; Dawson, I.; de, K.; de Asmundis, R.; de Benedetti, A.; de Castro, S.; de Cecco, S.; de Groot, N.; de Jong, P.; de la Torre, H.; de Lorenzi, F.; de Maria, A.; de Pedis, D.; de Salvo, A.; de Sanctis, U.; de Santo, A.; de Vasconcelos Corga, K.; de Vivie de Regie, J. B.; Debbe, R.; Debenedetti, C.; Dedovich, D. V.; Dehghanian, N.; Deigaard, I.; Del Gaudio, M.; Del Peso, J.; Delgove, D.; Deliot, F.; Delitzsch, C. M.; Dell'Acqua, A.; Dell'Asta, L.; Dell'Orso, M.; Della Pietra, M.; Della Volpe, D.; Delmastro, M.; Delporte, C.; Delsart, P. A.; Demarco, D. A.; Demers, S.; Demichev, M.; Demilly, A.; Denisov, S. P.; Denysiuk, D.; Derendarz, D.; Derkaoui, J. E.; Derue, F.; Dervan, P.; Desch, K.; Deterre, C.; Dette, K.; Devesa, M. R.; Deviveiros, P. O.; Dewhurst, A.; Dhaliwal, S.; di Bello, F. A.; di Ciaccio, A.; di Ciaccio, L.; di Clemente, W. K.; di Donato, C.; di Girolamo, A.; di Girolamo, B.; di Micco, B.; di Nardo, R.; di Petrillo, K. F.; di Simone, A.; di Sipio, R.; di Valentino, D.; Diaconu, C.; Diamond, M.; Dias, F. A.; Diaz, M. A.; Diehl, E. B.; Dietrich, J.; Díez Cornell, S.; Dimitrievska, A.; Dingfelder, J.; Dita, P.; Dita, S.; Dittus, F.; Djama, F.; Djobava, T.; Djuvsland, J. I.; Do Vale, M. A. B.; Dobos, D.; Dobre, M.; Doglioni, C.; Dolejsi, J.; Dolezal, Z.; Donadelli, M.; Donati, S.; Dondero, P.; Donini, J.; Dopke, J.; Doria, A.; Dova, M. T.; Doyle, A. T.; Drechsler, E.; Dris, M.; Du, Y.; Duarte-Campderros, J.; Dubreuil, A.; Duchovni, E.; Duckeck, G.; Ducourthial, A.; Ducu, O. A.; Duda, D.; Dudarev, A.; Dudder, A. Chr.; Duffield, E. M.; Duflot, L.; Dührssen, M.; Dumancic, M.; Dumitriu, A. E.; Duncan, A. K.; Dunford, M.; Duran Yildiz, H.; Düren, M.; Durglishvili, A.; Duschinger, D.; Dutta, B.; Dyndal, M.; Dziedzic, B. S.; Eckardt, C.; Ecker, K. M.; Edgar, R. C.; Eifert, T.; Eigen, G.; Einsweiler, K.; Ekelof, T.; El Kacimi, M.; El Kosseifi, R.; Ellajosyula, V.; Ellert, M.; Elles, S.; Ellinghaus, F.; Elliot, A. A.; Ellis, N.; Elmsheuser, J.; Elsing, M.; Emeliyanov, D.; Enari, Y.; Endner, O. C.; Ennis, J. S.; Erdmann, J.; Ereditato, A.; Ernst, M.; Errede, S.; Escalier, M.; Escobar, C.; Esposito, B.; Estrada Pastor, O.; Etienvre, A. I.; Etzion, E.; Evans, H.; Ezhilov, A.; Ezzi, M.; Fabbri, F.; Fabbri, L.; Fabiani, V.; Facini, G.; Fakhrutdinov, R. M.; Falciano, S.; Falla, R. J.; Faltova, J.; Fang, Y.; Fanti, M.; Farbin, A.; Farilla, A.; Farina, C.; Farina, E. M.; Farooque, T.; Farrell, S.; Farrington, S. M.; Farthouat, P.; Fassi, F.; Fassnacht, P.; Fassouliotis, D.; Faucci Giannelli, M.; Favareto, A.; Fawcett, W. J.; Fayard, L.; Fedin, O. L.; Fedorko, W.; Feigl, S.; Feligioni, L.; Feng, C.; Feng, E. J.; Feng, H.; Fenton, M. J.; Fenyuk, A. B.; Feremenga, L.; Fernandez Martinez, P.; Fernandez Perez, S.; Ferrando, J.; Ferrari, A.; Ferrari, P.; Ferrari, R.; Ferreira de Lima, D. E.; Ferrer, A.; Ferrere, D.; Ferretti, C.; Fiedler, F.; Filipčič, A.; Filipuzzi, M.; Filthaut, F.; Fincke-Keeler, M.; Finelli, K. D.; Fiolhais, M. C. N.; Fiorini, L.; Fischer, A.; Fischer, C.; Fischer, J.; Fisher, W. C.; Flaschel, N.; Fleck, I.; Fleischmann, P.; Fletcher, R. R. M.; Flick, T.; Flierl, B. M.; Flores Castillo, L. R.; Flowerdew, M. J.; Forcolin, G. T.; Formica, A.; Förster, F. A.; Forti, A.; Foster, A. G.; Fournier, D.; Fox, H.; Fracchia, S.; Francavilla, P.; Franchini, M.; Franchino, S.; Francis, D.; Franconi, L.; Franklin, M.; Frate, M.; Fraternali, M.; Freeborn, D.; Fressard-Batraneanu, S. M.; Freund, B.; Froidevaux, D.; Frost, J. A.; Fukunaga, C.; Fusayasu, T.; Fuster, J.; Gabaldon, C.; Gabizon, O.; Gabrielli, A.; Gabrielli, A.; Gach, G. P.; Gadatsch, S.; Gadomski, S.; Gagliardi, G.; Gagnon, L. G.; Galea, C.; Galhardo, B.; Gallas, E. J.; Gallop, B. J.; Gallus, P.; Galster, G.; Gan, K. K.; Ganguly, S.; Gao, Y.; Gao, Y. S.; Garay Walls, F. M.; García, C.; García Navarro, J. E.; García Pascual, J. A.; Garcia-Sciveres, M.; Gardner, R. W.; Garelli, N.; Garonne, V.; Gascon Bravo, A.; Gasnikova, K.; Gatti, C.; Gaudiello, A.; Gaudio, G.; Gavrilenko, I. L.; Gay, C.; Gaycken, G.; Gazis, E. N.; Gee, C. N. P.; Geisen, J.; Geisen, M.; Geisler, M. P.; Gellerstedt, K.; Gemme, C.; Genest, M. H.; Geng, C.; Gentile, S.; Gentsos, C.; George, S.; Gerbaudo, D.; Gershon, A.; Geßner, G.; Ghasemi, S.; Ghneimat, M.; Giacobbe, B.; Giagu, S.; Giangiacomi, N.; Giannetti, P.; Gibson, S. M.; Gignac, M.; Gilchriese, M.; Gillberg, D.; Gilles, G.; Gingrich, D. M.; Giordani, M. P.; Giorgi, F. M.; Giraud, P. F.; Giromini, P.; Giugliarelli, G.; Giugni, D.; Giuli, F.; Giuliani, C.; Giulini, M.; Gjelsten, B. K.; Gkaitatzis, S.; Gkialas, I.; Gkougkousis, E. L.; Gkountoumis, P.; Gladilin, L. K.; Glasman, C.; Glatzer, J.; Glaysher, P. C. F.; Glazov, A.; Goblirsch-Kolb, M.; Godlewski, J.; Goldfarb, S.; Golling, T.; Golubkov, D.; Gomes, A.; Gonçalo, R.; Goncalves Gama, R.; Goncalves Pinto Firmino da Costa, J.; Gonella, G.; Gonella, L.; Gongadze, A.; González de La Hoz, S.; Gonzalez-Sevilla, S.; Goossens, L.; Gorbounov, P. A.; Gordon, H. A.; Gorelov, I.; Gorini, B.; Gorini, E.; Gorišek, A.; Goshaw, A. T.; Gössling, C.; Gostkin, M. I.; Gottardo, C. A.; Goudet, C. R.; Goujdami, D.; Goussiou, A. G.; Govender, N.; Gozani, E.; Graber, L.; Grabowska-Bold, I.; Gradin, P. O. J.; Gramling, J.; Gramstad, E.; Grancagnolo, S.; Gratchev, V.; Gravila, P. M.; Gray, C.; Gray, H. M.; Greenwood, Z. D.; Grefe, C.; Gregersen, K.; Gregor, I. M.; Grenier, P.; Grevtsov, K.; Griffiths, J.; Grillo, A. A.; Grimm, K.; Grinstein, S.; Gris, Ph.; Grivaz, J.-F.; Groh, S.; Gross, E.; Grosse-Knetter, J.; Grossi, G. C.; Grout, Z. J.; Grummer, A.; Guan, L.; Guan, W.; Guenther, J.; Guescini, F.; Guest, D.; Gueta, O.; Gui, B.; Guido, E.; Guillemin, T.; Guindon, S.; Gul, U.; Gumpert, C.; Guo, J.; Guo, W.; Guo, Y.; Gupta, R.; Gupta, S.; Gustavino, G.; Gutelman, B. J.; Gutierrez, P.; Gutierrez Ortiz, N. G.; Gutschow, C.; Guyot, C.; Guzik, M. P.; Gwenlan, C.; Gwilliam, C. B.; Haas, A.; Haber, C.; Hadavand, H. K.; Haddad, N.; Hadef, A.; Hageböck, S.; Hagihara, M.; Hakobyan, H.; Haleem, M.; Haley, J.; Halladjian, G.; Hallewell, G. D.; Hamacher, K.; Hamal, P.; Hamano, K.; Hamilton, A.; Hamity, G. N.; Hamnett, P. G.; Han, L.; Han, S.; Hanagaki, K.; Hanawa, K.; Hance, M.; Haney, B.; Hanke, P.; Hansen, J. B.; Hansen, J. D.; Hansen, M. C.; Hansen, P. H.; Hara, K.; Hard, A. S.; Harenberg, T.; Hariri, F.; Harkusha, S.; Harrington, R. D.; Harrison, P. F.; Hartmann, N. M.; Hasegawa, Y.; Hasib, A.; Hassani, S.; Haug, S.; Hauser, R.; Hauswald, L.; Havener, L. B.; Havranek, M.; Hawkes, C. M.; Hawkings, R. J.; Hayakawa, D.; Hayden, D.; Hays, C. P.; Hays, J. M.; Hayward, H. S.; Haywood, S. J.; Head, S. J.; Heck, T.; Hedberg, V.; Heelan, L.; Heer, S.; Heidegger, K. K.; Heim, S.; Heim, T.; Heinemann, B.; Heinrich, J. J.; Heinrich, L.; Heinz, C.; Hejbal, J.; Helary, L.; Held, A.; Hellman, S.; Helsens, C.; Henderson, R. C. W.; Heng, Y.; Henkelmann, S.; Henriques Correia, A. M.; Henrot-Versille, S.; Herbert, G. H.; Herde, H.; Herget, V.; Hernández Jiménez, Y.; Herr, H.; Herten, G.; Hertenberger, R.; Hervas, L.; Herwig, T. C.; Hesketh, G. G.; Hessey, N. P.; Hetherly, J. W.; Higashino, S.; Higón-Rodriguez, E.; Hildebrand, K.; Hill, E.; Hill, J. C.; Hiller, K. H.; Hillier, S. J.; Hils, M.; Hinchliffe, I.; Hirose, M.; Hirschbuehl, D.; Hiti, B.; Hladik, O.; Hoad, X.; Hobbs, J.; Hod, N.; Hodgkinson, M. C.; Hodgson, P.; Hoecker, A.; Hoeferkamp, M. R.; Hoenig, F.; Hohn, D.; Holmes, T. R.; Homann, M.; Honda, S.; Honda, T.; Hong, T. M.; Hooberman, B. H.; Hopkins, W. H.; Horii, Y.; Horton, A. J.; Hostachy, J.-Y.; Hou, S.; Hoummada, A.; Howarth, J.; Hoya, J.; Hrabovsky, M.; Hrdinka, J.; Hristova, I.; Hrivnac, J.; Hryn'ova, T.; Hrynevich, A.; Hsu, P. J.; Hsu, S.-C.; Hu, Q.; Hu, S.; Huang, Y.; Hubacek, Z.; Hubaut, F.; Huegging, F.; Huffman, T. B.; Hughes, E. W.; Hughes, G.; Huhtinen, M.; Huo, P.; Huseynov, N.; Huston, J.; Huth, J.; Iacobucci, G.; Iakovidis, G.; Ibragimov, I.; Iconomidou-Fayard, L.; Idrissi, Z.; Iengo, P.; Igonkina, O.; Iizawa, T.; Ikegami, Y.; Ikeno, M.; Ilchenko, Y.; Iliadis, D.; Ilic, N.; Introzzi, G.; Ioannou, P.; Iodice, M.; Iordanidou, K.; Ippolito, V.; Isacson, M. F.; Ishijima, N.; Ishino, M.; Ishitsuka, M.; Issever, C.; Istin, S.; Ito, F.; Iturbe Ponce, J. M.; Iuppa, R.; Iwasaki, H.; Izen, J. M.; Izzo, V.; Jabbar, S.; Jackson, P.; Jacobs, R. M.; Jain, V.; Jakobi, K. B.; Jakobs, K.; Jakobsen, S.; Jakoubek, T.; Jamin, D. O.; Jana, D. K.; Jansky, R.; Janssen, J.; Janus, M.; Janus, P. A.; Jarlskog, G.; Javadov, N.; Javå¯Rek, T.; Javurkova, M.; Jeanneau, F.; Jeanty, L.; Jejelava, J.; Jelinskas, A.; Jenni, P.; Jeske, C.; Jézéquel, S.; Ji, H.; Jia, J.; Jiang, H.; Jiang, Y.; Jiang, Z.; Jiggins, S.; Jimenez Pena, J.; Jin, S.; Jinaru, A.; Jinnouchi, O.; Jivan, H.; Johansson, P.; Johns, K. A.; Johnson, C. A.; Johnson, W. J.; Jon-And, K.; Jones, R. W. L.; Jones, S. D.; Jones, S.; Jones, T. J.; Jongmanns, J.; Jorge, P. M.; Jovicevic, J.; Ju, X.; Juste Rozas, A.; Köhler, M. K.; Kaczmarska, A.; Kado, M.; Kagan, H.; Kagan, M.; Kahn, S. J.; Kaji, T.; Kajomovitz, E.; Kalderon, C. W.; Kaluza, A.; Kama, S.; Kamenshchikov, A.; Kanaya, N.; Kanjir, L.; Kantserov, V. A.; Kanzaki, J.; Kaplan, B.; Kaplan, L. S.; Kar, D.; Karakostas, K.; Karastathis, N.; Kareem, M. J.; Karentzos, E.; Karpov, S. N.; Karpova, Z. M.; Karthik, K.; Kartvelishvili, V.; Karyukhin, A. N.; Kasahara, K.; Kashif, L.; Kass, R. D.; Kastanas, A.; Kataoka, Y.; Kato, C.; Katre, A.; Katzy, J.; Kawade, K.; Kawagoe, K.; Kawamoto, T.; Kawamura, G.; Kay, E. F.; Kazanin, V. F.; Keeler, R.; Kehoe, R.; Keller, J. S.; Kellermann, E.; Kempster, J. J.; Kendrick, J.; Keoshkerian, H.; Kepka, O.; Kerševan, B. P.; Kersten, S.; Keyes, R. A.; Khader, M.; Khalil-Zada, F.; Khanov, A.; Kharlamov, A. G.; Kharlamova, T.; Khodinov, A.; Khoo, T. J.; Khovanskiy, V.; Khramov, E.; Khubua, J.; Kido, S.; Kilby, C. R.; Kim, H. Y.; Kim, S. H.; Kim, Y. K.; Kimura, N.; Kind, O. M.; King, B. T.; Kirchmeier, D.; Kirk, J.; Kiryunin, A. E.; Kishimoto, T.; Kisielewska, D.; Kitali, V.; Kivernyk, O.; Kladiva, E.; Klapdor-Kleingrothaus, T.; Klein, M. H.; Klein, M.; Klein, U.; Kleinknecht, K.; Klimek, P.; Klimentov, A.; Klingenberg, R.; Klingl, T.; Klioutchnikova, T.; Kluge, E.-E.; Kluit, P.; Kluth, S.; Kneringer, E.; Knoops, E. B. F. G.; Knue, A.; Kobayashi, A.; Kobayashi, D.; Kobayashi, T.; Kobel, M.; Kocian, M.; Kodys, P.; Koffas, T.; Koffeman, E.; Köhler, N. M.; Koi, T.; Kolb, M.; Koletsou, I.; Komar, A. A.; Komori, Y.; Kondo, T.; Kondrashova, N.; Köneke, K.; König, A. C.; Kono, T.; Konoplich, R.; Konstantinidis, N.; Kopeliansky, R.; Koperny, S.; Kopp, A. K.; Korcyl, K.; Kordas, K.; Korn, A.; Korol, A. A.; Korolkov, I.; Korolkova, E. V.; Kortner, O.; Kortner, S.; Kosek, T.; Kostyukhin, V. V.; Kotwal, A.; Koulouris, A.; Kourkoumeli-Charalampidi, A.; Kourkoumelis, C.; Kourlitis, E.; Kouskoura, V.; Kowalewska, A. B.; Kowalewski, R.; Kowalski, T. Z.; Kozakai, C.; Kozanecki, W.; Kozhin, A. S.; Kramarenko, V. A.; Kramberger, G.; Krasnopevtsev, D.; Krasny, M. W.; Krasznahorkay, A.; Krauss, D.; Kremer, J. A.; Kretzschmar, J.; Kreutzfeldt, K.; Krieger, P.; Krizka, K.; Kroeninger, K.; Kroha, H.; Kroll, J.; Kroll, J.; Kroseberg, J.; Krstic, J.; Kruchonak, U.; Krüger, H.; Krumnack, N.; Kruse, M. C.; Kubota, T.; Kucuk, H.; Kuday, S.; Kuechler, J. T.; Kuehn, S.; Kugel, A.; Kuger, F.; Kuhl, T.; Kukhtin, V.; Kukla, R.; Kulchitsky, Y.; Kuleshov, S.; Kulinich, Y. P.; Kuna, M.; Kunigo, T.; Kupco, A.; Kupfer, T.; Kuprash, O.; Kurashige, H.; Kurchaninov, L. L.; Kurochkin, Y. A.; Kurth, M. G.; Kus, V.; Kuwertz, E. S.; Kuze, M.; Kvita, J.; Kwan, T.; Kyriazopoulos, D.; La Rosa, A.; La Rosa Navarro, J. L.; La Rotonda, L.; La Ruffa, F.; Lacasta, C.; Lacava, F.; Lacey, J.; Lacker, H.; Lacour, D.; Ladygin, E.; Lafaye, R.; Laforge, B.; Lagouri, T.; Lai, S.; Lammers, S.; Lampl, W.; Lançon, E.; Landgraf, U.; Landon, M. P. J.; Lanfermann, M. C.; Lang, V. S.; Lange, J. C.; Langenberg, R. J.; Lankford, A. J.; Lanni, F.; Lantzsch, K.; Lanza, A.; Lapertosa, A.; Laplace, S.; Laporte, J. F.; Lari, T.; Lasagni Manghi, F.; Lassnig, M.; Lau, T. S.; Laurelli, P.; Lavrijsen, W.; Law, A. T.; Laycock, P.; Lazovich, T.; Lazzaroni, M.; Le, B.; Le Dortz, O.; Le Guirriec, E.; Le Quilleuc, E. P.; Leblanc, M.; Lecompte, T.; Ledroit-Guillon, F.; Lee, C. A.; Lee, G. R.; Lee, S. C.; Lee, L.; Lefebvre, B.; Lefebvre, G.; Lefebvre, M.; Legger, F.; Leggett, C.; Lehmann Miotto, G.; Lei, X.; Leight, W. A.; Leite, M. A. L.; Leitner, R.; Lellouch, D.; Lemmer, B.; Leney, K. J. C.; Lenz, T.; Lenzi, B.; Leone, R.; Leone, S.; Leonidopoulos, C.; Lerner, G.; Leroy, C.; Lesage, A. A. J.; Lester, C. G.; Levchenko, M.; Levêque, J.; Levin, D.; Levinson, L. J.; Levy, M.; Lewis, D.; Li, B.; Li, Changqiao; Li, H.; Li, L.; Li, Q.; Li, Q.; Li, S.; Li, X.; Li, Y.; Liang, Z.; Liberti, B.; Liblong, A.; Lie, K.; Liebal, J.; Liebig, W.; Limosani, A.; Lin, S. C.; Lin, T. H.; Lindquist, B. E.; Lionti, A. E.; Lipeles, E.; Lipniacka, A.; Lisovyi, M.; Liss, T. M.; Lister, A.; Litke, A. M.; Liu, B.; Liu, H.; Liu, H.; Liu, J. K. K.; Liu, J.; Liu, J. B.; Liu, K.; Liu, L.; Liu, M.; Liu, Y. L.; Liu, Y.; Livan, M.; Lleres, A.; Llorente Merino, J.; Lloyd, S. L.; Lo, C. Y.; Lo Sterzo, F.; Lobodzinska, E. M.; Loch, P.; Loebinger, F. K.; Loesle, A.; Loew, K. M.; Loginov, A.; Lohse, T.; Lohwasser, K.; Lokajicek, M.; Long, B. A.; Long, J. D.; Long, R. E.; Longo, L.; Looper, K. A.; Lopez, J. A.; Lopez Mateos, D.; Lopez Paz, I.; Lopez Solis, A.; Lorenz, J.; Lorenzo Martinez, N.; Losada, M.; Lösel, P. J.; Lou, X.; Lounis, A.; Love, J.; Love, P. A.; Lu, H.; Lu, N.; Lu, Y. J.; Lubatti, H. J.; Luci, C.; Lucotte, A.; Luedtke, C.; Luehring, F.; Lukas, W.; Luminari, L.; Lundberg, O.; Lund-Jensen, B.; Lutz, M. S.; Luzi, P. M.; Lynn, D.; Lysak, R.; Lytken, E.; Lyu, F.; Lyubushkin, V.; Ma, H.; Ma, L. L.; Ma, Y.; Maccarrone, G.; Macchiolo, A.; MacDonald, C. M.; Maček, B.; Machado Miguens, J.; Madaffari, D.; Madar, R.; Mader, W. F.; Madsen, A.; Maeda, J.; Maeland, S.; Maeno, T.; Maevskiy, A. S.; Magerl, V.; Mahlstedt, J.; Maiani, C.; Maidantchik, C.; Maier, A. A.; Maier, T.; Maio, A.; Majersky, O.; Majewski, S.; Makida, Y.; Makovec, N.; Malaescu, B.; Malecki, Pa.; Maleev, V. P.; Malek, F.; Mallik, U.; Malon, D.; Malone, C.; Maltezos, S.; Malyukov, S.; Mamuzic, J.; Mancini, G.; Mandić, I.; Maneira, J.; Manhaes de Andrade Filho, L.; Manjarres Ramos, J.; Mankinen, K. H.; Mann, A.; Manousos, A.; Mansoulie, B.; Mansour, J. D.; Mantifel, R.; Mantoani, M.; Manzoni, S.; Mapelli, L.; Marceca, G.; March, L.; Marchese, L.; Marchiori, G.; Marcisovsky, M.; Marjanovic, M.; Marley, D. E.; Marroquim, F.; Marsden, S. P.; Marshall, Z.; Martensson, M. U. F.; Marti-Garcia, S.; Martin, C. B.; Martin, T. A.; Martin, V. J.; Martin Dit Latour, B.; Martinez, M.; Martinez Outschoorn, V. I.; Martin-Haugh, S.; Martoiu, V. S.; Martyniuk, A. C.; Marzin, A.; Masetti, L.; Mashimo, T.; Mashinistov, R.; Masik, J.; Maslennikov, A. L.; Massa, L.; Mastrandrea, P.; Mastroberardino, A.; Masubuchi, T.; Mättig, P.; Maurer, J.; Maxfield, S. J.; Maximov, D. A.; Mazini, R.; Maznas, I.; Mazza, S. M.; Mc Fadden, N. C.; Mc Goldrick, G.; Mc Kee, S. P.; McCarn, A.; McCarthy, R. L.; McCarthy, T. G.; McClymont, L. I.; McDonald, E. F.; McFayden, J. A.; McHedlidze, G.; McMahon, S. J.; McNamara, P. C.; McPherson, R. A.; Meehan, S.; Megy, T. J.; Mehlhase, S.; Mehta, A.; Meideck, T.; Meier, K.; Meirose, B.; Melini, D.; Mellado Garcia, B. R.; Mellenthin, J. D.; Melo, M.; Meloni, F.; Melzer, A.; Menary, S. B.; Meng, L.; Meng, X. T.; Mengarelli, A.; Menke, S.; Meoni, E.; Mergelmeyer, S.; Merlassino, C.; Mermod, P.; Merola, L.; Meroni, C.; Merritt, F. S.; Messina, A.; Metcalfe, J.; Mete, A. S.; Meyer, C.; Meyer, J.-P.; Meyer, J.; Meyer Zu Theenhausen, H.; Miano, F.; Middleton, R. P.; Miglioranzi, S.; Mijović, L.; Mikenberg, G.; Mikestikova, M.; Mikuž, M.; Milesi, M.; Milic, A.; Millar, D. A.; Miller, D. W.; Mills, C.; Milov, A.; Milstead, D. A.; Minaenko, A. A.; Minami, Y.; Minashvili, I. A.; Mincer, A. I.; Mindur, B.; Mineev, M.; Minegishi, Y.; Ming, Y.; Mir, L. M.; Mistry, K. P.; Mitani, T.; Mitrevski, J.; Mitsou, V. A.; Miucci, A.; Miyagawa, P. S.; Mizukami, A.; Mjörnmark, J. U.; Mkrtchyan, T.; Mlynarikova, M.; Moa, T.; Mochizuki, K.; Mogg, P.; Mohapatra, S.; Molander, S.; Moles-Valls, R.; Mondragon, M. C.; Mönig, K.; Monk, J.; Monnier, E.; Montalbano, A.; Montejo Berlingen, J.; Monticelli, F.; Monzani, S.; Moore, R. W.; Morange, N.; Moreno, D.; Moreno Llácer, M.; Morettini, P.; Morgenstern, S.; Mori, D.; Mori, T.; Morii, M.; Morinaga, M.; Morisbak, V.; Morley, A. K.; Mornacchi, G.; Morris, J. D.; Morvaj, L.; Moschovakos, P.; Mosidze, M.; Moss, H. J.; Moss, J.; Motohashi, K.; Mount, R.; Mountricha, E.; Moyse, E. J. W.; Muanza, S.; Mueller, F.; Mueller, J.; Mueller, R. S. P.; Muenstermann, D.; Mullen, P.; Mullier, G. A.; Munoz Sanchez, F. J.; Murray, W. J.; Musheghyan, H.; Muškinja, M.; Myagkov, A. G.; Myska, M.; Nachman, B. P.; Nackenhorst, O.; Nagai, K.; Nagai, R.; Nagano, K.; Nagasaka, Y.; Nagata, K.; Nagel, M.; Nagy, E.; Nairz, A. M.; Nakahama, Y.; Nakamura, K.; Nakamura, T.; Nakano, I.; Naranjo Garcia, R. F.; Narayan, R.; Narrias Villar, D. I.; Naryshkin, I.; Naumann, T.; Navarro, G.; Nayyar, R.; Neal, H. A.; Nechaeva, P. Yu.; Neep, T. J.; Negri, A.; Negrini, M.; Nektarijevic, S.; Nellist, C.; Nelson, A.; Nelson, M. E.; Nemecek, S.; Nemethy, P.; Nessi, M.; Neubauer, M. S.; Neumann, M.; Newman, P. R.; Ng, T. Y.; Nguyen Manh, T.; Nickerson, R. B.; Nicolaidou, R.; Nielsen, J.; Nikolaenko, V.; Nikolic-Audit, I.; Nikolopoulos, K.; Nilsen, J. K.; Nilsson, P.; Ninomiya, Y.; Nisati, A.; Nishu, N.; Nisius, R.; Nitsche, I.; Nitta, T.; Nobe, T.; Noguchi, Y.; Nomachi, M.; Nomidis, I.; Nomura, M. A.; Nooney, T.; Nordberg, M.; Norjoharuddeen, N.; Novgorodova, O.; Nowak, S.; Nozaki, M.; Nozka, L.; Ntekas, K.; Nurse, E.; Nuti, F.; O'Connor, K.; O'Neil, D. C.; O'Rourke, A. A.; O'Shea, V.; Oakham, F. G.; Oberlack, H.; Obermann, T.; Ocariz, J.; Ochi, A.; Ochoa, I.; Ochoa-Ricoux, J. P.; Oda, S.; Odaka, S.; Oh, A.; Oh, S. H.; Ohm, C. C.; Ohman, H.; Oide, H.; Okawa, H.; Okumura, Y.; Okuyama, T.; Olariu, A.; Oleiro Seabra, L. F.; Olivares Pino, S. A.; Oliveira Damazio, D.; Olszewski, A.; Olszowska, J.; Onofre, A.; Onogi, K.; Onyisi, P. U. E.; Oppen, H.; Oreglia, M. J.; Oren, Y.; Orestano, D.; Orlando, N.; Orr, R. S.; Osculati, B.; Ospanov, R.; Otero Y Garzon, G.; Otono, H.; Ouchrif, M.; Ould-Saada, F.; Ouraou, A.; Oussoren, K. P.; Ouyang, Q.; Owen, M.; Owen, R. E.; Ozcan, V. E.; Ozturk, N.; Pachal, K.; Pacheco Pages, A.; Pacheco Rodriguez, L.; Padilla Aranda, C.; Pagan Griso, S.; Paganini, M.; Paige, F.; Palacino, G.; Palazzo, S.; Palestini, S.; Palka, M.; Pallin, D.; Panagiotopoulou, E. St.; Panagoulias, I.; Pandini, C. E.; Panduro Vazquez, J. G.; Pani, P.; Panitkin, S.; Pantea, D.; Paolozzi, L.; Papadopoulou, Th. D.; Papageorgiou, K.; Paramonov, A.; Paredes Hernandez, D.; Parker, A. J.; Parker, M. A.; Parker, K. A.; Parodi, F.; Parsons, J. A.; Parzefall, U.; Pascuzzi, V. R.; Pasner, J. M.; Pasqualucci, E.; Passaggio, S.; Pastore, Fr.; Pataraia, S.; Pater, J. R.; Pauly, T.; Pearson, B.; Pedraza Lopez, S.; Pedro, R.; Peleganchuk, S. V.; Penc, O.; Peng, C.; Peng, H.; Penwell, J.; Peralva, B. S.; Perego, M. M.; Perepelitsa, D. V.; Peri, F.; Perini, L.; Pernegger, H.; Perrella, S.; Peschke, R.; Peshekhonov, V. D.; Peters, K.; Peters, R. F. Y.; Petersen, B. A.; Petersen, T. C.; Petit, E.; Petridis, A.; Petridou, C.; Petroff, P.; Petrolo, E.; Petrov, M.; Petrucci, F.; Pettersson, N. E.; Peyaud, A.; Pezoa, R.; Phillips, F. H.; Phillips, P. W.; Piacquadio, G.; Pianori, E.; Picazio, A.; Piccaro, E.; Pickering, M. A.; Piegaia, R.; Pilcher, J. E.; Pilkington, A. D.; Pin, A. W. J.; Pinamonti, M.; Pinfold, J. L.; Pirumov, H.; Pitt, M.; Plazak, L.; Pleier, M.-A.; Pleskot, V.; Plotnikova, E.; Pluth, D.; Podberezko, P.; Poettgen, R.; Poggi, R.; Poggioli, L.; Pogrebnyak, I.; Pohl, D.; Polesello, G.; Poley, A.; Policicchio, A.; Polifka, R.; Polini, A.; Pollard, C. S.; Polychronakos, V.; Pommès, K.; Ponomarenko, D.; Pontecorvo, L.; Popeneciu, G. A.; Pospisil, S.; Potamianos, K.; Potrap, I. N.; Potter, C. J.; Poulsen, T.; Poveda, J.; Pozo Astigarraga, M. E.; Pralavorio, P.; Pranko, A.; Prell, S.; Price, D.; Primavera, M.; Prince, S.; Proklova, N.; Prokofiev, K.; Prokoshin, F.; Protopopescu, S.; Proudfoot, J.; Przybycien, M.; Puri, A.; Puzo, P.; Qian, J.; Qin, G.; Qin, Y.; Quadt, A.; Queitsch-Maitland, M.; Quilty, D.; Raddum, S.; Radeka, V.; Radescu, V.; Radhakrishnan, S. K.; Radloff, P.; Rados, P.; Ragusa, F.; Rahal, G.; Raine, J. A.; Rajagopalan, S.; Rangel-Smith, C.; Rashid, T.; Raspopov, S.; Ratti, M. G.; Rauch, D. M.; Rauscher, F.; Rave, S.; Ravinovich, I.; Rawling, J. H.; Raymond, M.; Read, A. L.; Readioff, N. P.; Reale, M.; Rebuzzi, D. M.; Redelbach, A.; Redlinger, G.; Reece, R.; Reed, R. G.; Reeves, K.; Rehnisch, L.; Reichert, J.; Reiss, A.; Rembser, C.; Ren, H.; Rescigno, M.; Resconi, S.; Resseguie, E. D.; Rettie, S.; Reynolds, E.; Rezanova, O. L.; Reznicek, P.; Rezvani, R.; Richter, R.; Richter, S.; Richter-Was, E.; Ricken, O.; Ridel, M.; Rieck, P.; Riegel, C. J.; Rieger, J.; Rifki, O.; Rijssenbeek, M.; Rimoldi, A.; Rimoldi, M.; Rinaldi, L.; Ripellino, G.; Ristić, B.; Ritsch, E.; Riu, I.; Rizatdinova, F.; Rizvi, E.; Rizzi, C.; Roberts, R. T.; Robertson, S. H.; Robichaud-Veronneau, A.; Robinson, D.; Robinson, J. E. M.; Robson, A.; Rocco, E.; Roda, C.; Rodina, Y.; Rodriguez Bosca, S.; Rodriguez Perez, A.; Rodriguez Rodriguez, D.; Roe, S.; Rogan, C. S.; Røhne, O.; Roloff, J.; Romaniouk, A.; Romano, M.; Romano Saez, S. M.; Romero Adam, E.; Rompotis, N.; Ronzani, M.; Roos, L.; Rosati, S.; Rosbach, K.; Rose, P.; Rosien, N.-A.; Rossi, E.; Rossi, L. P.; Rosten, J. H. N.; Rosten, R.; Rotaru, M.; Rothberg, J.; Rousseau, D.; Rozanov, A.; Rozen, Y.; Ruan, X.; Rubbo, F.; Rühr, F.; Ruiz-Martinez, A.; Rurikova, Z.; Rusakovich, N. A.; Russell, H. L.; Rutherfoord, J. P.; Ruthmann, N.; Ryabov, Y. F.; Rybar, M.; Rybkin, G.; Ryu, S.; Ryzhov, A.; Rzehorz, G. F.; Saavedra, A. F.; Sabato, G.; Sacerdoti, S.; Sadrozinski, H. F.-W.; Sadykov, R.; Safai Tehrani, F.; Saha, P.; Sahinsoy, M.; Saimpert, M.; Saito, M.; Saito, T.; Sakamoto, H.; Sakurai, Y.; Salamanna, G.; Salazar Loyola, J. E.; Salek, D.; Sales de Bruin, P. H.; Salihagic, D.; Salnikov, A.; Salt, J.; Salvatore, D.; Salvatore, F.; Salvucci, A.; Salzburger, A.; Sammel, D.; Sampsonidis, D.; Sampsonidou, D.; Sánchez, J.; Sanchez Martinez, V.; Sanchez Pineda, A.; Sandaker, H.; Sandbach, R. L.; Sander, C. O.; Sandhoff, M.; Sandoval, C.; Sankey, D. P. C.; Sannino, M.; Sano, Y.; Sansoni, A.; Santoni, C.; Santos, H.; Santoyo Castillo, I.; Sapronov, A.; Saraiva, J. G.; Sarrazin, B.; Sasaki, O.; Sato, K.; Sauvan, E.; Savage, G.; Savard, P.; Savic, N.; Sawyer, C.; Sawyer, L.; Saxon, J.; Sbarra, C.; Sbrizzi, A.; Scanlon, T.; Scannicchio, D. A.; Schaarschmidt, J.; Schacht, P.; Schachtner, B. M.; Schaefer, D.; Schaefer, L.; Schaefer, R.; Schaeffer, J.; Schaepe, S.; Schaetzel, S.; Schäfer, U.; Schaffer, A. C.; Schaile, D.; Schamberger, R. D.; Schegelsky, V. A.; Scheirich, D.; Schernau, M.; Schiavi, C.; Schier, S.; Schildgen, L. K.; Schillo, C.; Schioppa, M.; Schlenker, S.; Schmidt-Sommerfeld, K. R.; Schmieden, K.; Schmitt, C.; Schmitt, S.; Schmitz, S.; Schnoor, U.; Schoeffel, L.; Schoening, A.; Schoenrock, B. D.; Schopf, E.; Schott, M.; Schouwenberg, J. F. P.; Schovancova, J.; Schramm, S.; Schuh, N.; Schulte, A.; Schultens, M. J.; Schultz-Coulon, H.-C.; Schulz, H.; Schumacher, M.; Schumm, B. A.; Schune, Ph.; Schwartzman, A.; Schwarz, T. A.; Schweiger, H.; Schwemling, Ph.; Schwienhorst, R.; Schwindling, J.; Sciandra, A.; Sciolla, G.; Scornajenghi, M.; Scuri, F.; Scutti, F.; Searcy, J.; Seema, P.; Seidel, S. C.; Seiden, A.; Seixas, J. M.; Sekhniaidze, G.; Sekhon, K.; Sekula, S. J.; Semprini-Cesari, N.; Senkin, S.; Serfon, C.; Serin, L.; Serkin, L.; Sessa, M.; Seuster, R.; Severini, H.; Sfiligoj, T.; Sforza, F.; Sfyrla, A.; Shabalina, E.; Shaikh, N. W.; Shan, L. Y.; Shang, R.; Shank, J. T.; Shapiro, M.; Shatalov, P. B.; Shaw, K.; Shaw, S. M.; Shcherbakova, A.; Shehu, C. Y.; Shen, Y.; Sherafati, N.; Sherwood, P.; Shi, L.; Shimizu, S.; Shimmin, C. O.; Shimojima, M.; Shipsey, I. P. J.; Shirabe, S.; Shiyakova, M.; Shlomi, J.; Shmeleva, A.; Shoaleh Saadi, D.; Shochet, M. J.; Shojaii, S.; Shope, D. R.; Shrestha, S.; Shulga, E.; Shupe, M. A.; Sicho, P.; Sickles, A. M.; Sidebo, P. E.; Sideras Haddad, E.; Sidiropoulou, O.; Sidoti, A.; Siegert, F.; Sijacki, Dj.; Silva, J.; Silverstein, S. B.; Simak, V.; Simic, Lj.; Simion, S.; Simioni, E.; Simmons, B.; Simon, M.; Sinervo, P.; Sinev, N. B.; Sioli, M.; Siragusa, G.; Siral, I.; Sivoklokov, S. Yu.; Sjölin, J.; Skinner, M. B.; Skubic, P.; Slater, M.; Slavicek, T.; Slawinska, M.; Sliwa, K.; Slovak, R.; Smakhtin, V.; Smart, B. H.; Smiesko, J.; Smirnov, N.; Smirnov, S. Yu.; Smirnov, Y.; Smirnova, L. N.; Smirnova, O.; Smith, J. W.; Smith, M. N. K.; Smith, R. W.; Smizanska, M.; Smolek, K.; Snesarev, A. A.; Snyder, I. M.; Snyder, S.; Sobie, R.; Socher, F.; Soffer, A.; Søgaard, A.; Soh, D. A.; Sokhrannyi, G.; Solans Sanchez, C. A.; Solar, M.; Soldatov, E. Yu.; Soldevila, U.; Solodkov, A. A.; Soloshenko, A.; Solovyanov, O. V.; Solovyev, V.; Sommer, P.; Son, H.; Sopczak, A.; Sosa, D.; Sotiropoulou, C. L.; Soualah, R.; Soukharev, A. M.; South, D.; Sowden, B. C.; Spagnolo, S.; Spalla, M.; Spangenberg, M.; Spanò, F.; Sperlich, D.; Spettel, F.; Spieker, T. M.; Spighi, R.; Spigo, G.; Spiller, L. A.; Spousta, M.; St. Denis, R. D.; Stabile, A.; Stamen, R.; Stamm, S.; Stanecka, E.; Stanek, R. W.; Stanescu, C.; Stanitzki, M. M.; Stapf, B. S.; Stapnes, S.; Starchenko, E. A.; Stark, G. H.; Stark, J.; Stark, S. H.; Staroba, P.; Starovoitov, P.; Stärz, S.; Staszewski, R.; Steinberg, P.; Stelzer, B.; Stelzer, H. J.; Stelzer-Chilton, O.; Stenzel, H.; Stewart, G. A.; Stockton, M. C.; Stoebe, M.; Stoicea, G.; Stolte, P.; Stonjek, S.; Stradling, A. R.; Straessner, A.; Stramaglia, M. E.; Strandberg, J.; Strandberg, S.; Strauss, M.; Strizenec, P.; Ströhmer, R.; Strom, D. M.; Stroynowski, R.; Strubig, A.; Stucci, S. A.; Stugu, B.; Styles, N. A.; Su, D.; Su, J.; Suchek, S.; Sugaya, Y.; Suk, M.; Sulin, V. V.; Sultan, Dms; Sultansoy, S.; Sumida, T.; Sun, S.; Sun, X.; Suruliz, K.; Suster, C. J. E.; Sutton, M. R.; Suzuki, S.; Svatos, M.; Swiatlowski, M.; Swift, S. P.; Sykora, I.; Sykora, T.; Ta, D.; Tackmann, K.; Taenzer, J.; Taffard, A.; Tafirout, R.; Tahirovic, E.; Taiblum, N.; Takai, H.; Takashima, R.; Takasugi, E. H.; Takeshita, T.; Takubo, Y.; Talby, M.; Talyshev, A. A.; Tanaka, J.; Tanaka, M.; Tanaka, R.; Tanaka, S.; Tanioka, R.; Tannenwald, B. B.; Tapia Araya, S.; Tapprogge, S.; Tarem, S.; Tartarelli, G. F.; Tas, P.; Tasevsky, M.; Tashiro, T.; Tassi, E.; Tavares Delgado, A.; Tayalati, Y.; Taylor, A. C.; Taylor, A. J.; Taylor, G. N.; Taylor, P. T. E.; Taylor, W.; Teixeira-Dias, P.; Temple, D.; Ten Kate, H.; Teng, P. K.; Teoh, J. J.; Tepel, F.; Terada, S.; Terashi, K.; Terron, J.; Terzo, S.; Testa, M.; Teuscher, R. J.; Theveneaux-Pelzer, T.; Thiele, F.; Thomas, J. P.; Thomas-Wilsker, J.; Thompson, P. D.; Thompson, A. S.; Thomsen, L. A.; Thomson, E.; Tibbetts, M. J.; Ticse Torres, R. E.; Tikhomirov, V. O.; Tikhonov, Yu. A.; Timoshenko, S.; Tipton, P.; Tisserant, S.; Todome, K.; Todorova-Nova, S.; Todt, S.; Tojo, J.; Tokár, S.; Tokushuku, K.; Tolley, E.; Tomlinson, L.; Tomoto, M.; Tompkins, L.; Toms, K.; Tong, B.; Tornambe, P.; Torrence, E.; Torres, H.; Torró Pastor, E.; Toth, J.; Touchard, F.; Tovey, D. R.; Treado, C. J.; Trefzger, T.; Tresoldi, F.; Tricoli, A.; Trigger, I. M.; Trincaz-Duvoid, S.; Tripiana, M. F.; Trischuk, W.; Trocmé, B.; Trofymov, A.; Troncon, C.; Trottier-McDonald, M.; Trovatelli, M.; Truong, L.; Trzebinski, M.; Trzupek, A.; Tsang, K. W.; Tseng, J. C.-L.; Tsiareshka, P. V.; Tsipolitis, G.; Tsirintanis, N.; Tsiskaridze, S.; Tsiskaridze, V.; Tskhadadze, E. G.; Tsui, K. M.; Tsukerman, I. I.; Tsulaia, V.; Tsuno, S.; Tsybychev, D.; Tu, Y.; Tudorache, A.; Tudorache, V.; Tulbure, T. T.; Tuna, A. N.; Tupputi, S. A.; Turchikhin, S.; Turgeman, D.; Turk Cakir, I.; Turra, R.; Tuts, P. M.; Ucchielli, G.; Ueda, I.; Ughetto, M.; Ukegawa, F.; Unal, G.; Undrus, A.; Unel, G.; Ungaro, F. C.; Unno, Y.; Unverdorben, C.; Urban, J.; Urquijo, P.; Urrejola, P.; Usai, G.; Usui, J.; Vacavant, L.; Vacek, V.; Vachon, B.; Vadla, K. O. H.; Vaidya, A.; Valderanis, C.; Valdes Santurio, E.; Valente, M.; Valentinetti, S.; Valero, A.; Valéry, L.; Valkar, S.; Vallier, A.; Valls Ferrer, J. A.; van den Wollenberg, W.; van der Graaf, H.; van Gemmeren, P.; van Nieuwkoop, J.; van Vulpen, I.; van Woerden, M. C.; Vanadia, M.; Vandelli, W.; Vaniachine, A.; Vankov, P.; Vardanyan, G.; Vari, R.; Varnes, E. W.; Varni, C.; Varol, T.; Varouchas, D.; Vartapetian, A.; Varvell, K. E.; Vasquez, J. G.; Vasquez, G. A.; Vazeille, F.; Vazquez Schroeder, T.; Veatch, J.; Veeraraghavan, V.; Veloce, L. M.; Veloso, F.; Veneziano, S.; Ventura, A.; Venturi, M.; Venturi, N.; Venturini, A.; Vercesi, V.; Verducci, M.; Verkerke, W.; Vermeulen, A. T.; Vermeulen, J. C.; Vetterli, M. C.; Viaux Maira, N.; Viazlo, O.; Vichou, I.; Vickey, T.; Vickey Boeriu, O. E.; Viehhauser, G. H. A.; Viel, S.; Vigani, L.; Villa, M.; Villaplana Perez, M.; Vilucchi, E.; Vincter, M. G.; Vinogradov, V. B.; Vishwakarma, A.; Vittori, C.; Vivarelli, I.; Vlachos, S.; Vogel, M.; Vokac, P.; Volpi, G.; von der Schmitt, H.; von Toerne, E.; Vorobel, V.; Vorobev, K.; Vos, M.; Voss, R.; Vossebeld, J. H.; Vranjes, N.; Vranjes Milosavljevic, M.; Vrba, V.; Vreeswijk, M.; Vuillermet, R.; Vukotic, I.; Wagner, P.; Wagner, W.; Wagner-Kuhr, J.; Wahlberg, H.; Wahrmund, S.; Walder, J.; Walker, R.; Walkowiak, W.; Wallangen, V.; Wang, C.; Wang, C.; Wang, F.; Wang, H.; Wang, H.; Wang, J.; Wang, J.; Wang, Q.; Wang, R.; Wang, S. M.; Wang, T.; Wang, W.; Wang, W.; Wang, Z.; Wanotayaroj, C.; Warburton, A.; Ward, C. P.; Wardrope, D. R.; Washbrook, A.; Watkins, P. M.; Watson, A. T.; Watson, M. F.; Watts, G.; Watts, S.; Waugh, B. M.; Webb, A. F.; Webb, S.; Weber, M. S.; Weber, S. W.; Weber, S. A.; Webster, J. S.; Weidberg, A. R.; Weinert, B.; Weingarten, J.; Weirich, M.; Weiser, C.; Weits, H.; Wells, P. S.; Wenaus, T.; Wengler, T.; Wenig, S.; Wermes, N.; Werner, M. D.; Werner, P.; Wessels, M.; Weston, T. D.; Whalen, K.; Whallon, N. L.; Wharton, A. M.; White, A. S.; White, A.; White, M. J.; White, R.; Whiteson, D.; Whitmore, B. W.; Wickens, F. J.; Wiedenmann, W.; Wielers, M.; Wiglesworth, C.; Wiik-Fuchs, L. A. M.; Wildauer, A.; Wilk, F.; Wilkens, H. G.; Williams, H. H.; Williams, S.; Willis, C.; Willocq, S.; Wilson, J. A.; Wingerter-Seez, I.; Winkels, E.; Winklmeier, F.; Winston, O. J.; Winter, B. T.; Wittgen, M.; Wobisch, M.; Wolf, T. M. H.; Wolff, R.; Wolter, M. W.; Wolters, H.; Wong, V. W. S.; Worm, S. D.; Wosiek, B. K.; Wotschack, J.; Wozniak, K. W.; Wu, M.; Wu, S. L.; Wu, X.; Wu, Y.; Wyatt, T. R.; Wynne, B. M.; Xella, S.; Xi, Z.; Xia, L.; Xu, D.; Xu, L.; Xu, T.; Yabsley, B.; Yacoob, S.; Yamaguchi, D.; Yamaguchi, Y.; Yamamoto, A.; Yamamoto, S.; Yamanaka, T.; Yamane, F.; Yamatani, M.; Yamazaki, Y.; Yan, Z.; Yang, H.; Yang, H.; Yang, Y.; Yang, Z.; Yao, W.-M.; Yap, Y. C.; Yasu, Y.; Yatsenko, E.; Yau Wong, K. H.; Ye, J.; Ye, S.; Yeletskikh, I.; Yigitbasi, E.; Yildirim, E.; Yorita, K.; Yoshihara, K.; Young, C.; Young, C. J. S.; Yu, J.; Yu, J.; Yuen, S. P. Y.; Yusuff, I.; Zabinski, B.; Zacharis, G.; Zaidan, R.; Zaitsev, A. M.; Zakharchuk, N.; Zalieckas, J.; Zaman, A.; Zambito, S.; Zanzi, D.; Zeitnitz, C.; Zemaityte, G.; Zemla, A.; Zeng, J. C.; Zeng, Q.; Zenin, O.; Ženiš, T.; Zerwas, D.; Zhang, D.; Zhang, F.; Zhang, G.; Zhang, H.; Zhang, J.; Zhang, L.; Zhang, L.; Zhang, M.; Zhang, P.; Zhang, R.; Zhang, R.; Zhang, X.; Zhang, Y.; Zhang, Z.; Zhao, X.; Zhao, Y.; Zhao, Z.; Zhemchugov, A.; Zhou, B.; Zhou, C.; Zhou, L.; Zhou, M.; Zhou, M.; Zhou, N.; Zhu, C. G.; Zhu, H.; Zhu, J.; Zhu, Y.; Zhuang, X.; Zhukov, K.; Zibell, A.; Zieminska, D.; Zimine, N. I.; Zimmermann, C.; Zimmermann, S.; Zinonos, Z.; Zinser, M.; Ziolkowski, M.; Živković, L.; Zobernig, G.; Zoccoli, A.; Zou, R.; Zur Nedden, M.; Zwalinski, L.; Atlas Collaboration

2017-11-01

The analysis of the momentum difference between charged hadrons in high-energy proton-proton collisions is performed in order to study coherent particle production. The observed correlation pattern agrees with a model of a helical QCD string fragmenting into a chain of ground-state hadrons. A threshold momentum difference in the production of adjacent pairs of charged hadrons is observed, in agreement with model predictions. The presence of low-mass hadron chains also explains the emergence of charge-combination-dependent two-particle correlations commonly attributed to Bose-Einstein interference. The data sample consists of 190 μ b-1 of minimum-bias events collected with proton-proton collisions at a center-of-mass energy √{s }=7 TeV in the early low-luminosity data taking with the ATLAS detector at the LHC.

NMR (Nuclear Magnetic Resonance) of solid biopolymers

NASA Technical Reports Server (NTRS)

Andrew, E. R.

1983-01-01

It has been possible through the study of proton relaxation in solid proteins and related molecules to identify and characterize the following molecular motions which contribute to relaxation: (1) methyl group reorientation; (2) segmental motion; (3) side chain motion; (4) proline ring puckering; and (5) water molecule reorientation.

pODI at WIYN: Instrument Performance and Upgrade Path

NASA Astrophysics Data System (ADS)

Harbeck, Daniel R.; Boroson, T. A.; Rajagopal, J.; ODI Team; PPA Team

2013-06-01

A preliminary version of the WIYN One Degree Imager (ODI) has been commissioned throughout the semester 2012B, and has been put into scientific operation February 2013. ODI was devised to take advantage of the excellent image quality and wide field of view of the WIYN 3.5m telescope. To further improve delivered image quality, ODI uses Orthogonal Transfer Array (OTA) detectors that have the capability to electronically correct for image motion in the detectors during an exposure. The partial ODI (pODI) populates 13 out of the 64 OTAs in the focal plane, and coherent image motion correction is enabled. The 13 OTAs are configured as a 24 x 24 arcminute central “science field”, plus 4 outer OTAs, allowing the sampling of all radii within the one square degree field. Guide star signals from the outer detectors are either directed to the telescope only, or additionally used to calculate a global, coherent shift correction that is sent to the OTAs. The performance of pODI is excellent. Image quality is site seeing limited, and, on good seeing nights, we can achieve images around 0.4 arcsec FWHM over the entire field. We are still in the process of characterizing the gains from active image motion correction, but the detectors perform well in this mode. Data are immediately transferred to an archive at Indiana University, where they are pipeline-processed to remove instrumental signature. In this poster we summarize the current performance of the pODI instrument and outline a path towards a future, expanded version of ODI with a 6x6 central detector array, or a field of view of 48 x 48 arcminutes.

The NOvA simulation chain

NASA Astrophysics Data System (ADS)

Aurisano, A.; Backhouse, C.; Hatcher, R.; Mayer, N.; Musser, J.; Patterson, R.; Schroeter, R.; Sousa, A.

2015-12-01

The NOνA experiment is a two-detector, long-baseline neutrino experiment operating in the recently upgraded NuMI muon neutrino beam. Simulating neutrino interactions and backgrounds requires many steps including: the simulation of the neutrino beam flux using FLUKA and the FLUGG interface; cosmic ray generation using CRY; neutrino interaction modeling using GENIE; and a simulation of the energy deposited in the detector using GEANT4. To shorten generation time, the modeling of detector-specific aspects, such as photon transport, detector and electronics noise, and readout electronics, employs custom, parameterized simulation applications. We will describe the NOνA simulation chain, and present details on the techniques used in modeling photon transport near the ends of cells, and in developing a novel data-driven noise simulation. Due to the high intensity of the NuMI beam, the Near Detector samples a high rate of muons originating in the surrounding rock. In addition, due to its location on the surface at Ash River, MN, the Far Detector collects a large rate (˜ 140 kHz) of cosmic muons. We will discuss the methods used in NOνA for overlaying rock muons and cosmic ray muons with simulated neutrino interactions and show how realistically the final simulation reproduces the preliminary NOνA data.

The NO vA simulation chain

DOE PAGES

Aurisano, A.; Backhouse, C.; Hatcher, R.; ...

2015-12-23

The NO vA experiment is a two-detector, long-baseline neutrino experiment operating in the recently upgraded NuMI muon neutrino beam. Simulating neutrino interactions and backgrounds requires many steps including: the simulation of the neutrino beam flux using FLUKA and the FLUGG interface, cosmic ray generation using CRY, neutrino interaction modeling using GENIE, and a simulation of the energy deposited in the detector using GEANT4. To shorten generation time, the modeling of detector-specific aspects, such as photon transport, detector and electronics noise, and readout electronics, employs custom, parameterized simulation applications. We will describe the NO vA simulation chain, and present details onmore » the techniques used in modeling photon transport near the ends of cells, and in developing a novel data-driven noise simulation. Due to the high intensity of the NuMI beam, the Near Detector samples a high rate of muons originating in the surrounding rock. In addition, due to its location on the surface at Ash River, MN, the Far Detector collects a large rate ((˜) 140 kHz) of cosmic muons. Furthermore, we will discuss the methods used in NO vA for overlaying rock muons and cosmic ray muons with simulated neutrino interactions and show how realistically the final simulation reproduces the preliminary NO vA data.« less

Deuteration as a Means to Tune Crystallinity of Conducting Polymers

DOE PAGES

Jakowski, Jacek; Huang, Jingsong; Garashchuk, Sophya; ...

2017-08-25

The effects of deuterium isotope substitution on conjugated polymer chain stacking of poly(3-hexylthiophene) is studied in this paper experimentally by X-ray diffraction (XRD) in combination with gel permeation chromatography and theoretically using density functional theory and quantum molecular dynamics. For four P3HT materials with different levels of deuteration (pristine, main-chain deuterated, side-chain deuterated, and fully deuterated), the XRD measurements show that main-chain thiophene deuteration significantly reduces crystallinity, regardless of the side-chain deuteration. The reduction of crystallinity due to the main-chain deuteration is a quantum nuclear effect resulting from a static zero-point vibrational energy combined with a dynamic correlation of themore » dipole fluctuations. The quantum molecular dynamics simulations confirm the interchain correlation of the proton–proton and deuteron–deuteron motions but not of the proton–deuteron motion. Thus and finally, isotopic purity is an important factor affecting stability and properties of conjugated polymer crystals, which should be considered in the design of electronic and spintronic devices.« less

Deuteration as a Means to Tune Crystallinity of Conducting Polymers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jakowski, Jacek; Huang, Jingsong; Garashchuk, Sophya

The effects of deuterium isotope substitution on conjugated polymer chain stacking of poly(3-hexylthiophene) is studied in this paper experimentally by X-ray diffraction (XRD) in combination with gel permeation chromatography and theoretically using density functional theory and quantum molecular dynamics. For four P3HT materials with different levels of deuteration (pristine, main-chain deuterated, side-chain deuterated, and fully deuterated), the XRD measurements show that main-chain thiophene deuteration significantly reduces crystallinity, regardless of the side-chain deuteration. The reduction of crystallinity due to the main-chain deuteration is a quantum nuclear effect resulting from a static zero-point vibrational energy combined with a dynamic correlation of themore » dipole fluctuations. The quantum molecular dynamics simulations confirm the interchain correlation of the proton–proton and deuteron–deuteron motions but not of the proton–deuteron motion. Thus and finally, isotopic purity is an important factor affecting stability and properties of conjugated polymer crystals, which should be considered in the design of electronic and spintronic devices.« less

Brownian dynamics of a protein-polymer chain complex in a solid-state nanopore

NASA Astrophysics Data System (ADS)

Wells, Craig C.; Melnikov, Dmitriy V.; Gracheva, Maria E.

2017-08-01

We study the movement of a polymer attached to a large protein inside a nanopore in a thin silicon dioxide membrane submerged in an electrolyte solution. We use Brownian dynamics to describe the motion of a negatively charged polymer chain of varying lengths attached to a neutral protein modeled as a spherical bead with a radius larger than that of the nanopore, allowing the chain to thread the nanopore but preventing it from translocating. The motion of the protein-polymer complex within the pore is also compared to that of a freely translocating polymer. Our results show that the free polymer's standard deviations in the direction normal to the pore axis is greater than that of the protein-polymer complex. We find that restrictions imposed by the protein, bias, and neighboring chain segments aid in controlling the position of the chain in the pore. Understanding the behavior of the protein-polymer chain complex may lead to methods that improve molecule identification by increasing the resolution of ionic current measurements.

Brownian dynamics of a protein-polymer chain complex in a solid-state nanopore.

PubMed

Wells, Craig C; Melnikov, Dmitriy V; Gracheva, Maria E

2017-08-07

We study the movement of a polymer attached to a large protein inside a nanopore in a thin silicon dioxide membrane submerged in an electrolyte solution. We use Brownian dynamics to describe the motion of a negatively charged polymer chain of varying lengths attached to a neutral protein modeled as a spherical bead with a radius larger than that of the nanopore, allowing the chain to thread the nanopore but preventing it from translocating. The motion of the protein-polymer complex within the pore is also compared to that of a freely translocating polymer. Our results show that the free polymer's standard deviations in the direction normal to the pore axis is greater than that of the protein-polymer complex. We find that restrictions imposed by the protein, bias, and neighboring chain segments aid in controlling the position of the chain in the pore. Understanding the behavior of the protein-polymer chain complex may lead to methods that improve molecule identification by increasing the resolution of ionic current measurements.

Hidden regularity and universal classification of fast side chain motions in proteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rajeshwar, Rajitha; Smith, Jeremy C.; Krishnam, Marimuthu

Proteins display characteristic dynamical signatures that appear to be universal across all proteins regardless of topology and size. Here, we systematically characterize the universal features of fast side chain motions in proteins by examining the conformational energy surfaces of individual residues obtained using enhanced sampling molecular dynamics simulation (618 free energy surfaces obtained from 0.94 s MD simulation). The side chain conformational free energy surfaces obtained using the adaptive biasing force (ABF) method for a set of eight proteins with different molecular weights and secondary structures are used to determine the methyl axial NMR order parameters (O axis 2), populationsmore » of side chain rotamer states (ρ), conformational entropies (S conf), probability fluxes, and activation energies for side chain inter-rotameric transitions. The free energy barriers separating side chain rotamer states range from 0.3 to 12 kcal/mol in all proteins and follow a trimodal distribution with an intense peak at ~5 kcal/mol and two shoulders at ~3 and ~7.5 kcal/mol, indicating that some barriers are more favored than others by proteins to maintain a balance between their conformational stability and flexibility. The origin and the influences of the trimodal barrier distribution on the distribution of O axis 2 and the side chain conformational entropy are discussed. A hierarchical grading of rotamer states based on the conformational free energy barriers, entropy, and probability flux reveals three distinct classes of side chains in proteins. A unique nonlinear correlation is established between O axis 2 and the side chain rotamer populations (ρ). In conclusion, the apparent universality in O axis 2 versus correlation, trimodal barrier distribution, and distinct characteristics of three classes of side chains observed among all proteins indicates a hidden regularity (or commonality) in the dynamical heterogeneity of fast side chain motions in proteins.« less

Microfabricated electrochemiluminescence cell for chemical reaction detection

DOEpatents

Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.

2003-01-01

A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.

Hamiltonian Markov Chain Monte Carlo Methods for the CUORE Neutrinoless Double Beta Decay Sensitivity

NASA Astrophysics Data System (ADS)

Graham, Eleanor; Cuore Collaboration

2017-09-01

The CUORE experiment is a large-scale bolometric detector seeking to observe the never-before-seen process of neutrinoless double beta decay. Predictions for CUORE's sensitivity to neutrinoless double beta decay allow for an understanding of the half-life ranges that the detector can probe, and also to evaluate the relative importance of different detector parameters. Currently, CUORE uses a Bayesian analysis based in BAT, which uses Metropolis-Hastings Markov Chain Monte Carlo, for its sensitivity studies. My work evaluates the viability and potential improvements of switching the Bayesian analysis to Hamiltonian Monte Carlo, realized through the program Stan and its Morpho interface. I demonstrate that the BAT study can be successfully recreated in Stan, and perform a detailed comparison between the results and computation times of the two methods.

Thallium halide radiation detectors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ijaz-ur-Rahman; Hofstadter, R.

1984-03-15

During a series of experiments on crystal conduction counters performed at Stanford University on thallium halide crystals, we have observed motion of both hole and electron carriers in a TlBr crystal. At a temperature near -90 /sup 0/C the hole motion produces larger pulses than electron motion. We have studied the behavior of TlBr, TlCl, and KRS-5 (40 mol % TlBr + 60 mol % TlI) crystals and examined them as possible crystal conduction detectors of ..cap alpha.. particles and ..gamma.. rays. TlBr appears to be a promising candidate for applications to nuclear physics and high-energy ..gamma..-ray physics. Modules ofmore » TlBr in ''crystal-ball'' geometry may lead to new detection possibilities. At -20 /sup 0/C space-charge accumulation in TlBr decreases to such an extent that operation at this temperature seems possible with moderate electrical gradients. In the long-neglected field of crystal conduction counters, we have potentially removed the space-charge limitation in TlBr and, allowing for both hole and electron motion, raised the possibility for spectroscopic performance of this material for ..gamma..-ray studies.« less

A New Absolute Plate Motion Model for Africa

NASA Astrophysics Data System (ADS)

Maher, S. M.; Wessel, P.; Müller, D.; Harada, Y.

2013-12-01

The India-Eurasia collision, a change in relative plate motion between Australia and Antarctica, and the coeval ages of the Hawaiian Emperor Bend (HEB) and Louisville Bend of ~Chron 22-21 all provide convincing evidence of a global tectonic plate reorganization at ~50 Ma. Yet if it were a truly global event, then there should be a contemporaneous change in Africa absolute plate motion (APM) reflected by physical evidence somewhere on the Africa plate. This evidence might be visible in the Reunion-Mascarene bend, which exhibits many HEB-like features such as a large angular change close to ~50 Ma. Recently, the Reunion hotpot trail has been interpreted as a continental feature with incidental hotspot volcanism. Here we propose the alternative hypothesis that the northern portion of the chain between Saya de Malha and the Seychelles (Mascarene Plateau) formed as the Reunion hotspot was situated on the Carlsberg Ridge, contemporaneously forming the Chagos-Laccadive Ridge on the India plate. We have created a 4-stage model that explores how a simple APM model fitting the Mascarene Plateau can also satisfy the age progressions and geometry of other hotspot trails on the Africa plate. This type of model could explain the apparent bifurcation of the Tristan hotspot chain, the age reversals seen along the Walvis Ridge and the diffuse nature of the St. Helena chain. To test this hypothesis we have made a new African APM model that goes back to ~80 Ma using a modified version of the Hybrid Polygonal Finite Rotation Method. This method uses seamount chains and their associated hotspots as geometric constraints for the model, and seamount age dates to determine its motion through time. The positions of the hotspots can be moved to get the best fit for the model and to explore the possibility that the ~50 Ma bend in the Reunion-Mascarene chain reflects Africa plate motion. We will examine how well this model can predict the key features reflecting Africa plate motion and contrast its predictions with other proposed models.

Modelling and Characterisation of Detection Models in WAMI for Handling Negative Information

DTIC Science & Technology

2014-02-01

behaviour of the multi-stage detectors used in LoFT. This model is then used in a Probabilistic Hypothesis Density Filter (PHD). Unlike most multitarget...Therefore, we decided to use machine learning techniques which could model — and pre- dict — the behaviour of the detectors in LoFT. Because we are using...on feature detectors [8], motion models [13] and descriptor and template adaptation [9]. 2.3.2 State Model The state space of LoFT is defined in 2D

The solid state detector technology for picosecond laser ranging

NASA Technical Reports Server (NTRS)

Prochazka, Ivan

1993-01-01

We developed an all solid state laser ranging detector technology, which makes the goal of millimeter accuracy achievable. Our design and construction philosophy is to combine the techniques of single photon ranging, ultrashort laser pulses, and fast fixed threshold discrimination while avoiding any analog signal processing within the laser ranging chain. The all solid state laser ranging detector package consists of the START detector and the STOP solid state photon counting module. Both the detectors are working in an optically triggered avalanche switching regime. The optical signal is triggering an avalanche current buildup which results in the generation of a uniform, fast risetime output pulse.

Gold-coated copper cone detector as a new standard detector for F2 laser radiation at 157 nm.

PubMed

Kück, Stefan; Brandt, Friedhelm; Taddeo, Mario

2005-04-20

A new standard detector for high-accuracy measurements of F2 laser radiation at 157 nm is presented. This gold-coated copper cone detector permits the measurement of average powers up to 2 W with an uncertainty of approximately 1%. To the best of our knowledge, this is the first highly accurate standard detector for F2 laser radiation for this power level. It is fully characterized according to Guide to the Expression of Uncertainty in Measurement of the International Organization for Standardization and is connected to the calibration chain for laser radiation established by the German National Metrology Institute.

Study of ordered hadron chains with the ATLAS detector

DOE PAGES

Aaboud, M.; Aad, G.; Abbott, B.; ...

2017-11-29

The analysis of the momentum difference between charged hadrons in high-energy proton-proton collisions is performed in order to study coherent particle production. The observed correlation pattern agrees with a model of a helical QCD string fragmenting into a chain of ground-state hadrons. A threshold momentum difference in the production of adjacent pairs of charged hadrons is observed, in agreement with model predictions. The presence of low-mass hadron chains also explains the emergence of charge-combination-dependent two-particle correlations commonly attributed to Bose-Einstein interference. Here, the data sample consists of 190 μb –1 of minimum-bias events collected with proton-proton collisions at a center-of-massmore » energy √s=7 TeV in the early low-luminosity data taking with the ATLAS detector at the LHC.« less

Spatial filtering precedes motion detection.

PubMed

Morgan, M J

1992-01-23

When we perceive motion on a television or cinema screen, there must be some process that allows us to track moving objects over time: if not, the result would be a conflicting mass of motion signals in all directions. A possible mechanism, suggested by studies of motion displacement in spatially random patterns, is that low-level motion detectors have a limited spatial range, which ensures that they tend to be stimulated over time by the same object. This model predicts that the direction of displacement of random patterns cannot be detected reliably above a critical absolute displacement value (Dmax) that is independent of the size or density of elements in the display. It has been inferred that Dmax is a measure of the size of motion detectors in the visual pathway. Other studies, however, have shown that Dmax increases with element size, in which case the most likely interpretation is that Dmax depends on the probability of false matches between pattern elements following a displacement. These conflicting accounts are reconciled here by showing that Dmax is indeed determined by the spacing between the elements in the pattern, but only after fine detail has been removed by a physiological prefiltering stage: the filter required to explain the data has a similar size to the receptive field of neurons in the primate magnocellular pathway. The model explains why Dmax can be increased by removing high spatial frequencies from random patterns, and simplifies our view of early motion detection.

Attention and apparent motion.

PubMed

Horowitz, T; Treisman, A

1994-01-01

Two dissociations between short- and long-range motion in visual search are reported. Previous research has shown parallel processing for short-range motion and apparently serial processing for long-range motion. This finding has been replicated and it has also been found that search for short-range targets can be impaired both by using bicontrast stimuli, and by prior adaptation to the target direction of motion. Neither factor impaired search in long-range motion displays. Adaptation actually facilitated search with long-range displays, which is attributed to response-level effects. A feature-integration account of apparent motion is proposed. In this theory, short-range motion depends on specialized motion feature detectors operating in parallel across the display, but subject to selective adaptation, whereas attention is needed to link successive elements when they appear at greater separations, or across opposite contrasts.

Automatic 3D motion estimation of left ventricle from C-arm rotational angiocardiography using a prior motion model and learning based boundary detector.

PubMed

Chen, Mingqing; Zheng, Yefeng; Wang, Yang; Mueller, Kerstin; Lauritsch, Guenter

2013-01-01

Compared to pre-operative imaging modalities, it is more convenient to estimate the current cardiac physiological status from C-arm angiocardiography since C-arm is a widely used intra-operative imaging modality to guide many cardiac interventions. The 3D shape and motion of the left ventricle (LV) estimated from rotational angiocardiography provide important cardiac function measurements, e.g., ejection fraction and myocardium motion dyssynchrony. However, automatic estimation of the 3D LV motion is difficult since all anatomical structures overlap on the 2D X-ray projections and the nearby confounding strong image boundaries (e.g., pericardium) often cause ambiguities to LV endocardium boundary detection. In this paper, a new framework is proposed to overcome the aforementioned difficulties: (1) A new learning-based boundary detector is developed by training a boosting boundary classifier combined with the principal component analysis of a local image patch; (2) The prior LV motion model is learned from a set of dynamic cardiac computed tomography (CT) sequences to provide a good initial estimate of the 3D LV shape of different cardiac phases; (3) The 3D motion trajectory is learned for each mesh point; (4) All these components are integrated into a multi-surface graph optimization method to extract the globally coherent motion. The method is tested on seven patient scans, showing significant improvement on the ambiguous boundary cases with a detection accuracy of 2.87 +/- 1.00 mm on LV endocardium boundary delineation in the 2D projections.

Motion as a source of environmental information: a fresh view on biological motion computation by insect brains

PubMed Central

Egelhaaf, Martin; Kern, Roland; Lindemann, Jens Peter

2014-01-01

Despite their miniature brains insects, such as flies, bees and wasps, are able to navigate by highly erobatic flight maneuvers in cluttered environments. They rely on spatial information that is contained in the retinal motion patterns induced on the eyes while moving around (“optic flow”) to accomplish their extraordinary performance. Thereby, they employ an active flight and gaze strategy that separates rapid saccade-like turns from translatory flight phases where the gaze direction is kept largely constant. This behavioral strategy facilitates the processing of environmental information, because information about the distance of the animal to objects in the environment is only contained in the optic flow generated by translatory motion. However, motion detectors as are widespread in biological systems do not represent veridically the velocity of the optic flow vectors, but also reflect textural information about the environment. This characteristic has often been regarded as a limitation of a biological motion detection mechanism. In contrast, we conclude from analyses challenging insect movement detectors with image flow as generated during translatory locomotion through cluttered natural environments that this mechanism represents the contours of nearby objects. Contrast borders are a main carrier of functionally relevant object information in artificial and natural sceneries. The motion detection system thus segregates in a computationally parsimonious way the environment into behaviorally relevant nearby objects and—in many behavioral contexts—less relevant distant structures. Hence, by making use of an active flight and gaze strategy, insects are capable of performing extraordinarily well even with a computationally simple motion detection mechanism. PMID:25389392

Motion as a source of environmental information: a fresh view on biological motion computation by insect brains.

PubMed

Egelhaaf, Martin; Kern, Roland; Lindemann, Jens Peter

2014-01-01

Despite their miniature brains insects, such as flies, bees and wasps, are able to navigate by highly erobatic flight maneuvers in cluttered environments. They rely on spatial information that is contained in the retinal motion patterns induced on the eyes while moving around ("optic flow") to accomplish their extraordinary performance. Thereby, they employ an active flight and gaze strategy that separates rapid saccade-like turns from translatory flight phases where the gaze direction is kept largely constant. This behavioral strategy facilitates the processing of environmental information, because information about the distance of the animal to objects in the environment is only contained in the optic flow generated by translatory motion. However, motion detectors as are widespread in biological systems do not represent veridically the velocity of the optic flow vectors, but also reflect textural information about the environment. This characteristic has often been regarded as a limitation of a biological motion detection mechanism. In contrast, we conclude from analyses challenging insect movement detectors with image flow as generated during translatory locomotion through cluttered natural environments that this mechanism represents the contours of nearby objects. Contrast borders are a main carrier of functionally relevant object information in artificial and natural sceneries. The motion detection system thus segregates in a computationally parsimonious way the environment into behaviorally relevant nearby objects and-in many behavioral contexts-less relevant distant structures. Hence, by making use of an active flight and gaze strategy, insects are capable of performing extraordinarily well even with a computationally simple motion detection mechanism.

Oil well pump drive

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sanford, G.A.

1980-02-12

An oil well pump drive is disclosed including a drive unit that is hydraulically actuated by a double-acting hydraulic cylinder to reciprocate vertically. An endless chain is entrained over vertically spaced sprockets carried by the unit, with one flight of the chain anchored against vertical movement and the other flight is secured to the pump polish rod so that the vertical motion imparted to the polish rod is double that hydraulically imparted to the drive unit. The polish rod load on the chain is opposed by a counterweight connected thereto by a chain extending over an elevated pulley. The outputmore » of the hydraulic pump supplying the hydraulic cylinder is cam controlled so that the motion of the drive unit is smoothly decelerated and accelerated as the unit approaches and moves from the upper and lower limits of its movement.« less

Disordering Chain Motions in Fluoropolymers

NASA Astrophysics Data System (ADS)

Holt, David B.; Farmer, Barry L.

1998-03-01

Rotational and conformational disorder play important roles in the solid state phases of fluoropolymers such as polytetrafluoro- ethylene (PTFE). Modeling disordering processes and transitions which occur in fluoropolymers has been hampered due to a lack of force field parameters that adequately describe both the intra- and intermolecular characteristics (conformations and distances) of these polymers in the solid state. A force field has been developed which overcomes these inadequacies and has been utilized in molecular dynamics simulations on a system of PTFE oligomers to investigate two of the primary disordering processes that occur in the solid phases: rotations of chains about their helical axes and the formation and subsequent behavior of helix reversals. The simulation results confirm helix reversal activity at low temperatures and demonstrate correlations between chain segment rotations or librations and helix reversal motion. A mechanism for large scale chain segment rotations is proposed.

Model-based extended quaternion Kalman filter to inertial orientation tracking of arbitrary kinematic chains.

PubMed

Szczęsna, Agnieszka; Pruszowski, Przemysław

2016-01-01

Inertial orientation tracking is still an area of active research, especially in the context of out-door, real-time, human motion capture. Existing systems either propose loosely coupled tracking approaches where each segment is considered independently, taking the resulting drawbacks into account, or tightly coupled solutions that are limited to a fixed chain with few segments. Such solutions have no flexibility to change the skeleton structure, are dedicated to a specific set of joints, and have high computational complexity. This paper describes the proposal of a new model-based extended quaternion Kalman filter that allows for estimation of orientation based on outputs from the inertial measurements unit sensors. The filter considers interdependencies resulting from the construction of the kinematic chain so that the orientation estimation is more accurate. The proposed solution is a universal filter that does not predetermine the degree of freedom at the connections between segments of the model. To validation the motion of 3-segments single link pendulum captured by optical motion capture system is used. The next step in the research will be to use this method for inertial motion capture with a human skeleton model.

An optical transduction chain for the AURIGA detector

NASA Astrophysics Data System (ADS)

Conti, L.; Marin, F.; de Rosa, M.; Prodi, G. A.; Taffarello, L.; Zendri, J. P.; Cerdonio, M.; Vitale, S.

2000-06-01

We describe the principle of operation of an opto-mechanical readout for resonant mass gravitational wave detectors; with such a device the AURIGA detector is expected to reach a sensitivity at the level of Shh=10-22/Hz over a bandwidth of about 40Hz. Recent developments in the implementation of this transduction chain are also reported. In particular we achieve quantum limited laser power noise in the frequency range of 200Hz around the bar fundamental frequency (about 1kHz) by means of active stabilization. We also set up a reference cavity of finesse 40000 with optically contacted mirrors on a 0.2m long Zerodur spacer. The cavity can be heated from room temperature to about 100 °C and temperature stabilized with fluctuations within 1mK over a period of several days. The cavity is under vacuum and isolated from mechanical disturbancies by means of a double stage cantilever system. .

Large format array controller (aLFA-C): tests and characterisation at ESA

NASA Astrophysics Data System (ADS)

Lemmel, Frédéric; ter Haar, Jörg; van der Biezen, John; Duvet, Ludovic; Nelms, Nick; Blommaert, Sander; Butler, Bart; van der Luijt, Cornelis; Heijnen, Jerko; Smit, Hans; Visser, Ivo

2016-08-01

For future near infrared astronomy missions, ESA is developing a complete detection and conversion chain (photon to SpaceWire chain system): Large Format Array (aLFA-N) based on MCT type detectors. aLFA-C (Astronomy Large Format Array Controller): a versatile cryogenic detector controller. An aLFA-C prototype was developed by Caeleste (Belgium) under ESA contract (400106260400). To validate independently the performances of the aLFA-C prototype and consolidate the definition of the follow-on activity, a dedicated test bench has been designed and developed in ESTEC/ESA within the Payload Technology Validation group. This paper presents the test setup and the performance validation of the first prototype of this controller at room and cryogenic temperature. Test setup and software needed to test the HAWAII-2RG and aLFA-N detectors with the aLFA-C prototype at cryogenic temperature will be also presented.

Linear landmark extraction in SAR images with application to augmented integrity aero-navigation: an overview to a novel processing chain

NASA Astrophysics Data System (ADS)

Fabbrini, L.; Messina, M.; Greco, M.; Pinelli, G.

2011-10-01

In the context of augmented integrity Inertial Navigation System (INS), recent technological developments have been focusing on landmark extraction from high-resolution synthetic aperture radar (SAR) images in order to retrieve aircraft position and attitude. The article puts forward a processing chain that can automatically detect linear landmarks on highresolution synthetic aperture radar (SAR) images and can be successfully exploited also in the context of augmented integrity INS. The processing chain uses constant false alarm rate (CFAR) edge detectors as the first step of the whole processing procedure. Our studies confirm that the ratio of averages (RoA) edge detector detects object boundaries more effectively than Student T-test and Wilcoxon-Mann-Whitney (WMW) test. Nevertheless, all these statistical edge detectors are sensitive to violation of the assumptions which underlie their theory. In addition to presenting a solution to the previous problem, we put forward a new post-processing algorithm useful to remove the main false alarms, to select the most probable edge position, to reconstruct broken edges and finally to vectorize them. SAR images from the "MSTAR clutter" dataset were used to prove the effectiveness of the proposed algorithms.

Preliminary thermal architecture of the X-IFU instrument dewar

NASA Astrophysics Data System (ADS)

Charles, Ivan; Daniel, Christophe; André, Jérome; Duband, Lionel; Duval, Jean-Marc; den Hartog, Roland; Mitsuda, Kazuhisa; Shinozaki, Keisuke; van Weers, Henk; Yamasaki, Noriko Y.

2016-07-01

The ESA Athena mission will implement 2 instruments to study the hot and energetic universe. The X-ray Integral Field Unit (X-IFU) will provide spatially resolved high resolution spectroscopy. This high energy resolution of 2.5 eV at 7 keV could be achieved thanks to TES (Transition Edge Sensor) detectors that need to be cooled to very low temperature. To obtain the required 50 mK temperature level, a careful design of the cryostat and of the cooling chain including different technologies in cascade is needed. The preliminary cryogenic architecture of the X-IFU instrument that fulfils the TES detector thermal requirements is described. In particular, the thermal design of the detector focal plane assembly (FPA), that uses three temperature stages (from 2 K to 50 mK) to limit the thermal loads on the lowest temperature stage, is described. The baseline cooling chain is based on European and Japanese mechanical coolers (Stirling, Pulse tube and Joule Thomson coolers) that precool a sub Kelvin cooler made of a 3He sorption cooler coupled with a small ADR (Adiabatic Demagnetization Refrigerator). Preliminary thermal budgets of the X-IFU cryostat are presented and discussed regarding cooling chain performances.

Design and prototype results of the FAST detector

NASA Astrophysics Data System (ADS)

Mozzanica, A.; Basset, M.; Caccia, M.; Corradini, M.; Leali, M.; Lodi Rizzini, E.; Prest, M.; Venturelli, L.; Vallazza, E.; Zurlo, N.

2006-11-01

A new fiber tracker is being developed for the ASACUSA experiment at the Antiproton Decelerator at CERN. The detector is based on 1 mm diameter scintillating fibers readout by HAMAMATSU 64 channel multianode photomultipliers (MA-PMTs) connected to a dedicated electronic chain. The paper gives a description of the testing procedures for time resolution, spatial resolution and efficiency measurements performed with standard NIM electronics and a commercial TDC and reports the results for different prototype detectors.

Test of a prototype neutron spectrometer based on diamond detectors in a fast reactor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osipenko, M.; Ripani, M.; Ricco, G.

2015-07-01

A prototype of neutron spectrometer based on diamond detectors has been developed. This prototype consists of a {sup 6}Li neutron converter sandwiched between two CVD diamond crystals. The radiation hardness of the diamond crystals makes it suitable for applications in low power research reactors, while a low sensitivity to gamma rays and low leakage current of the detector permit to reach good energy resolution. A fast coincidence between two crystals is used to reject background. The detector was read out using two different electronic chains connected to it by a few meters of cable. The first chain was based onmore » conventional charge-sensitive amplifiers, the other used a custom fast charge amplifier developed for this purpose. The prototype has been tested at various neutron sources and showed its practicability. In particular, the detector was calibrated in a TRIGA thermal reactor (LENA laboratory, University of Pavia) with neutron fluxes of 10{sup 8} n/cm{sup 2}s and at the 3 MeV D-D monochromatic neutron source named FNG (ENEA, Rome) with neutron fluxes of 10{sup 6} n/cm{sup 2}s. The neutron spectrum measurement was performed at the TAPIRO fast research reactor (ENEA, Casaccia) with fluxes of 10{sup 9} n/cm{sup 2}s. The obtained spectra were compared to Monte Carlo simulations, modeling detector response with MCNP and Geant4. (authors)« less

Manipulator interactive design with interconnected flexible elements

NASA Technical Reports Server (NTRS)

Singh, R. P.; Likins, P. W.

1983-01-01

This paper describes the development of an analysis tool for the interactive design of control systems for manipulators and similar electro-mechanical systems amenable to representation as structures in a topological chain. The chain consists of a series of elastic bodies subject to small deformations and arbitrary displacements. The bodies are connected by hinges which permit kinematic constraints, control, or relative motion with six degrees of freedom. The equations of motion for the chain configuration are derived via Kane's method, extended for application to interconnected flexible bodies with time-varying boundary conditions. A corresponding set of modal coordinates has been selected. The motion equations are imbedded within a simulation that transforms the vector-dyadic equations into scalar form for numerical integration. The simulation also includes a linear, time-invariant controler specified in transfer function format and a set of sensors and actuators that interface between the structure and controller. The simulation is driven by an interactive set-up program resulting in an easy-to-use analysis tool.

Processing Ultra Wide Band Synthetic Aperture Radar Data with Motion Detectors

NASA Technical Reports Server (NTRS)

Madsen, Soren Norvang

1996-01-01

Several issues makes the processing of ultra wide band (UWB) SAR data acquired from an airborne platform difficult. The character of UWB data invalidates many of the usual SAR batch processing techniques, leading to the application of wavenumber domain type processors...This paper will suggest and evaluate an algorithm which combines a wavenumber domain processing algorithm with a motion compensation procedure which enables motion compensation to be applied as a function of target range and the azimuth angle.

The Advanced Part of a Treatise on the Dynamics of a System of Rigid Bodies

NASA Astrophysics Data System (ADS)

Routh, Edward John

2013-03-01

Preface; 1. Moving axes and relative motion; 2. Oscillations about equilibrium; 3. Oscillations about a state of motion; 4. Motion of a body under no forces; 5. Motion of a body under any forces; 6. Nature of the motion given by linear equations and the conditions of stability; 7. Free and forced oscillations; 8. Determination of the constants of integration in terms of the initial conditions; 9. Calculus of finite differences; 10. Calculus of variations; 11. Precession and nutation; 12. Motion of the moon about its centre; 13. Motion of a string or chain; 14. Motion of a membrane; Notes.

Performance studies of X3 silicon detectors for the future ELISSA array at ELI-NP

NASA Astrophysics Data System (ADS)

Chesnevskaya, S.; Balabanski, D. L.; Choudhury, D.; Constantin, P.; Filipescu, D. M.; Ghita, D. G.; Guardo, G. L.; Lattuada, D.; Matei, C.; Rotaru, A.; State, A.

2018-05-01

ELISSA is an array of silicon strip detectors under construction at the ELI-NP facility for measurements of photodissociation reactions using high-brilliance, quasi monoenergetic gamma beams. The detection system consists of 35 single-sided position-sensitive X3 detectors arranged in a cylindrical configuration and eight QQQ3 detectors as end-caps. A batch of forty X3 detectors have been tested at ELI-NP. The energy and position resolution, ballistic deficit, leakage currents, and depletion voltage were measured and analyzed. Measurements of the energy resolution were carried out using two read-out electronic chains, one based on multichannel preamplifiers and another based on multiplexers.

Investigation of structure-property relationships in systematic series of novel polymers

NASA Technical Reports Server (NTRS)

Gillham, J. K.

1976-01-01

Solid state transitions in polymeric materials was associated with the onset of sub-molecular motions of the polymer chains. Although these were considered to be intramolecular in general, the local environment of the polymer molecule exerts a strong influence through, for example, the effects of crystallinity, polarity and diluents. The manner of specimen preparation and previous history also affect transitions. The transitions are considered to arise when sufficient free volume is available to permit the occurrence of these side chain and backbone reorientations. The glass transition is the principal transition of amorphous polymeric materials and is associated with the onset of long range segmental motion of the polymer backbone. The various types of shorter range motion occurring below the glass transition have been catalogued.

WE-AB-303-01: FEATURED PRESENTATION: A Dual-Detector Phase-Matched Digital Tomosynthesis (DTS) Imaging Scheme Using Aggregated KV and MV Projections for Intra-Treatment Lung Tumor Tracking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Y; Yin, F; Mao, R

2015-06-15

Purpose: To develop a dual-detector phase-matched DTS technique for continuous and fast intra-treatment lung tumor localization. Methods: Tumor localization accuracy of limited-angle DTS imaging is affected by low inter-slice resolution. The dual-detector DTS technique aims to overcome this limitation through combining orthogonally acquired beam’s eye view MV projections and kV projections for intra-treatment DTS reconstruction and localization. To aggregate the kV and MV projections for reconstruction, the MV projections were linearly converted to synthesize corresponding kV projections. To further address the lung motion induced localization errors, this technique uses respiratory phase-matching to match the motion information between on-board DTS andmore » reference DTS to offset the adverse effects of motion blurriness in tumor localization.A study was performed using the CIRS008A lung phantom to simulate different on-board target variation scenarios for localization. The intra-treatment kV and MV acquisition was achieved through the Varian TrueBeam Developer Mode. Four methods were compared for their localization accuracy: 1. the proposed dual-detector phase-matched DTS technique; 2. the single-detector phase-matched DTS technique; 3. the dual-detector 3D-DTS technique without phase-matching; and 4. the single-detector 3D-DTS technique without phase-matching. Results: For scan angles of 2.5°, 5°, 10°, 20° and 30°, the dual-detector phase-matched DTS technique localized the tumor with average(±standard deviations) errors of 0.4±0.3 mm, 0.5±0.3 mm, 0.6±0.2 mm, 0.9±0.4 mm and 1.0±0.3 mm, respectively. The corresponding values of single-detector phase-matched DTS technique were 4.0±2.5 mm, 2.7±1.1 mm, 1.7±1.2 mm, 2.2±0.9 mm and 1.5±0.8 mm, respectively. The values of dual-detector 3D-DTS technique were 6.2±1.7 mm, 6.3±1.2 mm, 5.3±1.3 mm, 2.0±2.2 mm and 1.5±0.5 mm, respectively. And the values of single-detector 3D-DTS technique were 9.7±8.9 mm, 9.8±8.8 mm, 10.0±9.7 mm, 3.9±2.7 mm and 2.2±1.3 mm, respectively. Conclusion: The dual-detector phase-matched DTS technique substantially improves the tumor localization accuracy, which can be applied to real-time intra-treatment lung tumor localization. The research was funded by the National Institutes of Health Grant No. R01-CA184173 and a grant from Varian Medical Systems.« less

Sprayable superhydrophobic nano-chains coating with continuous self-jumping of dew and melting frost

PubMed Central

Wang, Shanlin; Zhang, Wenwen; Yu, Xinquan; Liang, Caihua; Zhang, Youfa

2017-01-01

Spontaneous movement of condensed matter provides a new insight to efficiently improve condensation heat transfer on superhydrophobic surface. However, very few reports have shown the jumping behaviors on the sprayable superhydrophobic coatings. Here, we developed a sprayable silica nano-porous coating assembled by fluorinated nano-chains to survey the condensates’ dynamics. The dewdrops were continuously removed by self- and/or trigger-propelling motion due to abundant nano-pores from random multilayer stacking of nano-chains. In comparison, the dewdrops just could be slipped under the gravity effect on lack of nano-pores coatings stacked by silica nano-spheres and nano-aggregates. More interestingly, the spontaneous jumping effect also occurred on micro-scale frost crystals under the defrosting process on nano-chains coating surfaces. Different from self-jumping of dewdrops motion, the propelling force of frost crystals were provided by a sudden increase of the pressure under the frost crystal. PMID:28074938

Production, characterization and operation of Ge enriched BEGe detectors in GERDA

NASA Astrophysics Data System (ADS)

Agostini, M.; Allardt, M.; Andreotti, E.; Bakalyarov, A. M.; Balata, M.; Barabanov, I.; Barros, N.; Baudis, L.; Bauer, C.; Becerici-Schmidt, N.; Bellotti, E.; Belogurov, S.; Belyaev, S. T.; Benato, G.; Bettini, A.; Bezrukov, L.; Bode, T.; Borowicz, D.; Brudanin, V.; Brugnera, R.; Budjáš, D.; Caldwell, A.; Cattadori, C.; Chernogorov, A.; D'Andrea, V.; Demidova, E. V.; Domula, A.; Egorov, V.; Falkenstein, R.; Freund, K.; Frodyma, N.; Gangapshev, A.; Garfagnini, A.; Gotti, C.; Grabmayr, P.; Gurentsov, V.; Gusev, K.; Hegai, A.; Heisel, M.; Hemmer, S.; Heusser, G.; Hofmann, W.; Hult, M.; Inzhechik, L. V.; Ioannucci, L.; Janicskó Csáthy, J.; Jochum, J.; Junker, M.; Kazalov, V.; Kihm, T.; Kirpichnikov, I. V.; Kirsch, A.; Klimenko, A.; Knöpfle, K. T.; Kochetov, O.; Kornoukhov, V. N.; Kuzminov, V. V.; Laubenstein, M.; Lazzaro, A.; Lebedev, V. I.; Lehnert, B.; Liao, H. Y.; Lindner, M.; Lippi, I.; Lubashevskiy, A.; Lubsandorzhiev, B.; Lutter, G.; Macolino, C.; Majorovits, B.; Maneschg, W.; Misiaszek, M.; Nemchenok, I.; Nisi, S.; O'Shaughnessy, C.; Palioselitis, D.; Pandola, L.; Pelczar, K.; Pessina, G.; Pullia, A.; Riboldi, S.; Rumyantseva, N.; Sada, C.; Salathe, M.; Schmitt, C.; Schreiner, J.; Schulz, O.; Schütz, A.-K.; Schwingenheuer, B.; Schönert, S.; Shevchik, E.; Shirchenko, M.; Simgen, H.; Smolnikov, A.; Stanco, L.; Strecker, H.; Ur, C. A.; Vanhoefer, L.; Vasenko, A. A.; von Sturm, K.; Wagner, V.; Walter, M.; Wegmann, A.; Wester, T.; Wilsenach, H.; Wojcik, M.; Yanovich, E.; Zavarise, P.; Zhitnikov, I.; Zhukov, S. V.; Zinatulina, D.; Zuber, K.; Zuzel, G.

2015-02-01

The GERmanium Detector Array ( Gerda) at the Gran Sasso Underground Laboratory (LNGS) searches for the neutrinoless double beta decay () of Ge. Germanium detectors made of material with an enriched Ge fraction act simultaneously as sources and detectors for this decay. During Phase I of theexperiment mainly refurbished semi-coaxial Ge detectors from former experiments were used. For the upcoming Phase II, 30 new Ge enriched detectors of broad energy germanium (BEGe)-type were produced. A subgroup of these detectors has already been deployed in Gerda during Phase I. The present paper reviews the complete production chain of these BEGe detectors including isotopic enrichment, purification, crystal growth and diode production. The efforts in optimizing the mass yield and in minimizing the exposure of the Ge enriched germanium to cosmic radiation during processing are described. Furthermore, characterization measurements in vacuum cryostats of the first subgroup of seven BEGe detectors and their long-term behavior in liquid argon are discussed. The detector performance fulfills the requirements needed for the physics goals of Gerda Phase II.

Measurement of Motion Transfer Functions for Mirror Suspensions

NASA Astrophysics Data System (ADS)

Stuver, Amber; Beilby, Mark; Glancy, Aran; Gonzalez, Gabriela

2001-04-01

Interferometric gravitational wave detectors, such as LIGO, use mirrors suspended in pendulums. The current LIGO dectors use simple pendulums, but advanced LIGO detectors will use multiple pendulums with some stages on soft vertical springs. A drawback of the a multiple pendulum design is that it is difficult to model and predict cross couplings from one vibrational mode to another due to slight unavoidable asymmetries in the real system. Of most concern are the couplings to motion along the optical axis and into angular motions, which have the most potential to contaminate data. Our research focuses on the experimental testing of the pendulum designs for cross couplings with a special dedicated shaking stage. The cross couplings in each degree of freedom, their isolation and damping are investigated in this research though the measurement of transfer functions as filtered though the suspension system. This research is supported by The Pennsylvania State University, the NSF Grant no. PHY-9870032, and the REU program at The Pennsylvania State University.

Counting local integrals of motion in disordered spinless-fermion and Hubbard chains

NASA Astrophysics Data System (ADS)

Mierzejewski, Marcin; Kozarzewski, Maciej; Prelovšek, Peter

2018-02-01

We develop a procedure which systematically generates all conserved operators in the disordered models of interacting fermions. Among these operators, we identify and count the independent and local integrals of motion (LIOM), which represent the hallmark of the many-body localization (MBL). The method is tested first on the prototype disordered chain of interacting spinless fermions. As expected for full MBL, we find for large enough disorder NM=2M-1 independent and quasilocal LIOM with support on M consecutive sites. On the other hand, the study of the disordered Hubbard chain reveals that 3M-1

Dynamics of Single Chains of Suspended Ferrofluid Particles

NASA Technical Reports Server (NTRS)

Cutillas, S.; Liu, J.

1999-01-01

We present an experimental study of the dynamics of isolated chains made of super-paramagnetic particles under the influence of a magnetic field. The motivation of this work is to understand if the chain fluctuations exist and, if it does, how does the fluctuation affect chain aggregation. We find that single chains strongly fluctuate and that the characteristic frequency of their fluctuations is inversely proportional to the magnetic field strength. The higher the field the lower the characteristic frequency of the chain fluctuations. In the high magnetic field limit, chains behave like rigid rods without any internal motions. In this work, we used ferrofluid particles suspended in water. These particles do not have any intrinsic magnetization. Once a magnetic field is applied, a dipole moment is induced in each particle, proportional to the magnetic field. A dipolar magnetic interaction then occurs between particles. If dipole-dipole magnetic energy is higher than the thermal energy, the result is a structure change inside the dipolar fluid. The ratio of these two energies is expressed by a coupling constant lambda as: lambda = (pi(a(exp 3))(chi(exp 2))(mu(sub 0))(H(sub 0))(exp 2))/18kT Where a is the particle radius, mu(sub 0) is the vacuum magnetic permeability, H(sub 0) the applied magnetic field, k the Boltzmann constant and T the absolute temperature. If lambda > 1, magnetic particles form chains along the field direction. The lateral coalescence of several chains may form bigger aggregates especially if the particle volume fraction is high. While many studies and applications deal with the rheological properties and the structural changes of these dipolar fluids, this work focuses on the understanding of the chain dynamics. In order to probe the chain dynamics, we used dynamic light scattering (DLS) in self-beating mode as our experimental technique. The experimental geometry is such that the scattering plane is perpendicular to the magnetic field. Therefore, only motions in this plane are probed. A very dilute sample of a ferrofluid emulsion with a particle volume fraction of 10(exp -5) is used in this experiment. We chose such a low volume fraction to avoid multiple light scattering as well as lateral chain-chain aggregation. DLS measures the dynamic structure factor S(q,t) of the sample (q is the scattering wave vector, t is the time). In the absence of the magnetic field, identical particles of ferrofluid droplets are randomly distributed and S(q,t) reduces to exp(-q(exp 2)2D(sub 0)t). D(sub 0)=(kT/(6(pi)(eta)(a)) is the diffusion coefficient of Brownian particles (where Xi = (6(pi)(eta)(a)) is the Stokes frictional coefficient of a spherical particle in a fluid of viscosity eta). If interactions or polydispersity can not be ignored, an effective diffusion coefficient is introduced. Formally, D(sub eff) is defined as: D(sub eff) = - q(exp -2) partial derivative of (ln(S(q,t)) with respect to time, as t goes to 0. D(sub eff) reduces to D(sub 0) if no interactions and only a few particles size are present. Therefore, we can use DLS to measure particle size. The particle radius was found to be a=0.23 mu m with 7% of polydispersity. In this case, if we vary the scattering angle theta (and so q) we do not have any change in the measured diffusion coefficient: it is q-independent. When a magnetic field is applied, particles aggregate into chains if lambda > 1. We first studied the kinetics of the chain formation when lambda = 406. At a fixed scattering angle, we measured diffusion coefficient D(sub eff) as a function of time. Experimentally, we find that D(sub eff) decreases monotonously with time. Physically, this means that chains are becoming longer and longer. Since we are only sensitive to motions in the scattering plane and since chains have their main axis perpendicular to this plane, the measured diffusion coefficient is the trans-verse diffusion coefficient. We can relate D(sub eff) to the mean number of particles per chain N(t) at a given time and to the diffusion coefficient of an isolated particle D(sub 0) as D(sub eff)=f(N(t))D(sub 0). Since f(N) is known from other recent work, N can be expressed as a function of the time. We found a square root dependency: N(t) proportional to the square root of t. As expected for very low volume fraction, this behavior is characteristic of a diffusion-limited aggregation as suggested by several authors and by our previous work. In this study, we focus on the dependence of the effective diffusion coefficient on the scattering angle and the magnetic field strength. After the magnetic field is applied (lambda = 406) for a long time, typically 6 hours, kinetics of chain formation becomes very slow. Chain size does not vary much over the next hour period. Thus, we can perform different interesting experiments. First, at a fixed magnetic field, we measure the effective diffusion coefficient as a function of the scattering angle (from 5 to 130 deg). Our results show that the measured diffusion coefficient increases linearly with the scattering angle: D(sub eff) proportional to q. If we do the same experiment for different lambda values, D(sub eff) depends on lambda as D(sub eff) proportional to lambda(exp -1/2). We also find for different lambda values that the same asymptotic D(sub eff) value is obtained when q approaches zero. The angle dependency of D(sub eff) suggests that an additional motion exists besides chain drifting. Chain size is constant during experiment, which was verified by measuring the same diffusion coefficient at the beginning and at the end of the angle switching. If chains are rigid, D(sub eff) is independent of q. Therefore, we found that D(sub eff) not only measures the motion of the entire chain but also its internal fluctuations. These internal motions are the fluctuations of the particles in the chain. To understand the q dependency of D(sub eff), let us look at the probing length used. In our study, the characteristic length scale probed is l=2pi/q which is in the range of 0.9

SU-E-I-25: Performance Evaluation of a Proposed CMOS-Based X-Ray Detector Using Linear Cascade Model Analysis.

PubMed

Jain, A; Bednarek, D; Rudin, S

2012-06-01

The need for high-resolution, dynamic x-ray imaging capability for neurovascular applications has put an ever increasing demand on x-ray detector technology. Present state-of-the-art detectors such as flat panels have limited resolution and noise performance. A linear cascade model analysis was used to estimate the theoretical performance for a proposed CMOS-based detector. The proposed CMOS-based detector was assumed to have a 300-micron thick HL type CsI phosphor, 35-micron pixels, a variable gain light image intensifier (LU), and 400 electron readout noise. The proposed detector has a CMOS sensor coupled to an LII which views the output of the CsI phosphor. For the analysis the whole imaging chain was divided into individual stages characterized by one of the basic processes (stochastic/deterministic blurring, binomial selection, quantum gain, additive noise). Standard linear cascade modeling was used for the propagation of signal and noise through the stages and an RQA5 spectrum was assumed. The gain, blurring or transmission of different stages was either measured or taken from manufacturer's specifications. The theoretically calculated MTF and DQE for the proposed detector were compared with a high-resolution, high-sensitive Micro-Angio Fluoroscope (MAF), predecessor of the proposed detector. Signal and noise for each of the 19 stages in the complete imaging chain were calculated and showed improved performance. For example, at 5 cycles/mm the MTF and DQE were 0.08 and 0.28, respectively, for the CMOS detector compared to 0.05 and 0.07 for the MAF detector. The proposed detector will have improved MTF and DQE and slimmer physical dimension due to the elimination of the large fiber-optic taper used in the MAF. Once operational, the proposed CMOS detector will serve as a further improvement over standard flat panel detectors compared to the MAF which is already receiving a very positive reception by neuro-vascular interventionalists. (Support:NIH-Grant R01EB002873) NIH Grants R01- EB008425, R01-EB002873 and an equipment grant from Toshiba Medical Systems Corp. © 2012 American Association of Physicists in Medicine.

Exploration of Fermi-Pasta-Ulam Behavior in a Magnetic System

NASA Astrophysics Data System (ADS)

Lewis, Jeramy; Camley, Robert E.; Anderson, Nicholas R.

2018-04-01

We study nonlinear spin motion in one-dimensional magnetic chains. We find significant differences from the classic Fermi-Pasta-Ulam (FPU) problem examining nonlinear elastic motion in a chain. We find that FPU behavior, the transfer of energy among low order eigenmodes, does not occur in magnetic systems with only exchange and external fields, but does exist if a uniaxial anisotropy is also present. The FPU behavior may be altered or turned off through the magnitude and orientation of an external magnetic field. A realistic micromagnetic model shows such behavior could be measurable.

A Real-Time Position-Locating Algorithm for CCD-Based Sunspot Tracking

NASA Technical Reports Server (NTRS)

Taylor, Jaime R.

1996-01-01

NASA Marshall Space Flight Center's (MSFC) EXperimental Vector Magnetograph (EXVM) polarimeter measures the sun's vector magnetic field. These measurements are taken to improve understanding of the sun's magnetic field in the hopes to better predict solar flares. Part of the procedure for the EXVM requires image motion stabilization over a period of a few minutes. A high speed tracker can be used to reduce image motion produced by wind loading on the EXVM, fluctuations in the atmosphere and other vibrations. The tracker consists of two elements, an image motion detector and a control system. The image motion detector determines the image movement from one frame to the next and sends an error signal to the control system. For the ground based application to reduce image motion due to atmospheric fluctuations requires an error determination at the rate of at least 100 hz. It would be desirable to have an error determination rate of 1 kHz to assure that higher rate image motion is reduced and to increase the control system stability. Two algorithms are presented that are typically used for tracking. These algorithms are examined for their applicability for tracking sunspots, specifically their accuracy if only one column and one row of CCD pixels are used. To examine the accuracy of this method two techniques are used. One involves moving a sunspot image a known distance with computer software, then applying the particular algorithm to see how accurately it determines this movement. The second technique involves using a rate table to control the object motion, then applying the algorithms to see how accurately each determines the actual motion. Results from these two techniques are presented.

Controlled surface-induced flows from the motion of self-assembled colloidal walkers.

PubMed

Sing, Charles E; Schmid, Lothar; Schneider, Matthias F; Franke, Thomas; Alexander-Katz, Alfredo

2010-01-12

Biological flows at the microscopic scale are important for the transport of nutrients, locomotion, and differentiation. Here, we present a unique approach for creating controlled, surface-induced flows inspired by a ubiquitous biological system, cilia. Our design is based on a collection of self-assembled colloidal rotors that "walk" along surfaces in the presence of a rotating magnetic field. These rotors are held together solely by magnetic forces that allow for reversible assembly and disassembly of the chains. Furthermore, rotation of the magnetic field allows for straightforward manipulation of the shape and motion of these chains. This system offers a simple and versatile approach for designing microfluidic devices as well as for studying fundamental questions in cooperative-driven motion and transport at the microscopic level.

A Bio-inspired Collision Avoidance Model Based on Spatial Information Derived from Motion Detectors Leads to Common Routes

PubMed Central

Bertrand, Olivier J. N.; Lindemann, Jens P.; Egelhaaf, Martin

2015-01-01

Avoiding collisions is one of the most basic needs of any mobile agent, both biological and technical, when searching around or aiming toward a goal. We propose a model of collision avoidance inspired by behavioral experiments on insects and by properties of optic flow on a spherical eye experienced during translation, and test the interaction of this model with goal-driven behavior. Insects, such as flies and bees, actively separate the rotational and translational optic flow components via behavior, i.e. by employing a saccadic strategy of flight and gaze control. Optic flow experienced during translation, i.e. during intersaccadic phases, contains information on the depth-structure of the environment, but this information is entangled with that on self-motion. Here, we propose a simple model to extract the depth structure from translational optic flow by using local properties of a spherical eye. On this basis, a motion direction of the agent is computed that ensures collision avoidance. Flying insects are thought to measure optic flow by correlation-type elementary motion detectors. Their responses depend, in addition to velocity, on the texture and contrast of objects and, thus, do not measure the velocity of objects veridically. Therefore, we initially used geometrically determined optic flow as input to a collision avoidance algorithm to show that depth information inferred from optic flow is sufficient to account for collision avoidance under closed-loop conditions. Then, the collision avoidance algorithm was tested with bio-inspired correlation-type elementary motion detectors in its input. Even then, the algorithm led successfully to collision avoidance and, in addition, replicated the characteristics of collision avoidance behavior of insects. Finally, the collision avoidance algorithm was combined with a goal direction and tested in cluttered environments. The simulated agent then showed goal-directed behavior reminiscent of components of the navigation behavior of insects. PMID:26583771

The Bicycle Illusion: Sidewalk Science Informs the Integration of Motion and Shape Perception

ERIC Educational Resources Information Center

Masson, Michael E. J.; Dodd, Michael D.; Enns, James T.

2009-01-01

The authors describe a new visual illusion first discovered in a natural setting. A cyclist riding beside a pair of sagging chains that connect fence posts appears to move up and down with the chains. In this illusion, a static shape (the chains) affects the perception of a moving shape (the bicycle), and this influence involves assimilation…

Unfolding neutron spectrum with Markov Chain Monte Carlo at MIT research Reactor with He-3 Neutral Current Detectors [Measuring neutron spectrum at MIT research reactor utilizing He-3 Bonner Cylinder Approach with an unfolding analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leder, A.; Anderson, A. J.; Billard, J.

Here, the Ricochet experiment seeks to measure Coherent (neutral-current) Elastic Neutrino-Nucleus Scattering (CEνNS) using dark-matter-style detectors with sub-keV thresholds placed near a neutrino source, such as the MIT (research) Reactor (MITR), which operates at 5.5 MW generating approximately 2.2 × 10 18 ν/second in its core. Currently, Ricochet is characterizing the backgrounds at MITR, the main component of which comes in the form of neutrons emitted from the core simultaneous with the neutrino signal. To characterize this background, we wrapped Bonner cylinders around a 3 2He thermal neutron detector, whose data was then unfolded via a Markov Chain Monte Carlo (MCMC) to producemore » a neutron energy spectrum across several orders of magnitude. We discuss the resulting spectrum and its implications for deploying Ricochet at the MITR site as well as the feasibility of reducing this background level via the addition of polyethylene shielding around the detector setup.« less

Unfolding neutron spectrum with Markov Chain Monte Carlo at MIT research Reactor with He-3 Neutral Current Detectors [Measuring neutron spectrum at MIT research reactor utilizing He-3 Bonner Cylinder Approach with an unfolding analysis

DOE PAGES

Leder, A.; Anderson, A. J.; Billard, J.; ...

2018-02-02

Here, the Ricochet experiment seeks to measure Coherent (neutral-current) Elastic Neutrino-Nucleus Scattering (CEνNS) using dark-matter-style detectors with sub-keV thresholds placed near a neutrino source, such as the MIT (research) Reactor (MITR), which operates at 5.5 MW generating approximately 2.2 × 10 18 ν/second in its core. Currently, Ricochet is characterizing the backgrounds at MITR, the main component of which comes in the form of neutrons emitted from the core simultaneous with the neutrino signal. To characterize this background, we wrapped Bonner cylinders around a 3 2He thermal neutron detector, whose data was then unfolded via a Markov Chain Monte Carlo (MCMC) to producemore » a neutron energy spectrum across several orders of magnitude. We discuss the resulting spectrum and its implications for deploying Ricochet at the MITR site as well as the feasibility of reducing this background level via the addition of polyethylene shielding around the detector setup.« less

Biomimetics of throwing at basketball

NASA Astrophysics Data System (ADS)

Merticaru, E.; Budescu, E.; Iacob, R. M.

2016-08-01

The paper deals with the inverse dynamics of a kinematic chain of the human upper limb when throwing the ball at the basketball, aiming to calculate the torques required to put in action the technical system. The kinematic chain respects the anthropometric features regarding the length and mass of body segments. The kinematic parameters of the motion were determined by measuring the angles of body segments during a succession of filmed pictures of a throw, and the interpolation of these values and determination of the interpolating polynomials for each independent geometric coordinate. Using the Lagrange equations, there were determined the variations with time of the required torques to put in motion the kinematic chain of the type of triple physical pendulum. The obtained values show, naturally, the fact that the biggest torque is that for mimetic articulation of the shoulder, being comparable with those obtained by the brachial biceps muscle of the analyzed human subject. Using the obtained data, there can be conceived the mimetic technical system, of robotic type, with application in sports, so that to perform the motion of ball throwing, from steady position, at the basket.

A New Movement Detector to Enable People with Multiple Disabilities to Control Environmental Stimulation with Hand Swing through a Commercial Mouse

ERIC Educational Resources Information Center

Shih, Ching-Hsiang; Shih, Ching-Tien

2009-01-01

This study assessed whether two persons with profound multiple disabilities would be able to control environmental stimulation using hand swing and a standard mouse with a newly developed mouse driver (i.e. a new mouse driver replaces standard mouse driver, and turns a mouse into a precise two-dimensional motion detector). The study was performed…

DURIP: Piezoresponse Force Microscope (PFM) with Controlled Environment for Characterization of Flexoelectric Nanostructures

DTIC Science & Technology

2015-04-21

seismic sensors , acoustic sensors , electromagnetic sensors and infrared (IR) detectors are among in-need multimodal sensing of vehicles, personnel, weapons... sensors and detectors largely due to the fact that the nature of piezoelectricity renders both active and passive sensing with fast response, low profile...and low power consumption. Acoustic and seismic sensors are used to ascertain the exact target location, speed, direction of motion, and

DynamiX, numerical tool for design of next-generation x-ray telescopes.

PubMed

Chauvin, Maxime; Roques, Jean-Pierre

2010-07-20

We present a new code aimed at the simulation of grazing-incidence x-ray telescopes subject to deformations and demonstrate its ability with two test cases: the Simbol-X and the International X-ray Observatory (IXO) missions. The code, based on Monte Carlo ray tracing, computes the full photon trajectories up to the detector plane, accounting for the x-ray interactions and for the telescope motion and deformation. The simulation produces images and spectra for any telescope configuration using Wolter I mirrors and semiconductor detectors. This numerical tool allows us to study the telescope performance in terms of angular resolution, effective area, and detector efficiency, accounting for the telescope behavior. We have implemented an image reconstruction method based on the measurement of the detector drifts by an optical sensor metrology. Using an accurate metrology, this method allows us to recover the loss of angular resolution induced by the telescope instability. In the framework of the Simbol-X mission, this code was used to study the impacts of the parameters on the telescope performance. In this paper we present detailed performance analysis of Simbol-X, taking into account the satellite motions and the image reconstruction. To illustrate the versatility of the code, we present an additional performance analysis with a particular configuration of IXO.

Posteriori error determination and grid adaptation for AMR and ALE computational fluid dynamics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lapenta, G. M.

2002-01-01

We discuss grid adaptation for application to AMR and ALE codes. Two new contributions are presented. First, a new method to locate the regions where the truncation error is being created due to an insufficient accuracy: the operator recovery error origin (OREO) detector. The OREO detector is automatic, reliable, easy to implement and extremely inexpensive. Second, a new grid motion technique is presented for application to ALE codes. The method is based on the Brackbill-Saltzman approach but it is directly linked to the OREO detector and moves the grid automatically to minimize the error.

Direct Determination of Site-Specific Noncovalent Interaction Strengths of Proteins from NMR-Derived Fast Side Chain Motional Parameters.

PubMed

Rajeshwar T, Rajitha; Krishnan, Marimuthu

2017-05-25

A novel approach to accurately determine residue-specific noncovalent interaction strengths (ξ) of proteins from NMR-measured fast side chain motional parameters (O axis 2 ) is presented. By probing the environmental sensitivity of side chain conformational energy surfaces of individual residues of a diverse set of proteins, the microscopic connections between ξ, O axis 2 , conformational entropy (S conf ), conformational barriers, and rotamer stabilities established here are found to be universal among proteins. The results reveal that side chain flexibility and conformational entropy of each residue decrease with increasing ξ and that for each residue type there exists a critical range of ξ, determined primarily by the mean side chain conformational barriers, within which flexibility of any residue can be reversibly tuned from highly flexible (with O axis 2 ∼ 0) to highly restricted (with O axis 2 ∼ 1) by increasing ξ by ∼3 kcal/mol. Beyond this critical range of ξ, both side chain flexibility and conformational entropy are insensitive to ξ. The interrelationships between conformational dynamics, conformational entropy, and noncovalent interactions of protein side chains established here open up new avenues to probe perturbation-induced (for example, ligand-binding, temperature, pressure) changes in fast side chain dynamics and thermodynamics of proteins by comparing their conformational energy surfaces in the native and perturbed states.

Conformational statistics of stiff macromolecules as solutions to partial differential equations on the rotation and motion groups

PubMed

Chirikjian; Wang

2000-07-01

Partial differential equations (PDE's) for the probability density function (PDF) of the position and orientation of the distal end of a stiff macromolecule relative to its proximal end are derived and solved. The Kratky-Porod wormlike chain, the Yamakawa helical wormlike chain, and the original and revised Marko-Siggia models are examples of stiffness models to which the present formulation is applied. The solution technique uses harmonic analysis on the rotation and motion groups to convert PDE's governing the PDF's of interest into linear algebraic equations which have mathematically elegant solutions.

Effect of fluid inertia on the motion of a collinear swimmer.

PubMed

Felderhof, B U

2016-12-01

The swimming of a two-sphere system and of a three-sphere chain in an incompressible viscous fluid is studied on the basis of simplified equations of motion which take account of both Stokes friction and added mass effects. The analysis is based on an explicit expression for the asymptotic periodic swimming velocity and a corresponding evaluation of the mean rate of dissipation. The mean swimming velocity of the two-sphere system is found to be nonvanishing provided that the two spheres are not identical. The swimming of a comparable chain of three identical spheres is much more efficient.

An Evaluation of the Fixed Hotspot Hypothesis for the Pacific Plate

NASA Astrophysics Data System (ADS)

Wessel, P.; Kroenke, L. W.

2008-12-01

Using geometry and ages from 12 Pacific seamount chains, we recently constructed two new Pacific absolute plate motion models that extend our self-consistent and high-resolution models back to 145 Ma. The WK08-A model maps the full uncertainty in the age progressions into uncertainties in rotation opening angles, yielding a relatively smooth plate motion model. The WK08-G model relaxes the mapping of age uncertainties in order to better isolate secondary geometry changes seen along many co-registered chains. Both models have been used to assess the viability of the fixed hotspot hypothesis in the Pacific. In constructing these models, we found that only a small group of age samples had to be discarded on the grounds that they were discordant with the dominant trends. We were able to connect plate motions for pre- and post-Emperor age intervals by including the Ratak-Gilbert-Ellice, Liliuokalani and Musicians trails in our analysis. However, as no active hotspot locations exist for the older chains their inclusion adds additional model parameters. Both age and geometry misfits increase with age, reflecting the observed increase in age uncertainties and the broader and less distinct nature of the older trails. Paleomagnetic observations from the Emperor seamount chain have been interpreted to suggest that these seamounts must have formed at latitudes significantly more northerly than the present location of the Hawaii hotspot, implying a drifting mantle plume. At the same time, new estimates of the age of the Hawaii- Emperor bend places bend formation at a time of global plate reorganization. We will present a complete analysis of inter-chain distances between coeval radiometric samples from Pacific chains and compare these distances to the inter-hotspot distances at the present time. Significant departures from the current hotspot separations would be direct and unequivocal evidence of motion between the Pacific hotspot reference frame and the spin axis and as such complement the paleomagnetic analysis. Preliminary results suggest the Emperor segment data may indicate an increase in hotspot separation.

Experience of using MOSFET detectors for dose verification measurements in an end-to-end 192Ir brachytherapy quality assurance system.

PubMed

Persson, Maria; Nilsson, Josef; Carlsson Tedgren, Åsa

Establishment of an end-to-end system for the brachytherapy (BT) dosimetric chain could be valuable in clinical quality assurance. Here, the development of such a system using MOSFET (metal oxide semiconductor field effect transistor) detectors and experience gained during 2 years of use are reported with focus on the performance of the MOSFET detectors. A bolus phantom was constructed with two implants, mimicking prostate and head & neck treatments, using steel needles and plastic catheters to guide the 192 Ir source and house the MOSFET detectors. The phantom was taken through the BT treatment chain from image acquisition to dose evaluation. During the 2-year evaluation-period, delivered doses were verified a total of 56 times using MOSFET detectors which had been calibrated in an external 60 Co beam. An initial experimental investigation on beam quality differences between 192 Ir and 60 Co is reported. The standard deviation in repeated MOSFET measurements was below 3% in the six measurement points with dose levels above 2 Gy. MOSFET measurements overestimated treatment planning system doses by 2-7%. Distance-dependent experimental beam quality correction factors derived in a phantom of similar size as that used for end-to-end tests applied on a time-resolved measurement improved the agreement. MOSFET detectors provide values stable over time and function well for use as detectors for end-to-end quality assurance purposes in 192 Ir BT. Beam quality correction factors should address not only distance from source but also phantom dimensions. Copyright © 2017 American Brachytherapy Society. Published by Elsevier Inc. All rights reserved.

Dynamic Metasurface Aperture as Smart Around-the-Corner Motion Detector.

PubMed

Del Hougne, Philipp; F Imani, Mohammadreza; Sleasman, Timothy; Gollub, Jonah N; Fink, Mathias; Lerosey, Geoffroy; Smith, David R

2018-04-25

Detecting and analysing motion is a key feature of Smart Homes and the connected sensor vision they embrace. At present, most motion sensors operate in line-of-sight Doppler shift schemes. Here, we propose an alternative approach suitable for indoor environments, which effectively constitute disordered cavities for radio frequency (RF) waves; we exploit the fundamental sensitivity of modes of such cavities to perturbations, caused here by moving objects. We establish experimentally three key features of our proposed system: (i) ability to capture the temporal variations of motion and discern information such as periodicity ("smart"), (ii) non line-of-sight motion detection, and (iii) single-frequency operation. Moreover, we explain theoretically and demonstrate experimentally that the use of dynamic metasurface apertures can substantially enhance the performance of RF motion detection. Potential applications include accurately detecting human presence and monitoring inhabitants' vital signs.

Visual Motion Perception and Visual Attentive Processes.

DTIC Science & Technology

1988-04-01

88-0551 Visual Motion Perception and Visual Attentive Processes George Spering , New YorkUnivesity A -cesson For DTIC TAB rant AFOSR 85-0364... Spering . HIPSt: A Unix-based image processing syslem. Computer Vision, Graphics, and Image Processing, 1984,25. 331-347. ’HIPS is the Human Information...Processing Laboratory’s Image Processing System. 1985 van Santen, Jan P. It, and George Spering . Elaborated Reichardt detectors. Journal of the Optical

Single crystal diamond detector measurements of deuterium-deuterium and deuterium-tritium neutrons in Joint European Torus fusion plasmas.

PubMed

Cazzaniga, C; Sundén, E Andersson; Binda, F; Croci, G; Ericsson, G; Giacomelli, L; Gorini, G; Griesmayer, E; Grosso, G; Kaveney, G; Nocente, M; Perelli Cippo, E; Rebai, M; Syme, B; Tardocchi, M

2014-04-01

First simultaneous measurements of deuterium-deuterium (DD) and deuterium-tritium neutrons from deuterium plasmas using a Single crystal Diamond Detector are presented in this paper. The measurements were performed at JET with a dedicated electronic chain that combined high count rate capabilities and high energy resolution. The deposited energy spectrum from DD neutrons was successfully reproduced by means of Monte Carlo calculations of the detector response function and simulations of neutron emission from the plasma, including background contributions. The reported results are of relevance for the development of compact neutron detectors with spectroscopy capabilities for installation in camera systems of present and future high power fusion experiments.

Macro-motion detection using ultra-wideband impulse radar.

PubMed

Xin Li; Dengyu Qiao; Ye Li

2014-01-01

Radar has the advantage of being able to detect hidden individuals, which can be used in homeland security, disaster rescue, and healthcare monitoring-related applications. Human macro-motion detection using ultra-wideband impulse radar is studied in this paper. First, a frequency domain analysis is carried out to show that the macro-motion yields a bandpass signal in slow-time. Second, the FTFW (fast-time frequency windowing), which has the advantage of avoiding the measuring range reduction, and the HLF (high-pass linear-phase filter), which can preserve the motion signal effectively, are proposed to preprocess the radar echo. Last, a threshold decision method, based on the energy detector structure, is presented.

Design of a highly integrated video acquisition module for smart video flight unit development

NASA Astrophysics Data System (ADS)

Lebre, V.; Gasti, W.

2017-11-01

CCD and APS devices are widely used in space missions as instrument sensors and/or in Avionics units like star detectors/trackers. Therefore, various and numerous designs of video acquisition chains have been produced. Basically, a classical video acquisition chain is constituted of two main functional blocks: the Proximity Electronics (PEC), including detector drivers and the Analogue Processing Chain (APC) Electronics that embeds the ADC, a master sequencer and the host interface. Nowadays, low power technologies allow to improve the integration, radiometric performances and power budget optimisation of video units and to standardize video units design and development. To this end, ESA has initiated a development activity through a competitive process requesting the expertise of experienced actors in the field of high resolution electronics for earth observation and Scientific missions. THALES ALENIA SPACE has been granted this activity as a prime contractor through ESA contract called HIVAC that holds for Highly Integrated Video Acquisition Chain. This paper presents main objectives of the on going HIVAC project and focuses on the functionalities and performances offered by the usage of the under development HIVAC board for future optical instruments.

Recent Progress in Understanding the Origin of the Hawaiian-Emperor Bend

NASA Astrophysics Data System (ADS)

Gordon, R. G.; Morgan, J. P.

2016-12-01

Two main explanations have been proposed for the origin of the Hawaiian-Emperor Bend (HEB): (1) that it records a change in motion of the Pacific plate relative to a stationary Hawaiian plume [Morgan, 1971]; (2) that Pacific plate motion has been uniform but the HEB records a change from rapid (>40 mm/yr) southward motion of the Hawaiian plume, while the Emperor chain was formed, to a stationary plume while the Hawaiian chain was formed [Tarduno et al. 2003]. We summarize recent progress on this issue. Recent work invalidates prior studies that inferred significant rates of motion between hotspots since the time of the HEB. Nominal rates of motion are 2-6 mm/yr with a lower bound of zero and upper bounds of 8-13 mm/yr (95% c. l.) [Koivisto et al., 2014]. In this context, Hawaiian plume drift as great as 40 mm/yr before 50 Ma B.P. seems unlikely. Other recent work demonstrates the viability of using the orientation of seismic anisotropy in the upper mantle, combined with relative plate motions, to estimate absolute plate motions independently of hotspot tracks. Wang et al. [this meeting] show that the two reference frames agree with each other within their 95% confidence limits, thus lending credibility to both estimates. To infer motion of the Hawaiian hotspot relative to the mantle from paleomagnetic data one must ignore true polar wander (TPW), but TPW is too big to ignore and is occurring today—it is an important part of explaining the apparent polar wander of the Pacific and other plates. New evidence shows that the Hawaiian hotspot was fixed in latitude during formation of most, if not all, of the Emperor seamount chain [Seidman et al., this meeting], in contradiction to the southward motion found by Tarduno et al. [2003]. Revised timing and age-dating of the HEB (now 50 Ma; Clague [this meeting]) implies that the change in plate motion coincides with a change in Pacific-Farallon motion and other circum-Pacific tectonic events. Barkhausen et al [2013] show that the Pacific-Farallon spreading rate doubles between 50 Ma and 40 Ma coincident with the acceleration of the Pacific plate from the HEB to the Hawaiian trend and an increasing propagation rate along that trend. We conclude that current evidence still favors W. J. Morgan's original explanation for the HEB: that it records a change in Pacific plate motion relative to the deep mantle.

A new look at Op art: towards a simple explanation of illusory motion.

PubMed

Zanker, Johannes M; Walker, Robin

2004-04-01

Vivid motion illusions created by some Op art paintings are at the centre of a lively scientific debate about possible mechanisms that might underlie these phenomena. Here we review emerging evidence from a new approach that combines perceptual judgements of the illusion and observations of eye movements with simulations of the induced optic flow. This work suggests that the small involuntary saccades which participants make when viewing such Op art patterns would generate an incoherent distribution of motion signals that resemble the perceptual effects experienced by the observers. The combined experimental and computational evidence supports the view that the illusion is indeed caused by involuntary image displacements picked up by low-level motion detectors, and further suggests that coherent motion signals are crucial to perceive a stable world.

A new look at Op art: towards a simple explanation of illusory motion

NASA Astrophysics Data System (ADS)

Zanker, Johannes M.; Walker, Robin

Vivid motion illusions created by some Op art paintings are at the centre of a lively scientific debate about possible mechanisms that might underlie these phenomena. Here we review emerging evidence from a new approach that combines perceptual judgements of the illusion and observations of eye movements with simulations of the induced optic flow. This work suggests that the small involuntary saccades which participants make when viewing such Op art patterns would generate an incoherent distribution of motion signals that resemble the perceptual effects experienced by the observers. The combined experimental and computational evidence supports the view that the illusion is indeed caused by involuntary image displacements picked up by low-level motion detectors, and further suggests that coherent motion signals are crucial to perceive a stable world.

MagicPlate-512: A 2D silicon detector array for quality assurance of stereotactic motion adaptive radiotherapy.

PubMed

Petasecca, M; Newall, M K; Booth, J T; Duncan, M; Aldosari, A H; Fuduli, I; Espinoza, A A; Porumb, C S; Guatelli, S; Metcalfe, P; Colvill, E; Cammarano, D; Carolan, M; Oborn, B; Lerch, M L F; Perevertaylo, V; Keall, P J; Rosenfeld, A B

2015-06-01

Spatial and temporal resolutions are two of the most important features for quality assurance instrumentation of motion adaptive radiotherapy modalities. The goal of this work is to characterize the performance of the 2D high spatial resolution monolithic silicon diode array named "MagicPlate-512" for quality assurance of stereotactic body radiation therapy (SBRT) and stereotactic radiosurgery (SRS) combined with a dynamic multileaf collimator (MLC) tracking technique for motion compensation. MagicPlate-512 is used in combination with the movable platform HexaMotion and a research version of radiofrequency tracking system Calypso driving MLC tracking software. The authors reconstruct 2D dose distributions of small field square beams in three modalities: in static conditions, mimicking the temporal movement pattern of a lung tumor and tracking the moving target while the MLC compensates almost instantaneously for the tumor displacement. Use of Calypso in combination with MagicPlate-512 requires a proper radiofrequency interference shielding. Impact of the shielding on dosimetry has been simulated by (GEANT)4 and verified experimentally. Temporal and spatial resolutions of the dosimetry system allow also for accurate verification of segments of complex stereotactic radiotherapy plans with identification of the instant and location where a certain dose is delivered. This feature allows for retrospective temporal reconstruction of the delivery process and easy identification of error in the tracking or the multileaf collimator driving systems. A sliding MLC wedge combined with the lung motion pattern has been measured. The ability of the MagicPlate-512 (MP512) in 2D dose mapping in all three modes of operation was benchmarked by EBT3 film. Full width at half maximum and penumbra of the moving and stationary dose profiles measured by EBT3 film and MagicPlate-512 confirm that motion has a significant impact on the dose distribution. Motion, no motion, and motion with MLC tracking profiles agreed within 1 and 0.4 mm, respectively, for all field sizes tested. Use of electromagnetic tracking system generates a fluctuation of the detector baseline up to 10% of the full scale signal requiring a proper shielding strategy. MagicPlate-512 is also able to reconstruct the dose variation pulse-by-pulse in each pixel of the detector. An analysis of the dose transients with motion and motion with tracking shows that the tracking feedback algorithm used for this experiment can compensate effectively only the effect of the slower transient components. The fast changing components of the organ motion can contribute only to discrepancy of the order of 15% in penumbral region while the slower components can change the dose profile up to 75% of the expected dose. MagicPlate-512 is shown to be, potentially, a valid alternative to film or 2D ionizing chambers for quality assurance dosimetry in SRS or SBRT. Its high spatial and temporal resolutions allow for accurate reconstruction of the profile in any conditions with motion and with tracking of the motion. It shows excellent performance to reconstruct the dose deposition in real time or retrospectively as a function of time for detailed analysis of the effect of motion in a specific pixel or area of interest.

Directional bias of illusory stream caused by relative motion adaptation.

PubMed

Tomimatsu, Erika; Ito, Hiroyuki

2016-07-01

Enigma is an op-art painting that elicits an illusion of rotational streaming motion. In the present study, we tested whether adaptation to various motion configurations that included relative motion components could be reflected in the directional bias of the illusory stream. First, participants viewed the center of a rotating Enigma stimulus for adaptation. There was no physical motion on the ring area. During the adaptation period, the illusory stream on the ring was mainly seen in the direction opposite to that of the physical rotation. After the physical rotation stopped, the illusory stream on the ring was mainly seen in the same direction as that of the preceding physical rotation. Moreover, adapting to strong relative motion induced a strong bias in the illusory motion direction in the subsequently presented static Enigma stimulus. The results suggest that relative motion detectors corresponding to the ring area may produce the illusory stream of Enigma. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

40 CFR 63.1363 - Standards for equipment leaks.

Code of Federal Regulations, 2014 CFR

2014-07-01

... heating and cooling systems which do not combine their materials with those in the processes they serve..., magnetic sensor, motion detector on the pressure relief valve stem, flow monitor, or pressure monitor. (B...

40 CFR 63.1331 - Equipment leak provisions.

Code of Federal Regulations, 2014 CFR

2014-07-01

... pump or seal whereby polymer fluid used to provide lubrication and/or cooling of the pump or agitator... limited to, a rupture disk indicator, magnetic sensor, motion detector on the pressure relief valve stem...

Motion and Emotional Behavior Design for Pet Robot Dog

NASA Astrophysics Data System (ADS)

Cheng, Chi-Tai; Yang, Yu-Ting; Miao, Shih-Heng; Wong, Ching-Chang

A pet robot dog with two ears, one mouth, one facial expression plane, and one vision system is designed and implemented so that it can do some emotional behaviors. Three processors (Inter® Pentium® M 1.0 GHz, an 8-bit processer 8051, and embedded soft-core processer NIOS) are used to control the robot. One camera, one power detector, four touch sensors, and one temperature detector are used to obtain the information of the environment. The designed robot with 20 DOF (degrees of freedom) is able to accomplish the walking motion. A behavior system is built on the implemented pet robot so that it is able to choose a suitable behavior for different environmental situation. From the practical test, we can see that the implemented pet robot dog can do some emotional interaction with the human.

A critical examination of the Emperor and Hawaiian volcanic chains

NASA Astrophysics Data System (ADS)

Nathenson, M.; Foulger, G. R.; Anderson, D. L.; Julian, B. R.; Natland, J. H.

2003-12-01

The Emperor and Hawaiian volcanic chains are usually assumed to represent a single entity, and to be an exemplary fit to the plume model. However, many features do not conform to this hypothesis. These include: 1) the great "bend" does not result from a change in direction of motion of the Pacific plate, since no such change occurred, 2) southerly motion of ~ 800 km of the melt locus occurred during formation of the Emperor chain, and stopped at the time of the great bend, 3) the chain apparently commenced near a ridge, 4) there is no Hawaiian "plume head", 5) the melt volume flux varies greatly along the chains and has increased by an order of magnitude during the last 5 Myr, 6) there is no significant heatflow anomaly around the bathymetric swell, 7) there is no measurable thermal rejuvenation near Hawaii, 8) low temperatures relative to those required for a plume are estimated from geothermometry, 9) there is no petrological or geochemical evidence that requires a deep melt source, and 10) seismic evidence indicates relatively normal wave speeds throughout the mantle beneath Hawaii. A large number of seamounts unaffiliated with volcanic chains have similar geochemistry to Hawaii. A fully quantified hypothesis for Hawaii that can explain these features is long overdue.

Note: A resonating reflector-based optical system for motion measurement in micro-cantilever arrays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sathishkumar, P.; Punyabrahma, P.; Sri Muthu Mrinalini, R.

A robust, compact optical measurement unit for motion measurement in micro-cantilever arrays enables development of portable micro-cantilever sensors. This paper reports on an optical beam deflection-based system to measure the deflection of micro-cantilevers in an array that employs a single laser source, a single detector, and a resonating reflector to scan the measurement laser across the array. A strategy is also proposed to extract the deflection of individual cantilevers from the acquired data. The proposed system and measurement strategy are experimentally evaluated and demonstrated to measure motion of multiple cantilevers in an array.

Model for the computation of self-motion in biological systems

NASA Technical Reports Server (NTRS)

Perrone, John A.

1992-01-01

A technique is presented by which direction- and speed-tuned cells, such as those commonly found in the middle temporal region of the primate brain, can be utilized to analyze the patterns of retinal image motion that are generated during observer movement through the environment. The developed model determines heading by finding the peak response in a population of detectors or neurons each tuned to a particular heading direction. It is suggested that a complex interaction of multiple cell networks is required for the solution of the self-motion problem in the primate brain.

Scanned carbon beam irradiation of moving films: comparison of measured and calculated response

PubMed Central

2012-01-01

Background Treatment of moving target volumes with scanned particle beams benefits from treatment planning that includes the time domain (4D). Part of 4D treatment planning is calculation of the expected result. These calculation codes should be verified against suitable measurements. We performed simulations and measurements to validate calculation of the film response in the presence of target motion. Methods All calculations were performed with GSI's treatment planning system TRiP. Interplay patterns between scanned particle beams and moving film detectors are very sensitive to slight deviations of the assumed motion parameters and therefore ideally suited to validate 4D calculations. In total, 14 film motion parameter combinations with lateral motion amplitudes of 8, 15, and 20 mm and 4 combinations for lateral motion including range changes were used. Experimental and calculated film responses were compared by relative difference, mean deviation in two regions-of-interest, as well as line profiles. Results Irradiations of stationary films resulted in a mean relative difference of -1.52% ± 2.06% of measured and calculated responses. In comparison to this reference result, measurements with translational film motion resulted in a mean difference of -0.92% ± 1.30%. In case of irradiations incorporating range changes with a stack of 5 films as detector the deviations increased to -6.4 ± 2.6% (-10.3 ± 9.0% if film in distal fall-off is included) in comparison to -3.6% ± 2.5% (-13.5% ± 19.9% including the distal film) for the stationary irradiation. Furthermore, the comparison of line profiles of 4D calculations and experimental data showed only slight deviations at the borders of the irradiated area. The comparisons of pure lateral motion were used to determine the number of motion states that are required for 4D calculations depending on the motion amplitude. 6 motion states per 10 mm motion amplitude are sufficient to calculate the film response in the presence of motion. Conclusions By comparison to experimental data, the 4D extension of GSI's treatment planning system TRiP has been successfully validated for film response calculations in the presence of target motion within the accuracy limitation given by film-based dosimetry. PMID:22462523

Analysis of multilayer and single layer X-ray detectors for contrast-enhanced mammography using imaging task

NASA Astrophysics Data System (ADS)

Allec, Nicholas; Abbaszadeh, Shiva; Karim, Karim S.

2011-03-01

A multilayer (single-shot) detector has previously been proposed for contrast-enhanced mammography. The multilayer detector has the benefit of avoiding motion artifacts due to simultaneous acquisition of both high and low energy images. A single layer (dual-shot) detector has the benefit of better control over the energy separation since the incident beams can be produced and filtered separately. In this paper the performance of the multilayer detector is compared to that of a single layer detector using an ideal observer detectability index which is determined from an extended cascaded systems model and a defined imaging task. The detectors are assumed to have amorphous selenium direct conversion layers, however the same theoretical techniques used here may be applied to other types of integrating detectors. The anatomical noise caused by variation of glandularity within the breast is known to dominate the noise power spectrum at low frequencies due to its inverse power law dependence and is thus taken into account in our model to provide an accurate estimate of the detectability index. The conditions leading to the optimal detectability index, such as tube voltage, filtration, and weight factor are reported for both detector designs.

A Role for MST Neurons in Heading Estimation

NASA Technical Reports Server (NTRS)

Stone, L. S.; Perrone, J. A.

1994-01-01

A template model of human visual self-motion perception, which uses neurophysiologically realistic "heading detectors", is consistent with numerous human psychophysical results including the failure of humans to estimate their heading (direction of forward translation) accurately under certain visual conditions. We tested the model detectors with stimuli used by others in single-unit studies. The detectors showed emergent properties similar to those of MST neurons: (1) Sensitivity to non-preferred flow; Each detector is tuned to a specific combination of flow components and its response is systematically reduced by the addition of nonpreferred flow, and (2) Position invariance; The detectors maintain their apparent preference for particular flow components over large regions of their receptive fields. It has been argued that this latter property is incompatible with MST playing a role in heading perception. The model however demonstrates how neurons with the above response properties could still support accurate heading estimation within extrastriate cortical maps.

Simulation of Top Quark Pair Production as a Background for Higgs Events at the Compact Muon Solenoid

NASA Astrophysics Data System (ADS)

Justus, Christopher

2005-04-01

In this study, we simulated top-antitop (tt-bar) quark events at the Compact Muon Solenoid (CMS), an experiment presently being constructed at the Large Hadron Collider in Geneva, Switzerland. The tt-bar process is an important background for Higgs events. We used a chain of software to simulate and reconstruct processes that will occur inside the detector. CMKIN was used to generate and store Monte Carlo Events. OSCAR, a GEANT4 based CMS detector simulator, was used to simulate the CMS detector and how particles would interact with the detector. Next, we used ORCA to simulate the response of the readout electronics at CMS. Last, we used the Jet/MET Root maker to create root files of jets and missing energy. We are now using this software analysis chain to complete a systematic study of initial state radiation at hadron colliders. This study is essential because tt-bar is the main background for the Higgs boson and these processes are extremely sensitive to initial state radiation. Results of our initial state radiation study will be presented. We started this study at the new LHC Physics Center (LPC) located at Fermi National Accelerator Laboratory, and we are now completing the study at the University of Rochester.

Wrapping cytochrome c around single-wall carbon nanotube: engineered nanohybrid building blocks for infrared detection at high quantum efficiency

PubMed Central

Gong, Youpin; Liu, Qingfeng; Wilt, Jamie Samantha; Gong, Maogang; Ren, Shenqiang; Wu, Judy

2015-01-01

Biomolecule cytochrome c (Cty c), a small molecule of a chain of amino acids with extraordinary electron transport, was helically wrapped around a semiconductive single-wall carbon nanotube (s-SWCNT) to form a molecular building block for uncooled infrared detection with two uniquely designed functionalities: exciton dissociation to free charge carriers at the heterojunction formed on the s-SWCNT/Cty c interface and charge transport along the electron conducting chain of Cty c (acceptor) and hole conducting channel through s-SWCNT (donor). Such a design aims at addressing the long-standing challenges in exciton dissociation and charge transport in an SWCNT network, which have bottlenecked development of photonic SWCNT-based infrared detectors. Using these building blocks, uncooled s-SWCNT/Cyt c thin film infrared detectors were synthesized and shown to have extraordinary photoresponsivity up to 0.77 A W−1 due to a high external quantum efficiency (EQE) in exceeding 90%, which represents a more than two orders of magnitude enhancement than the best previously reported on CNT-based infrared detectors with EQE of only 1.72%. From a broad perspective, this work on novel s-SWCNT/Cyt c nanohybrid infrared detectors has developed a successful platform of engineered carbon nanotube/biomolecule building blocks with superior properties for optoelectronic applications. PMID:26066737

Wrapping cytochrome c around single-wall carbon nanotube: engineered nanohybrid building blocks for infrared detection at high quantum efficiency.

PubMed

Gong, Youpin; Liu, Qingfeng; Wilt, Jamie Samantha; Gong, Maogang; Ren, Shenqiang; Wu, Judy

2015-06-11

Biomolecule cytochrome c (Cty c), a small molecule of a chain of amino acids with extraordinary electron transport, was helically wrapped around a semiconductive single-wall carbon nanotube (s-SWCNT) to form a molecular building block for uncooled infrared detection with two uniquely designed functionalities: exciton dissociation to free charge carriers at the heterojunction formed on the s-SWCNT/Cty c interface and charge transport along the electron conducting chain of Cty c (acceptor) and hole conducting channel through s-SWCNT (donor). Such a design aims at addressing the long-standing challenges in exciton dissociation and charge transport in an SWCNT network, which have bottlenecked development of photonic SWCNT-based infrared detectors. Using these building blocks, uncooled s-SWCNT/Cyt c thin film infrared detectors were synthesized and shown to have extraordinary photoresponsivity up to 0.77 A W(-1) due to a high external quantum efficiency (EQE) in exceeding 90%, which represents a more than two orders of magnitude enhancement than the best previously reported on CNT-based infrared detectors with EQE of only 1.72%. From a broad perspective, this work on novel s-SWCNT/Cyt c nanohybrid infrared detectors has developed a successful platform of engineered carbon nanotube/biomolecule building blocks with superior properties for optoelectronic applications.

Defining the computational structure of the motion detector in Drosophila

PubMed Central

Clark, Damon A.; Bursztyn, Limor; Horowitz, Mark; Schnitzer, Mark J.; Clandinin, Thomas R.

2011-01-01

SUMMARY Many animals rely on visual motion detection for survival. Motion information is extracted from spatiotemporal intensity patterns on the retina, a paradigmatic neural computation. A phenomenological model, the Hassenstein-Reichardt Correlator (HRC), relates visual inputs to neural and behavioral responses to motion, but the circuits that implement this computation remain unknown. Using cell-type specific genetic silencing, minimal motion stimuli, and in vivo calcium imaging, we examine two critical HRC inputs. These two pathways respond preferentially to light and dark moving edges. We demonstrate that these pathways perform overlapping but complementary subsets of the computations underlying the HRC. A numerical model implementing differential weighting of these operations displays the observed edge preferences. Intriguingly, these pathways are distinguished by their sensitivities to a stimulus correlation that corresponds to an illusory percept, “reverse phi”, that affects many species. Thus, this computational architecture may be widely used to achieve edge selectivity in motion detection. PMID:21689602

Dynamic Positron Emission Tomography [PET] in Man Using Small Bismuth Germanate Crystals

DOE R&D Accomplishments Database

Derenzo, S. E.; Budinger, T. F.; Huesman, R. H.; Cahoon, J. L.

1982-04-01

Primary considerations for the design of positron emission tomographs for medical studies in humans are the need for high imaging sensitivity, whole organ coverage, good spatial resolution, high maximum data rates, adequate spatial sampling with minimum mechanical motion, shielding against out of plane activity, pulse height discrimination against scattered photons, and timing discrimination against accidental coincidences. We discuss the choice of detectors, sampling motion, shielding, and electronics to meet these objectives.

The coupling effects of kinematics and flexibility on the Lagrangian dynamic formulation of open chain deformable links

NASA Technical Reports Server (NTRS)

Changizi, Koorosh

1989-01-01

A nonlinear Lagrangian formulation for the spatial kinematic and dynamic analysis of open chain deformable links consisting of cylindrical joints that connect pairs of flexible links is developed. The special cases of revolute or prismatic joint can also be obtained from the kinematic equations. The kinematic equations are described using a 4x4 matrix method. The configuration of each deformable link in the open loop kinematic chain is identified using a coupled set of relative joint variables, constant geometric parameters, and elastic coordinates. The elastic coordinates define the link deformation with respect to a selected joint coordinate system that is consistent with the kinematic constraints on the boundary of the deformable link. These coordinates can be introduced using approximation techniques such as Rayleigh-Ritz method, finite element technique or any other desired approach. The large relative motion between two neighboring links are defined by a set of joint coordinates which describes the large relative translational and rotational motion between two neighboring joint coordinate systems. The origin of these coordinate systems are rigidly attached to the neighboring links at the joint definition points along the axis of motion.

Note: A simple picture of subdiffusive polymer motion from stochastic simulations

NASA Astrophysics Data System (ADS)

Gniewek, Pawel; Kolinski, Andrzej

2011-02-01

Entangled polymer solutions and melts exhibit unusual frictional properties. In the entanglement limit self-diffusion coefficient of long flexible polymers decays with the second power of chain length and viscosity increases with 3-3.5 power of chain length.1 It is very difficult to provide detailed molecular-level explanation of the entanglement effect.2 Perhaps, the problem of many entangled polymer chains is the most complex multibody issue of classical physics. There are different approaches to polymer melt dynamics. Some of these recognize hydrodynamic interactions as a dominant term, while topological constraints for polymer chains are assumed as a secondary factor. Other theories consider the topological constraints as the most important factors controlling polymer dynamics. Herman and co-workers describe polymer dynamics in melts, as a lateral sliding of a chain along other chains until complete mutual disentanglement. Despite the success in explaining the power-laws for viscosity, the model has some limitations. First of all, memory effects are ignored, that is, polymer segments are treated independently. Also, each entanglement/obstacle is treated as a separate entity, which is certainly a simplification of the memory effect problem. In addition to that, correlated motions of segments are addressed within the framework of renormalized Rouse-chain theory,7 without calling any topological entanglements in advance. This approach leads to the generalized Langevin equation characterized by distinct memory kernels describing local and nonlocal segment correlations or to the Smoluchowski equation in which the segments' mobility is treated as a stochastic variable.11 Both models describe the polymer segments motion at a microscopic level. An interesting alternative is to solve the integrodifferential equation for the chain relaxation with a sophisticated kernel function.12 The design of the kernel function is based on a mesoscopic description of the polymer melt. These theories explain some experimental data, although the description of the crossover between the Rouse and non-Rouse behavior is not satisfactory. Obviously, within the scope of a short note we cannot review all theoretical concepts of the polymer melt dynamics. Here we focus just on the interpretation of the observed single segment autocorrelation function.

Future of ePix detectors for high repetition rate FELs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blaj, G., E-mail: blaj@slac.stanford.edu; Caragiulo, P.; Carini, G.

2016-07-27

Free-electron lasers (FELs) made the imaging of atoms and molecules in motion possible, opening new science opportunities with high brilliance, ultra-short x-ray laser pulses at up to 120 Hz. Some new or upgraded FEL facilities will operate at greatly increased pulse rates (kHz to MHz), presenting additional requirements on detection. We will present the ePix platform for x-ray detectors and the current status of the ePix detectors: ePix100 for low noise applications, ePix10k for high dynamic range applications, and ePixS for spectroscopic applications. Then we will introduce the plans to match the ePix detectors with the requirements of currently plannedmore » high repetition rate FELs (mainly readout speed and energy range).« less

Production, characterization and operation of $$^{76}$$Ge enriched BEGe detectors in GERDA

DOE PAGES

Agostini, M.; Allardt, M.; Andreotti, E.; ...

2015-02-03

The GERmanium Detector Array (Gerda) at the Gran Sasso Underground Laboratory (LNGS) searches for the neutrinoless double beta decay (0νββ) of 76Ge. Germanium detectors made of material with an enriched 76Ge fraction act simultaneously as sources and detectors for this decay. During Phase I of theexperiment mainly refurbished semi-coaxial Ge detectors from former experiments were used. For the upcoming Phase II, 30 new 76 Ge enriched detectors of broad energy germanium (BEGe)-type were produced. A subgroup of these detectors has already been deployed in Gerda during Phase I. The present article reviews the complete production chain of these BEGe detectors including isotopic enrichment,more » purification, crystal growth and diode production. The efforts in optimizing the mass yield and in minimizing the exposure of the 76Ge enriched germanium to cosmic radiation during processing are described. Furthermore, characterization measurements in vacuum cryostats of the first subgroup of seven BEGe detectors and their long-term behavior in liquid argon are discussed. Lastly, the detector performance fulfills the requirements needed for the physics goals of Gerda Phase II.« less

The upper spatial limit for perception of displacement is affected by preceding motion.

PubMed

Stefanova, Miroslava; Mateeff, Stefan; Hohnsbein, Joachim

2009-03-01

The upper spatial limit D(max) for perception of apparent motion of a random dot pattern may be strongly affected by another, collinear, motion that precedes it [Mateeff, S., Stefanova, M., &. Hohnsbein, J. (2007). Perceived global direction of a compound of real and apparent motion. Vision Research, 47, 1455-1463]. In the present study this phenomenon was studied with two-dimensional motion stimuli. A random dot pattern moved alternately in the vertical and oblique direction (zig-zag motion). The vertical motion was of 1.04 degrees length; it was produced by three discrete spatial steps of the dots. Thereafter the dots were displaced by a single spatial step in oblique direction. Each motion lasted for 57ms. The upper spatial limit for perception of the oblique motion was measured under two conditions: the vertical component of the oblique motion and the vertical motion were either in the same or in opposite directions. It was found that the perception of the oblique motion was strongly influenced by the relative direction of the vertical motion that preceded it; in the "same" condition the upper spatial limit was much shorter than in the "opposite" condition. Decreasing the speed of the vertical motion reversed this effect. Interpretations based on networks of motion detectors and on Gestalt theory are discussed.

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

Phospholipid bilayer relaxation dynamics as revealed by the pulsed electron-electron double resonance of spin labels

NASA Astrophysics Data System (ADS)

Syryamina, V. N.; Dzuba, S. A.

2012-10-01

Electron paramagnetic resonance (EPR) spectroscopy in the form of pulsed electron-electron double resonance (ELDOR) was applied to 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) phospholipid bilayers containing lipids that were spin-labeled at different carbon positions along the lipid acyl chain. Pulsed ELDOR detects motionally induced spin flips of nitrogen nuclei in the nitroxide spin labels, which manifests itself as magnetization transfer (MT) in the nitroxide EPR spectrum. The MT effect was observed over a wide temperature range (100-225 K) on a microsecond time scale. In line with a previous study on molecular glasses [N. P. Isaev and S. A. Dzuba, J. Chem. Phys. 135, 094508 (2011), 10.1063/1.3633241], the motions that induce MT effect were suggested to have the same nature as those in dielectric secondary (β) Johari-Goldstein fast relaxation. The results were compared with literature dielectric relaxation data for POPC bilayers, revealing some common features. Molecular motions resulting in MT are faster for deeper spin labels in the membrane interior. The addition of cholesterol to the bilayer suppresses the lipid motions near the steroid nucleus and accelerates the lipid motions beyond the steroid nucleus, in the bilayer interior. This finding was attributed to the lipid acyl chains being more ordered near the steroid nucleus and less ordered in the bilayer interior. The motions are absent in dry lipids, indicating that the motions are determined by intermolecular interactions in the bilayer.

Characterization of a detector chain using a FPGA-based time-to-digital converter to reconstruct the three-dimensional coordinates of single particles at high flux

NASA Astrophysics Data System (ADS)

Nogrette, F.; Heurteau, D.; Chang, R.; Bouton, Q.; Westbrook, C. I.; Sellem, R.; Clément, D.

2015-11-01

We report on the development of a novel FPGA-based time-to-digital converter and its implementation in a detection chain that records the coordinates of single particles along three dimensions. The detector is composed of micro-channel plates mounted on top of a cross delay line and connected to fast electronics. We demonstrate continuous recording of the timing signals from the cross delay line at rates up to 4.1 × 106 s-1 and three-dimensional reconstruction of the coordinates up to 3.2 × 106 particles per second. From the imaging of a calibrated structure we measure the in-plane resolution of the detector to be 140(20) μm at a flux of 3 × 105 particles per second. In addition, we analyze a method to estimate the resolution without placing any structure under vacuum, a significant practical improvement. While we use UV photons here, the results of this work apply to the detection of other kinds of particles.

Mobile user identity sensing using the motion sensor

NASA Astrophysics Data System (ADS)

Zhao, Xi; Feng, Tao; Xu, Lei; Shi, Weidong

2014-05-01

Employing mobile sensor data to recognize user behavioral activities has been well studied in recent years. However, to adopt the data as a biometric modality has rarely been explored. Existing methods either used the data to recognize gait, which is considered as a distinguished identity feature; or segmented a specific kind of motion for user recognition, such as phone picking-up motion. Since the identity and the motion gesture jointly affect motion data, to fix the gesture (walking or phone picking-up) definitively simplifies the identity sensing problem. However, it meanwhile introduces the complexity from gesture detection or requirement on a higher sample rate from motion sensor readings, which may draw the battery fast and affect the usability of the phone. In general, it is still under investigation that motion based user authentication in a large scale satisfies the accuracy requirement as a stand-alone biometrics modality. In this paper, we propose a novel approach to use the motion sensor readings for user identity sensing. Instead of decoupling the user identity from a gesture, we reasonably assume users have their own distinguishing phone usage habits and extract the identity from fuzzy activity patterns, represented by a combination of body movements whose signals in chains span in relative low frequency spectrum and hand movements whose signals span in relative high frequency spectrum. Then Bayesian Rules are applied to analyze the dependency of different frequency components in the signals. During testing, a posterior probability of user identity given the observed chains can be computed for authentication. Tested on an accelerometer dataset with 347 users, our approach has demonstrated the promising results.

Traveling-wave solutions in continuous chains of unidirectionally coupled oscillators

NASA Astrophysics Data System (ADS)

Glyzin, S. D.; Kolesov, A. Yu; Rozov, N. Kh

2017-12-01

Proposed is a mathematical model of a continuous annular chain of unidirectionally coupled generators given by certain nonlinear advection-type hyperbolic boundary value problem. Such problems are constructed by a limit transition from annular chains of unidirectionally coupled ordinary differential equations with an unbounded increase in the number of links. It is shown that any preassigned finite number of stable periodic motions of the traveling-wave type can coexist in the model.

Motion detector and analyzer

DOEpatents

Unruh, W.P.

1987-03-23

Method and apparatus are provided for deriving positive and negative Doppler spectrum to enable analysis of objects in motion, and particularly, objects having rotary motion. First and second returned radar signals are mixed with internal signals to obtain an in-phase process signal and a quadrature process signal. A broad-band phase shifter shifts the quadrature signal through 90/degree/ relative to the in-phase signal over a predetermined frequency range. A pair of signals is output from the broad-band phase shifter which are then combined to provide a first side band signal which is functionally related to a negative Doppler shift spectrum. The distinct positive and negative Doppler spectra may then be analyzed for the motion characteristics of the object being examined.

Collision of Identical Solitary Waves in Hertzian Chains

NASA Astrophysics Data System (ADS)

Sen, Surajit; Manciu, Marian; Hurd, Alan J.

2000-03-01

We consider a chain of elastic beads, which repel upon contact according to the non-linear Hertz potential. We further assume that the chain is under zero loading, i.e., the grains have zero initial overlap. We show via careful numerical solution of the equations of motion that an impulse propagates as a solitary wave and that the collision of identical solitary waves propagating in opposite directions along the chain spawns a hierarchy of multiple weak solitary waves [1]. [1] M. Manciu, S. Sen and A.J. Hurd, Phys Lett A (submitted).

A CBLT and MCST capable VME slave interface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wuerthwein, F.; Strohman, C.; Honscheid, K.

1996-12-31

We report on the development of a VME slave interface for the CLEO III detector implemented in an ALTERA EPM7256 CPLD. This includes the first implementation of the chained block transfer protocol (CBLT) and multi-cast cycles (MCST) as defined by the VME-P task group of VIPA. Within VME64 there is no operation that guarantees efficient readout of large blocks of data that are sparsely distributed among a series of slave modules in a VME crate. This has led the VME-P task group of VIPA to specify protocols that enable a master to address many slaves at a single address. Whichmore » slave is to drive the data bus is determined by a token passing mechanism that uses the *IACKOUT, *IACKIN daisy chain. This protocol requires no special features from the master besides conformance to VME64. Non-standard features are restricted to the VME slave interface. The CLEO III detector comprises {approximately}400,000 electronic channels that have to be digitized, sparsified, and stored within 20{mu}s in order to incur less than 2% dead time at an anticipated trigger rate of 1000Hz. 95% of these channels are accounted for by only two detector subsystems, the silicon microstrip detector (125,000 channels), and the ring imaging Cerenkov detector (RICH) (230,400 channels). After sparsification either of these two detector subsystems is expected to provide event fragments on the order of 10KBytes, spread over 4, and 8 VME crates, respectively. We developed a chip set that sparsifies, tags, and stores the incoming digital data on the data boards, and includes a VME slave interface that implements MCST and CUT protocols. In this poster, we briefly describe this chip set and then discuss the VME slave interface in detail.« less

Pinhole/coronograph pointing control system integration and noise reduction analysis

NASA Technical Reports Server (NTRS)

Greene, M.

1981-01-01

The Pinhole Occulter Facility (P/OF) is a Space Shuttle based experiment for the production of solar coronographics and hard X-ray images. The system is basically pinhole camera utilizing a deployable 50-m flexible boom for separating the pinholes and coronograph shields from the recording devices located in the Shuttle bay. At the distal end of the boom from the Shuttle is a 25 kg mask containing pinholes and coronograph shields. At the proximal end the detectors are located and mounted, along with the deployable boom, to the ASPS gimbal pointing system (AGS). The mask must be pointed at the Sun with a high degree of pointing stability and accuracy to align the axes of the detectors with the pinholes and shields. Failure to do so will result in a blurring of the images on the detectors and a loss of resolution. Being a Shuttle based experiment, the system will be subjected to the disturbances of the Shuttle. The worst of these is thruster firing for orbit correction; the Shuttle uses a bang-bang thruster control system to maintain orbit to within preset limits. Other disturbances include man motion, motion induced by other systems, and gravity gradient torques.

Pinhole/coronograph pointing control system integration and noise reduction analysis

NASA Astrophysics Data System (ADS)

Greene, M.

1981-09-01

The Pinhole Occulter Facility (P/OF) is a Space Shuttle based experiment for the production of solar coronographics and hard X-ray images. The system is basically pinhole camera utilizing a deployable 50-m flexible boom for separating the pinholes and coronograph shields from the recording devices located in the Shuttle bay. At the distal end of the boom from the Shuttle is a 25 kg mask containing pinholes and coronograph shields. At the proximal end the detectors are located and mounted, along with the deployable boom, to the ASPS gimbal pointing system (AGS). The mask must be pointed at the Sun with a high degree of pointing stability and accuracy to align the axes of the detectors with the pinholes and shields. Failure to do so will result in a blurring of the images on the detectors and a loss of resolution. Being a Shuttle based experiment, the system will be subjected to the disturbances of the Shuttle. The worst of these is thruster firing for orbit correction; the Shuttle uses a bang-bang thruster control system to maintain orbit to within preset limits. Other disturbances include man motion, motion induced by other systems, and gravity gradient torques.

Origin of diverse time scales in the protein hydration layer solvation dynamics: A simulation study

NASA Astrophysics Data System (ADS)

Mondal, Sayantan; Mukherjee, Saumyak; Bagchi, Biman

2017-10-01

In order to inquire the microscopic origin of observed multiple time scales in solvation dynamics, we carry out several computer experiments. We perform atomistic molecular dynamics simulations on three protein-water systems, namely, lysozyme, myoglobin, and sweet protein monellin. In these experiments, we mutate the charges of the neighbouring amino acid side chains of certain natural probes (tryptophan) and also freeze the side chain motions. In order to distinguish between different contributions, we decompose the total solvation energy response in terms of various components present in the system. This allows us to capture the interplay among different self- and cross-energy correlation terms. Freezing the protein motions removes the slowest component that results from side chain fluctuations, but a part of slowness remains. This leads to the conclusion that the slow component approximately in the 20-80 ps range arises from slow water molecules present in the hydration layer. While the more than 100 ps component has multiple origins, namely, adjacent charges in amino acid side chains, hydrogen bonded water molecules and a dynamically coupled motion between side chain and water. In addition, the charges enforce a structural ordering of nearby water molecules and helps to form a local long-lived hydrogen bonded network. Further separation of the spatial and temporal responses in solvation dynamics reveals different roles of hydration and bulk water. We find that the hydration layer water molecules are largely responsible for the slow component, whereas the initial ultrafast decay arises predominantly (approximately 80%) due to the bulk. This agrees with earlier theoretical observations. We also attempt to rationalise our results with the help of a molecular hydrodynamic theory that was developed using classical time dependent density functional theory in a semi-quantitative manner.

Real-Time Detection of Rupture Development: Earthquake Early Warning Using P Waves From Growing Ruptures

NASA Astrophysics Data System (ADS)

Kodera, Yuki

2018-01-01

Large earthquakes with long rupture durations emit P wave energy throughout the rupture period. Incorporating late-onset P waves into earthquake early warning (EEW) algorithms could contribute to robust predictions of strong ground motion. Here I describe a technique to detect in real time P waves from growing ruptures to improve the timeliness of an EEW algorithm based on seismic wavefield estimation. The proposed P wave detector, which employs a simple polarization analysis, successfully detected P waves from strong motion generation areas of the 2011 Mw 9.0 Tohoku-oki earthquake rupture. An analysis using 23 large (M ≥ 7) events from Japan confirmed that seismic intensity predictions based on the P wave detector significantly increased lead times without appreciably decreasing the prediction accuracy. P waves from growing ruptures, being one of the fastest carriers of information on ongoing rupture development, have the potential to improve the performance of EEW systems.

An overview of LIGO and Virgo -- status and plans

NASA Astrophysics Data System (ADS)

Miller, John

2014-06-01

Interferometric gravitational-wave detectors, the most sensitive position meters ever operated, aim to detect the motion of massive bodies throughout the universe by pushing precision measurement to the standard quantum limit and beyond. A global network of these detectors is currently under construction, promising unprecedented sensitivity and the ability to determine the sky position of any detected signals. I will describe the current status and expected performance of this network with a focus on limiting noise sources and the techniques currently being developed to combat them.

SU-E-J-64: Feasibility Study of Surgical Clips for Fiducial Tracking in CyberKnife System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, H; Yoon, J; Lee, E

Purpose: To investigate the ability of CyberKnife to track surgical clips used as fiducial markers. Methods: The Octavius 1000SRS detector and solid water (RW3) slab phantom were used with motion platform to evaluate the study. The RW3 slab phantom was set up to measure the dose distribution from coronal plane. It consists of 9 plates and the thickness of each plate is 10mm. Among them, one plate was attached with 3 surgical clips, which are orthogonally positioned on outer region of array. The length of attached clip was represented as 1cm on planning CT. The clip plate was placed onmore » the 1000SRS detector and 3 slabs were stacked up on the plate to build the measuring depth. Below the detector, 5 slabs were set. The two-axis motion platform was programmed with 1D sinusoidal movement (20mm peak-to-peak, 3s period) toward superior/inferior and left/right directions to simulate target motion. During delivery, two clips were extracted by two X-ray imagers, which led to translational error correction only. Synchrony was also used for dynamic tracking. After the irradiation, the measured dose distribution of coronal plane was compared with the planar dose distribution calculated by the CyberKnife treatment planning system (Multiplan) for cross verification. The results were assessed by comparing the absolute Gamma (γ) index. Results: The dose distributions measured by the 1000SRS detector were in good agreements with those calculated by Multiplan. In the dosimetric comparison using γ-function criteria based on the distance-to-agreement of 3mm and the local dose difference of 3%, the passing rate with γ- parameter ≤1 was 91% in coronal plane. Conclusion: The surgical clips can be considered as new fiducials for robotic radiosurgery delivery by considering the target margin with less than 5mm.« less

Wireless Synchronization of a Multi-Pinhole Small Animal SPECT Collimation Device With a Clinical Scanner

NASA Astrophysics Data System (ADS)

DiFilippo, Frank P.; Patel, Sagar

2009-06-01

A multi-pinhole collimation device for small animal single photon emission computed tomography (SPECT) uses the gamma camera detectors of a standard clinical SPECT scanner. The collimator and animal bed move independently of the detectors, and therefore their motions must be synchronized. One approach is manual triggering of the SPECT acquisition simultaneously with a programmed motion sequence for the device. However, some data blurring and loss of image quality result, and true electronic synchronization is preferred. An off-the-shelf digital gyroscope with integrated Bluetooth interface provides a wireless solution to device synchronization. The sensor attaches to the SPECT gantry and reports its rotational speed to a notebook computer controlling the device. Software processes the rotation data in real-time, averaging the signal and issuing triggers while compensating for baseline drift. Motion commands are sent to the collimation device with minimal delay, within approximately 0.5 second of the start of SPECT gantry rotation. Test scans of a point source demonstrate an increase in true counts and a reduction in background counts compared to manual synchronization. The wireless rotation sensor provides robust synchronization of the collimation device with the clinical SPECT scanner and enhances image quality.

Gravitational Waves: A New Observational Window

NASA Technical Reports Server (NTRS)

Camp, Jordan B.

2010-01-01

The era of gravitational wave astronomy is rapidly approaching, with a likely start date around the middle of this decade ' Gravitational waves, emitted by accelerated motions of very massive objects, provide detailed information about strong-field gravity and its sources, including black holes and neutron stars, that electromagnetic probes cannot access. In this talk I will discuss the anticipated sources and the status of the extremely sensitive detectors (both ground and space based) that will make gravitational wave detections possible. As ground based detectors are now taking data, I will show some initial science results related to measured upper limits on gravitational wave signals. Finally Z will describe new directions including advanced detectors and joint efforts with other fields of astronomy.

Simulations of Liners and Test Objects for a New Atlas Advanced Radiography Source

DOE Office of Scientific and Technical Information (OSTI.GOV)

D. V. Morgan; S. Iversen; R. A. Hilko

2002-06-01

The Advanced Radiographic Source (ARS) will improve the data significantly due to its smaller source width. Because of the enhanced ARS output, larger source-to-object distances are a reality. The harder ARS source will allow radiography of thick high-Z targets. The five different spectral simulations resulted in similar imaging detector weighted transmission. This work used a limited set of test objects and imaging detectors. Other test objects and imaging detectors could possibly change the MVp-sensitivity result. The effect of material motion blur must be considered for the ARS due to the expected smaller X-ray source size. This study supports the originalmore » 1.5-MVp value.« less

Understanding the Physics of Bungee Jumping

ERIC Educational Resources Information Center

Heck, Andre; Uylings, Peter; Kedzierska, Ewa

2010-01-01

Changing mass phenomena like the motion of a falling chain, the behaviour of a falling elastic bar or spring, and the motion of a bungee jumper surprise many a physicist. In this article we discuss the first phase of bungee jumping, when the bungee jumper falls, but the bungee rope is still slack. In instructional material this phase is often…

Modeling and measuring the visual detection of ecologically relevant motion by an Anolis lizard.

PubMed

Pallus, Adam C; Fleishman, Leo J; Castonguay, Philip M

2010-01-01

Motion in the visual periphery of lizards, and other animals, often causes a shift of visual attention toward the moving object. This behavioral response must be more responsive to relevant motion (predators, prey, conspecifics) than to irrelevant motion (windblown vegetation). Early stages of visual motion detection rely on simple local circuits known as elementary motion detectors (EMDs). We presented a computer model consisting of a grid of correlation-type EMDs, with videos of natural motion patterns, including prey, predators and windblown vegetation. We systematically varied the model parameters and quantified the relative response to the different classes of motion. We carried out behavioral experiments with the lizard Anolis sagrei and determined that their visual response could be modeled with a grid of correlation-type EMDs with a spacing parameter of 0.3 degrees visual angle, and a time constant of 0.1 s. The model with these parameters gave substantially stronger responses to relevant motion patterns than to windblown vegetation under equivalent conditions. However, the model is sensitive to local contrast and viewer-object distance. Therefore, additional neural processing is probably required for the visual system to reliably distinguish relevant from irrelevant motion under a full range of natural conditions.

Nonlinear dust-lattice waves: a modified Toda lattice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cramer, N. F.

Charged dust grains in a plasma interact with a Coulomb potential, but also with an exponential component to the potential, due to Debye shielding in the background plasma. Here we investigate large-amplitude oscillations and waves in dust-lattices, employing techniques used in Toda lattice analysis. The lattice consists of a linear chain of particles, or a periodic ring as occurs in experimentally observed dust particle clusters. The particle motion has a triangular waveform, and chaotic motion for large amplitude motion of a grain.

Experimental realization of a metamaterial detector focal plane array.

PubMed

Shrekenhamer, David; Xu, Wangren; Venkatesh, Suresh; Schurig, David; Sonkusale, Sameer; Padilla, Willie J

2012-10-26

We present a metamaterial absorber detector array that enables room-temperature, narrow-band detection of gigahertz (GHz) radiation in the S band (2-4 GHz). The system is implemented in a commercial printed circuit board process and we characterize the detector sensitivity and angular dependence. A modified metamaterial absorber geometry allows for each unit cell to act as an isolated detector pixel and to collectively form a focal plane array . Each pixel can have a dedicated microwave receiver chain and functions together as a hybrid device tuned to maximize the efficiency of detected power. The demonstrated subwavelength pixel shows detected sensitivity of -77 dBm, corresponding to a radiation power density of 27 nW/m(2), with pixel to pixel coupling interference below -14 dB at 2.5 GHz.

Calibration of a large water-Cherenkov detector at the Sierra Negra site of LAGO

NASA Astrophysics Data System (ADS)

Galindo, A.; Moreno, E.; Carrasco, E.; Torres, I.; Carramiñana, A.; Bonilla, M.; Salazar, H.; Conde, R.; Alvarez, W.; Alvarez, C.; Araujo, C.; Areso, O.; Arnaldi, H.; Asorey, H.; Audelo, M.; Barros, H.; Bonnett, M.; Calderon, R.; Calderon, M.; Campos-Fauth, A.; Carramiñana, A.; Carrasco, E.; Carrera, E.; Cazar, D.; Cifuentes, E.; Collogo, D.; Conde, R.; Cotzomi, J.; Dasso, S.; De Castro, A.; De La Torre, J.; De León, R.; Estupiñan, A.; Galindo, A.; García, L.; Gomez Berisso, M.; González, M.; Guevara, W.; Gulisano, A. M.; Hernández, H.; Jaimes, A.; López, J.; Mantilla, C.; Martín, R.; Martinez-Mendez, A.; Martínez, O.; Martins, E.; Macías-Meza, J. J.; Mayo-García, R.; Melo, T.; Mendoza, J.; Miranda, P.; Montes, E.; Morales, E.; Morales, I.; Moreno, E.; Murrugarra, C.; Nina, C.; Núñez, L. A.; Núñez-Castiñeyra, A.; Otiniano, L.; Peña-Rodríguez, J.; Perenguez, J.; Pérez, H.; Pérez, Y.; Pérez, G.; Pinilla-Velandia, S.; Ponce, E.; Quishpe, R.; Quispe, F.; Ramelli, M.; Reyes, K.; Rivera, H.; Rodriguez, J.; Rodríguez-Ferreira, J.; Rodríguez-Pascual, M.; Romero, M.; Rubio-Montero, A. J.; Salazar, H.; Salinas, J.; Sarmiento-Cano, C.; Sidelnik, I.; Sofo Haro, M.; Suárez-Durán, M.; Subieta, M.; Tello, J.; Ticona, R.; Torres, I.; Torres-Niõ, L.; Truyenque, J.; Valencia-Otero, M.; Vargas, S.; Vásquez, N.; Villaseñor, L.; Zamalloa, M.; Zavala, L.; LAGO Collaboration

2017-07-01

The Latin American Giant Observatory (LAGO) is an international network of water-Cherenkov detectors (WCD) set in different sites across Latin America. On top of the Sierra Negra volcano in Mexico at an altitude of 4530 m, LAGO has completed its first out of three instrumented detector. It consists of a cylindrical water tank with a diameter of 7.3 m and a height of 1 m and a total detection area of 40 m2 that is sectioned in four equal slices. In this work we present the full calibration procedure of this detector and the initial measurements of stability in rate. We also derive the effective area to gamma-ray bursts for the complete array using the LAGO simulation chain, based on CORSIKA and GEANT4.

Experience from operating germanium detectors in GERDA

NASA Astrophysics Data System (ADS)

Palioselitis, Dimitrios; GERDA Collaboration

2015-05-01

Phase I of the Germanium Detector Array (GERDA) experiment, searching for the neutrinoless double beta (0νββ) decay of 76Ge, was completed in September 2013. The most competitive half-life lower limit for the 0νββ decay of 76Ge was set (T-0ν1/2 > 2.1 · 1025 yr at 90% C.L.). GERDA operates bare Ge diodes immersed in liquid argon. During Phase I, mainly refurbished semi-coaxial high purity Ge detectors from previous experiments were used. The experience gained with handling and operating bare Ge diodes in liquid argon, as well as the stability and performance of the detectors during GERDA Phase I are presented. Thirty additional new enriched BEGe-type detectors were produced and will be used in Phase II. A subgroup of these detectors has already been used successfully in GERDA Phase I. The present paper gives an overview of the production chain of the new germanium detectors, the steps taken to minimise the exposure to cosmic radiation during manufacturing, and the first results of characterisation measurements in vacuum cryostats.

Computerized method to compensate for breathing body motion in dynamic chest radiographs

NASA Astrophysics Data System (ADS)

Matsuda, H.; Tanaka, R.; Sanada, S.

2017-03-01

Dynamic chest radiography combined with computer analysis allows quantitative analyses on pulmonary function and rib motion. The accuracy of kinematic analysis is directly linked to diagnostic accuracy, and thus body motion compensation is a major concern. Our purpose in this study was to develop a computerized method to reduce a breathing body motion in dynamic chest radiographs. Dynamic chest radiographs of 56 patients were obtained using a dynamic flat-panel detector. The images were divided into a 1 cm-square and the squares on body counter were used to detect the body motion. Velocity vector was measured using cross-correlation method on the body counter and the body motion was then determined on the basis of the summation of motion vector. The body motion was then compensated by shifting the images based on the measured vector. By using our method, the body motion was accurately detected by the order of a few pixels in clinical cases, mean 82.5% in right and left directions. In addition, our method detected slight body motion which was not able to be identified by human observations. We confirmed our method effectively worked in kinetic analysis of rib motion. The present method would be useful for the reduction of a breathing body motion in dynamic chest radiography.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pal, Sambit Bikas; Haldar, Arijit; Roy, Basudev

A photonic force microscope comprises of an optically trapped micro-probe and a position detection system to track the motion of the probe. Signal collection for motion detection is often carried out using the backscattered light off the probe-however, this mode has problems of low S/N due to the small backscattering cross sections of the micro-probes typically used. The position sensors often used in these cases are quadrant photodetectors. To ensure maximum sensitivity of such detectors, it would help if the detector size matched with the detection beam radius after the condenser lens (which for backscattered detection would be the trappingmore » objective itself). To suit this condition, we have used a miniature displacement sensor whose dimensions makes it ideal to work with 1:1 images of micrometer-sized trapped probes in the backscattering detection mode. The detector is based on the quadrant photo-integrated chip in the optical pick-up head of a compact disc player. Using this detector, we measured absolute displacements of an optically trapped 1.1 {mu}m probe with a resolution of {approx}10 nm for a bandwidth of 10 Hz at 95% significance without any sample or laser stabilization. We characterized our optical trap for different sized probes by measuring the power spectrum for each probe to 1% accuracy, and found that for 1.1 {mu}m diameter probes, the noise in our position measurement matched the thermal resolution limit for averaging times up to 10 ms. We also achieved a linear response range of around 385 nm with cross talk between axes {approx_equal}4% for 1.1 {mu}m diameter probes. The detector has extremely high bandwidth (few MHz) and low optical power threshold-other factors that can lead to its widespread use in photonic force microscopy.« less

Orientation selectivity sharpens motion detection in Drosophila

PubMed Central

Fisher, Yvette E.; Silies, Marion; Clandinin, Thomas R.

2015-01-01

SUMMARY Detecting the orientation and movement of edges in a scene is critical to visually guided behaviors of many animals. What are the circuit algorithms that allow the brain to extract such behaviorally vital visual cues? Using in vivo two-photon calcium imaging in Drosophila, we describe direction selective signals in the dendrites of T4 and T5 neurons, detectors of local motion. We demonstrate that this circuit performs selective amplification of local light inputs, an observation that constrains motion detection models and confirms a core prediction of the Hassenstein-Reichardt Correlator (HRC). These neurons are also orientation selective, responding strongly to static features that are orthogonal to their preferred axis of motion, a tuning property not predicted by the HRC. This coincident extraction of orientation and direction sharpens directional tuning through surround inhibition and reveals a striking parallel between visual processing in flies and vertebrate cortex, suggesting a universal strategy for motion processing. PMID:26456048

Rotational waves in geodynamics

NASA Astrophysics Data System (ADS)

Gerus, Artyom; Vikulin, Alexander

2015-04-01

The rotation model of a geoblock with intrinsic momentum was constructed by A.V. Vikulin and A.G. Ivanchin [9, 10] to describe seismicity within the Pacific Ocean margin. It is based on the idea of a rotational motion of geoblocks as the parts of the rotating body of the Earth that generates rotary deformation waves. The law of the block motion was derived in the form of the sine-Gordon equation (SG) [5, 9]; the dimensionless form of the equation is: δ2θ δ2θ δξ2 - δη2 = sinθ, (1) where θ = β/2, ξ = k0z and η = v0k0t are dimensionless coordinates, z - length of the chain of masses (blocks), t - time, β - turn angle, ν0 - representative velocity of the process, k0 - wave number. Another case analyzed was a chain of nonuniformly rotating blocks, with deviation of force moments from equilibrium positions μ, considering friction forces α along boundaries, which better matched a real-life seismic process. As a result, the authors obtained the law of motion for a block in a chain in the form of the modified SG equation [8]: δ2θ δ2θ δθ- δξ2 - δ η2 = sin θ+ α δη + μδ(ξ)sin θ (2)

Marker-based reconstruction of the kinematics of a chain of segments: a new method that incorporates joint kinematic constraints.

PubMed

Klous, Miriam; Klous, Sander

2010-07-01

The aim of skin-marker-based motion analysis is to reconstruct the motion of a kinematical model from noisy measured motion of skin markers. Existing kinematic models for reconstruction of chains of segments can be divided into two categories: analytical methods that do not take joint constraints into account and numerical global optimization methods that do take joint constraints into account but require numerical optimization of a large number of degrees of freedom, especially when the number of segments increases. In this study, a new and largely analytical method for a chain of rigid bodies is presented, interconnected in spherical joints (chain-method). In this method, the number of generalized coordinates to be determined through numerical optimization is three, irrespective of the number of segments. This new method is compared with the analytical method of Veldpaus et al. [1988, "A Least-Squares Algorithm for the Equiform Transformation From Spatial Marker Co-Ordinates," J. Biomech., 21, pp. 45-54] (Veldpaus-method, a method of the first category) and the numerical global optimization method of Lu and O'Connor [1999, "Bone Position Estimation From Skin-Marker Co-Ordinates Using Global Optimization With Joint Constraints," J. Biomech., 32, pp. 129-134] (Lu-method, a method of the second category) regarding the effects of continuous noise simulating skin movement artifacts and regarding systematic errors in joint constraints. The study is based on simulated data to allow a comparison of the results of the different algorithms with true (noise- and error-free) marker locations. Results indicate a clear trend that accuracy for the chain-method is higher than the Veldpaus-method and similar to the Lu-method. Because large parts of the equations in the chain-method can be solved analytically, the speed of convergence in this method is substantially higher than in the Lu-method. With only three segments, the average number of required iterations with the chain-method is 3.0+/-0.2 times lower than with the Lu-method when skin movement artifacts are simulated by applying a continuous noise model. When simulating systematic errors in joint constraints, the number of iterations for the chain-method was almost a factor 5 lower than the number of iterations for the Lu-method. However, the Lu-method performs slightly better than the chain-method. The RMSD value between the reconstructed and actual marker positions is approximately 57% of the systematic error on the joint center positions for the Lu-method compared with 59% for the chain-method.

Scene-based nonuniformity correction with video sequences and registration.

PubMed

Hardie, R C; Hayat, M M; Armstrong, E; Yasuda, B

2000-03-10

We describe a new, to our knowledge, scene-based nonuniformity correction algorithm for array detectors. The algorithm relies on the ability to register a sequence of observed frames in the presence of the fixed-pattern noise caused by pixel-to-pixel nonuniformity. In low-to-moderate levels of nonuniformity, sufficiently accurate registration may be possible with standard scene-based registration techniques. If the registration is accurate, and motion exists between the frames, then groups of independent detectors can be identified that observe the same irradiance (or true scene value). These detector outputs are averaged to generate estimates of the true scene values. With these scene estimates, and the corresponding observed values through a given detector, a curve-fitting procedure is used to estimate the individual detector response parameters. These can then be used to correct for detector nonuniformity. The strength of the algorithm lies in its simplicity and low computational complexity. Experimental results, to illustrate the performance of the algorithm, include the use of visible-range imagery with simulated nonuniformity and infrared imagery with real nonuniformity.

The Detection of Gravitational Waves

NASA Astrophysics Data System (ADS)

Blair, David G.

2005-10-01

Part I. An Introduction to Gravitational Waves and Methods for their Detection: 1. Gravitational waves in general relativity D. G. Blair; 2. Sources of gravitational waves D. G. Blair; 3. Gravitational wave detectors D. G. Blair; Part II. Gravitational Wave Detectors: 4. Resonant-bar detectors D. G. Blair; 5. Gravity wave dewars W. O. Hamilton; 6. Internal friction in high Q materials J. Ferreirinko; 7. Motion amplifiers and passive transducers J. P. Richard; 8. Parametric transducers P. J. Veitch; 9. Detection of continuous waves K. Tsubono; 10. Data analysis and algorithms for gravitational wave-antennas G. V. Paalottino; Part III. Laser Interferometer Antennas: 11. A Michelson interferometer using delay lines W. Winkler; 12. Fabry-Perot cavity gravity-wave detectors R. W. P. Drever; 13. The stabilisation of lasers for interferometric gravitational wave detectors J. Hough; 14. Vibration isolation for the test masses in interferometric gravitational wave detectors N. A. Robertson; 15. Advanced techniques A. Brillet; 16. Data processing, analysis and storage for interferometric antennas B. F. Schutz; 17. Gravitational wave detection at low and very low frequencies R. W. Hellings.

Detector system dose verification comparisons for arc therapy: couch vs. gantry mount

PubMed Central

Manikandan, Arjunan; Nandy, Maitreyee; Sureka, Chandra Sekaran; Gossman, Michael S.; Sujatha, Nadendla; Rajendran, Vivek Thirupathur

2014-01-01

The aim of this study was to assess the performance of a gantry‐mounted detector system and a couch set detector system using a systematic multileaf collimator positional error manually introduced for volumetric‐modulated arc therapy. Four head and neck and esophagus VMAT plans were evaluated by measurement using an electronic portal imaging device and an ion chamber array. Each plan was copied and duplicated with a 1 mm systematic MLC positional error in the left leaf bank. Direct comparison of measurements for plans with and without the error permitted observational characteristics for quality assurance performance between detectors. A total of 48 different plans were evaluated for this testing. The mean percentage planar dose differences required to satisfy a 95% match between plans with and without the MLCPE were 5.2% ± 0.5% for the chamber array with gantry motion, 8.12% ± 1.04% for the chamber array with a static gantry at 0°, and 10.9% ± 1.4% for the EPID with gantry motion. It was observed that the EPID was less accurate due to overresponse of the MLCPE in the left leaf bank. The EPID always images bank‐A on the ipsilateral side of the detector, whereas for a chamber array or for a patient, that bank changes as it crosses the ‐90° or +90° position. A couch set detector system can reproduce the TPS calculated values most consistently. We recommend it as the most reliable patient specific QA system for MLC position error testing. This research is highlighted by the finding of up to 12.7% dose variation for H/N and esophagus cases for VMAT delivery, where the mere source of error was the stated clinically acceptability of 1 mm MLC position deviation of TG‐142. PACS numbers: 87.56.‐v, 87.55.‐x, 07.57.KP, 29.40.‐n, 85.25.Pb PMID:24892330

Buffering effect in continuous chains of unidirectionally coupled generators

NASA Astrophysics Data System (ADS)

Glyzin, S. D.; Kolesov, A. Yu.; Rozov, N. Kh.

2014-11-01

We propose a mathematical model of a continuous annular chain of unidirectionally coupled generators given by some nonlinear advection-type hyperbolic boundary value problem. Such problems are constructed by a limit transition from annular chains of unidirectionally coupled ordinary differential equations with an unbounded increase in the number of links. We find that a certain buffering phenomenon is realized in our boundary value problem. Namely, we show that any preassigned finite number of stable periodic motions of the traveling-wave type can coexist in the model.

Defining the computational structure of the motion detector in Drosophila.

PubMed

Clark, Damon A; Bursztyn, Limor; Horowitz, Mark A; Schnitzer, Mark J; Clandinin, Thomas R

2011-06-23

Many animals rely on visual motion detection for survival. Motion information is extracted from spatiotemporal intensity patterns on the retina, a paradigmatic neural computation. A phenomenological model, the Hassenstein-Reichardt correlator (HRC), relates visual inputs to neural activity and behavioral responses to motion, but the circuits that implement this computation remain unknown. By using cell-type specific genetic silencing, minimal motion stimuli, and in vivo calcium imaging, we examine two critical HRC inputs. These two pathways respond preferentially to light and dark moving edges. We demonstrate that these pathways perform overlapping but complementary subsets of the computations underlying the HRC. A numerical model implementing differential weighting of these operations displays the observed edge preferences. Intriguingly, these pathways are distinguished by their sensitivities to a stimulus correlation that corresponds to an illusory percept, "reverse phi," that affects many species. Thus, this computational architecture may be widely used to achieve edge selectivity in motion detection. Copyright © 2011 Elsevier Inc. All rights reserved.

Idea Project Final Report, Laser Vehicle Detector-Classifier

DOT National Transportation Integrated Search

1995-11-28

WEIGH-IN-MOTION OR WIM, COMMERCIAL VEHICLE OPERATIONS OR CVO : THIS INVESTIGATION WAS COMPLETED AS PART OF THE ITS-IDEA PROGRAM, WHICH IS ONE OF THREE IDEA PROGRAMS MANAGED BY THE TRANSPORTATION RESEARCH BOARD (TRB) TO FOSTER INNOVATIONS IN SURFAC...

Movie of the structural changes during a catalytic cycle of nucleoside monophosphate kinases.

PubMed

Vonrhein, C; Schlauderer, G J; Schulz, G E

1995-05-15

There are 17 crystal structures of nucleoside monophosphate kinases known. As expected for kinases, they show large conformational changes upon binding of substrates. These are concentrated in two chain segments, or domains, of 30 and 38 residues that are involved in binding of the substrates N1TP and N2MP (nucleoside tri- and monophosphates with bases N1 and N2), respectively. After aligning the 17 structures on the main parts of their polypeptide chains, two domains in various conformational states were revealed. These states were caused by bound substrate (or analogues) and by crystal-packing forces, and ranged between a 'closed' conformation and a less well defined 'open' conformation. The structures were visually sorted yielding an approximately evenly spaced series of domain states that outlines the closing motions when the substrates bind. The packing forces in the crystals are weak, leaving the natural domain trajectories essentially intact. Packing is necessary, however, to produce stable intermediates. The ordered experimental structures were then recorded as still pictures of a movie and animated to represent the motions of the molecule during a catalytic cycle. The motions were smoothed out by adding interpolated structures to the observed ones. The resulting movies are available through the World Wide Web (http:@bio5.chemie.uni-freiburg.de/ak movie.html). Given the proliferating number of homologous proteins known to exist in different conformational states, it is becoming possible to outline the motions of chain segments and combine them into a movie, which can then represent protein action much more effectively than static pictures alone are able to do.

Anomalous diffusion of a probe in a bath of active granular chains

NASA Astrophysics Data System (ADS)

Jerez, Michael Jade Y.; Confesor, Mark Nolan P.; Carpio-Bernido, M. Victoria; Bernido, Christopher C.

2017-08-01

We investigate the dynamics of a passive probe particle in a bath of active granular chains (AGC). The bath and the probe are enclosed in an experimental compartment with a sinusoidal boundary to prevent AGC congestion along the boundary while connected to an electrodynamic shaker. Single AGC trajectory analysis reveals a persistent type of motion compared to a purely Brownian motion as seen in its mean squared displacement (MSD). It was found that at small concentration, Φ ≤ 0.44, the MSD exhibits two dynamical regimes characterized by two different scaling exponents. For small time scales, the dynamics is superdiffusive (1.32-1.63) with the MSD scaling exponent increasing monotonically with increasing AGC concentration. On the other hand, at long time, we recover the Brownian dynamics regime, MSD = DΔt, where the mobility D ∝ Φ. We quantify the probe dynamics at short time scale by modeling it as a fractional Brownian motion. The analytical form of the MSD agrees with experimental results.

Decoupling of ion conductivity from segmental dynamics in oligomeric ethylene oxide functionalized oxanorbornene dicarboximide homopolymers

DOE PAGES

Adams, Marisa; Richmond, Victoria; Smith, Douglas; ...

2017-03-24

Here, in order to design more effective solid polymer electrolytes, it is important to decouple ion conductivityfrom polymer segmental motion. To that end, novel polymers based on oxanorbornene dicarboximidemonomers with varying lengths of oligomeric ethylene oxide side chains have been synthesized usingring opening metathesis polymerization. These unique polymers have a fairly rigid and bulky backboneand were used to investigate the decoupling of ion motion from polymer segmental dynamics. Ionconductivity was measured using broadband dielectric spectroscopy for varying levels of added lithiumsalt. The conductivity data demonstrate six to seven orders of separation in timescale of ion conductivityfrom polymer segmental motion formore » polymers with shorter ethylene oxide side chains. However,commensurate changes in the glass transition temperatures T g reduce the effect of decoupling in ionconductivity and lead to lower conductivity at ambient conditions. These results suggest that both anincrease in decoupling and a reduction in T g might be required to develop solid polymer electrolytes withhigh ion conductivity at room temperature.« less

Optimized pulse shaping for trapped ion quantum computing

NASA Astrophysics Data System (ADS)

Manning, T.; Debnath, Shantanu; Choi, Taeyoung; Figgatt, Caroline; Monroe, Chris

2013-05-01

We perform entangling phase gates between pairs of qubits in a chain of trapped atomic ytterbium ions. Beat notes between frequency comb lines of a pulsed laser coherently drive Raman transitions that couple the hyperfine qubits to multiple collective transverse modes of motion. By optimizing the phase and amplitude of segmented laser pulses, we demonstrate a five-segment scheme to entangle two qubits with high fidelity over a range of detunings. We compare this special case of full control of spin-motion entanglement to a traditional single-segment gate. We extend this scheme to selectively entangle pairs of qubits in larger chains using individual optical addressing, where we couple to all the motional modes. We show how these robust gates can achieve high fidelities for practical gate times in an approach that scales realistically to much larger numbers of qubits. This work is supported by grants from the U.S. Army Research Office with funding from the DARPA OLE program, IARPA, and the MURI program; and the NSF Physics Frontier Center at JQI.

Characterization of a detector chain using a FPGA-based time-to-digital converter to reconstruct the three-dimensional coordinates of single particles at high flux

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nogrette, F.; Chang, R.; Bouton, Q.

We report on the development of a novel FPGA-based time-to-digital converter and its implementation in a detection chain that records the coordinates of single particles along three dimensions. The detector is composed of micro-channel plates mounted on top of a cross delay line and connected to fast electronics. We demonstrate continuous recording of the timing signals from the cross delay line at rates up to 4.1 × 10{sup 6} s{sup −1} and three-dimensional reconstruction of the coordinates up to 3.2 × 10{sup 6} particles per second. From the imaging of a calibrated structure we measure the in-plane resolution of themore » detector to be 140(20) μm at a flux of 3 × 10{sup 5} particles per second. In addition, we analyze a method to estimate the resolution without placing any structure under vacuum, a significant practical improvement. While we use UV photons here, the results of this work apply to the detection of other kinds of particles.« less

A Monoclonal–Monoclonal Antibody Based Capture ELISA for Abrin

PubMed Central

Tam, Christina C.; Cheng, Luisa W.; He, Xiaohua; Merrill, Paul; Hodge, David; Stanker, Larry H.

2017-01-01

Abrin, one of the most highly potent toxins in the world, is derived from the plant, Abrus precatorius. Because of its high toxicity, it poses potential bioterror risks. Therefore, a need exists for new reagents and technologies that would be able to rapidly detect abrin contamination as well as lead to new therapeutics. We report here a group of abrin-specific monoclonal antibodies (mAbs) that recognize abrin A-chain, intact A–B chain toxin, and agglutinin by Western blot. Additionally, these mAbs were evaluated for their ability to serve as capture antibodies for a sandwich (capture) ELISA. All possible capture–detector pairs were evaluated and the best antibody pair identified and optimized for a capture ELISA. The capture ELISA based on this capture–detector mAb pair had a limit of detection (L.O.D) of ≈1 ng/mL measured using three independent experiments. The assay did not reveal any false positives with extracts containing other potential ribosome-inactivating proteins (RIPs). Thus, this new capture ELISA uses mAbs for both capture and detection; has no cross-reactivity against other plant RIPs; and has a sensitivity comparable to other reported capture ELISAs using polyclonal antibodies as either capture or detector. PMID:29057799

Newtonian noise and ambient ground motion for gravitational wave detectors

NASA Astrophysics Data System (ADS)

Beker, M. G.; van den Brand, J. F. J.; Hennes, E.; Rabeling, D. S.

2012-06-01

Fluctuations of the local gravitational field as a result of seismic and atmospheric displacements will limit the sensitivity of ground based gravitational wave detectors at frequencies below 10 Hz. We discuss the implications of Newtonian noise for future third generation gravitational wave detectors. The relevant seismic wave fields are predominately of human origin and are dependent on local infrastructure and population density. Seismic studies presented here show that considerable seismic noise reduction is possible compared to current detector locations. A realistic seismic amplitude spectral density of a suitably quiet site should not exceed 0.5 nm/(Hz/f)2 above 1 Hz. Newtonian noise models have been developed both analytically and by finite element analysis. These show that the contribution to Newtonian noise from surface waves due to distance sources significantly reduces with depth. Seismic displacements from local sources and body waves then become the dominant contributors to the Newtonian fluctuations.

Position, Orientation and Velocity Detection of Unmanned Underwater Vehicles (UUVs) Using an Optical Detector Array

PubMed Central

Pe’eri, Shachak; Thein, May-Win; Rzhanov, Yuri; Celikkol, Barbaros; Swift, M. Robinson

2017-01-01

This paper presents a proof-of-concept optical detector array sensor system to be used in Unmanned Underwater Vehicle (UUV) navigation. The performance of the developed optical detector array was evaluated for its capability to estimate the position, orientation and forward velocity of UUVs with respect to a light source fixed in underwater. The evaluations were conducted through Monte Carlo simulations and empirical tests under a variety of motion configurations. Monte Carlo simulations also evaluated the system total propagated uncertainty (TPU) by taking into account variations in the water column turbidity, temperature and hardware noise that may degrade the system performance. Empirical tests were conducted to estimate UUV position and velocity during its navigation to a light beacon. Monte Carlo simulation and empirical results support the use of the detector array system for optics based position feedback for UUV positioning applications. PMID:28758936

Local Dynamics of Acid- and Ion-containing Copolymer Melts

NASA Astrophysics Data System (ADS)

Winey, Karen; Middleton, Robert; Tarver, Jacob; Tyagi, Madhusudan; Soles, Christopher; Frischknecht, Amalie

Interest in acid- and ion-containing polymers arises in part from applications as single-ion conductors for selectively transporting a counter ion for battery applications. Structurally, the low dielectric constant of organic polymers and strong ionic interactions leads to ionic aggregation. Here the polymer backbone motion was investigated through quasi-elastic neutron scattering measurements (QENS) and compared with fully atomistic molecular dynamic simulations of precise poly(ethylene-acrylic acid) copolymers and their ionomers (pxAA-y%Li). The effect of carbon spacer length (x =9, 15, 21) between the acid groups and the degree of neutralization (y) with Li on PE backbone dynamics were considered. Systematic slowing in chain dynamics were observed with increasing neutralization where polymer dynamics appear constrained due to anchoring effects. Simulations provide complementary viewpoints indicating a gradient in chain dynamics as a distance away from acid groups. These results indicate that the addition of pendant acid groups inhibit typical PE backbone motion and the neutralized forms strongly suppress the fraction of mobile PE chain.

The rf coil as a sensitive motion detector for magnetic resonance imaging.

PubMed

Buikman, D; Helzel, T; Röschmann, P

1988-01-01

A new sensor principle for detection of patient movement in magnetic resonance imaging has been successfully applied for the reduction of motion artifacts. It uses a device that is already present in every MRI system, namely the rf coil. Patient movement within the coil causes changes in the rf impedance match of the coil, which can be measured as variations in the reflected rf power. The principle used for the detection of respiratory and cardiac motion is described, and experimental results measured with several coil arrangements are given. Images are presented which were acquired with respiratory gating derived from the rf body coil of a 2 Tesla whole body MRI system.

Motion detection using extended fractional Fourier transform and digital speckle photography.

PubMed

Bhaduri, Basanta; Tay, C J; Quan, C; Sheppard, Colin J R

2010-05-24

Digital speckle photography is a useful tool for measuring the motion of optically rough surfaces from the speckle shift that takes place at the recording plane. A simple correlation based digital speckle photographic system has been proposed that implements two simultaneous optical extended fractional Fourier transforms (EFRTs) of different orders using only a single lens and detector to simultaneously detect both the magnitude and direction of translation and tilt by capturing only two frames: one before and another after the object motion. The dynamic range and sensitivity of the measurement can be varied readily by altering the position of the mirror/s used in the optical setup. Theoretical analysis and experiment results are presented.

Cytoplasmic motion induced by cytoskeleton stretching and its effect on cell mechanics.

PubMed

Zhang, T

2011-09-01

Cytoplasmic motion assumed as a steady state laminar flow induced by cytoskeleton stretching in a cell is determined and its effect on the mechanical behavior of the cell under externally applied forces is demonstrated. Non-Newtonian fluid is assumed for the multiphase cytoplasmic fluid and the analytical velocity field around the macromolecular chain is obtained by solving the reduced nonlinear momentum equation using homotopy technique. The entropy generation by the fluid internal friction is calculated and incorporated into the entropic elasticity based 8-chain constitutive relations. Numerical examples showed strengthening behavior of cells in response to externally applied mechanical stimuli. The spatial distribution of the stresses within a cell under externally applied fluid flow forces were also studied.

Nanoscale Particle Motion in Attractive Polymer Nanocomposites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Senses, Erkan; Narayanan, Suresh; Mao, Yimin

Using x-ray photon correlation spectroscopy, we examined slow nanoscale motion of silica nanoparticles individually dispersed in entangled poly (ethylene oxide) melt at particle volume fractions up to 42 %. The nanoparticles, therefore, serve as both fillers for the resulting attractive polymer nanocomposites and probes for the network dynamics therein. The results show that the particle relaxation closely follows the mechanical reinforcement in the nanocomposites only at the intermediate concentrations below the critical value for the chain confinement. Quite unexpectedly, the relaxation time of the particles does not further slowdown at higher volume fractions- when all chains are practically on themore » nanoparticle interface- and decouples from the elastic modulus of the nanocomposites that further increases orders of magnitude.« less

Nanoscale Particle Motion in Attractive Polymer Nanocomposites

DOE PAGES

Senses, Erkan; Narayanan, Suresh; Mao, Yimin; ...

2017-12-06

Using x-ray photon correlation spectroscopy, we examined slow nanoscale motion of silica nanoparticles individually dispersed in entangled poly (ethylene oxide) melt at particle volume fractions up to 42 %. The nanoparticles, therefore, serve as both fillers for the resulting attractive polymer nanocomposites and probes for the network dynamics therein. The results show that the particle relaxation closely follows the mechanical reinforcement in the nanocomposites only at the intermediate concentrations below the critical value for the chain confinement. Quite unexpectedly, the relaxation time of the particles does not further slowdown at higher volume fractions- when all chains are practically on themore » nanoparticle interface- and decouples from the elastic modulus of the nanocomposites that further increases orders of magnitude.« less

RADIO-ACTIVE TRANSDUCER

DOEpatents

Wanetick, S.

1962-03-01

ABS>ure the change in velocity of a moving object. The transducer includes a radioactive source having a collimated beam of radioactive particles, a shield which can block the passage of the radioactive beam, and a scintillation detector to measure the number of radioactive particles in the beam which are not blocked by the shield. The shield is operatively placed across the radioactive beam so that any motion normal to the beam will cause the shield to move in the opposite direction thereby allowing more radioactive particles to reach the detector. The number of particles detected indicates the acceleration. (AEC)

The network of photodetectors and diode lasers of the CMS Link alignment system

NASA Astrophysics Data System (ADS)

Arce, P.; Barcala, J. M.; Calvo, E.; Ferrando, A.; Josa, M. I.; Molinero, A.; Navarrete, J.; Oller, J. C.; Brochero, J.; Calderón, A.; Fernández, M. G.; Gómez, G.; González-Sánchez, F. J.; Martínez-Rivero, C.; Matorras, F.; Rodrigo, T.; Ruiz-Árbol, P.; Scodellaro, L.; Sobrón, M.; Vila, I.; Virto, A. L.; Fernández, J.; Raics, P.; Szabó, Zs.; Trócsnyi, Z.; Ujvári, B.; Zilizi, Gy.; Béni, N.; Christian, G.; Imrek, J.; Molnar, J.; Novak, D.; Pálinkás, J.; Székely, G.; Szillási, Z.; Bencze, G. L.; Vestergombi, G.; Benettoni, M.; Gasparini, F.; Montecassiano, F.; Rampazzo, M.; Zago, M.; Benvenuti, A.; Reithler, H.; Jiang, C.

2018-07-01

The central feature of the CMS Link alignment system is a network of Amorphous Silicon Position Detectors distributed throughout the muon spectrometer that are connected by multiple laser lines. The data collected during the years from 2008 to 2015 is presented confirming an outstanding performance of the photo sensors during more than seven years of operation. Details of the photo sensor readout of the laser signals are presented. The mechanical motions of the CMS detector are monitored using these photosensors and good agreement with distance sensors is obtained.

Quantum radiation produced by the entanglement of quantum fields

NASA Astrophysics Data System (ADS)

Iso, Satoshi; Oshita, Naritaka; Tatsukawa, Rumi; Yamamoto, Kazuhiro; Zhang, Sen

2017-01-01

We investigate the quantum radiation produced by an Unruh-De Witt detector in a uniformly accelerating motion coupled to the vacuum fluctuations. Quantum radiation is nonvanishing, which is consistent with the previous calculation by Lin and Hu [Phys. Rev. D 73, 124018 (2006), 10.1103/PhysRevD.73.124018]. We infer that this quantum radiation from the Unruh-De Witt detector is generated by the nonlocal correlation of the Minkowski vacuum state, which has its origin in the entanglement of the state between the left and the right Rindler wedges.

Overcoming Pose Limitations of a Skin-Cued Histograms of Oriented Gradients Dismount Detector Through Contextual Use of Skin Islands and Multiple Support Vector Machines

DTIC Science & Technology

2011-03-24

HOG) dismount detector that cues based off of the presence of human skin (to limit false detections and to reduce the search space complexity). While...wave infrared wavelengths in addition to the visible spectra in order to identify human skin [29] and selectively scan the image for the presence of...and the angle of the acqui- sition camera. Consequently, it is expected that limitations exist on the humans ’ range of motion or stance that still

Control strategy to limit duty cycle impact of earthquakes on the LIGO gravitational-wave detectors

NASA Astrophysics Data System (ADS)

Biscans, S.; Warner, J.; Mittleman, R.; Buchanan, C.; Coughlin, M.; Evans, M.; Gabbard, H.; Harms, J.; Lantz, B.; Mukund, N.; Pele, A.; Pezerat, C.; Picart, P.; Radkins, H.; Shaffer, T.

2018-03-01

Advanced gravitational-wave detectors such as the laser interferometer gravitational-wave observatories (LIGO) require an unprecedented level of isolation from the ground. When in operation, they measure motion of less than 10‑19 m. Strong teleseismic events like earthquakes disrupt the proper functioning of the detectors, and result in a loss of data. An earthquake early-warning system, as well as a prediction model, have been developed to understand the impact of earthquakes on LIGO. This paper describes a control strategy to use this early-warning system to reduce the LIGO downtime by  ∼30%. It also presents a plan to implement this new earthquake configuration in the LIGO automation system.

Method and apparatus for radiometer star sensing

NASA Technical Reports Server (NTRS)

Wilcox, Jack E. (Inventor)

1989-01-01

A method and apparatus for determining the orientation of the optical axis of radiometer instruments mounted on a satellite involves a star sensing technique. The technique makes use of a servo system to orient the scan mirror of the radiometer into the path of a sufficiently bright star such that motion of the satellite will cause the star's light to impinge on the scan mirror and then the visible light detectors of the radiometer. The light impinging on the detectors is converted to an electronic signal whereby, knowing the position of the star relative to appropriate earth coordinates and the time of transition of the star image through the detector array, the orientation of the optical axis of the instrument relative to earth coordinates can be accurately determined.

Extending and Characterizing an Exoplanet System in a Pristine Chain of Resonances

NASA Astrophysics Data System (ADS)

Christiansen, Jessie; Gorjian, Varoujan; Hardegree-Ullman, Kevin; Livingston, John; Dressing, Courtney; Barclay, Thomas; Lintott, Chris; Ciardi, David; Barentson, Geert; Kristiansen, Martti; Crossfield, Ian; Benneke, Bjorn; Howard, Andrew

2018-01-01

The K2-138 (EPIC 245950175; 2MASS J23154776-1050590) exoplanet system was recently identified in the K2 mission campaign 12 data (Christiansen et al. 2018). The moderately bright (K=10.3) K1V star hosts at least five sub-Neptune planets (1.6-3.3 Re) in a compact configuration, all with periods shorter than 13 days. The five confirmed planets in the system form an unbroken chain of near first-order mean motion resonances, with each successive pair of planets having close to a 3:2 commensurability; this is the longest such chain as yet discovered. The K2 data contain two additional transits which, if confirmed as due to a sixth planet, could extend the chain even further. Due to the proximity of the K2-138 planets to mean motion resonances, it is an ideal target to search for transit timing variations (TTVs). In order to further both of these time-critical and important science cases, we propose for DDT time to capture a third transit of the candidate sixth planet, and also observe a chance nearby cluster of three transits of planets b, c, and d. (12hr for the 6th planet was approved.)

Hot Stuff.

ERIC Educational Resources Information Center

Patterson, Kristin

1996-01-01

Property theft at schools is a problem districts are having to confront. Deterrents include inventory checks and etching equipment with inventory control numbers. In Washington, D.C., officials are installing high-security equipment such as closed-circuit television, fiber-optics lines to secure computers, and motion detectors. (MLF)

Twin helix system produces fast scan in infrared detector

NASA Technical Reports Server (NTRS)

Vanzetti, R.

1966-01-01

Two rotating wheels in orthogonal relationship with helicoidal reflecting surfaces mounted on their outer rims achieve a linear speed without normal time loss in their return motion. The pitch of the helicoidal surfaces equals the displacement that the mirrors must traverse.

Locomotive and reptation motion induced by internal force and friction.

PubMed

Sakaguchi, Hidetsugu; Ishihara, Taisuke

2011-06-01

We propose a simple mechanical model of locomotion induced by internal force and friction. We first construct a system of two elements as an analog of the bipedal motion. The internal force does not induce a directional motion by itself because of the action-reaction law, but a directional motion becomes possible by the control of the frictional force. The efficiency of these model systems is studied using an analogy to the heat engine. As a modified version of the two-element model, we construct a model that exhibits a bipedal motion similar to kinesin's motion of molecular motor. Next, we propose a linear chain model and a ladder model as an extension of the original two-element model. We find a transition from a straight to a snake-like motion in a ladder model by changing the strength of the internal force.

A gated LaBr3(Ce) detector for border protection applications

NASA Astrophysics Data System (ADS)

Etile, A.; Denis-Petit, D.; Gaudefroy, L.; Meot, V.; Roig, O.

2018-01-01

We report on the dedicated implementation of the blocking technique for a LaBr3(Ce) detector as well as associated electronics and data acquisition system for border protection applications. The detector is meant to perform delayed γ-ray spectroscopy of fission fragments produced via photofission induced by a high intensity pulsed photon beam. The gating technique avoids saturation of the detection chain during irradiation. The resulting setup allows us to successfully perform delayed γ-ray spectroscopy starting only 30 ns after the gating operation. The measured energy resolution ranges from 5% to 6.5% at 662 keV depending on the γ-ray detection time after the gating operation.

On the suitability of Elekta’s Agility 160 MLC for tracked radiation delivery: closed-loop machine performance

NASA Astrophysics Data System (ADS)

Glitzner, M.; Crijns, S. P. M.; de Senneville, B. Denis; Lagendijk, J. J. W.; Raaymakers, B. W.

2015-03-01

For motion adaptive radiotherapy, dynamic multileaf collimator tracking can be employed to reduce treatment margins by steering the beam according to the organ motion. The Elekta Agility 160 MLC has hitherto not been evaluated for its tracking suitability. Both dosimetric performance and latency are key figures and need to be assessed generically, independent of the used motion sensor. In this paper, we propose the use of harmonic functions directly fed to the MLC to determine its latency during continuous motion. Furthermore, a control variable is extracted from a camera system and fed to the MLC. Using this setup, film dosimetry and subsequent γ statistics are performed, evaluating the response when tracking (MRI)-based physiologic motion in a closed-loop. The delay attributed to the MLC itself was shown to be a minor contributor to the overall feedback chain as compared to the impact of imaging components such as MRI sequences. Delay showed a linear phase behaviour of the MLC employed in continuously dynamic applications, which enables a general MLC-characterization. Using the exemplary feedback chain, dosimetry showed a vast increase in pass rate employing γ statistics. In this early stage, the tracking performance of the Agility using the test bench yielded promising results, making the technique eligible for translation to tracking using clinical imaging modalities.

Field signature for apparently superluminal particle motion

NASA Astrophysics Data System (ADS)

Land, Martin

2015-05-01

In the context of Stueckelberg's covariant symplectic mechanics, Horwitz and Aharonovich [1] have proposed a simple mechanism by which a particle traveling below light speed almost everywhere may exhibit a transit time that suggests superluminal motion. This mechanism, which requires precise measurement of the particle velocity, involves a subtle perturbation affecting the particle's recorded time coordinate caused by virtual pair processes. The Stueckelberg framework is particularly well suited to such problems, because it permits pair creation/annihilation at the classical level. In this paper, we study a trajectory of the type proposed by Horwitz and Aharonovich, and derive the Maxwell 4-vector potential associated with the motion. We show that the resulting fields carry a signature associated with the apparent superluminal motion, providing an independent test for the mechanism that does not require direct observation of the trajectory, except at the detector.

Exploring the energy landscape of antibody-antigen complexes: protein dynamics, flexibility, and molecular recognition.

PubMed

Thielges, Megan C; Zimmermann, Jörg; Yu, Wayne; Oda, Masayuki; Romesberg, Floyd E

2008-07-08

The production of antibodies that selectively bind virtually any foreign compound is the hallmark of the immune system. While much is understood about how sequence diversity contributes to this remarkable feat of molecular recognition, little is known about how sequence diversity impacts antibody dynamics, which is also expected to contribute to molecular recognition. Toward this goal, we examined a panel of antibodies elicited to the chromophoric antigen fluorescein. On the basis of isothermal titration calorimetry, we selected six antibodies that bind fluorescein with diverse binding entropies, suggestive of varying contributions of dynamics to molecular recognition. Sequencing revealed that two pairs of antibodies employ homologous heavy chains that were derived from common germline genes, while the other two heavy chains and all six of the light chains were derived from different germline genes and are not homologous. Interestingly, more than half of all the somatic mutations acquired during affinity maturation among the six antibodies are located in positions unlikely to contact fluorescein directly. To quantify and compare the dynamics of the antibody-fluorescein complexes, three-pulse photon echo peak shift and transient grating spectroscopy were employed. All of the antibodies exhibited motions on three distinct time scales, ultrafast motions on the <100 fs time scale, diffusive motions on the picosecond time scale, and motions that occur on time scales longer than nanoseconds and thus appear static. However, the exact frequency of the picosecond time scale motion and the relative contribution of the different motions vary significantly among the antibody-chromophore complexes, revealing a high level of dynamic diversity. Using a hierarchical model, we relate the data to features of the antibodies' energy landscapes as well as their flexibility in terms of elasticity and plasticity. In all, the data provide a consistent picture of antibody flexibility, which interestingly appears to be correlated with binding entropy as well as with germline gene use and the mutations introduced during affinity maturation. The data also provide a gauge of the dynamic diversity of the antibody repertoire and suggest that this diversity might contribute to molecular recognition by facilitating the recognition of the broadest range of foreign molecules.

SuperCDMS Underground Detector Fabrication Facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Platt, M.; Mahapatra, R.; Bunker, Raymond A.

The SuperCDMS SNOLAB dark matter experiment processes Ge and Si crystals into fully tested phonon and ionization detectors at surface fabrication and test facilities. If not mitigated, it is anticipated that trace-level production of radioisotopes in the crystals due to exposure to cosmic rays at (or above) sea level will result in the dominant source of background events in future dark matter searches using the current SuperCDMS detector technology. Fabrication and testing of detectors in underground facilities shielded from cosmic radiation is one way to directly reduce production of trace levels of radioisotopes, thereby improving experimental sensitivity for the discoverymore » of dark matter beyond the level of the current experiment. In this report, we investigate the cost and feasibility to establish a complete detector fabrication processing chain in an underground location to mitigate cosmogenic activation of the Ge and Si detector substrates. For a specific and concrete evaluation, we explore options for such a facility located at SNOLAB, an underground laboratory in Sudbury, Canada hosting the current and future experimental phases of SuperCDMS.« less

Interlocking Molecular Gear Chains Built on Surfaces.

PubMed

Zhao, Rundong; Qi, Fei; Zhao, Yan-Ling; Hermann, Klaus E; Zhang, Rui-Qin; Van Hove, Michel A

2018-05-17

Periodic chains of molecular gears in which molecules couple with each other and rotate on surfaces have been previously explored by us theoretically using ab initio simulation tools. On the basis of the knowledge and experience gained about the interactions between neighboring molecular gears, we here explore the transmission of rotational motion and energy over larger distances, namely, through a longer chain of gear-like passive "slave" molecules. Such microscopic gears exhibit quite different behaviors compared to rigid cogwheels in the macroscopic world due to their structural flexibility affecting intermolecular interaction. Here, we investigate the capabilities of such gear chains and reveal the mechanisms of the transmission process in terms of both quantum-level density functional theory (DFT) and simple classical mechanics. We find that the transmission of rotation along gear chains depends strongly on the gear-gear distance: short distances can cause tilting of gears and even irregular "creep-then-jump" (or "stick-slip") motion or expulsion of gears; long gear-gear distances cause weak coupling between gears, slipping and skipping. More importantly, for transmission of rotation at intermediate gear-gear distances, our modeling clearly exhibits the relative roles of several important factors: flexibility of gear arms, axles, and supports, as well as resulting rotational delays, slippages, and thermal and other effects. These studies therefore allow better informed design of future molecular machine components involving motors, gears, axles, etc.

Background levels in the Borexino detector

NASA Astrophysics Data System (ADS)

D'Angelo, Davide; Wurm, Michael; Borexino Collaboration

2008-11-01

The Borexino detector, designed and constructed for sub-MeV solar neutrino spectroscopy, is taking data at the Gran Sasso Laboratory, Italy; since May 2007. The main physics objective of Borexino, based on elastic scattering of neutrinos in organic liquid scintillator, is the real time flux measurement of the 862keV mono-energetic neutrinos from 7Be, which set extremely severe radio-purity requirements in the detector's design and handling. The first year of continous data taking provide now evidence of the extremely low background levels achieved in the construction of the detector and in the purification of the target mass. Several pieces of analysis sense the presence of radioisotopes of the 238U and 232Th chains, of 85Kr and of 210Po out of equilibrium from other Radon daughters. Particular emphasis is given to the detection of the cosmic muon background whose angular distributions have been obtained with the outer detector tracking algorithm and to the possibility of tagging the muon-induced neutron background in the scintillator with the recently enhanced electronics setup.

Performance of the NOνA Data Acquisition and Trigger Systems for the full 14 kT Far Detector

NASA Astrophysics Data System (ADS)

Norman, A.; Davies, G. S.; Ding, P. F.; Dukes, E. C.; Duyan, H.; Frank, M. J.; R. C. Group; Habig, A.; Henderson, W.; Niner, E.; Mina, R.; Moren, A.; Mualem, L.; Oksuzian, Y.; Rebel, B.; Shanahan, P.; Sheshukov, A.; Tamsett, M.; Tomsen, K.; Vinton, L.; Wang, Z.; Zamorano, B.; Zirnstien, J.

2015-12-01

The NOvA experiment uses a continuous, free-running, dead-timeless data acquisition system to collect data from the 14 kT far detector. The DAQ system readouts the more than 344,000 detector channels and assembles the information into an raw unfiltered high bandwidth data stream. The NOvA trigger systems operate in parallel to the readout and asynchronously to the primary DAQ readout/event building chain. The data driven triggering systems for NOvA are unique in that they examine long contiguous time windows of the high resolution readout data and enable the detector to be sensitive to a wide range of physics interactions from those with fast, nanosecond scale signals up to processes with long delayed coincidences between hits which occur at the tens of milliseconds time scale. The trigger system is able to achieve a true 100% live time for the detector, making it sensitive to both beam spill related and off-spill physics.

The readout chain for the bar PANDA MVD strip detector

NASA Astrophysics Data System (ADS)

Schnell, R.; Brinkmann, K.-Th.; Di Pietro, V.; Kleines, H.; Goerres, A.; Riccardi, A.; Rivetti, A.; Rolo, M. D.; Sohlbach, H.; Zaunick, H.-G.

2015-02-01

The bar PANDA (antiProton ANnihilation at DArmstadt) experiment will study the strong interaction in annihilation reactions between an antiproton beam and a stationary gas jet target. The detector will comprise different sub-detectors for tracking, particle identification and calorimetry. The Micro-Vertex Detector (MVD) as the innermost part of the tracking system will allow precise tracking and detection of secondary vertices. For the readout of the double-sided silicon strip sensors a custom-made ASIC is being developed, employing the Time-over-Threshold (ToT) technique for digitization and utilize time-to-digital converters (TDC) to provide a high-precision time stamp of the hit. A custom-made Module Data Concentrator ASIC (MDC) will multiplex the data of all front-ends of one sensor towards the CERN-developed GBT chip set (GigaBit Transceiver). The MicroTCA-based MVD Multiplexer Board (MMB) at the off-detector site will receive and concentrate the data from the GBT links and transfer it to FPGA-based compute nodes for global event building.

Preliminary analysis of EUSO—TA data

NASA Astrophysics Data System (ADS)

Fenu, F.; Piotrowski, L. W.; Shin, H.; Jung, A.; Bacholle, S.; Bisconti, F.; Capel, F.; Eser, J.; Kawasaki, Y.; Kuznetsov, E.; Larsson, O.; Mackovjak, S.; Miyamoto, H.; Plebaniak, Z.; Prevot, G.; Putis, M.; Shinozaki, K.; Adams, J.; Bertaina, M.; Bobik, P.; Casolino, M.; Matthews, J. N.; Ricci, M.; Wiencke, L.; EUSO-TA Collaboration

2016-05-01

The EUSO-TA detector is a pathfinder for the JEM-EUSO project and is currently installed in Black Rock Mesa (Utah) on the site of the Telescope Array fluorescence detectors. Aim of this experiment is to validate the observation principle of JEM-EUSO on air showers measured from ground. The experiment gets data in coincidence with the TA triggers to increase the likelihood of cosmic ray detection. In this framework the collaboration is also testing the detector response with respect to several test events from lasers and LED flashers. Moreover, another aim of the project is the validation of the stability of the data acquisition chain in real sky condition and the optimization of the trigger scheme for the rejection of background. Data analysis is ongoing to identify cosmic ray events in coincidence with the TA detector. In this contribution we will show the response of the EUSO-TA detector to all the different typologies of events and we will show some preliminary results on the trigger optimization performed on such data.

Photon noise from chaotic and coherent millimeter-wave sources measured with horn-coupled, aluminum lumped-element kinetic inductance detectors

NASA Astrophysics Data System (ADS)

Flanigan, D.; McCarrick, H.; Jones, G.; Johnson, B. R.; Abitbol, M. H.; Ade, P.; Araujo, D.; Bradford, K.; Cantor, R.; Che, G.; Day, P.; Doyle, S.; Kjellstrand, C. B.; Leduc, H.; Limon, M.; Luu, V.; Mauskopf, P.; Miller, A.; Mroczkowski, T.; Tucker, C.; Zmuidzinas, J.

2016-02-01

We report photon-noise limited performance of horn-coupled, aluminum lumped-element kinetic inductance detectors at millimeter wavelengths. The detectors are illuminated by a millimeter-wave source that uses an active multiplier chain to produce radiation between 140 and 160 GHz. We feed the multiplier with either amplified broadband noise or a continuous-wave tone from a microwave signal generator. We demonstrate that the detector response over a 40 dB range of source power is well-described by a simple model that considers the number of quasiparticles. The detector noise-equivalent power (NEP) is dominated by photon noise when the absorbed power is greater than approximately 1 pW, which corresponds to NEP≈2 ×10-17 W Hz-1 /2 , referenced to absorbed power. At higher source power levels, we observe the relationships between noise and power expected from the photon statistics of the source signal: NEP∝P for broadband (chaotic) illumination and NEP∝P1 /2 for continuous-wave (coherent) illumination.

Registration of alpha particles in Makrofol-E nuclear track detectors

NASA Astrophysics Data System (ADS)

Rammah, Y. S.; Abdalla, Ayman M.; Ashraf, O.; Ashry, A. H.

2016-06-01

Fast detection of alpha particles in the range from 1 to 5 MeV in Makrofol-E polycarbonate nuclear track detectors (PCTDs) using a new chemical etchant was investigated. 252Cf and 241Am-thin open sources were used for irradiating Makrofol-E detectors with fission fragments and alpha particles in air at normal pressure and temperature (NPT). A chain of experimental work has been carried out using new etchants to register alpha particle in short time in Makrofol-E polycarbonate detectors. The etching efficiency were exhibited a clear dependence on the amount of methanol in the etching solution and etching time. The optimized chemical condition obtained at this stage of development for 200 μm Makrofol-E detectors are (8 ml of 10 N NaOH + 2 ml CH3OH) etching solutions at 60 °C for 3 h. In this study; it is possible to observe energy detection windows for Makrofol-E detectors according to applied etching duration. Makrofol-E introduced the characteristic Bragg peak, which indicates the advantages of this detector as alpha spectrometer. Consequently, the suggested new etchant can be developed for heavy ions detection and monitoring radon levels and its daughters.

Ridge interaction features of the Line Islands

NASA Astrophysics Data System (ADS)

Konter, J. G.; Koppers, A. A. P.; Storm, L. P.

2016-12-01

The sections of Pacific absolute plate motion history that precede the Hawaii-Emperor and Louisville chains are based on three chains: the Line Islands-Mid-Pacific Mountains, the Hess Rise-Shatsky Rise, and the Marshall Islands-Wake Islands (Rurutu hotspot). Although it has been clear that the Line Islands do not define a simple age progression (e.g. Schlanger et al., 1984), the apparent similarity to the Emperor Seamount geographic trend has been used to extend the overall Hawaii-Emperor track further into the past. However, we show here that plate tectonic reconstructions suggest that the Mid-Pacific Mountains (MPMs) and Line Islands (LIs) were erupted near a mid-ocean ridge, and thus these structures do not reflect absolute plate motion. Moverover, the morphology and geochemistry of the volcanoes show similarities with Pukapuka Ridge (e.g. Davis et al., 2002) and the Rano Rahi seamounts, presumed to have a shallow origin. Modern 40Ar/39Ar ages show that the LIs erupted at various times along the entire volcanic chain. The oldest structures formed within 10 Ma of plate formation. Given the short distance to the ridge system, large aseismic volcanic ridges, such as Necker Ridge and Horizon Guyot may simply reflect a connection between MPMs and the ridge, similar to the Pukapuka Ridge. The Line Islands to the south (including Karin Ridge) define short subchains of elongated seamounts that are widespread, resembling the Rano Rahi seamount field. During this time, the plate moved nearly parallel to the ridge system. The change from few large ridges to many subchains may reflect a change in absolute plate motion, similar to the Rano Rahi field. Here, significant MPMs volcanism is no longer connected to the ridge along plate motion. Similar to Pukapuka vs. Rano Rahi, the difference in direction between plate motion and the closest ridge determines whether larger ridges or smaller seamount subchains are formed. The difference between the largest structures (MPMs and LIs ridge south of Clarion fracture zone) may result from their formation near microplate triple junctions, above the edges of the LLSVPs, during increased spreading rates of the Cretaceous. Unusually strong passive upwelling may have sampled dense fertile material (Korenaga, 2005) from the LLSVP generating a LIP without a hotspot chain.

Nuclear resonance fluorescence in U-238 using LaBr detectors for nuclear security

NASA Astrophysics Data System (ADS)

Hayakawa, Takehito; Negm, Hani; Ohgaki, Hideaki; Daito, Izuru; Kii, Toshiteru; Zen, Heishun; Omer, Mohamed; Shizuma, Toshiyuki; Hajima, Ryoichi

2014-09-01

Recently, a nondestructive measurement method of shielded fissional isotopes such as 235U or 239Pu has been proposed for the nuclear security. These isotopes are measured by using nuclear resonance fluorescence (NRF) with monochromatic energy gamma-ray beams generated by laser Compton-scattering (LCS). We have proposed that one measure scattered gamma-rays from NRF with LCS gamma-ray beams using the LaBr3(Ce) detectors. The LaBr3(Ce) crystals include internal radioisotopes of a meta-stable isotope 138La and alpha decay chains from some actinides as 227Ac. There is a broad pump at about 2 MeV. This pump is considered to be an overlap of alpha-rays from decay chains of some actinides but its detailed structure has not been established. Here we have measured NRF spectra of 238U using the LCS gamma-rays with energy of about 2.5 MeV at the HIgS facility of the Duke University. The background has been evaluated using a simulation code GEAT4. The 9 peaks, 8 NRF gamma-rays plus the Compton scattered gamma-ray of the incident beam, are finally assigned in an energy range of about 200 keV at about 2.5 MeV. The 8 integrated NRF cross-sections measured by LaBr3(Ce) have been consistent with results by an HPGe detector. The three levels are newly assigned using the HPGe detector. Two of them are also measured by LaBr3(Ce).

Caution is required in interpretation of mutations in the voltage sensing domain of voltage gated channels as evidence for gating mechanisms.

PubMed

Kariev, Alisher M; Green, Michael E

2015-01-12

The gating mechanism of voltage sensitive ion channels is generally considered to be the motion of the S4 transmembrane segment of the voltage sensing domains (VSD). The primary supporting evidence came from R → C mutations on the S4 transmembrane segment of the VSD, followed by reaction with a methanethiosulfonate (MTS) reagent. The cys side chain is -SH (reactive form -S-); the arginine side chain is much larger, leaving space big enough to accommodate the MTS sulfonate head group. The cavity created by the mutation has space for up to seven more water molecules than were present in wild type, which could be displaced irreversibly by the MTS reagent. Our quantum calculations show there is major reorientation of three aromatic residues that face into the cavity in response to proton displacement within the VSD. Two phenylalanines reorient sufficiently to shield/unshield the cysteine from the intracellular and extracellular ends, depending on the proton positions, and a tyrosine forms a hydrogen bond to the cysteine sulfur with its side chain -OH. These could produce the results of the experiments that have been interpreted as evidence for physical motion of the S4 segment, without physical motion of the S4 backbone. The computations strongly suggest that the interpretation of cysteine substitution reaction experiments be re-examined in the light of these considerations.

A detector interferometric calibration experiment for high precision astrometry

NASA Astrophysics Data System (ADS)

Crouzier, A.; Malbet, F.; Henault, F.; Léger, A.; Cara, C.; LeDuigou, J. M.; Preis, O.; Kern, P.; Delboulbe, A.; Martin, G.; Feautrier, P.; Stadler, E.; Lafrasse, S.; Rochat, S.; Ketchazo, C.; Donati, M.; Doumayrou, E.; Lagage, P. O.; Shao, M.; Goullioud, R.; Nemati, B.; Zhai, C.; Behar, E.; Potin, S.; Saint-Pe, M.; Dupont, J.

2016-11-01

Context. Exoplanet science has made staggering progress in the last two decades, due to the relentless exploration of new detection methods and refinement of existing ones. Yet astrometry offers a unique and untapped potential of discovery of habitable-zone low-mass planets around all the solar-like stars of the solar neighborhood. To fulfill this goal, astrometry must be paired with high precision calibration of the detector. Aims: We present a way to calibrate a detector for high accuracy astrometry. An experimental testbed combining an astrometric simulator and an interferometric calibration system is used to validate both the hardware needed for the calibration and the signal processing methods. The objective is an accuracy of 5 × 10-6 pixel on the location of a Nyquist sampled polychromatic point spread function. Methods: The interferometric calibration system produced modulated Young fringes on the detector. The Young fringes were parametrized as products of time and space dependent functions, based on various pixel parameters. The minimization of function parameters was done iteratively, until convergence was obtained, revealing the pixel information needed for the calibration of astrometric measurements. Results: The calibration system yielded the pixel positions to an accuracy estimated at 4 × 10-4 pixel. After including the pixel position information, an astrometric accuracy of 6 × 10-5 pixel was obtained, for a PSF motion over more than five pixels. In the static mode (small jitter motion of less than 1 × 10-3 pixel), a photon noise limited precision of 3 × 10-5 pixel was reached.

Shutdown system for a nuclear reactor

DOEpatents

Groh, E.F.; Olson, A.P.; Wade, D.C.; Robinson, B.W.

1984-06-05

An ultimate shutdown system is provided for termination of neutronic activity in a nuclear reactor. The shutdown system includes bead chains comprising spherical containers suspended on a flexible cable. The containers are comprised of mating hemispherical shells which provide a ruggedized enclosure for reactor poison material. The bead chains, normally suspended above the reactor core on storage spools, are released for downward travel upon command from an external reactor monitor. The chains are capable of horizontal movement, so as to flow around obstructions in the reactor during their downward motion. 8 figs.

Magnonic analog of relativistic Zitterbewegung in an antiferromagnetic spin chain

NASA Astrophysics Data System (ADS)

Wang, Weiwei; Gu, Chenjie; Zhou, Yan; Fangohr, Hans

2017-07-01

We theoretically investigate the spin-wave (magnon) excitations in a classical antiferromagnetic spin chain with easy-axis anisotropy. We obtain a Dirac-like equation by linearizing the Landau-Lifshitz-Gilbert equation in this antiferromagnetic system, in contrast to the ferromagnetic system in which a Schrödinger-type equation is derived. The Hamiltonian operator in the Dirac-like equation is a pseudo-Hermitian. We compute and demonstrate relativistic Zitterbewegung (trembling motion) in the antiferromagnetic spin chain by measuring the expectation values of the wave-packet position.

Shutdown system for a nuclear reactor

DOEpatents

Groh, Edward F.; Olson, Arne P.; Wade, David C.; Robinson, Bryan W.

1984-01-01

An ultimate shutdown system is provided for termination of neutronic activity in a nuclear reactor. The shutdown system includes bead chains comprising spherical containers suspended on a flexible cable. The containers are comprised of mating hemispherical shells which provide a ruggedized enclosure for reactor poison material. The bead chains, normally suspended above the reactor core on storage spools, are released for downward travel upon command from an external reactor monitor. The chains are capable of horizontal movement, so as to flow around obstructions in the reactor during their downward motion.

Quantum superintegrable system with a novel chain structure of quadratic algebras

NASA Astrophysics Data System (ADS)

Liao, Yidong; Marquette, Ian; Zhang, Yao-Zhong

2018-06-01

We analyse the n-dimensional superintegrable Kepler–Coulomb system with non-central terms. We find a novel underlying chain structure of quadratic algebras formed by the integrals of motion. We identify the elements for each sub-structure and obtain the algebra relations satisfied by them and the corresponding Casimir operators. These quadratic sub-algebras are realized in terms of a chain of deformed oscillators with factorized structure functions. We construct the finite-dimensional unitary representations of the deformed oscillators, and give an algebraic derivation of the energy spectrum of the superintegrable system.

Chaotic dynamics of Heisenberg ferromagnetic spin chain with bilinear and biquadratic interactions

NASA Astrophysics Data System (ADS)

Blessy, B. S. Gnana; Latha, M. M.

2017-10-01

We investigate the chaotic dynamics of one dimensional Heisenberg ferromagnetic spin chain by constructing the Hamiltonian equations of motion. We present the trajectory and phase plots of the system with bilinear and also biquadratic interactions. The stability of the system is analysed in both cases by constructing the Jacobian matrix and by measuring the Lyapunov exponents. The results are illustrated graphically.

Human motion planning based on recursive dynamics and optimal control techniques

NASA Technical Reports Server (NTRS)

Lo, Janzen; Huang, Gang; Metaxas, Dimitris

2002-01-01

This paper presents an efficient optimal control and recursive dynamics-based computer animation system for simulating and controlling the motion of articulated figures. A quasi-Newton nonlinear programming technique (super-linear convergence) is implemented to solve minimum torque-based human motion-planning problems. The explicit analytical gradients needed in the dynamics are derived using a matrix exponential formulation and Lie algebra. Cubic spline functions are used to make the search space for an optimal solution finite. Based on our formulations, our method is well conditioned and robust, in addition to being computationally efficient. To better illustrate the efficiency of our method, we present results of natural looking and physically correct human motions for a variety of human motion tasks involving open and closed loop kinematic chains.

Nanoscopic dynamics in hybrid hydroxyapatite-CTAB composite

NASA Astrophysics Data System (ADS)

Dubey, P. S.; Sharma, V. K.; Mitra, S.; Verma, G.; Hassan, P. A.; Dutta, B.; Johnson, M.; Mukhopadhyay, R.

2017-06-01

Synthetic hydroxyapatite (HAp) is an important material in biomedical engineering due to its excellent biocompatibility and bioactivity. HAp nanoparticles were synthesized by the co-precipitation method using cetyltrimethylammonium bromide (CTAB) micelles as a template and are characterized using x-ray diffraction, electron microscopy, and thermal gravimetric measurements. Transmission electron microscope (TEM) demonstrates the formation of rod-shaped HAp. Dynamics of CTAB in HAp-CTAB composite as studied by using quasielastic neutron scattering (QENS) technique is reported here. HAp-CTAB composite provides an ideal system for studying the dynamics of CTAB micelles without any aqueous media. QENS data indicate that the observed dynamics are reminiscent of localized motions in ionic micellar systems, consisting of segmental and fast torsional motions. Segmental dynamics has been described with a model, in which hydrogen atoms in the alkyl chain undergoes localized translation diffusion and the CH3 unit associated with the head group undergo 3-fold jump rotation. Within this model, the hydrogen atoms in the alkyl chain undergo diffusion within spherical domains having different radii and diffusivities. A simple linear distribution of the radius and diffusivity has been assumed, in which the CH2 unit nearest to the head group has the least value and the ones furthest from the head group, that is, at the end of the alkyl chain has the largest value. The fast torsional motion is described by a 2-fold jump rotation model. Quantitative estimate of the different parameters characterizing various dynamical motions active within the time scale of the instrument is also presented. We have provided a detailed description of the observed dynamical features in hybrid HAp-CTAB composite, a potential candidate for biomedical applications.

Detectors in Extreme Conditions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Blaj, G.; Carini, G.; Carron, S.

2015-08-06

Free Electron Lasers opened a new window on imaging the motion of atoms and molecules. At SLAC, FEL experiments are performed at LCLS using 120Hz pulses with 10 12 - 10 13 photons in 10 femtoseconds (billions of times brighter than the most powerful synchrotrons). This extreme detection environment raises unique challenges, from obvious to surprising. Radiation damage is a constant threat due to accidental exposure to insufficiently attenuated beam, focused beam and formation of ice crystals reflecting the beam onto the detector. Often high power optical lasers are also used (e.g., 25TW), increasing the risk of damage or impedingmore » data acquisition through electromagnetic pulses (EMP). The sample can contaminate the detector surface or even produce shrapnel damage. Some experiments require ultra high vacuum (UHV) with strict design, surface contamination and cooling requirements - also for detectors. The setup is often changed between or during experiments with short turnaround times, risking mechanical and ESD damage, requiring work planning, training of operators and sometimes continuous participation of the LCLS Detector Group in the experiments. The detectors used most often at LCLS are CSPAD cameras for hard x-rays and pnCCDs for soft x-rays.« less

Thermal Noise in the Initial LIGO Interferometers

NASA Astrophysics Data System (ADS)

Gillespie, Aaron D.

1995-01-01

Gravitational wave detectors capable of detecting broadband gravitational wave bursts with a strain amplitude sensitivity near 10^{-21} at frequencies around 100 Hz are currently under construction by the LIGO (Laser Interferometer Gravitational-wave Observatory) and VIRGO groups. One challenge facing these groups is how to detect the motion of the center of an inertial mass to a precision of 10^{-18} m when the mass consists of atoms each of which individually moves much more than that due to thermal energy. The uncertainty in the interferometer's measurement due to these thermal motions is called thermal noise. This thesis describes the thermal noise of the initial LIGO detectors. The thermal noise was analyzed by modelling the normal modes of the test mass suspension system as harmonic oscillators with dissipation and applying the fluctuation dissipation theorem. The dissipation of all modes which contribute significant thermal noise to the interferometer was measured and from these measurements the total thermal noise was estimated. The frequency dependence of the dissipation of the pendulum mode was characterized from measurements of the violin modes. A steel music wire suspension system was found to meet the goals of the initial LIGO detectors. A mathematical technique was developed which relates the energy in each vibrational mode to the motion of the mirror surface measured by the interferometer. Modes with acoustic wavelengths greater than the laser beam spot size can contribute significant thermal noise to the interferometer measurements. The dissipation of the test masses of LIGO's 40 -m interferometer at Caltech was investigated, and a technique for suspending and controlling the test masses which lowered the dissipation and met the thermal noise goals of the initial LIGO detector was developed. New test masses were installed in the 40-m interferometer resulting in improved noise performance. The implications of thermal noise to detecting gravitational waves from inspiralling compact binaries was investigated. An optimal pendulum length for detecting these signals was found. It was shown that the narrow band thermally excited violin resonances could be efficiently filtered from the broadband gravitational wave signal.

Illusory motion reversal is caused by rivalry, not by perceptual snapshots of the visual field.

PubMed

Kline, Keith; Holcombe, Alex O; Eagleman, David M

2004-10-01

In stroboscopic conditions--such as motion pictures--rotating objects may appear to rotate in the reverse direction due to under-sampling (aliasing). A seemingly similar phenomenon occurs in constant sunlight, which has been taken as evidence that the visual system processes discrete "snapshots" of the outside world. But if snapshots are indeed taken of the visual field, then when a rotating drum appears to transiently reverse direction, its mirror image should always appeared to reverse direction simultaneously. Contrary to this hypothesis, we found that when observers watched a rotating drum and its mirror image, almost all illusory motion reversals occurred for only one image at a time. This result indicates that the motion reversal illusion cannot be explained by snapshots of the visual field. The same result is found when the two images are presented within one visual hemifield, further ruling out the possibility that discrete sampling of the visual field occurs separately in each hemisphere. The frequency distribution of illusory reversal durations approximates a gamma distribution, suggesting perceptual rivalry as a better explanation for illusory motion reversal. After adaptation of motion detectors coding for the correct direction, the activity of motion-sensitive neurons coding for motion in the reverse direction may intermittently become dominant and drive the perception of motion.

Characterizing Quality Factor of Niobium Resonators Using a Markov Chain Monte Carlo Approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Basu Thakur, Ritoban; Tang, Qing Yang; McGeehan, Ryan

The next generation of radiation detectors in high precision Cosmology, Astronomy, and particle-astrophysics experiments will rely heavily on superconducting microwave resonators and kinetic inductance devices. Understanding the physics of energy loss in these devices, in particular at low temperatures and powers, is vital. We present a comprehensive analysis framework, using Markov Chain Monte Carlo methods, to characterize loss due to two-level system in concert with quasi-particle dynamics in thin-film Nb resonators in the GHz range.

Exact Fan-Beam Reconstruction With Arbitrary Object Translations and Truncated Projections

NASA Astrophysics Data System (ADS)

Hoskovec, Jan; Clackdoyle, Rolf; Desbat, Laurent; Rit, Simon

2016-06-01

This article proposes a new method for reconstructing two-dimensional (2D) computed tomography (CT) images from truncated and motion contaminated sinograms. The type of motion considered here is a sequence of rigid translations which are assumed to be known. The algorithm first identifies the sufficiency of angular coverage in each 2D point of the CT image to calculate the Hilbert transform from the local “virtual” trajectory which accounts for the motion and the truncation. By taking advantage of data redundancy in the full circular scan, our method expands the reconstructible region beyond the one obtained with chord-based methods. The proposed direct reconstruction algorithm is based on the Differentiated Back-Projection with Hilbert filtering (DBP-H). The motion is taken into account during backprojection which is the first step of our direct reconstruction, before taking the derivatives and inverting the finite Hilbert transform. The algorithm has been tested in a proof-of-concept study on Shepp-Logan phantom simulations with several motion cases and detector sizes.

Information flow and protein dynamics: the interplay between nuclear magnetic resonance spectroscopy and molecular dynamics simulations

PubMed Central

Pastor, Nina; Amero, Carlos

2015-01-01

Proteins participate in information pathways in cells, both as links in the chain of signals, and as the ultimate effectors. Upon ligand binding, proteins undergo conformation and motion changes, which can be sensed by the following link in the chain of information. Nuclear magnetic resonance (NMR) spectroscopy and molecular dynamics (MD) simulations represent powerful tools for examining the time-dependent function of biological molecules. The recent advances in NMR and the availability of faster computers have opened the door to more detailed analyses of structure, dynamics, and interactions. Here we briefly describe the recent applications that allow NMR spectroscopy and MD simulations to offer unique insight into the basic motions that underlie information transfer within and between cells. PMID:25999971

Fluoropolymer Dynamics: Effects of Perfluoromethyl Branches

NASA Astrophysics Data System (ADS)

Eby, R. K.; Holt, D. B.; Farmer, B. L.; Adams, D. D.

1997-03-01

Previous simulations of polytetrafluoroethylene (PTFE) in the solid state showed that the interaction and movement of helix reversals plays an important role in the dynamic behavior of this important polymer. Copolymers of TFE and hexafluoropropylene (HFP), which can be viewed as PTFE with perfluoromethyl (PFM) group branch defects, is also widely used. Molecular mechanics and dynamics calculations have been performed with PTFE chain clusters containing PFM branches to investigate the effect of these defects on the local crystalline environment (and vice versa) and on the motions and interactions of helix reversals. Initial results indicate that helix reversals are attracted to sites of PFM branches in a chain. Such an interaction will impede the motions of helix reversals and have an impact on macroscopic mechanical properties such as resistance to plastic deformation under shear.

A Toxoplasma gondii Class XIV Myosin, Expressed in Sf9 Cells with a Parasite Co-chaperone, Requires Two Light Chains for Fast Motility*

PubMed Central

Bookwalter, Carol S.; Kelsen, Anne; Leung, Jacqueline M.; Ward, Gary E.; Trybus, Kathleen M.

2014-01-01

Many diverse myosin classes can be expressed using the baculovirus/Sf9 insect cell expression system, whereas others have been recalcitrant. We hypothesized that most myosins utilize Sf9 cell chaperones, but others require an organism-specific co-chaperone. TgMyoA, a class XIVa myosin from the parasite Toxoplasma gondii, is required for the parasite to efficiently move and invade host cells. The T. gondii genome contains one UCS family myosin co-chaperone (TgUNC). TgMyoA expressed in Sf9 cells was soluble and functional only if the heavy and light chain(s) were co-expressed with TgUNC. The tetratricopeptide repeat domain of TgUNC was not essential to obtain functional myosin, implying that there are other mechanisms to recruit Hsp90. Purified TgMyoA heavy chain complexed with its regulatory light chain (TgMLC1) moved actin in a motility assay at a speed of ∼1.5 μm/s. When a putative essential light chain (TgELC1) was also bound, TgMyoA moved actin at more than twice that speed (∼3.4 μm/s). This result implies that two light chains bind to and stabilize the lever arm, the domain that amplifies small motions at the active site into the larger motions that propel actin at fast speeds. Our results show that the TgMyoA domain structure is more similar to other myosins than previously appreciated and provide a molecular explanation for how it moves actin at fast speeds. The ability to express milligram quantities of a class XIV myosin in a heterologous system paves the way for detailed structure-function analysis of TgMyoA and identification of small molecule inhibitors. PMID:25231988

Prototype Compton imager for special nuclear material

NASA Astrophysics Data System (ADS)

Wulf, Eric A.; Phlips, Bernard F.; Kurfess, James D.; Novikova, Elena I.; Fitzgerald, Carrie

2006-05-01

Compton imagers offer a method for passive detection of nuclear material over background radiation. A prototype Compton imager has been constructed using 8 layers of silicon detectors. Each layer consists of a 2×2 array of 2 mm thick cross-strip double-sided silicon detectors with active areas of 5.7 × 5.7 cm2 and 64 strips per side. The detectors are daisy-chained together in the array so that only 256 channels of electronics are needed to read-out each layer of the instrument. This imager is a prototype for a large, high-efficiency Compton imager that will meet operational requirements of Homeland Security for detection of shielded uranium. The instrument can differentiate between different radioisotopes using the reconstructed gamma-ray energy and can also show the location of the emissions with respect to the detector location. Results from the current instrument as well as simulations of the next generation instrument are presented.

Absorption of Thermal Neutrons in Uranium

DOE R&D Accomplishments Database

Creutz, E. C.; Wilson, R. R.; Wigner, E. P.

1941-09-26

A knowledge of the absorption processes for neutrons in uranium is important for planning a chain reaction experiment. The absorption of thermal neutrons in uranium and uranium oxide has been studied. Neutrons from the cyclotron were slowed down by passage through a graphite block. A uranium or uranium oxide sphere was placed at various positions in the block. The neutron intensity at different points in the sphere and in the graphite was measured by observing the activity induced in detectors or uranium oxide or manganese. It was found that both the fission activity in the uranium oxide and the activity induced in manganese was affected by non-thermal neutrons. An experimental correction for such effects was made by making measurements with the detectors surrounded by cadmium. After such corrections the results from three methods of procedure with the uranium oxide detectors and from the manganese detectors were consistent to within a few per cent.

Printable sensors for explosive detonation

NASA Astrophysics Data System (ADS)

Griffith, Matthew J.; Cooling, Nathan A.; Elkington, Daniel C.; Muller, Elmar; Belcher, Warwick J.; Dastoor, Paul C.

2014-10-01

Here, we report the development of an organic thin film transistor (OTFT) based on printable solution processed polymers and employing a quantum tunnelling composite material as a sensor to convert the pressure wave output from detonation transmission tubing (shock tube) into an inherently amplified electronic signal for explosives initiation. The organic electronic detector allows detection of the signal in a low voltage operating range, an essential feature for sites employing live ordinances that is not provided by conventional electronic devices. We show that a 30-fold change in detector response is possible using the presented detector assembly. Degradation of the OTFT response with both time and repeated voltage scans was characterised, and device lifetime is shown to be consistent with the requirements for on-site printing and usage. The integration of a low cost organic electronic detector with inexpensive shock tube transmission fuse presents attractive avenues for the development of cheap and simple assemblies for precisely timed initiation of explosive chains.

The role of motion streaks in the perception of the kinetic Zollner illusion.

PubMed

Khuu, Sieu K

2012-06-12

In classic geometric illusions such as the Zollner illusion, vertical lines superimposed on oriented background lines appear tilted in the direction opposite to the background. In kinetic forms of this illusion, an object moving over oriented background lines appears to follow a titled path, again in the direction opposite to the background. Existing literature does not proffer a complete explanation of the effect. Here, it is suggested that motion streaks underpin the illusion; that the effect is a consequence of interactions between detectors tuned to the orientation of background lines and those sensing the motion streaks that arise from fast object motion. This account was examined in the present study by measuring motion-tilt induction under different conditions in which the strength or salience of motion streaks was attenuated: by varying object speed (Experiment 1), contrast (Experiment 2), and trajectory/length by changing the element life-time within the stimulus (Experiment 3). It was predicted that, as motion streaks become less available, background lines would less affect the perceived direction of motion. Consistent with this prediction, the results indicated that, with a reduction in object speed below that required to generate motion streaks (< 1.12°/s), Weber contrast (< 0.125) and motion streak length (two frames) reduced or extinguished the motion-tilt-induction effect. The findings of the present study are consistent with previous reports and computational models that directly combine form and motion information to provide an effective determinant of motion direction.

Novel wearable and wireless ring-type pulse oximeter with multi-detectors.

PubMed

Huang, Cheng-Yang; Chan, Ming-Che; Chen, Chien-Yue; Lin, Bor-Shyh

2014-09-19

The pulse oximeter is a popular instrument to monitor the arterial oxygen saturation (SPO2). Although a fingertip-type pulse oximeter is the mainstream one on the market at present, it is still inconvenient for long-term monitoring, in particular, with respect to motion. Therefore, the development of a wearable pulse oximeter, such as a finger base-type pulse oximeter, can effectively solve the above issue. However, the tissue structure of the finger base is complex, and there is lack of detailed information on the effect of the light source and detector placement on measuring SPO2. In this study, the practicability of a ring-type pulse oximeter with a multi-detector was investigated by optical human tissue simulation. The optimal design of a ring-type pulse oximeter that can provide the best efficiency of measuring SPO2 was discussed. The efficiency of ring-type pulse oximeters with a single detector and a multi-detector was also discussed. Finally, a wearable and wireless ring-type pulse oximeter was also implemented to validate the simulation results and was compared with the commercial fingertip-type pulse oximeter.

Novel Wearable and Wireless Ring-Type Pulse Oximeter with Multi-Detectors

PubMed Central

Huang, Cheng-Yang; Chan, Ming-Che; Chen, Chien-Yue; Lin, Bor-Shyh

2014-01-01

The pulse oximeter is a popular instrument to monitor the arterial oxygen saturation (SPO2). Although a fingertip-type pulse oximeter is the mainstream one on the market at present, it is still inconvenient for long-term monitoring, in particular, with respect to motion. Therefore, the development of a wearable pulse oximeter, such as a finger base-type pulse oximeter, can effectively solve the above issue. However, the tissue structure of the finger base is complex, and there is lack of detailed information on the effect of the light source and detector placement on measuring SPO2. In this study, the practicability of a ring-type pulse oximeter with a multi-detector was investigated by optical human tissue simulation. The optimal design of a ring-type pulse oximeter that can provide the best efficiency of measuring SPO2 was discussed. The efficiency of ring-type pulse oximeters with a single detector and a multi-detector was also discussed. Finally, a wearable and wireless ring-type pulse oximeter was also implemented to validate the simulation results and was compared with the commercial fingertip-type pulse oximeter. PMID:25244586

A Model for an Angular Velocity-Tuned Motion Detector Accounting for Deviations in the Corridor-Centering Response of the Bee.

PubMed

Cope, Alex J; Sabo, Chelsea; Gurney, Kevin; Vasilaki, Eleni; Marshall, James A R

2016-05-01

We present a novel neurally based model for estimating angular velocity (AV) in the bee brain, capable of quantitatively reproducing experimental observations of visual odometry and corridor-centering in free-flying honeybees, including previously unaccounted for manipulations of behaviour. The model is fitted using electrophysiological data, and tested using behavioural data. Based on our model we suggest that the AV response can be considered as an evolutionary extension to the optomotor response. The detector is tested behaviourally in silico with the corridor-centering paradigm, where bees navigate down a corridor with gratings (square wave or sinusoidal) on the walls. When combined with an existing flight control algorithm the detector reproduces the invariance of the average flight path to the spatial frequency and contrast of the gratings, including deviations from perfect centering behaviour as found in the real bee's behaviour. In addition, the summed response of the detector to a unit distance movement along the corridor is constant for a large range of grating spatial frequencies, demonstrating that the detector can be used as a visual odometer.

A Model for an Angular Velocity-Tuned Motion Detector Accounting for Deviations in the Corridor-Centering Response of the Bee

PubMed Central

Sabo, Chelsea; Gurney, Kevin; Vasilaki, Eleni; Marshall, James A. R.

2016-01-01

We present a novel neurally based model for estimating angular velocity (AV) in the bee brain, capable of quantitatively reproducing experimental observations of visual odometry and corridor-centering in free-flying honeybees, including previously unaccounted for manipulations of behaviour. The model is fitted using electrophysiological data, and tested using behavioural data. Based on our model we suggest that the AV response can be considered as an evolutionary extension to the optomotor response. The detector is tested behaviourally in silico with the corridor-centering paradigm, where bees navigate down a corridor with gratings (square wave or sinusoidal) on the walls. When combined with an existing flight control algorithm the detector reproduces the invariance of the average flight path to the spatial frequency and contrast of the gratings, including deviations from perfect centering behaviour as found in the real bee’s behaviour. In addition, the summed response of the detector to a unit distance movement along the corridor is constant for a large range of grating spatial frequencies, demonstrating that the detector can be used as a visual odometer. PMID:27148968

Tales told by tails: watching DNA driven through a random medium

NASA Astrophysics Data System (ADS)

Guan, Juan; Wang, Bo; Bae, Sung Chul; Granick, Steve

2013-03-01

DNA ligation is used to label separately the ends and centers of monodisperse DNA 16 μm in contour length, and 2-color fluorescence microscopy is used to follow with nm resolution how chains migrate through agarose networks driven by electric fields, at both whole chain and segment level. We observe that the leading segment is always a physical chain end which stretches and pulls out slack in the still-quiescent remainder of the chain until the other end is taken up. Heads and tails behave strikingly differently: the leading end of migrating chains migrates more smoothly, whereas motion of the trailing end shows intermittent pauses and jerky recoil. None of the mechanisms imagined classically for this situation - chain reptation, hooking or entropic trapping, appears to fully describe these data obtained from single-molecule visualization.

The HADES-RICH upgrade using Hamamatsu H12700 MAPMTs with DiRICH FEE + Readout

NASA Astrophysics Data System (ADS)

Patel, V.; Traxler, M.

2018-03-01

The High Acceptance Di-Electron Spectrometer (HADES) is operational since the year 2000 and uses a hadron blind RICH detector for electron identification. The RICH photon detector is currently replaced by Hamamatsu H12700 MAPMTs with a readout system based on the DiRICH front-end module. The electronic readout chain is being developed as a joint effort of the HADES-, CBM- and PANDA collaborations and will also be used in the photon detectors for the upcoming Compressed Baryonic Matter (CBM) and PANDA experiments at FAIR . This article gives a brief overview on the photomultipliers and their quality assurance test measurements, as well as first measurements of the new DiRICH front-end module in final configurations.

Measurement of neutrino flux from the primary proton-proton fusion process in the Sun with Borexino detector

NASA Astrophysics Data System (ADS)

Smirnov, O. Yu.; Agostini, M.; Appel, S.; Bellini, G.; Benziger, J.; Bick, D.; Bonfini, G.; Bravo, D.; Caccianiga, B.; Calaprice, F.; Caminata, A.; Cavalcante, P.; Chepurnov, A.; Choi, K.; D'Angelo, D.; Davini, S.; Derbin, A.; Di Noto, L.; Drachnev, I.; Empl, A.; Etenko, A.; Fomenko, K.; Franco, D.; Gabriele, F.; Galbiati, C.; Ghiano, C.; Giammarchi, M.; Goeger-Neff, M.; Goretti, A.; Gromov, M.; Hagner, C.; Hungerford, E.; Ianni, Aldo; Ianni, Andrea; Jedrzejczak, K.; Kaiser, M.; Kobychev, V.; Korablev, D.; Korga, G.; Kryn, D.; Laubenstein, M.; Lehnert, B.; Litvinovich, E.; Lombardi, F.; Lombardi, P.; Ludhova, L.; Lukyanchenko, G.; Machulin, I.; Manecki, S.; Maneschg, W.; Marcocci, S.; Meroni, E.; Meyer, M.; Miramonti, L.; Misiaszek, M.; Mosteiro, P.; Muratova, V.; Neumair, B.; Oberauer, L.; Obolensky, M.; Ortica, F.; Otis, K.; Pagani, L.; Pallavicini, M.; Papp, L.; Perasso, L.; Pocar, A.; Ranucci, G.; Razeto, A.; Re, A.; Romani, A.; Roncin, R.; Rossi, N.; Schönert, S.; Semenov, D.; Simgen, H.; Skorokhvatov, M.; Sotnikov, A.; Sukhotin, S.; Suvorov, Y.; Tartaglia, R.; Testera, G.; Thurn, J.; Toropova, M.; Unzhakov, E.; Vogelaar, R. B.; von Feilitzsch, F.; Wang, H.; Weinz, S.; Winter, J.; Wojcik, M.; Wurm, M.; Yokley, Z.; Zaimidoroga, O.; Zavatarelli, S.; Zuber, K.; Zuzel, G.

2016-11-01

Neutrino produced in a chain of nuclear reactions in the Sun starting from the fusion of two protons, for the first time has been detected in a real-time detector in spectrometric mode. The unique properties of the Borexino detector provided an oppurtunity to disentangle pp-neutrino spectrum from the background components. A comparison of the total neutrino flux from the Sun with Solar luminosity in photons provides a test of the stability of the Sun on the 105 years time scale, and sets a strong limit on the power production in the unknown energy sources in the Sun of no more than 4% of the total energy production at 90% C.L.

Measuring mechanical motion with a single spin

NASA Astrophysics Data System (ADS)

Bennett, S. D.; Kolkowitz, S.; Unterreithmeier, Q. P.; Rabl, P.; Bleszynski Jayich, A. C.; Harris, J. G. E.; Lukin, M. D.

2012-12-01

We study theoretically the measurement of a mechanical oscillator using a single two-level system as a detector. In a recent experiment, we used a single electronic spin associated with a nitrogen-vacancy center in diamond to probe the thermal motion of a magnetized cantilever at room temperature (Kolkowitz et al 2012 Science 335 1603). Here, we present a detailed analysis of the sensitivity limits of this technique, as well as the possibility to measure the zero-point motion of the oscillator. Further, we discuss the issue of measurement backaction in sequential measurements and find that although backaction heating can occur, it does not prohibit the detection of zero-point motion. Throughout the paper, we focus on the experimental implementation of a nitrogen-vacancy center coupled to a magnetic cantilever; however, our results are applicable to a wide class of spin-oscillator systems. The implications for the preparation of nonclassical states of a mechanical oscillator are also discussed.

Exact analytical approach for six-degree-of-freedom measurement using image-orientation-change method.

PubMed

Tsai, Chung-Yu

2012-04-01

An exact analytical approach is proposed for measuring the six-degree-of-freedom (6-DOF) motion of an object using the image-orientation-change (IOC) method. The proposed measurement system comprises two reflector systems, where each system consists of two reflectors and one position sensing detector (PSD). The IOCs of the object in the two reflector systems are described using merit functions determined from the respective PSD readings before and after motion occurs, respectively. The three rotation variables are then determined analytically from the eigenvectors of the corresponding merit functions. After determining the three rotation variables, the order of the translation equations is downgraded to a linear form. Consequently, the solution for the three translation variables can also be analytically determined. As a result, the motion transformation matrix describing the 6-DOF motion of the object is fully determined. The validity of the proposed approach is demonstrated by means of an illustrative example.

Image motion compensation on the Spacelab 2 Solar Optical Universal Polarimeter /SL2 SOUP/

NASA Technical Reports Server (NTRS)

Tarbell, T. D.; Duncan, D. W.; Finch, M. L.; Spence, G.

1981-01-01

The SOUP experiment on Spacelab 2 includes a 30 cm visible light telescope and focal plane package mounted on the Instrument Pointing System (IPS). Scientific goals of the experiment dictate pointing stability requirements of less than 0.05 arcsecond jitter over periods of 5-20 seconds. Quantitative derivations of these requirements from two different aspects are presented: (1) avoidance of motion blurring of diffraction-limited images; (2) precise coalignment of consecutive frames to allow measurement of small image differences. To achieve this stability, a fine guider system capable of removing residual jitter of the IPS and image motions generated on the IPS cruciform instrument support structure has been constructed. This system uses solar limb detectors in the prime focal plane to derive an error signal. Image motion due to pointing errors is compensated by the agile secondary mirror mounted on piezoelectric transducers, controlled by a closed-loop servo system.

Deuteron NMR (Nuclear Magnetic Resonance) in relation to the glass transition in polymers

NASA Technical Reports Server (NTRS)

Roessler, E.; Sillescu, H.; Spiess, H. W.; Wallwitz, R.

1983-01-01

H-2NMR is introduced as a tool for investigating slow molecular motion in the glass transition region of amorphous polymers. In particular, we compare H-2 spin alignment echo spectra of chain deuterated polystyrene with model calculations for restricted rotational Brownian motion. Molecular motion in the polyztyrene-toluene system has been investigated by analyzing H-2NMR of partially deuterated polystyrene and toluene, respectively. The diluent mobility in the mixed glass has been decomposed into solid and liquid components where the respective average correlation times differ by more than 5 decades.

Theoretical and Monte Carlo optimization of a stacked three-layer flat-panel x-ray imager for applications in multi-spectral diagnostic medical imaging

NASA Astrophysics Data System (ADS)

Lopez Maurino, Sebastian; Badano, Aldo; Cunningham, Ian A.; Karim, Karim S.

2016-03-01

We propose a new design of a stacked three-layer flat-panel x-ray detector for dual-energy (DE) imaging. Each layer consists of its own scintillator of individual thickness and an underlying thin-film-transistor-based flat-panel. Three images are obtained simultaneously in the detector during the same x-ray exposure, thereby eliminating any motion artifacts. The detector operation is two-fold: a conventional radiography image can be obtained by combining all three layers' images, while a DE subtraction image can be obtained from the front and back layers' images, where the middle layer acts as a mid-filter that helps achieve spectral separation. We proceed to optimize the detector parameters for two sample imaging tasks that could particularly benefit from this new detector by obtaining the best possible signal to noise ratio per root entrance exposure using well-established theoretical models adapted to fit our new design. These results are compared to a conventional DE temporal subtraction detector and a single-shot DE subtraction detector with a copper mid-filter, both of which underwent the same theoretical optimization. The findings are then validated using advanced Monte Carlo simulations for all optimized detector setups. Given the performance expected from initial results and the recent decrease in price for digital x-ray detectors, the simplicity of the three-layer stacked imager approach appears promising to usher in a new generation of multi-spectral digital x-ray diagnostics.

Gas electron multiplier (GEM) enhanced ionization chamber for fluorescence detector

NASA Astrophysics Data System (ADS)

Shaban, E. H.; Siddons, D. P.; Kuczewski, A.

2007-11-01

Detecting dilute elements in thin materials using extended X-ray absorption fluorescence spectroscopy (EXAFS) method requires a detector capable of high count rate and low noise. For detection of dilute elements, the fluorescence signal amplitude is often overcome by the presence of noise or background interference. In this paper we have used a gas ionization chamber enhanced by a gas electron multiplier (GEM) to amplify the primary ionized electrons due to the X-ray fluorescence of a dilute element. The GEM provides an essentially noise free electron amplification of the signal primary photoelectrons. It provides a larger output current prior to the electronic amplification, allowing a lower gain amplifier with lower electronic circuit noise contribution and hence improved S/ N ratio. In addition, since the signal is produced only by electrons, and not from ion motion, the detector is capable of recording rapidly changing signals. Iron in an arbitrary tree leaf was used as a test sample. This sample was measured using our detector SUBRSAB, and also with Lytle and passivated implanted planar silicon (PIPS) detectors. An improvement in the signal amplitude by a factor of 20 and a factor of 2 are recorded for the proposed detector with respect to the Lytle and PIPS detectors, respectively. Although the gain in signal over the PIPS detector is small for this detector, its lack of sensitivity to light and its low and temperature-independent dark current are further advantages.

Motional Induction by Tsunamis and Ocean Tides: 10 Years of Progress

NASA Astrophysics Data System (ADS)

Minami, Takuto

2017-09-01

Motional induction is the process by which the motion of conductive seawater in the ambient geomagnetic main field generates electromagnetic (EM) variations, which are observable on land, at the seafloor, and sometimes at satellite altitudes. Recent years have seen notable progress in our understanding of motional induction associated with tsunamis and with ocean tides. New studies of tsunami motional induction were triggered by the 2004 Sumatra earthquake tsunami and further promoted by subsequent events, such as the 2010 Chile earthquake and the 2011 Tohoku earthquake. These events yielded observations of tsunami-generated EM variations from land and seafloor stations. Studies of magnetic fields generated by ocean tides attracted interest when the Swarm satellite constellation enabled researchers to monitor tide-generated magnetic variations from low Earth orbit. Both avenues of research benefited from the advent of sophisticated seafloor instruments, by which we may exploit motional induction for novel applications. For example, seafloor EM measurements can serve as detectors of vector properties of tsunamis, and seafloor EM data related to ocean tides have proved useful for sounding Earth's deep interior. This paper reviews and discusses the progress made in motional induction studies associated with tsunamis and ocean tides during the last decade.

Optical Trapping of Ion Coulomb Crystals

NASA Astrophysics Data System (ADS)

Schmidt, Julian; Lambrecht, Alexander; Weckesser, Pascal; Debatin, Markus; Karpa, Leon; Schaetz, Tobias

2018-04-01

The electronic and motional degrees of freedom of trapped ions can be controlled and coherently coupled on the level of individual quanta. Assembling complex quantum systems ion by ion while keeping this unique level of control remains a challenging task. For many applications, linear chains of ions in conventional traps are ideally suited to address this problem. However, driven motion due to the magnetic or radio-frequency electric trapping fields sometimes limits the performance in one dimension and severely affects the extension to higher-dimensional systems. Here, we report on the trapping of multiple barium ions in a single-beam optical dipole trap without radio-frequency or additional magnetic fields. We study the persistence of order in ensembles of up to six ions within the optical trap, measure their temperature, and conclude that the ions form a linear chain, commonly called a one-dimensional Coulomb crystal. As a proof-of-concept demonstration, we access the collective motion and perform spectrometry of the normal modes in the optical trap. Our system provides a platform that is free of driven motion and combines advantages of optical trapping, such as state-dependent confinement and nanoscale potentials, with the desirable properties of crystals of trapped ions, such as long-range interactions featuring collective motion. Starting with small numbers of ions, it has been proposed that these properties would allow the experimental study of many-body physics and the onset of structural quantum phase transitions between one- and two-dimensional crystals.

SRS Computer Animation and Drive Train System

NASA Technical Reports Server (NTRS)

Arthun, Daniel; Schachner, Christian

2001-01-01

The spinning rocket simulator (SRS) is an ongoing project at Oral Roberts University. The goal of the SRS is to gather crucial data concerning a spinning rocket under thrust for the purpose of analysis and correction of the coning motion experienced by this type of spacecraft maneuver. The computer animation simulates a virtual, scale model of the component of the SRS that represents the spacecraft itself. This component is known as the (VSM), or virtual spacecraft model. During actual physical simulation, this component of the SRS will experience a coning. The goal of the animation is to cone the VSM within that range to accurately represent the motion of the actual simulator. The drive system of the SRS is the apparatus that turns the actual simulator. It consists of a drive motor, motor mount and chain to power the simulator into motion. The motor mount is adjustable and rigid for high torque application. A digital stepper motor controller actuates the main drive motor for linear acceleration. The chain transfers power from the motor to the simulator via sprockets on both ends.

Markov Chain Models for Stochastic Behavior in Resonance Overlap Regions

NASA Astrophysics Data System (ADS)

McCarthy, Morgan; Quillen, Alice

2018-01-01

We aim to predict lifetimes of particles in chaotic zoneswhere resonances overlap. A continuous-time Markov chain model isconstructed using mean motion resonance libration timescales toestimate transition times between resonances. The model is applied todiffusion in the co-rotation region of a planet. For particles begunat low eccentricity, the model is effective for early diffusion, butnot at later time when particles experience close encounters to the planet.

Radiation hardness and timing studies of a monolithic TowerJazz pixel design for the new ATLAS Inner Tracker

NASA Astrophysics Data System (ADS)

Riegel, C.; Backhaus, M.; Van Hoorne, J. W.; Kugathasan, T.; Musa, L.; Pernegger, H.; Riedler, P.; Schaefer, D.; Snoeys, W.; Wagner, W.

2017-01-01

A part of the upcoming HL-LHC upgrade of the ATLAS Detector is the construction of a new Inner Tracker. This upgrade opens new possibilities, but also presents challenges in terms of occupancy and radiation tolerance. For the pixel detector inside the inner tracker, hybrid modules containing passive silicon sensors and connected readout chips are presently used, but require expensive assembly techniques like fine-pitch bump bonding. Silicon devices fabricated in standard commercial CMOS technologies, which include part or all of the readout chain, are also investigated offering a reduced cost as they are cheaper per unit area than traditional silicon detectors. If they contain the full readout chain, as for a fully monolithic approach, there is no need for the expensive flip-chip assembly, resulting in a further cost reduction and material savings. In the outer pixel layers of the ATLAS Inner Tracker, the pixel sensors must withstand non-ionising energy losses of up to 1015 n/cm2 and offer a timing resolution of 25 ns or less. This paper presents test results obtained on a monolithic test chip, the TowerJazz 180nm Investigator, towards these specifications. The presented program of radiation hardness and timing studies has been launched to investigate this technology's potential for the new ATLAS Inner Tracker.

Dynamics in Polymer Nanocomposites

NASA Astrophysics Data System (ADS)

Clarke, Nigel

2015-03-01

Since nanoparticles are increasingly being added to polymers to impart mechanical and functional properties, we are exploring how nanoparticles impact polymer dynamics with a focus on the diffusion coefficients. In high molecular weight polymer melts, chain diffusion is well described by the reptation model. Motion proceeds as a snake-like diffusion of the chain as a whole, along the contour of a tube that mimics the role of physical entanglements, or topological constraints, with other chains. In polymer nanocomposites there are additional constraints due to the dispersed nanoparticles in the polymer matrix. Chain motion can be altered by nanoparticle size, shape , aspect ratio, surface area, loading and the nature of the interactions between the nanoparticles and the polymer matrix. We have observed a minimum in the diffusion coefficient as a function of nanoparticle concentration when the nanoparticles are rod-like and a collapse of the diffusion coefficient onto a master curve when the nanoparticles are spherical. We are simulating the dynamics using molecular and dissipative particle simulations in order to provide physical insight into the local structure and dynamics, and have also carried out highly coarse grained Monte Carlo simulations of entangled polymers to explore how reptation is affected by the presence of larger scale obstacles. We acknowledge support from the NSF/EPSRC Materials World Network Program.

Silicon Drift Detectors - A Novel Technology for Vertex Detectors

NASA Astrophysics Data System (ADS)

Lynn, D.

1996-10-01

Silicon Drift Detectors (SDD) are novel position sensing silicon detectors which operate in a manner analogous to gas drift detectors. Single SDD's were shown in the CERN NA45 experiment to permit excellent spatial resolution (< 10 μm), to handle large particle occupancy, and to require a small fraction of the number of electronic channels of an equivalent pixel detector. The Silicon Vertex Tracker (SVT) for the STAR experiment at RHIC is based on this new technology. The SVT will consist of 216 SDD's, each 6.3 cm by 6.3 cm, arranged in a three layer barrel design, covering 2 π in azimuth and ±1 in pseudo-rapidity. Over the last three years we undertook a concentrated R+D effort to optimize the performance of the detector by minimizing the inactive area, the operating voltage and the data volume. We will present test results from several wafer prototypes. The charge produced by the passage of ionizing particles through the bulk of the detectors is collected on segmented anodes, with a pitch of 250 μm, on the far edges of the detector. The anodes are wire-bonded to a thick film multi-chip module which contains preamplifier/shaper chips and CMOS based switched capacitor arrays used as an analog memory pipeline. The ADC is located off-detector. The complete readout chain from the wafer to the DAQ will be presented. Finally we will show physics performance simulations based on the resolution achieved by the SVT prototypes.

Three Stages and Two Systems of Visual Processing

DTIC Science & Technology

1989-01-01

as squaring do not, in and of themselves, imply second- order processing . For example, the Adelson and Bergen’s (1985) detector of directional motion...rectification, halfwave rectification is a second- order processing scheme. Figure 8. Stimuli for analyzing second- order processing . (a) An x,y,t representation of

NMR (Nuclear Magnetic Resonance) and macromolecular migration in a melt or in concentrated solutions

NASA Technical Reports Server (NTRS)

Addad, J. P. C.

1983-01-01

The purpose of this paper is to analyze the migration process of long polymer molecules in a melt or in concentrated solutions as it may be observed from the dynamics of the transverse magnetization of nuclear spins linked to these chains. The low frequency viscoelastic relaxation of polymer systems is known to be mainly controlled by the mechanism of dissociation of topological constraints excited on chains and which are called entanglements. This mechanism exhibits a strong dependence upon the chain molecular weight. These topological constraints also govern the diffusion process of polymer chains. So, the accurate description of the diffusion motion of a chain may be a convenient way to characterize disentanglement processes necessarily involved in any model proposed to explain viscoelastic effects.

Side-chain mobility in the folded state of Myoglobin

NASA Astrophysics Data System (ADS)

Lammert, Heiko; Onuchic, Jose

We study the accessibility of alternative side-chain rotamer configurations in the native state of Myoglobin, using an all-atom structure-based model. From long, unbiased simulation trajectories we determine occupancies of rotameric states and also estimate configurational and vibrational entropies. Direct sampling of the full native-state dynamics, enabled by the simple model, reveals facilitation of side-chain motions by backbone dynamics. Correlations between different dihedral angles are quantified and prove to be weak. We confirm global trends in the mobilities of side-chains, following burial and also the chemical character of residues. Surface residues loose little configurational entropy upon folding; side-chains contribute significantly to the entropy of the folded state. Mobilities of buried side-chains vary strongly with temperature. At ambient temperature, individual side-chains in the core of the protein gain substantial access to alternative rotamers, with occupancies that are likely observable experimentally. Finally, the dynamics of buried side-chains may be linked to the internal pockets, available to ligand gas molecules in Myoglobin.

Optimizing the way kinematical feed chains with great distance between slides are chosen for CNC machine tools

NASA Astrophysics Data System (ADS)

Lucian, P.; Gheorghe, S.

2017-08-01

This paper presents a new method, based on FRISCO formula, for optimizing the choice of the best control system for kinematical feed chains with great distance between slides used in computer numerical controlled machine tools. Such machines are usually, but not limited to, used for machining large and complex parts (mostly in the aviation industry) or complex casting molds. For such machine tools the kinematic feed chains are arranged in a dual-parallel drive structure that allows the mobile element to be moved by the two kinematical branches and their related control systems. Such an arrangement allows for high speed and high rigidity (a critical requirement for precision machining) during the machining process. A significant issue for such an arrangement it’s the ability of the two parallel control systems to follow the same trajectory accurately in order to address this issue it is necessary to achieve synchronous motion control for the two kinematical branches ensuring that the correct perpendicular position it’s kept by the mobile element during its motion on the two slides.

Mesoscopic modeling for nucleic acid chain dynamics

PubMed Central

Sales-Pardo, M.; Guimerà, R.; Moreira, A. A.; Widom, J.; Amaral, L. A. N.

2007-01-01

To gain a deeper insight into cellular processes such as transcription and translation, one needs to uncover the mechanisms controlling the configurational changes of nucleic acids. As a step toward this aim, we present here a mesoscopic-level computational model that provides a new window into nucleic acid dynamics. We model a single-stranded nucleic as a polymer chain whose monomers are the nucleosides. Each monomer comprises a bead representing the sugar molecule and a pin representing the base. The bead-pin complex can rotate about the backbone of the chain. We consider pairwise stacking and hydrogen-bonding interactions. We use a modified Monte Carlo dynamics that splits the dynamics into translational bead motion and rotational pin motion. By performing a number of tests, we first show that our model is physically sound. We then focus on a study of the kinetics of a DNA hairpin—a single-stranded molecule comprising two complementary segments joined by a noncomplementary loop—studied experimentally. We find that results from our simulations agree with experimental observations, demonstrating that our model is a suitable tool for the investigation of the hybridization of single strands. PMID:16089566

End of the chain? Rugosity and fine-scale bathymetry from existing underwater digital imagery using structure-from-motion (SfM) technology

USGS Publications Warehouse

Storlazzi, Curt; Dartnell, Peter; Hatcher, Gerry; Gibbs, Ann E.

2016-01-01

The rugosity or complexity of the seafloor has been shown to be an important ecological parameter for fish, algae, and corals. Historically, rugosity has been measured either using simple and subjective manual methods such as ‘chain-and-tape’ or complicated and expensive geophysical methods. Here, we demonstrate the application of structure-from-motion (SfM) photogrammetry to generate high-resolution, three-dimensional bathymetric models of a fringing reef from existing underwater video collected to characterize the seafloor. SfM techniques are capable of achieving spatial resolution that can be orders of magnitude greater than large-scale lidar and sonar mapping of coral reef ecosystems. The resulting data provide finer-scale measurements of bathymetry and rugosity that are more applicable to ecological studies of coral reefs than provided by the more expensive and time-consuming geophysical methods. Utilizing SfM techniques for characterizing the benthic habitat proved to be more effective and quantitatively powerful than conventional methods and thus might portend the end of the ‘chain-and-tape’ method for measuring benthic complexity.

Dynamic photoinduced realignment processes in photoresponsive block copolymer films: effects of the chain length and block copolymer architecture.

PubMed

Sano, Masami; Shan, Feng; Hara, Mitsuo; Nagano, Shusaku; Shinohara, Yuya; Amemiya, Yoshiyuki; Seki, Takahiro

2015-08-07

A series of block copolymers composed of an amorphous poly(butyl methacrylate) (PBMA) block connected with an azobenzene (Az)-containing liquid crystalline (PAz) block were synthesized by changing the chain length and polymer architecture. With these block copolymer films, the dynamic realignment process of microphase separated (MPS) cylinder arrays of PBMA in the PAz matrix induced by irradiation with linearly polarized light was studied by UV-visible absorption spectroscopy, and time-resolved grazing incidence small angle X-ray scattering (GI-SAXS) measurements using a synchrotron beam. Unexpectedly, the change in the chain length hardly affected the realignment rate. In contrast, the architecture of the AB-type diblock or the ABA-type triblock essentially altered the realignment feature. The strongly cooperative motion with an induction period before realignment was characteristic only for the diblock copolymer series, and the LPL-induced alignment change immediately started for triblock copolymers and the PAz homopolymer. Additionally, a marked acceleration in the photoinduced dynamic motions was unveiled in comparison with a thermal randomization process.

Limiting the Effects of Earthquake Shaking on Gravitational-Wave Interferometers

NASA Astrophysics Data System (ADS)

Perry, M. R.; Earle, P. S.; Guy, M. R.; Harms, J.; Coughlin, M.; Biscans, S.; Buchanan, C.; Coughlin, E.; Fee, J.; Mukund, N.

2016-12-01

Second-generation ground-based gravitational wave interferometers such as the Laser Interferometer Gravitational-wave Observatory (LIGO) are susceptible to high-amplitude waves from teleseismic events, which can cause astronomical detectors to fall out of mechanical lock (lockloss). This causes the data to be useless for gravitational wave detection around the time of the seismic arrivals and for several hours thereafter while the detector stabilizes enough to return to the locked state. The down time can be reduced if advance warning of impending shaking is received and the impact is suppressed in the isolation system with the goal of maintaining lock even at the expense of increased instrumental noise. Here we describe an early warning system for modern gravitational-wave observatories. The system relies on near real-time earthquake alerts provided by the U.S. Geological Survey (USGS) and the National Oceanic and Atmospheric Administration (NOAA). Hypocenter and magnitude information is typically available within 5 to 20 minutes of the origin time of significant earthquakes, generally before the arrival of high-amplitude waves from these teleseisms at LIGO. These alerts are used to estimate arrival times and ground velocities at the gravitational wave detectors. In general, 94% of the predictions for ground-motion amplitude are within a factor of 5 of measured values. The error in both arrival time and ground-motion prediction introduced by using preliminary, rather than final, hypocenter and magnitude information is minimal with about 90% of the events falling within a factor of 2 of the final predicted value. By using a Machine Learning Algorithm, we develop a lockloss prediction model that calculates the probability that a given earthquake will prevent a detector from taking data. Our initial results indicate that by using detector control configuration changes, we could save lockloss from 40-100 earthquake events in a 6-month time-period.

Rouse mode analysis of chain relaxation in homopolymer melts

DOE PAGES

Kalathi, Jagannathan T.; Kumar, Sanat K.; Rubinstein, Michael; ...

2014-09-15

We use molecular dynamics simulations of the Kremer–Grest (KG) bead–spring model of polymer chains of length between 10 and 500, and a closely related analogue that allows for chain crossing, to clearly delineate the effects of entanglements on the length-scale-dependent chain relaxation in polymer melts. We analyze the resulting trajectories using the Rouse modes of the chains and find that entanglements strongly affect these modes. The relaxation rates of the chains show two limiting effective monomeric frictions, with the local modes experiencing much lower effective friction than the longer modes. The monomeric relaxation rates of longer modes vary approximately inverselymore » with chain length due to kinetic confinement effects. The time-dependent relaxation of Rouse modes has a stretched exponential character with a minimum of stretching exponent in the vicinity of the entanglement chain length. None of these trends are found in models that allow for chain crossing. As a result, these facts, in combination, argue for the confined motion of chains for time scales between the entanglement time and their ultimate free diffusion.« less

Analog bus driver and multiplexer

NASA Technical Reports Server (NTRS)

Pain, Bedabrata (Inventor); Hancock, Bruce (Inventor); Cunningham, Thomas J. (Inventor)

2012-01-01

For a source-follower signal chain, the ohmic drop in the selection switch causes unacceptable voltage offset, non-linearity, and reduced small signal gain. For an op amp signal chain, the required bias current and the output noise rises rapidly with increasing the array format due to a rapid increase in the effective capacitance caused by the Miller effect boosting up the contribution of the bus capacitance. A new switched source-follower signal chain circuit overcomes limitations of existing op-amp based or source follower based circuits used in column multiplexers and data readout. This will improve performance of CMOS imagers, and focal plane read-out integrated circuits for detectors of infrared or ultraviolet light.

Periodic motion planning and control for underactuated mechanical systems

NASA Astrophysics Data System (ADS)

Wang, Zeguo; Freidovich, Leonid B.; Zhang, Honghua

2018-06-01

We consider the problem of periodic motion planning and of designing stabilising feedback control laws for such motions in underactuated mechanical systems. A novel periodic motion planning method is proposed. Each state is parametrised by a truncated Fourier series. Then we use numerical optimisation to search for the parameters of the trigonometric polynomial exploiting the measure of discrepancy in satisfying the passive dynamics equations as a performance index. Thus an almost feasible periodic motion is found. Then a linear controller is designed and stability analysis is given to verify that solutions of the closed-loop system stay inside a tube around the planned approximately feasible periodic trajectory. Experimental results for a double rotary pendulum are shown, while numerical simulations are given for models of a spacecraft with liquid sloshing and of a chain of mass spring system.

On event-based optical flow detection

PubMed Central

Brosch, Tobias; Tschechne, Stephan; Neumann, Heiko

2015-01-01

Event-based sensing, i.e., the asynchronous detection of luminance changes, promises low-energy, high dynamic range, and sparse sensing. This stands in contrast to whole image frame-wise acquisition by standard cameras. Here, we systematically investigate the implications of event-based sensing in the context of visual motion, or flow, estimation. Starting from a common theoretical foundation, we discuss different principal approaches for optical flow detection ranging from gradient-based methods over plane-fitting to filter based methods and identify strengths and weaknesses of each class. Gradient-based methods for local motion integration are shown to suffer from the sparse encoding in address-event representations (AER). Approaches exploiting the local plane like structure of the event cloud, on the other hand, are shown to be well suited. Within this class, filter based approaches are shown to define a proper detection scheme which can also deal with the problem of representing multiple motions at a single location (motion transparency). A novel biologically inspired efficient motion detector is proposed, analyzed and experimentally validated. Furthermore, a stage of surround normalization is incorporated. Together with the filtering this defines a canonical circuit for motion feature detection. The theoretical analysis shows that such an integrated circuit reduces motion ambiguity in addition to decorrelating the representation of motion related activations. PMID:25941470

Polymer diffusion in quenched disorder: A renormalization group approach

NASA Astrophysics Data System (ADS)

Ebert, Ute

1996-01-01

We study the diffusion of polymers through quenched short-range correlated random media by renormalization group (RG) methods, which allow us to derive universal predictions in the limit of long chains and weak disorder. We take local quenched random potentials with second moment v and the excluded-volume interaction u of the chain segments into account. We show that our model contains the relevant features of polymer diffusion in random media in the RG sense if we focus on the local entropic effects rather than on the topological constraints of a quenched random medium. The dynamic generating functional and the general structure of its perturbation expansion in u and v are derived. The distribution functions for the center-of-mass motion and the internal modes of one chain and for the correlation of the center of mass motions of two chains are calculated to one-loop order. The results allow for sufficient cross-checks to have trust in the one-loop renormalizability of the model. The general structure as well as the one-loop results of the integrated RG flow of the parameters are discussed. Universal results can be found for the effective static interaction w≔u-v≥0 and for small effective disorder couplingbar v(l) on the intermediate length scale l. As a first physical prediction from our analysis, we determine the general nonlinear scaling form of the chain diffusion constant and evaluate it explicitly as[Figure not available: see fulltext.] forbar v(l) ≪ 1.

Fast coincidence counting with active inspection systems

NASA Astrophysics Data System (ADS)

Mullens, J. A.; Neal, J. S.; Hausladen, P. A.; Pozzi, S. A.; Mihalczo, J. T.

2005-12-01

This paper describes 2nd and 3rd order time coincidence distributions measurements with a GHz processor that synchronously samples 5 or 10 channels of data from radiation detectors near fissile material. On-line, time coincidence distributions are measured between detectors or between detectors and an external stimulating source. Detector-to-detector correlations are useful for passive measurements also. The processor also measures the number of times n pulses occur in a selectable time window and compares this multiplet distribution to a Poisson distribution as a method of determining the occurrence of fission. The detectors respond to radiation emitted in the fission process induced internally by inherent sources or by external sources such as LINACS, DT generators either pulsed or steady state with alpha detectors, etc. Data can be acquired from prompt emission during the source pulse, prompt emissions immediately after the source pulse, or delayed emissions between source pulses. These types of time coincidence measurements (occurring on the time scale of the fission chain multiplication processes for nuclear weapons grade U and Pu) are useful for determining the presence of these fissile materials and quantifying the amount, and are useful for counter terrorism and nuclear material control and accountability. This paper presents the results for a variety of measurements.

Measurement of intrinsic radioactive backgrounds from the 137Cs and U/Th chains in CsI(Tl) crystals

NASA Astrophysics Data System (ADS)

Liu, Shu-Kui; Yue, Qian; Lin, Shin-Ted; Li, Yuan-Jing; Tang, Chang-Jian; Wong Tsz-King, Henry; Xing, Hao-Yang; Yang, Chao-Wen; Zhao, Wei; Zhu, Jing-Jun

2015-04-01

The inorganic CsI(Tl) crystal scintillator is a candidate anti-compton detector for the China Dark matter Experiment. Studying the intrinsic radiopurity of the CsI(Tl) crystal is an issue of major importance. The timing, energy and spatial correlations, as well as the capability of pulse shape discrimination provide powerful methods for the measurement of intrinsic radiopurities. The experimental design, detector performance and event-selection algorithms are described. A total of 359×3 kg-days data from three prototypes of CsI(Tl) crystals were taken at China Jinping Underground Laboratory (CJPL), which offers a good shielding environment. The contamination levels of internal isotopes from 137Cs, 232Th and 238U series, as well as the upper bounds of 235U series are reported. Identification of the whole α peaks from U/Th decay chains and derivation of those corresponding quenching factors are achieved. Supported by National Natural Science Foundation of China (11275107, 11175099)

Development of optoelectronic monitoring system for ear arterial pressure waveforms

NASA Astrophysics Data System (ADS)

Sasayama, Satoshi; Imachi, Yu; Yagi, Tamotsu; Imachi, Kou; Ono, Toshirou; Man-i, Masando

1994-02-01

Invasive intra-arterial blood pressure measurement is the most accurate method but not practical if the subject is in motion. The apparatus developed by Wesseling et al., based on a volume-clamp method of Penaz (Finapres), is able to monitor continuous finger arterial pressure waveforms noninvasively. The limitation of Finapres is the difficulty in measuring the pressure of a subject during work that involves finger or arm action. Because the Finapres detector is attached to subject's finger, the measurements are affected by inertia of blood and hydrostatic effect cause by arm or finger motion. To overcome this problem, the authors made a detector that is attached to subject's ear and developed and optoelectronic monitoring systems for ear arterial pressure waveform (Earpres). An IR LEDs, photodiode, and air cuff comprised the detector. The detector was attached to a subject's ear, and the space adjusted between the air cuff and the rubber plate on which the LED and photodiode were positioned. To evaluate the accuracy of Earpres, the following tests were conducted with participation of 10 healthy male volunteers. The subjects rested for about five minutes, then performed standing and squatting exercises to provide wide ranges of systolic and diastolic arterial pressure. Intra- and inter-individual standard errors were calculated according to the method of van Egmond et al. As a result, average, the averages of intra-individual standard errors for earpres appeared small (3.7 and 2.7 mmHg for systolic and diastolic pressure respectively). The inter-individual standard errors for Earpres were about the same was Finapres for both systolic and diastolic pressure. The results showed the ear monitor was reliable in measuring arterial blood pressure waveforms and might be applicable to various fields such as sports medicine and ergonomics.

Directional Antineutrino Detection

NASA Astrophysics Data System (ADS)

Safdi, B. R.; Suerfu, J.

2014-12-01

We propose the first truly directional antineutrino detector for antineutrinos near the threshold for the inverse beta decay (IBD) of hydrogen, with potential applications including the spatial mapping of geo-neutrinos, searches for stellar antineutrinos, and the monitoring of nuclear reactors. The detector consists of adjacent and separated target and neutron-capture layers. The IBD events, which result in a neutron and a positron, take place in the target layers. These layers are thin enough so that the neutrons escape without scattering elastically. The neutrons are detected in the thicker neutron-capture layers. The location of the IBD event is determined from the energy deposited by the positron as it slows in the medium and from the two gamma rays that come from the positron annihilation. Since the neutron recoils in the direction of the antineutrino's motion, a line may then be drawn between the IBD event location and the neutron-capture location to approximate the antineutrino's velocity. In some events, we may even measure the positron's velocity, which further increases our ability to reconstruct the antineutrino's direction of motion. Our method significantly improves upon previous methods by allowing the neutron to freely travel a long distance before diffusing and being captured. Moreover, our design is a straightforward modification of existing antineutrino detectors; a prototype could easily be built with existing technology. We verify our design through Monte Carlo simulations in Geant4, using commercially-available boron-loaded plastic scintillators for the target and neutron-capture layer materials. We are able to discriminate from background using multiple coincidence signatures within a short, ~microsecond time interval. We conclude that the detector could likely operate above ground with minimal shielding.

Limiting the effects of earthquakes on gravitational-wave interferometers

NASA Astrophysics Data System (ADS)

Coughlin, Michael; Earle, Paul; Harms, Jan; Biscans, Sebastien; Buchanan, Christopher; Coughlin, Eric; Donovan, Fred; Fee, Jeremy; Gabbard, Hunter; Guy, Michelle; Mukund, Nikhil; Perry, Matthew

2017-02-01

Ground-based gravitational wave interferometers such as the Laser Interferometer Gravitational-wave Observatory (LIGO) are susceptible to ground shaking from high-magnitude teleseismic events, which can interrupt their operation in science mode and significantly reduce their duty cycle. It can take several hours for a detector to stabilize enough to return to its nominal state for scientific observations. The down time can be reduced if advance warning of impending shaking is received and the impact is suppressed in the isolation system with the goal of maintaining stable operation even at the expense of increased instrumental noise. Here, we describe an early warning system for modern gravitational-wave observatories. The system relies on near real-time earthquake alerts provided by the U.S. Geological Survey (USGS) and the National Oceanic and Atmospheric Administration (NOAA). Preliminary low latency hypocenter and magnitude information is generally available in 5 to 20 min of a significant earthquake depending on its magnitude and location. The alerts are used to estimate arrival times and ground velocities at the gravitational-wave detectors. In general, 90% of the predictions for ground-motion amplitude are within a factor of 5 of measured values. The error in both arrival time and ground-motion prediction introduced by using preliminary, rather than final, hypocenter and magnitude information is minimal. By using a machine learning algorithm, we develop a prediction model that calculates the probability that a given earthquake will prevent a detector from taking data. Our initial results indicate that by using detector control configuration changes, we could prevent interruption of operation from 40 to 100 earthquake events in a 6-month time-period.

Limiting the effects of earthquakes on gravitational-wave interferometers

USGS Publications Warehouse

Coughlin, Michael; Earle, Paul; Harms, Jan; Biscans, Sebastien; Buchanan, Christopher; Coughlin, Eric; Donovan, Fred; Fee, Jeremy; Gabbard, Hunter; Guy, Michelle; Mukund, Nikhil; Perry, Matthew

2017-01-01

Ground-based gravitational wave interferometers such as the Laser Interferometer Gravitational-wave Observatory (LIGO) are susceptible to ground shaking from high-magnitude teleseismic events, which can interrupt their operation in science mode and significantly reduce their duty cycle. It can take several hours for a detector to stabilize enough to return to its nominal state for scientific observations. The down time can be reduced if advance warning of impending shaking is received and the impact is suppressed in the isolation system with the goal of maintaining stable operation even at the expense of increased instrumental noise. Here, we describe an early warning system for modern gravitational-wave observatories. The system relies on near real-time earthquake alerts provided by the U.S. Geological Survey (USGS) and the National Oceanic and Atmospheric Administration (NOAA). Preliminary low latency hypocenter and magnitude information is generally available in 5 to 20 min of a significant earthquake depending on its magnitude and location. The alerts are used to estimate arrival times and ground velocities at the gravitational-wave detectors. In general, 90% of the predictions for ground-motion amplitude are within a factor of 5 of measured values. The error in both arrival time and ground-motion prediction introduced by using preliminary, rather than final, hypocenter and magnitude information is minimal. By using a machine learning algorithm, we develop a prediction model that calculates the probability that a given earthquake will prevent a detector from taking data. Our initial results indicate that by using detector control configuration changes, we could prevent interruption of operation from 40 to 100 earthquake events in a 6-month time-period.

Enhancement of Brownian motion for a chain of particles in a periodic potential

NASA Astrophysics Data System (ADS)

Dessup, Tommy; Coste, Christophe; Saint Jean, Michel

2018-02-01

The transport of particles in very confined channels in which single file diffusion occurs has been largely studied in systems where the transverse confining potential is smooth. However, in actual physical systems, this potential may exhibit both static corrugations and time fluctuations. Some recent results suggest the important role played by this nonsmoothness of the confining potential. In particular, quite surprisingly, an enhancement of the Brownian motion of the particles has been evidenced in these kinds of systems. We show that this enhancement results from the commensurate effects induced by the underlying potential on the vibrational spectra of the chain of particles, and from the effective temperature associated with its time fluctuations. We will restrict our derivation to the case of low temperatures for which the mean squared displacement of the particles remains smaller than the potential period.

Caution Is Required in Interpretation of Mutations in the Voltage Sensing Domain of Voltage Gated Channels as Evidence for Gating Mechanisms

PubMed Central

Kariev, Alisher M.; Green, Michael E.

2015-01-01

The gating mechanism of voltage sensitive ion channels is generally considered to be the motion of the S4 transmembrane segment of the voltage sensing domains (VSD). The primary supporting evidence came from R→C mutations on the S4 transmembrane segment of the VSD, followed by reaction with a methanethiosulfonate (MTS) reagent. The cys side chain is –SH (reactive form –S−); the arginine side chain is much larger, leaving space big enough to accommodate the MTS sulfonate head group. The cavity created by the mutation has space for up to seven more water molecules than were present in wild type, which could be displaced irreversibly by the MTS reagent. Our quantum calculations show there is major reorientation of three aromatic residues that face into the cavity in response to proton displacement within the VSD. Two phenylalanines reorient sufficiently to shield/unshield the cysteine from the intracellular and extracellular ends, depending on the proton positions, and a tyrosine forms a hydrogen bond to the cysteine sulfur with its side chain –OH. These could produce the results of the experiments that have been interpreted as evidence for physical motion of the S4 segment, without physical motion of the S4 backbone. The computations strongly suggest that the interpretation of cysteine substitution reaction experiments be re-examined in the light of these considerations. PMID:25588216

Depth information in natural environments derived from optic flow by insect motion detection system: a model analysis

PubMed Central

Schwegmann, Alexander; Lindemann, Jens P.; Egelhaaf, Martin

2014-01-01

Knowing the depth structure of the environment is crucial for moving animals in many behavioral contexts, such as collision avoidance, targeting objects, or spatial navigation. An important source of depth information is motion parallax. This powerful cue is generated on the eyes during translatory self-motion with the retinal images of nearby objects moving faster than those of distant ones. To investigate how the visual motion pathway represents motion-based depth information we analyzed its responses to image sequences recorded in natural cluttered environments with a wide range of depth structures. The analysis was done on the basis of an experimentally validated model of the visual motion pathway of insects, with its core elements being correlation-type elementary motion detectors (EMDs). It is the key result of our analysis that the absolute EMD responses, i.e., the motion energy profile, represent the contrast-weighted nearness of environmental structures during translatory self-motion at a roughly constant velocity. In other words, the output of the EMD array highlights contours of nearby objects. This conclusion is largely independent of the scale over which EMDs are spatially pooled and was corroborated by scrutinizing the motion energy profile after eliminating the depth structure from the natural image sequences. Hence, the well-established dependence of correlation-type EMDs on both velocity and textural properties of motion stimuli appears to be advantageous for representing behaviorally relevant information about the environment in a computationally parsimonious way. PMID:25136314

Hydrostatic Level Sensors as High Precision Ground Motion Instrumentation for Tevatron and Other Energy Frontier Accelerators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Volk, James; Hansen, Sten; Johnson, Todd

2012-01-01

Particle accelerators require very tight tolerances on the alignment and stability of their elements: magnets, accelerating cavities, vacuum chambers, etc. In this article we describe the Hydrostatic Level Sensors (HLS) for very low frequency measurements used in a variety of facilities at Fermilab. We present design features of the sensors, outline their technical parameters, describe their test and calibration procedures, discuss different regimes of operation and give few illustrative examples of the experimental data. Detail experimental results of the ground motion measurements with these detectors will be presented in subsequent papers.

Nanoparticle Motion in Entangled Melts of Linear and Nonconcatenated Ring Polymers

PubMed Central

2017-01-01

The motion of nanoparticles (NPs) in entangled melts of linear polymers and nonconcatenated ring polymers are compared by large-scale molecular dynamics simulations. The comparison provides a paradigm for the effects of polymer architecture on the dynamical coupling between NPs and polymers in nanocomposites. Strongly suppressed motion of NPs with diameter d larger than the entanglement spacing a is observed in a melt of linear polymers before the onset of Fickian NP diffusion. This strong suppression of NP motion occurs progressively as d exceeds a and is related to the hopping diffusion of NPs in the entanglement network. In contrast to the NP motion in linear polymers, the motion of NPs with d > a in ring polymers is not as strongly suppressed prior to Fickian diffusion. The diffusion coefficient D decreases with increasing d much slower in entangled rings than in entangled linear chains. NP motion in entangled nonconcatenated ring polymers is understood through a scaling analysis of the coupling between NP motion and the self-similar entangled dynamics of ring polymers. PMID:28392603

A study of longitudinal tumor motion in helical tomotherapy using a cylindrical phantom

PubMed Central

Klein, Michael; Gaede, Stewart

2013-01-01

Tumor motion during radiation treatment on a helical tomotherapy unit may create problems due to interplay with motion of the multileaf collimator, gantry rotation, and patient couch translation through the gantry. This study evaluated this interplay effect for typical clinical parameters using a cylindrical phantom consisting of 1386 diode detectors placed on a respiratory motion platform. All combinations of radiation field widths (1, 2.5, and 5 cm) and gantry rotation periods (16, 30, and 60 s) were considered for sinusoidal motions with a period of 4 s and amplitudes of 5, 6, 7, 8, 9, and 10 mm, as well as real patient breathing pattern. Gamma comparisons with 2% dose difference and 2 mm distance to agreement and dose profiles were used for evaluation. The required motion margins were determined for each set of parameters. The required margin size increased with decreasing field width and increasing tumor motion amplitude, but was not affected by rotation period. The plans with the smallest field width of 1 cm have required motion margins approximately equal to the amplitude of motion (±25%), while those with the largest field width of 5 cm had required motion margins approximately equal to 20% of the motion amplitude (±20%). For tumor motion amplitudes below 6 mm and field widths above 1 cm, the required additional motion margins were very small, at a maximum of 2.5 mm for sinusoidal breathing patterns and 1.2 mm for the real patient breathing pattern. PACS numbers: 87.55.km, 87.55.Qr, 87.56.Fc

Calibration and Characterization of the UNCB and Nab Detectors

NASA Astrophysics Data System (ADS)

Zeck, Bryan; UCNB Collaboration; Nab Collaboration

2017-09-01

The UCNB and Nab experiments are designed to produce precision measurements of the free neutron decay angular correlations B, a, and b. Measurements of B and a require a coincident detection of the proton and electron produced in neutron decay, while for b, which manifests as a subtle shift in the electron energy spectrum, energy resolution better than 3 keV is desired and excellent fidelity for energy reconstruction is required, including characterization of non-linearity to the 10-4 level. To this end, a thick segmented silicon detector with a 100 nm dead layer and a 100 cm active area has been extensively characterized at LANL. The thin dead layer allows protons accelerated to 30 keV to deposit energy above threshold in the active volume of the detector, and the paired amplifer chain, developed at LANL, has a risetime of approximately 40 ns. Comparison of simulation to experiment reveals a detector resolution better than σ = 2.5 keV. A complete characterization of the detector will be presented. This work has been supported by Grants from the US National Science Foundation and the Department of Energy.

Layered motion segmentation and depth ordering by tracking edges.

PubMed

Smith, Paul; Drummond, Tom; Cipolla, Roberto

2004-04-01

This paper presents a new Bayesian framework for motion segmentation--dividing a frame from an image sequence into layers representing different moving objects--by tracking edges between frames. Edges are found using the Canny edge detector, and the Expectation-Maximization algorithm is then used to fit motion models to these edges and also to calculate the probabilities of the edges obeying each motion model. The edges are also used to segment the image into regions of similar color. The most likely labeling for these regions is then calculated by using the edge probabilities, in association with a Markov Random Field-style prior. The identification of the relative depth ordering of the different motion layers is also determined, as an integral part of the process. An efficient implementation of this framework is presented for segmenting two motions (foreground and background) using two frames. It is then demonstrated how, by tracking the edges into further frames, the probabilities may be accumulated to provide an even more accurate and robust estimate, and segment an entire sequence. Further extensions are then presented to address the segmentation of more than two motions. Here, a hierarchical method of initializing the Expectation-Maximization algorithm is described, and it is demonstrated that the Minimum Description Length principle may be used to automatically select the best number of motion layers. The results from over 30 sequences (demonstrating both two and three motions) are presented and discussed.

Angular oversampling with temporally offset layers on multilayer detectors in computed tomography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sjölin, Martin, E-mail: martin.sjolin@mi.physics.kth.se; Danielsson, Mats

2016-06-15

Purpose: Today’s computed tomography (CT) scanners operate at an increasingly high rotation speed in order to reduce motion artifacts and to fulfill the requirements of dynamic acquisition, e.g., perfusion and cardiac imaging, with lower angular sampling rate as a consequence. In this paper, a simple method for obtaining angular oversampling when using multilayer detectors in continuous rotation CT is presented. Methods: By introducing temporal offsets between the measurement periods of the different layers on a multilayer detector, the angular sampling rate can be increased by a factor equal to the number of layers on the detector. The increased angular samplingmore » rate reduces the risk of producing aliasing artifacts in the image. A simulation of a detector with two layers is performed to prove the concept. Results: The simulation study shows that aliasing artifacts from insufficient angular sampling are reduced by the proposed method. Specifically, when imaging a single point blurred by a 2D Gaussian kernel, the method is shown to reduce the strength of the aliasing artifacts by approximately an order of magnitude. Conclusions: The presented oversampling method is easy to implement in today’s multilayer detectors and has the potential to reduce aliasing artifacts in the reconstructed images.« less

Blast-induced Mild Traumatic Brain Injury

DTIC Science & Technology

2010-01-01

concentration with agents such as psychostimulants, or improving compensatory strategies through cognitive- behavioral therapies. Pharmacological interventions...participate in educational activities and support groups. Some examples of general educational content include (1) compensatory strategies for impaired...or simple, ranging from electronic transmitters to trip wires, tilt switches, motion detectors, or thermal or pressure-sensitive switches. lEOs are

Advanced Instrumentation for Positron Emission Tomography [PET

DOE R&D Accomplishments Database

Derenzo, S. E.; Budinger, T. F.

1985-04-01

This paper summarizes the physical processes and medical science goals that underlay modern instrumentation design for Positron Emission Tomography. The paper discusses design factors such as detector material, crystalphototube coupling, shielding geometry, sampling motion, electronics design, time-of-flight, and the interrelationships with quantitative accuracy, spatial resolution, temporal resolution, maximum data rates, and cost.

Decomposition of total solvation energy into core, side-chains and water contributions: Role of cross correlations and protein conformational fluctuations in dynamics of hydration layer

NASA Astrophysics Data System (ADS)

Mondal, Sayantan; Mukherjee, Saumyak; Bagchi, Biman

2017-09-01

Dynamical coupling between water and amino acid side-chain residues in solvation dynamics is investigated by selecting residues often used as natural probes, namely tryptophan, tyrosine and histidine, located at different positions on protein surface. Such differently placed residues are found to exhibit different timescales of relaxation. The total solvation response measured by the probe is decomposed in terms of its interactions with (i) protein core, (ii) side-chain and (iii) water. Significant anti cross-correlation among these contributions are observed. When the motion of the protein side-chains is quenched, solvation either becomes faster or slower depending on the location of the probe.

A restraint-free small animal SPECT imaging system with motion tracking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weisenberger, A.G.; Gleason, S.S.; Goddard, J.

2005-06-01

We report on an approach toward the development of a high-resolution single photon emission computed tomography (SPECT) system to image the biodistribution of radiolabeled tracers such as Tc-99m and I-125 in unrestrained/unanesthetized mice. An infrared (IR)-based position tracking apparatus has been developed and integrated into a SPECT gantry. The tracking system is designed to measure the spatial position of a mouse's head at a rate of 10-15 frames per second with submillimeter accuracy. The high-resolution, gamma imaging detectors are based on pixellated NaI(Tl) crystal scintillator arrays, position-sensitive photomultiplier tubes, and novel readout circuitry requiring fewer analog-digital converter (ADC) channels whilemore » retaining high spatial resolution. Two SPECT gamma camera detector heads based upon position-sensitive photomultiplier tubes have been built and installed onto the gantry. The IR landmark-based pose measurement and tracking system is under development to provide animal position data during a SPECT scan. The animal position and orientation data acquired by the tracking system will be used for motion correction during the tomographic image reconstruction.« less

3D Tracking of Diatom Motion in Turbulent Flow

NASA Astrophysics Data System (ADS)

Variano, E. A.; Brandt, L.; Sardina, G.; Ardekani, M.; Pujara, N.; Ayers, S.; Du Clos, K.; Karp-Boss, L.; Jumars, P. A.

2016-02-01

We present laboratory measurements of single-celled and chain forming diatom motion in a stirred turbulence tank. The overarching goal is to explore whether diatoms track flow with fidelity (passive tracers) or whether interactions with cell density and shape result in biased trajectories that alter settling velocities. Diatom trajectories are recorded in 3D using a stereoscopic, calibrated tracking tool. Turbulence is created in a novel stirred tank, designed to create motions that match those found in the ocean surface mixed layer at scales less than 10 cm. The data are analyzed for evidence of enhanced particle clustering, an indicator of turbulently altered settling rates

The Hawaii-Emperor Bend: Clearly a Record of Pacific Plate Motion Change

NASA Astrophysics Data System (ADS)

Wessel, P.; Harada, Y.; Kroenke, L. W.; Sterling, A.

2003-12-01

As most introductory textbooks will point out, the conventional explanation for the ˜120° change in the trends of the Hawaiian and Emperor chains is a ˜60° change in plate motion over a fixed plume in the mantle. Recently, however, new paleomagnetic and radiometric age data from the Emperor Seamounts have led some scientists to reject the conventional view of the origin of the Hawaii-Emperor bend in favor of a mobile plume. Yet, at the brink of being explained away as the mere consequence of a drifting plume, the fixed hotspot hypothesis now gains support from newly reported radiometric dates of rock samples from seamounts at the bend which reveal an age much older than expected. Unlike the previous younger age ( ˜43 Ma), the older age ( ˜47 Ma) allows the bend to be directly correlated with a period of pronounced, global tectonic reorganizations around Chron 21. Here we present a new Pacific absolute plate motion model, derived from 15 hotspot chains, which does not require hotspot drift in order to satisfy geometric and chronological constraints. By considering this absolute plate motion model with available Pacific paleomagnetic poles we find support for the notion that the spin axis was closer to the Hawaiian hotspot during the formation of the Emperor chain, and this interpretation (polar wander, not hotspot drift) also explains the paleomagnetic latitudes from the Emperor seamounts as well as the lack of coral reefs materials in the drill holes north of Koko Guyot. However, this interpretation is not unique, and drift cannot be summarily ruled out. Yet, if Pacific plumes are drifting then they appear to be moving in unison. Careful examination of the Pacific seafloor reveals additional Pacific trails with bends that appear to be contemporaneous with the Hawaii-Emperor Bend, although conclusive radiometric age data are lacking. Our plate motion model predicts hotspot tracks that fit these bends. Considering all these lines of evidence the fixed hotspot hypothesis is granted a new lease on life.

Is Buffer a Good Proxy for a Crowded Cell-Like Environment? A Comparative NMR Study of Calmodulin Side-Chain Dynamics in Buffer and E. coli Lysate

PubMed Central

Latham, Michael P.; Kay, Lewis E.

2012-01-01

Biophysical studies of protein structure and dynamics are typically performed in a highly controlled manner involving only the protein(s) of interest. Comparatively fewer such studies have been carried out in the context of a cellular environment that typically involves many biomolecules, ions and metabolites. Recently, solution NMR spectroscopy, focusing primarily on backbone amide groups as reporters, has emerged as a powerful technique for investigating protein structure and dynamics in vivo and in crowded “cell-like” environments. Here we extend these studies through a comparative analysis of Ile, Leu, Val and Met methyl side-chain motions in apo, Ca2+-bound and Ca2+, peptide-bound calmodulin dissolved in aqueous buffer or in E. coli lysate. Deuterium spin relaxation experiments, sensitive to pico- to nano-second time-scale processes and Carr-Purcell-Meiboom-Gill relaxation dispersion experiments, reporting on millisecond dynamics, have been recorded. Both similarities and differences in motional properties are noted for calmodulin dissolved in buffer or in lysate. These results emphasize that while significant insights can be obtained through detailed “test-tube” studies, experiments performed under conditions that are “cell-like” are critical for obtaining a comprehensive understanding of protein motion in vivo and therefore for elucidating the relation between motion and function. PMID:23118958

Performances of a HGCDTE APD based direct detection lidar at 2 μm. Application to dial measurements

NASA Astrophysics Data System (ADS)

Gibert, Fabien; Dumas, Arnaud; Rothman, Johan; Edouart, Dimitri; Cénac, Claire; Pellegrino, Jessica

2018-04-01

A lidar receiver with a direct detection chain adapted to a HgCdTe APD based detector with electric cooling is associated to a 2.05 μm Ho :YLF pulsed dual wavelength single mode transmitter to provide the first atmospheric lidar measurements using this technology. Experiments confirm the outstanding sensitivity of the detector and hightligth its huge potential for DIAL measurements of trace gas (CO2 and H2O) in this spectral domain. Performances of coherent vs direct detection at 2.05 μm is assessed.

Nanoparticle Motion in Entangled Melts of Linear and Nonconcatenated Ring Polymers [Nanoparticle Motion in Entangled Melts of Non-Concatenated Ring Polymers].

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ge, Ting; Kalathi, Jagannathan T.; Halverson, Jonathan D.

The motion of nanoparticles (NPs) in entangled melts of linear polymers and non-concatenated ring polymers are compared by large-scale molecular dynamics simulations. The comparison provides a paradigm for the effects of polymer architecture on the dynamical coupling between NPs and polymers in nanocomposites. Strongly suppressed motion of NPs with diameter d larger than the entanglement spacing a is observed in a melt of linear polymers before the onset of Fickian NP diffusion. This strong suppression of NP motion occurs progressively as d exceeds a, and is related to the hopping diffusion of NPs in the entanglement network. In contrast tomore » the NP motion in linear polymers, the motion of NPs with d > a in ring polymers is not as strongly suppressed prior to Fickian diffusion. The diffusion coefficient D decreases with increasing d much slower in entangled rings than in entangled linear chains. NP motion in entangled non-concatenated ring polymers is understood through a scaling analysis of the coupling between NP motion and the self-similar entangled dynamics of ring polymers.« less

Nanoparticle Motion in Entangled Melts of Linear and Nonconcatenated Ring Polymers [Nanoparticle Motion in Entangled Melts of Non-Concatenated Ring Polymers].

DOE PAGES

Ge, Ting; Kalathi, Jagannathan T.; Halverson, Jonathan D.; ...

2017-02-13

The motion of nanoparticles (NPs) in entangled melts of linear polymers and non-concatenated ring polymers are compared by large-scale molecular dynamics simulations. The comparison provides a paradigm for the effects of polymer architecture on the dynamical coupling between NPs and polymers in nanocomposites. Strongly suppressed motion of NPs with diameter d larger than the entanglement spacing a is observed in a melt of linear polymers before the onset of Fickian NP diffusion. This strong suppression of NP motion occurs progressively as d exceeds a, and is related to the hopping diffusion of NPs in the entanglement network. In contrast tomore » the NP motion in linear polymers, the motion of NPs with d > a in ring polymers is not as strongly suppressed prior to Fickian diffusion. The diffusion coefficient D decreases with increasing d much slower in entangled rings than in entangled linear chains. NP motion in entangled non-concatenated ring polymers is understood through a scaling analysis of the coupling between NP motion and the self-similar entangled dynamics of ring polymers.« less

Turbulence characterization by studying laser beam wandering in a differential tracking motion setup

NASA Astrophysics Data System (ADS)

Pérez, Darío G.; Zunino, Luciano; Gulich, Damián; Funes, Gustavo; Garavaglia, Mario

2009-09-01

The Differential Image Motion Monitor (DIMM) is a standard and widely used instrument for astronomical seeing measurements. The seeing values are estimated from the variance of the differential image motion over two equal small pupils some distance apart. The twin pupils are usually cut in a mask on the entrance pupil of the telescope. As a differential method, it has the advantage of being immune to tracking errors, eliminating erratic motion of the telescope. The Differential Laser Tracking Motion (DLTM) is introduced here inspired by the same idea. Two identical laser beams are propagated through a path of air in turbulent motion, at the end of it their wander is registered by two position sensitive detectors-at a count of 800 samples per second. Time series generated from the difference of the pair of centroid laser beam coordinates is then analyzed using the multifractal detrended fluctuation analysis. Measurements were performed at the laboratory with synthetic turbulence: changing the relative separation of the beams for different turbulent regimes. The dependence, with respect to these parameters, and the robustness of our estimators is compared with the non-differential method. This method is an improvement with respect to previous approaches that study the beam wandering.

Ultrahigh-frame CCD imagers

NASA Astrophysics Data System (ADS)

Lowrance, John L.; Mastrocola, V. J.; Renda, George F.; Swain, Pradyumna K.; Kabra, R.; Bhaskaran, Mahalingham; Tower, John R.; Levine, Peter A.

2004-02-01

This paper describes the architecture, process technology, and performance of a family of high burst rate CCDs. These imagers employ high speed, low lag photo-detectors with local storage at each photo-detector to achieve image capture at rates greater than 106 frames per second. One imager has a 64 x 64 pixel array with 12 frames of storage. A second imager has a 80 x 160 array with 28 frames of storage, and the third imager has a 64 x 64 pixel array with 300 frames of storage. Application areas include capture of rapid mechanical motion, optical wavefront sensing, fluid cavitation research, combustion studies, plasma research and wind-tunnel-based gas dynamics research.

A Role for MST Neurons in Heading Estimation

NASA Technical Reports Server (NTRS)

Stone, Leland Scott; Perrone, J. A.; Wade, Charles E. (Technical Monitor)

1994-01-01

A template model of human visual self-motion perception (Perrone, JOSA, 1992; Perrone & Stone, Vis. Res., in press), which uses neurophysiologically realistic "heading detectors", is consistent with numerous human psychophysical results (Warren & Hannon, Nature, 1988; Stone & Perrone, Neuro. Abstr., 1991) including the failure of humans to estimate their heading (direction of forward translation) accurately under certain visual conditions (Royden et al., Nature, 1992). We tested the model detectors with stimuli used by others in- single-unit studies. The detectors showed emergent properties similar to those of MST neurons: 1) Sensitivity to non-preferred flow. Each detector is tuned to a specific combination of flow components and its response is systematically reduced by the addition of nonpreferred flow (Orban et al., PNAS, 1992), and 2) Position invariance. The detectors maintain their apparent preference for particular flow components over large regions of their receptive fields (e.g. Duffy & Wurtz, J. Neurophys., 1991; Graziano et al., J. Neurosci., 1994). It has been argued that this latter property is incompatible with MST playing a role in heading perception. The model however demonstrates how neurons with the above response properties could still support accurate heading estimation within extrastriate cortical maps.

Results from a calibration of XENON100 using a source of dissolved radon-220

NASA Astrophysics Data System (ADS)

Aprile, E.; Aalbers, J.; Agostini, F.; Alfonsi, M.; Amaro, F. D.; Anthony, M.; Arneodo, F.; Barrow, P.; Baudis, L.; Bauermeister, B.; Benabderrahmane, M. L.; Berger, T.; Breur, P. A.; Brown, A.; Brown, E.; Bruenner, S.; Bruno, G.; Budnik, R.; Bütikofer, L.; Calvén, J.; Cardoso, J. M. R.; Cervantes, M.; Cichon, D.; Coderre, D.; Colijn, A. P.; Conrad, J.; Cussonneau, J. P.; Decowski, M. P.; de Perio, P.; di Gangi, P.; di Giovanni, A.; Diglio, S.; Duchovni, E.; Eurin, G.; Fei, J.; Ferella, A. D.; Fieguth, A.; Franco, D.; Fulgione, W.; Gallo Rosso, A.; Galloway, M.; Gao, F.; Garbini, M.; Geis, C.; Goetzke, L. W.; Grandi, L.; Greene, Z.; Grignon, C.; Hasterok, C.; Hogenbirk, E.; Itay, R.; Kaminsky, B.; Kessler, G.; Kish, A.; Landsman, H.; Lang, R. F.; Lellouch, D.; Levinson, L.; Le Calloch, M.; Lin, Q.; Lindemann, S.; Lindner, M.; Lopes, J. A. M.; Manfredini, A.; Maris, I.; Marrodán Undagoitia, T.; Masbou, J.; Massoli, F. V.; Masson, D.; Mayani, D.; Meng, Y.; Messina, M.; Micheneau, K.; Miguez, B.; Molinario, A.; Murra, M.; Naganoma, J.; Ni, K.; Oberlack, U.; Orrigo, S. E. A.; Pakarha, P.; Pelssers, B.; Persiani, R.; Piastra, F.; Pienaar, J.; Piro, M.-C.; Plante, G.; Priel, N.; Rauch, L.; Reichard, S.; Reuter, C.; Rizzo, A.; Rosendahl, S.; Rupp, N.; Saldanha, R.; Dos Santos, J. M. F.; Sartorelli, G.; Scheibelhut, M.; Schindler, S.; Schreiner, J.; Schumann, M.; Scotto Lavina, L.; Selvi, M.; Shagin, P.; Shockley, E.; Silva, M.; Simgen, H.; Sivers, M. V.; Stein, A.; Thers, D.; Tiseni, A.; Trinchero, G.; Tunnell, C.; Upole, N.; Wang, H.; Wei, Y.; Weinheimer, C.; Wulf, J.; Ye, J.; Zhang, Y.; Xenon Collaboration

2017-04-01

A Rn 220 source is deployed on the XENON100 dark matter detector in order to address the challenges in calibration of tonne-scale liquid noble element detectors. We show that the Pb 212 beta emission can be used for low-energy electronic recoil calibration in searches for dark matter. The isotope spreads throughout the entire active region of the detector, and its activity naturally decays below background level within a week after the source is closed. We find no increase in the activity of the troublesome Rn 222 background after calibration. Alpha emitters are also distributed throughout the detector and facilitate calibration of its response to Rn 222 . Using the delayed coincidence of Rn 220 - Po 216 , we map for the first time the convective motion of particles in the XENON100 detector. Additionally, we make a competitive measurement of the half-life of Po 212 , t1 /2=(293.9 ±(1.0 )stat±(0.6 )sys) ns .

Trochoidal X-ray Vector Radiography: Directional dark-field without grating stepping

NASA Astrophysics Data System (ADS)

Sharma, Y.; Bachche, S.; Kageyama, M.; Kuribayashi, M.; Pfeiffer, F.; Lasser, T.; Momose, A.

2018-03-01

X-ray Vector Radiography (XVR) is an imaging technique that reveals the orientations of sub-pixel sized structures within a sample. Several dark-field radiographs are acquired by rotating the sample around the beam propagation direction and stepping one of the gratings to several positions for every pose of the sample in an X-ray grating interferometry setup. In this letter, we present a method of performing XVR of a continuously moving sample without the need of any grating motion. We reconstruct the orientations within a sample by analyzing the change in the background moire fringes caused by the sample moving and simultaneously rotating in plane (trochoidal trajectory) across the detector field-of-view. Avoiding the motion of gratings provides significant advantages in terms of stability and repeatability, while the continuous motion of the sample makes this kind of system adaptable for industrial applications such as the scanning of samples on a conveyor belt. Being the first step in the direction of utilizing advanced sample trajectories to replace grating motion, this work also lays the foundations for a full three dimensional reconstruction of scattering function without grating motion.

Stereomotion is processed by the third-order motion system: reply to comment on Three-systems theory of human visual motion perception: review and update

NASA Astrophysics Data System (ADS)

Lu, Zhong-Lin; Sperling, George

2002-10-01

Two theories are considered to account for the perception of motion of depth-defined objects in random-dot stereograms (stereomotion). In the LuSperling three-motion-systems theory J. Opt. Soc. Am. A 18 , 2331 (2001), stereomotion is perceived by the third-order motion system, which detects the motion of areas defined as figure (versus ground) in a salience map. Alternatively, in his comment J. Opt. Soc. Am. A 19 , 2142 (2002), Patterson proposes a low-level motion-energy system dedicated to stereo depth. The critical difference between these theories is the preprocessing (figureground based on depth and other cues versus simply stereo depth) rather than the motion-detection algorithm itself (because the motion-extraction algorithm for third-order motion is undetermined). Furthermore, the ability of observers to perceive motion in alternating feature displays in which stereo depth alternates with other features such as texture orientation indicates that the third-order motion system can perceive stereomotion. This reduces the stereomotion question to Is it third-order alone or third-order plus dedicated depth-motion processing? Two new experiments intended to support the dedicated depth-motion processing theory are shown here to be perfectly accounted for by third-order motion, as are many older experiments that have previously been shown to be consistent with third-order motion. Cyclopean and rivalry images are shown to be a likely confound in stereomotion studies, rivalry motion being as strong as stereomotion. The phase dependence of superimposed same-direction stereomotion stimuli, rivalry stimuli, and isoluminant color stimuli indicates that these stimuli are processed in the same (third-order) motion system. The phase-dependence paradigm Lu and Sperling, Vision Res. 35 , 2697 (1995) ultimately can resolve the question of which types of signals share a single motion detector. All the evidence accumulated so far is consistent with the three-motion-systems theory. 2002 Optical Society of America

Recent Improvements to the Finite-Fault Rupture Detector Algorithm: FinDer II

NASA Astrophysics Data System (ADS)

Smith, D.; Boese, M.; Heaton, T. H.

2015-12-01

Constraining the finite-fault rupture extent and azimuth is crucial for accurately estimating ground-motion in large earthquakes. Detecting and modeling finite-fault ruptures in real-time is thus essential to both earthquake early warning (EEW) and rapid emergency response. Following extensive real-time and offline testing, the finite-fault rupture detector algorithm, FinDer (Böse et al., 2012 & 2015), was successfully integrated into the California-wide ShakeAlert EEW demonstration system. Since April 2015, FinDer has been scanning real-time waveform data from approximately 420 strong-motion stations in California for peak ground acceleration (PGA) patterns indicative of earthquakes. FinDer analyzes strong-motion data by comparing spatial images of observed PGA with theoretical templates modeled from empirical ground-motion prediction equations (GMPEs). If the correlation between the observed and theoretical PGA is sufficiently high, a report is sent to ShakeAlert including the estimated centroid position, length, and strike, and their uncertainties, of an ongoing fault rupture. Rupture estimates are continuously updated as new data arrives. As part of a joint effort between USGS Menlo Park, ETH Zurich, and Caltech, we have rewritten FinDer in C++ to obtain a faster and more flexible implementation. One new feature of FinDer II is that multiple contour lines of high-frequency PGA are computed and correlated with templates, allowing the detection of both large earthquakes and much smaller (~ M3.5) events shortly after their nucleation. Unlike previous EEW algorithms, FinDer II thus provides a modeling approach for both small-magnitude point-source and larger-magnitude finite-fault ruptures with consistent error estimates for the entire event magnitude range.

Three Small-Receptive-Field Ganglion Cells in the Mouse Retina Are Distinctly Tuned to Size, Speed, and Object Motion

PubMed Central

Jacoby, Jason

2017-01-01

Retinal ganglion cells (RGCs) are frequently divided into functional types by their ability to extract and relay specific features from a visual scene, such as the capacity to discern local or global motion, direction of motion, stimulus orientation, contrast or uniformity, or the presence of large or small objects. Here we introduce three previously uncharacterized, nondirection-selective ON–OFF RGC types that represent a distinct set of feature detectors in the mouse retina. The three high-definition (HD) RGCs possess small receptive-field centers and strong surround suppression. They respond selectively to objects of specific sizes, speeds, and types of motion. We present comprehensive morphological characterization of the HD RGCs and physiological recordings of their light responses, receptive-field size and structure, and synaptic mechanisms of surround suppression. We also explore the similarities and differences between the HD RGCs and a well characterized RGC with a comparably small receptive field, the local edge detector, in response to moving objects and textures. We model populations of each RGC type to study how they differ in their performance tracking a moving object. These results, besides introducing three new RGC types that together constitute a substantial fraction of mouse RGCs, provide insights into the role of different circuits in shaping RGC receptive fields and establish a foundation for continued study of the mechanisms of surround suppression and the neural basis of motion detection. SIGNIFICANCE STATEMENT The output cells of the retina, retinal ganglion cells (RGCs), are a diverse group of ∼40 distinct neuron types that are often assigned “feature detection” profiles based on the specific aspects of the visual scene to which they respond. Here we describe, for the first time, morphological and physiological characterization of three new RGC types in the mouse retina, substantially augmenting our understanding of feature selectivity. Experiments and modeling show that while these three “high-definition” RGCs share certain receptive-field properties, they also have distinct tuning to the size, speed, and type of motion on the retina, enabling them to occupy different niches in stimulus space. PMID:28100743

De-Trending K2 Exoplanet Targets for High Spacecraft Motion

NASA Astrophysics Data System (ADS)

Saunders, Nicholas; Luger, Rodrigo; Barnes, Rory

2018-01-01

After the failure of two reaction wheels, the Kepler space telescope lost its fine pointing ability and entered a new phase of observation, K2. Targets observed by K2 have high motion relative to the detector and K2 light curves have higher noise than Kepler observations. Despite the increased noise, systematics removal pipelines such as K2SFF and EVEREST have enabled continued high-precision transiting planet science with the telescope, resulting in the detection of hundreds of new exoplanets. However, as the spacecraft begins to run out of fuel, sputtering will drive large and random variations in pointing that can prevent detection of exoplanets during the remaining 5 campaigns. In general, higher motion will spread the stellar point spread function (PSF) across more pixels during a campaign, which increases the number of degrees of freedom in the noise component and significantly reduces the de-trending power of traditional systematics removal methods. We use a model of the Kepler CCD combined with pixel-level information of a large number of stars across the detector to improve the performance of the EVEREST pipeline at high motion. We also consider the problem of increased crowding for static apertures in the high-motion regime and develop pixel response function (PRF)-fitting techniques to mitigate contamination and maximize the de-trending power. We assess the performance of our code by simulating sputtering events and assessing exoplanet detection efficiency with transit injection/recovery tests. We find that targets with roll amplitudes of up to 8 pixels, approximately 15 times K2 roll, can be de-trended within 2 to 3 factors of current K2 photometric precision for stars up to 14th magnitude. Achieved recovery precision allows detection of small planets around 11th and 12th magnitude stars. These methods can be applied to the light curves of K2 targets for existing and future campaigns to ensure that precision exoplanet science can still be performed despite increased motion. We further discuss how these methods can be applied to upcoming space telescope missions, such as the Transiting Exoplanet Survey Satellite (TESS), to improve future detection and characterization of exoplanet candidates.

Molecular Dynamics in the Crystalline Regions of Poly(ethylene oxide) Containing a Well-Defined Point Defect in the Middle of the Polymer Chain.

PubMed

Golitsyn, Yury; Pulst, Martin; Kressler, Jörg; Reichert, Detlef

2017-05-04

The chain mobility in crystals of a homopolymer of poly(ethylene oxide) (PEO) with 22 monomer units (PEO 22 ) is compared with that of a PEO having the identical number of monomer units but additionally a 1,4-disubstituted 1,2,3-triazole (TR) point defect in the middle of the chain (PEO 11 -TR-PEO 11 ). In crystals of PEO 22 , the characteristic α c -relaxation (helix jumps) is detected and the activation energy of this process is calculated from the pure crystalline 1 H FIDs to 67 kJ/mol. PEO 11 -TR-PEO 11 exhibits a more complex behavior, i.e. a transition into the high temperature phase HTPh is noticed during heating in the temperature range between -5 and 10 °C which is attributed to the incorporation of the TR ring into the crystalline lamellae. The crystal mobility of the low temperature phase LTPh of PEO 11 -TR-PEO 11 is in good agreement with PEO 22 since helical jump motions could also be detected by analysis of the 1 H FIDs and the corresponding values of their second moments M 2 . In contrast, the high temperature phase of PEO 11 -TR-PEO 11 shows a completely different behavior of the crystal mobility. The crystalline PEO chains are rigid in this HTPh on the time scale of both, the 1 H time-domain technique and in 13 C MAS CODEX NMR spectroscopy, i.e. the α c -mobility of PEO in the HTPh of PEO 11 -TR-PEO 11 is completely suppressed and the PEO 11 chains are converted into a crystal-fixed polymer due to the incorporation of the TR rings into the crystal structure. However, the TR defect of PEO 11 -TR-PEO 11 shows in the HTPh characteristic π-flip motions with an Arrhenius type activation energy of 223 kJ/mol measured by dielectric relaxation spectroscopy. This motion cannot be observed by corresponding 13 C MAS CODEX NMR measurements due to an interfering spin-dynamic effect.

IAEA Co-ordinated Research Project: update of X-ray and gamma-ray decay data standards for detector calibration and other applications.

PubMed

Nichols, Alan L

2004-01-01

A Co-ordinated Research Project (CRP) was established in 1998 by the IAEA Nuclear Data Section (Update of X-ray and gamma-ray Decay Data Standards for Detector Calibration and Other Applications), in order to improve further the recommended decay data used to undertake efficiency calibrations of gamma-ray detectors. Participants in this CRP reviewed and modified the list of radionuclides most suited for detector efficiency calibration, and also considered the decay-data needs for safeguards, waste management, dosimetry, nuclear medicine, material analysis and environmental monitoring. Overall, 62 radionuclides were selected for decay-data evaluation, along with four parent-daughter combinations and two natural decay chains. gamma-ray emissions from specific nuclear reactions were also included to extend the calibrant energy well beyond 10 MeV. A significant number of these decay-data evaluations have been completed, and an IAEA-TECDOC report and database are in the process of being assembled for planned completion by the end of 2003.

Environmental radionuclides as contaminants of HPGe gamma-ray spectrometers: Monte Carlo simulations for Modane underground laboratory.

PubMed

Breier, R; Brudanin, V B; Loaiza, P; Piquemal, F; Povinec, P P; Rukhadze, E; Rukhadze, N; Štekl, I

2018-05-21

The main limitation in the high-sensitive HPGe gamma-ray spectrometry has been the detector background, even for detectors placed deep underground. Environmental radionuclides such as 40 K and decay products in the 238 U and 232 Th chains have been identified as the most important radioactive contaminants of construction parts of HPGe gamma-ray spectrometers. Monte Carlo simulations have shown that the massive inner and outer lead shields have been the main contributors to the HPGe-detector background, followed by aluminum cryostat, copper cold finger, detector holder and the lead ring with FET. The Monte Carlo simulated cosmic-ray background gamma-ray spectrum has been by about three orders of magnitude lower than the experimental spectrum measured in the Modane underground laboratory (4800 m w.e.), underlying the importance of using radiopure materials for the construction of ultra-low-level HPGe gamma-ray spectrometers. Copyright © 2018 Elsevier Ltd. All rights reserved.

UVSiPM: A light detector instrument based on a SiPM sensor working in single photon counting

NASA Astrophysics Data System (ADS)

Sottile, G.; Russo, F.; Agnetta, G.; Belluso, M.; Billotta, S.; Biondo, B.; Bonanno, G.; Catalano, O.; Giarrusso, S.; Grillo, A.; Impiombato, D.; La Rosa, G.; Maccarone, M. C.; Mangano, A.; Marano, D.; Mineo, T.; Segreto, A.; Strazzeri, E.; Timpanaro, M. C.

2013-06-01

UVSiPM is a light detector designed to measure the intensity of electromagnetic radiation in the 320-900 nm wavelength range. It has been developed in the framework of the ASTRI project whose main goal is the design and construction of an end-to-end Small Size class Telescope prototype for the Cherenkov Telescope Array. The UVSiPM instrument is composed by a multipixel Silicon Photo-Multiplier detector unit coupled to an electronic chain working in single photon counting mode with 10 nanosecond double pulse resolution, and by a disk emulator interface card for computer connection. The detector unit of UVSiPM is of the same kind as the ones forming the camera at the focal plane of the ASTRI prototype. Eventually, the UVSiPM instrument can be equipped with a collimator to regulate its angular aperture. UVSiPM, with its peculiar characteristics, will permit to perform several measurements both in lab and on field, allowing the absolute calibration of the ASTRI prototype.

Immersion Suit Flotation Testing REACT Report

DTIC Science & Technology

2016-08-01

wind-generated motion, we used a 75-pound, pyramid anchor , with 20 feet of 3/8 inch mooring chain. As with the ballasted mannequin, the team fully...everything, packed it and shipped it to JMTF Mobile where the team would reassemble the gear for in-water deployment. This included both 75-pound anchors ...first mooring on the ramp, put the tethered buoy in the water, then put the anchor over the side, allowing the chain to run free. Next, the team

30 CFR 77.407 - Power-driven pulleys.

Code of Federal Regulations, 2010 CFR

2010-07-01

... equipment especially designed for hand feeding. (b) Pulleys of conveyors shall not be cleaned manually while the conveyor is in motion. ... for Mechanical Equipment § 77.407 Power-driven pulleys. (a) Belts, chains, and ropes shall not be...

DNA Motion Capture Reveals the Mechanical Properties of DNA at the Mesoscale

PubMed Central

Price, Allen C.; Pilkiewicz, Kevin R.; Graham, Thomas G.W.; Song, Dan; Eaves, Joel D.; Loparo, Joseph J.

2015-01-01

Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. PMID:25992731

Phase stability and dynamics of entangled polymer-nanoparticle composites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mangal, Rahul; Srivastava, Samanvaya; Archer, Lynden A.

Nanoparticle–polymer composites, or polymer–nanoparticle composites (PNCs), exhibit unusual mechanical and dynamical features when the particle size approaches the random coil dimensions of the host polymer. Here, we harness favourable enthalpic interactions between particle-tethered and free, host polymer chains to create model PNCs, in which spherical nanoparticles are uniformly dispersed in high molecular weight entangled polymers. Investigation of the mechanical properties of these model PNCs reveals that the nanoparticles have profound effects on the host polymer motions on all timescales. On short timescales, nanoparticles slow-down local dynamics of the host polymer segments and lower the glass transition temperature. On intermediate timescales,more » where polymer chain motion is typically constrained by entanglements with surrounding molecules, nanoparticles provide additional constraints, which lead to an early onset of entangled polymer dynamics. Finally, on long timescales, nanoparticles produce an apparent speeding up of relaxation of their polymer host.« less

High-Dimensional Mutant and Modular Thermodynamic Cycles, Molecular Switching, and Free Energy Transduction

PubMed Central

Carter, Charles W.

2017-01-01

Understanding how distinct parts of proteins produce coordinated behavior has driven and continues to drive advances in protein science and enzymology. However, despite consensus about the conceptual basis for allostery, the idiosyncratic nature of allosteric mechanisms resists general approaches. Computational methods can identify conformational transition states from structural changes, revealing common switching mechanisms that impose multistate behavior. Thermodynamic cycles use factorial perturbations to measure coupling energies between side chains in molecular switches that mediate shear during domain motion. Such cycles have now been complemented by modular cycles that measure energetic coupling between separable domains. For one model system, energetic coupling between domains has been shown to be quantitatively equivalent to that between dynamic side chains. Linkages between domain motion, switching residues, and catalysis make nucleoside triphosphate hydrolysis conditional on domain movement, confirming an essential yet neglected aspect of free energy transduction and suggesting the potential generality of these studies. PMID:28375734

Real time markerless motion tracking using linked kinematic chains

DOEpatents

Luck, Jason P [Arvada, CO; Small, Daniel E [Albuquerque, NM

2007-08-14

A markerless method is described for tracking the motion of subjects in a three dimensional environment using a model based on linked kinematic chains. The invention is suitable for tracking robotic, animal or human subjects in real-time using a single computer with inexpensive video equipment, and does not require the use of markers or specialized clothing. A simple model of rigid linked segments is constructed of the subject and tracked using three dimensional volumetric data collected by a multiple camera video imaging system. A physics based method is then used to compute forces to align the model with subsequent volumetric data sets in real-time. The method is able to handle occlusion of segments and accommodates joint limits, velocity constraints, and collision constraints and provides for error recovery. The method further provides for elimination of singularities in Jacobian based calculations, which has been problematic in alternative methods.

Generalised Eisenhart lift of the Toda chain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cariglia, Marco, E-mail: marco@iceb.ufop.br; Gibbons, Gary, E-mail: g.w.gibbons@damtp.cam.ac.uk

The Toda chain of nearest neighbour interacting particles on a line can be described both in terms of geodesic motion on a manifold with one extra dimension, the Eisenhart lift, or in terms of geodesic motion in a symmetric space with several extra dimensions. We examine the relationship between these two realisations and discover that the symmetric space is a generalised, multi-particle Eisenhart lift of the original problem that reduces to the standard Eisenhart lift. Such generalised Eisenhart lift acts as an inverse Kaluza-Klein reduction, promoting coupling constants to momenta in higher dimension. In particular, isometries of the generalised liftmore » metric correspond to energy preserving transformations that mix coordinates and coupling constants. A by-product of the analysis is that the lift of the Toda Lax pair can be used to construct higher rank Killing tensors for both the standard and generalised lift metrics.« less

Arcus end-to-end simulations

NASA Astrophysics Data System (ADS)

Wilms, Joern; Guenther, H. Moritz; Dauser, Thomas; Huenemoerder, David P.; Ptak, Andrew; Smith, Randall; Arcus Team

2018-01-01

We present an overview of the end-to-end simulation environment that we are implementing as part of the Arcus phase A Study. With the rcus simulator, we aim to to model the imaging, detection, and event reconstruction properties of the spectrometer. The simulator uses a Monte Carlo ray-trace approach, projecting photons onto the Arcus focal plane from the silicon pore optic mirrors and critical-angle transmission gratings. We simulate the detection and read-out of the photons in the focal plane CCDs with software originally written for the eROSITA and Athena-WFI detectors; we include all relevant detector physics, such as charge splitting, and effects of the detector read-out, such as out of time events. The output of the simulation chain is an event list that closely resembles the data expected during flight. This event list is processed using a prototype event reconstruction chain for the order separation, wavelength calibration, and effective area calibration. The output is compatible with standard X-ray astronomical analysis software.During phase A, the end-to-end simulation approach is used to demonstrate the overall performance of the mission, including a full simulation of the calibration effort. Continued development during later phases of the mission will ensure that the simulator remains a faithful representation of the true mission capabilities, and will ultimately be used as the Arcus calibration model.

Force-chain evolution in a two-dimensional granular packing compacted by vertical tappings

NASA Astrophysics Data System (ADS)

Iikawa, Naoki; Bandi, M. M.; Katsuragi, Hiroaki

2018-03-01

We experimentally study the statistics of force-chain evolution in a vertically-tapped two-dimensional granular packing by using photoelastic disks. In this experiment, the tapped granular packing is gradually compacted. During the compaction, the isotropy of grain configurations is quantified by measuring the deviator anisotropy derived from fabric tensor, and then the evolution of force-chain structure is quantified by measuring the interparticle forces and force-chain orientational order parameter. As packing fraction increases, the interparticle force increases and finally saturates to an asymptotic value. Moreover, the grain configurations and force-chain structures become isotropically random as the tapping-induced compaction proceeds. In contrast, the total length of force chains remains unchanged. From the correlations of those parameters, we find two relations: (i) a positive correlation between the isotropy of grain configurations and the disordering of force-chain orientations, and (ii) a negative correlation between the increasing of interparticle forces and the disordering of force-chain orientations. These relations are universally held regardless of the mode of particle motions with or without convection.

A recursive approach to the equations of motion for the maneuvering and control of flexible multi-body systems

NASA Technical Reports Server (NTRS)

Kwak, Moon K.; Meirovitch, Leonard

1991-01-01

Interest lies in a mathematical formulation capable of accommodating the problem of maneuvering a space structure consisting of a chain of articulated flexible substructures. Simultaneously, any perturbations from the 'rigid body' maneuvering and any elastic vibration must be suppressed. The equations of motion for flexible bodies undergoing rigid body motions and elastic vibrations can be obtained conveniently by means of Lagrange's equations in terms of quasi-coordinates. The advantage of this approach is that it yields equations in terms of body axes, which are the same axes that are used to express the control forces and torques. The equations of motion are nonlinear hybrid differential quations. The partial differential equations can be discretized (in space) by means of the finite element method or the classical Rayleigh-Ritz method. The result is a set of nonlinear ordinary differential equations of high order. The nonlinearity can be traced to the rigid body motions and the high order to the elastic vibration. Elastic motions tend to be small when compared with rigid body motions.

A novel in situ trigger combination method

DOE PAGES

Buzatu, Adrian; Warburton, Andreas; Krumnack, Nils; ...

2013-01-30

Searches for rare physics processes using particle detectors in high-luminosity colliding hadronic beam environments require the use of multi-level trigger systems to reject colossal background rates in real time. In analyses like the search for the Higgs boson, there is a need to maximize the signal acceptance by combining multiple different trigger chains when forming the offline data sample. In such statistically limited searches, datasets are often amassed over periods of several years, during which the trigger characteristics evolve and system performance can vary significantly. Reliable production cross-section measurements and upper limits must take into account a detailed understanding ofmore » the effective trigger inefficiency for every selected candidate event. We present as an example the complex situation of three trigger chains, based on missing energy and jet energy, that were combined in the context of the search for the Higgs (H) boson produced in association with a $W$ boson at the Collider Detector at Fermilab (CDF). We briefly review the existing techniques for combining triggers, namely the inclusion, division, and exclusion methods. We introduce and describe a novel fourth in situ method whereby, for each candidate event, only the trigger chain with the highest a priori probability of selecting the event is considered. We compare the inclusion and novel in situ methods for signal event yields in the CDF $WH$ search. This new combination method, by virtue of its scalability to large numbers of differing trigger chains and insensitivity to correlations between triggers, will benefit future long-running collider experiments, including those currently operating on the Large Hadron Collider.« less

A novel in situ trigger combination method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buzatu, Adrian; Warburton, Andreas; Krumnack, Nils

Searches for rare physics processes using particle detectors in high-luminosity colliding hadronic beam environments require the use of multi-level trigger systems to reject colossal background rates in real time. In analyses like the search for the Higgs boson, there is a need to maximize the signal acceptance by combining multiple different trigger chains when forming the offline data sample. In such statistically limited searches, datasets are often amassed over periods of several years, during which the trigger characteristics evolve and system performance can vary significantly. Reliable production cross-section measurements and upper limits must take into account a detailed understanding ofmore » the effective trigger inefficiency for every selected candidate event. We present as an example the complex situation of three trigger chains, based on missing energy and jet energy, that were combined in the context of the search for the Higgs (H) boson produced in association with a $W$ boson at the Collider Detector at Fermilab (CDF). We briefly review the existing techniques for combining triggers, namely the inclusion, division, and exclusion methods. We introduce and describe a novel fourth in situ method whereby, for each candidate event, only the trigger chain with the highest a priori probability of selecting the event is considered. We compare the inclusion and novel in situ methods for signal event yields in the CDF $WH$ search. This new combination method, by virtue of its scalability to large numbers of differing trigger chains and insensitivity to correlations between triggers, will benefit future long-running collider experiments, including those currently operating on the Large Hadron Collider.« less

Molecular Dynamics Simulation of Salt Diffusion in Polyelectrolyte Assemblies.

PubMed

Zhang, Ran; Duan, Xiaozheng; Ding, Mingming; Shi, Tongfei

2018-06-05

The diffusion of salt ions and charged probe molecules in polyelectrolyte assemblies is often assumed to follow a theoretical hopping model, in which the diffusing ion is hopping between charged sites of chains based on electroneutrality. However, experimental verification of diffusing pathway at such microscales is difficult, and the corresponding molecular mechanisms remain elusive. In this study, we perform all-atom molecular dynamics (MD) simulations of salt diffusion in polyelectrolyte (PE) assembly of poly (sodium 4-styrenesulfonate) (PSS) and poly (diallyldimethylammonium chloride) (PDAC). Besides the ion hopping mode, the diffusing trajectories are found presenting common features of a jump process, i.e., subjecting to PE relaxation, water pockets in the structure open and close, thus the ion can move from one pocket to another. Anomalous subdiffusion of ions and water is observed due to the trapping scenarios in these water pockets. The jump events are much rarer compared with ion hopping but significantly increases salt diffusion with increasing temperature. Our result strongly indicates that salt diffusion in hydrated PDAC/PSS is a combined process of ion hopping and jump motion. This provides new molecular explanation for the coupling of salt motion with chain motion and the nonlinear increase of salt diffusion at glass transition temperature.

Nonlinear ball chain waveguides for acoustic emission and ultrasound sensing of ablation

NASA Astrophysics Data System (ADS)

Pearson, Stephen H.

Harsh environment acoustic emission and ultrasonic wave sensing applications often benefit from placing the sensor in a remote and more benign physical location by using waveguides to transmit elastic waves between the structural location under test and the transducer. Waveguides are normally designed to have high fidelity over broad frequency ranges to minimize distortion -- often difficult to achieve in practice. This thesis reports on an examination of using nonlinear ball chain waveguides for the transmission of acoustic emission and ultrasonic waves for the monitoring of thermal protection systems undergoing severe heat loading, leading to ablation and similar processes. Experiments test the nonlinear propagation of solitary, harmonic and mixed harmonic elastic waves through a copper tube filled with steel and elastomer balls and various other waveguides. Triangulation of pencil lead breaks occurs on a steel plate. Data are collected concerning the usage of linear waveguides and a water-cooled linear waveguide. Data are collected from a second water-cooled waveguide monitoring Atmospheric Reentry Materials in UVM's Inductively-Coupled Plasma Torch Facility. The motion of the particles in the dimer waveguides is linearly modeled with a three ball and spring chain model and the results are compared per particle. A theoretical nonlinear model is presented which is capable of exactly modeling the motion of the dimer chains. The shape of the waveform propagating through the dimer chain is modeled in a sonic vacuum. Mechanical pulses of varying time widths and amplitudes are launched into one end of the ball chain waveguide and observed at the other end in both time and frequency domains. Similarly, harmonic and mixed harmonic mechanical loads are applied to one end of the waveguide. Balls of different materials are analyzed and discriminated into categories. A copper tube packed with six steel particles, nine steel or marble particles and a longer copper tube packed with 17 steel particles are studied with a frequency sweep. The deformation experienced by a single steel particle in the dimer chain is approximated. Steel ball waveguides and steel rods are fitted with piezoelectric sensors to monitor the force at different points inside the waveguide during testing. The corresponding frequency responses, including intermodulation products, are compared based on amplitude and preloads. A nonlinear mechanical model describes the motion of the dimer chains in a vacuum. Based on the results of these studies it is anticipated that a nonlinear waveguide will be designed, built, and tested as a possible replacement for the high-fidelity waveguides presently being used in an Inductively Coupled Plasma Torch facility for high heat flux thermal protection system testing. The design is intended to accentuate acoustic emission signals of interest, while suppressing other forms of elastic wave noise.

Open-field mouse brain PET: design optimisation and detector characterisation.

PubMed

Kyme, Andre Z; Judenhofer, Martin S; Gong, Kuang; Bec, Julien; Selfridge, Aaron; Du, Junwei; Qi, Jinyi; Cherry, Simon R; Meikle, Steven R

2017-07-13

'Open-field' PET, in which an animal is free to move within an enclosed space during imaging, is a very promising advance for neuroscientific research. It provides a key advantage over conventional imaging under anesthesia by enabling functional changes in the brain to be correlated with an animal's behavioural response to environmental or pharmacologic stimuli. Previously we have demonstrated the feasibility of open-field imaging of rats using motion compensation techniques applied to a commercially available PET scanner. However, this approach of 'retro-fitting' motion compensation techniques to an existing system is limited by the inherent geometric and performance constraints of the system. The goal of this project is to develop a purpose-built PET scanner with geometry, motion tracking and imaging performance tailored and optimised for open-field imaging of the mouse brain. The design concept is a rail-based sliding tomograph which moves according to the animal's motion. Our specific aim in this work was to evaluate candidate scanner designs and characterise the performance of a depth-of-interaction detector module for the open-field system. We performed Monte Carlo simulations to estimate and compare the sensitivity and spatial resolution performance of four scanner geometries: a ring, parallel plate, and two box variants. Each system was based on a detector block consisting of a 23  ×  23 array of 0.785  ×  0.785  ×  20 mm 3 LSO crystals (overall dim. 19.6  ×  19.6  ×  20 mm). We found that a DoI resolution capability of 3 mm was necessary to achieve approximately uniform sub-millimetre spatial resolution throughout the FoV for all scanners except the parallel-plate geometry. With this DoI performance, the sensitivity advantage afforded by the box geometry with overlapping panels (16% peak absolute sensitivity, a 36% improvement over the ring design) suggests this unconventional design is best suited for imaging the mouse brain. We also built and characterised the block detector modelled in the simulations, including a dual-ended readout based on 6  ×  6 arrays of through-silicon-via silicon photomultipliers (active area 84%) for DoI estimation. Identification of individual crystals in the flood map was excellent, energy resolution varied from 12.4%  ±  0.6% near the centre to 24.4%  ±  3.4% at the ends of the crystal, and the average DoI resolution was 2.8 mm  ±  0.35 mm near the central depth (10 mm) and 3.5 mm  ±  1.0 mm near the ends. Timing resolution was 1.4  ±  0.14 ns. Therefore, the DoI detector module meets the target specifications for the application and will be used as the basis for a prototype open-field mouse PET scanner.

Open-field mouse brain PET: design optimisation and detector characterisation

NASA Astrophysics Data System (ADS)

Kyme, Andre Z.; Judenhofer, Martin S.; Gong, Kuang; Bec, Julien; Selfridge, Aaron; Du, Junwei; Qi, Jinyi; Cherry, Simon R.; Meikle, Steven R.

2017-08-01

‘Open-field’ PET, in which an animal is free to move within an enclosed space during imaging, is a very promising advance for neuroscientific research. It provides a key advantage over conventional imaging under anesthesia by enabling functional changes in the brain to be correlated with an animal’s behavioural response to environmental or pharmacologic stimuli. Previously we have demonstrated the feasibility of open-field imaging of rats using motion compensation techniques applied to a commercially available PET scanner. However, this approach of ‘retro-fitting’ motion compensation techniques to an existing system is limited by the inherent geometric and performance constraints of the system. The goal of this project is to develop a purpose-built PET scanner with geometry, motion tracking and imaging performance tailored and optimised for open-field imaging of the mouse brain. The design concept is a rail-based sliding tomograph which moves according to the animal’s motion. Our specific aim in this work was to evaluate candidate scanner designs and characterise the performance of a depth-of-interaction detector module for the open-field system. We performed Monte Carlo simulations to estimate and compare the sensitivity and spatial resolution performance of four scanner geometries: a ring, parallel plate, and two box variants. Each system was based on a detector block consisting of a 23  ×  23 array of 0.785  ×  0.785  ×  20 mm3 LSO crystals (overall dim. 19.6  ×  19.6  ×  20 mm). We found that a DoI resolution capability of 3 mm was necessary to achieve approximately uniform sub-millimetre spatial resolution throughout the FoV for all scanners except the parallel-plate geometry. With this DoI performance, the sensitivity advantage afforded by the box geometry with overlapping panels (16% peak absolute sensitivity, a 36% improvement over the ring design) suggests this unconventional design is best suited for imaging the mouse brain. We also built and characterised the block detector modelled in the simulations, including a dual-ended readout based on 6  ×  6 arrays of through-silicon-via silicon photomultipliers (active area 84%) for DoI estimation. Identification of individual crystals in the flood map was excellent, energy resolution varied from 12.4%  ±  0.6% near the centre to 24.4%  ±  3.4% at the ends of the crystal, and the average DoI resolution was 2.8 mm  ±  0.35 mm near the central depth (10 mm) and 3.5 mm  ±  1.0 mm near the ends. Timing resolution was 1.4  ±  0.14 ns. Therefore, the DoI detector module meets the target specifications for the application and will be used as the basis for a prototype open-field mouse PET scanner.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petasecca, M., E-mail: marcop@uow.edu.au; Newall, M. K.; Aldosari, A. H.

Purpose: Spatial and temporal resolutions are two of the most important features for quality assurance instrumentation of motion adaptive radiotherapy modalities. The goal of this work is to characterize the performance of the 2D high spatial resolution monolithic silicon diode array named “MagicPlate-512” for quality assurance of stereotactic body radiation therapy (SBRT) and stereotactic radiosurgery (SRS) combined with a dynamic multileaf collimator (MLC) tracking technique for motion compensation. Methods: MagicPlate-512 is used in combination with the movable platform HexaMotion and a research version of radiofrequency tracking system Calypso driving MLC tracking software. The authors reconstruct 2D dose distributions of smallmore » field square beams in three modalities: in static conditions, mimicking the temporal movement pattern of a lung tumor and tracking the moving target while the MLC compensates almost instantaneously for the tumor displacement. Use of Calypso in combination with MagicPlate-512 requires a proper radiofrequency interference shielding. Impact of the shielding on dosimetry has been simulated by GEANT4 and verified experimentally. Temporal and spatial resolutions of the dosimetry system allow also for accurate verification of segments of complex stereotactic radiotherapy plans with identification of the instant and location where a certain dose is delivered. This feature allows for retrospective temporal reconstruction of the delivery process and easy identification of error in the tracking or the multileaf collimator driving systems. A sliding MLC wedge combined with the lung motion pattern has been measured. The ability of the MagicPlate-512 (MP512) in 2D dose mapping in all three modes of operation was benchmarked by EBT3 film. Results: Full width at half maximum and penumbra of the moving and stationary dose profiles measured by EBT3 film and MagicPlate-512 confirm that motion has a significant impact on the dose distribution. Motion, no motion, and motion with MLC tracking profiles agreed within 1 and 0.4 mm, respectively, for all field sizes tested. Use of electromagnetic tracking system generates a fluctuation of the detector baseline up to 10% of the full scale signal requiring a proper shielding strategy. MagicPlate-512 is also able to reconstruct the dose variation pulse-by-pulse in each pixel of the detector. An analysis of the dose transients with motion and motion with tracking shows that the tracking feedback algorithm used for this experiment can compensate effectively only the effect of the slower transient components. The fast changing components of the organ motion can contribute only to discrepancy of the order of 15% in penumbral region while the slower components can change the dose profile up to 75% of the expected dose. Conclusions: MagicPlate-512 is shown to be, potentially, a valid alternative to film or 2D ionizing chambers for quality assurance dosimetry in SRS or SBRT. Its high spatial and temporal resolutions allow for accurate reconstruction of the profile in any conditions with motion and with tracking of the motion. It shows excellent performance to reconstruct the dose deposition in real time or retrospectively as a function of time for detailed analysis of the effect of motion in a specific pixel or area of interest.« less

Visual Search for Motion-Form Conjunctions: Selective Attention to Movement Direction.

PubMed

Von Mühlenen, Adrian; Müller, Hermann J

1999-07-01

In 2 experiments requiring visual search for conjunctions of motion and form, the authors reinvestigated whether motion-based filtering (e.g., P. McLeod, J. Driver, Z. Dienes, & J. Crisp, 1991) is direction selective and whether cuing of the target direction promotes efficient search performance. In both experiments, the authors varied the number of movement directions in the display and the predictability of the target direction. Search was less efficient when items moved in multiple (2, 3, and 4) directions as compared with just 1 direction. Furthermore, precuing of the target direction facilitated the search, even with "wrap-around" displays, relatively more when items moved in multiple directions. The authors proposed 2 principles to explain that pattern of effects: (a) interference on direction computation between items moving in different directions (e.g., N. Qian & R. A. Andersen, 1994) and (b) selective direction tuning of motion detectors involving a receptive-field contraction (cf. J. Moran & R. Desimone, 1985; S. Treue & J. H. R. Maunsell, 1996).

Gated Sensor Fusion: A way to Improve the Precision of Ambulatory Human Body Motion Estimation.

PubMed

Olivares, Alberto; Górriz, J M; Ramírez, J; Olivares, Gonzalo

2014-01-01

Human body motion is usually variable in terms of intensity and, therefore, any Inertial Measurement Unit attached to a subject will measure both low and high angular rate and accelerations. This can be a problem for the accuracy of orientation estimation algorithms based on adaptive filters such as the Kalman filter, since both the variances of the process noise and the measurement noise are set at the beginning of the algorithm and remain constant during its execution. Setting fixed noise parameters burdens the adaptation capability of the filter if the intensity of the motion changes rapidly. In this work we present a conjoint novel algorithm which uses a motion intensity detector to dynamically vary the noise statistical parameters of different approaches of the Kalman filter. Results show that the precision of the estimated orientation in terms of the RMSE can be improved up to 29% with respect to the standard fixed-parameters approaches.

Reduction of thoracic aorta motion artifact with high-pitch 128-slice dual-source computed tomographic angiography: a historical control study.

PubMed

Nakagawa, Junichiro; Tasaki, Osamu; Watanabe, Yoshiyuki; Azuma, Takeo; Ohnishi, Mitsuo; Ukai, Isao; Tahara, Kenichi; Ogura, Hiroshi; Kuwagata, Yasuyuki; Hamasaki, Toshimitsu; Shimazu, Takeshi

2013-01-01

Electrocardiogram-gated imaging combined with multi-detector row computed tomography (MDCT) has reduced cardiac motion artifacts, but it was not practical in the emergency setting. The purpose of this study was to evaluate the ability of a high-pitch, 128-slice dual-source CT (DSCT) scanner to reduce motion artifacts in patients admitted to the emergency room. This study comprised 100 patients suspected of having thoracic aorta lesions. We examined 47 patients with the 128-slice DSCT scanner (DSCT group), and 53 patients were examined with a 64-slice MDCT scanner (MDCT group). Six anatomic areas in the thoracic aorta were evaluated. Computed tomography images in the DSCT group were distinct, and significant differences were observed in images of all areas between the 2 groups except for the descending aorta. The high-pitch DSCT scanner can reduce motion artifacts of the thoracic aorta and enable radiological diagnosis even in patients with tachycardia and without breath hold.

On the use of microwave radar devices in chronobiology studies: an application with Periplaneta americana.

PubMed

Pasquali, Vittorio; Renzi, Paolo

2005-08-01

Modified motion detectors can be used to monitor locomotor activity and measure endogenous rhythms. Although these devices can help monitor insects in their home cages, the small size of the animals requires a very short wavelength detector. We modified a commercial microwave-based detection device, connected the detector's output to the digital input of a computer, and validated the device by recording circadian and ultradian rhythms. Periplaneta americana were housed in individual cages, and their activity was monitored at 18 degrees C and subsequently at 28 degrees C in constant darkness. Time series were analyzed by a discrete Fourier transform and a chi-square periodogram. Q10 values and the circadian free-running period confirmed the data reported in the literature, validating the apparatus. Moreover, the spectral analysis and periodogram revealed the presence of ultradian rhythmicity in the range of 1-8 h.

Optomechanical terahertz detection with single meta-atom resonator.

PubMed

Belacel, Cherif; Todorov, Yanko; Barbieri, Stefano; Gacemi, Djamal; Favero, Ivan; Sirtori, Carlo

2017-11-17

Most of the common technologies for detecting terahertz photons (>1 THz) at room temperature rely on slow thermal devices. The realization of fast and sensitive detectors in this frequency range is indeed a notoriously difficult task. Here we propose a novel device consisting of a subwavelength terahertz meta-atom resonator, which integrates a nanomechanical element and allows energy exchange between the mechanical motion and the electromagnetic degrees of freedom. An incident terahertz wave thus produces a nanomechanical signal that can be read out optically with high precision. We exploit this concept to demonstrate a terahertz detector that operates at room temperature with high sensitivity and a much higher frequency response compared to standard detectors. Beyond the technological issue of terahertz detection, our architecture opens up new perspectives for fundamental science of light-matter interaction at terahertz frequencies, combining optomechanical approaches with semiconductor quantum heterostructures.

2D metal profile detector using a polymeric fiber optic sensor

NASA Astrophysics Data System (ADS)

Hua, Wei-Shu; Hooks, Joshua R.; Erwin, Nicholas A.; Wu, Wen-Jong; Wang, Wei-Chih

2012-04-01

As sensors become integrated in more applications, interest in magnetostrictive sensor technology has blossomed. Magnetostrictive materials have many advantages and useful applications in daily life, such as high efficient coupling between elastic and polymer material, large displacement, magnetic field sensors, micro actuator and motion motor, etc. The purpose of this paper is to develop a metal sensor which is capable of detecting different geometries and shapes of metal objects. The main configuration is using a Mach-Zehnder fiber-optic interferometer coated with magnetostrictive material. The metal detector system is a novel design of metal detector, easy to fabricate and capable of high sensitivity. In our design, metal detection is made possible by disrupting the magnetic flux density that encompasses the magnetostriction sensor. In this paper, experimental setups are described and metal sensing results are presented. The results of detecting complex metal's geometry and metal's mapping results are discussed.

Dark matter directional detection: comparison of the track direction determination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Couturier, C.; Zopounidis, J.P.; Sauzet, N.

Several directional techniques have been proposed for a directional detection of Dark matter, among others anisotropic crystal detectors, nuclear emulsion plates, and low-pressure gaseous TPCs. The key point is to get access to the initial direction of the nucleus recoiling due to the elastic scattering by a WIMP. In this article, we aim at estimating, for each method, how the information of the recoil track initial direction is preserved in different detector materials. We use the SRIM simulation code to emulate the motion of the first recoiling nucleus in each material. We propose the use of a new observable, Dmore » , to quantify the preservation of the initial direction of the recoiling nucleus in the detector. We show that in an emulsion mix and an anisotropic crystal, the initial direction is lost very early, while in a typical TPC gas mix, the direction is well preserved.« less

Polymer scaling and dynamics in steady-state sedimentation at infinite Péclet number.

PubMed

Lehtola, V; Punkkinen, O; Ala-Nissila, T

2007-11-01

We consider the static and dynamical behavior of a flexible polymer chain under steady-state sedimentation using analytic arguments and computer simulations. The model system comprises a single coarse-grained polymer chain of N segments, which resides in a Newtonian fluid as described by the Navier-Stokes equations. The chain is driven into nonequilibrium steady state by gravity acting on each segment. The equations of motion for the segments and the Navier-Stokes equations are solved simultaneously using an immersed boundary method, where thermal fluctuations are neglected. To characterize the chain conformation, we consider its radius of gyration RG(N). We find that the presence of gravity explicitly breaks the spatial symmetry leading to anisotropic scaling of the components of RG with N along the direction of gravity RG, parallel and perpendicular to it RG, perpendicular, respectively. We numerically estimate the corresponding anisotropic scaling exponents nu parallel approximately 0.79 and nu perpendicular approximately 0.45, which differ significantly from the equilibrium scaling exponent nue=0.588 in three dimensions. This indicates that on the average, the chain becomes elongated along the sedimentation direction for large enough N. We present a generalization of the Flory scaling argument, which is in good agreement with the numerical results. It also reveals an explicit dependence of the scaling exponents on the Reynolds number. To study the dynamics of the chain, we compute its effective diffusion coefficient D(N), which does not contain Brownian motion. For the range of values of N used here, we find that both the parallel and perpendicular components of D increase with the chain length N, in contrast to the case of thermal diffusion in equilibrium. This is caused by the fluid-driven fluctuations in the internal configuration of the polymer that are magnified as polymer size becomes larger.

Correction for human head motion in helical x-ray CT

NASA Astrophysics Data System (ADS)

Kim, J.-H.; Sun, T.; Alcheikh, A. R.; Kuncic, Z.; Nuyts, J.; Fulton, R.

2016-02-01

Correction for rigid object motion in helical CT can be achieved by reconstructing from a modified source-detector orbit, determined by the object motion during the scan. This ensures that all projections are consistent, but it does not guarantee that the projections are complete in the sense of being sufficient for exact reconstruction. We have previously shown with phantom measurements that motion-corrected helical CT scans can suffer from data-insufficiency, in particular for severe motions and at high pitch. To study whether such data-insufficiency artefacts could also affect the motion-corrected CT images of patients undergoing head CT scans, we used an optical motion tracking system to record the head movements of 10 healthy volunteers while they executed each of the 4 different types of motion (‘no’, slight, moderate and severe) for 60 s. From these data we simulated 354 motion-affected CT scans of a voxelized human head phantom and reconstructed them with and without motion correction. For each simulation, motion-corrected (MC) images were compared with the motion-free reference, by visual inspection and with quantitative similarity metrics. Motion correction improved similarity metrics in all simulations. Of the 270 simulations performed with moderate or less motion, only 2 resulted in visible residual artefacts in the MC images. The maximum range of motion in these simulations would encompass that encountered in the vast majority of clinical scans. With severe motion, residual artefacts were observed in about 60% of the simulations. We also evaluated a new method of mapping local data sufficiency based on the degree to which Tuy’s condition is locally satisfied, and observed that areas with high Tuy values corresponded to the locations of residual artefacts in the MC images. We conclude that our method can provide accurate and artefact-free MC images with most types of head motion likely to be encountered in CT imaging, provided that the motion can be accurately determined.

Investigation of ultra low-dose scans in the context of quantum-counting clinical CT

NASA Astrophysics Data System (ADS)

Weidinger, T.; Buzug, T. M.; Flohr, T.; Fung, G. S. K.; Kappler, S.; Stierstorfer, K.; Tsui, B. M. W.

2012-03-01

In clinical computed tomography (CT), images from patient examinations taken with conventional scanners exhibit noise characteristics governed by electronics noise, when scanning strongly attenuating obese patients or with an ultra-low X-ray dose. Unlike CT systems based on energy integrating detectors, a system with a quantum counting detector does not suffer from this drawback. Instead, the noise from the electronics mainly affects the spectral resolution of these detectors. Therefore, it does not contribute to the image noise in spectrally non-resolved CT images. This promises improved image quality due to image noise reduction in scans obtained from clinical CT examinations with lowest X-ray tube currents or obese patients. To quantify the benefits of quantum counting detectors in clinical CT we have carried out an extensive simulation study of the complete scanning and reconstruction process for both kinds of detectors. The simulation chain encompasses modeling of the X-ray source, beam attenuation in the patient, and calculation of the detector response. Moreover, in each case the subsequent image preprocessing and reconstruction is modeled as well. The simulation-based, theoretical evaluation is validated by experiments with a novel prototype quantum counting system and a Siemens Definition Flash scanner with a conventional energy integrating CT detector. We demonstrate and quantify the improvement from image noise reduction achievable with quantum counting techniques in CT examinations with ultra-low X-ray dose and strong attenuation.

On the relationship between NMR-derived amide order parameters and protein backbone entropy changes

PubMed Central

Sharp, Kim A.; O’Brien, Evan; Kasinath, Vignesh; Wand, A. Joshua

2015-01-01

Molecular dynamics simulations are used to analyze the relationship between NMR-derived squared generalized order parameters of amide NH groups and backbone entropy. Amide order parameters (O2NH) are largely determined by the secondary structure and average values appear unrelated to the overall flexibility of the protein. However, analysis of the more flexible subset (O2NH < 0.8) shows that these report both on the local flexibility of the protein and on a different component of the conformational entropy than that reported by the side chain methyl axis order parameters, O2axis. A calibration curve for backbone entropy vs. O2NH is developed which accounts for both correlations between amide group motions of different residues, and correlations between backbone and side chain motions. This calibration curve can be used with experimental values of O2NH changes obtained by NMR relaxation measurements to extract backbone entropy changes, e.g. upon ligand binding. In conjunction with our previous calibration for side chain entropy derived from measured O2axis values this provides a prescription for determination of the total protein conformational entropy changes from NMR relaxation measurements. PMID:25739366

Complex dynamics in the Leslie-Gower type of the food chain system with multiple delays

NASA Astrophysics Data System (ADS)

Guo, Lei; Song, Zi-Gen; Xu, Jian

2014-08-01

In this paper, we present a Leslie-Gower type of food chain system composed of three species, which are resource, consumer, and predator, respectively. The digestion time delays corresponding to consumer-eat-resource and predator-eat-consumer are introduced for more realistic consideration. It is called the resource digestion delay (RDD) and consumer digestion delay (CDD) for simplicity. Analyzing the corresponding characteristic equation, the stabilities of the boundary and interior equilibrium points are studied. The food chain system exhibits the species coexistence for the small values of digestion delays. Large RDD/CDD may destabilize the species coexistence and induce the system dynamic into recurrent bloom or system collapse. Further, the present of multiple delays can control species population into the stable coexistence. To investigate the effect of time delays on the recurrent bloom of species population, the Hopf bifurcation and periodic solution are investigated in detail in terms of the central manifold reduction and normal form method. Finally, numerical simulations are performed to display some complex dynamics, which include multiple periodic solution and chaos motion for the different values of system parameters. The system dynamic behavior evolves into the chaos motion by employing the period-doubling bifurcation.

On the relationship between NMR-derived amide order parameters and protein backbone entropy changes.

PubMed

Sharp, Kim A; O'Brien, Evan; Kasinath, Vignesh; Wand, A Joshua

2015-05-01

Molecular dynamics simulations are used to analyze the relationship between NMR-derived squared generalized order parameters of amide NH groups and backbone entropy. Amide order parameters (O(2) NH ) are largely determined by the secondary structure and average values appear unrelated to the overall flexibility of the protein. However, analysis of the more flexible subset (O(2) NH  < 0.8) shows that these report both on the local flexibility of the protein and on a different component of the conformational entropy than that reported by the side chain methyl axis order parameters, O(2) axis . A calibration curve for backbone entropy vs. O(2) NH is developed, which accounts for both correlations between amide group motions of different residues, and correlations between backbone and side chain motions. This calibration curve can be used with experimental values of O(2) NH changes obtained by NMR relaxation measurements to extract backbone entropy changes, for example, upon ligand binding. In conjunction with our previous calibration for side chain entropy derived from measured O(2) axis values this provides a prescription for determination of the total protein conformational entropy changes from NMR relaxation measurements. © 2015 Wiley Periodicals, Inc.

Multiframe video coding for improved performance over wireless channels.

PubMed

Budagavi, M; Gibson, J D

2001-01-01

We propose and evaluate a multi-frame extension to block motion compensation (BMC) coding of videoconferencing-type video signals for wireless channels. The multi-frame BMC (MF-BMC) coder makes use of the redundancy that exists across multiple frames in typical videoconferencing sequences to achieve additional compression over that obtained by using the single frame BMC (SF-BMC) approach, such as in the base-level H.263 codec. The MF-BMC approach also has an inherent ability of overcoming some transmission errors and is thus more robust when compared to the SF-BMC approach. We model the error propagation process in MF-BMC coding as a multiple Markov chain and use Markov chain analysis to infer that the use of multiple frames in motion compensation increases robustness. The Markov chain analysis is also used to devise a simple scheme which randomizes the selection of the frame (amongst the multiple previous frames) used in BMC to achieve additional robustness. The MF-BMC coders proposed are a multi-frame extension of the base level H.263 coder and are found to be more robust than the base level H.263 coder when subjected to simulated errors commonly encountered on wireless channels.

Early clinical experience utilizing scintillator with optical fiber (SOF) detector in clinical boron neutron capture therapy: its issues and solutions.

PubMed

Ishikawa, Masayori; Yamamoto, Tetsuya; Matsumura, Akira; Hiratsuka, Junichi; Miyatake, Shin-Ichi; Kato, Itsuro; Sakurai, Yoshinori; Kumada, Hiroaki; Shrestha, Shubhechha J; Ono, Koji

2016-08-09

Real-time measurement of thermal neutrons in the tumor region is essential for proper evaluation of the absorbed dose in boron neutron capture therapy (BNCT) treatment. The gold wire activation method has been routinely used to measure the neutron flux distribution in BNCT irradiation, but a real-time measurement using gold wire is not possible. To overcome this issue, the scintillator with optical fiber (SOF) detector has been developed. The purpose of this study is to demonstrate the feasibility of the SOF detector as a real-time thermal neutron monitor in clinical BNCT treatment and also to report issues in the use of SOF detectors in clinical practice and their solutions. Clinical measurements using the SOF detector were carried out in 16 BNCT clinical trial patients from December 2002 until end of 2006 at the Japanese Atomic Energy Agency (JAEA) and Kyoto University Research Reactor Institute (KURRI). The SOF detector worked effectively as a real-time thermal neutron monitor. The neutron fluence obtained by the gold wire activation method was found to differ from that obtained by the SOF detector. The neutron fluence obtained by the SOF detector was in better agreement with the expected fluence than with gold wire activation. The estimation error for the SOF detector was small in comparison to the gold wire measurement. In addition, real-time monitoring suggested that the neutron flux distribution and intensity at the region of interest (ROI) may vary due to the reactor condition, patient motion and dislocation of the SOF detector. Clinical measurements using the SOF detector to measure thermal neutron flux during BNCT confirmed that SOF detectors are effective as a real-time thermal neutron monitor. To minimize the estimation error due to the displacement of the SOF probe during treatment, a loop-type SOF probe was developed.

Simultaneous readout of 128 X-ray and gamma-ray transition-edge microcalorimeters using microwave SQUID multiplexing

NASA Astrophysics Data System (ADS)

Mates, J. A. B.; Becker, D. T.; Bennett, D. A.; Dober, B. J.; Gard, J. D.; Hays-Wehle, J. P.; Fowler, J. W.; Hilton, G. C.; Reintsema, C. D.; Schmidt, D. R.; Swetz, D. S.; Vale, L. R.; Ullom, J. N.

2017-08-01

The number of elements in most cryogenic sensor arrays is limited by the technology available to multiplex signals from the arrays into a smaller number of wires and readout amplifiers. The largest demonstrated arrays of transition-edge sensor (TES) microcalorimeters contain roughly 250 detectors and use time-division multiplexing with Superconducting Quantum Interference Devices (SQUIDs). The bandwidth limits of this technology constrain the number of sensors per amplifier chain, a quantity known as the multiplexing factor, to several 10s. With microwave SQUID multiplexing, we can expand the readout bandwidth and enable much larger multiplexing factors. While microwave SQUID multiplexing of TES microcalorimeters has been previously demonstrated with small numbers of detectors, we now present a fully scalable demonstration in which 128 TES detectors are read out on a single pair of coaxial cables.

Documentation of the ISA Micro Computed Tomography System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brown, William D.; Smith, Jerel A.

2013-12-18

This document is intended to provide information on the ISA Micro Computed Tomography (MicroCT) system that will be installed in Yavne, Israel. X-ray source, detector, and motion control hardware are specified as well as specimen platforms, containers, and reference material types. Most of the details on the system are derived from Reference 1 and 2.

Using Touchscreens as Position Detectors in Physics Experiments

ERIC Educational Resources Information Center

Dilek, Ufuk; Sengören, Serap Kaya

2017-01-01

The position of a ball was measured by using the touchscreen of a mobile phone during its rolling motion. The translational speed of the ball was determined using the recorded position and time data. The speed was also calculated by a conventional method. The speed values determined by the two methods were consistent, thus it was proven that a…

Synthesis and Characterization of Itaconic Anhydride and Stearyl Methacrylate Copolymers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shang, S.; Huang, S; Weiss, R

The free-radical copolymerization and the properties of comb-like copolymers derived from renewable resources, itaconic anhydride (ITA) and stearyl methacrylate (SM), are described. The ITA-SM copolymers were nearly random with a slight alternating tendency. The copolymers exhibited a nanophase-separated morphology, with the stearate side-chains forming a bilayer, semi-crystalline structure. The melting point (Tm) of the side-chains and the crystallinity decreased with increasing ITA concentration. The crystalline side-chains suppressed molecular motion of the main chain, so that a glass transition temperature (Tg) was not resolved unless the ITA concentration was sufficiently high so that Tg > Tm. The softening point and modulusmore » of the copolymers increased with the increasing ITA concentration, but the thermal stability decreased.« less

Molecular dynamics of lipid bilayers studied by incoherent quasi-elastic neutron scattering

NASA Astrophysics Data System (ADS)

König, S.; Pfeiffer, W.; Bayerl, T.; Richter, D.; Sackmann, E.

1992-08-01

Molecular motions in highly oriented multilayers of dipalmitoylphosphatidylcholine were studied as a function of temperature and hydration using incoherent quasi-elastic neutron scattering (QENS). The short range diffusive motions of the lipid molecules and the chain/headgroup dynamics were evaluated : 1) by measurement of the dependence of the elastic incoherent structure factor (EISF), the line-width Γ and the dynamic structure factors on the scattering vector Q for two orientations of the sample. The orientations were chosen such that the scattering vecto Q was either predominantly perpendicular or parallel to the membrane normal ; 2) by comparing data from protonated and chain deuterated lipids and 3) by the use of instruments of different energy resolution (i.e. time-of-flight and backscattering spectrometers exploring time regimes of 10^{-13} s to 10^{-11} s and 10^{-11} s to 10^{-9} s respectively). In the fluid phase the time-of-flight spectra revealed a restricted isotropic in-plane and out-of-plane diffusion of the hydrocarbon chain and headgroup protons. The mean displacements range from ≈ 0.6 Å for methylene protons near the glycerol backbone to 7 Å for protons near the chain ends. These values are obtained for a water content of 23 wt%. The values are somewhat increased at 30wt% of water. Measurements of the temperature variation of the EISF and the line-width Γ revealed a remarkably high degree of chain dynamics in the gel (L{β '})-phase. The total elastic intensity as observed with the backscattering instrument showed that L{α}-L{β '}-phase transition is only well expressed at Q-values around 1 Å^{-1}, while the number and mobility of the chain defects characterized at Q≈ 2 Å^{-1} (possibly gtg-kinks) increase continuously between 2 °C and 70 °C. In the time regime explored by the backscattering instrument, motions of the whole lipid molecules are also seen. It was interpreted in terms of a superposition of local in-plane and out-of-plane diffusion and lateral diffusional jumps between adjacent sites as predicted by the free volume model. For a sample containing 12 wt% of water at 60 °C the diffusion coefficient for the out-of-plane motion is D^{allel}=6× 10^{-6} cm2/s with an amplitude of 2.25 Å. In-plane the diffusion coefficients range from D_{min}^{perp}=1.5× 10^{-7} cm2/s to D_{max}^{perp}=6× 10^{-6} cm2/s. The lateral diffusion coefficient is D_lat=9.7× 10^{-8} cm2/s in reasonable agreement with FRAP measurements. The strong increase of the lateral mobility with increasing water content yielded an exponential law for the variation of the diffusion coefficient with excess area per lipid (i.e. hydration) in agreement with the free volume model. The out-of-plane motion is characterized by an amplitude of about 0.5 Å in the time-of-flight time regime and of 2-3 Å in the backscattering time regime. The origin of this discrepancy could be the thermally excited membrane undulations since their relaxation times of ≈ 3× 10^{-9} s (obtained in a separate spin-echo study) agree roughly with the reciprocal line-width of 2.5× 10^{-9} s for the backscattering instrument at Qto 0. The time-of-flight result of 0.5 Å can be attributed to a dynamic surface roughness.

Absolute plate motion of Africa around Hawaii-Emperor bend time

NASA Astrophysics Data System (ADS)

Maher, S. M.; Wessel, P.; Müller, R. D.; Williams, S. E.; Harada, Y.

2015-06-01

Numerous regional plate reorganizations and the coeval ages of the Hawaiian Emperor bend (HEB) and Louisville bend of 50-47 Ma have been interpreted as a possible global tectonic plate reorganization at ˜chron 21 (47.9 Ma). Yet for a truly global event we would expect a contemporaneous change in Africa absolute plate motion (APM) reflected by physical evidence distributed on the Africa Plate. This evidence has been postulated to take the form of the Réunion-Mascarene bend which exhibits many HEB-like features, such as a large angular change close to ˜chron 21. However, the Réunion hotspot trail has recently been interpreted as a sequence of continental fragments with incidental hotspot volcanism. Here we show that the alternative Réunion-Mascarene Plateau trail can also satisfy the age progressions and geometry of other hotspot trails on the Africa Plate. The implied motion, suggesting a pivoting of Africa from 67 to 50 Ma, could explain the apparent bifurcation of the Tristan hotspot chain, the age reversals seen along the Walvis Ridge, the sharp curve of the Canary trail, and the diffuse nature of the St. Helena chain. To test this hypothesis further we made a new Africa APM model that extends back to ˜80 Ma using a modified version of the Hybrid Polygonal Finite Rotation Method. This method uses seamount chains and their associated hotspots as geometric constraints for the model, and seamount age dates to determine APM through time. While this model successfully explains many of the volcanic features, it implies an unrealistically fast global lithospheric net rotation, as well as improbable APM trajectories for many other plates, including the Americas, Eurasia and Australia. We contrast this speculative model with a more conventional model in which the Mascarene Plateau is excluded in favour of the Chagos-Laccadive Ridge rotated into the Africa reference frame. This second model implies more realistic net lithospheric rotation and far-field APMs, but fails to explain key details of the Atlantic Ocean volcanic chains. Both models predict a Canary plume influence beneath the Madeiras. Neither model, when projected via the global plate circuit into the Pacific, predicts any significant change in plate motion around chron 21. Consequently, Africa APM models do not appear to provide independent support for a chron 21 global reorganization.

Data conditioning for gravitational wave detectors: A Kalman filter for regressing suspension violin modes

NASA Astrophysics Data System (ADS)

Finn, Lee Samuel; Mukherjee, Soma

2001-03-01

Interferometric gravitational wave detectors operate by sensing the differential light travel time between free test masses. Correspondingly, they are sensitive to anything that changes the physical distance between the test masses, including physical motion of the masses themselves. In ground-based detectors the test masses are suspended as pendula, in order that they be approximately ``free'' above the pendulumn frequency. Still, thermal or other excitations of the suspension wires' violin modes do impart a force on the masses that appears as a strong, albeit narrow-band, ``signal'' in the detectors waveband. Gravitational waves, on the other hand, change the distance between the test masses without disturbing the suspensions. Consequently, violin modes can confound attempts to observe gravitational waves since ``signals'' that are correlated with a disturbance of the suspension violin modes are not likely due to a passing gravitational wave. Here we describe the design of a Kalman filter that determines the time-dependent vibrational state of a detector's suspension ``violin'' modes from time dependent observations of the detector output. From the estimated state we can predict that component of the detector output due to suspension excitations, thermal or otherwise. The wire state can be examined for evidence of suspension disturbances that might, in the absence of such a diagnostic, be mistaken for gravitational wave signals. Additionally, from the wire state we can subtractively remove the contribution from suspension disturbances, thermal or otherwise, from the detector output, leaving a residual free from this instrumental artifact. We demonstrate the filter's effectiveness both through numerical simulations and application to real data taken on the LIGO 40 M prototype detector.

Numerical study of two disks settling in an Oldroyd-B fluid: From periodic interaction to chaining

NASA Astrophysics Data System (ADS)

Pan, Tsorng-Whay; Glowinski, Roland

2017-12-01

In this article, we present a numerical study of the dynamics of two disks sedimenting in a narrow vertical channel filled with an Oldroyd-B fluid. Two kinds of particle dynamics are observed: (i) a periodic interaction between the two disks, and (ii) the formation of a two-disk chain. For the periodic interaction of the two disks, two different motions are observed: (a) the two disks stay far apart and interact periodically, and (b) the two disks interact closely and then far apart in a periodic way, like the drafting, kissing, and tumbling of two disks sedimenting in a Newtonian fluid, due to a weak elastic force. Concerning the formation of a two-disk chain occurring at higher values of the elasticity number, either a tilted chain or a vertical chain is observed. Our simulations show that, as expected, the values of the elasticity and Mach numbers are the determining factors concerning the particle chain formation and its orientation.

Numerical study of two disks settling in an Oldroyd-B fluid: From periodic interaction to chaining.

PubMed

Pan, Tsorng-Whay; Glowinski, Roland

2017-12-01

In this article, we present a numerical study of the dynamics of two disks sedimenting in a narrow vertical channel filled with an Oldroyd-B fluid. Two kinds of particle dynamics are observed: (i) a periodic interaction between the two disks, and (ii) the formation of a two-disk chain. For the periodic interaction of the two disks, two different motions are observed: (a) the two disks stay far apart and interact periodically, and (b) the two disks interact closely and then far apart in a periodic way, like the drafting, kissing, and tumbling of two disks sedimenting in a Newtonian fluid, due to a weak elastic force. Concerning the formation of a two-disk chain occurring at higher values of the elasticity number, either a tilted chain or a vertical chain is observed. Our simulations show that, as expected, the values of the elasticity and Mach numbers are the determining factors concerning the particle chain formation and its orientation.

Orientation of chain molecules in ionotropic gels: a Brownian dynamics model

NASA Astrophysics Data System (ADS)

Woelki, Stefan; Kohler, Hans-Helmut

2003-09-01

As is known from birefringence measurements, polysaccharide molecules of ionotropic gels are preferentially orientated normal to the direction of gel growth. In this paper the orientation effect is investigated by means of an off-lattice Brownian dynamics model simulating the gel formation process. The model describes the integration of a single coarse grained phantom chain into the growing gel. The equations of motion of the chain are derived. The computer simulations show that, during the process of integration, the chain is contracting normal to the direction of gel growth. A scaling relation is obtained for the degree of contraction as a function of the length parameters of the chain, the velocity of the gel formation front and the rate constant of the crosslinking reaction. It is shown that the scaling relation, if applied to the example of ionotropic copper alginate gel, leads to reasonable predictions of the time course of the degree of contraction of the alginate chains.

Protonic transport through solitons in hydrogen-bonded systems

NASA Astrophysics Data System (ADS)

Kavitha, L.; Jayanthi, S.; Muniyappan, A.; Gopi, D.

2011-09-01

We offer an alternative route for investigating soliton solutions in hydrogen-bonded (HB) chains. We invoke the modified extended tangent hyperbolic function method coupled with symbolic computation to solve the governing equation of motion for proton dynamics. We investigate the dynamics of proton transfer in HB chains through bell-shaped soliton excitations, which trigger the bio-energy transport in most biological systems. This solitonic mechanism of proton transfer could play functional roles in muscular contraction, enzymatic activity and oxidative phosphorylation.

A priori motion models for four-dimensional reconstruction in gated cardiac SPECT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lalush, D.S.; Tsui, B.M.W.; Cui, Lin

1996-12-31

We investigate the benefit of incorporating a priori assumptions about cardiac motion in a fully four-dimensional (4D) reconstruction algorithm for gated cardiac SPECT. Previous work has shown that non-motion-specific 4D Gibbs priors enforcing smoothing in time and space can control noise while preserving resolution. In this paper, we evaluate methods for incorporating known heart motion in the Gibbs prior model. The new model is derived by assigning motion vectors to each 4D voxel, defining the movement of that volume of activity into the neighboring time frames. Weights for the Gibbs cliques are computed based on these {open_quotes}most likely{close_quotes} motion vectors.more » To evaluate, we employ the mathematical cardiac-torso (MCAT) phantom with a new dynamic heart model that simulates the beating and twisting motion of the heart. Sixteen realistically-simulated gated datasets were generated, with noise simulated to emulate a real Tl-201 gated SPECT study. Reconstructions were performed using several different reconstruction algorithms, all modeling nonuniform attenuation and three-dimensional detector response. These include ML-EM with 4D filtering, 4D MAP-EM without prior motion assumption, and 4D MAP-EM with prior motion assumptions. The prior motion assumptions included both the correct motion model and incorrect models. Results show that reconstructions using the 4D prior model can smooth noise and preserve time-domain resolution more effectively than 4D linear filters. We conclude that modeling of motion in 4D reconstruction algorithms can be a powerful tool for smoothing noise and preserving temporal resolution in gated cardiac studies.« less

Influence of Correspondence Noise and Spatial Scaling on the Upper Limit for Spatial Displacement in Fully-Coherent Random-Dot Kinematogram Stimuli

PubMed Central

Tripathy, Srimant P.; Shafiullah, Syed N.; Cox, Michael J.

2012-01-01

Correspondence noise is a major factor limiting direction discrimination performance in random-dot kinematograms [1]. In the current study we investigated the influence of correspondence noise on Dmax, which is the upper limit for the spatial displacement of the dots for which coherent motion is still perceived. Human direction discrimination performance was measured, using 2-frame kinematograms having leftward/rightward motion, over a 200-fold range of dot-densities and a four-fold range of dot displacements. From this data Dmax was estimated for the different dot densities tested. A model was proposed to evaluate the correspondence noise in the stimulus. This model summed the outputs of a set of elementary Reichardt-type local detectors that had receptive fields tiling the stimulus and were tuned to the two directions of motion in the stimulus. A key assumption of the model was that the local detectors would have the radius of their catchment areas scaled with the displacement that they were tuned to detect; the scaling factor k linking the radius to the displacement was the only free parameter in the model and a single value of k was used to fit all of the psychophysical data collected. This minimal, correspondence-noise based model was able to account for 91% of the variability in the human performance across all of the conditions tested. The results highlight the importance of correspondence noise in constraining the largest displacement that can be detected. PMID:23056172

Influence of correspondence noise and spatial scaling on the upper limit for spatial displacement in fully-coherent random-dot kinematogram stimuli.

PubMed

Tripathy, Srimant P; Shafiullah, Syed N; Cox, Michael J

2012-01-01

Correspondence noise is a major factor limiting direction discrimination performance in random-dot kinematograms. In the current study we investigated the influence of correspondence noise on Dmax, which is the upper limit for the spatial displacement of the dots for which coherent motion is still perceived. Human direction discrimination performance was measured, using 2-frame kinematograms having leftward/rightward motion, over a 200-fold range of dot-densities and a four-fold range of dot displacements. From this data Dmax was estimated for the different dot densities tested. A model was proposed to evaluate the correspondence noise in the stimulus. This model summed the outputs of a set of elementary Reichardt-type local detectors that had receptive fields tiling the stimulus and were tuned to the two directions of motion in the stimulus. A key assumption of the model was that the local detectors would have the radius of their catchment areas scaled with the displacement that they were tuned to detect; the scaling factor k linking the radius to the displacement was the only free parameter in the model and a single value of k was used to fit all of the psychophysical data collected. This minimal, correspondence-noise based model was able to account for 91% of the variability in the human performance across all of the conditions tested. The results highlight the importance of correspondence noise in constraining the largest displacement that can be detected.

Oxygen ion implantation induced microstructural changes and electrical conductivity in Bakelite RPC detector material

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, K. V. Aneesh, E-mail: aneesh1098@gmail.com; Ravikumar, H. B., E-mail: hbr@physics.uni-mysore.ac.in; Ranganathaiah, C., E-mail: cr@physics.uni-mysore.ac.in

2016-05-06

In order to explore the structural modification induced electrical conductivity, samples of Bakelite Resistive Plate Chamber (RPC) detector materials were exposed to 100 keV Oxygen ion in the fluences of 10{sup 12}, 10{sup 13}, 10{sup 14} and 10{sup 15} ions/cm{sup 2}. Ion implantation induced microstructural changes have been studied using Positron Annihilation Lifetime Spectroscopy (PALS) and X-Ray Diffraction (XRD) techniques. Positron lifetime parameters viz., o-Ps lifetime and its intensity shows the deposition of high energy interior track and chain scission leads to the formation of radicals, secondary ions and electrons at lower ion implantation fluences (10{sup 12} to10{sup 14} ions/cm{supmore » 2}) followed by cross-linking at 10{sup 15} ions/cm{sup 2} fluence due to the radical reactions. The reduction in electrical conductivity of Bakelite detector material is correlated to the conducting pathways and cross-links in the polymer matrix. The appropriate implantation energy and fluence of Oxygen ion on polymer based Bakelite RPC detector material may reduce the leakage current, improves the efficiency, time resolution and thereby rectify the aging crisis of the RPC detectors.« less

First Results from the Telescope Array RAdar (TARA) Detector

NASA Astrophysics Data System (ADS)

Myers, Isaac

2014-03-01

The TARA cosmic ray detector has been in operation for about a year and a half. This bi-static radar detector was designed with the goal of detecting cosmic rays in coincidence with Telescope Array (TA). A new high power (25 kW, 5 MW effective radiated power) transmitter and antenna array and 250 MHz fPGA-based DAQ have been operational since August 2013. The eight-Yagi antenna array broadcasts a 54.1 MHz tone across the TA surface detector array toward our receiver station 50 km away at the Long Ridge fluorescence detector. Receiving antennas feed an intelligent DAQ that self-adjusts to the fluctuating radio background and which employs a bank of matched filters that search in real-time for chirp radar echoes. Millions of triggers have been collected in this mode. A second mode is a forced trigger scheme that uses the trigger status of the fluorescence telescope. Of those triggers collected in FD-triggered mode, about 800 correspond with well-reconstructed TA events. I will describe recent advancements in calibrating key components in the transmitter and receiver RF chains and the analysis of FD-triggered data. Work supported by W.M. Keck Foundation and NSF.

Testing of Front End Electronics for 10ps Time of Flight Detectors

NASA Astrophysics Data System (ADS)

Kimball, Matthew; EIC PID Consortium Collaboration

2016-09-01

To fully achieve the physics goals of the future Electron Ion Collider (EIC), continued development of the detectors involved is needed. One area of research involves improving the timing resolution of Time of Flight (ToF) detectors from 100ps to 10ps. When the timing resolution of these ToF detectors is improved, better particle identification can be achieved. In addition, as ToF detectors are being constructed with ever improving timing resolution, the need to improve the high speed performance of the fast electronics used in their front-end electronics (FEE) increases. A series of careful measurements has been performed to investigate the performance and efficiency of each element in the FEE chain. The focus of these tests lies on the amplitude transmission efficiency of the high speed signals as a function of frequency, also known as the bandwidth. The components tested include balanced to unbalanced (balun) boards, signal pre-amps, and waveform digitizers. These tests were performed on individual components and with all elements connected over a frequency range of 1MHz to 1GHz. The results of these tests will be presented. This research was supported by US DOE MENP Grant DE-FG02-03ER41243.

Generation of Classical DInSAR and PSI Ground Motion Maps on a Cloud Thematic Platform

NASA Astrophysics Data System (ADS)

Mora, Oscar; Ordoqui, Patrick; Romero, Laia

2016-08-01

This paper presents the experience of ALTAMIRA INFORMATION uploading InSAR (Synthetic Aperture Radar Interferometry) services in the Geohazard Exploitation Platform (GEP), supported by ESA. Two different processing chains are presented jointly with ground motion maps obtained from the cloud computing, one being DIAPASON for classical DInSAR and SPN (Stable Point Network) for PSI (Persistent Scatterer Interferometry) processing. The product obtained from DIAPASON is the interferometric phase related to ground motion (phase fringes from a SAR pair). SPN provides motion data (mean velocity and time series) on high-quality pixels from a stack of SAR images. DIAPASON is already implemented, and SPN is under development to be exploited with historical data coming from ERS-1/2 and ENVISAT satellites, and current acquisitions of SENTINEL-1 in SLC and TOPSAR modes.

A system for learning statistical motion patterns.

PubMed

Hu, Weiming; Xiao, Xuejuan; Fu, Zhouyu; Xie, Dan; Tan, Tieniu; Maybank, Steve

2006-09-01

Analysis of motion patterns is an effective approach for anomaly detection and behavior prediction. Current approaches for the analysis of motion patterns depend on known scenes, where objects move in predefined ways. It is highly desirable to automatically construct object motion patterns which reflect the knowledge of the scene. In this paper, we present a system for automatically learning motion patterns for anomaly detection and behavior prediction based on a proposed algorithm for robustly tracking multiple objects. In the tracking algorithm, foreground pixels are clustered using a fast accurate fuzzy K-means algorithm. Growing and prediction of the cluster centroids of foreground pixels ensure that each cluster centroid is associated with a moving object in the scene. In the algorithm for learning motion patterns, trajectories are clustered hierarchically using spatial and temporal information and then each motion pattern is represented with a chain of Gaussian distributions. Based on the learned statistical motion patterns, statistical methods are used to detect anomalies and predict behaviors. Our system is tested using image sequences acquired, respectively, from a crowded real traffic scene and a model traffic scene. Experimental results show the robustness of the tracking algorithm, the efficiency of the algorithm for learning motion patterns, and the encouraging performance of algorithms for anomaly detection and behavior prediction.

Particle Detectors in the Theory of Quantum Fields on Curved Spacetimes

NASA Astrophysics Data System (ADS)

Cant, John Fraser

This work discusses aspects of a fundamental problem in the theory of quantum fields on curved spacetimes--that of giving physical meaning to the particle representations of the theory. In particular, the response of model particle detectors is analysed in detail. Unruh (1976) first introduced the idea of a model particle detector in order to give an operational definition to particles. He found that even in flat spacetime, the excitation of a particle detector does not necessarily correspond to the presence of an energy carrier--an accelerating detector will excite in response to the zero-energy state of the Minkowski vacuum. The central question I consider in this work is --where does the energy for the excitation of the accelerating detector come from? The accepted response has been that the accelerating force provides the energy. Evaluating the energy carried by the (conformally-invariant massless scalar) field after the interaction with the detector, however, I find that the detector excitation is compensated by an equal but opposite emission of negative energy. This result suggests that there may be states of lesser energy than that of the Minkowski vacuum. To resolve this paradox, I argue that the emission of a detector following a more realistic trajectory than that of constant acceleration--one that starts and finishes in inertial motion--will in total be positive, although during periods of constant acceleration the detector will still emit negative energy. The Minkowski vacuum retains its status as the field state of lowest energy. The second question I consider is the response of Unruh's detector in curved spacetime--is it possible to use such a detector to measure the energy carried by the field? In the particular case of a detector following a Killing trajectory, I find that there is a response to the energy of the field, but that there is also an inherent 'noise'. In a two dimensional model spacetime, I show that this 'noise' depends on the detector's acceleration and on the curvature of the spacetime, thereby encompassing previous results of Unruh (1976) and of Gibbons & Hawking (1977).

AVIRIS onboard data handling and control

NASA Technical Reports Server (NTRS)

Steinkraus, Ronald E.; Hickok, Roger W.

1987-01-01

The timing and flow of detector and ancillary data for the Airborne Visible/Infrared imaging spectrometer (AVIRIS) are controlled within the instrument by its digital electronics assembly. In addition to providing detector and signal chain timing, the digital electronics receives, formats, and rate-buffers digitized science data; collects and formats ancillary (calibration and engineering) data; and merges both into a single tape record. Overall AVIRIS data handling is effected by a combination of dedicated digital electronics to control instrument timing, image data flow, and data rate buffering and a microcomputer programmed to handle real-time control of instrument mechanisms and the coordinated preparation of ancillary data.

Gravitational Wave Astrophysics: Opening the New Frontier

NASA Technical Reports Server (NTRS)

Centrella, Joan

2011-01-01

The gravitational wave window onto the universe is expected to open in 5 years, when ground-based detectors make the first detections in the high-frequency regime. Gravitational waves are ripples in spacetime produced by the motions of massive objects such as black holes and neutron stars. Since the universe is nearly transparent to gravitational waves, these signals carry direct information about their sources such as masses, spins, luminosity distances, and orbital parameters through dense, obscured regions across cosmic time. This article explores gravitational waves as cosmic messengers, highlighting key sources, detection methods, and the astrophysical payoffs across the gravitational wave spectrum. Keywords: Gravitational wave astrophysics; gravitational radiation; gravitational wave detectors; black holes.

Schenberg microwave cabling seismic isolation.

NASA Astrophysics Data System (ADS)

Bortoli, F. S.; Frajuca, C.; Aguiar, O. D.

2018-02-01

SCHENBERG is a resonant-mass gravitational wave detector with a frequency about 3.2 kHz. Its spherical antenna, weighing 1.15 metric ton, is connected to the external world by a system which must attenuate seismic noise. When a gravitational wave passes the antenna vibrates, its motion is monitored by transducers. These parametric transducers uses microwaves carried by coaxial cables that are also connected to the external world, they also carry seismic noise. In this analysis the system was modeled using finite element method. This work shows that the addition of masses along these cables can decrease this noise, so that this noise is below the thermal noise of the detector when operating at 50 mK.

Tracking and imaging humans on heterogeneous infrared sensor arrays for law enforcement applications

NASA Astrophysics Data System (ADS)

Feller, Steven D.; Zheng, Y.; Cull, Evan; Brady, David J.

2002-08-01

We present a plan for the integration of geometric constraints in the source, sensor and analysis levels of sensor networks. The goal of geometric analysis is to reduce the dimensionality and complexity of distributed sensor data analysis so as to achieve real-time recognition and response to significant events. Application scenarios include biometric tracking of individuals, counting and analysis of individuals in groups of humans and distributed sentient environments. We are particularly interested in using this approach to provide networks of low cost point detectors, such as infrared motion detectors, with complex imaging capabilities. By extending the capabilities of simple sensors, we expect to reduce the cost of perimeter and site security applications.

Laser radiography forming bremsstrahlung radiation to image an object

DOEpatents

Perry, Michael D.; Sefcik, Joseph A.

2004-01-13

A method of imaging an object by generating laser pulses with a short-pulse, high-power laser. When the laser pulse strikes a conductive target, bremsstrahlung radiation is generated such that hard ballistic high-energy electrons are formed to penetrate an object. A detector on the opposite side of the object detects these electrons. Since laser pulses are used to form the hard x-rays, multiple pulses can be used to image an object in motion, such as an exploding or compressing object, by using time gated detectors. Furthermore, the laser pulses can be directed down different tubes using mirrors and filters so that each laser pulse will image a different portion of the object.

77 FR 64330 - Upper Peninsula Power Company; Notice of Application Accepted for Filing, Soliciting Motions To...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-19

... comments filed. k. Description of Application: The licensee proposes to, in part, remove the Cisco Development from the Bond Falls Hydroelectric Project license. The Cisco Dam and its chain of lakes would be...

Omni-Purpose Stretchable Strain Sensor Based on a Highly Dense Nanocracking Structure for Whole-Body Motion Monitoring.

PubMed

Jeon, Hyungkook; Hong, Seong Kyung; Kim, Min Seo; Cho, Seong J; Lim, Geunbae

2017-12-06

Here, we report an omni-purpose stretchable strain sensor (OPSS sensor) based on a nanocracking structure for monitoring whole-body motions including both joint-level and skin-level motions. By controlling and optimizing the nanocracking structure, inspired by the spider sensory system, the OPSS sensor is endowed with both high sensitivity (gauge factor ≈ 30) and a wide working range (strain up to 150%) under great linearity (R 2 = 0.9814) and fast response time (<30 ms). Furthermore, the fabrication process of the OPSS sensor has advantages of being extremely simple, patternable, integrated circuit-compatible, and reliable in terms of reproducibility. Using the OPSS sensor, we detected various human body motions including both moving of joints and subtle deforming of skin such as pulsation. As specific medical applications of the sensor, we also successfully developed a glove-type hand motion detector and a real-time Morse code communication system for patients with general paralysis. Therefore, considering the outstanding sensing performances, great advantages of the fabrication process, and successful results from a variety of practical applications, we believe that the OPSS sensor is a highly suitable strain sensor for whole-body motion monitoring and has potential for a wide range of applications, such as medical robotics and wearable healthcare devices.

1st- and 2nd-order motion and texture resolution in central and peripheral vision

NASA Technical Reports Server (NTRS)

Solomon, J. A.; Sperling, G.

1995-01-01

STIMULI. The 1st-order stimuli are moving sine gratings. The 2nd-order stimuli are fields of static visual texture, whose contrasts are modulated by moving sine gratings. Neither the spatial slant (orientation) nor the direction of motion of these 2nd-order (microbalanced) stimuli can be detected by a Fourier analysis; they are invisible to Reichardt and motion-energy detectors. METHOD. For these dynamic stimuli, when presented both centrally and in an annular window extending from 8 to 10 deg in eccentricity, we measured the highest spatial frequency for which discrimination between +/- 45 deg texture slants and discrimination between opposite directions of motion were each possible. RESULTS. For sufficiently low spatial frequencies, slant and direction can be discriminated in both central and peripheral vision, for both 1st- and for 2nd-order stimuli. For both 1st- and 2nd-order stimuli, at both retinal locations, slant discrimination is possible at higher spatial frequencies than direction discrimination. For both 1st- and 2nd-order stimuli, motion resolution decreases 2-3 times more rapidly with eccentricity than does texture resolution. CONCLUSIONS. (1) 1st- and 2nd-order motion scale similarly with eccentricity. (2) 1st- and 2nd-order texture scale similarly with eccentricity. (3) The central/peripheral resolution fall-off is 2-3 times greater for motion than for texture.

Flagellar dynamics of a connected chain of active, polar, Brownian particles

PubMed Central

Chelakkot, Raghunath; Gopinath, Arvind; Mahadevan, L.; Hagan, Michael F.

2014-01-01

We show that active, self-propelled particles that are connected together to form a single chain that is anchored at one end can produce the graceful beating motions of flagella. Changing the boundary condition from a clamp to a pivot at the anchor leads to steadily rotating tight coils. Strong noise in the system disrupts the regularity of the oscillations. We use a combination of detailed numerical simulations, mean-field scaling analysis and first passage time theory to characterize the phase diagram as a function of the filament length, passive elasticity, propulsion force and noise. Our study suggests minimal experimental tests for the onset of oscillations in an active polar chain. PMID:24352670

Flagellar dynamics of a connected chain of active, polar, Brownian particles.

PubMed

Chelakkot, Raghunath; Gopinath, Arvind; Mahadevan, L; Hagan, Michael F

2014-03-06

We show that active, self-propelled particles that are connected together to form a single chain that is anchored at one end can produce the graceful beating motions of flagella. Changing the boundary condition from a clamp to a pivot at the anchor leads to steadily rotating tight coils. Strong noise in the system disrupts the regularity of the oscillations. We use a combination of detailed numerical simulations, mean-field scaling analysis and first passage time theory to characterize the phase diagram as a function of the filament length, passive elasticity, propulsion force and noise. Our study suggests minimal experimental tests for the onset of oscillations in an active polar chain.

Age, geochemistry and melt flux variations for the Hawaiian Ridge

NASA Astrophysics Data System (ADS)

Garcia, M. O.; Weis, D. A.; Greene, A. R.; Wessel, P.; Harrison, L.; Tree, J.

2012-12-01

The Hawaiian Ridge portion of the Hawaiian-Emperor Chain, the classic example of a mantle plume produced linear island chain, is 6000 km in length, active for 80+ Myr, and tectonically simple. Despite its importance to our understanding of mantle plumes and Cenozoic plate motion, there are large data gaps for the age and geochemistry of lavas from volcanoes along the Hawaiian Ridge (HR) portion of the Chain. Ages: Only volcanoes near the Hawaiian-Emperor bend and in the Hawaiian Islands have modern Ar-Ar ages, leaving a gap of 2000 km where existing K-Ar ages suggest synchronous volcanism over a 1000 km section. Geochemistry: There is a 2900 km gap in high precision geochemical data for the HR. The Emperor Seamounts (>45 Ma) have better regional coverage of recent isotopic data and show a correlation of Sr isotope composition with age of the underlying oceanic lithosphere (Regelous et al. 2003). The HR has an unexplained, exponential increase in magma flux over the last 30 Myr (Vidal & Bonneville 2004). Potential explanations for the increase in magma flux include: changes in melting conditions (temperature and/or pressure), change in source fertility related to rock type (pyroxenite vs. peridotite) or previous melting history, and/or changes in plate stresses resulting from reconfigurations of plate motion. Our new multi-disciplinary project will: 1) Determine 40Ar/39Ar ages, and whole-rock major, trace element, and Pb, Sr, Nd and Hf isotopic geochemistry for lavas from 20 volcanoes spanning ~2150 km of the HR (NW of the Hawaiian Islands). 2) Use the geochemical data to determine the long-term evolution of the Hawaiian mantle plume source components and to evaluate whether there have been systematic variations in mantle potential temperature, melting pressure, and/or source lithology during the creation of the HR. If so, are they responsible for the 300% variation in melt production along the Ridge? Also, we will assess when the more fertile Loa source component appeared. 3) Reassess models for the origin of the HR using the new 40Ar/39Ar ages. 4) Recompute and compare the magma flux rate for the Hawaiian and Louisville Ridges using our new HR ages and IODP results for Louisville Ridge, and updated bathymetric data for both chains. 5) Utilize the new ages to revise Cenozoic Pacific plate motions and to compute differential motions as proxies for stress changes along the HR with time to evaluate the effects of plate motion on magma flux rate. These studies will have fundamental implications for mantle plume sources, plume dynamics, and plate kinematics. Vidal V, Bonneville A, 2004. J. Geophys. Res., 109, B03104, doi:10.1029/2003JB002559 Regelous M, Hofmann AW, Abouchami W, Galer SJG, 2003. Jour. Petrol. 44, 113-140

Site-specific protein backbone and side-chain NMR chemical shift and relaxation analysis of human vinexin SH3 domain using a genetically encoded {sup 15}N/{sup 19}F-labeled unnatural amino acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Pan; School of Life Science, University of Science and Technology of China, Hefei, Anhui 230026; Xi, Zhaoyong

Research highlights: {yields} Chemical synthesis of {sup 15}N/{sup 19}F-trifluomethyl phenylalanine. {yields} Site-specific incorporation of {sup 15}N/{sup 19}F-trifluomethyl phenylalanine to SH3. {yields} Site-specific backbone and side chain chemical shift and relaxation analysis. {yields} Different internal motions at different sites of SH3 domain upon ligand binding. -- Abstract: SH3 is a ubiquitous domain mediating protein-protein interactions. Recent solution NMR structural studies have shown that a proline-rich peptide is capable of binding to the human vinexin SH3 domain. Here, an orthogonal amber tRNA/tRNA synthetase pair for {sup 15}N/{sup 19}F-trifluoromethyl-phenylalanine ({sup 15}N/{sup 19}F-tfmF) has been applied to achieve site-specific labeling of SH3 at threemore » different sites. One-dimensional solution NMR spectra of backbone amide ({sup 15}N){sup 1}H and side-chain {sup 19}F were obtained for SH3 with three different site-specific labels. Site-specific backbone amide ({sup 15}N){sup 1}H and side-chain {sup 19}F chemical shift and relaxation analysis of SH3 in the absence or presence of a peptide ligand demonstrated different internal motions upon ligand binding at the three different sites. This site-specific NMR analysis might be very useful for studying large-sized proteins or protein complexes.« less

Non-classical light generated by quantum-noise-driven cavity optomechanics.

PubMed

Brooks, Daniel W C; Botter, Thierry; Schreppler, Sydney; Purdy, Thomas P; Brahms, Nathan; Stamper-Kurn, Dan M

2012-08-23

Optomechanical systems, in which light drives and is affected by the motion of a massive object, will comprise a new framework for nonlinear quantum optics, with applications ranging from the storage and transduction of quantum information to enhanced detection sensitivity in gravitational wave detectors. However, quantum optical effects in optomechanical systems have remained obscure, because their detection requires the object’s motion to be dominated by vacuum fluctuations in the optical radiation pressure; so far, direct observations have been stymied by technical and thermal noise. Here we report an implementation of cavity optomechanics using ultracold atoms in which the collective atomic motion is dominantly driven by quantum fluctuations in radiation pressure. The back-action of this motion onto the cavity light field produces ponderomotive squeezing. We detect this quantum phenomenon by measuring sub-shot-noise optical squeezing. Furthermore, the system acts as a low-power, high-gain, nonlinear parametric amplifier for optical fluctuations, demonstrating a gain of 20 dB with a pump corresponding to an average of only seven intracavity photons. These findings may pave the way for low-power quantum optical devices, surpassing quantum limits on position and force sensing, and the control and measurement of motion in quantum gases.

Enrico Fermi's Impact on Science - John Marburger Speech

Science.gov Websites

neutrons in a similar way, by directing a high energy proton beam onto a target, dislodging a spray of then spun at a very high speed inside a fissure in a large paraffin block. We found that, while, with the wheel at rest, the two detectors became equally active, when the wheel was in motion during the

Episodic Feelings and Transfer of Learning

ERIC Educational Resources Information Center

Nemirovsky, Ricardo

2011-01-01

The goal of this article is to develop a new perspective on transfer of learning integrating cognition, emotion, and bodily experience. It is based on a case study with a 10-year-old girl as she explored the use of a motion detector, allowing for the simultaneous graphing of the position versus time of 2 moving points. The paper elaborates on the…

Development of Adaptive Tilt Tracker that Utilizes QUAD-cell Detector to Track Extended Objects

DTIC Science & Technology

2014-03-17

telescopes. When incident light encounters the atmosphere , it experiences a turbulent medium that distorts optical wavefronts. Without the AO...fluctuations which randomize optical path lengths. Figure 2 - The temporal and spatial aspects of atmospheric turbulence [6] Consider...the PTS are determined by atmospheric turbulence , optical set-up, and object characteristics such as size, shape, motion, and intensity

A low cost PSD-based monocular motion capture system

NASA Astrophysics Data System (ADS)

Ryu, Young Kee; Oh, Choonsuk

2007-10-01

This paper describes a monocular PSD-based motion capture sensor to employ with commercial video game systems such as Microsoft's XBOX and Sony's Playstation II. The system is compact, low-cost, and only requires a one-time calibration at the factory. The system includes a PSD(Position Sensitive Detector) and active infrared (IR) LED markers that are placed on the object to be tracked. The PSD sensor is placed in the focal plane of a wide-angle lens. The micro-controller calculates the 3D position of the markers using only the measured intensity and the 2D position on the PSD. A series of experiments were performed to evaluate the performance of our prototype system. From the experimental results we see that the proposed system has the advantages of the compact size, the low cost, the easy installation, and the high frame rates to be suitable for high speed motion tracking in games.

Video noise reduction

NASA Astrophysics Data System (ADS)

Drewery, J. O.; Storey, R.; Tanton, N. E.

1984-07-01

A video noise and film grain reducer is described which is based on a first-order recursive temporal filter. Filtering of moving detail is avoided by inhibiting recursion in response to the amount of motion in a picture. Motion detection is based on the point-by-point power of the picture difference signal coupled with a knowledge of the noise statistics. A control system measures the noise power and adjusts the working point of the motion detector accordingly. A field trial of a manual version of the equipment at Television Center indicated that a worthwhile improvement in the quality of noisy or grainy pictures received by the viewer could be obtained. Subsequent trials of the automated version confirmed that the improvement could be maintained. Commercial equipment based on the design is being manufactured and marketed by Pye T.V.T. under license. It is in regular use on both the BBC1 and BBC2 networks.

Clearance detector and method for motion and distance

DOEpatents

Xavier, Patrick G [Albuquerque, NM

2011-08-09

A method for correct and efficient detection of clearances between three-dimensional bodies in computer-based simulations, where one or both of the volumes is subject to translation and/or rotations. The method conservatively determines of the size of such clearances and whether there is a collision between the bodies. Given two bodies, each of which is undergoing separate motions, the method utilizes bounding-volume hierarchy representations for the two bodies and, mappings and inverse mappings for the motions of the two bodies. The method uses the representations, mappings and direction vectors to determine the directionally furthest locations of points on the convex hulls of the volumes virtually swept by the bodies and hence the clearance between the bodies, without having to calculate the convex hulls of the bodies. The method includes clearance detection for bodies comprising convex geometrical primitives and more specific techniques for bodies comprising convex polyhedra.

An Analysis of the High Frequency Vibrations in Early Thematic Mapper Scenes

NASA Technical Reports Server (NTRS)

Kogut, J.; Larduinat, E.

1985-01-01

The motion of the mirrors in the thematic mapper (TM) and multispectral scanner (MSS) instruments, and the motion of other devices, such as the TDRSS antenna drive, and solar array drives onboard LANDSAT-4 cause vibrations to propagate through the spacecraft. These vibrations as well as nonlinearities in the scanning motion of the TM mirror can cause the TM detectors to point away from their nominal positions. Two computer programs, JITTER and SCDFT, were developed as part of the LANDSAT-D Assessment System (LAS), Products and Procedures Analysis (PAPA) program to evaluate the potential effect of high frequency vibrations on the final TM image. The maximum overlap and underlap which were observed for early TM scenes are well within specifications for the ground processing system. The cross scan and scan high frequency vibrations are also within the specifications cited for the flight system.

Introductory Physics Experiments Using the Wiimote

NASA Astrophysics Data System (ADS)

Somers, William; Rooney, Frank; Ochoa, Romulo

2009-03-01

The Wii, a video game console, is a very popular device with millions of units sold worldwide over the past two years. Although computationally it is not a powerful machine, to a physics educator its most important components can be its controllers. The Wiimote (or remote) controller contains three accelerometers, an infrared detector, and Bluetooth connectivity at a relatively low price. Thanks to available open source code, any PC with Bluetooth capability can detect the information sent out by the Wiimote. We have designed several experiments for introductory physics courses that make use of the accelerometers and Bluetooth connectivity. We have adapted the Wiimote to measure the: variable acceleration in simple harmonic motion, centripetal and tangential accelerations in circular motion, and the accelerations generated when students lift weights. We present the results of our experiments and compare them with those obtained when using motion and/or force sensors.

Diagnosing residual motion via the x-ray self emission from indirectly driven inertial confinement implosions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pak, A., E-mail: pak5@llnl.gov; Field, J. E.; Benedetti, L. R.

2014-11-15

In an indirectly driven implosion, non-radial translational motion of the compressed fusion capsule is a signature of residual kinetic energy not coupled into the compressional heating of the target. A reduction in compression reduces the peak pressure and nuclear performance of the implosion. Measuring and reducing the residual motion of the implosion is therefore necessary to improve performance and isolate other effects that degrade performance. Using the gated x-ray diagnostic, the x-ray Bremsstrahlung emission from the compressed capsule is spatially and temporally resolved at x-ray energies of >8.7 keV, allowing for measurements of the residual velocity. Here details of themore » x-ray velocity measurement and fitting routine will be discussed and measurements will be compared to the velocities inferred from the neutron time of flight detectors.« less

Energy-dependent etching-related impacts on CR-39 alpha detection efficiency for the Rn-222 and Rn-220 decay chains

NASA Astrophysics Data System (ADS)

Tan, Y.; Yuan, H.; Kearfott, K. J.

2018-04-01

CR-39 detectors are widely used to measure environmental levels of Rn-222, Rn-220 and their progeny. Prior research reported the CR-39 detection efficiency for alpha particles from Rn-222, Rn-220 and their progeny under a variety of etching conditions. This paper provides an explanation for interesting observations included in that work, namely that the critical incidence angle decreases with the increasing particle energy and the detection efficiency for 8.78 MeV alpha particles is zero. This paper explains these phenomena from a consideration of the interaction of alpha particles with the CR-39 detectors and the physics of etching dynamics. The proposed theory provides a rationale for an approach to optimizing the etching conditions of CR-39 detector for measuring Rn-222, Rn-220 and their progenies.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carmichael, Joshua Daniel; Carr, Christina; Pettit, Erin C.

We apply a fully autonomous icequake detection methodology to a single day of high-sample rate (200 Hz) seismic network data recorded from the terminus of Taylor Glacier, ANT that temporally coincided with a brine release episode near Blood Falls (May 13, 2014). We demonstrate a statistically validated procedure to assemble waveforms triggered by icequakes into populations of clusters linked by intra-event waveform similarity. Our processing methodology implements a noise-adaptive power detector coupled with a complete-linkage clustering algorithm and noise-adaptive correlation detector. This detector-chain reveals a population of 20 multiplet sequences that includes ~150 icequakes and produces zero false alarms onmore » the concurrent, diurnally variable noise. Our results are very promising for identifying changes in background seismicity associated with the presence or absence of brine release episodes. We thereby suggest that our methodology could be applied to longer time periods to establish a brine-release monitoring program for Blood Falls that is based on icequake detections.« less

Digital signal processing for the ATLAS/LUCID detector

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

2015-07-01

Both the detector and the associated read-out electronics have been improved in order to cope with the LHC luminosity increase foreseen for RUN 2 and RUN 3. The new operating conditions require a careful tuning of the read-out electronics in order to optimize the signal-to-noise ratio. The new read-out electronics will allow the use of digital filtering of the photo multiplier tube signals. In this talk, we will present the first results that we obtained in the optimization of the signal-to-noise ratio. In addition, we will introduce the next steps to adapt this system to high performance read-out chains formore » low energy gamma rays. Such systems are based, for instance, on Silicon Drift Detector devices and can be used in applications at Free-Electron-Laser facilities such as the XFEL under construction at DESY. (authors)« less

Thermal-noise suppression in nano-scale Si field-effect transistors by feedback control based on single-electron detection

NASA Astrophysics Data System (ADS)

Chida, Kensaku; Nishiguchi, Katsuhiko; Yamahata, Gento; Tanaka, Hirotaka; Fujiwara, Akira

2015-08-01

We perform feedback (FB) control for suppressing thermal fluctuation in the number of electrons in a silicon single-electron (SE) device composed of a small transistor and capacitor. SEs enter and leave the capacitor via the transistor randomly at thermal equilibrium, which is monitored in real time using a high-charge-sensitivity detector. In order to suppress such random motion or thermal fluctuation of the electrons, SEs are injected and removed using the transistor according to the monitored change in the number of electrons in the capacitor, which is exactly the FB control. As a result, thermal fluctuation in the number of electrons in a SE device is suppressed by 60%, which corresponds to the so-called FB cooling from 300 to 110 K. Moreover, a thermodynamics analysis of this FB cooling reveals that entropy in the capacitor is reduced and the device is at non-equilibrium; i.e., the free energy of the device increases. Since this entropy reduction originates from information about the electrons' motion monitored by the detector, our results by the FB control represent one type of information-to-energy conversion.

Thermal noise and optomechanical features in the emission of a membrane-coupled compound cavity laser diode.

PubMed

Baldacci, Lorenzo; Pitanti, Alessandro; Masini, Luca; Arcangeli, Andrea; Colangelo, Francesco; Navarro-Urrios, Daniel; Tredicucci, Alessandro

2016-08-19

We demonstrate the use of a compound optical cavity as linear displacement detector, by measuring the thermal motion of a silicon nitride suspended membrane acting as the external mirror of a near-infrared Littrow laser diode. Fluctuations in the laser optical power induced by the membrane vibrations are collected by a photodiode integrated within the laser, and then measured with a spectrum analyzer. The dynamics of the membrane driven by a piezoelectric actuator is investigated as a function of air pressure and actuator displacement in a homodyne configuration. The high Q-factor (~3.4 · 10(4) at 8.3 · 10(-3) mbar) of the fundamental mechanical mode at ~73 kHz guarantees a detection sensitivity high enough for direct measurement of thermal motion at room temperature (~87 pm RMS). The compound cavity system here introduced can be employed as a table-top, cost-effective linear displacement detector for cavity optomechanics. Furthermore, thanks to the strong optical nonlinearities of the laser compound cavity, these systems open new perspectives in the study of non-Markovian quantum properties at the mesoscale.

Thermal noise and optomechanical features in the emission of a membrane-coupled compound cavity laser diode

PubMed Central

Baldacci, Lorenzo; Pitanti, Alessandro; Masini, Luca; Arcangeli, Andrea; Colangelo, Francesco; Navarro-Urrios, Daniel; Tredicucci, Alessandro

2016-01-01

We demonstrate the use of a compound optical cavity as linear displacement detector, by measuring the thermal motion of a silicon nitride suspended membrane acting as the external mirror of a near-infrared Littrow laser diode. Fluctuations in the laser optical power induced by the membrane vibrations are collected by a photodiode integrated within the laser, and then measured with a spectrum analyzer. The dynamics of the membrane driven by a piezoelectric actuator is investigated as a function of air pressure and actuator displacement in a homodyne configuration. The high Q-factor (~3.4 · 104 at 8.3 · 10−3 mbar) of the fundamental mechanical mode at ~73 kHz guarantees a detection sensitivity high enough for direct measurement of thermal motion at room temperature (~87 pm RMS). The compound cavity system here introduced can be employed as a table-top, cost-effective linear displacement detector for cavity optomechanics. Furthermore, thanks to the strong optical nonlinearities of the laser compound cavity, these systems open new perspectives in the study of non-Markovian quantum properties at the mesoscale. PMID:27538586

Hotspot motion caused the Hawaiian-Emperor Bend and LLSVPs are not fixed

NASA Astrophysics Data System (ADS)

Tarduno, J. A.; Bono, R. K.

2017-12-01

Paleomagnetic study of volcanic rocks remains the gold standard on which to assess hotspot motion, true polar wander and plate motion recorded by oceanic plates. There is remarkable consistency between paleomagnetic results from basaltic lavas recovered by ocean drilling of the Emperor seamounts, and independent predictions of plate circuits. Both reveal greater than 40 mm/yr of southward hotspot motion; thus the dominant reason for the distinct bend morphology the Hawaiian-Emperor track is hotspot motion rather than plate motion. These findings provide the motivation for moving beyond hotspot fixity to understand mantle processes responsible for the observed motions. Global analyses as well as comparisons between the Hawaiian-Emperor and Louisville tracks indicate only a minor (if any) role for true polar wander. Two viable, non-mutually exclusive processes to explain the observed Hawaiian plume motion are: i. plume-ridge and ii plume-LLSVP interaction. Here we further explore these issues by paleomagnetic analyses of basalts from the Cenozoic Hawaiian chain and Late Cretaceous basalts of the southernmost Pacific Plate. The latter yield paleolatitudes consistent with those from the northern Pacific, indicating that long-standing non-dipole fields cannot have been large enough to affect conclusions on hotspot drift. Data from the former suggest some relative motions between the LLSVPs on tens-of-millions of year time scales, which probably record the continual reshaping of these provinces by plume motion in the lower mantle.

Measuring Fission Chain Dynamics Through Inter-event Timing of Correlated Particles

NASA Astrophysics Data System (ADS)

Monterial, Mateusz

Neutrons born from fission may go on to induce subsequent fissions in self-propagating series of reactions resulting in a fission chain. Fissile materials comprise all isotopes capable of sustaining nuclear fission chain reactions, and are therefore a necessary prerequisite for the construction of a nuclear weapon. As a result the accountancy and characterization of fissile material is of great importance for national security and the international community. The rate at which neutrons "multiply" in a fissile material is a function of the composition, total mass, density, and shape of the object. These are key characteristics sought out in areas of nuclear non-proliferation, safeguards, treaty verification and emergency response. This thesis demonstrates a novel technique of measuring the underlying fission chain dynamics in fissile material through temporal correlation of neutrons and gamma rays emitted from fission. Fissile material exhibits key detectable signatures through the emission of correlated neutrons and gamma rays from fission. The Non-Destructive Assay (NDA) community has developed mature techniques of assaying fissile material that detect these signatures, such as neutron counting by thermal capture based detectors, and gamma-ray spectroscopy. An alternative use of fast organic scintillators provides three additional capabilities: (1) discrimination between neutrons and gamma-ray pulses (2) sub-nanosecond scale timing between correlated events (3) measurement of deposited neutron energy in the detector. This thesis leverages these capabilities into to measure a new signature, which is demonstrated to be sensitive to both fissile neutron multiplication and presence of neutronically coupled reflectors. In addition, a new 3D imaging method of sources of correlated gamma rays and neutrons is presented, which can improve estimation of total source volume and localization.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Siqi; Senses, Erkan; Jiao, Yang

Nanoparticles functionalized with long polymer chains at low graft density are interesting systems to study structure–dynamic relationships in polymer nanocomposites since they are shown to aggregate into strings in both solution and melts and also into spheres and branched aggregates in the presence of free polymer chains. Our work investigates structure and entanglement effects in composites of polystyrene-grafted iron oxide nanoparticles by measuring particle relaxations using X-ray photon correlation spectroscopy. And for particles within highly ordered strings and aggregated systems, they experience a dynamically heterogeneous environment displaying hyperdiffusive relaxation commonly observed in jammed soft glassy systems. Furthermore, particle dynamics ismore » diffusive for branched aggregated structures which could be caused by less penetration of long matrix chains into brushes. These results suggest that particle motion is dictated by the strong interactions of chains grafted at low density with the host matrix polymer.« less

Frequent side chain methyl carbon-oxygen hydrogen bonding in proteins revealed by computational and stereochemical analysis of neutron structures.

PubMed

Yesselman, Joseph D; Horowitz, Scott; Brooks, Charles L; Trievel, Raymond C

2015-03-01

The propensity of backbone Cα atoms to engage in carbon-oxygen (CH · · · O) hydrogen bonding is well-appreciated in protein structure, but side chain CH · · · O hydrogen bonding remains largely uncharacterized. The extent to which side chain methyl groups in proteins participate in CH · · · O hydrogen bonding is examined through a survey of neutron crystal structures, quantum chemistry calculations, and molecular dynamics simulations. Using these approaches, methyl groups were observed to form stabilizing CH · · · O hydrogen bonds within protein structure that are maintained through protein dynamics and participate in correlated motion. Collectively, these findings illustrate that side chain methyl CH · · · O hydrogen bonding contributes to the energetics of protein structure and folding. © 2014 Wiley Periodicals, Inc.

LOCALIZATION OF SHORT DURATION GRAVITATIONAL-WAVE TRANSIENTS WITH THE EARLY ADVANCED LIGO AND VIRGO DETECTORS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Essick, Reed; Vitale, Salvatore; Katsavounidis, Erik

2015-02-20

The Laser Interferometer Gravitational wave Observatory (LIGO) and Virgo advanced ground-based gravitational-wave detectors will begin collecting science data in 2015. With first detections expected to follow, it is important to quantify how well generic gravitational-wave transients can be localized on the sky. This is crucial for correctly identifying electromagnetic counterparts as well as understanding gravitational-wave physics and source populations. We present a study of sky localization capabilities for two search and parameter estimation algorithms: coherent WaveBurst, a constrained likelihood algorithm operating in close to real-time, and LALInferenceBurst, a Markov chain Monte Carlo parameter estimation algorithm developed to recover generic transientmore » signals with latency of a few hours. Furthermore, we focus on the first few years of the advanced detector era, when we expect to only have two (2015) and later three (2016) operational detectors, all below design sensitivity. These detector configurations can produce significantly different sky localizations, which we quantify in detail. We observe a clear improvement in localization of the average detected signal when progressing from two-detector to three-detector networks, as expected. Although localization depends on the waveform morphology, approximately 50% of detected signals would be imaged after observing 100-200 deg{sup 2} in 2015 and 60-110 deg{sup 2} in 2016, although knowledge of the waveform can reduce this to as little as 22 deg{sup 2}. This is the first comprehensive study on sky localization capabilities for generic transients of the early network of advanced LIGO and Virgo detectors, including the early LIGO-only two-detector configuration.« less

Theoretical performance analysis for CMOS based high resolution detectors.

PubMed

Jain, Amit; Bednarek, Daniel R; Rudin, Stephen

2013-03-06

High resolution imaging capabilities are essential for accurately guiding successful endovascular interventional procedures. Present x-ray imaging detectors are not always adequate due to their inherent limitations. The newly-developed high-resolution micro-angiographic fluoroscope (MAF-CCD) detector has demonstrated excellent clinical image quality; however, further improvement in performance and physical design may be possible using CMOS sensors. We have thus calculated the theoretical performance of two proposed CMOS detectors which may be used as a successor to the MAF. The proposed detectors have a 300 μm thick HL-type CsI phosphor, a 50 μm-pixel CMOS sensor with and without a variable gain light image intensifier (LII), and are designated MAF-CMOS-LII and MAF-CMOS, respectively. For the performance evaluation, linear cascade modeling was used. The detector imaging chains were divided into individual stages characterized by one of the basic processes (quantum gain, binomial selection, stochastic and deterministic blurring, additive noise). Ranges of readout noise and exposure were used to calculate the detectors' MTF and DQE. The MAF-CMOS showed slightly better MTF than the MAF-CMOS-LII, but the MAF-CMOS-LII showed far better DQE, especially for lower exposures. The proposed detectors can have improved MTF and DQE compared with the present high resolution MAF detector. The performance of the MAF-CMOS is excellent for the angiography exposure range; however it is limited at fluoroscopic levels due to additive instrumentation noise. The MAF-CMOS-LII, having the advantage of the variable LII gain, can overcome the noise limitation and hence may perform exceptionally for the full range of required exposures; however, it is more complex and hence more expensive.

A CMOS-based high-resolution fluoroscope (HRF) detector prototype with 49.5μm pixels for use in endovascular image guided interventions (EIGI)

NASA Astrophysics Data System (ADS)

Russ, M.; Shankar, A.; Setlur Nagesh, S. V.; Ionita, C. N.; Bednarek, D. R.; Rudin, S.

2017-03-01

X-ray detectors to meet the high-resolution requirements for endovascular image-guided interventions (EIGIs) are being developed and evaluated. A new 49.5-micron pixel prototype detector is being investigated and compared to the current suite of high-resolution fluoroscopic (HRF) detectors. This detector featuring a 300-micron thick CsI(Tl) scintillator, and low electronic noise CMOS readout is designated the HRF- CMOS50. To compare the abilities of this detector with other existing high resolution detectors, a standard performance metric analysis was applied, including the determination of the modulation transfer function (MTF), noise power spectra (NPS), noise equivalent quanta (NEQ), and detective quantum efficiency (DQE) for a range of energies and exposure levels. The advantage of the smaller pixel size and reduced blurring due to the thin phosphor was exemplified when the MTF of the HRF-CMOS50 was compared to the other high resolution detectors, which utilize larger pixels, other optical designs or thicker scintillators. However, the thinner scintillator has the disadvantage of a lower quantum detective efficiency (QDE) for higher diagnostic x-ray energies. The performance of the detector as part of an imaging chain was examined by employing the generalized metrics GMTF, GNEQ, and GDQE, taking standard focal spot size and clinical imaging parameters into consideration. As expected, the disparaging effects of focal spot unsharpness, exacerbated by increasing magnification, degraded the higher-frequency performance of the HRF-CMOS50, while increasing scatter fraction diminished low-frequency performance. Nevertheless, the HRF-CMOS50 brings improved resolution capabilities for EIGIs, but would require increased sensitivity and dynamic range for future clinical application.

Figure-ground segregation can rely on differences in motion direction.

PubMed

Kandil, Farid I; Fahle, Manfred

2004-12-01

If the elements within a figure move synchronously while those in the surround move at a different time, the figure is easily segregated from the surround and thus perceived. Lee and Blake (1999) [Visual form created solely from temporal structure. Science, 284, 1165-1168] demonstrated that this figure-ground separation may be based not only on time differences between motion onsets, but also on the differences between reversals of motion direction. However, Farid and Adelson (2001) [Synchrony does not promote grouping in temporally structured displays. Nature Neuroscience, 4, 875-876] argued that figure-ground segregation in the motion-reversal experiment might have been based on a contrast artefact and concluded that (a)synchrony as such was 'not responsible for the perception of form in these or earlier displays'. Here, we present experiments that avoid contrast artefacts but still produce figure-ground segregation based on purely temporal cues. Our results show that subjects can segregate figure from ground even though being unable to use motion reversals as such. Subjects detect the figure when either (i) motion stops (leading to contrast artefacts), or (ii) motion directions differ between figure and ground. Segregation requires minimum delays of about 15 ms. We argue that whatever the underlying cues and mechanisms, a second stage beyond motion detection is required to globally compare the outputs of local motion detectors and to segregate figure from ground. Since analogous changes take place in both figure and ground in rapid succession, this second stage has to detect the asynchrony with high temporal precision.

Under-reported dosimetry errors due to interplay effects during VMAT dose delivery in extreme hypofractionated stereotactic radiotherapy.

PubMed

Gauer, Tobias; Sothmann, Thilo; Blanck, Oliver; Petersen, Cordula; Werner, René

2018-06-01

Radiotherapy of extracranial metastases changed from normofractioned 3D CRT to extreme hypofractionated stereotactic treatment using VMAT beam techniques. Random interaction between tumour motion and dynamically changing beam parameters might result in underdosage of the CTV even for an appropriately dimensioned ITV (interplay effect). This study presents a clinical scenario of extreme hypofractionated stereotactic treatment and analyses the impact of interplay effects on CTV dose coverage. For a thoracic/abdominal phantom with an integrated high-resolution detector array placed on a 4D motion platform, dual-arc treatment plans with homogenous target coverage were created using a common VMAT technique and delivered in a single fraction. CTV underdosage through interplay effects was investigated by comparing dose measurements with and without tumour motion during plan delivery. Our study agrees with previous works that pointed out insignificant interplay effects on target coverage for very regular tumour motion patterns like simple sinusoidal motion. However, we identified and illustrated scenarios that are likely to result in a clinically relevant CTV underdosage. For tumour motion with abnormal variability, target coverage quantified by the CTV area receiving more than 98% of the prescribed dose decreased to 78% compared to 100% at static dose measurement. This study is further proof of considerable influence of interplay effects on VMAT dose delivery in stereotactic radiotherapy. For selected conditions of an exemplary scenario, interplay effects and related motion-induced target underdosage primarily occurred in tumour motion pattern with increased motion variability and VMAT plan delivery using complex MLC dose modulation.

Pictorial Review of Digital Radiography Artifacts.

PubMed

Walz-Flannigan, Alisa I; Brossoit, Kimberly J; Magnuson, Dayne J; Schueler, Beth A

2018-01-01

Visual familiarity with the variety of digital radiographic artifacts is needed to identify, resolve, or prevent image artifacts from creating issues with patient imaging. Because the mechanism for image creation is different between flat-panel detectors and computed radiography, the causes and appearances of some artifacts can be unique to these different modalities. Examples are provided of artifacts that were found on clinical images or during quality control testing with flat-panel detectors. The examples are meant to serve as learning tools for future identification and troubleshooting of artifacts and as a reminder for steps that can be taken for prevention. The examples of artifacts provided are classified according to their causal connection in the imaging chain, including an equipment defect as a result of an accident or mishandling, debris or gain calibration flaws, a problematic acquisition technique, signal transmission failures, and image processing issues. Specific artifacts include those that are due to flat-panel detector drops, backscatter, debris in the x-ray field during calibration, detector saturation or underexposure, or collimation detection errors, as well as a variety of artifacts that are processing induced. © RSNA, 2018.

Ethylene glycol revisited: Molecular dynamics simulations and visualization of the liquid and its hydrogen-bond network☆

PubMed Central

Kaiser, Alexander; Ismailova, Oksana; Koskela, Antti; Huber, Stefan E.; Ritter, Marcel; Cosenza, Biagio; Benger, Werner; Nazmutdinov, Renat; Probst, Michael

2014-01-01

Molecular dynamics simulations of liquid ethylene glycol described by the OPLS-AA force field were performed to gain insight into its hydrogen-bond structure. We use the population correlation function as a statistical measure for the hydrogen-bond lifetime. In an attempt to understand the complicated hydrogen-bonding, we developed new molecular visualization tools within the Vish Visualization shell and used it to visualize the life of each individual hydrogen-bond. With this tool hydrogen-bond formation and breaking as well as clustering and chain formation in hydrogen-bonded liquids can be observed directly. Liquid ethylene glycol at room temperature does not show significant clustering or chain building. The hydrogen-bonds break often due to the rotational and vibrational motions of the molecules leading to an H-bond half-life time of approximately 1.5 ps. However, most of the H-bonds are reformed again so that after 50 ps only 40% of these H-bonds are irreversibly broken due to diffusional motion. This hydrogen-bond half-life time due to diffusional motion is 80.3 ps. The work was preceded by a careful check of various OPLS-based force fields used in the literature. It was found that they lead to quite different angular and H-bond distributions. PMID:24748697

Thermally Induced Lateral Motion of α-Zirconium Phosphate Layers Intercalated with Hexadecylamines

NASA Astrophysics Data System (ADS)

Char, Kookheon

2005-03-01

Well-defined intercalated structure, either interdigitated layers or bilayers, of hexadecylamines (HDAs) in a confined space of a highly-functionalized layered material, α- zirconium phosphate (α-ZrP), was prepared and these two distinct intercalated structures can serve as model systems to investigate the interaction of the two monolayers whose amphiphilic tails are adjacent to each other. Acidic functional groups (-POH) on the α-ZrP are in well-ordered array and the number of functional group is quite high (i.e., cationic exchange capacity (CEC) = 664 mmole/100 g, area per one charge site = 0.24 nm^2) enough to realize the bilayers (i.e., discrete two monolayers) of HDAs within the α-ZrP interlayer. We employed the two-step intercalation mechanism for the preparation of well- ordered interdigitated layers as well as the bilayers of alkyl chains attached to both sides of the α-ZrP intergallery. An intriguing lateral motion of the α-ZrP sheets was observed with in-situ SAXS measurements for the interdigitated layer during heating and cooling cycle and verified with TEM. This lateral motion is believed to be due to the transition from the tilted to the untilted conformation of the interdigitated HDA chains and this transition is found to be thermally reversible.

Fluorescence Determination of Tryptophan Side-Chain Accessibility and Dynamics in Triple-Helical Collagen-Like Peptides

PubMed Central

Simon-Lukasik, Kristine V.; Persikov, Anton V.; Brodsky, Barbara; Ramshaw, John A. M.; Laws, William R.; Alexander Ross, J. B.; Ludescher, Richard D.

2003-01-01

We report tryptophan fluorescence measurements of emission intensity, iodide quenching, and anisotropy that describe the environment and dynamics at X and Y sites in stable collagen-like peptides of sequence (Gly-X-Y)n. About 90% of tryptophans at both sites have similar solvent exposed fluorescence properties and a lifetime of 8.5–9 ns. Analysis of anisotropy decays using an associative model indicates that these long lifetime populations undergo rapid depolarizing motion with a 0.5 ns correlation time; however, the extent of fast motion at the Y site is considerably less than the essentially unrestricted motion at the X site. About 10% of tryptophans at both sites have a shorter (∼3 ns) lifetime indicating proximity to a protein quenching group; these minor populations are immobile on the peptide surface, depolarizing only by overall trimer rotation. Iodide quenching indicates that tryptophans at the X site are more accessible to solvent. Side chains at X sites are more solvent accessible and considerably more mobile than residues at Y sites and can more readily fluctuate among alternate intermolecular interactions in collagen fibrils. This fluorescence analysis of collagen-like peptides lays a foundation for studies on the structure, dynamics, and function of collagen and of triple-helical junctions in gelatin gels. PMID:12524302

Rotational Dynamics of Solutes with Multiple Single Bond Axes Studied by Infrared Pump-Probe Spectroscopy.

PubMed

Okuda, Masaki; Ohta, Kaoru; Tominaga, Keisuke

2018-02-01

To investigate the relationship between the structural degrees of freedom around a vibrational probe and the rotational relaxation process of a solute in solution, we studied the anisotropy decays of three different N 3 -derivatized amino acids in primary alcohol solutions. By performing polarization-controlled IR pump-probe measurements, we reveal that the anisotropy decays of the vibrational probe molecules in 1-alcohol solutions possess two decay components, at subpicosecond and picosecond time scales. On the basis of results showing that the fast relaxation component is insensitive to the vibrational probe molecule, we suggest that the anisotropy decay of the N 3 group on a subpicosecond time scale results from a local, small-amplitude fluctuation of the flexible vibrational probe, which does not depend on the details of its molecular structure. However, the slow relaxation component depends on the solute: with longer alkyl chains attached to the N 3 group, the anisotropy decay of the slow component is faster. Consequently, we conclude that the slow relaxation component corresponds to the reorientational motion of the N 3 group correlated with other intramolecular rotational motions (e.g., rotational motions of the neighboring alkyl chain). Our experimental results provide important insight into understanding the rotational dynamics of solutes with multiple single bond axes in solution.

Fast internal dynamics in alcohol dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Monkenbusch, M.; Stadler, A., E-mail: a.stadler@fz-juelich.de; Biehl, R.

2015-08-21

Large-scale domain motions in alcohol dehydrogenase (ADH) have been observed previously by neutron spin-echo spectroscopy (NSE). We have extended the investigation on the dynamics of ADH in solution by using high-resolution neutron time-of-flight (TOF) and neutron backscattering (BS) spectroscopy in the incoherent scattering range. The observed hydrogen dynamics were interpreted in terms of three mobility classes, which allowed a simultaneous description of the measured TOF and BS spectra. In addition to the slow global protein diffusion and domain motions observed by NSE, a fast internal process could be identified. Around one third of the protons in ADH participate in themore » fast localized diffusive motion. The diffusion coefficient of the fast internal motions is around two third of the value of the surrounding D{sub 2}O solvent. It is tempting to associate the fast internal process with solvent exposed amino acid residues with dangling side chains.« less

Actuation for simultaneous motions and constraining efforts: an open chain example

NASA Astrophysics Data System (ADS)

Perreira, N. Duke

1997-06-01

A brief discussion on systems where simultaneous control of forces and velocities are desirable is given and an example linkage with revolute and prismatic joint is selected for further analysis. The Newton-Euler approach for dynamic system analysis is applied to the example to provide a basis of comparison. Gauge invariant transformations are used to convert the dynamic equations into invariant form suitable for use in a new dynamic system analysis method known as the motion-effort approach. This approach uses constraint elimination techniques based on singular value decompositions to recast the invariant form of dynamic system equations into orthogonal sets of motion and effort equations. Desired motions and constraining efforts are partitioned into ideally obtainable and unobtainable portions which are then used to determine the required actuation. The method is applied to the example system and an analytic estimate to its success is made.

Direct Investigation of Slow Correlated Dynamics in Proteins via Dipolar Interactions

PubMed Central

Fenwick, R. Bryn; Schwieters, Charles D.; Vögeli, Beat

2016-01-01

The synchronization of native state motions as they transition between microstates influences catalysis kinetics, mediates allosteric interactions and reduces the conformational entropy of proteins. However, it has proven difficult to describe native microstates because they are usually minimally frustrated and may interconvert on the μs-ms time scale. Direct observation of concerted equilibrium fluctuations would therefore be an important tool for describing protein native states. Here we propose a strategy that relates NMR cross-correlated relaxation (CCR) rates between dipolar interactions to residual dipolar couplings (RDCs) of individual consecutive HN–N and Hα–Cα bonds, which act as a proxy for the peptide planes and the side chains respectively. Using Xplor-NIH ensemble structure calculations restrained with the RDC and CCR data we observe collective motions on time scales slower than nanoseconds in the backbone for GB3. To directly access the correlations from CCR we develop a structure-free data analysis. The resulting dynamic correlation map is consistent with the ensemble-restrained simulations and reveals a complex network. In general we find that the bond motions are on average slightly correlated, and that the local environment dominates many observations. Despite this, some patterns are typical over entire secondary structure elements. In the β-sheet, nearly all bonds are weakly correlated and there is an approximately binary alternation in correlation intensity corresponding to the solvent exposure/shielding alternation of the side chains. For α-helices there is also a weak correlation in the HN-N bonds and the degree of correlation involving Hα-Cα bonds is directly affected by side-chain fluctuations, while loops show complex and non-uniform behavior. PMID:27331619

Size-dependent penetrant diffusion in polymer glasses.

PubMed

Meng, Dong; Zhang, Kai; Kumar, Sanat K

2018-05-18

Molecular Dynamics simulations are used to understand the underpinning basis of the transport of gas-like solutes in deeply quenched polymeric glasses. As found in previous work, small solutes, with sizes smaller than 0.15 times the chain monomer size, move as might be expected in a medium with large pores. In contrast, the motion of larger solutes is activated and is strongly facilitated by matrix motion. In particular, solute motion is coupled to the local elastic fluctuations of the matrix as characterized by the Debye-Waller factor. While similar ideas have been previously proposed for the viscosity of supercooled liquids above their glass transition, to our knowledge, this is the first illustration of this concept in the context of solute mass transport in deeply quenched polymer glasses.

Designing an Active Target Test Projection Chamber

NASA Astrophysics Data System (ADS)

Koci, James; Tan Ahn Collaboration, Dr.; Nicolas Dixneuf Collaboration

2015-10-01

The development of instrumentation in nuclear physics is crucial for advancing our ability to measure the properties of exotic nuclei. One limitation of the use of exotic nuclei in experiment is their very low production intensities. Recently, detectors, called active-target dectectors, have been developed to address this issue. Active-target detectors use a gas medium to image charged-particle tracks that are emitted in nuclear reactions. Last semester, I designed a vacuum chamber to be used in developing Micro-Pattern Gas detectors that will upgrade the capabilities of an active-target detector called the Prototype AT-TPC. With the exterior of the chamber complete, I have now been using an electric field modeling program, Garfield, developed by CERN to design a field cage to be placed within the vacuum chamber. The field cage will be a box-like apparatus consisting of two parallel metal plates connected with a resistor chain and attached to wires wrapped between them. The cage will provide a uniform electric field within the chamber to drift electrons from nuclear reactions down to the detector in the bottom of the chamber. These signals are then amplified by a proportional counter, and the data is sent to a computer. For the long term, we would like to incorporate a Micro-Pattern Gas Detectors in the interior of the chamber and eventually use the AT-TPC to examine various nuclei. Dr. Ahn is my advising professor.

Full-wave receiver architecture for the homodyne motion sensor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haugen, Peter C.; Dallum, Gregory E.; Welsh, Patrick A.

A homodyne motion sensor or detector based on ultra-wideband radar utilizes the entire received waveform through implementation of a voltage boosting receiver. The receiver includes a receiver input and a receiver output. A first diode is connected to the receiver output. A first charge storage capacitor is connected from between the first diode and the receiver output to ground. A second charge storage capacitor is connected between the receiver input and the first diode. A second diode is connected from between the second charge storage capacitor and the first diode to ground. The dual diode receiver performs voltage boosting ofmore » a RF signal received at the receiver input, thereby enhancing receiver sensitivity.« less

Human face detection using motion and color information

NASA Astrophysics Data System (ADS)

Kim, Yang-Gyun; Bang, Man-Won; Park, Soon-Young; Choi, Kyoung-Ho; Hwang, Jeong-Hyun

2008-02-01

In this paper, we present a hardware implementation of a face detector for surveillance applications. To come up with a computationally cheap and fast algorithm with minimal memory requirement, motion and skin color information are fused successfully. More specifically, a newly appeared object is extracted first by comparing average Hue and Saturation values of background image and a current image. Then, the result of skin color filtering of the current image is combined with the result of a newly appeared object. Finally, labeling is performed to locate a true face region. The proposed system is implemented on Altera Cyclone2 using Quartus II 6.1 and ModelSim 6.1. For hardware description language (HDL), Verilog-HDL is used.

Full-wave receiver architecture for the homodyne motion sensor

DOEpatents

Haugen, Peter C; Dallum, Gregory E; Welsh, Patrick A; Romero, Carlos E

2013-11-19

A homodyne motion sensor or detector based on ultra-wideband radar utilizes the entire received waveform through implementation of a voltage boosting receiver. The receiver includes a receiver input and a receiver output. A first diode is connected to the receiver output. A first charge storage capacitor is connected from between the first diode and the receiver output to ground. A second charge storage capacitor is connected between the receiver input and the first diode. A second diode is connected from between the second charge storage capacitor and the first diode to ground. The dual diode receiver performs voltage boosting of a RF signal received at the receiver input, thereby enhancing receiver sensitivity.

Optimized Detector Angular Configuration Increases the Sensitivity of X-ray Fluorescence Computed Tomography (XFCT).

PubMed

Ahmad, Moiz; Bazalova-Carter, Magdalena; Fahrig, Rebecca; Xing, Lei

2015-05-01

In this work, we demonstrated that an optimized detector angular configuration based on the anisotropic energy distribution of background scattered X-rays improves X-ray fluorescence computed tomography (XFCT) detection sensitivity. We built an XFCT imaging system composed of a bench-top fluoroscopy X-ray source, a CdTe X-ray detector, and a phantom motion stage. We imaged a 6.4-cm-diameter phantom containing different concentrations of gold solution and investigated the effect of detector angular configuration on XFCT image quality. Based on our previous theoretical study, three detector angles were considered. The X-ray fluorescence detector was first placed at 145 (°) (approximating back-scatter) to minimize scatter X-rays. XFCT image quality was compared to images acquired with the detector at 60 (°) (forward-scatter) and 90 (°) (side-scatter). The datasets for the three different detector positions were also combined to approximate an isotropically arranged detector. The sensitivity was optimized with detector in the 145 (°) back-scatter configuration counting the 78-keV gold Kβ1 X-rays. The improvement arose from the reduced energy of scattered X-ray at the 145 (°) position and the large energy separation from gold K β1 X-rays. The lowest detected concentration in this configuration was 2.5 mgAu/mL (or 0.25% Au with SNR = 4.3). This concentration could not be detected with the 60 (°) , 90 (°) , or isotropic configurations (SNRs = 1.3, 0, 2.3, respectively). XFCT imaging dose of 14 mGy was in the range of typical clinical X-ray CT imaging doses. To our knowledge, the sensitivity achieved in this experiment is the highest in any XFCT experiment using an ordinary bench-top X-ray source in a phantom larger than a mouse ( > 3 cm).

The Relationship Between Pitching Mechanics and Injury: A Review of Current Concepts

PubMed Central

Chalmers, Peter N.; Wimmer, Markus A.; Verma, Nikhil N.; Cole, Brian J.; Romeo, Anthony A.; Cvetanovich, Gregory L.; Pearl, Michael L.; Chalmers, Peter N.; Wimmer, Markus A.; Verma, Nikhil N.; Cole, Brian J.; Romeo, Anthony A.; Cvetanovich, Gregory L.; Pearl, Michael L.

2017-01-01

Context: The overhand pitch is one of the fastest known human motions and places enormous forces and torques on the upper extremity. Shoulder and elbow pain and injury are common in high-level pitchers. A large body of research has been conducted to understand the pitching motion. Evidence Acquisition: A comprehensive review of the literature was performed to gain a full understanding of all currently available biomechanical and clinical evidence surrounding pitching motion analysis. These motion analysis studies use video motion analysis, electromyography, electromagnetic sensors, and markered motion analysis. This review includes studies performed between 1983 and 2016. Study Design: Clinical review. Level of Evidence: Level 5. Results: The pitching motion is a kinetic chain, in which the force generated by the large muscles of the lower extremity and trunk during the wind-up and stride phases are transferred to the ball through the shoulder and elbow during the cocking and acceleration phases. Numerous kinematic factors have been identified that increase shoulder and elbow torques, which are linked to increased risk for injury. Conclusion: Altered knee flexion at ball release, early trunk rotation, loss of shoulder rotational range of motion, increased elbow flexion at ball release, high pitch velocity, and increased pitcher fatigue may increase shoulder and elbow torques and risk for injury. PMID:28107113

The 150 ns detector project: Prototype preamplifier results

NASA Astrophysics Data System (ADS)

Warburton, W. K.; Russell, S. R.; Kleinfelder, Stuart A.

1994-08-01

The long-term goal of the 150 ns detector project is to develop a pixel area detector capable of 6 MHz frame rates (150 ns/frame). Our milestones toward this goal are: a single pixel, 1×256 1D and 8×8 2D detectors, 256×256 2D detectors and, finally, 1024 × 1024 2D detectors. The design strategy is to supply a complete electronics chain (resetting preamp, selectable gain amplifier, analog-to-digital converter (ADC), and memory) for each pixel. In the final detectors these will all be custom integrated circuits. The front-end preamplifiers are integrated first, since their design and performance are the most unusual and also critical to the project's success. Similarly, our early work is concentrated on devising and perfecting detector structures. In this paper we demonstrate the performance of prototypes of our integrated preamplifiers. While the final design will have 64 preamps to a chip, including a switchable gain stage, the prototypes were integrated 8 channels to a "Tiny Chip" and tested in 4 configurations (feedback capacitor Cf equal 2.5 or 4.0 pF, output directly or through a source follower). These devices have been tested thoroughly for reset settling times, gain, linearity, and electronic noise. They generally work as designed, being fast enough to easily integrate detector charge, settle, and reset in 150 ns. Gain and linearity appear to be acceptable. Current values of electronic noise, in double-sampling mode, are about twice the design goal of {2}/{3} of a single photon at 6 keV. We expect this figure to improve with the addition of the onboard amplifier stage and improved packaging. Our next test chip will include these improvements and allow testing with our first detector samples, which will be 1×256 (50 μm wide pixels) and 8×8 (1 mm 2 pixels) element detector on 1 mm thick silicon.

Impact-induced concerted mass transport on W surfaces by a voidion mechanism

NASA Astrophysics Data System (ADS)

Mazilova, T. I.; Sadanov, E. V.; Voyevodin, V. N.; Ksenofontov, V. A.; Mikhailovskij, I. M.

2018-03-01

Using low-temperature field ion microscope techniques, we studied at the atomic level morphological evolution of the W surface through bombardment by a beam of several keV He atoms. This technique allows the direct observation of the results of the high energy He atom impact on the elementary damage stages. The formation of the 〈110〉 and 〈100〉 linear vacancy chains and the high relaxation of the near-neighbors of the surface vacancy clusters were revealed. Performed molecular dynamics simulations shows that a single He atom impact triggers the relaxation process of the linear vacancy chain by a substantial decrease of the distance between atoms at both sides of the chain. The observed inward relaxations in W and Mo are an order of magnitude more than that for a single vacancy. It was revealed a novel highly cooperative impact-induced mass transport mechanism on the stepped surface: the formation and motion of a surface spatially delocalized vacancies (voidions). Surface voidions are extremely mobile: the mean velocity of atoms in voidions equals to a substantial portion of the sound velocity. Successive collective translations of the 〈111〉 lines of atoms in adjacent voidions give rise to a concerted gliding motion of great atomic clusters.

Phantom motion after effects--evidence of detectors for the analysis of optic flow.

PubMed

Snowden, R J; Milne, A B

1997-10-01

Electrophysiological recording from the extrastriate cortex of non-human primates has revealed neurons that have large receptive fields and are sensitive to various components of object or self movement, such as translations, rotations and expansion/contractions. If these mechanisms exist in human vision, they might be susceptible to adaptation that generates motion aftereffects (MAEs). Indeed, it might be possible to adapt the mechanism in one part of the visual field and reveal what we term a 'phantom MAE' in another part. The existence of phantom MAEs was probed by adapting to a pattern that contained motion in only two non-adjacent 'quarter' segments and then testing using patterns that had elements in only the other two segments. We also tested for the more conventional 'concrete' MAE by testing in the same two segments that had adapted. The strength of each MAE was quantified by measuring the percentage of dots that had to be moved in the opposite direction to the MAE in order to nullify it. Four experiments tested rotational motion, expansion/contraction motion, translational motion and a 'rotation' that consisted simply of the two segments that contained only translational motions of opposing direction. Compared to a baseline measurement where no adaptation took place, all subjects in all experiments exhibited both concrete and phantom MAEs, with the size of the latter approximately half that of the former. Adaptation to two segments that contained upward and downward motion induced the perception of leftward and rightward motion in another part of the visual field. This strongly suggests there are mechanisms in human vision that are sensitive to complex motions such as rotations.

Time-Resolved Quantitative Analysis of the Diaphragms During Tidal Breathing in a Standing Position Using Dynamic Chest Radiography with a Flat Panel Detector System ("Dynamic X-Ray Phrenicography"): Initial Experience in 172 Volunteers.

PubMed

Yamada, Yoshitake; Ueyama, Masako; Abe, Takehiko; Araki, Tetsuro; Abe, Takayuki; Nishino, Mizuki; Jinzaki, Masahiro; Hatabu, Hiroto; Kudoh, Shoji

2017-04-01

Diaphragmatic motion in a standing position during tidal breathing remains unclear. The purpose of this observational study was to evaluate diaphragmatic motion during tidal breathing in a standing position in a health screening center cohort using dynamic chest radiography in association with participants' demographic characteristics. One hundred seventy-two subjects (103 men; aged 56.3 ± 9.8 years) underwent sequential chest radiographs during tidal breathing using dynamic chest radiography with a flat panel detector system. We evaluated the excursions of and peak motion speeds of the diaphragms. Associations between the excursions and participants' demographics (gender, height, weight, body mass index [BMI], smoking history, tidal volume, vital capacity, and forced expiratory volume) were investigated. The average excursion of the left diaphragm (14.9 ± 4.6 mm, 95% CI 14.2-15.5 mm) was significantly larger than that of the right (11.0 ± 4.0 mm, 95% CI 10.4-11.6 mm) (P <0.001). The peak motion speed of the left diaphragm (inspiratory, 16.6 ± 4.2 mm/s; expiratory, 13.7 ± 4.2 mm/s) was significantly faster than that of the right (inspiratory, 12.4 ± 4.4 mm/s; expiratory, 9.4 ± 3.8 mm/s) (both P <0.001). Both simple and multiple regression models demonstrated that higher BMI and higher tidal volume were associated with increased excursions of the bilateral diaphragm (all P <0.05). The average excursions of the diaphragms are 11.0 mm (right) and 14.9 mm (left) during tidal breathing in a standing position. The diaphragmatic motion of the left is significantly larger and faster than that of the right. Higher BMI and tidal volume are associated with increased excursions of the bilateral diaphragm. Copyright © 2017 The Association of University Radiologists. Published by Elsevier Inc. All rights reserved.

Enzymatic hydrolysis of short-chain lecithin/long-chain phospholipid unilamellar vesicles: sensitivity of phospholipases to matrix phase state.

PubMed

Gabriel, N E; Agman, N V; Roberts, M F

1987-11-17

Short-chain lecithin/long-chain phospholipid unilamellar vesicles (SLUVs), unlike pure long-chain lecithin vesicles, are excellent substrates for water-soluble phospholipases. Hemolysis assays show that greater than 99.5% of the short-chain lecithin is partitioned in the bilayer. In these binary component vesicles, the short-chain species is the preferred substrate, while the long-chain phospholipid can be treated as an inhibitor (phospholipase C) or poor substrate (phospholipase A2). For phospholipase C Bacillus cereus, apparent Km and Vmax values show that bilayer-solubilized diheptanoylphosphatidylcholine (diheptanoyl-PC) is nearly as good a substrate as pure micellar diheptanoyl-PC, although the extent of short-chain lecithin hydrolysis depends on the phase state of the long-chain lipid. For phospholipase A2 Naja naja naja, both Km and Vmax values show a greater range: in a gel-state matrix, diheptanoyl-PC is hydrolyzed with micellelike kinetic parameters; in a liquid-crystalline matrix, the short-chain lecithin becomes comparable to the long-chain component. Both enzymes also show an anomalous increase in specific activity toward diheptanoyl-PC around the phase transition temperature of the long-chain phospholipid. Since the short-chain lecithin does not exhibit a phase transition, this must reflect fluctuations in head-group area or vertical motions of the short-chain lecithin caused by surrounding long-chain lecithin molecules. These results are discussed in terms of a specific model for SLUV hydrolysis and a general explanation for the "interfacial activation" observed with water-soluble phospholipases.

On-ground characterization of the Euclid's CCD273-based readout chain

NASA Astrophysics Data System (ADS)

Szafraniec, Magdalena; Azzollini, R.; Cropper, M.; Pottinger, S.; Khalil, A.; Hailey, M.; Hu, D.; Plana, C.; Cutts, A.; Hunt, T.; Kohley, R.; Walton, D.; Theobald, C.; Sharples, R.; Schmoll, J.; Ferrando, P.

2016-07-01

Euclid is a medium class European Space Agency mission scheduled for launch in 2020. The goal of the survey is to examine the nature of Dark Matter and Dark Energy in the Universe. One of the cosmological probes used to analyze Euclid's data, the weak lensing technique, measures the distortions of galaxy shapes and this requires very accurate knowledge of the system point spread function (PSF). Therefore, to ensure that the galaxy shape is not affected, the detector chain of the telescope's VISible Instrument (VIS) needs to meet specific performance performance requirements. Each of the 12 VIS readout chains consisting of 3 CCDs, readout electronics (ROE) and a power supply unit (RPSU) will undergo a rigorous on-ground testing to ensure that these requirements are met. This paper reports on the current status of the warm and cold testing of the VIS Engineering Model readout chain. Additionally, an early insight to the commissioning of the Flight Model calibration facility and program is provided.

K0.78Na0.22MoO2AsO4

PubMed Central

Jouini, Raja; Bouzidi, Chahira; Zid, Mohamed Faouzi; Driss, Ahmed

2013-01-01

The title compound, potassium sodium dioxidomolybden­um(VI) arsenate, K0.78Na0.22MoO2AsO4, was synthesized by a solid-state reaction route. The structure is built up from corner-sharing MoO6 octa­hedra and AsO4 tetra­hedra, creating infinite [MoAsO8]∞ chains running along the b-axis direction. As, Mo and all but one O atom are on special positions (4c) with m symmetry and K (occupancy 0.78) is on a position (4a) of -1 in the tunnels. The possible motion of the alkali cations has been investigated by means of the bond-valance sum (BVS) model. The simulation shows that the Na+ motion appears to be easier mainly along the b-axis direction. Structural relationships between the different compounds of the AMoO2AsO4 (A = Ag, Li, Na, K, Rb) series and MXO8 (M = V; X = P, As) chains are discussed. PMID:24109253

DNA motion capture reveals the mechanical properties of DNA at the mesoscale.

PubMed

Price, Allen C; Pilkiewicz, Kevin R; Graham, Thomas G W; Song, Dan; Eaves, Joel D; Loparo, Joseph J

2015-05-19

Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Planetary wave-like oscillations in the ionosphere retrieved with a longitudinal chain of ionosondes at high northern latitudes

NASA Astrophysics Data System (ADS)

Stray, Nora H.; Espy, Patrick J.

2018-06-01

This paper examines the influence of neutral dynamics on the high latitude ionosphere. Using a longitudinal chain of ionosondes at high northern latitudes (52°-65° N), planetary wave-like structures were observed in the spatial structure of the peak electron density in the ionosphere. Longitudinal wavenumbers S0, S1 and S2 have been extracted from these variations of the F layer. The observed wave activity in wavenumber one and two does not show any significant correlation with indices of magnetic activity, suggesting that this is not the primary driver. In addition, the motion of the S1 ionospheric wave structures parallels that of the S1 planetary waves observed in the winds of the mesosphere-lower-thermosphere derived from a longitudinal array of SuperDARN meteor-radar wind measurements. The time delay between the motions of the wave structures would indicate a indirect coupling, commensurate with the diffusion to the ionosphere of mesospheric atomic oxygen perturbations.

Blob-Spring Model for the Dynamics of Ring Polymer in Obstacle Environment

NASA Astrophysics Data System (ADS)

Lele, Ashish K.; Iyer, Balaji V. S.; Juvekar, Vinay A.

2008-07-01

The dynamical behavior of cyclic macromolecules in a fixed obstacle (FO) environment is very different than the behavior of linear chains in the same topological environment; while the latter relax by a snake-like reptational motion from their chain ends the former can relax only by contour length fluctuations since they are endless. Duke, Obukhov and Rubinstein proposed a scaling model (the DOR model) to interpret the dynamical scaling exponents shown by Monte Carlo simulations of rings in a FO environment. We present a model (blob-spring model) to describe the dynamics of flexible and non-concatenated ring polymer in FO environment based on a theoretical formulation developed for the dynamics of an unentangled fractal polymer. We argue that the perpetual evolution of ring perimeter by the motion of contour segments results in an extra frictional load. Our model predicts self-similar dynamics with scaling exponents for the molecular weight dependence of diffusion coefficient and relaxation times that are in agreement with the scaling model proposed by Obukhov et al.

Euclidean perspective on the unfolding of azurin: angular correlations

NASA Astrophysics Data System (ADS)

Warren, Jeffrey J.; Gray, Harry B.; Winkler, Jay R.; Kozak, John J.

2013-12-01

The geometrical model introduced previously by the authors has been extended quantitatively to document changes in angular correlations between and among residues as azurin unfolds. In the early stages of denaturation, these changes are found to be more pronounced than changes in the spatial displacement of residues, a result that is also found for residues acting in concert, viz., α-helices, β-sheet residues and residues in 'turning regions.' Our analysis leads to a picture of the large-scale motion of the polypeptide chain as azurin denatures. Flanking a central 'ribbon' of residues whose orientation remains essentially invariant, we find that in the early stages of unfolding, left- and right-hand 'wings' adjacent to this stationary scaffolding pivot counterclockwise, while smaller regions on opposing ends of the β-barrel pivot clockwise. As spatial constraints characterising the native state are further relaxed, our calculations show that some regions reverse their orientational motion, reflecting the enhanced flexibility of the polypeptide chain in the denatured state.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nekrasov, Nikita; ITEP, Moscow; Shatashvili, Samson

Supersymmetric vacua of two dimensional N = 4 gauge theories with matter, softly broken by the twisted masses down to N = 2, are shown to be in one-to-one correspondence with the eigenstates of integrable spin chain Hamiltonians. Examples include: the Heisenberg SU(2)XXX spin chain which is mapped to the two dimensional U(N) theory with fundamental hypermultiplets, the XXZ spin chain which is mapped to the analogous three dimensional super-Yang-Mills theory compactified on a circle, the XYZ spin chain and eight-vertex model which are related to the four dimensional theory compactified on T{sup 2}. A consequence of our correspondence ismore » the isomorphism of the quantum cohomology ring of various quiver varieties, such as cotangent bundles to (partial) flag varieties and the ring of quantum integrals of motion of various spin chains. The correspondence extends to any spin group, representations, boundary conditions, and inhomogeneity, it includes Sinh-Gordon and non-linear Schroedinger models as well as the dynamical spin chains like Hubbard model. Compactifications of four dimensional N = 2 theories on a two-sphere lead to the instanton-corrected Bethe equations.« less

Real-time visual target tracking: two implementations of velocity-based smooth pursuit

NASA Astrophysics Data System (ADS)

Etienne-Cummings, Ralph; Longo, Paul; Van der Spiegel, Jan; Mueller, Paul

1995-06-01

Two systems for velocity-based visual target tracking are presented. The first two computational layers of both implementations are composed of VLSI photoreceptors (logarithmic compression) and edge detection (difference-of-Gaussians) arrays that mimic the outer-plexiform layer of mammalian retinas. The subsequent processing layers for measuring the target velocity and to realize smooth pursuit tracking are implemented in software and at the focal plane in the two versions, respectively. One implentation uses a hybrid of a PC and a silicon retina (39 X 38 pixels) operating at 333 frames/second. The software implementation of a real-time optical flow measurement algorithm is used to determine the target velocity, and a closed-loop control system zeroes the relative velocity of the target and retina. The second implementation is a single VLSI chip, which contains a linear array of photoreceptors, edge detectors and motion detectors at the focal plane. The closed-loop control system is also included on chip. This chip realizes all the computational properties of the hybrid system. The effects of background motion, target occlusion, and disappearance are studied as a function of retinal size and spatial distribution of the measured motion vectors (i.e. foveal/peripheral and diverging/converging measurement schemes). The hybrid system, which tested successfully, tracks targets moving as fast as 3 m/s at 1.3 meters from the camera and it can compensate for external arbitrary movements in its mounting platform. The single chip version, whose circuits tested successfully, can handle targets moving at 10 m/s.

Event-Based Computation of Motion Flow on a Neuromorphic Analog Neural Platform

PubMed Central

Giulioni, Massimiliano; Lagorce, Xavier; Galluppi, Francesco; Benosman, Ryad B.

2016-01-01

Estimating the speed and direction of moving objects is a crucial component of agents behaving in a dynamic world. Biological organisms perform this task by means of the neural connections originating from their retinal ganglion cells. In artificial systems the optic flow is usually extracted by comparing activity of two or more frames captured with a vision sensor. Designing artificial motion flow detectors which are as fast, robust, and efficient as the ones found in biological systems is however a challenging task. Inspired by the architecture proposed by Barlow and Levick in 1965 to explain the spiking activity of the direction-selective ganglion cells in the rabbit's retina, we introduce an architecture for robust optical flow extraction with an analog neuromorphic multi-chip system. The task is performed by a feed-forward network of analog integrate-and-fire neurons whose inputs are provided by contrast-sensitive photoreceptors. Computation is supported by the precise time of spike emission, and the extraction of the optical flow is based on time lag in the activation of nearby retinal neurons. Mimicking ganglion cells our neuromorphic detectors encode the amplitude and the direction of the apparent visual motion in their output spiking pattern. Hereby we describe the architectural aspects, discuss its latency, scalability, and robustness properties and demonstrate that a network of mismatched delicate analog elements can reliably extract the optical flow from a simple visual scene. This work shows how precise time of spike emission used as a computational basis, biological inspiration, and neuromorphic systems can be used together for solving specific tasks. PMID:26909015

Event-Based Computation of Motion Flow on a Neuromorphic Analog Neural Platform.

PubMed

Giulioni, Massimiliano; Lagorce, Xavier; Galluppi, Francesco; Benosman, Ryad B

2016-01-01

Estimating the speed and direction of moving objects is a crucial component of agents behaving in a dynamic world. Biological organisms perform this task by means of the neural connections originating from their retinal ganglion cells. In artificial systems the optic flow is usually extracted by comparing activity of two or more frames captured with a vision sensor. Designing artificial motion flow detectors which are as fast, robust, and efficient as the ones found in biological systems is however a challenging task. Inspired by the architecture proposed by Barlow and Levick in 1965 to explain the spiking activity of the direction-selective ganglion cells in the rabbit's retina, we introduce an architecture for robust optical flow extraction with an analog neuromorphic multi-chip system. The task is performed by a feed-forward network of analog integrate-and-fire neurons whose inputs are provided by contrast-sensitive photoreceptors. Computation is supported by the precise time of spike emission, and the extraction of the optical flow is based on time lag in the activation of nearby retinal neurons. Mimicking ganglion cells our neuromorphic detectors encode the amplitude and the direction of the apparent visual motion in their output spiking pattern. Hereby we describe the architectural aspects, discuss its latency, scalability, and robustness properties and demonstrate that a network of mismatched delicate analog elements can reliably extract the optical flow from a simple visual scene. This work shows how precise time of spike emission used as a computational basis, biological inspiration, and neuromorphic systems can be used together for solving specific tasks.

Large scale track analysis for wide area motion imagery surveillance

NASA Astrophysics Data System (ADS)

van Leeuwen, C. J.; van Huis, J. R.; Baan, J.

2016-10-01

Wide Area Motion Imagery (WAMI) enables image based surveillance of areas that can cover multiple square kilometers. Interpreting and analyzing information from such sources, becomes increasingly time consuming as more data is added from newly developed methods for information extraction. Captured from a moving Unmanned Aerial Vehicle (UAV), the high-resolution images allow detection and tracking of moving vehicles, but this is a highly challenging task. By using a chain of computer vision detectors and machine learning techniques, we are capable of producing high quality track information of more than 40 thousand vehicles per five minutes. When faced with such a vast number of vehicular tracks, it is useful for analysts to be able to quickly query information based on region of interest, color, maneuvers or other high-level types of information, to gain insight and find relevant activities in the flood of information. In this paper we propose a set of tools, combined in a graphical user interface, which allows data analysts to survey vehicles in a large observed area. In order to retrieve (parts of) images from the high-resolution data, we developed a multi-scale tile-based video file format that allows to quickly obtain only a part, or a sub-sampling of the original high resolution image. By storing tiles of a still image according to a predefined order, we can quickly retrieve a particular region of the image at any relevant scale, by skipping to the correct frames and reconstructing the image. Location based queries allow a user to select tracks around a particular region of interest such as landmark, building or street. By using an integrated search engine, users can quickly select tracks that are in the vicinity of locations of interest. Another time-reducing method when searching for a particular vehicle, is to filter on color or color intensity. Automatic maneuver detection adds information to the tracks that can be used to find vehicles based on their behavior.

Rugged: an operational, open-source solution for Sentinel-2 mapping

NASA Astrophysics Data System (ADS)

Maisonobe, Luc; Seyral, Jean; Prat, Guylaine; Guinet, Jonathan; Espesset, Aude

2015-10-01

When you map the entire Earth every 5 days with the aim of generating high-quality time series over land, there is no room for geometrical error: the algorithms have to be stable, reliable, and precise. Rugged, a new open-source library for pixel geolocation, is at the geometrical heart of the operational processing for Sentinel-2. Rugged performs sensor-to-terrain mapping taking into account ground Digital Elevation Models, Earth rotation with all its small irregularities, on-board sensor pixel individual lines-of-sight, spacecraft motion and attitude, and all significant physical effects. It provides direct and inverse location, i.e. it allows the accurate computation of which ground point is viewed from a specific pixel in a spacecraft instrument, and conversely which pixel will view a specified ground point. Direct and inverse location can be used to perform full ortho-rectification of images and correlation between sensors observing the same area. Implemented as an add-on for Orekit (Orbits Extrapolation KIT; a low-level space dynamics library), Rugged also offers the possibility of simulating satellite motion and attitude auxiliary data using Orekit's full orbit propagation capability. This is a considerable advantage for test data generation and mission simulation activities. Together with the Orfeo ToolBox (OTB) image processing library, Rugged provides the algorithmic core of Sentinel-2 Instrument Processing Facilities. The S2 complex viewing model - with 12 staggered push-broom detectors and 13 spectral bands - is built using Rugged objects, enabling the computation of rectification grids for mapping between cartographic and focal plane coordinates. These grids are passed to the OTB library for further image resampling, thus completing the ortho-rectification chain. Sentinel-2 stringent operational requirements to process several terabytes of data per week represented a tough challenge, though one that was well met by Rugged in terms of the robustness and performance of the library.

Spaceborne electronic imaging systems

NASA Technical Reports Server (NTRS)

1971-01-01

Criteria and recommended practices for the design of the spaceborne elements of electronic imaging systems are presented. A spaceborne electronic imaging system is defined as a device that collects energy in some portion of the electromagnetic spectrum with detector(s) whose direct output is an electrical signal that can be processed (using direct transmission or delayed transmission after recording) to form a pictorial image. This definition encompasses both image tube systems and scanning point-detector systems. The intent was to collect the design experience and recommended practice of the several systems possessing the common denominator of acquiring images from space electronically and to maintain the system viewpoint rather than pursuing specialization in devices. The devices may be markedly different physically, but each was designed to provide a particular type of image within particular limitations. Performance parameters which determine the type of system selected for a given mission and which influence the design include: Sensitivity, Resolution, Dynamic range, Spectral response, Frame rate/bandwidth, Optics compatibility, Image motion, Radiation resistance, Size, Weight, Power, and Reliability.

Detector Damage at X-Ray Free-Electron Laser Sources

NASA Astrophysics Data System (ADS)

Blaj, G.; Carini, G.; Carron, S.; Haller, G.; Hart, P.; Hasi, J.; Herrmann, S.; Kenney, C.; Segal, J.; Stan, C. A.; Tomada, A.

2016-06-01

Free-electron lasers (FELs) opened a new window on imaging the motion of atoms and molecules. At SLAC, FEL experiments are performed at LCLS using 120 Hz pulses with 1012 to 1013 photons in 10 fs (billions of times brighter than at the most powerful synchrotrons). Concurrently, users and staff operate under high pressure due to flexible and often rapidly changing setups and low tolerance for system malfunction. This extreme detection environment raises unique challenges, from obvious to surprising, and leads to treating detectors as consumables. We discuss in detail the detector damage mechanisms observed in 7 years of operation at LCLS, together with the corresponding damage mitigation strategies and their effectiveness. Main types of damage mechanisms already identified include: (1) x-ray radiation damage (from “catastrophic” to “classical”), (2) direct and indirect damage caused by optical lasers, (3) sample induced damage, (4) vacuum related damage, (5) high-pressure environment. In total, 19 damage mechanisms have been identified. We also present general strategies for reducing damage risk or minimizing the impact of detector damage on the science program. These include availability of replacement parts and skilled operators and also careful planning, incident investigation resulting in updated designs, procedures and operator training.

Self-adaptive calibration for staring infrared sensors

NASA Astrophysics Data System (ADS)

Kendall, William B.; Stocker, Alan D.

1993-10-01

This paper presents a new, self-adaptive technique for the correlation of non-uniformities (fixed-pattern noise) in high-density infrared focal-plane detector arrays. We have developed a new approach to non-uniformity correction in which we use multiple image frames of the scene itself, and take advantage of the aim-point wander caused by jitter, residual tracking errors, or deliberately induced motion. Such wander causes each detector in the array to view multiple scene elements, and each scene element to be viewed by multiple detectors. It is therefore possible to formulate (and solve) a set of simultaneous equations from which correction parameters can be computed for the detectors. We have tested our approach with actual images collected by the ARPA-sponsored MUSIC infrared sensor. For these tests we employed a 60-frame (0.75-second) sequence of terrain images for which an out-of-date calibration was deliberately used. The sensor was aimed at a point on the ground via an operator-assisted tracking system having a maximum aim point wander on the order of ten pixels. With these data, we were able to improve the calibration accuracy by a factor of approximately 100.

The new ATLAS/LUCID detector

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bruschi, Marco

The new ATLAS luminosity monitor has many innovative aspects implemented. Its photomultipliers tubes are used as detector elements by using the Cherenkov light produced by charged particles above threshold crossing the quartz windows. The analog shaping of the readout chain has been improved, in order to cope with the 25 ns bunch spacing of the LHC machine. The main readout card is a quite general processing unit based on 12 bit - 500 MS/s Flash ADC and on FPGAs, delivering the processed data to 1.3 Gb/s optical links. The article will describe all these aspects and will outline future perspectivesmore » of the card for next generation high energy physics experiments. (authors)« less

Digital instrumentation and management of dead time: first results on a NaI well-type detector setup.

PubMed

Censier, B; Bobin, C; Bouchard, J; Aubineau-Lanièce, I

2010-01-01

The LNE-LNHB is engaged in a development program on digital instrumentation, the first step being the instrumentation of a NaI well-type detector set-up. The prototype acquisition card and its technical specifications are presented together with the first comparison with the classical NIM-based acquisition chain, for counting rates up to 100 kcps. The digital instrumentation is shown to be counting-loss free in this range. This validates the main option adopted in this project, namely the implementation of an extending dead time with live-time measurement already successfully used in the MTR2 NIM module developed at LNE-LNHB. Copyright 2010. Published by Elsevier Ltd.